WorldWideScience

Sample records for vidas listeria species

  1. Listeria species in retail smoked fish at Jos, Nigeria | Chukwu ...

    African Journals Online (AJOL)

    The prevalence of Listeria species in 65 samples of smoked fish at the retail markets in Jos, Nigeria, is reported. The experimental samples which included 30 catfish (Clarias species) and 35 Tilapia were screened for Listeria monocytogenes and other Listeria species using a two-step enrichment method. Total Listeria ...

  2. Prevalence of Listeria species in some foods and their rapid ...

    African Journals Online (AJOL)

    Results: Out of 40 meat samples, 14 (35 %) samples were contaminated with Listeria spp., with the ... Conclusion: High protein foods contain different types of Listeria species; whole-cell protein ..... in meat and fermented fish in Malaysia.

  3. Carrier status for Listeria monocytogenes and other Listeria species ...

    African Journals Online (AJOL)

    Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...

  4. Disinfectant effect of Methylated Ethanol against Listeria species

    Directory of Open Access Journals (Sweden)

    Y Yakubu

    2012-04-01

    Full Text Available This study was carried out in order to determine the disinfectant effect of Methylated spirit® (95% methanol and 5% ethanol as a teat dip against Listeria species. Hand milking was employed to collect 576 (288 x 2 raw milk samples from different lactating cows within Sokoto metropolis (Nigeria. 288 samples were collected before disinfecting the udder teats with Methylated spirit®, while the other 288 were collected after disinfection with Methylated spirit®. The samples were analyzed using selective culture and isolation technique in which the 288 samples collected before disinfection, 114 (39.6% were positive for Listeria species. Among the positive samples 44 (38.6% were Listeria innocua, 16 (14.0% Listeria ivanovii, 36 (31.6% Listeria monocytogenes, 11 (9.6% Listeria welshimeri and 7 (6.1% Listeria seeligeri, while none of the 288 samples collected after disinfection was positive. The study has shown high prevalence of Listeria species in milk collected without washing/disinfecting the teats and has also established the sensitivity of Listeria species to methylated ethanol which can be used as dip for disinfecting udder teats before milking in order to prevent contamination with Listeria species and other methylated spirit-sensitive organisms. This study is essential to educate Fulani herdsmen and other milk handlers on the importance of disinfecting udder teats before milking. [Vet. World 2012; 5(2.000: 91-93

  5. Prevalence and Characterization of Listeria Species from Raw Milk and Dairy Products from Çanakkale Province

    Directory of Open Access Journals (Sweden)

    Pınar Şanlıbaba

    2018-02-01

    Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.

  6. Isolation and characterisation of Listeria species from ruminants in ...

    African Journals Online (AJOL)

    A cross sectional study was carried out to determine the prevalence of Listeria species in ruminants in Maiduguri. Three hundred faecal samples were randomly collected from ruminants at the Maiduguri central abattoir from January – March, 2011. One hundred faecal samples each were collected from cattle, sheep and ...

  7. Antimicrobial susceptibility profile of Listeria species isolated from ...

    African Journals Online (AJOL)

    The antimicrobial susceptibility profile of L. monocytogenes and other Listeria species isolated from some ready-to-eat (RTE) foods sold in Kano metropolis, north-western Nigeria was carried out using disc-diffusion method. The results obtained showed that L. monocytogenes was moderately susceptible to all the ...

  8. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    Directory of Open Access Journals (Sweden)

    Kwang-Pyo Kim

    2015-09-01

    Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.

  9. Disinfectant effect of Methylated Ethanol against Listeria species

    OpenAIRE

    Y Yakubu; M D Salihu; O O Faleke; M B Abubakar; A A Magaji,A U Junaidu

    2012-01-01

    This study was carried out in order to determine the disinfectant effect of Methylated spirit® (95% methanol and 5% ethanol) as a teat dip against Listeria species. Hand milking was employed to collect 576 (288 x 2) raw milk samples from different lactating cows within Sokoto metropolis (Nigeria). 288 samples were collected before disinfecting the udder teats with Methylated spirit®, while the other 288 were collected after disinfection with Methylated spirit®. The ...

  10. Prevalence of Listeria Species in Ready-to-Eat Food in Shahrekord Restaurants

    OpenAIRE

    Rahimi, E; Shakerian, A. (PhD

    2014-01-01

    Background and Objective: Listeria bacteria with worldwide widespread are commonly found in soil, sewage, dust and water. Among which,Listeria monocytogenes can cause a serious food-borne disease. The objective of this study was to investigate the prevalence of Listeria species in ready-to-eat foods. Material and Methods: The samples (n=235) including oloveyh salad (n = 64), Yogurt stew (n= 35), vegetable salad (n=52), macaroni salad (n= 48) and meat salad (n =36) were collected from the rest...

  11. Applicability of the EN ISO 11290-1 standard method for Listeria monocytogenes detection in presence of new Listeria species.

    Science.gov (United States)

    Barre, Léna; Angelidis, Apostolos S; Boussaid, Djouher; Brasseur, Emilie Decourseulles; Manso, Eléonore; Gnanou Besse, Nathalie

    2016-12-05

    During the past six years, new species of the genus Listeria have been isolated from foods and other environmental niches worldwide. The Standard method EN ISO 11290-1 that is currently under revision will include in its scope all Listeria species in addition to L. monocytogenes. The objective of this project was to evaluate the ability of the Standard EN ISO 11290-1 method to detect and identify the newly discovered Listeria spp., and to assess potential over-growth effects of the new species in mixed cultures with L. monocytogenes during each step of the enrichment process. This objective was addressed by the generation of necessary data on the behavior of the new species during the pre-enrichment and the enrichment steps of the reference method as well as data on their phenotypic characteristics on rich and selective media used for isolation and identification. Most of the new Listeria species developed well on selective agar media for Listeria, however the recovery of some species was difficult due to poor growth in Half Fraser and Fraser broth. Good results (consistently positive) were obtained for confirmation at the genus level via the catalase test, the Gram test and the blueish appearance test on non-selective medium, but not with the VP test, as most of the new species yielded a negative result. In the light of results obtained in co-culture experiments and inhibition tests, and considering the growth rates in Half Fraser and Fraser broths, the new species do not seem to interfere with the detection of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. The Presence and Prevalence of Listeria Species in Milk and Herby Cheese in and Around Van

    OpenAIRE

    SAĞUN, Emrullah; SANCAK, Yakup Can; İŞLEYİCİ, Özgür; EKİCİ, Kamil

    2014-01-01

    In this study 250 raw milk and 254 herby cheese samples collected from Van city center and neighboring villages were investigated in terms of Listeria species. For Listeria isolation,the method recommended by the FDA was used.Of the raw milk samples,6 (2.40 %)were found to be positive with regard to Listeria; 3 (1.20 %)had L.monocytogenes, 1 (0.40 %)L.innocua and 1 (0.40 %)L.welshimeri. Of the herby cheese samples,13 (5.11 %)were found to be positive with regard to Listeria;10 (3.93 %)had...

  13. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

    Science.gov (United States)

    Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

    2015-06-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Prevalence and antimicrobial resistance of listeria species isolated from different types of raw meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein

    2012-12-01

    Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.

  15. Geographical and meteorological factors associated with isolation of Listeria species in New York State produce production and natural environments.

    Science.gov (United States)

    Chapin, Travis K; Nightingale, Kendra K; Worobo, Randy W; Wiedmann, Martin; Strawn, Laura K

    2014-11-01

    Listeria species have been isolated from diverse environments, often at considerable prevalence, and are known to persist in food processing facilities. The presence of Listeria spp. has been suggested to be a marker for Listeria monocytogenes contamination. Therefore, a study was conducted to (i) determine the prevalence and diversity of Listeria spp. in produce production and natural environments and (ii) identify geographical and/or meteorological factors that affect the isolation of Listeria spp. in these environments. These data were also used to evaluate Listeria spp. as index organisms for L. monocytogenes in produce production environments. Environmental samples collected from produce production (n = 588) and natural (n = 734) environments in New York State were microbiologically analyzed to detect and isolate Listeria spp. The prevalence of Listeria spp. was approximately 33 and 34% for samples obtained from natural environments and produce production, respectively. Co-isolation of L. monocytogenes and at least one other species of Listeria in a given sample was recorded for 3 and 9% of samples from natural environments and produce production, respectively. Soil moisture and proximity to water and pastures were highly associated with isolation of Listeria spp. in produce production environments, while elevation, study site, and proximity to pastures were highly associated with isolation of Listeria spp. in natural environments, as determined by randomForest models. These data show that Listeria spp. were prevalent in both agricultural and nonagricultural environments and that geographical and meteorological factors associated with isolation of Listeria spp. were considerably different between the two environments.

  16. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    Directory of Open Access Journals (Sweden)

    Ebrahim Rahimi

    2014-02-01

    Full Text Available Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. Results: Using cultural method, 19 samples (7.3% were positive for Listeria spp. The highest prevalence of Listeria was found in raw water buffalo milk (11.8%, followed by raw bovine milk (10.6%, raw ovine milk (7.1%, and raw caprine milk (4.2% samples. All 37 camel milk samples from 20 camel breeding farms were negative for Listeria spp. The overall prevalence of Listeria was 7.3%, in which Listeria innocua was the most recovered species (4.2%; the remaining isolates were Listeria monocytogenes (1.9%, Listeria ivanovii (0.08% and Listeria seeligari (0.04%. The PCR assay could identify 8 Listeria-contaminated milk samples that were negative using the cultural method. Conclusions: The results presented in this study indicate the potential risk of infection with Listeria in people consuming raw and unpasteurized milk.

  17. Prevalence of Listeria monocytogenes and other Listeria species in butter from United Kingdom production, retail, and catering premises.

    Science.gov (United States)

    Lewis, H C; Little, C L; Elson, R; Greenwood, M; Grant, K A; McLauchlin, J

    2006-07-01

    Two recent listeriosis outbreaks involving butter prompted this first cross-sectional study on the prevalence, levels, and types of Listeria species in 3229 samples of butter from production, retail, and catering premises in the United Kingdom during May and June 2004. When the criteria of the Microbiological Guidelines were used, 99.4% of samples were found to be of satisfactory microbiological quality, 0.5% were of acceptable quality, and 0.1% were of unsatisfactory quality as a result of high levels (>100 CFU/g) of Listeria spp. The butter samples with Listeria spp. present at more than 100 CFU/g were negative for L. monocytogenes. L. monocytogenes was detected in 0.4% (n=13) of samples, all at levels of less than 10 CFU/g, and were therefore of acceptable quality. Butter was contaminated more frequently with Listeria spp., including L. monocytogenes, when packed in plastic tubs, when in pack sizes of 500 g or less, when stored or displayed above 8 degrees C, when a hazard analysis system was not in place, and when the manager had received no food hygiene training. This study demonstrates that although butter is regarded as a low-risk product, it may provide an environment for the persistence and growth of Listeria spp., including L. monocytogenes. The control of L. monocytogenes in food processing and supply systems is critical in order to minimize the potential for this bacterium to be present in foods at the point of consumption at levels hazardous to health.

  18. Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets.

    Science.gov (United States)

    Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh

    2015-07-25

    The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.

  19. Control of Listeria species food safety at a poultry food production facility.

    Science.gov (United States)

    Fox, Edward M; Wall, Patrick G; Fanning, Séamus

    2015-10-01

    Surveillance and control of food-borne human pathogens, such as Listeria monocytogenes, is a critical aspect of modern food safety programs at food production facilities. This study evaluated contamination patterns of Listeria species at a poultry food production facility, and evaluated the efficacy of procedures to control the contamination and transfer of the bacteria throughout the plant. The presence of Listeria species was studied along the production chain, including raw ingredients, food-contact, non-food-contact surfaces, and finished product. All isolates were sub-typed by pulsed-field gel electrophoresis (PFGE) to identify possible entry points for Listeria species into the production chain, as well as identifying possible transfer routes through the facility. The efficacy of selected in-house sanitizers against a sub-set of the isolates was evaluated. Of the 77 different PFGE-types identified, 10 were found among two or more of the five categories/areas (ingredients, food preparation, cooking and packing, bulk packing, and product), indicating potential transfer routes at the facility. One of the six sanitizers used was identified as unsuitable for control of Listeria species. Combining PFGE data, together with information on isolate location and timeframe, facilitated identification of a persistent Listeria species contamination that had colonized the facility, along with others that were transient. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Prevalence of listeria, Aeromonas, and Vibrio species in fish used for human consumption in Turkey.

    Science.gov (United States)

    Yücel, Nihal; Balci, Senay

    2010-02-01

    A total of 78 raw retail fish samples from 30 freshwater and 48 marine fish were examined for the presence of Listeria, Aeromonas, and Vibrio species. The overall incidence of Listeria spp. was 30% in freshwater samples and 10.4% in marine fish samples. Listeria monocytogenes (44.5%) was the most commonly isolated species in freshwater fish, and Listeria murrayi (83.5%) was the most commonly isolated species in marine fish samples. Motile aeromonads were more common in marine fish samples (93.7%) than in freshwater fish samples (10%). Vibrio alginolyticus, Vibrio fluvialis, and Vibrio damsela were isolated only in marine fish samples, representing 40.9, 38.6, and 36.3% of Vibrio isolates, respectively. In freshwater and marine fish, the highest incidences of Listeria and Aeromonas were found in skin samples; the highest incidence of Vibrio in marine fish was found in gill samples. The location of Listeria spp. and L. monocytogenes in a fish was significantly different among freshwater fish. A high incidence of these bacterial pathogens was found in the brown trout (Salmo trutta) and horse mackerel (Trachurus trachurus). Handling of contaminated fish, cross-contamination, or eating raw fish might pose a health hazard, especially in immunosuppressed individuals, elderly people, and children. This study highlights the importance of bacterial pathogens in fish intended for human consumption, but more study is needed.

  1. Identification of listeria species isolated in Tunisia by Microarray based assay : results of a preliminary study

    International Nuclear Information System (INIS)

    Hmaied, Fatma; Helel, Salma; Barkallah, Insaf; Leberre, V.; Francois, J.M.; Kechrid, A.

    2008-01-01

    Microarray-based assay is a new molecular approach for genetic screening and identification of microorganisms. We have developed a rapid microarray-based assay for the reliable detection and discrimination of Listeria spp. in food and clinical isolates from Tunisia. The method used in the present study is based on the PCR amplification of a virulence factor gene (iap gene). the PCR mixture contained cyanine Cy5labeled dCTP. Therefore, The PCR products were fluorescently labeled. The presence of multiple species-specific sequences within the iap gene enabled us to design different oligoprobes per species. The species-specific sequences of the iap gene used in this study were obtained from genBank and then aligned for phylogenetic analysis in order to identify and retrieve the sequences of homologues of the amplified iap gene analysed. 20 probes were used for detection and identification of 22 food isolates and clinical isolates of Listeria spp (L. monocytogenes, L. ivanovi), L. welshimeri, L. seeligeri, and L. grayi). Each bacterial gene was identified by hybridization to oligoprobes specific for each Listeria species and immobilized on a glass surface. The microarray analysis showed that 5 clinical isolates and 2 food isolates were identified listeria monocytogenes. Concerning the remaining 15 food isolates; 13 were identified listeria innocua and 2 isolates could not be identified by microarray based assay. Further phylogenetic and molecular analysis are required to design more species-specific probes for the identification of Listeria spp. Microarray-based assay is a simple and rapid method used for Listeria species discrimination

  2. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  3. Matrix-assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) Can Precisely Discriminate the Lineages of Listeria monocytogenes and Species of Listeria.

    Science.gov (United States)

    Ojima-Kato, Teruyo; Yamamoto, Naomi; Takahashi, Hajime; Tamura, Hiroto

    2016-01-01

    The genetic lineages of Listeria monocytogenes and other species of the genus Listeria are correlated with pathogenesis in humans. Although matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has become a prevailing tool for rapid and reliable microbial identification, the precise discrimination of Listeria species and lineages remains a crucial issue in clinical settings and for food safety. In this study, we constructed an accurate and reliable MS database to discriminate the lineages of L. monocytogenes and the species of Listeria (L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. grayi, and L. rocourtiae) based on the S10-spc-alpha operon gene encoded ribosomal protein mass spectrum (S10-GERMS) proteotyping method, which relies on both genetic information (genomics) and observed MS peaks in MALDI-TOF MS (proteomics). The specific set of eight biomarkers (ribosomal proteins L24, L6, L18, L15, S11, S9, L31 type B, and S16) yielded characteristic MS patterns for the lineages of L. monocytogenes and the different species of Listeria, and led to the construction of a MS database that was successful in discriminating between these organisms in MALDI-TOF MS fingerprinting analysis followed by advanced proteotyping software Strain Solution analysis. We also confirmed the constructed database on the proteotyping software Strain Solution by using 23 Listeria strains collected from natural sources.

  4. Evaluation of the Thermo Scientific™ SureTect™ Listeria species Assay.

    Science.gov (United States)

    Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko

    2014-03-01

    The Thermo Scientific™ SureTect™ Listeria species Assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. This validation study was conducted using the AOAC Research Institute (RI) Performance Tested MethodsSM program to validate the SureTect Listeria species Assay in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996 including amendment 1:2004 in a variety of foods plus plastic and stainless steel. The food matrixes validated were smoked salmon, processed cheese, fresh bagged spinach, cantaloupe, cooked prawns, cooked sliced turkey meat, cooked sliced ham, salami, pork frankfurters, and raw ground beef. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, fresh bagged spinach, and stainless steel surface samples) were analyzed independently as part of the AOAC-RI-controlled independent laboratory study by the University of Guelph, Canada. Using probability of detection statistical analysis, a significant difference in favour of the SureTect assay was demonstrated between the SureTect and reference method for high level spiked samples of pork frankfurters, smoked salmon, cooked prawns, stainless steel, and low-spiked samples of salami. For all other matrixes, no significant difference was seen between the two methods during the study. Inclusivity testing was conducted with 68 different isolates of Listeria species, all of which were detected by the SureTect Listeria species Assay. None of the 33 exclusivity isolates were detected by the SureTect Listeria species Assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside of the recommended parameters open to variation, which demonstrated that the assay gave reliable performance. Accelerated stability testing was additionally conducted, validating the

  5. Evaluation of the Thermo Scientific SureTect Listeria species assay. AOAC Performance Tested Method 071304.

    Science.gov (United States)

    Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron

    2014-01-01

    The Thermo Scientific SureTect Listeria species Assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. This validation study was conducted using the AOAC Research Institute (RI) Performance Tested Methods program to validate the SureTect Listeria species Assay in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996 including amendment 1:2004 in a variety of foods plus plastic and stainless steel. The food matrixes validated were smoked salmon, processed cheese, fresh bagged spinach, cantaloupe, cooked prawns, cooked sliced turkey meat, cooked sliced ham, salami, pork frankfurters, and raw ground beef. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, fresh bagged spinach, and stainless steel surface samples) were analyzed independently as part of the AOAC-RI-controlled independent laboratory study by the University ofGuelph, Canada. Using probability of detection statistical analysis, a significant difference in favour of the SureTect assay was demonstrated between the SureTect and reference method for high level spiked samples of pork frankfurters, smoked salmon, cooked prawns, stainless steel, and low-spiked samples of salami. For all other matrixes, no significant difference was seen between the two methods during the study. Inclusivity testing was conducted with 68 different isolates of Listeria species, all of which were detected by the SureTect Listeria species Assay. None of the 33 exclusivity isolates were detected by the SureTect Listeria species Assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside of the recommended parameters open to variation, which demonstrated that the assay gave reliable performance. Accelerated stability testing was additionally conducted, validating the assay

  6. Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran

    Directory of Open Access Journals (Sweden)

    Ehsan Shamloo

    2015-01-01

    Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.

  7. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

    Science.gov (United States)

    In the environment, many microorganisms coexist in communities as biofilms. The objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development was measured using crystal violet in 96-well microtiter pla...

  8. Occurrence of Listeria species in different captive wild animals of Nandankanan Zoo, Baranga, Odisha, India

    Directory of Open Access Journals (Sweden)

    L.N. Sarangi

    2013-01-01

    Full Text Available Listeria species were isolated from faecal samples collected from different captive wild animals of Nandankanan Zoo, Baranga, Odisha, using selective enrichment medium. The isolates were characterized based on their cell morphology, biochemical and sugar fermentation characteristics as well as culture morphology. Further, in vitro and in vivo pathogenicity tests were carried out to assess the pathogenic potential of the isolates. Listeria were found in 24 (23.07% of the total 104 faecal samples. Listeria were isolated from the samples of tiger, bear, hyena, leopard, zebra, elephant, jackal, lion, barking deer, porcupine, chital, monkey and wild boar. Out of the 24 Listeria isolates 11 were confirmed as L. monocytogenes. The other 13 isolates included L. innocua, L. seeligeri, L. welshimeri and L. ivanovii. The pathogenicity study revealed that only four isolates were pathogenic. Three of these were L. monocytogenes isolated from tiger, hyena and elephant and one was L. ivanovii isolated from leopard. Antibiotic sensitivity of the 24 isolates was high towards ciprofloxacin, levofloxacin, amoxicillin, azithromycin and enrofloxacin. The isolates showed resistance towards oxytetracyclin, gentamicin, cephadroxil, penicillin- G and nalidixic acid.

  9. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    OpenAIRE

    Rahimi, Ebrahim; Momtaz, Hassan; Behzadnia, Asma; Baghbadorani, Zeinab Torki

    2014-01-01

    Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. R...

  10. Detection of Listeria species in Gamma irradiated Fishes during Storage periods

    International Nuclear Information System (INIS)

    Mohamed, W.S.

    2011-01-01

    This investigation was carried out to detect the post irradiation recovery and growth of Listeria species encountered in frozen whole Tilapia fishes ,Tilapia fillet and frozen Hamour fillets fishes (-18 degree C) irradiated at 1, 2, 2.5 and 3 kGy. The pathogen was eliminated at a dose of 2.5 kGy of gamma radiation. The presence of the microorganism was monitored for sex months on appropriate selective media. The ability of recovery of the organism from irradiation damage was not influenced by the kind of fish. No increased counts of the organism in irradiated fishes at 2.5 kGy of gamma radiation was noticed during 6 months of freezing storage at -18 degree C. This study also aimed to evaluate the effect of different enrichment procedures on the detection of Listeria species in fishes

  11. Evaluation of the MIT RMID 1000 system for the identification of Listeria species.

    Science.gov (United States)

    Ricardi, John; Haavig, David; Cruz, Lasaunta; Paoli, George; Gehring, Andrew

    2010-01-01

    The Micro Imaging Technology (MIT) 1000 Rapid Microbial Identification (RMID) System is a device that uses the principles of light scattering coupled with proprietary algorithms to identify bacteria after being cultured and placed in a vial of filtered water. This specific method is for pure culture identification of Listeria spp. A total of 81 microorganisms (55 isolates) were tested by the MIT 1000 System, of which 25 were Listeria spp. and 30 a variety of other bacterial species. In addition, a total of 406 tests over seven different ruggedness parameters were tested by the MIT 1000 System to determine its flexibility to the specifications stated in the MIT 1000 System User Guide in areas where they might be deviated by a user to shorten the test cycle. Overall, MIT concluded that the MIT 1000 System had an accuracy performance that should certify this Performance Test Method for the identification of Listeria spp. This report discusses the tests performed, results achieved, and conclusions, along with several reference documents to enable a higher understanding of the technology used by the MIT 1000 System.

  12. Prevalence of Listeria species in camel sausages from retail markets in Aydin province in Turkey and RAPD analysis of Listeria monocytogenes isolates

    OpenAIRE

    Ozbey, Gokben; Ertas, Hasan Basri; Kok, Filiz

    2006-01-01

    Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%), Listeria innocua from 14 samples (14%) and Listeria welshimeri from two samples(2%). A 701 bp fragment of listeriolysi...

  13. Mixed species biofilms of Listeria monocytogenes and Lactobacillus plantarum show enhanced resistance to benzalkonium chloride and peracetic acid

    NARCIS (Netherlands)

    Veen, van der S.; Abee, T.

    2011-01-01

    We investigated the formation of single and mixed species biofilms of Listeria monocytogenes strains EGD-e and LR-991, with Lactobacillus plantarum WCFS1 as secondary species, and their resistance to the disinfectants benzalkonium chloride and peracetic acid. Modulation of growth, biofilm formation,

  14. Characterization of cellular fatty acids of listeria species and their effect on circulating blood monocytes

    International Nuclear Information System (INIS)

    Omm-e-Hany; Khan, M.A.; Khan, M.A.; Shahzad, A.; Ahmed, W.; Siddiqi, R.; Atta-ur-Rehman

    2011-01-01

    Listeria monocytogenes NCTC 7973, L. ivanovii SLCC 2379 and L. seeligeri SLCC 3954 were found to contain 5 - 7.8 % (dry weight) chloroform- soluble lipids. All species exhibited, nearly similar fatty acid esters profile with little difference when grown at 37 deg. C. The study revealed the abundance of odd chain saturated fatty acids in all the three species of Listeria. Among all, in particular ante-iso are more prevalent than iso- forms. The high percentage of the C15 fatty acid ester was characteristic of each species but with some differences in the relative amounts were observed. C19 and C22 fatty acid esters were characteristic of L. monocytogenes. Whole cells of L. monocytogenes and L. ivanovii induced strong monocytosis in the infected animals (rabbits, mice, and rats) of varying degree of susceptibility. Similar effect was observed with crude lipid extract of L.moncytogenes. No such response was observed even when live L. seeligri cells or crude lipid of L. ivanovii were injected. (author)

  15. Antibiotics Susceptibility Profile of Listeria Species Isolated from Poultry Wastes and Fishpond Water from Private and Institutional Farms in Ibadan, Nigeria

    OpenAIRE

    Olutayo Israel Falodun; Moturayo Janet Amusan

    2017-01-01

    Introduction: Untreated waste being discharged into the environment due to proliferation of poultry and fish farms can constitute a public health threat to human. Listeria, an emerging pathogen is commonly associated with food. This study aimed at determining the antibiotic resistant pattern of Listeria species isolated from poultry droppings and fish pond water in Ibadan. Materials and Methods: Poultry waste and fishpond water samples were collected between April and July, 2016. Listeria...

  16. Effect of Filling Type and Heating Method on Prevalence of Listeria species and Listeria monocytogenes in Dumplings Produced in Poland.

    Science.gov (United States)

    Szymczak, Barbara; Dąbrowski, Waldemar

    2015-05-01

    The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P monocytogenes in meat dumplings. In contrast, the microwave heating applied for 2 min at 600 W only reduced the count of L. monocytogenes by 1 to 2 logs. Hence, the microwave heating failed to reduce the risk of infection with this pathogen below the level permissible in the EU regulation, especially in the most contaminated samples. In this case, the efficacy of microwave heating was significantly (P monocytogenes (rho = 0.626), then by meat content in the stuffing (0.476), and to the lowest extent--by the type of meat (0.415 to 0.425). However, no Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®

  17. PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

    Directory of Open Access Journals (Sweden)

    Imad al Kassaa

    2016-06-01

    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  18. Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

    Science.gov (United States)

    Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

    2017-07-01

    Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

  19. Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method.

    Science.gov (United States)

    Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou

    2015-06-01

    For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

    Directory of Open Access Journals (Sweden)

    Yunfeng Xu

    2017-09-01

    Full Text Available In the natural environments microorganisms coexist in communities as biofilms. Since foodborne pathogens have varying abilities to form biofilms, investigation of bacterial interactions in biofilm formation may enhance our understanding of the persistence of these foodborne pathogens in the environment. Thus the objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development after 24 h was measured using crystal violet in 96-well microtiter plate. Scanning electron microscopy and cell enumeration were employed after growth on stainless steel coupons. When compared with their single species counterparts, the dual species biofilms exhibited a significant increase in biofilm biomass. The number of L. monocytogenes in co-culture biofilms on stainless steel also increased significantly. However, there was no effect on the biofilm formation of L. monocytogenes when cultured with R. insidiosa separated by a semi-permeable membrane-linked compartment or cultured in R. insidiosa cell-free supernatant, indicating that direct cell-cell contact is critical for this interaction.

  1. Isolation and Confirmation of Listeria Species from Seafood off Goa Region by Polymerase Chain Reaction.

    Digital Repository Service at National Institute of Oceanography (India)

    Gawade, L.; Barbuddhe, S.B.; Bhosle, S.

    Several food borne outbreaks have highlighted the importance of Listeria monocytogenes to the public health and have been recognized as an emerging, important food borne pathogen, and a causative agent of listerioses. A number of genes are involved...

  2. Prevalence of and risk factors for Listeria species on dairy farms.

    Science.gov (United States)

    Vilar, M J; Yus, E; Sanjuán, M L; Diéguez, F J; Rodríguez-Otero, J L

    2007-11-01

    This cross-sectional study determined the prevalence of Listeria spp. in bulk-tank milk on dairy farms in the region of Galicia in northwest Spain. The aim was to identify management practices associated with the presence of Listeria spp. and possible effects on milk hygienic quality. A total of 98 farms was randomly selected on the basis of an expected prevalence of 6.5% for Listeria monocytogenes from 20,107 dairy farms in the region. Bulk-tank milk samples were obtained from 98 farms, fecal samples from lactating cows from 97 farms, and silage samples from 83 farms. Listeria monocytogenes was detected in 6.1, 9.3, and 6.0% of these samples, respectively. Statistical analyses confirmed the relationship between low silage quality (as indicated by high pH) and presence of Listeria spp. in silage (29.5 vs. 6.2% for pH above or below 4.5, respectively). Only milking system [tie-stall systems (28.6%) vs. parlor milking (10%)] and inadequately controlled milking order [yes (32.0%) vs. no (10.7%)] had statistically significant effects on management practices for increasing the risk of Listeria contamination of bulk-tank milk.

  3. Prevalence and antimicrobial resistance of Listeria, Salmonella, and Yersinia species isolates in ducks and geese.

    Science.gov (United States)

    Jamali, Hossein; Radmehr, Behrad; Ismail, Salmah

    2014-04-01

    The aims of this study were to determine the prevalence and antimicrobial resistance of Listeria, Salmonella, and Yersinia spp. isolated from duck and goose intestinal contents. A total of 471 samples, including 291 duck and 180 goose intestinal contents, were purchased from wet markets between November 2008 and July 2010. Listeria, Salmonella, and Yersinia spp. were isolated from 58 (12.3%), 107 (22.7%), and 80 (17%) of the samples, respectively. It was concluded that Listeria ivanovii, Salmonella Thompson, and Yersinia enterocolitica were the predominant serovars among Listeria, Salmonella, and Yersinia spp., respectively. Moreover, resistance to tetracycline was common in Listeria (48.3%) and Salmonella spp. (63.6%), whereas 51.3% of the Yersinia spp. isolates were resistant to cephalothin. Therefore, continued surveillance of the prevalence of the pathogens and also of emerging antibiotic resistance is needed to render possible the recognition of foods that may represent risks and also ensure the effective treatment of listeriosis, salmonellosis, and yersiniosis.

  4. Prevalence and antimicrobial susceptibility profile of listeria species from ready-to-eat foods of animal origin in Gondar Town, Ethiopia.

    Science.gov (United States)

    Garedew, Legesse; Taddese, Ayele; Biru, Tigist; Nigatu, Seleshe; Kebede, Elias; Ejo, Mebrat; Fikru, Abraham; Birhanu, Tamiru

    2015-05-12

    Listeriosis, mostly caused by Listeria monocytogenes species, has become a major concern to public health authorities due to its clinical severity and high mortality rate, particularly in high risk groups. Currently, there is limited information regarding the prevalence and antimicrobial susceptibility profiles of listeria species in ready-to-eat foods of animal origin in Gondar town, Ethiopia. The aim of this study was to determine the prevalence and antimicrobial susceptibility pattern of Listeria species isolated from ready-to-eat food of animal origin from public dinning places in Gondar town, Ethiopia. A cross sectional study on ready-toeat foods of animal origin sampled from major supermarkets, butcher shops, pastry shops, restaurants and hotels was carried out. Culture, biochemical and sugar tests were conducted for listeria species identification and disc diffusion test was performed to study the antimicrobial susceptibility profiles of the isolates. Out of 384 food samples examined, 96 (25%) were positive for Listeria species. Listeria monocytogenes was detected in 24 (6.25%) of the samples. Listeria monocytogenes was isolated from cake, raw meat, ice cream, minced beef, fish, unpasteurized milk and pizza in that order from higher to lower rate. Assessment of antimicrobial susceptibility profile of L. monocytogenes revealed the presence of four multi-drug resistant isolates. The higher resistance rate was recorded for penicillin, nalidixic acid, tetracycline and chloramphenicol, in decreasing order. All L. monocytogenes identified in the current study were sensitive to amoxicillin, cephalothin, cloxacillin, sulfamethoxazole, gentamicin and vancomycin. The presence of L. monocytogenes including drug resistant and multidrug resistant isolates in some ready-to-eat food items is an indicator of the presence of public health hazards to the consumer, particularly to the high-risk groups. Hence awareness creation on food safety and implementation of regulations

  5. Prevalence of Listeria species in camel sausages from retail markets in Aydin province in Turkey and RAPD analysis of Listeria monocytogenes Isolates

    Directory of Open Access Journals (Sweden)

    Ozbey Gokben

    2006-06-01

    Full Text Available Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%, Listeria innocua from 14 samples (14% and Listeria welshimeri from two samples(2%. A 701 bp fragment of listeriolysin O sequence for L. monocytogenes was amplified using specific primers by polymerase chain reaction (PCR for confirmation of the identification. A random primer (OPA-11 was used in a random amplified polymorphic DNA (RAPD assay. This detected five different band profiles amongst the L. monocytogenes isolates, indicating a relatively large amount of genetic heterogeneity amongst the nine isolates. The study has highlighted the need for improved strategies for food safety, in particular appropriate hygienic precautions to avoid contamination of sausage during the manufacturing process and appropriate preservation techniques during storage and transport, to prevent transmission of Listeria spp to consumers at home and abroad.

  6. Prevalence and Antimicrobial Resistance Profile of Listeria Species Isolated from Farmed and On-Sale Rainbow Trout ( Oncorhynchus mykiss) in Western Iran.

    Science.gov (United States)

    Rezai, Ramin; Ahmadi, Elham; Salimi, Behnam

    2018-05-01

    Listeria species are important foodborne pathogens, among which L. monocytogenes and L. ivanovii cause human listeriosis. The purpose of this study was to evaluate the incidence and antimicrobial resistance profiles of Listeria species in farmed and on-sale rainbow trout ( Oncorhynchus mykiss) in Kurdistan province, western Iran. A total of 240 fresh rainbow trout fish (120 samples from farms and 120 samples from retail outlets) were collected and analyzed phenotypically for the presence of Listeria. All Listeria isolates were differentiated with molecular techniques, and L. monocytogenes strains were identified to serotype. The antibiotic susceptibility of all Listeria isolates also was determined. Among the 240 samples, 86 (35.83%) were contaminated with Listeria: 32 samples of farmed fish and 54 samples of on-sale fish. The prevalence among the 240 samples was 9.16% (22 samples) for L. monocytogenes, 6.66% (16 samples) for L. ivanovii, 3.75% (9 samples) for L. welshimeri, 4.99% (12 samples) for L. grayi, 7.5% (18 samples) for L. innocua, and 3.75% (9 samples) for L. seeligeri. The prevalences of the human pathogenic strains L. monocytogenes and L. ivanovii were 4.16% (5 samples) and 14.16% (17 samples) in farmed fish and 5.83% (7 samples) and 7.5% (9 samples) in on-sale fish, respectively. Of the 22 L. monocytogenes isolates, 15, 3, and 4 were identified as serotypes 4b, 1/2a, and 1/2b, respectively. The highest rates of antibiotic resistance among the 86 Listeria isolates was observed against tetracycline (62.79% of all isolates), enrofloxacin (56.97%), and ciprofloxacin (38.37%). Very high resistance was also detected against penicillin (36.04%) and ampicillin (34.88%). These results highlight the potential public health threat posed by fish contaminated with Listeria species, including L. monocytogenes, in the west of Iran. Regular monitoring of Listeria contamination, upgrading of sanitary conditions in the fish industry, and prudent use of antibiotics is

  7. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants.

    Science.gov (United States)

    Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra

    2011-01-01

    A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.

  8. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  9. Prevalence and level of Listeria monocytogenes and other Listeria species in retail pre-packaged mixed vegetable salads in the UK.

    Science.gov (United States)

    Little, C L; Taylor, F C; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J

    2007-01-01

    As part of the European Commission (EC) co-ordinated programme for 2005, a study of pre-packaged ready-to-eat (RTE) mixed salads containing meat or seafood ingredients from retail premises was undertaken in the UK to determine the frequency and level of Listeria monocytogenes in these products. Almost all (99.8%; 2682/2686) samples were of satisfactory/acceptable microbiological quality. Two (0.1%) samples exceeded EC legal food safety criteria due to the presence of L. monocytogenes in excess of 100 cfu g(-1) (1.7 x 10(2), 9.9 x 10(2)cfu g(-1)) while another two (0.1%) were unsatisfactory due to L. welshimeri levels over 100 cfu g(-1) (1.2 x 10(3), 6.0 x 10(3) cfu g(-1)). Overall contamination of Listeria spp. and L. monocytogenes found in samples of mixed salads in the UK was 10.8% and 4.8%, respectively. Almost twice as many salad samples with meat ingredients were contaminated with Listeria spp. and L. monocytogenes (14.7% and 6.0%, respectively) compared to samples with seafood ingredients (7.4% and 3.8%, respectively). Pre-packaged mixed salads were contaminated with Listeria spp. and L. monocytogenes more frequently when: collected from sandwich shops; not packaged on the premises; stored or displayed above 8 degrees C. This study demonstrates that the control of L. monocytogenes in food manufacturing and at retail sale is essential in order to minimize the potential for this bacterium to be present in mixed salads at the point of consumption at levels hazardous to health.

  10. Roka Listeria detection method using transcription mediated amplification to detect Listeria species in select foods and surfaces. Performance Tested Method(SM) 011201.

    Science.gov (United States)

    Hua, Yang; Kaplan, Shannon; Reshatoff, Michael; Hu, Ernie; Zukowski, Alexis; Schweis, Franz; Gin, Cristal; Maroni, Brett; Becker, Michael; Wisniewski, Michele

    2012-01-01

    The Roka Listeria Detection Assay was compared to the reference culture methods for nine select foods and three select surfaces. The Roka method used Half-Fraser Broth for enrichment at 35 +/- 2 degrees C for 24-28 h. Comparison of Roka's method to reference methods requires an unpaired approach. Each method had a total of 545 samples inoculated with a Listeria strain. Each food and surface was inoculated with a different strain of Listeria at two different levels per method. For the dairy products (Brie cheese, whole milk, and ice cream), our method was compared to AOAC Official Method(SM) 993.12. For the ready-to-eat meats (deli chicken, cured ham, chicken salad, and hot dogs) and environmental surfaces (sealed concrete, stainless steel, and plastic), these samples were compared to the U.S. Department of Agriculture/Food Safety and Inspection Service-Microbiology Laboratory Guidebook (USDA/FSIS-MLG) method MLG 8.07. Cold-smoked salmon and romaine lettuce were compared to the U.S. Food and Drug Administration/Bacteriological Analytical Manual, Chapter 10 (FDA/BAM) method. Roka's method had 358 positives out of 545 total inoculated samples compared to 332 positive for the reference methods. Overall the probability of detection analysis of the results showed better or equivalent performance compared to the reference methods.

  11. Species and serovars of the genus Listeria lsolated from different sources in Brazil from 1971 to 1997

    Directory of Open Access Journals (Sweden)

    Hofer Ernesto

    2000-01-01

    Full Text Available Using phenotype techniques, characterization was made to species and serovar of 3,112 strains of Listeria, isolated from different sources of infection such as human (247-7.9% and animals (239-7.6%, as well as from various routes of infection, including food (2,330-74.8% and environmental constituents (296-9.5%, all coming from different regions of the country and collected during the period 1971-1997. The following species were recovered in the cultures analysed: L. monocytogenes (774-24.8%, L. innocua (2,269-72.9%, L. seeligeri (37-1.1%, L. welshimeri (22-0.7%, L. grayi (9-0.2%, and L. ivanovii (1-0.03%. L. monocytogenes was represented by ten serovars, the most prevalent being 4b (352-11.3%, 1/2a (162-5.2%, and 1/2b (148-4.7%. The predominant serovar in L. innocua was 6a (2,093-67.2%. Considerations about laboratory methods for diagnosis and epidemiological aspects are presented on the basis of the results obtained.

  12. Listeria (Listeriosis)

    Science.gov (United States)

    ... The Listeria Initiative The Listeria Whole Genome Sequencing Project Publications Language: English (US) Español (Spanish) File Formats Help: How do I view different file formats (PDF, DOC, PPT, MPEG) on this site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file ...

  13. The role of defeathering in the contamination of turkey skin by Salmonella species and Listeria monocytogenes.

    Science.gov (United States)

    Clouser, C S; Doores, S; Mast, M G; Knabel, S J

    1995-04-01

    This study was undertaken to determine whether the incidence of either Salmonella spp. or Listeria monocytogenes on turkeys at three commercial processors could be related to the type of defeathering system: 1) conventional, 58 C common bath scald; 2) kosher, 7 C common bath scald; or 3) steam-spray, 62 C nonimmersion scald. Flocks were sampled before defeathering, after defeathering, and after chill at each facility. The incidence of Salmonella-positive turkeys significantly increased subsequent to conventional defeathering (10 positive out of 14) as compared with before defeathering (3/14). The number of Salmonella-positive carcasses following kosher (0/14) and steam-spray (2/14) defeathering were similar to the number of Salmonella-positive carcasses found prior to defeathering (1/14 and 3/14, respectively). The incidence of Salmonella-positive carcasses following chill was slightly lower, but not significantly different than the number of Salmonella-positive carcasses found immediately following defeathering at all processors (8/14, 0/14, 1/14 for conventional, kosher, and steam-spray processors, respectively). Although L. monocytogenes was detected on turkeys sampled before chilling (2/10, kosher) and after chilling (8/14, kosher; 1/14, conventional), no L. monocytogenes was detected on turkeys at any of the processors prior to the evisceration process. Flocks with high aerobic plate counts prior to processing were more likely to contain Salmonella-positive birds throughout processing. Aerobic plate counts of all flocks were similar after chill whether or not Salmonella spp. and L. monocytogenes were detected.

  14. Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.

    Science.gov (United States)

    de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa

    2018-04-12

    Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

  15. Effects of Cover Crop Species and Season on Population Dynamics of Escherichia coli and Listeria innocua in Soil.

    Science.gov (United States)

    Reed-Jones, Neiunna L; Marine, Sasha Cahn; Everts, Kathryne L; Micallef, Shirley A

    2016-01-04

    Cover crops provide several ecosystem services, but their impact on enteric bacterial survival remains unexplored. The influence of cover cropping on foodborne pathogen indicator bacteria was assessed in five cover crop/green manure systems: cereal rye, hairy vetch, crimson clover, hairy vetch-rye and crimson clover-rye mixtures, and bare ground. Cover crop plots were inoculated with Escherichia coli and Listeria innocua in the fall of 2013 and 2014 and tilled into the soil in the spring to form green manure. Soil samples were collected and the bacteria enumerated. Time was a factor for all bacterial populations studied in all fields (P cover crop was a factor for E. coli in year 1 (P = 0.004) and for L. innocua in year 2 (P = 0.011). In year 1, E. coli levels were highest in the rye and hairy vetch-rye plots. In year 2, L. innocua levels were higher in hairy vetch-rye (P = 0.01) and hairy vetch (P = 0.03) plots than in the rye plot. Bacterial populations grew (P cover crops/green manures on bacterial population dynamics in soil varied, being influenced by bacterial species, time from inoculation, soil temperature, rainfall, and tillage; this reveals the need for long-term studies. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

    Science.gov (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

    2015-04-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  17. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

    Science.gov (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

    2016-01-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

  18. Prevalence of Listeria Species in Ice Creams Sold in The Cities of Kahramanmaraş and Adana

    OpenAIRE

    AKMAN, Deniz; DURAN, Nizami; DIĞRAK, Metin

    2004-01-01

    In this study, the prevalence of Listeria spp. was investigated in the ice cream samples collected from the downtown stores of Kahramanmaras (28 samples) and Adana (30 samples). A total of 58 ice cream samples were analysed by the Food and Drug Administration (FDA) two-stage enrichment techniques. Growth of Listeria spp. was determined in 14 (24.1%) of the samples collected from Kahramanmaras and 10 (17.2%) samples from Adana. The results of the biochemical tests revealed that the bacterial g...

  19. Prevalence and level of Listeria monocytogenes and other Listeria species in selected retail ready-to-eat foods in the United Kingdom.

    Science.gov (United States)

    Little, C L; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J

    2009-09-01

    Although listeriosis is a rare cause of human disease in the United Kingdom, an increase in the number of cases has been observed since 2001, almost exclusively in persons older than 60 years. This increase prompted this study on the microbiological safety of ready-to-eat (RTE) foods, which included those types potentially linked to cases of listeriosis. Between May 2006 and April 2007, 6,984 RTE foods were sampled (2,168 sliced meats, 1,242 hard cheese, 1,088 sandwiches, 878 butter, 725 spreadable cheese, 515 confectionery products containing cream, and 368 probiotic drinks). The food types with the highest prevalence of Listeria monocytogenes were sandwiches (7.0%) and sliced meats (3.7% within shelf life, 4.2% end of shelf life). L. monocytogenes at > 100 CFU/g (exceeding the European Commission's food safety criteria limit) only occurred in sandwiches (0.4%) and sliced meats (0.7% within shelf life, 1.0% end of shelf life). Contamination with L. monocytogenes at >100 CFU/g was more frequent in meats that were prepacked and/or of pack size > or = 300 g and in sandwiches that were supplied prepacked that contained salad vegetables as an ingredient. Satisfactory microbiological quality was associated with premises on which the management was trained in food hygiene and those that complied with hazard analysis and critical control point principles. This study provides important information about the microbiological safety of RTE foods and demonstrates that the control of L. monocytogenes in such foods, and in particular sandwiches and sliced meats, is essential in order to minimize the risk of this bacterium being present at levels hazardous to health at the point of consumption.

  20. Detection of Listeria in raw milk in Syria

    International Nuclear Information System (INIS)

    Al-Mariri, A.; Abou-Younes, A.

    2010-01-01

    The 66 milk collected from all province of Syria, were examined for the presence of Listeria sp. using a several technique, and L. monocytogenes serotypes associated with human listeriosis were also identified in the product. The PCR based method identified 117 strains of Listeria, L. monocytogenes, L. innocua, L. ivanovii, L. gravi, and L. welshimeri. The API Listeria system identified 94% of the isolates whereas FTIR identification was 98% for all Listeria species. (author)

  1. Listeria and Pregnancy

    Science.gov (United States)

    ... Events Advocacy For Patients About ACOG Listeria and Pregnancy Home For Patients Search FAQs Listeria and Pregnancy ... Pregnancy PFS013, January 2017 PDF Format Listeria and Pregnancy Fact Sheets Food Poisoning in Pregnant Women The ...

  2. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    2000-01-01

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....

  3. Bruker Biotyper Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry System for Identification of Nocardia, Rhodococcus, Kocuria, Gordonia, Tsukamurella, and Listeria Species

    Science.gov (United States)

    Lee, Tai-Fen; Du, Shin-Hei; Teng, Shih-Hua; Liao, Chun-Hsing; Sheng, Wang-Hui; Teng, Lee-Jene

    2014-01-01

    We evaluated whether the Bruker Biotyper matrix-associated laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) system provides accurate species-level identifications of 147 isolates of aerobically growing Gram-positive rods (GPRs). The bacterial isolates included Nocardia (n = 74), Listeria (n = 39), Kocuria (n = 15), Rhodococcus (n = 10), Gordonia (n = 7), and Tsukamurella (n = 2) species, which had all been identified by conventional methods, molecular methods, or both. In total, 89.7% of Listeria monocytogenes, 80% of Rhodococcus species, 26.7% of Kocuria species, and 14.9% of Nocardia species (n = 11, all N. nova and N. otitidiscaviarum) were correctly identified to the species level (score values, ≥2.0). A clustering analysis of spectra generated by the Bruker Biotyper identified six clusters of Nocardia species, i.e., cluster 1 (N. cyriacigeorgica), cluster 2 (N. brasiliensis), cluster 3 (N. farcinica), cluster 4 (N. puris), cluster 5 (N. asiatica), and cluster 6 (N. beijingensis), based on the six peaks generated by ClinProTools with the genetic algorithm, i.e., m/z 2,774.477 (cluster 1), m/z 5,389.792 (cluster 2), m/z 6,505.720 (cluster 3), m/z 5,428.795 (cluster 4), m/z 6,525.326 (cluster 5), and m/z 16,085.216 (cluster 6). Two clusters of L. monocytogenes spectra were also found according to the five peaks, i.e., m/z 5,594.85, m/z 6,184.39, and m/z 11,187.31, for cluster 1 (serotype 1/2a) and m/z 5,601.21 and m/z 11,199.33 for cluster 2 (serotypes 1/2b and 4b). The Bruker Biotyper system was unable to accurately identify Nocardia (except for N. nova and N. otitidiscaviarum), Tsukamurella, or Gordonia species. Continuous expansion of the MALDI-TOF MS databases to include more GPRs is necessary. PMID:24759706

  4. Listeria monocytogenes-carrying consortia in food industry. Composition, subtyping and numerical characterisation of mono-species biofilm dynamics on stainless steel.

    Science.gov (United States)

    Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta

    2015-08-03

    In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Behavior of Listeria monocytogenes in a multi-species biofilm with Enterococcus faecalis and Enterococcus faecium and control through sanitation procedures.

    Science.gov (United States)

    da Silva Fernandes, Meg; Kabuki, Dirce Yorika; Kuaye, Arnaldo Yoshiteru

    2015-05-04

    The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8 days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8 days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8 days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8 days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organismsbiofilms under all tested conditions (counts of the all microorganisms biofilms under all the test conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Tolerance development in Listeria monocytogenes-Escherichia coli dual-species biofilms after sublethal exposures to pronase-benzalkonium chloride combined treatments.

    Science.gov (United States)

    Rodríguez-López, Pedro; Cabo, Marta López

    2017-10-01

    This study was designed to assess the effects that sublethal exposures to pronase (PRN) and benzalkonium chloride (BAC) combined treatments have on Listeria monocytogenes-Escherichia coli dual-species biofilms grown on stainless steel in terms of tolerance development (TD) to these compounds. Additionally, fluorescence microscopy was used to observe the changes of the biofilm structure. PRN-BAC exposure was carried out using three different approaches and TD was evaluated treating biofilms with a final 100 μg/ml PRN followed by 50 μg/ml BAC combined treatment. Results showed that exposure to PRN-BAC significantly decreased the number of adhered L. monocytogenes (P reduction values were generally lower in L. monocytogenes compared to E. coli. Additionally, microscopy images showed an altered morphology produced by sublethal PRN-BAC in exposed L. monocytogenes-E. coli dual-species biofilms compared to control samples. Results also demonstrated that L. monocytogenes-E. coli dual-species biofilms are able to develop tolerance to PRN-BAC combined treatments depending on way they have been previously exposed. Moreover, they suggest that the generation of bacterial tolerance should be included as a parameter for sanitation procedures design. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Co-Culture with Listeria monocytogenes within a Dual-Species Biofilm Community Strongly Increases Resistance of Pseudomonas putida to Benzalkonium Chloride

    Science.gov (United States)

    Giaouris, Efstathios; Chorianopoulos, Nikos; Doulgeraki, Agapi; Nychas, George-John

    2013-01-01

    Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS), as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC) used in inadequate (sub-lethal) concentration (50 ppm). The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species) did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90%) of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE) analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation. PMID:24130873

  8. Co-culture with Listeria monocytogenes within a dual-species biofilm community strongly increases resistance of Pseudomonas putida to benzalkonium chloride.

    Directory of Open Access Journals (Sweden)

    Efstathios Giaouris

    Full Text Available Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS, as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC used in inadequate (sub-lethal concentration (50 ppm. The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90% of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation.

  9. Differential Biofilm Formation and Chemical Disinfection Resistance of Sessile Cells of Listeria monocytogenes Strains under Monospecies and Dual-Species (with Salmonella enterica) Conditions

    Science.gov (United States)

    Kostaki, Maria; Chorianopoulos, Nikos; Braxou, Elli; Nychas, George-John

    2012-01-01

    This study aimed to investigate the possible influence of bacterial intra- and interspecies interactions on the ability of Listeria monocytogenes and Salmonella enterica to develop mixed-culture biofilms on an abiotic substratum, as well as on the subsequent resistance of sessile cells to chemical disinfection. Initially, three strains from each species were selected and left to attach and form biofilms on stainless steel (SS) coupons incubated at 15°C for 144 h, in periodically renewable tryptone soy broth (TSB), under either monoculture or mixed-culture (mono-/dual-species) conditions. Following biofilm formation, mixed-culture sessile communities were subjected to 6-min disinfection treatments with (i) benzalkonium chloride (50 ppm), (ii) sodium hypochlorite (10 ppm), (iii) peracetic acid (10 ppm), and (iv) a mixture of hydrogen peroxide (5 ppm) and peracetic acid (5 ppm). Results revealed that both species reached similar biofilm counts (ca. 105 CFU cm−2) and that, in general, interspecies interactions did not have any significant effect either on the biofilm-forming ability (as this was assessed by agar plating enumeration of the mechanically detached biofilm bacteria) or on the antimicrobial resistance of each individual species. Interestingly, pulsed-field gel electrophoresis (PFGE) analysis clearly showed that the three L. monocytogenes strains did not contribute at the same level either to the formation of mixed-culture sessile communities (mono-/dual species) or to their antimicrobial recalcitrance. Additionally, the simultaneous existence inside the biofilm structure of S. enterica cells seemed to influence the occurrence and resistance pattern of L. monocytogenes strains. In sum, this study highlights the impact of microbial interactions taking place inside a mixed-culture sessile community on both its population dynamics and disinfection resistance. PMID:22307304

  10. Quantifying the combined effects of pronase and benzalkonium chloride in removing late-stage Listeria monocytogenes-Escherichia coli dual-species biofilms.

    Science.gov (United States)

    Rodríguez-López, Pedro; Puga, Carmen H; Orgaz, Belén; Cabo, Marta L

    2017-09-01

    This work presents the assessment of the effectivity of a pronase (PRN)-benzalkonium chloride (BAC) sequential treatment in removing Listeria monocytogenes-Escherichia coli dual-species biofilms grown on stainless steel (SS) using fluorescence microscopy and plate count assays. The effects of PRN-BAC on the occupied area (OA) by undamaged cells in 168 h dual-species samples were determined using a first-order factorial design. Empirical equations significantly (r 2 = 0.927) described a negative individual effect of BAC and a negative interactive effect of PRN-BAC achieving OA reductions up to 46%. After treatment, high numbers of remaining attached and released viable and cultivable E. coli cells were detected in PRN-BAC combinations when low BAC concentrations were used. Therefore, at appropriate BAC doses, in addition to biofilm removal, sequential application of PRN and BAC represents an appealing strategy for pathogen control on SS surfaces while hindering the dispersion of live cells into the environment.

  11. Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces.

    Science.gov (United States)

    Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth

    2013-01-01

    This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

  12. Listeria booriae sp. nov. and Listeria newyorkensis sp. nov., from food processing environments in the USA.

    Science.gov (United States)

    Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C

    2015-01-01

    Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.

  13. Vida extraterrestre

    OpenAIRE

    Guerrero, Ricardo, 1943-; Berlanga Herranz, Mercedes

    2012-01-01

    L'univers és ple de núvols de gas, pols i matèria orgànica. Els radiotelescopis han detectat la presència d"aigua i gran varietat de molècules orgàniques, peces essencials per al meccano de la vida.

  14. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  15. Prevalence and level of Listeria monocytogenes and other Listeria sp. in ready-to-eat minimally processed and refrigerated vegetables.

    Science.gov (United States)

    Kovačević, Mira; Burazin, Jelena; Pavlović, Hrvoje; Kopjar, Mirela; Piližota, Vlasta

    2013-04-01

    Minimally processed and refrigerated vegetables can be contaminated with Listeria species bacteria including Listeria monocytogenes due to extensive handling during processing or by cross contamination from the processing environment. The objective of this study was to examine the microbiological quality of ready-to-eat minimally processed and refrigerated vegetables from supermarkets in Osijek, Croatia. 100 samples of ready-to-eat vegetables collected from different supermarkets in Osijek, Croatia, were analyzed for presence of Listeria species and Listeria monocytogenes. The collected samples were cut iceberg lettuces (24 samples), other leafy vegetables (11 samples), delicatessen salads (23 samples), cabbage salads (19 samples), salads from mixed (17 samples) and root vegetables (6 samples). Listeria species was found in 20 samples (20 %) and Listeria monocytogenes was detected in only 1 sample (1 %) of cut red cabbage (less than 100 CFU/g). According to Croatian and EU microbiological criteria these results are satisfactory. However, the presence of Listeria species and Listeria monocytogenes indicates poor hygiene quality. The study showed that these products are often improperly labeled, since 24 % of analyzed samples lacked information about shelf life, and 60 % of samples lacked information about storage conditions. With regard to these facts, cold chain abruption with extended use after expiration date is a probable scenario. Therefore, the microbiological risk for consumers of ready-to-eat minimally processed and refrigerated vegetables is not completely eliminated.

  16. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  17. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

    Science.gov (United States)

    Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

    2014-09-01

    A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Investigating Listeria Outbreaks

    Centers for Disease Control (CDC) Podcasts

    Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDC’s Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks.

  19. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  20. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes

    Science.gov (United States)

    Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.

    2017-01-01

    The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (102 or 105 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of L. innocua

  1. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes.

    Science.gov (United States)

    Locatelli, Aude; Lewis, Micah A; Rothrock, Michael J

    2017-01-01

    The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes , in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (10 2 or 10 5  CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes . However, cocultures in UVM for high inoculum concentration did not show preferential growth of L

  2. Cytopathogenic effects in enterocytelike Caco-2 cells differentiate virulent from avirulent Listeria strains.

    OpenAIRE

    Pine, L; Kathariou, S; Quinn, F; George, V; Wenger, J D; Weaver, R E

    1991-01-01

    We have developed a simple test that differentiates between virulent and avirulent Listeria species as defined by the mouse 50% lethal doses (LD50S). The assay is based on trypan blue-revealed cytopathogenic effects that are produced during the infection of the human enterocytelike cell line Caco-2. These effects were elicited only by Listeria strains that had an intraperitoneal mouse LD50 less than 10(8) and were not produced by nonhemolytic, avirulent strains of Listeria monocytogenes gener...

  3. Rapid identification and classification of Listeria spp. and serotype assignment of Listeria monocytogenes using fourier transform-infrared spectroscopy and artificial neural network analysis

    Science.gov (United States)

    The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software, NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains...

  4. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  5. Transfer of antibiotic resistance from Enterococcus faecium of fermented meat origin to Listeria monocytogenes and Listeria innocua.

    Science.gov (United States)

    Jahan, M; Holley, R A

    2016-04-01

    Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.

  6. Listeria prevalence and Listeria monocytogenes serovar diversity at cull cow and bull processing plants in the United States.

    Science.gov (United States)

    Guerini, Michael N; Brichta-Harhay, Dayna M; Shackelford, T Steven D; Arthur, Terrance M; Bosilevac, Joseph M; Kalchayanand, Norasak; Wheeler, Tommy L; Koohmaraie, Mohammad

    2007-11-01

    Listeria monocytogenes, the causative agent of epidemic and sporadic listeriosis, is routinely isolated from many sources, including cattle, yet information on the prevalence of Listeria in beef processing plants in the United States is minimal. From July 2005 through April 2006, four commercial cow and bull processing plants were sampled in the United States to determine the prevalence of Listeria and the serovar diversity of L. monocytogenes. Samples were collected during the summer, fall, winter, and spring. Listeria prevalence on hides was consistently higher during cooler weather (28 to 92% of samples) than during warmer weather (6 and 77% of samples). The Listeria prevalence data collected from preevisceration carcass ranged from undetectable in some warm season samples to as high as 71% during cooler weather. Listeria on postintervention carcasses in the chill cooler was normally undetectable, with the exception of summer and spring samples from one plant where > 19% of the carcasses were positive for Listeria. On hides, L. monocytogenes serovar 1/2a was the predominant serovar observed, with serovars 1/2b and 4b present 2.5 times less often and serovar 1/2c not detected on any hides sampled. L. monocytogenes serovars 1/2a, 1/2c, and 4b were found on postintervention carcasses. This prevalence study demonstrates that Listeria species are more prevalent on hides during the winter and spring and that interventions being used in cow and bull processing plants appear to be effective in reducing or eliminating Listeria contamination on carcasses.

  7. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus.

    Directory of Open Access Journals (Sweden)

    Aneta Nowakiewicz

    Full Text Available The objective of the study was to examine a population of free-living carnivorous mammals most commonly found in Poland (red fox, beech marten, and raccoon for the occurrence of bacteria that are potentially pathogenic for humans and other animal species and to determine their virulence potential (the presence of selected virulence genes. From the total pool of isolates obtained (n = 328, we selected 90 belonging to species that pose the greatest potential threat to human health: Salmonella spp. (n = 19; 4.51%, Yersinia enterocolitica (n = 10; 2.37%, Listeria monocytogenes and L. ivanovii (n = 21, and Staphylococcus aureus (n = 40; 9.5%. The Salmonella spp. isolates represented three different subspecies; S. enterica subsp. enterica accounted for a significant proportion (15/19, and most of the serotypes isolated (S. Typhimurium, S. Infantis, S. Newport and S. Enteritidis were among the 10 non-typhoidal Salmonella serotypes that are most often responsible for infections in Europe, including Poland. Y. enterococlitica was detected in the smallest percentage of animals, but 60% of strains among the isolates tested possessed the ail gene, which is responsible for attachment and invasion. Potentially pathogenic Listeria species were isolated from approx. 5% of the animals. The presence of all tested virulence genes was shown in 35% of L. monocytogenes strains, while in the case of the other strains, the genes occurred in varying numbers and configurations. The presence of the inlA, inlC, hlyA, and iap genes was noted in all strains, whereas the genes encoding PI-PLC, actin, and internalin Imo2821 were present in varying percentages (from 80% to 55%. S. aureus was obtained from 40 individuals. Most isolates possessed the hla, hld (95% for each, and hlb (32.5% genes encoding hemolysins as well as the gene encoding leukotoxin lukED (70%. In a similar percentage of strains (77.5%, the presence of at least one gene encoding enterotoxin was found, with 12

  8. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus.

    Science.gov (United States)

    Nowakiewicz, Aneta; Zięba, Przemysław; Ziółkowska, Grażyna; Gnat, Sebastian; Muszyńska, Marta; Tomczuk, Krzysztof; Majer Dziedzic, Barbara; Ulbrych, Łukasz; Trościańczyk, Aleksandra

    2016-01-01

    The objective of the study was to examine a population of free-living carnivorous mammals most commonly found in Poland (red fox, beech marten, and raccoon) for the occurrence of bacteria that are potentially pathogenic for humans and other animal species and to determine their virulence potential (the presence of selected virulence genes). From the total pool of isolates obtained (n = 328), we selected 90 belonging to species that pose the greatest potential threat to human health: Salmonella spp. (n = 19; 4.51%), Yersinia enterocolitica (n = 10; 2.37%), Listeria monocytogenes and L. ivanovii (n = 21), and Staphylococcus aureus (n = 40; 9.5%). The Salmonella spp. isolates represented three different subspecies; S. enterica subsp. enterica accounted for a significant proportion (15/19), and most of the serotypes isolated (S. Typhimurium, S. Infantis, S. Newport and S. Enteritidis) were among the 10 non-typhoidal Salmonella serotypes that are most often responsible for infections in Europe, including Poland. Y. enterococlitica was detected in the smallest percentage of animals, but 60% of strains among the isolates tested possessed the ail gene, which is responsible for attachment and invasion. Potentially pathogenic Listeria species were isolated from approx. 5% of the animals. The presence of all tested virulence genes was shown in 35% of L. monocytogenes strains, while in the case of the other strains, the genes occurred in varying numbers and configurations. The presence of the inlA, inlC, hlyA, and iap genes was noted in all strains, whereas the genes encoding PI-PLC, actin, and internalin Imo2821 were present in varying percentages (from 80% to 55%). S. aureus was obtained from 40 individuals. Most isolates possessed the hla, hld (95% for each), and hlb (32.5%) genes encoding hemolysins as well as the gene encoding leukotoxin lukED (70%). In a similar percentage of strains (77.5%), the presence of at least one gene encoding enterotoxin was found, with 12

  9. Investigating Listeria Outbreaks

    Centers for Disease Control (CDC) Podcasts

    2013-01-04

    Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDC’s Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks.  Created: 1/4/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 1/8/2013.

  10. Study on contamination of sheep meat in Shahrekord area with Listeria ivanovii and determination its antibiotic resistance pattern

    Directory of Open Access Journals (Sweden)

    Farid Khalili Borujeni

    2013-06-01

    Full Text Available Background and objectives: Listeria monocytogenes and Listeria ivanovii are two pathogenic species of Listeria. The role of Listeria ivanovii is important in abortion, stillbirth, septicemia in animals and this bacterium sometimes is pathogenic in humans. Contamination of ovine carcasses during the slaughter and processing can cause foodborne infections in humans. In this study we examined the contamination of sheep meat in slaughter house of Shahrekord city to Listeria ivanovii and determined its antibiotic resistance pattern.Material and Methods: A total 200 samples of sheep meat were collected from abattoir and processed by use of two enrichment method. After doing specific biochemical tests and PCR, Listeria spp was identified and antibiotic resistance of isolated Listeria were tested by the agar disc diffusion method. Results: The contamination of sheep carcasses with listeria was 2.5% (5 out of 200 samples. All five isolates (2.5% were recognized as Listeria ivanovii and were resistant to four antibiotics, sensitive to six antibiotics and intermediate to other antibiotics.  Conclusion: According to the contamination rate in sheep carcasses with Listeria ivanovii and the relatively high antibiotic resistance specified in this bacteria, the role of red meat in transmission of Listeria spp. and appropriate use of antibiotics against this bacteria should be considered.

  11. Two cases of listeria rhombencephalitis

    Directory of Open Access Journals (Sweden)

    Christopher Thomas Mansbridge

    2018-01-01

    Full Text Available Listeria rhombencephalitis (LRE is a rare encephalitis of the hindbrain that can present with a variety of neurological symptoms. It is a diagnostic challenge, but prompt antimicrobial therapy is important to prevent high rates of mortality and morbidity. We report two cases of LRE, with several contrasting clinical features and different disease courses. Despite being rare, it is important to consider listeria in patients with possible meningoencephalitis, even if cultures are negative. Empirical treatment of meningoencephalitis should provide coverage for listeria, especially if the patient is at risk of listeriosis or there is a potential history of listeria exposure.

  12. Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics.

    Science.gov (United States)

    Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A

    2014-05-01

    The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

  13. Listeria spp. in Street-Vended Ready-to-Eat Foods

    OpenAIRE

    El-Shenawy, Moustafa; El-Shenawy, Mohamed; Ma?es, Jordi; Soriano, Jose M.

    2011-01-01

    Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contamina...

  14. listeria monocytogenes AND OTHER Listeria species IN POUL TRY ...

    African Journals Online (AJOL)

    BSN

    of pathogemc bacteria into the ground and surface water as well as the food chain. ... of pre\\ 1ous Listeric infections diagnosed and treatment effected. but their .... DISCUSSION ... In igeria, techniques such as composting or deep stacking to reduce or ... Therefore, it is critical for human health, animal health and agricultural ...

  15. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  16. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

  17. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

    DEFF Research Database (Denmark)

    Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

    2000-01-01

    A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

  18. Magnetic bead based immuno-detection of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables using the Bio-Plex suspension array system.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-04-01

    Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.

  19. O direito à vida

    Directory of Open Access Journals (Sweden)

    Luciana Mendes Pereira Roberto

    2004-12-01

    Full Text Available The Life is the basic property of the human being, because without the life, there is no way to talk about other rights, not even about the personality ones. According to this understanding, each single man has the right to the life, ie, the right to live, and not even it, he also has the right to a full and a dignified life, respect to their values and requirements. In this study, the start of the life to the Right is showed, as well its ending, with the death. Also, it is tried to elucidate the life as a primordial right of the personality, and the sanctions of even transgression.A Vida é o bem fundamental do ser humano, pois sem a vida, não há que se falar em outros direitos, nem mesmo os de personalidade. Com base nesse entendimento, todo o homem tem direito à vida, ou seja, o direito de viver e não apenas isso, tem o direito de uma vida plena e digna, respeito aos seus valores e necessidades. Procura-se, neste estudo, mostrar o início da vida para o Direito, bem como o seu fim, com a morte. Busca-se também elucidar a vida como direito primordial da personalidade, e as sanções de tal transgressão.

  20. The Antibiofilm Effect of Ginkgo biloba Extract Against Salmonella and Listeria Isolates from Poultry.

    Science.gov (United States)

    Wu, Yan; Park, Keun Cheol; Choi, Beom Geun; Park, Jin Hwa; Yoon, Ki Sun

    2016-05-01

    Salmonella spp. and Listeria spp. are common foodborne pathogens in poultry and have caused a large number of outbreaks worldwide. Biofilm formation is common in the food industry and is also a mechanism of antimicrobial resistance. The aim of this work was to investigate the antimicrobial effect and mechanism of Ginkgo biloba extract against the biofilm formation of Salmonella and Listeria isolates from poultry at retail markets. Bacteria detection, isolation, and enumeration were carried out on 27 chicken and 29 ducks at retail markets. The effects of temperature and G. biloba extract against biofilm formation of Salmonella and Listeria isolates were measured using the crystal violet assay and swimming and swarming motilities. The monitoring results of Salmonella and Listeria in 56 poultry carcasses at retail markets in Korea showed that the prevalence of Salmonella spp. in poultry was low (5.4%), but the prevalence of Listeria spp (78.6%) was high. L. innocua was the predominant serotype (80%) in the isolated Listeria species. Temperature, strain, and surface affected the biofilm formation of Salmonella spp. and Listeria spp. L. innocua showed the best biofilm formation ability on a 96-well plate, while Salmonella Enteritidis formed the most biofilm on a glass slide. Biofilm formation abilities of Salmonella spp. and Listeria spp. were increased with the increase of temperature. G. biloba extract at 75 μg/mL significantly inhibited biofilm formation of Salmonella spp. and Listeria spp (p Listeria, but not L. monocytogenes. The findings of this study provided the basis for the application of G. biloba extract as a food additive to promote the quality and safety of poultry products.

  1. Aerosol studies with Listeria innocua and Listeria monocytogenes.

    Science.gov (United States)

    Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

    2007-08-01

    Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

  2. Dynamics of biofilm formation by Listeria monocytogenes on stainless steel under mono-species and mixed-culture simulated fish processing conditions and chemical disinfection challenges.

    Science.gov (United States)

    Papaioannou, Eleni; Giaouris, Efstathios D; Berillis, Panagiotis; Boziaris, Ioannis S

    2018-02-21

    The progressive ability of a six-strains L. monocytogenes cocktail to form biofilm on stainless steel (SS), under fish-processing simulated conditions, was investigated, together with the biocide tolerance of the developed sessile communities. To do this, the pathogenic bacteria were left to form biofilms on SS coupons incubated at 15°C, for up to 240h, in periodically renewable model fish juice substrate, prepared by aquatic extraction of sea bream flesh, under both mono-species and mixed-culture conditions. In the latter case, L. monocytogenes cells were left to produce biofilms together with either a five-strains cocktail of four Pseudomonas species (fragi, savastanoi, putida and fluorescens), or whole fish indigenous microflora. The biofilm populations of L. monocytogenes, Pseudomonas spp., Enterobacteriaceae, H 2 S producing and aerobic plate count (APC) bacteria, both before and after disinfection, were enumerated by selective agar plating, following their removal from surfaces through bead vortexing. Scanning electron microscopy was also applied to monitor biofilm formation dynamics and anti-biofilm biocidal actions. Results revealed the clear dominance of Pseudomonas spp. bacteria in all the mixed-culture sessile communities throughout the whole incubation period, with the in parallel sole presence of L. monocytogenes cells to further increase (ca. 10-fold) their sessile growth. With respect to L. monocytogenes and under mono-species conditions, its maximum biofilm population (ca. 6logCFU/cm 2 ) was reached at 192h of incubation, whereas when solely Pseudomonas spp. cells were also present, its biofilm formation was either slightly hindered or favored, depending on the incubation day. However, when all the fish indigenous microflora was present, biofilm formation by the pathogen was greatly hampered and never exceeded 3logCFU/cm 2 , while under the same conditions, APC biofilm counts had already surpassed 7logCFU/cm 2 by the end of the first 96h of

  3. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  4. El tiempo en la vida humana. Disfrutar la vida.

    OpenAIRE

    Fernández-Crehuet, José María

    2016-01-01

    La conciliación de la vida profesional, familiar y personal es una tarea que estará presente durante toda nuestra vida y no siempre será sencilla. En la medida en que descubramos el sentido de nuestra vida, identificando nuestra misión, el camino que hemos de recorrer y la meta a alcanzar, podremos priorizar e integrar los distintos roles que tenemos que ejercer disfrutando del tiempo de nuestra vida.

  5. Tu proyecto de vida

    OpenAIRE

    Ramos, Georgina

    2012-01-01

    - Párrafo Inicial - Conociendo a Liliana N. - La intervención de la psicóloga Adriana - Tu proyecto de vida - Referencias - Notas de enseñanza o Resumen o Objetivos o Temas relacionados o Plan de aplicación para el aprendizaje o Análisis o Epílogo

  6. Clinical Case of Listeria Meningitis

    Directory of Open Access Journals (Sweden)

    V.O. Kuzmina

    2014-09-01

    Full Text Available This article describes a case of listeria meningitis in a 41-year-old man. At the time of admission to hospital, the patient complained of fever, headache, vomiting, general weakness. An objective examination revealed cervical lymphadenopathy, meningeal signs (positive Kernig’s sign and doubtful rigidity of occipitals, with no focal symptoms. On the right hand it was revealed an abscess in the stage of healing. In the liquor we have detected: pleocytosis — 222 cells with a predominance of neutrophils — 73 %, рrotein — 0.49 g/l, the sugar level in the liquor is slightly reduced. During the bacteriological study of liquor we have isolated Listeria monocytogenes. Serological survey of blood serum using passive hemagglutination test and indirect hemagglutination test revealed levels of antibodies to Listeria monocytogenes — 1 : 800 and 3 (+, respectively.

  7. Listeria Endocarditis: A Diagnostic Challenge

    Directory of Open Access Journals (Sweden)

    Wilhelmina J. A. R. M. Valckx MD

    2017-04-01

    Full Text Available A 74-year-old hemodialysis patient with a history of an atrial septum defect closure, coronary bypass surgery, and a St. Jude aortic prosthetic valve was diagnosed with pneumonia and volume overload. Blood cultures were positive for Listeria monocytogenes, and amoxicillin was given for 2 weeks. Immediately after discontinuation of amoxicillin, fever relapsed. Transthoracic and transesophageal echocardiography showed no sign of endocarditis. Given the fever relapse and 3 positive minor Duke criteria, an 18F-FDG PET-CT scan (18F-fluorodeoxyglucose-positron emission tomography-computed tomography scan was performed. This scan showed activity at the aortic root, proximal ascending aorta, and inferior wall of the heart, making Listeria monocytogenes endocarditis a likely explanation. Amoxicillin was given for 6 weeks with good clinical result. Diagnosing a life-threatening Listeria monocytogenes endocarditis can be challenging and an 18F-FDG PET-CT scan can be helpful.

  8. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  9. Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

    African Journals Online (AJOL)

    This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

  10. Prevalence of Listeria spp. and Molecular Characterization of Listeria monocytogenes Isolates from Broilers at the Abattoir.

    Science.gov (United States)

    Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc

    2015-07-01

    Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.

  11. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

    Science.gov (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

    2016-01-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  12. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C

    2008-08-01

    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  13. Calidad de vida

    Directory of Open Access Journals (Sweden)

    Enrique Ardila

    2000-07-01

    Full Text Available Muchas enfermedades tienen un impacto sobre las personas diferente de la mortalidad, como es el caso de las enfermedades no letales que producen sufrimiento e incapacidad. Debido a esto también es importante medir el impacto de las enfermedades en términos del efecto que estas tienen sobre la calidad de vida de la persona que las padece.

  14. Historias de vida

    Directory of Open Access Journals (Sweden)

    BERNABÉ SARABIA

    1985-01-01

    Full Text Available El material biográfico tiene aplicaciones variadas, como los análisis de cohortes y ciclos vitales y los estudios profundos de casos individuales. Se revisa la bibliografía actual más importante sobre esta técnica de historias de vida, el modelo de reconstrucción autobiográfico y el método de Bruselas de autobiografía asistida.

  15. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  16. Prevalence of Listeria monocytogenes in the river receiving the effluent of municipal wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Atefeh Taherkhani

    2013-01-01

    Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.

  17. Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

    Science.gov (United States)

    Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

    2010-08-01

    Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

  18. Comparison of the incidence of Listeria on equipment versus environmental sites within dairy processing plants.

    Science.gov (United States)

    Pritchard, T J; Flanders, K J; Donnelly, C W

    1995-08-01

    This study was undertaken to compare the incidence of Listeria contamination of processing equipment with that of the general dairy processing environment. A total of 378 sponge samples obtained from 21 dairy plants were analyzed for Listeria using three different enrichment media. Use of extended microbiological analysis allowed us to identify 26 Listeria positive sites which would have not been identified had a single test format been employed. Eighty (80) of 378 sites (21.2%) were identified as Listeria positive. Listeria innocua was isolated from 59 of the 80 (73.8%) positive samples, L. monocytogenes was identified in 35 (43.8%) of the positive samples, and L. seeligeri was isolated from 5 (6.3%) of the Listeria positive samples. Positive equipment samples were obtained from 6 of the 21 (28.6%) plants and 19 of the 21 (90.5%) plants had positive environmental sites. Seventeen of the 215 (7.9%) samples from equipment were positive for Listeria species. Eleven of these sites, including 3 holding tanks, 2 table tops, 3 conveyor/chain systems, a pasta filata wheel, a pint milk filler and a brine pre-filter machine, were positive for L. monocytogenes. Nineteen of the 21 (90.5%) plants had positive environmental sites. Sixty-three of the 163 (41.1%) samples from environmental sites were Listeria positive and 24 were positive for L. monocytogenes. Two-tailed student t-test analysis of the mean frequencies indicated that the level of contamination was significantly higher (p plant, and that greater emphasis needs to be placed on the cleaning and sanitizing of the plant environment.

  19. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

    Science.gov (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

    2017-01-01

    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  20. Establishment of a simple and rapid identification method for Listeria spp. by using high-resolution melting analysis, and its application in food industry.

    Science.gov (United States)

    Ohshima, Chihiro; Takahashi, Hajime; Phraephaisarn, Chirapiphat; Vesaratchavest, Mongkol; Keeratipibul, Suwimon; Kuda, Takashi; Kimura, Bon

    2014-01-01

    Listeria monocytogenes is the causative bacteria of listeriosis, which has a higher mortality rate than that of other causes of food poisoning. Listeria spp., of which L. monocytogenes is a member, have been isolated from food and manufacturing environments. Several methods have been published for identifying Listeria spp.; however, many of the methods cannot identify newly categorized Listeria spp. Additionally, they are often not suitable for the food industry, owing to their complexity, cost, or time consumption. Recently, high-resolution melting analysis (HRMA), which exploits DNA-sequence differences, has received attention as a simple and quick genomic typing method. In the present study, a new method for the simple, rapid, and low-cost identification of Listeria spp. has been presented using the genes rarA and ldh as targets for HRMA. DNA sequences of 9 Listeria species were first compared, and polymorphisms were identified for each species for primer design. Species specificity of each HRM curve pattern was estimated using type strains of all the species. Among the 9 species, 7 were identified by HRMA using rarA gene, including 3 new species. The remaining 2 species were identified by HRMA of ldh gene. The newly developed HRMA method was then used to assess Listeria isolates from the food industry, and the method efficiency was compared to that of identification by 16S rDNA sequence analysis. The 2 methods were in coherence for 92.6% of the samples, demonstrating the high accuracy of HRMA. The time required for identifying Listeria spp. was substantially low, and the process was considerably simplified, providing a useful and precise method for processing multiple samples per day. Our newly developed method for identifying Listeria spp. is highly valuable; its use is not limited to the food industry, and it can be used for the isolates from the natural environment.

  1. Listeria monocytogenes - Danger for health safety vegetable production.

    Science.gov (United States)

    Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

    2018-04-22

    The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

  2. Listeria spp. in Street-Vended Ready-to-Eat Foods

    Science.gov (United States)

    El-Shenawy, Moustafa; El-Shenawy, Mohamed; Mañes, Jordi; Soriano, Jose M.

    2011-01-01

    Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin). Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food. PMID:22194742

  3. Identification of non-Listeria spp. bacterial isolates yielding a β-D-glucosidase-positive phenotype on Agar Listeria according to Ottaviani and Agosti (ALOA).

    Science.gov (United States)

    Angelidis, Apostolos S; Kalamaki, Mary S; Georgiadou, Sofia S

    2015-01-16

    Agar Listeria according to Ottaviani and Agosti (ALOA) is the mandatory medium used for the detection and enumeration of Listeria monocytogenes in foods according to the official International Organization for Standardization (ISO) methods. On ALOA, Listeria spp. appear as bluish-green colonies due to the production of β-D-glucosidase, an enzyme that cleaves 5-bromo-4-chloro-3-indolyl-β-D-glucopyranoside, a chromogenic substrate included in the formulation of the medium. The present work reports on bacterial isolates (n=64) from ready-to-eat soft cheeses, which are able to grow on ALOA, forming bluish-green colonies and therefore phenotypically resemble Listeria spp. All isolates were also capable of growing on the selective media PALCAM and RAPID L'mono. The isolates were characterised with biochemical tests including those specified in the ISO standards for the confirmation of Listeria spp. and identified via partial sequencing of their 16S rRNA gene. According to sequencing results the isolates represented 12 different bacterial species or species-groups belonging to seven different genera: Bacillus spp. (B. circulans, B. clausii, B. licheniformis and B. oleronius), Cellulosimicrobium spp. (C. funkei), Enterococcus spp. (E. faecalis, E. faecium/durans), Kocuria spp. (K. kristinae), Marinilactibacillus spp. (M. psychrotolerans), Rothia spp. (R. terrae) and Staphylococcus spp. (S. sciuri and S. saprophyticus subsp. saprophyticus/xylosus). Cellulosimicrobium spp. have never been previously isolated from foods. These results significantly extend the list of bacteria previously known as capable of growing on ALOA as bluish-green colonies and suggest that there may be room for further improvement in the medium's inhibitory properties towards non-Listeria spp., Gram-positive bacteria present in foods. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji

    2008-09-01

    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  5. Epidemiologia molecular de Listeria monocytogenes isoladas de diferentes fontes no Brasil

    OpenAIRE

    Andrea Micke Moreno; Renata Paixão; Luisa Zanolli Moreno; Débora Dirani Sena de Gobbi; Daniele Cristine Raimundo; Thais Sebastiana Porfida Ferreira; Ernesto Hofer; Maria Helena Matte; Marina Moreno

    2013-01-01

    Listeria monocytogenes é um importante patógeno de origem alimentar que afeta principalmente grávidas, neonatos, idosos e indivíduos imunocomprometidos, e pode causar abortamento, septicemia e meningite. Dos 13 grupos capsulares descritos, os sorotipos 4b, 1/2b e 1/2a são os mais relacionados à infecção humana. Por esta razão, a sorotipagem possui valor limitado como ferramenta epidemiológica e, dessa forma, métodos mais discriminatórios são necessários para melhorar o conhecimento sobre a co...

  6. Pensar a vida

    OpenAIRE

    Encarnação, José d'

    2016-01-01

    Texto incluído no catálogo («Mudar de Vida») da exposição permanente da cidade romana de Tongobriga, na intenção de se reconstituir o dia-a-dia dos seus habitantes. E uma das suas ocupações seria orar - e disso se trata neste capítulo. Imagina-se, no âmbito da vivência diária, as intenções de Valerius Paternus ao mandar gravar uma árula à deusa Fortuna e os rituais da sua colocação solene no lararium familiar, da cidade romana de Tongobriga.

  7. The VIDA programme

    DEFF Research Database (Denmark)

    Jensen, Bente; Iannone, Rosa Lisa

    and Innovation’ within the project ‘Curriculum Quality Analysis and Impact Review of European Education and Care’ (CARE). The programme at the centre of this case builds on theory drawn from research on child development, social disadvantage related to issues of social inequality, and research on organisational...... of innovation as “the development of new concepts, strategies and tools that support groups in achieving the objective of improved well-being”. Three research questions are explored: 1) How is the innovative approach to ECEC professional development conceptualised and translated into practice in the VIDA...... (mechanisms/aspects) affect the implementation of the innovative programme for practice change within ECEC? Methods used include a combination of qualitative data collected through interviews with ECEC educators, managers, consultants, a university college teachers, municipal directors and existing...

  8. Commensal microbes provide first line defense against Listeria monocytogenes infection

    Science.gov (United States)

    Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

  9. Anti-Listeria starters: in vitro selection and production plant evaluation.

    Science.gov (United States)

    Raimondi, Stefano; Popovic, Mina; Amaretti, Alberto; Di Gioia, Diana; Rossi, Maddalena

    2014-05-01

    Anti-Listeria bacterial starters are highly demanded by the meat industry. Novel bioprotective anti-Listeria starters were searched among Lactobacillus species strains isolated from artisanal sausages. The screening confirmed that anti-Listeria activity is a strain-specific property and yielded only 1 strain (of 36) exhibiting a satisfactory level of inhibition, L. delbrueckii WC0286. This strain was compared with two commercial bioprotective starters, SafePro B-SF-43 and SafePro B-LC-20, in a model simulating in vitro the first step of the fermentation process. The presence of the bioprotective starters did not modify the pH in such a way that could affect the safety or organoleptic properties of the product. Both SafePro B-SF-43 and SafePro B-LC-20 effected an important reduction of Listeria counts (0.56 and 0.72 log CFU g(-1), respectively, in 72 h), while the anti-Listeria effect of L. delbrueckii WC0286 was minor (0.15 log CFU g(-1)). These results discouraged the utilization of L. delbrueckii WC0286 for a challenge test in a pilot salami production, in favor of the best-performing bioprotective starter, SafePro B-LC-20. The test confirmed that SafePro B-LC-20 did not alter the acidification trend of sausages and was capable of inhibiting Listeria, which decreased by 1.21 log CFU g(-1). This information is relevant to address research activity toward the development of new bioprotective starters. The data herein presented demonstrate that the efficacy in Listeria control of potentially bioprotective bacterial starters requires further validation in real meat matrixes, possibly by using in vitro meat fermentation experiments to narrow down the list of candidates before pilot scale challenge tests.

  10. Detection of Antibiotic Resistant Listeria spp. in Beef Burgers Distributed in Ahvaz City, Iran

    Directory of Open Access Journals (Sweden)

    Maktabi

    2016-03-01

    Full Text Available Background Listeria spp. are able to be survive in many foods during frozen storage. One particular species, Listeria monocytogenes, is one of the most important food-borne pathogens globally. The antimicrobial resistance of pathogenic microorganisms is a worldwide public health concern because of increasing global trade and travel. Objectives The aim of this study was to evaluate the occurrence and antibiotic resistance of Listeria spp. in the Iranian beef burgers distributed in Ahvaz city. Materials and Methods During a five-month period, 150 frozen burgers were purchased from local markets in Ahvaz city, and tested for presence of Listeria spp. The experimental procedure consisted of a one-step enrichment in Listeria enrichment broth, followed by plating on Oxford agar. Suspected colonies were subjected to subsequent biochemical tests and a polymerase chain reaction (PCR assay. The susceptibility of the isolates to various antibiotics was investigated using the Kirby-Bauer disk diffusion method, and the results were analyzed via the chi-square test and Fisher’s exact test using SPSS 16.0 software. Results Out of 150 samples, only two were contaminated with Listeria innocua, and the statistical analysis showed no significant differences in the prevalence of Listeria between companies (P > 0.05. One of the isolates was resistant to tetracycline and the other to co-trimoxazole. Both of the isolates showed an intermediate susceptibility to chloramphenicol; however, they were sensitive to the other tested antibiotics. Conclusions L. innocua is not a pathogen, but the presence of the bacterium could be an indicator of probable contamination with L. monocytogenes. Moreover, there is a potential risk to public health from the consumption of raw or undercooked burgers, which may increase the possibility of the acquisition of resistance to antibiotics.

  11. Irrigation Is Significantly Associated with an Increased Prevalence of Listeria monocytogenes in Produce Production Environments in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-06-01

    Environmental (i.e., meteorological and landscape) factors and management practices can affect the prevalence of foodborne pathogens in produce production environments. This study was conducted to determine the prevalence of Listeria monocytogenes, Listeria species (including L. monocytogenes), Salmonella, and Shiga toxin-producing Escherichia coli (STEC) in produce production environments and to identify environmental factors and management practices associated with their isolation. Ten produce farms in New York State were sampled during a 6-week period in 2010, and 124 georeferenced samples (80 terrestrial, 33 water, and 11 fecal) were collected. L. monocytogenes, Listeria spp., Salmonella, and STEC were detected in 16, 44, 4, and 5% of terrestrial samples, 30, 58, 12, and 3% of water samples, and 45, 45, 27, and 9% of fecal samples, respectively. Environmental factors and management practices were evaluated for their association with terrestrial samples positive for L. monocytogenes or other Listeria species by univariate logistic regression; analysis was not conducted for Salmonella or STEC because the number of samples positive for these pathogens was low. Although univariate analysis identified associations between isolation of L. monocytogenes or Listeria spp. from terrestrial samples and various water-related factors (e.g., proximity to wetlands and precipitation), multivariate analysis revealed that only irrigation within 3 days of sample collection was significantly associated with isolation of L. monocytogenes (odds ratio = 39) and Listeria spp. (odds ratio = 5) from terrestrial samples. These findings suggest that intervention at the irrigation level may reduce the risk of produce contamination.

  12. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov

    2014-03-01

    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  13. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  14. Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

    Science.gov (United States)

    Alali, Walid Q; Schaffner, Donald W

    2013-07-01

    The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

  15. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  16. Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

    Science.gov (United States)

    Shoughy, Samir S; Tabbara, Khalid F

    2014-01-01

    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  17. Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Daniel R. Rissi

    2010-01-01

    fed with silage. In three farms there were close contact among affected sheep and other species. Clinical signs were characterized by recumbency (7/7, head tilt (4/7, incoordination (3/7, depression (3/7, circling (2/7, unilateral blindness, wasting, fever, midriasis, paddling, opisthotonus, hind or hind and fore limb paralysis, drooling, and muscle tremors (1/7 each. Clinical evolution varied from 12 hours to three days. Histological findings consisted of predominantly unilateral, microabscedative encephalitis with variable degrees of gliosis and degenerative lesions characterized by axonal spheroids and infiltration by Gitter cells. These lesions were observed extending from medulla oblongata to mesencephalon. Listeria monocytogenes antigen was showed by imunohistochemistry in routinely processed sections of brainstem from all seven affected sheep. The diagnostic was based on epidemiological, clinical, and pathological findings and confirmed by immunohistochemistry (IHQ using polyclonal anti-L. monocytogenes antibody.

  18. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

    Science.gov (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

    2015-07-02

    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Cruce de miradas sobre Lepa Vida (Hermosa Vida

    Directory of Open Access Journals (Sweden)

    Barbara Pregelj

    2015-04-01

    Full Text Available Los eslovenos tenemos varios héroes míticos marcados por la experiencia de la interculturalidad: el buen soberano Kralj Matjaž (el Rey Matías que duerme bajo el monte de Peca, esperando a que le crezca lo suficientemente la barba para poder entrar en acción; Martin Krpan, hombre fuerte como un roble que liberó Viena del mal y a cambio consiguió un permiso especial para traficar con sal; Peter Klepec, un chico humilde que compartía con los demás su fuerza; y Lepa Vida (Hermosa Vida, la joven madre que por engaño abandona a su hijo y su hogar para viajar en barco al extranjero. Todos ellos tienen origen en el bagaje cultural popular y todos ellos posteriormente han sido objeto de nuevas y distintas adaptaciones artísticas. Entre las adaptaciones literarias por frecuencia sobresale Hermosa Vida, que a su vez ha tenido eco (aunque mucho menor en la pintura: sobresale la obra de Maksim Gaspari, y la obra de Marko Kociper (2010 en cómic ‒recogida en una de las versiones literarias más recientes, Hermosa Vida en acción de Andrej Rozman Roza.

  20. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Science.gov (United States)

    Nayak, Deepti N.; Savalia, C. V.; Kalyani, I. H.; Kumar, Rajeev; Kshirsagar, D. P.

    2015-01-01

    Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each) collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence-associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9%) were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%), Listeria innocua (5, 27.7%), Listeria welshimeri (4, 22.2%), and L. monocytogenes (3, 16.6%). The highest prevalence was observed in milk samples (8). Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk). All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200) of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest prevalence

  1. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Directory of Open Access Journals (Sweden)

    Deepti N. Nayak

    2015-06-01

    Full Text Available Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9% were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%, Listeria innocua (5, 27.7%, Listeria welshimeri (4, 22.2%, and L. monocytogenes (3, 16.6%. The highest prevalence was observed in milk samples (8. Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk. All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200 of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest

  2. "Quantificação de Listeria monocytogenes em salames fatiados embalados a vácuo"

    OpenAIRE

    Ichiro Sakate, Ricardo; Casale Aragon, Lina; Raghiante, Fernanda; Landgra, Mariza; Bernadette D. G. M, Franco; Destro, Maria Teresa

    2003-01-01

    RESUMO. Pouco se sabe, no Brasil e na América do Sul, sobre a ocorrência de Listeria monocytogenes em embutidos cárneos fermentados, fatiados, embalados a vácuo. Por suas características de produção e armazenamento, estes produtos são potenciais veiculadores deste patógeno ao ser humano, principalmente imunodeprimidos, idosos e grávidas, levando a disfunções gastrintestinais e neurológicas. Neste trabalho, foram analisadas 45 amostras de diferentes tipos e marcas de salames fatiados embalados...

  3. con mala calidad de vida

    Directory of Open Access Journals (Sweden)

    Agustín Martín-Rodríguez

    2007-01-01

    Full Text Available En este estudio ex post facto se ha analizado si los familiares de pacientes con mala calidad de vida presentan diferencias en las variables clínicas de personalidad y relaciones familiares en función de que el paciente haya estado o no ingresado en una Unidad de Cuidados Intensivos. Seleccionamos dos grupos: 29 familiares de pacientes traumatizados graves transcurridos cuatro años de su ingreso en una UCI de Traumatología y con mala calidad de vida (debido a secuelas físicas y/o psicológicas tras el ingreso, tales como traumatismos craneoencefálicos, politraumatismos y tetraplejias traumáticas y 32 familiares de pacientes con mala calidad de vida con cuatro años de evolución de su enfermedad física (hipertensión, diabetes, artritis reumatoide y síndrome de intestino irritable que no han estado ingresados en la UCI. Para alcanzar nuestro objetivo empleamos una Encuesta Psicosocial y los siguientes instrumentos: Cuestionario de Análisis Clínico, Escala de Clima Social en la Familia y Escala de Adaptación Psicosocial de la Enfermedad. Los resultados mostraron que los familiares de pacientes con mala calidad de vida que estuvieron ingresados en la UCI hace cuatro años, presentan diferencias significativas en las variables agitación y expresividad comparados con los familiares de pacientes con mala calidad de vida que no han estado ingresados en la UCI.

  4. Búsqueda de vida en Marte

    Directory of Open Access Journals (Sweden)

    Rafael Navarro-González

    2005-01-01

    Full Text Available La misión astrobiológica más importante que se ha realizado hasta la fecha ha sido sin duda el proyecto Vikingo de la NASA. Esta misión consistió en tres experimentos biológicos especialmente diseñados para la búsqueda de indicadores de vida en las capas superficiales del suelo marciano. Los tres experimentos dieron resultados positivos. Sin embargo, el análisis de materia orgánica en el suelo marciano demostró la ausencia total de carbono orgánico. Este hallazgo fue utilizado como uno de los argumentos más sólidos en contra de la existencia de vida en la superficie del planeta Marte. Como preparación para futuras misiones a Marte en búsqueda de vida es necesario probar los instrumentos en localidades terrestres que pudieran ser ambientes análogos a Marte. Uno de los desiertos más áridos del planeta es el de Atacama, en el norte de Chile. Estudios químicos y microbiológicos del suelo de Atacama sugieren que el corazón del desierto es en realidad un buen análogo de Marte, ya que no posee vida macroscópica y microscópica, tiene niveles muy bajos de materia orgánica, y sus suelos son muy reactivos. En colaboración con científicos franceses y estadounidenses, estamos preparando una misión robótica dirigida por la NASA para la búsqueda de vida pasada o presente en Marte por lo que el Desierto de Atacama en Chile es el escenario para la preparación de esta misión espacial.

  5. IDENTIFIKASI Listeria spp. PADA PANGAN JAJANAN BERBASIS IKAN DI KOTA BOGOR

    Directory of Open Access Journals (Sweden)

    Elia Yuswita

    2016-06-01

    Full Text Available L. monocytogenes contamination in processed food, especially fish-based snack, may results from contaminated raw materials, underprocessed or recontamination. The aims of this study were to identify the presence of Listeria spp. especially L. monocytogenes by PCR method and biochemical methods, as well as calculate the prevalence of Listeria spp. in fish-based snack food in Bogor. This study was conducted of 4 steps: (1 determination of L. monocytogenes’s DNA limit detection, (2 sample preparation, (3 identification of L. monocytogenes with real-time PCR, and (4 identification of Listeria spp. with biochemical methods. The results showed that DNA detection limits of L. monocytogenes in fish meatball and otak-otak were at 8.3x102 and 2.9x102 CFU/g, respectively. The study on 65 samples indicated that contamination of L. monocytogenes was not observed, but other species of Listeria spp., namely L. grayi and L. innocua, were found. The prevalence of L. grayi and L. innocua in siomay was at 5.9%, while the prevalence of L. grayi in shrimp meatballs, fish meat balls, fried meatballs was at 8.3, 9.1, and 50%, respectively. Furthermore, L. innocua from takoyaki samples with a prevalence of 20% was observed.

  6. Tabela de vida de fertilidade de três espécies neotropicais de Trichogrammatidae em ovos de hospedeiros alternativos como critério de seleção hospedeira Fertility life table of three neotropical species of Trichogrammatidae on factitious hosts as a criterion for selection of hosts

    Directory of Open Access Journals (Sweden)

    Nivia da Silva Dias

    2010-03-01

    Full Text Available Tabela de vida de fertilidade de três espécies neotropicais de Trichogrammatidae em ovos de hospedeiros alternativos como critério de seleção hospedeira. O objetivo deste trabalho foi selecionar o hospedeiro alternativo que permita o melhor desenvolvimento das três espécies neotropicais de tricogramatídeos, Trichogramma atopovirilia Oatman & Platner, 1983; Trichogramma bruni Nagaraja, 1983 e Trichogrammatoidea annulata De Santis, 1972, utilizando-se como parâmetro comparativo as tabelas de vida de fertilidade nos respectivos hospedeiros. Foram estimados a duração média de uma geração (T, taxa líquida de reprodução (Ro, razão infinitesimal (r m e a razão finita de aumento (λ. A tabela de vida de fertilidade pode ser utilizada para selecionar o hospedeiro alternativo mais adequado para as espécies de tricogramatídeos. Corcyra cephalonica (Stainton, 1865 (Lepidoptera, Pyralidae foi o hospedeiro alternativo mais adequado para criação de T. annulata e de T. bruni, enquanto que para T. atopovirilia, Anagasta kuehniella (Zeller, 1879 (Lepidoptera, Pyralidae e/ou C. cephalonica foram os hospedeiros mais adequados. Sitotroga cerealella (Olivier, 1819 (Lepidoptera, Gelechiidae apresentou baixa capacidade de aumento populacional para as três espécies de parasitóides, sendo, portanto, uma espécie inadequada como hospedeiro alternativo para as mesmas.The objective of this work was to select the factitious host that permit the best development of three neotropical Trichogrammatidae species, Trichogramma atopovirilia Oatman & Platner, 1983; Trichogramma bruni Nagaraja, 1983, and Trichogrammatoidea annulata De Santis, 1972, using the fertility life table on their respective hosts as a comparative parameter. Mean generation time (T, net reproductive rate (Ro, intrinsic rate of natural increase (r m and the finite rate of increase (λ were estimated. A fertility life table is useful to select the most adequate factitious hosts for the

  7. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  8. Embryos, Unborns and Other Species. A Choreography of the Limits of Human Life Embriones, no nacidos y otras especies. una coreografía de los límites de la vida humana

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz Marcos

    2010-11-01

    Full Text Available In this article we draw upon the theoretical baggage of posthumanism as toolkit to inquire about the processes that configure the limits of human life. To do so we focus in three dimensions that, according to our analysis, are delineating the boundary which settles the initiation of human life as such: the first dimension will consider the morphological aspects, the second the temporal ones and the third the spatial aspects. The first one, morphological, will answer the question about the proper human form, the second will refer to when does that human life start, and the third will consider the where

    takes place that initiation. To track down how those three axes operate we analyse various materials, mostly legal texts and images. We try, therefore, to pursue a whole array of heterogeneous actors -both human and non-human-, practices, discourses and relations that facilitate the emergence of the properly "human" as such. As this complex array of elements tends to be erased from the narrative on the origins of human life, "humanness" comes to be read as a given, something unmediated and a-problematic.

    En este trabajo nos valemos del armazón teórico del posthumanismo como herramienta para indagar en los procesos de configuración de los límites de la vida humana. Para ello dirigimos nuestra mirada hacia tres dimensiones que, a nuestro juicio, están trazando la línea que designa los inicios de la vida humana: una primera dimensión morfológica, una segunda temporal y una tercera de carácter espacial. La primera de ellas respondería a la pregunta por la forma humana, la segunda haría referencia al cuándo y la tercera dirimiría el dónde de ese comienzo. Para rastrear la forma en que operan estos tres ejes proponemos el análisis de diversos materiales, principalmente textos legales e imágenes. Se trata en definitiva de indagar en todo un cúmulo de actores -humanos y no

  9. Listeria Occurrence in Poultry Flocks: Detection and Potential Implications

    Directory of Open Access Journals (Sweden)

    Michael J. Rothrock

    2017-08-01

    Full Text Available Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli, and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes, possesses a high mortality rate (approximately 20% and is considered one of the most dangerous foodborne pathogens. Although the usual reservoirs for Listeria transmission have been extensively studied, little is known about the relationship between Listeria and live poultry production. Sporadic and isolated cases of listeriosis have been attributed to poultry production and Listeria spp. have been isolated from all stages of poultry production and processing. Farm studies suggest that live birds may be an important vector and contributor to contamination of the processing environment and transmission of Listeria to consumers. Therefore, the purpose of this review is to highlight the occurrence, incidence, and potential systemic interactions of Listeria spp. with poultry.

  10. Listeria Occurrence in Poultry Flocks: Detection and Potential Implications.

    Science.gov (United States)

    Rothrock, Michael J; Davis, Morgan L; Locatelli, Aude; Bodie, Aaron; McIntosh, Tori G; Donaldson, Janet R; Ricke, Steven C

    2017-01-01

    Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli , and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes , possesses a high mortality rate (approximately 20%) and is considered one of the most dangerous foodborne pathogens. Although the usual reservoirs for Listeria transmission have been extensively studied, little is known about the relationship between Listeria and live poultry production. Sporadic and isolated cases of listeriosis have been attributed to poultry production and Listeria spp. have been isolated from all stages of poultry production and processing. Farm studies suggest that live birds may be an important vector and contributor to contamination of the processing environment and transmission of Listeria to consumers. Therefore, the purpose of this review is to highlight the occurrence, incidence, and potential systemic interactions of Listeria spp. with poultry.

  11. Non-Specific Reactions during Immunomagnetic Separation of Listeria

    Directory of Open Access Journals (Sweden)

    Iveta Zachová

    2005-01-01

    Full Text Available Problems occurring during the immunomagnetic separation (IMS of Listeria using immunomagnetic particles Dynabeads® anti-Listeria (Dynal Biotech, Norway were specified. Characteristics of these particles were compared with anti-Listeria spp. magnetite particles (Quantum Magnetics, USA. Pure cultures of Listeria innocua, Arthrobacter spp., Bacillus subtilis, Citrobacter braakii, Escherichia coli, Enterobacter aerogenes, Enterobacter cloacae and Staphylococcus aureus were used to evaluate non-specific reactions during IMS. Gram-positive microorganisms, especially Staphylococcus aureus and Arthrobacter spp., were found to be responsible for non-specific reactions in most cases. The capacity of Dynabeads® anti-Listeria particles was determined to be about 10 % of the initial pure cultures of Listeria spp., after 10 min of incubation. Non-specific reactions during IMS of Listeria were examined on the artificially inoculated food samples in which Gram-positive bacteria showed the highest percentage of capture. Influence of washing in two buffers was also studied.

  12. Prevalence, identification by a DNA microarray-based assay of human and food isolates Listeria spp. from Tunisia.

    Science.gov (United States)

    Hmaïed, F; Helel, S; Le Berre, V; François, J-M; Leclercq, A; Lecuit, M; Smaoui, H; Kechrid, A; Boudabous, A; Barkallah, I

    2014-02-01

    We aimed at evaluating the prevalence of Listeria species isolated from food samples and characterizing food and human cases isolates. Between 2005 and 2007, one hundred food samples collected in the markets of Tunis were analysed in our study. Five strains of Listeria monocytogenes responsible for human listeriosis isolated in hospital of Tunis were included. Multiplex PCR serogrouping and pulsed field gel electrophoresis (PFGE) applying the enzyme AscI and ApaI were used for the characterization of isolates of L. monocytogenes. We have developed a rapid microarray-based assay to a reliable discrimination of species within the Listeria genus. The prevalence of Listeria spp. in food samples was estimated at 14% by using classical biochemical identification. Two samples were assigned to L. monocytogenes and 12 to L. innocua. DNA microarray allowed unambiguous identification of Listeria species. Our results obtained by microarray-based assay were in accordance with the biochemical identification. The two food L. monocytogenes isolates were assigned to the PCR serogroup IIa (serovar 1/2a). Whereas human L. monocytogenes isolates were of PCR serogroup IVb, (serovars 4b). These isolates present a high similarity in PFGE. Food L. monocytogenes isolates were classified into two different pulsotypes. These pulsotypes were different from that of the five strains responsible for the human cases. We confirmed the presence of Listeria spp. in variety of food samples in Tunis. Increased food and clinical surveillance must be taken into consideration in Tunisia to identify putative infections sources. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  13. Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

    OpenAIRE

    Fossmo, Sabine

    2013-01-01

    Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

  14. Camembert, Listeria and the immunocompromised patient.

    Science.gov (United States)

    Ries, F; Dicato, M; Hemmer, R; Arendt, F

    1990-01-01

    Listeriosis is a rare but well known infectious complication in pregnant women and immunocompromised patients. Epidemiological studies have shown an association between listeriosis and alimentary contamination by listeria of a variety of foodstuff including soft, ripened cheeses. We describe two case-reports of listeria meningitis with high evidence of food-related illness due to the consumption of contaminated camembert. These observations urged our State Department of Health to formulate a communication about alimentary listeriosis at the intent of all health care professionals, including recommendations for patients at risk.

  15. THE PREVALENCE OF Salmonella sp., Listeria sp. AND Aeromonas spp. IN CATFISH (CLARIAS (Clarias gariepinus AND TILAPIA (Tilapia mossambica BY PELLETING METHOD

    Directory of Open Access Journals (Sweden)

    Titik Budiati

    2013-06-01

    Full Text Available The aim of this study was to modify the isolation methods of Aeromonas sp., Salmonella spp., and Listeria sp. in catfish (Clarias gariepinus and tilapia (Tilapia mossambica obtained from wet markets and ponds in Malaysia by pelleting the sample. A total of 108 samples (32 catfish intestines, 32 tilapia intestines, and 44 water samples were obtained from nine wet markets and eight ponds. The modified method was employed by pelleting the samples and followed by either implementing pre-enrichment or without pre-enrichment on the isolation of Salmonella and Listeria spp. The modified method (by pelleting the sample in combination with pre-enrichment was the most efficient for Salmonella and Listeria isolation. The sensitivity of the modified Salmonella isolation method was 0.53 and 0.73 for fish and water samples, respectively. The sensitivity of the modified Listeria method was 1 and 0.92 for fish and water samples, respectively. However, the sensitivity of the method by pelleting the sample was similar to those of non-pelleting the sample on Aeromonas isolation. Five species of Aeromonas spp., seven serovars of Salmonella sp., and four species of Listeria sp. were observed in catfish, tilapia and water samples. Overall, by pelleting the sample offered the beneficial to isolate Aeromonas spp., Salmonella sp. and Listeria spp. in catfish, tilapia and water.

  16. Hablar del sentido de la vida

    OpenAIRE

    Jean Grondin

    2012-01-01

    La pregunta por la vida, es un preguntar por y desde el sentido de lo que es y porta la vida. Interesa destacar la pregunta socrática o filosófica por el "sentido de la vida", en términos de existencia y realidad. La existencia del sentido la porta la vida; sin embargo, la dirección, la reflexión, la significación y, sobre todo, el sentir el sentido, es la tarea humana que le toca realizar a quien se pregunta por el thelos de la vida, su fin o finalidad. La naturaleza del mundo es lingüística...

  17. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin

    2015-01-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

  18. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  19. Keep Listeria Out of Your Kitchen

    Science.gov (United States)

    ... Listeria has been linked to a variety of ready-to-eat foods, including deli meats, hot dogs, smoked seafood and ... to check the temperature there. Use precooked and ready-to-eat foods as soon as you can. The longer they ...

  20. Prevalence, antimicrobial resistance profiles of Listeria ...

    African Journals Online (AJOL)

    Listeria monocytogenes is known to cause epidemic and sporadic cases of listeriosis. The present study investigated the occurrence, antibiograms and molecular serotypes of the organism in various retail outlets in Gaborone, Botswana. Food samples were obtained randomly from selected supermarkets and street vendors ...

  1. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  2. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  3. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Prevalence, Antimicrobial Resistance, and Genetic Diversity of Listeria spp. Isolated from Raw Chicken Meat and Chicken-Related Products in Malaysia.

    Science.gov (United States)

    Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie

    2018-02-01

    Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.

  5. Use of a novel medium, the Polymyxin Ceftazidime Oxford Medium, for isolation of Listeria monocytogenes from raw or non-pasteurized foods.

    Science.gov (United States)

    Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A

    2016-05-01

    Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Impact of growth conditions and role of sigB on Listeria monocytogenes fitness in single and mixed biofilms cultured with Lactobacillus plantarum

    NARCIS (Netherlands)

    Saa Ibusquiza, P.; Nierop Groot, M.N.; Deban Valles, A.; Abee, T.; Besten, den H.M.W.

    2015-01-01

    The role of sigB, a major transcriptional regulator of stress response genes, was assessed in formation of single and mixed species biofilms of Listeria monocytogenes EGD-e and Lactobacillus plantarum WCFS1 as secondary species at 20 °C and 30 °C using different medium compositions (nutrient-rich

  7. Vida artificial, el nuevo paradigma

    Directory of Open Access Journals (Sweden)

    José Jesús Martínez Páez

    1998-05-01

    Full Text Available Se presenta una síntesis cronológica de los hechos más importantes en el desarrollo teórico y de simulación computacional, que han llevado a la formación de un nuevo paradigma que se conoce como vida artificial; se analizan sus características y sus príncipales líneas de investigación. Finalmente, se hace una descripción de su trabajo en la Universidad Nacional.

  8. "Vidas secas": a (hyperintertextual reading

    Directory of Open Access Journals (Sweden)

    Giselda Maria Dutra Bandoli

    2016-04-01

    Full Text Available This work conducts a reflection on the notions of hypertext from a few updated views of Vidas Secas by Graciliano Ramos. Our purpose is to carry out the reading of an art object, dissociating hypertext from the idea of a device enabled only by electronic media. Thus, we show that hypertext is also manifested in printed texts, and postulate that literary language can be a manifestation of hypertextuality. Finally, we perform an intertextual reading of the book, seeking to highlight the dialogue between this and other works by representative Brazilian authors.

  9. Búsqueda de vida en Marte

    OpenAIRE

    Rafael Navarro-González

    2005-01-01

    La misión astrobiológica más importante que se ha realizado hasta la fecha ha sido sin duda el proyecto Vikingo de la NASA. Esta misión consistió en tres experimentos biológicos especialmente diseñados para la búsqueda de indicadores de vida en las capas superficiales del suelo marciano. Los tres experimentos dieron resultados positivos. Sin embargo, el análisis de materia orgánica en el suelo marciano demostró la ausencia total de carbono orgánico. Este hallazgo fue utilizado como u...

  10. Efficacy of a variety of disinfectants against Listeria spp.

    OpenAIRE

    Best, M; Kennedy, M E; Coates, F

    1990-01-01

    The efficacy of 14 disinfectants against Listeria innocua and two strains of Listeria monocytogenes in the presence of organic matter was studied. Quantitative efficacy tests were used. Many of the disinfectants tested were not as effective on Listeria spp. when the test organisms were dried onto the surface of steel disks (carrier tests) as they were when the organisms were placed in suspension (suspension test). The presence of whole serum and milk (2% fat) further reduced the disinfectant ...

  11. Listeria spp. in Street-Vended Ready-to-Eat Foods

    Directory of Open Access Journals (Sweden)

    Moustafa El-Shenawy

    2011-01-01

    Full Text Available Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin. Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food.

  12. [Survey of the presence of Listeria monocytogenes in meat products sold in retail].

    Science.gov (United States)

    Langiano, E; Lanni, L; Atrei, P; De Vito, E

    2007-01-01

    The present study evaluates the presence of Listeria spp and particularly of L. monocytogenes in bovine, pork and poultry meats sold by retail in supermarkets and butchers in the city of Cassino. The sensibility to the antibiotics mostly used in the veterinary practice has been tested on the isolated strains. The different species of Listeria have shown a considerable variation of isolation based on the meat's typology and on the different store's provenance. Moreover our results show greater degree of contamination than the data currently available the Italian literature. In our study poultry meat is the most contaminated one. We can assert that omissions and poor caring errors in the manipulation and conservation of meat expose the customer to an even higher risk of infection.

  13. Diferencias en las historias de vida de dos especies de isópodos bopíridos (Isopoda: Epicaridea que parasitan al nape Neotrypaea uncinata (Milne-Edwards, 1837 (Decapoda: Thalassinidea Different life histories of two species of bopyrid isopods (Isopoda, Epicaridea, parasites of the ghost shrimp Neotrypaea uncinata (H. Milne Edwards, 1837 (Decapoda: Thalassinidea

    Directory of Open Access Journals (Sweden)

    GABRIELA MUÑOZ

    2001-12-01

    Full Text Available En ambientes costeros de Concepción, Chile, se han registrado dos especies de isópodos, Ione ovata Shiino, 1964 e Ionella agassizi Bonnier, 1900, parásitos en las cámaras branquiales del nape Neotrypaea uncinata (H. Milne Edwards, 1837. La prevalencia de parasitismo sin embargo, es mucho menor en Ione ovata quien además presenta menor frecuencia de parejas cohabitando una misma branquia, aunque posee una especificidad comparativamente menor que I. agassizi. Esto sugiere que ambas especies poseen historias de vida contrastantes. Para mejorar el entendimiento de las causas de estas diferencias, en este estudio se analizan y comparan algunos rasgos de la historia de vida de los isópodos (fecundidad, tamaño de los huevos, inversión reproductiva, y capacidad de los machos para colonizar napes no parasitados. Ione agassizi tuvo una menor fecundidad, y huevos de mayor tamaño que I. ovata. Sin embargo, no hubo diferencias en la inversión reproductiva entre ambas especies, ni en su relación con el tamaño corporal del isópodo. Los machos de I. ovata poseen mayor habilidad que los de I. agassizi para colonizar nuevos napes no parasitados, ya que pudieron permanecer en nuevos hospedadores y rediferenciarse sexualmente en hembras. Se considera que sería necesario estimar la sobrevivencia durante el tiempo total de vida de estos parásitos para mejorar la interpretación de estos resultadosOn coastal habitats near Concepción city, Chile, there are two isopod species Ione ovata Shiino, 1964, and Ionella agassizi Bonnier, 1900 both occupying the gill chambers of the ghost shrimp Neotrypaea uncinata (H. Milne Edwards, 1837. However, in I. ovata, the prevalence is smaller, there is a low frequency of coupled isopods in the same gill chamber, and is less host specific than I. agassizi. These observations suggest that both isopod species have different life histories. To improve the understanding of the causes of these differences some life history

  14. Prevalence of Trichomonas, Salmonella, and Listeria in Wild Birds from Southeast Texas.

    Science.gov (United States)

    Brobey, Britni; Kucknoor, Ashwini; Armacost, Jim

    2017-09-01

    Infectious diseases can be a major threat to wildlife populations, especially in human-modified habitats, but infection rates in populations of wild animals are often poorly studied. Trichomonas, Salmonella, and Listeria are all pathogens known to infect birds, but their infection rates in wild bird populations are not well documented. This study documents infection rates of the three pathogens in wild bird populations inhabiting a suburban to rural gradient in Southeast Texas. Various species of wild birds were sampled at five sites in Southeastern Texas representing rural (Birds were captured in mist nets and samples were taken from the oral cavity, crop, and vent to detect the presence of pathogens. Samples were screened for Trichomonas by examining wet mounts under a light microscope, whereas samples were screened for Salmonella and Listeria by examining colonies grown on agar plates. Pathogens detected during the initial screening were further confirmed by PCR and DNA sequencing. Infection rates for Trichomonas, Salmonella, and Listeria were 9%, 17%, and 5%, respectively. The distributions of infection rates across habitats (i.e., rural, exurban, rural) did not differ significantly from the expected null distributions for any of the three pathogens; however, the data suggested some interesting patterns that should be confirmed with a larger dataset. Infection rates for Trichomonas and Salmonella were highest at the suburban sites, whereas the infection rate for Listeria was highest at the rural site. Feeder birds were more likely to be infected by all three pathogens than non-feeder birds. Small sample sizes prevent definitive conclusions regarding variation in infection rates along the suburban to rural gradient, but the results suggest that pathogens followed the predicted patterns. For many of the bird species sampled, this study presents the first report of infection rates by these three pathogens in wild populations.

  15. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  16. A PNPase Dependent CRISPR System in Listeria

    Science.gov (United States)

    Sesto, Nina; Touchon, Marie; Andrade, José Marques; Kondo, Jiro; Rocha, Eduardo P. C.; Arraiano, Cecilia Maria; Archambaud, Cristel; Westhof, Éric; Romby, Pascale; Cossart, Pascale

    2014-01-01

    The human bacterial pathogen Listeria monocytogenes is emerging as a model organism to study RNA-mediated regulation in pathogenic bacteria. A class of non-coding RNAs called CRISPRs (clustered regularly interspaced short palindromic repeats) has been described to confer bacterial resistance against invading bacteriophages and conjugative plasmids. CRISPR function relies on the activity of CRISPR associated (cas) genes that encode a large family of proteins with nuclease or helicase activities and DNA and RNA binding domains. Here, we characterized a CRISPR element (RliB) that is expressed and processed in the L. monocytogenes strain EGD-e, which is completely devoid of cas genes. Structural probing revealed that RliB has an unexpected secondary structure comprising basepair interactions between the repeats and the adjacent spacers in place of canonical hairpins formed by the palindromic repeats. Moreover, in contrast to other CRISPR-Cas systems identified in Listeria, RliB-CRISPR is ubiquitously present among Listeria genomes at the same genomic locus and is never associated with the cas genes. We showed that RliB-CRISPR is a substrate for the endogenously encoded polynucleotide phosphorylase (PNPase) enzyme. The spacers of the different Listeria RliB-CRISPRs share many sequences with temperate and virulent phages. Furthermore, we show that a cas-less RliB-CRISPR lowers the acquisition frequency of a plasmid carrying the matching protospacer, provided that trans encoded cas genes of a second CRISPR-Cas system are present in the genome. Importantly, we show that PNPase is required for RliB-CRISPR mediated DNA interference. Altogether, our data reveal a yet undescribed CRISPR system whose both processing and activity depend on PNPase, highlighting a new and unexpected function for PNPase in “CRISPRology”. PMID:24415952

  17. ISG15 counteracts Listeria monocytogenes infection

    Science.gov (United States)

    Radoshevich, Lilliana; Impens, Francis; Ribet, David; Quereda, Juan J; Nam Tham, To; Nahori, Marie-Anne; Bierne, Hélène; Dussurget, Olivier; Pizarro-Cerdá, Javier; Knobeloch, Klaus-Peter; Cossart, Pascale

    2015-01-01

    ISG15 is an interferon-stimulated, linear di-ubiquitin-like protein, with anti-viral activity. The role of ISG15 during bacterial infection remains elusive. We show that ISG15 expression in nonphagocytic cells is dramatically induced upon Listeria infection. Surprisingly this induction can be type I interferon independent and depends on the cytosolic surveillance pathway, which senses bacterial DNA and signals through STING, TBK1, IRF3 and IRF7. Most importantly, we observed that ISG15 expression restricts Listeria infection in vitro and in vivo. We made use of stable isotope labeling in tissue culture (SILAC) to identify ISGylated proteins that could be responsible for the protective effect. Strikingly, infection or overexpression of ISG15 leads to ISGylation of ER and Golgi proteins, which correlates with increased secretion of cytokines known to counteract infection. Together, our data reveal a previously uncharacterized ISG15-dependent restriction of Listeria infection, reinforcing the view that ISG15 is a key component of the innate immune response. DOI: http://dx.doi.org/10.7554/eLife.06848.001 PMID:26259872

  18. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium

    2006-04-01

    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  19. Listeria spp. e listeria monocytogenes na produção de salsichas tipo hot dog

    OpenAIRE

    Cesar, Alessandra Paro Rodrigues; Mesquita, Albenones José de; Prado, Cristiano Sales; Nunes, Iolanda Aparecida; Almeida Filho, Edivaldo Sampaio de

    2011-01-01

    v. 12, n. 2, p.339-352, abr./jun.2011. Listeria monocytogenes está amplamente distribuída no ambiente e tem sido isolada de alimentos associados a surtos de elevada letalidade, representando um risco para a saúde pública. Em alguns países, os produtos prontos para consumo, como embutidos cozidos, entre os quais as salsichas, estão associadas à listeriose humana. Considerando a relevância do tema e a necessidade de dados, analisou-se a ocorrência de Listeria spp. e L. monocytogenes na pr...

  20. Escrituras de la vida cotidiana

    Directory of Open Access Journals (Sweden)

    Federico Baeza

    2012-07-01

    Full Text Available Diversas producciones en las artes visuales y performáticas de la última década, se han puesto como objetivo la constitución de estrategias escriturales,en tanto transcripción y, más precisamente, configuración de experiencias extraídas de la vida de todos los días. Las narraciones alrededor de distintos núcleos del ámbito de la cotidianidad, como la cocina, la conversación o el habitar, entre otros tópicos ya señalados por Michel de Certeau1, aparecen en el centro de estas operaciones que recorren el eje entre la historia reciente como episodio colectivo y la singularidad de las historias de vida volviendo a reivindicar lo personal como político. Dichas operaciones artísticas, que funcionan como ready-mades de experiencias personales, precisan de estrategias de transcripción de las textualidades de la vida cotidiana que incluyen narraciones biográficas, recuerdos, particulares usos de los objetos, entre otras prácticas de las “artes del hacer” cotidiano. Abordaremos estas operaciones escriturarias desde la selección de obras de tres artistas argentinos contemporáneos que inscriben su trabajo en este vasto horizonte de problemáticas cercano a la noción de “espacio biográfico”.2 De la producción de Verónica Gómez nos centraremos fundamentalmente en uno de sus primeros trabajos, Casa Museo (2003-2005, en el que la artista desarrolla diversos procedimientos sobre objetos del recuerdo que parodian lo científico y rememoran juegos infantiles en una institución apócrifa alojada en la casa de sus abuelos. Luego observaremos la obra de Gabriel Baggio cuya producción se centra en la conexión entre historia personal e historia colectiva, en los mecanismos culturales que se ponen en juego al aprender prácticas u oficios de “nuestros mayores”, en el diseño de circuitos de contacto interpersonal y en la observación de las prácticas estéticas de todos los días (cocinar, tejer, habitar. Finalmente nos

  1. Vida cotidiana y trasnformaciones silenciosas

    OpenAIRE

    Godall, Teresa

    2014-01-01

    Este artículo pone en cuestión la concepción clásica de educación cotidiana en educación infantil, basada todavía en actividades colectivas como eje vertebrador de la vida del grupo y especialmente en la enseñanza-aprendizaje de hábitos donde se valora sobre todo que el niño lo haga todo solo en vez de velar especialmente por las necesidades y los intereses individuales, dando valor a la palabra cuidado y a la relación entre adulto y niño o entre adulto y un pequeño grupo de niños y niñas en ...

  2. O consumo na vida digital

    Directory of Open Access Journals (Sweden)

    Iuri Yudi Furukita Baptista

    2016-02-01

    Full Text Available O modelo de consumo não possui as mesmas características sempre: suas relações, motivações, formatos, espaços, interesses e atividades são construções sociais que se modificam atreladas ao cenário econômico, político e tecnológico. O presente trabalho repassa o surgimento da sociedade do consumidor para então conjecturar sobre as propriedades distintivas do consumo na vida digital. O que se defende ao final é que o consumidor já não se restringe ao papel de consumir.

  3. Prebisch y Urquidi: vidas paralelas

    Directory of Open Access Journals (Sweden)

    Joseph Hodara

    2008-01-01

    Full Text Available Este ensayo se propone sugerir “trayectorias paralelas” en la vida y en la obra de Raúl Prebisch y de Víctor L. Urquidi. Argentino el primero y mexicano el segundo, ambos fueron impulsados por una pasión convergente: comprender las razones estructurales del subdesarrollo económico y social latinoamericano y plantear medidas gubernamentales que moderasen los efectos negativos de las circunstancias internas y externas que distorsionan la evolución regional contemporánea. Sin embargo, las disparidades entre ambos fueron considerables. Prebisch fue el caudillo intelectual que, armado con la Comisión Economía para la América Latina (CEPAL, enhebró un nuevo discurso desarrollista que los gobiernos formalmente incorporaron. Tuvo el talento de absorber las ideas de múltiples autores y colaboradores, y, sin darles el debido crédito, formuló un paradigma que presidió desde la década de los cincuenta hasta los ochenta la ponderación de las relaciones entre la “periferia latinoamericana” y el “centro”, eufemismo que señalaba principalmente a Estados Unidos. Urquidi, al contrario, fue un empresario intelectual que gestó El Colegio de México como institución mexicana de altos estudios en múltiples ramas, desde las ciencias sociales a la historia y la literatura. Fue un investigador de amplios horizontes y cultura. Y sus póstumas refl exiones sobre la evolución económica y social de América Latina se caracterizan por un áspero pesimismo. Ambos esperan a un Plutarco que narre con pulcritud las peripecias de sus vidas.

  4. Estilo de vida en gastritis

    Directory of Open Access Journals (Sweden)

    María Paola Yumbay Yallica

    2017-05-01

    Full Text Available Objetivo: Determinar como los estilos de vida inciden en la gastritis de los estudiantes de Segundo Semestre de Enfermería de la Facultad Ciencias de la Salud de la Universidad Técnica de Ambato. Material y métodos: El estudio es no experimental con un diseño descriptivo de corte transversal, se relacionan con las variables involucradas, además es de corta duración en un periodo corto de tiempo, el instrumento utilizado fueron dos encuestas a treinta personas, la primera encuesta sobre la variable independiente refiriéndonos a los estilos de vida con diez preguntas y la segunda encuesta sobre la variable dependiente que es la gastritis con diez preguntas. Resultados: Se obtuvo como resultados que no tienen horarios fijos de alimentación por lo cual producirán o tendrán el riesgo de contraer no solo la gastritis sino también otras patologías que dañaran su organismo y producirán su muerte. Conclusión: La mala nutrición puesto a que es el proceso mediante el cual los seres vivos incorporan, modifican y eliminan sustancias procedentes del exterior, absorbidas durante el proceso digestivo. La gastritis es la inflamación del revestimiento del estómago, puede ser de tipo agudo, de aparición rápida y resolución en pocos días, o de tipo crónico, en cuyo caso puede persistir durante años y producir úlcera péptica. En algunos casos, ésta puede llevar a la formación de úlceras y aumentar el padecer cáncer de estómago.

  5. Pulsiones de Vida y Muerte

    Directory of Open Access Journals (Sweden)

    Guillermo Sánchez Medina

    2001-12-01

    Full Text Available

    Cuando hacemos alusión a las pulsiones o a su energía, lo estamos haciendo a cargas eléctricas y a partículas subatómicas; así mismo nos referimos a "estímulos endógenos y exógenos", "señales", "excitaciones", "deseos", "necesidades", "afectos y emociones", "transmisiones e impulsos", originados
    en los "instintos".
    Conocemos desde la perspectiva del psicoanálisis de Freud (en su trabajo sobre Meta psicología en 1915, cómo el instinto es un concepto limítrofe entre lo mental y lo somático, siendo la representación psíquica del estímulo, originado en el organismo que elige la mente.
    Por lo tanto los instintos no serían sino la organización de "fuerzas" para la vida y la muerte orgánica, que buscan restablecer un orden y estado de interrelación y movimiento con otras fuerzas (cargas opuestas, antimateria y/o antipartículas, que perturban ese funcionamiento o por el contrario, actúan para conservar el equilibrio y orden; he ahí un concepto proveniente o que nos lleva también a la teoría de la complejidad y caos.
    Los instintos (de vida-eros y muerte-tanatos vigilarían el destino de los organismos elementales que sobreviven al individuo total, proporcionándoles un refugio seguro mientras se encuentran indefensos contra los estímulos del mundo externo, y a la vez facilitando su encuentro o nacimiento en la estructura de los nucleótidos del ADN, que son la base biológica del instinto sexual, que preservan la especie y.restablecen un estado previo, el que puede ser la misma involución y la inercia. Todos estos fenómenos no significan que exista una tendencia a la perfección; de aquí que la muerte interna sea también natural como la vida, la que tiene su escape en la ya mencionada supervivencia, defensa y conservación de la especie. De tal forma, la biología no va en contravía de los instintos
    de muerte. "Por su parte al reservorio del instinto de vida le damos, en psicoan

  6. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  7. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

  8. Application of heat in postcook meat chillers reduces Listeria.

    Science.gov (United States)

    Eglezos, Sofroni; Dykes, Gary A

    2011-06-01

    Electrical air-blowing heaters were used to heat and dry out holding chillers used for postcook commercial processed meats in an attempt to control the presence of Listeria. A baseline study of the prevalence of Listeria in holding chillers in seven facilities was undertaken. Listeria was detected in four of the seven chillers, and swab samples showed Listeria prevalence ranging from 7 (7.8%) of 90 to 6 (20%) of 30, depending on the facility. Two of the facilities with established Listeria contamination (A and E) were chosen for further studies. The heating trials consisted of three individual heating interventions at each of the two facilities, with 2 weeks of postintervention sampling after each treatment. The initial Listeria prevalence in chiller A was 19 (10.6%) of 180, and treatment at 37°C for 36 h reduced prevalence to 3 (1.7%) of 180. The initial Listeria prevalence in chiller E was 7 (7.8%) of 90, and treatment at 50°C for 2 h reduced prevalence to 0 of 90. Both reductions were statistically significant at P prevalence of Listeria in chillers.

  9. 21 CFR 866.3355 - Listeria spp. serological reagents.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3355 Listeria spp... from clinical specimens. Additionally, some of these reagents consist of Listeria spp. antisera... clinical specimens. The identification aids in the diagnosis of listeriosis, a disease caused by bacteria...

  10. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    Prof. Ogunji

    Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...

  11. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

  12. Prevalence of food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran.

    Science.gov (United States)

    Akya, A; Najafi, A; Moradi, J; Mohebi, Z; Adabagher, S

    2013-05-01

    Listeria monocytogenes is a human pathogen causing serious diseases. We aimed to determine food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Samples (185 dairy, 187 meat products and 158 ready-to-eat foods such as salads) were randomly collected from markets. After processing, samples were cultured in half-Fraser and Fraser broth followed by cultivation on PALCAM and Oxford media. Confirmatory tests including carbohydrate utilization were performed on isolates to determine species. Bacteria were isolated from 66/530 samples (12.5%). Meat products showed the highest (27.2%) and dairy products the lowest (3.8%) contamination rates. L. innocua was found in 56 (10.6%) samples, but L. monocytogenes was only found in 3 samples (0.6%). The results indicate that the rate of contamination with L. monocytogenes, even for ready-to-eat foods, was low but for other Listeria spp., in particular strains of L. innocua, the rate of contamination was higher, suggesting that more control on food sanitation is required.

  13. An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation

    Directory of Open Access Journals (Sweden)

    Laura Bifulco

    2013-01-01

    Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

  14. Listeria monocytogenes behaviour in presence of non-UV-irradiated titanium dioxide nanoparticles.

    Directory of Open Access Journals (Sweden)

    Maria Grazia Ammendolia

    Full Text Available Listeria monocytogenes is the agent of listeriosis, a food-borne disease. It represents a serious problem for the food industry because of its environmental persistence mainly due to its ability to form biofilm on a variety of surfaces. Microrganisms attached on the surfaces are a potential source of contamination for environment and animals and humans. Titanium dioxide nanoparticles (TiO2 NPs are used in food industry in a variety of products and it was reported that daily exposure to these nanomaterials is very high. Anti-listerial activity of TiO2 NPs was investigated only with UV-irradiated nanomaterials, based on generation of reactive oxigen species (ROS with antibacterial effect after UV exposure. Since both Listeria monocytogenes and TiO2 NPs are veicolated with foods, this study explores the interaction between Listeria monocytogenes and non UV-irradiated TiO2 NPs, with special focus on biofilm formation and intestinal cell interaction. Scanning electron microscopy and quantitative measurements of biofilm mass indicate that NPs influence both production and structural architecture of listerial biofilm. Moreover, TiO2 NPs show to interfere with bacterial interaction to intestinal cells. Increased biofilm production due to TiO2 NPs exposure may favour bacterial survival in environment and its transmission to animal and human hosts.

  15. Listeria Spp. and Listeria Monocytogenes Contamination in Ready-To-Eat Sandwiches Collected from Vending Machines.

    Science.gov (United States)

    Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Scarano, Christian; Piana, Andrea; De Santis, Enrico Pietro Luigi

    2016-04-19

    Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments , such as hospitals and consumed by susceptible people . Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes , more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  16. Listeria spp. and Listeria monocytogenes contamination in ready-to-eat sandwiches collected from vending machines

    Directory of Open Access Journals (Sweden)

    Francesca Cossu

    2016-05-01

    Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  17. Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

    Science.gov (United States)

    Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

    2014-01-01

    L. monocytogenes strains that encompassed 13 serotypes across the various lineages and none of the 30 exclusive organisms, including seven other Listeria species. The product consistency and kit stability studies revealed no statistical differences between the three lots tested or to the term of the shelf life. Finally, the robustness study demonstrated no statistical differences when samples were incubated at 33 ± 2°C or 37 ± 2°C, when enrichment aliquots were 1.3 mL or 1.7 mL, or when the samples were analyzed the same day or five days later. Overall the Atlas Listeria monocytogenes LmG2 Detection Assay is statistically equivalent to or better than the reference methods and is robust to the tested variations.

  18. Ecuación de la vida

    OpenAIRE

    Garcia Nassar, Rodolfo Jose

    2015-01-01

    — Es igual a la lluvia, producto de un día nublado, frío y mal calcado. Un dibujo mal hecho, un guión mal escrito, un retrato mal pintado. — ¿De qué hablas? — La vida. — La vida no es un retrato. — Es lo que quiero que sea. — Es lo que quieres ver de la vida. Ciego a lo que quieres no significa que sea lo que quieres que sea. — Bien. Pues observa. Haré de ella lo que pueda para que sea lo que quiera. — ¿Y si fallas?

  19. Prevalence of Listeria monocytogenes in traditional ice cream, Yazd, IRAN (1394 and compared to other studies in different parts of Iran

    Directory of Open Access Journals (Sweden)

    Negar Hamidian

    2017-07-01

    Full Text Available 1-Mortazavi S, Gods rohani M, Juyande H. milk and dairy products technology. The University Ferdowsi Mashhad; 1996. p. 266. 2-Azadnia P, Ghasemi M, Abbasi M, Taarof N, Jashni M. Microbial Quality of Traditional Ice Cream Produced by Small-Scale Manufacturers in Khormoj and Its Comparison with the Iranian National Standard. Journal of Animal and Veterinary Advances 2011;10(6:742-4. 3- Ziabari Mirnezami H. What do you know about milk (Milk chemical technology: Tehran University; 1996. 4-Movassagh MH, Movassagh A, Mahmoodi H, Servatkhah F, Sourorbakhsh MR. Microbiological contamination of the traditional chocolate Ice cream sold in the Northwest Region of Iran. Global Veterinaria 2011;6(3:269-71. 5-Karim G, Razavilar V, Akhonndzade A. survey contamination of traditional ice cream to bacteria causing the infection and food poisoning[persian]. Tehran University Faculty of Veterinary 1374;50:71-8. 6-Kanbakan U, Con A, Ayar A. Determination of microbiological contamination sources during ice cream production in Denizli, Turkey. Food Control 2004;15(6:463-70. 7- Fallah AA, Saei-Dehkordi SS, Rahnama M, Tahmasby H, Mahzounieh M. Prevalence and antimicrobial resistance patterns of  Listeria  species isolated from poultry products marketed in Iran. Food Control 2012;28(2:327-32. 8-Farber J, Peterkin P. Listeria monocytogenes, a food-borne pathogen. Microbiological reviews 1991;55(3:476. 9-Navratilova P, Schlegelova J, Sustackova A, Napravnikova E, Lukasova J, Klimova E. Prevalence of Listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. Veterinarni Medicina-UZPI 2004;49. 10-Williams SK, Roof S, Boyle EA, Burson D, Thippareddi H, Geornaras I, et al. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants. J Food Prot 2011;74(1:63-77. 11-Halter E, Neuhaus K, Scherer S. Listeria weihenstephanensis sp. nov

  20. Qualidade de vida de graduandos de enfermagem

    Directory of Open Access Journals (Sweden)

    Beatriz Marques de Oliveira

    2011-02-01

    Full Text Available O presente estudo objetivou descrever o perfil sociodemográfico dos estudantes de enfermagem e compreender o significado atribuído para sua atual qualidade de vida. Foram entrevistados 65 acadêmicos do 8º semestre do ano de 2007, por meio da aplicação de questionário autoreferido, com informações de dados sociodemográficos e questões abertas sobre qualidade de vida. A população de estudo foi predominantemente do sexo feminino, solteira, com idade entre 22 a 24 anos e com diferentes percepções sobre sua qualidade de vida, apreendidas por meio da vivência de fatores favoráveis e desfavoráveis no decorrer dos anos de aprendizado. O estudo destacou a percepção da qualidade de vida sob a ótica do estudante de enfermagem

  1. Qualidade de vida de graduandos de enfermagem

    Directory of Open Access Journals (Sweden)

    Beatriz Marques de Oliveira

    Full Text Available O presente estudo objetivou descrever o perfil sociodemográfico dos estudantes de enfermagem e compreender o significado atribuído para sua atual qualidade de vida. Foram entrevistados 65 acadêmicos do 8º semestre do ano de 2007, por meio da aplicação de questionário autoreferido, com informações de dados sociodemográficos e questões abertas sobre qualidade de vida. A população de estudo foi predominantemente do sexo feminino, solteira, com idade entre 22 a 24 anos e com diferentes percepções sobre sua qualidade de vida, apreendidas por meio da vivência de fatores favoráveis e desfavoráveis no decorrer dos anos de aprendizado. O estudo destacou a percepção da qualidade de vida sob a ótica do estudante de enfermagem

  2. La vida y la flecha del tiempo

    Directory of Open Access Journals (Sweden)

    Jaksel Nájera Mota

    2014-01-01

    Full Text Available La vida y la flecha del tiempo se fundamentan en una interrelación entre orden-desorden, muerte-vida, acumulación-pérdida que permite transformaciones y disipaciones en la estructura orgánica. Por lo anterior, se analizan algunos procesos metabólicos y de regeneración celular. Se demuestra que a pesar de los esfuerzos por retrasar el desgaste del organismo, la vida se mantiene dirigida a la degradación; sin embargo, es posible minimizar algunos problemas causados por el envejecimiento manteniendo una vida más saludable, con ejercicio y buena alimentación.

  3. Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

    Science.gov (United States)

    Miettinen, Hanna; Wirtanen, Gun

    2005-10-15

    A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

  4. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-09-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. [Prevalence of emerging foodborne pathogens and illness: Campylobacter and Listeria].

    Science.gov (United States)

    Ferriero, Anna Maria; Damiani, Gianfranco; Neve, Caterina Bianca; Bianchi, Aurora; Ronconi, Alessandra; Laurenti, Patrizia

    2011-01-01

    This study evaluated the proportion of food samples, examined by the Italian Istituti Zooprofilattici Sperimentali (Experimental Zooprophylactic Institutes) in the years 2000-2005, positive for Campylobacter and Listeria. A correlation was found between food samples found positive for Listeria in the years 2002-2005 and the number of hospitalisations for Listeria illness in the same years (as reported in hospital discharge abstract forms). This confirms that attention should be given in the evaluation of phenomena known to be under reported and for which data are collected and analysed by different methods.

  6. Cuidar la vida, objetivo fundamental

    Directory of Open Access Journals (Sweden)

    Marina Subirats Martori

    2015-04-01

    Full Text Available A instancias de Podemos dos autoras, María Pazos y Bibiana Medialdea, han elaborado un documento “Reorganizar la sociedad de cuidados: condición necesaria para la recuperación económica y el avance democrático,” que propone un conjunto de medidas políticas para resolver una cuestión que hoy, en España, está pendiente. La incorporación de las mujeres al mercado de trabajo en los últimos cuarenta años ha supuesto una imposibilidad real de atender debidamente las tareas del cuidado, y ello ha repercutido en una doble carga para las mujeres, al no haber asumido los hombres la mitad del trabajo anteriormente considerado femenino, y en una deficiencia del cuidado en las etapas en que somos dependientes. Las autoras proponen un conjunto de medidas –jornada de 35 horas semanales, servicio universal de guarderías gratuitas, servicios para la autonomía de cada persona durante toda su vida- que constituyen una base sólida para iniciar los cambios necesarios, y, por otra parte, muestran la contribución que tales medidas podrían suponer para resolver problemas económicos, medioambientales  Hay que felicitar a Podemos por esta iniciativa, esperar que la incluya en su programa y que, si llega a gobernar, ponga en marcha tales políticas de manera rotunda y eficaz.

  7. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  8. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  9. Epidemiologia molecular de Listeria monocytogenes isoladas de diferentes fontes no Brasil

    Directory of Open Access Journals (Sweden)

    Andrea Micke Moreno

    2013-04-01

    Full Text Available Listeria monocytogenes é um importante patógeno de origem alimentar que afeta principalmente grávidas, neonatos, idosos e indivíduos imunocomprometidos, e pode causar abortamento, septicemia e meningite. Dos 13 grupos capsulares descritos, os sorotipos 4b, 1/2b e 1/2a são os mais relacionados à infecção humana. Por esta razão, a sorotipagem possui valor limitado como ferramenta epidemiológica e, dessa forma, métodos mais discriminatórios são necessários para melhorar o conhecimento sobre a contaminação e a infecção por L. monocytogenes. O objetivo deste estudo foi caracterizar a diversidade genética de isolados de L. monocytogenes da indústria de processamento de carne suína no Estado de São Paulo, Brasil, e compará-los a isolados de casos de infecção humana através do ERIC-PCR e AFLP com uma única enzima. Os sorotipos 1/2c e 4b foram frequentes em carne suína e ambientes de abatedouros e mercados, enquanto os sorotipos 4b e 1/2a foram observados nos isolados de humanos. ERIC-PCR e AFLP resultaram em 34 e 31 perfis distintos, respectivamente, com uma tendência a separar de acordo com o sorogrupo e a origem do isolado. Os perfis genéticos de ambiente dos abatedouros e mercados sugerem a possibilidade de diferentes origens de contaminação por Listeria nos ambientes estudados, porém, em alguns casos, é possível que ocorra a persistência de cepas clonais causando contaminação contínua.

  10. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

    Science.gov (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

    2013-04-01

    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  11. Incidence and pathogenicity profile of Listeria sp. isolated from food ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in the brain, adrenal glands, spleen, kidney, lungs and the gastrointestinal ..... Cryptogenic liver abscess due to Listeria monocytogenes. .... of foods in sporadic listeriosis I. Case – control study of dietry risk factors. J. Am. Med.

  12. Stalling autophagy: a new function for Listeria phospholipases

    Directory of Open Access Journals (Sweden)

    Ivan Tattoli

    2014-01-01

    Full Text Available Listeria monocytogenes is a Gram-positive bacterial pathogen that induces its own uptake in non-phagocytic cells. Following invasion, Listeria escapes from the entry vacuole through the secretion of a pore-forming toxin, listeriolysin O (LLO that acts to damage and disrupt the vacuole membrane. Listeria then replicates in the cytosol and is able to spread from cell-to-cell using actin-based motility. In addition to LLO, Listeria produces two phospholipase toxins, a phosphatidylinositol-specific phospholipase C (PI-PLC, encoded by plcB and a broad-range phospholipase C (PC-PLC, encoded by plcA, which contribute to bacterial virulence. It has long been recognized that secretion of PI- and PC-PLC enables the disruption of the double membrane vacuole during cell-to-cell spread, and those phospholipases have also been shown to augment LLO-dependent escape from the entry endosome. However, a specific role for Listeria phospholipases during the cytosolic stage of infection has not been previously reported. In a recent study, we demonstrated that Listeria PI-PLC and PC-PLC contribute to the bacterial escape from autophagy through a mechanism that involves direct inhibition of the autophagic flux in the infected cells [Tattoli et al. EMBO J (2013, 32, 3066-3078].

  13. OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence

    Directory of Open Access Journals (Sweden)

    Andrzej Prokop

    2017-10-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.

  14. Stress Distribution, Friction and Listeria Propulsion

    Science.gov (United States)

    Prost, Jacques

    2003-03-01

    I will review our work on the physics of listeria propulsion based on an unavoidable elastic analysis of the stress distribution in the actin gel and dynamical boundary conditions (both normal and tangential). I will show in particular that it provides a natural explanation for the symmetry breaking transition occurring with beads (work with K. Sekimoto and F. Julicher), of the saltatory behavior of beads reported by A Bernheim et al (Nature 2002) and of the shape of soft beads (with O. Campas and J.F Joanny). This last analysis proves that, as announced in an earlier paper (F; Gerbal et al Biophys Journal 2000) the rear part of the gel contributes negatively to the motion.

  15. Sensitivity of Listeria monocytogenes to irradiation

    International Nuclear Information System (INIS)

    Tarjan, Veronika

    1990-01-01

    Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

  16. Cloning and Expression of Listeria monocytogenes Listeriolysin O in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Masoumeh Hayati

    2017-11-01

    Full Text Available Background: The protein listeriolysin O (LLO encoded by hly gene, is one of the most important virulence factors of Listeria monocytogenes. This highly potent immunogenic cholesterol binding toxin has hemolytic activity, responsible for phagosomal membrane disruption and bacterial escape to the cytoplasm and facilitating the stimulation of CD8+ T cells and Th1 response. Recently pathobiotechnological vaccination using probiotic bacteria have been proposed. One of these strategies is expression of LLO in non-pathogenic bacteria such as lactic acid bacteria as delivery strains. Objectives: Our aim in this study was cloning of hly gene in a Lactobacillus species via pNZ8110, an inducible expression vector which is specific for Lactococcus species. Materials and Methods: hly gene was amplified by PCR and cloned into pNZ8110 by restriction enzymes cutting and ligation method. After transformation and propagation in E. coli MC1061 intermediate host, it was successfully electrotransformed into Lactobacillus plantarum. Results: Gel electrophoresis of colony PCR, extracted plasmids and restriction analysis along with sequencing confirmed the transformation. After induction using supernatant of nisin producer Lactococcus lactis NZ9700 strain, Expression of LLO was confirmed by SDS PAGE and western blot. Conclusion: Here, we have employed a nonpathogenic probiotic strain; Lactobacillus plantarum for the first time to express hly gene of Listeria monocytogenes in order to propose a new vaccine candidate.

  17. A portable cell-based optical detection device for rapid detection of Listeria and Bacillus toxins

    Science.gov (United States)

    Banerjee, Pratik; Banada, Padmapriya P.; Rickus, Jenna L.; Morgan, Mark T.; Bhunia, Arun K.

    2005-11-01

    A mammalian cell-based optical biosensor was built to detect pathogenic Listeria and Bacillus species. This sensor measures the ability of the pathogens to infect and induce cytotoxicity on hybrid lymphocyte cell line (Ped-2E9) resulting in the release of alkaline phosphatase (ALP) that can be detected optically using a portable spectrophotometer. The Ped-2E9 cells were encapsulated in collagen gel matrices and grown in 48-well plates or in specially designed filtration tube units. Toxin preparations or bacterial cells were introduced and ALP release was assayed after 3-5 h. Pathogenic L. monocytogenes strains or the listeriolysin toxins preparation showed cytotoxicity ranging from 55% - 92%. Toxin preparations (~20 μg/ml) from B. cereus strains showed 24 - 98% cytotoxicity. In contrast, a non-pathogenic L. innocua (F4247) and a B. substilis induced only 2% and 8% cytotoxicity, respectively. This cell-based detection device demonstrates its ability to detect the presence of pathogenic Listeria and Bacillus species and can potentially be used onsite for food safety or in biosecurity application.

  18. DETECTION AND CHARACTERISATION OF LISTERIA ISOLATES COLLECTED ALONG THE GORGONZOLA PDO PRODUCTION CHAIN

    Directory of Open Access Journals (Sweden)

    D. Nucera

    2011-08-01

    Full Text Available Considering that Listeria monocytogenes represents a concern in the production of Gorgonzola PDO cheese, this study was aimed to investigate the presence of Listeria along one Gorgonzola PDO production chain. L. monocytogenes subtype diversity was also investigated in order to identify possible reservoirs and dissemination routes. One dairy plant and its conferring farms (N=20 were selected and samples were collected in 4 visits in order to investigate seasonal variability. In each of them, producer tank milk (N=80, Gorgonzola producer tanks (N=12, Gorgonzola producer environmental samples (N=108 were collected, for a total of 200 samples. L. innocua was isolated from 3 milk samples (4%; L. monocytogenes alone was detected in 3 environmental samples (16% and L. innocua in 11 (58%. Both species were present in 5 samples. All Listeria strains isolated were typed through ERIC and REP PCRs. For each samples, if possible 5 colonies were selected for typing, for a total of 76 isolates. The analyses allowed the differentiation of L. monocytogenes and L. innocua in 9 and 7 PCR profiles (P, respectively. The former showed an overall similarity value of 75% and the latter of 81%. P1 (N=3 of L. monocytogenes was present in multiple sources (ripening surfaces and salting equipment and P5 (N=6 in different sampling rounds (January and June 2009. P1 (N=25 and P2 (N=15 of L. innocua were found in multiple sources (performing equipment, ripening surfaces, salting equipment, moving carts and in multiple sample rounds (P1: May 2008, January and June 2009; P2: June and October 2009. The presence of a few highly similar strains of L. monocytogenes in the production chain, as suggested by the profiles retrieved from different sources/sampling rounds, indicates the presence of persistent and niche-adapted strains. However, no profile was shared between raw milk and environmental samples, suggesting that the plant environment, not the incoming raw milk, is the source

  19. Hablemos del derecho a la vida

    Directory of Open Access Journals (Sweden)

    Hernán Olano García

    2016-12-01

    Full Text Available Con el objetivo de resaltar el valor del derecho fundamental dentro de los derechos fundamentales, de acuerdo con la Constitución Política de Colombia (y a otras constituciones y, dentro de su línea de investigación en historia de las instituciones-I, el autor realiza algunas reflexiones acerca del derecho a la vida, siguiendo una metodología deductiva, de acuerdo con los aspectos más importantes que tanto la doctrina, como la jurisprudencia le han aportado para estructurar el artículo en varios acápites como: (i su carácter sagrado, (ii ¿Un derecho a la muerte?, (iii la dignidad ontológica de la vida y (iv el día de la vida, que reconoce la protección de este derecho de toda persona, como fundamento y fin de todo el orden social justo. La conclusión principal a la que se llega es el valor sagrado y jurídico de la vida humana, dotada de trascendencia en el ordenamiento positivo por su origen natural.  

  20. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  1. Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states.

    Science.gov (United States)

    Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F

    2014-11-01

    Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

  2. DNA fingerprinting by ERIC-PCR for comparing Listeria spp. strains isolated from different sources in San Luis: Argentina Caracterización molecular por ERIC-PCR de cepas de Listeria spp. aisladas de diversos orígenes en San Luis: Argentina

    Directory of Open Access Journals (Sweden)

    A. Laciar

    2006-04-01

    Full Text Available In this study, a total of 24 Listeria spp. strains were analyzed. Twenty-two isolates were obtained in San Luis (Argentina from human, animal, and food samples. Two types of strains, Listeria monocytogenes CLIP 22762 and Listeria innocua CLIP 74915, were included as reference strains. All isolates were biochemically identified and characterized by serotyping, phage typing, and amplification of the flaA gene by polymerase chain reaction (PCR. Repetitive intergenic consensus (ERIC sequence-based PCR was used to generate DNA fingerprints. On the basis of ERIC-PCR fingerprints, Listeria spp. strains were divided into three major clusters matching origin of isolation. ERIC-PCR fingerprints of human and animal isolates were different from those of food isolates. In addition, groups I and II included ten L. monocytogenes strains, and only one Listeria seeligeri strain. Group III included nine L. innocua strains and four L. monocytogenes strains. Computer evaluation of ERIC-PCR fingerprints allowed discrimination between the tested serotypes 1/2b, 4b, 6a, and 6b within each major cluster. The index of discrimination calculated was 0.94. This study suggests that the ERIC-PCR technique provides an alternative method for the identification of Listeria species and the discrimination of strains within one species.En este estudio se analizaron 24 cepas de Listeria spp. De ellas, 22 fueron obtenidas en San Luis (Argentina, a partir de muestras humanas, de animales y alimentos. Se incluyeron 2 cepas de referencia Listeria monocytogenes CLIP 22762 y Listeria innocua CLIP 74915. Todos los aislamientos fueron identificados bioquímicamente y caracterizados por serotipificación, fagotipificación y detección del gen flaA por reacción en cadena de la polimerasa (PCR. Se generaron perfiles de bandas de ADN mediante la amplificación de secuencias repetitivas de consenso intergénico de enterobacterias (ERIC-PCR. De acuerdo a los resultados obtenidos por ERIC

  3. Calidad de vida y felicidad: no es exactamento lo mismo

    NARCIS (Netherlands)

    R. Veenhoven (Ruut)

    2001-01-01

    textabstractLa " Calidad de vida" se concibe como un amplio concepto que abarca tres significados: 1) Calidad del entorno en que vivimos; 2) Calidad de acción y 3) Disfrute subjetivo de la vida. La " Felicidad " se incluye en este último significado. Se define como la apreciación completa de la vida

  4. Specific biological properties of Listeria innocua spp. isolated in Primorye Territory

    Directory of Open Access Journals (Sweden)

    E. A. Zaitseva

    2017-01-01

    Full Text Available Rationale: Most cases of listeriosis are caused by the pathogenic Listeria monocytogenes. Some cases of isolation of L.  innocua with pathogenicity factors from foods have been published, as well as on the cases of the disease in humans caused by this species. Aim: To assess biological properties including potential pathogenicity of L.  innocua, isolated from food and environmental objects. Materials and methods: We performed microbiological study of L. innocua cultures isolated from foods (n = 35 and environmental objects (n = 15 on the territory of Primorye Territory (Russian Federation, as well as assessment of their sensitivity to antibiotics. Results: The studied L.  innocua cultures showed stable phenotypic features of their biological properties, such as morphology, typical colony growth on the medium with characteristic odor of fermented milk, blue or blue-green luminescence induced by inclined light, presence of catalase activity and absence of the oxidase activity. Only 38 ± 6.9% of L.  innocua demonstrated movements at T 22 °С. L.  innocua cultures did not ferment mannitol (100% of cultures; they degraded ramnose to its acid without gas (70 ± 6.5% and degraded xylose (42.8 ± 7%. Listeria isolated from vegetables and environmental objects could ferment ramnose (92.8 ± 7.2% of the studied cultures and xylose (28.5 ± 12.5% more frequently than L. innocua isolated from meat and fish foods. L.  innocua demonstrated variable biochemical activities towards mannose (92 ± 3.8%, saccharose (85.7 ± 7.8% and melesitose (76.2 ± 9.5%. L. innocua cultures with hemolytic activity (34 ± 6.7% (α or β  type were isolated, more commonly from fish products. All Listeria irrespective of their isolation source showed lipase activity. L.  innocua cultures from foods and environmental objects were highly sensitive to antimicrobials from the following classes: penicillins (ampicillin, carbenicillin, combined amoxicillin and clavulanic

  5. Inactivation of Salmonella and Listeria in ground chicken breast meat during thermal processing.

    Science.gov (United States)

    Murphy, R Y; Marks, B P; Johnson, E R; Johnson, M G

    1999-09-01

    Thermal inactivation of six Salmonella spp. and Listeria innocua was evaluated in ground chicken breast and liquid medium. Survival of Salmonella and Listeria was affected by the medium composition. Under the same thermal process condition, significantly more Salmonella and Listeria survived in chicken breast meat than in 0.1% peptone-agar solution. The thermal lethality of six tested Salmonella spp. was additive in chicken meat. Survival of Listeria in chicken meat during thermal processing was not affected by the presence of the six Salmonella spp. Sample size and shape affected the inactivation of Salmonella and Listeria in chicken meat during thermal processing.

  6. Green fluorescent protein labeling of Listeria, Salmonella, and Escherichia coli O157:H7 for safety-related studies.

    Directory of Open Access Journals (Sweden)

    Li Ma

    Full Text Available Many food safety-related studies require tracking of introduced foodborne pathogens to monitor their fate in complex environments. The green fluorescent protein (GFP gene (gfp provides an easily detectable phenotype so has been used to label many microorganisms for ecological studies. The objectives of this study were to label major foodborne pathogens and related bacteria, including Listeria monocytogenes, Listeria innocua, Salmonella, and Escherichia coli O157:H7 strains, with GFP and characterize the labeled strains for stability of the GFP plasmid and the plasmid's effect on bacterial growth. GFP plasmids were introduced into these strains by a CaCl(2 procedure, conjugation or electroporation. Stability of the label was determined through sequential propagation of labeled strains in the absence of selective pressure, and rates of plasmid-loss were calculated. Stability of the GFP plasmid varied among the labeled species and strains, with the most stable GFP label observed in E. coli O157:H7. When grown in nonselective media for two consecutive subcultures (ca. 20 generations, the rates of plasmid loss among labeled E. coli O157:H7, Salmonella and Listeria strains ranged from 0%-30%, 15.8%-99.9% and 8.1%-93.4%, respectively. Complete loss (>99.99% of the plasmid occurred in some labeled strains after five consecutive subcultures in the absence of selective pressure, whereas it remained stable in others. The GFP plasmid had an insignificant effect on growth of most labeled strains. E. coli O157:H7, Salmonella and Listeria strains can be effectively labeled with the GFP plasmid which can be stable in some isolates for many generations without adversely affecting growth rates.

  7. Rapid detection of Listeria monocytogenes in raw milk and soft cheese by a redox potential measurement based method combined with real-time PCR.

    Science.gov (United States)

    Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter

    2014-09-01

    The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.

  8. The search of Listeria and Salmonella in different food matrices

    International Nuclear Information System (INIS)

    Ben Saad, Emna

    2010-01-01

    The foods safety and security does not cease to be a priority. Although foods contaminants generate changes in the sensory characteristics, they may cause diseases and pose a risk to human health. This study includes a targeted search of two food borne pathogens Listeria and Salmonella responsible respectively of two serious infections listeriosis and salmonellosis. 100 Food samples taken from the market for public consumption are analyzed in the CNSTN laboratory of microbiology and molecular biology. Once isolated (eight strains of Listeria and one of Salmonella), the strains were identified by Api (Listeria and 20E) and PCR. The results obtained show the ability of our products to be contaminated which arise the importance of strengthening measures of prevention and health control.

  9. Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

    DEFF Research Database (Denmark)

    Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

    2017-01-01

    dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

  10. COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    G. Tantillo

    2013-02-01

    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  11. [Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

    Science.gov (United States)

    Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

    2008-03-01

    To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

  12. Efeito da estratégia de vida sobre as variações no conteúdo de energia de duas espécies de peixes (Brycon hilarii e Hypophthalmus edentatus, durante o ciclo reprodutivo = Effect of life strategy on the variations of energy content of two fish species (Brycon hilarii e Hypophthalmus edentatus during their reproductive cycle

    Directory of Open Access Journals (Sweden)

    Vanessa Monteiro

    2007-04-01

    Full Text Available Com o objetivo de investigar diferenças no conteúdo de energia durante o ciclo reprodutivo, foram selecionados 54 exemplares de Brycon hilarii (k-estrategista e 82 de Hypophthalmus edentatus (r-estrategista em amostragens realizadas mensalmente, entreoutubro de 2000 e março de 2004, no reservatório de Manso, Estado do Mato Grosso do Norte e em sua área de influência. Determinou-se, para cada indivíduo, o conteúdo calórico, em kcal g-1 de peso seco, com auxílio da bomba calorimétrica (Parr 1261 e, realizaram-se comparações entre os valores calóricos obtidos, o fator de condição (K e a relação gonadossomática. Observou-se que, em geral, os valores médios de K e do conteúdo calórico foram superiores nos machos das duas espécies analisadas, embora não tenham sidoidentificadas diferenças significativas entre os sexos. Constatou-se que os valores calóricos de H. edentatus foram superiores aos de B. hilarii, enquanto os valores do fator de condição foram contrários, apresentando-se superiores para B. hilarii. Diferenças significativas foram constatadas nas comparações realizadas entre o conteúdo energético e o fator de condição, de indivíduos de ambas as espécies. Enquanto B. hilarii apresentou as mais elevadas concentrações de energia nos músculos, durante o máximo desenvolvimento gonadal, emH. edentatus, isso ocorreu quando iniciava o processo de maturação gonadal. Os resultados descritos para cada espécie durante o ciclo reprodutivo permitem confirmar a hipótese de que as duas espécies de peixes, B. hilarii e H. edentatus, com diferentes estratégias de vida,acumulam e mobilizam energia de forma distinta durante o período de maturação gonadal.The aim of this work was to investigate differences in the energy content during reproductive cycle of two species of fish with different life strategies: Brycon hilarii (k-strategist and Hypophthalmus edentatus (r-strategist. Fifty-four samples of B. hilarii

  13. [A Listeria breast abscess in a man].

    Science.gov (United States)

    Marsaudon, E; Berthy, J; Mamoune, S; Deniel, A; Ksiyer, S; Tiuca, D

    2018-03-01

    Listeriosis is a food-borne illness leading to bacteriemia or central nervous system infection especially in pregnant women or high-risk patients. It is rarely a localized infection. Breast contamination has rarely been reported in lactating women. We report a breast abscess in man. A 80 year old man, hypertensive and arrhythmic, was explored for weakness and dehydration. Type 2 diabetes and chronic lymphocytic leukemia were diagnosed. Clinical examination disclosed a breast abcess related to L monocytogenes infection. Histopathological study also revealed a breast subcutaneous infiltration by chronic lymphocytic leukemia. Listeriosis sometimes uncover an unknown immunosuppression, especially in the elderly. Breast is a non-sterile tissue containing a stable microbiome partly from digestive origin. It can thereby be contaminated by Listeria. The specific cutaneous infiltrate of chronic lymphocytic leukemia can create the conditions for a local infection. Copyright © 2017 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  14. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba

    2016-04-01

    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  15. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  16. Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.

    Science.gov (United States)

    Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo

    2014-12-01

    This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.

  17. Generation of airborne Listeria innocua from model floor drains.

    Science.gov (United States)

    Berrang, Mark E; Frank, Joseph F

    2012-07-01

    Listeria monocytogenes can colonize floor drains in poultry processing and further processing facilities, remaining present even after cleaning and disinfection. Therefore, during wash down, workers exercise caution to avoid spraying hoses directly into drains in an effort to prevent the escape and transfer of drain microflora to food contact surfaces. The objective of this study was to examine the extent to which an inadvertent water spray into a colonized floor drain can cause the spread of airborne Listeria. Listeria innocua was used to inoculate a polyvinyl chloride model floor drain, resulting in approximately 10(8) cells per ml of phosphate-buffered saline and 10(4) attached cells per square centimeter of inner surface. Each model drain was subjected to a 2-s spray of tap water at 68.9 kPa from a distance of 1 m. Drains were sprayed while filled and again after emptying. Airborne cells were collected by using sedimentation plates containing Listeria selective agar which were placed on the floor and walls of a contained room at incremental horizontal and vertical distances of 0.6, 1.2, 2.4, or 4.0 m from the drain. Sedimentation plates were exposed for 10 min. A mechanical sampler was used to also collect air by impaction on the surface of Listeria selective agar to determine the number of cells per liter of air. The experiment was conducted in triplicate rooms for each of four replications. L. innocua was detected on sedimentation plates on the floor as far as 4.0 m from the drain and on walls as high as 2.4 m above the floor and 4 m from the drain. A 2-s spray with a water hose into a contaminated drain can cause airborne spread of Listeria, resulting in the potential for cross-contamination of food contact surfaces, equipment, and exposed product.

  18. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  19. Thermal resistance of Listeria monocytogenes in sausage meat.

    Science.gov (United States)

    Farber, J M; Hughes, A; Holley, R; Brown, B

    1989-01-01

    The heat resistance of a mixture of 10 different strains of Listeria monocytogenes inoculated into ground meat and ground meat plus cure was examined. D-values for ground meat ranged from 1.01 min at 62 degrees C to 13.18 min at 56 degrees C. The D-values obtained for ground meat plus cure were approximately 5-8 fold times higher than those for ground meat alone. These results imply that rare meats and possibly some cooked fermented meats may not be heated adequately to inactivate Listeria.

  20. [Listeria monocytogenes nosocomial infection in the maternity ward].

    Science.gov (United States)

    Jean, D; Croize, J; Hirtz, P; Legeais, C; Pelloux, I; Favier, M; Mallaret, M R; Le Noc, P; Rambaud, P

    1991-01-01

    Nosocomial infection with Listeria monocytogenes 4b occurred in January 1990 in a maternity hospital in Grenoble. The 3 patients involved were born within a 24 hour-interval. The premature newborn responsible for contamination was asymptomatic. Two other newborns without any perinatal infectious risk presented with meningitis, one on the 5th day of life in the maternity hospital, the other one on the 11th day while already at home. The 3 strains of Listeria had the same serovar and lysovar. Epidemiologic investigations led to suspect a contamination in the delivery room and during the care of the children. Strict respect of hygiene orders is imperative to avoid nosocomial infections.

  1. Herbert Marcuse: la vida y la muerte

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Hernández

    1979-01-01

    Full Text Available Una clave inicial con la que se puede recorrer a vuelo de pájaro -corno lo exige la limitación de una reseña-la obra de Herbert Marcuse es una valoración, instalada en el fundamento de su reflexión, según la cual la finalidad es la vida del hombre" ... es decir, la felicidad". Su teoría crítica eleva al nivel universalizante el objetivo que los individuos buscan en la vida corriente y han buscado siempre: la felicidad. En ese nivel ha de responderse por la riqueza del género, por el bien de la especie.

  2. Calidad de vida de los cuidadores familiares

    Directory of Open Access Journals (Sweden)

    Clara Inés Giraldo Molina

    2006-01-01

    Full Text Available El objetivo de esta investigación es describir, desde la perspectiva etnográfica, cómo podría estar afectada la calidad de vida de los cuidadores familiares de adultos mayores con dependencia funcional, como consecuencia del desempeño del rol de cuidador, y según su percepción. Se trata de un estudio cualitativo etnográfico, con apoyo en la etnografía enfocada, en 14 cuidadoras familiares de adultos mayores de 65 años, con más de seis meses a su cuidado, en el municipio de Envigado, Colombia, en 2002, y una muestra de quince entrevistas en profundidad. El análisis de las entrevistas identificó siete grandes temas o categorías con las percepciones de las cuidadoras sobre su rol y los efectos de éste en su calidad de vida: significado de calidad de vida, percepción de la cuidadora sobre el rol de cuidadora, consecuencias del rol sobre su salud física y mental, relaciones cuidadora y persona cuidada, conocimientos y aprendizajes sobre el cuidado de las personas, apoyos que recibe la cuidadora para el cuidado, y la invisibilidad del trabajo de las cuidadoras. Las categorías que emergieron coinciden con las de otros estudios; se hace énfasis en la categoría "la invisibilidad del trabajo de la cuidadora familiar", en tanto es la menos documentada en la literatura, y en la importancia del acercamiento a los valores y las tradiciones de grupos para la interpretación de las respuestas de su vida social.

  3. SUEÑO Y CALIDAD DE VIDA

    Directory of Open Access Journals (Sweden)

    Gualberto Buela-Casal

    2005-06-01

    Full Text Available Existe una estrecha interrelación entre los procesos de sueño y el estado general de salud física y psicológica de una persona. En el presente artículo se revisan algunas de las principales líneas de investigación que abordan las relaciones entre el sueño y la calidad de vida. Se analiza la influencia de los diferentes patrones de sueño (patrón de sueño corto, intermedio y largo y de la calidad del sueño (sueño eficiente/no eficiente en la salud y la calidad de vida. Se examinan las consecuencias sobre la salud de ciertos cambios en el sueño que son muy frecuentes en nuestro actual estilo de vida, tales como la privación de sueño o el trabajar en un sistema de turnos rotatorios o de trabajo nocturno, y de algunos de los trastornos del sueño más importantes como el insomnio o la apnea. El sueño es sin duda un excelente indicador del estado de salud de las personas tanto en muestras clínicas como en la población general. El desarrollo de estrategias preventivas y de intervención que reduzcan las alteraciones del sueño redundará en una mejor calidad de vida.

  4. Qualidade de vida de adolescentes modelos profissionais

    Directory of Open Access Journals (Sweden)

    Luciana Pires

    Full Text Available Muitas adolescentes deixam suas famílias para seguir a profissão de modelo, sonhando com um futuro glamoroso. O presente estudo caso-controle analisou a qualidade de vida de 74 adolescentes do sexo feminino, sendo 37 modelos, agenciadas em São Paulo, com delineamento transversal, utilizando o World Health Organization Quality of Life - versão breve (WHOQOL-BREF, que avalia qualidade de vida global e os domínios físico, psicológico, social e ambiental. Utilizou-se o Critério Brasil 2008, para avaliação do nível socioeconômico e para parear o grupo controle. Em geral, o grupo de modelos obteve médias superiores ao grupo de não modelos, sendo esta diferença significante apenas no domínio psicológico. Observou-se que as adolescentes modelos apresentaram uma qualidade de vida semelhante à das não modelos.

  5. Listeria spp. occurrence in equipments and processing plants of meat/ Listeria spp. ocorrência em equipamentos e ambientes de processamento de carne bovina

    Directory of Open Access Journals (Sweden)

    Luís Augusto Nero

    2004-05-01

    Full Text Available Exopolysaccharides, biopolymers or hydrosolubles gums, are produced by a great variety of microorganisms and possess physical, structural and chemical properties quite homogeneous, in relation to derived from algae and plants. The production is relatively independent on climatic conditions, faster obtaining of the finished product and need small space. Biopolymers have been studied thoroughly in the last years. Due to wide diversity in structure and physical properties, the microbial polysaccharides possess a lot of applications in food, pharmaceutical, oil, cosmetics, textile, inks and agricultural products among others industries. Some of those applications, include uses as emulsifying, stabilizing, binding, jellifying, clotting, lubricants, film coated, thickening and suspender agents. The parameters that have most influenced the process of exopolysaccharides biosyntheses have been the microorganism, the culture medium composition, pH and temperature of incubation. The exopolysaccharide production can be developed by species of Gram-negative and Gram-positive bacteria, some microalgae and many moulds. This work discusses the influence of these parameters during the production process and exopolysaccharides biosyntheses by bacteria.O objetivo desta pesquisa foi estabelecer a ocorrência de Listeria monocytogenes em diversos pontos de plantas de processamento de carne bovina em 01 abatedouro e 05 casas de carnes localizados na região norte do Paraná. Para a detecção de Listeria spp. em 124 amostras de equipamentos/utensílios e instalações, utilizou-se a metodologia preconizada pelo United States Departament of Agriculture (USDA, com identificação das espécies por testes bioquímicos e posterior confirmação pelo API Listeria (bioMérieux. Os resultados obtidos indicaram freqüências de 6,25% de L. monocytogenes; 68,75% de L. innocua; 18,75% de L. welshimeri; 4,17% de L. seeligeri e 2,08% de L. grayi. As amostras positivas para L

  6. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  7. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  8. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  9. 21 CFR 172.785 - Listeria-specific bacteriophage preparation.

    Science.gov (United States)

    2010-04-01

    ... application to meat and poultry products that comply with the ready-to-eat definition in 9 CFR 430.1. Current... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Listeria-specific bacteriophage preparation. 172.785 Section 172.785 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN...

  10. GROWTH OF NATURALLY OCCURING Listeria innocua IN COPPA DI TESTA

    Directory of Open Access Journals (Sweden)

    G. Merialdi

    2010-06-01

    Full Text Available Coppa di testa is a traditional cooked pork salami produced in different Italian regions. The main raw material is deboned meat of pork head with the addition of tongue and rind. After a long (3-5 h high temperature (97°C cooking, additives and flavourings are added and the salami is prepared. After cooling the salami is often portioned and vacuum- packaged. In this study the growth of naturally occurring contamination of Listeria innocua in three batches of vacuum packaged Coppa di testa, stored at 4°C for 80 days, is described. The average max was 0.24 (days-1 and the average doubling time was 2.87 days. The maximum growth level ranged from 4.90 to 8.17 (log10 cfu/g. These results indicate that Coppa di testa definitely supports the growth of Listeria innocua in the considered storage conditions. Taking into account that at 4°C Listeria monocytogenes strains are associated with higher grow rates than L. innocua, these results emphasize the importance of preventing Listeria monocytogenes contamination in the production stages following cooking.

  11. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  12. Microbial quality and prevalence of Salmonella and Listeria in eggs

    Directory of Open Access Journals (Sweden)

    Manijeh Mahdavi

    2012-01-01

    Full Text Available Aims: This study was undertaken to determine the microbial quality and the prevalence of Salmonella and Listeria in table eggs in Isfahan, Iran. Materials and Methods: A total of 525 samples were randomly collected from various shops in Isfahan, Iran. Microbial quality of eggs evaluated by coliform count and total bacterial viable counts. Also, detection of Listeria and Salmonella in egg contents and on eggs shells was performed. Results: The mean of total viable bacteria and coliform counts in the egg contents were 3.95 × 10 4 CFU/g and 4.94 × 10 3 CFU/g, respectively. Salmonella and Listeria were not found on the shell or content of eggs. Enterobacteriaceae families were found in 357 of 525 (68.28% and 276 of 525 (52.44% of egg shell and egg content samples, respectively. Moreover, Pseudomonas aeruginosa was isolated from 175 (33.41% and 144 (25.37% of egg shell and egg content, respectively. The isolated Enterobacteriaceae were included: Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Buttiauxella agrestis, Cedecea lapagei, Cedecea davisae and Erwinia herbicola. Conclusion: The findings of the present study indicate although Salmonella and Listeria were not found in egg samples; however, there is an urgent need to improve the hygienic level of consumed eggs.

  13. Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.

    Science.gov (United States)

    Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando

    2012-01-01

    Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.

  14. Listeria monocytogenes repellence by enzymatically modified PES surfaces

    NARCIS (Netherlands)

    Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.

    2015-01-01

    : The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces

  15. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  16. LISTERIA MONOCYTOGENES IN THE CONTEXT OF THE NEW COMMUNITY REGULATIONS

    Directory of Open Access Journals (Sweden)

    A. Bragagnolo

    2008-02-01

    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  17. Antibiotic resistant pattern of environmental isolates of Listeria ...

    African Journals Online (AJOL)

    Incidence of Listeria monocytogenes in cow manure, agricultural soil, and common vegetables sold in major markets in Ado-Ekiti, Nigeria was determined. Antibiotic resistant pattern of the isolates was examined by paper disk assay. A total of 196 environmental samples were cultured on a selective medium out of which ...

  18. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  19. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  20. Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid

    NARCIS (Netherlands)

    Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.

    2008-01-01

    We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the

  1. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  2. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  3. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

  4. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  5. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  6. Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

    African Journals Online (AJOL)

    One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

  7. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)

    ALESSANDRA PARO RODRIGUES CESAR

    2011-06-01

    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  8. Current Knowledge on Listeria monocytogenes Biofilms in Food-Related Environments: Incidence, Resistance to Biocides, Ecology and Biocontrol

    Directory of Open Access Journals (Sweden)

    Pedro Rodríguez-López

    2018-06-01

    Full Text Available Although many efforts have been made to control Listeria monocytogenes in the food industry, growing pervasiveness amongst the population over the last decades has made this bacterium considered to be one of the most hazardous foodborne pathogens. Its outstanding biocide tolerance capacity and ability to promiscuously associate with other bacterial species forming multispecies communities have permitted this microorganism to survive and persist within the industrial environment. This review is designed to give the reader an overall picture of the current state-of-the-art in L. monocytogenes sessile communities in terms of food safety and legislation, ecological aspects and biocontrol strategies.

  9. Detection of Listeria monocytogenes from selective enrichment broth using MALDI-TOF Mass Spectrometry.

    Science.gov (United States)

    Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A

    2014-01-31

    Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in

  10. Lactic acid bacteria from chicken carcasses with inhibitory activity against Salmonella spp. and Listeria monocytogenes.

    Science.gov (United States)

    Sakaridis, I; Soultos, N; Dovas, C I; Papavergou, E; Ambrosiadis, I; Koidis, P

    2012-02-01

    This study was conducted to isolate psychrotrophic lactic acid bacteria (LAB) from chicken carcasses with inhibitory activity against strains of Salmonella spp. and Listeria monocytogenes. A total of 100 broiler samples were examined for the presence of LAB. Ninety-two LAB isolates that showed antimicrobial effects against Salmonella spp. and L. monocytogenes were further analysed to examine their LAB (Gram-positive, catalase negative, oxidase negative) and psychrotrophic characteristics (ability to grow at 7 °C). Fifty isolates were further selected and identified initially using standard biochemical tests in miniature (Micro-kits API CH 50) and then by sequencing of the 16s-23s rRNA gene boundary region (Intergenic Spacer Region). By molecular identification, these isolates were classified into 5 different LAB species: Lactobacillus salivarius, Lactobacillus reuteri, Lactobacillus johnsonii, Pediococcus acidilactici, and Lactobacillus paralimentarius. None of the isolates produced tyramine or histamine. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone

    2013-01-01

    Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

  12. Estilos de vida en estudiantes universitarios

    Directory of Open Access Journals (Sweden)

    Martha Muñoz Argel

    2013-07-01

    Full Text Available Abstract This research paper aims to identify life style based on specific practices and beliefs and to analyze the socio-economical stratum at a university level. The research design is transversal and descriptive and the tool used was the Practices and Beliefs About Life Style Questionnaire. The socioeconomical stratum was established through database entry and an enrollment category assigned by the university. For the sample 180 students were chosen through a random and systematic sampling method. The results show the prevalence of a healthy life style with discrepancies between practices and beliefs. In relation to the socio-economic stratum, differences were not showed. Resumen El presente artículo de investigación tiene como objetivo identificar el estilo de vida a partir de las prácticas y las creencias, así como analizar la variable estrato socioeconómico en el contexto del nivel educativo universitario. El diseño de investigación es transversal descriptivo y el instrumento utilizado fue el Cuestionario de Prácticas y Creencias sobre el Estilo de Vida. El estrato socioeconómico se estableció mediante la base de datos de ingreso y categoría de matrícula asignada por la universidad. La muestra fue constituida por 180 estudiantes universitarios, que fueron seleccionados mediante muestreo aleatorio por conglomerado y sistemático. Los resultados muestran la prevalencia del estilo de vida saludable, con discrepancias entre prácticas y creencias, y en relación con el estrato socioeconómico, no se presentaron diferencias significativas.

  13. Psicología y vida rural

    OpenAIRE

    Ringuelet, Roberto R.; Rey, María Inés

    2015-01-01

    Nos centramos en la discusión sobre una psicologia de la vida rural, entendida como un subcampo posible de conocimiento psicológico. Desarrollamos un diálogo con algunas propuestas y textos recientes, tal las circulares de las 1ras Jornadas Nacionales de Psicología Rural realizada en 2013 en Posadas y alguno de sus resultados (Univ. de la Cuenca del Plata, 2013; Landini, 2015); tal el texto de Roberti y Mussi sobre “el desarrollo rural y las contribuciones de la Psicología” (Roberti y Muss...

  14. Vivir las Ideas, Idear la Vida

    Directory of Open Access Journals (Sweden)

    Rodrigo Iván Sepúlveda López de Mesa.

    2008-01-01

    Full Text Available El suicidio entre los nativos, permite entender la enfermedad mental como la saturación de la adversidad, la experiencia de un lugar en el mundo estrangulado por un ethos cultural sumergido en la violencia, lleva al suicidio como un rito de paso hacia la vida de ensueño. En este sentido, la terapia es un tipo de relación con el otro, en la que tangetiality, la subjetividad y el subjuntivo efectos sociales de apoyo como una relación hacia la fexibility.

  15. La vida más

    Directory of Open Access Journals (Sweden)

    CHARLES MELMAN

    2005-01-01

    Full Text Available Escrito luego del viaje de trabajo que hizo en agosto del 2004 empezando por Bogotá, este texto resulta ser una valiosa síntesis de las reflexiones y observaciones de Charles Melman sobre la situación política y el poder en la modernidad, especialmente, América Latina. "La vida más" quedó de postfacio a la nueva edición de su libro L-homme sans gravité, incluido en la colección de bolsillo Folio en 2005.

  16. Comorbilidades y calidad de vida en Osteoartritis

    OpenAIRE

    Solis Cartas, Urbano; Calvopiña Bejarano, Silvia Johana

    2018-01-01

    RESUMEN Introducción: la osteoartritis es considerada la enfermedad reumática más antigua y frecuente que existe. A pesar de ser considerada una patología benigna se asocia a un gran número de comorbilidades que pueden influir en el curso de la enfermedad. Objetivo: determinar la influencia de las comorbilidades en la percepción de la calidad de vida relacionada con la salud en pacientes con osteoartritis del cantón Riobamba. Método: estudio descriptivo, transversal y observacional ...

  17. El prematuro: una esperanza de vida

    OpenAIRE

    Betancur R., Diana Helena; Fundación Valle de Lili; Garzón F., Lucía

    1999-01-01

    Factores prenatales de riesgo para el feto/Alteraciones inherentes a la prematuréz/Manejo del niño prematuro/ ¿Existe relación entre la actividad física y los partos prematuros?/ ¿Cómo se puede prevenir la prematuréz?/ ¿El recién nacido prematuro puede llevar una vida normal una vez es dado de alta?/ ¿Qué tipo de alimentación deberá recibir el prematuro?/ ¿Cuándo debe usted consultar a su pediatra?

  18. Poder, vida y subjetivación

    OpenAIRE

    Lemm, Vanessa; Vatter, Miguel; Noys, Benjamin; Chirolla, Gustavo

    2018-01-01

    Carlos Manrique y Laura Quintana (CM y LQ): en el debate contemporáneo sobre “biopolítica”, en particular en el contexto italiano y siguiendo, entre otros, el impulso de Roberto Esposito, ha cobrado una cierta fuerza la idea de que una verdadera resistencia al gobierno sobre la vida tendría que implicar necesariamente repensar la categoría de la “vida” (más allá de las oposiciones metafísicas entre lo humano y lo animal, o entre bios y zoê) y desarrollar en conformidad con esto las posibilida...

  19. A vida singular de um jovem militante

    Directory of Open Access Journals (Sweden)

    Áurea Maria Guimarães

    2012-01-01

    Full Text Available Esse artigo é fruto de uma pesquisa realizada no período de 2007 a 2010, junto a jovens militantes da cidade de Campinas, com o objetivo de compreender as diferentes maneiras que conduziam esses jovens tanto a reproduzir um modelo de vida quanto a criar outras possibilidades de militância na relação com esse modelo. Entre as histórias orais de vida narradas por jovens que militavam em diferentes grupos ou instituições, escolhi a vida de Biula, representante do movimento estudantil secundarista, procurando evidenciar que a singularidade desta vida, como também e a de outros jovens, estava conectada à problematização que faziam no interior de certas práticas, histórica e culturalmente constituídas, possibilitando a criação de novas formas de subjetivação nas quais se modificava a experiência que tinham deles mesmos na relação com os seus heróis ou modelos de referência. Palavras-chave: história oral – transcriação – heróis – resistência - processos de singularização.   THE SINGULAR LIFE OF A YOUNG MILITANT ABSTRACT   This article is the result of a research carried out from 2007 to 2010 with   young militants in the city of Campinas, aiming to understand the different ways which conducted these youngsters to both reproduce a life model and create other possibilities of militancy in the relationship with this model. Among oral stories narrated by young militants from different groups or institutions, I have chosen the life of Biula, a representative of the secondary students’ movement, trying to show that the singularity of this life and other youngsters’ lives was connected to the problematization they promoted within certain practices, historically and culturally built, thus enabling the creation of new subjectification modes in which the experience they had of themselves in the relationship with their heroes or reference models has changed. Key words: oral history -  transcreation – heroes

  20. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  1. Do valor da vida senciente e autoconsciente

    Directory of Open Access Journals (Sweden)

    Milene Consenso Tonetto

    2004-01-01

    Full Text Available O objetivo principal deste trabalho é analisar a posição assumida por Peter Singer em relação à questão do valor da vida dos seres humanos e não-humanos. Reconstruo, primeiramente, a argumentação desenvolvida por Singer no artigo Animals and Value of Life no qual questiona se é moralmente correto tirar a vida de animais para fins de nutrição ou experimentação. Analiso, em segundo lugar, diferentes posições, a saber: algumas tradições religiosas; os filósofos clássicos: René Descartes e Jeremy Bentham; os filósofos contemporâneos: Tom Regan e Michael Tooley; as filósofas feministas: Nel Noodings e Carol Gilligan. Finalmente, avalio criticamente o conceito de pessoa utilizado por Singer e sua posição em relação aos animais não-humanos.

  2. Standardization of PCR technique for detecting Listeria monocytogenes in chicken, beef and pork/Estandarización de la técnica PCR para diagnosticar Listeria monocytogenes en carne de pollo, res y cerdo

    Directory of Open Access Journals (Sweden)

    Asael E. de la Rosa-Zariñana

    2018-01-01

    Full Text Available The aim of this study was to standardize the PCR technique for detecting Listeria monocytogenes (Lm in chicken, beef and pork. The sensitivity and speci city of PCR and the level of concordance with the microbiological method were evaluated. PCR was standardized using a total of 60 samples of chicken, beef and pork (20 samples per meat type. Sensitivity and speci city were calculated using the 2 x 2 table and the level of accordance by the Kappa index. The minimum detectable DNA concentration was 3.0 ng μL−1. The PCR showed 100% sensitivity and speci city, and 80, 91 and 100% concordance between the methods was obtained for detecting Lm in chicken, beef and pork samples respectively, with 89.4% similarity between the methods for the three types of meat.

  3. Contamination profile of Listeria spp. in three types of ready-to-eat chicken meat products.

    Science.gov (United States)

    Lekroengsin, Sumalin; Keeratipibul, Suwimon; Trakoonlerswilai, Kasame

    2007-01-01

    This study investigated contamination sources of Listeria spp. in frozen, ready-to-eat, roasted, steamed, and fried chicken meat products from a plant in Thailand, as well as the correlation between Listeria contamination in the production environment and the finished product. The cooking processes used in this factory (with a product core temperature of 80 degrees C for 1 min) were confirmed as adequate for eliminating Listeria spp. However, Listeria spp. were detected at the packing stage of roasted and steamed chicken products. An environmental swab test was conducted by means of the zone concept, whereby surfaces in the production area were divided into three zones. Zone 1 was made up of the equipment surfaces that came into direct contact with the products. Zone 2 consisted of equipment surfaces that were not in direct contact with the products, including surfaces that were difficult to be cleaned. Zone 3 included surfaces that did not come in direct contact with the products and were located far from the products. The results showed that the prevalence of Listeria spp. in roasted and steamed products was affected by the prevalence of Listeria contamination in all zones, especially zone 1, which demonstrated the highest correlation. In addition, the prevalence of Listeria contamination in zones 2 and 3 affected the prevalence of Listeria in zone 1. A correlation between Listeria on roasted chicken products and the surfaces of zone 1 at the start of production was also established.

  4. Multiple cortical brain abscesses due to Listeria monocytogenes in an immunocompetent patient.

    Science.gov (United States)

    Khan, Sadia; Kumar, Anil; Kale, Satyajit; Kurkure, Nitin; Nair, Gulsiv; Dinesh, Kavitha

    2018-04-01

    Listeria monocytogenes is an intracellular organism which is well recognised for its ability to cause meningeal infections in neonates, immunosuppressed, debilitated and elderly individuals. 1 Other less common central nervous system (CNS) infections caused by Listeria spp. include rhomboencephalitis, cerebritis and abscesses in the brain, brain stem and spinal cord. The neuroradiological appearance of Listeria brain abscesses is similar to other types and may also mimic primary or metastatic brain tumours. 2 , 3 We report a case of Listeria brain abscesses in a patient who was being treated for atypical parkinsonism. A good clinical outcome was achieved after appropriate antimicrobial therapy.

  5. A study on the effects of some laboratory-derived genetic mutations on biofilm formation by Listeria monocytogenes

    Digital Repository Service at National Institute of Oceanography (India)

    Kumar, S.; Parvathi, A.; George, J.; Krohne, G.; Karunasagar, Indrani; Karunasagar, Iddya

    , Germany Address for correspondence Sanath Kumar ENMU 2386 1500 S, Ave K Portales, New Mexico 88130 USA e-mail: sanathkm@yahoo.com Running Title: Gene mutations and Listeria biofilm Abstract Biofilms formed by the human pathogen Listeria...

  6. InlB-mediated Listeria monocytogenes internalization requires a balanced phospholipase D activity maintained through phospho-cofilin

    NARCIS (Netherlands)

    Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li

    Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into

  7. Reflexiones sobre la crisis. Vidas y Memorias

    Directory of Open Access Journals (Sweden)

    Estela Vázquez

    2009-11-01

    Full Text Available El artículo se plantea analizar la deslegitimación de la política y de los políticos, así como del acto de votar. Encuadrado en el marco del contexto de la crisis argentina de los últimos años, quiere responder, por medio de la entrevista oral y la historia de vida, a cómo se ve desde la ciudadanía el ejercicio de la democracia, las prácticas políticas, la alternancia en el poder y de qué forma todo esto influye en las vidas personales de los entrevistados. Asimismo, se entrelaza el análisis del espectáculo político con el público que ofrecen los medios de comunicación y de entretenimiento, con lo que se viene a concluir que es cada vez más difícil distinguir en el debate social la ficción de los hechos y personajes verdaderamente reales. Para este trabajo se analizan tres trayectorias laborales de ex-empleados de la administración pública, y sus apreciaciones sobre el despido, vinculando estas experiencias de vida a la formación de sus ideas sobre la política y los políticos.. Sus lugares de trabajo eran el Registro Civil, la Secretaría de Educación y la Legislatura, respectivamente.__________________ABSTRACT:This article tries to analyse the discredit of politics and politicians along with the act of voting. Placed in the context of the Argentine crisis, it wants to determinate through oral interview and life story how citizens see the exercise of democracy, the political practices and the power switching, to establish how they have influenced in the lifes of the persons being interviewed. At the same time, it interlaces an analysis of he political spectacle shown to the public by the media, to conclude that is becoming more a more difficult to distinguish the fiction from the real characters in the social debate.

  8. Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

    Directory of Open Access Journals (Sweden)

    Wanessa Altimiras Costa

    2009-12-01

    Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

  9. Detección de Listeria spp. y Listeria monocytogenes en muestras de leche cruda y quesos artesanales respectivamente, mediante PCR en Tiempo Real

    Directory of Open Access Journals (Sweden)

    Viviana Pamela Chiluisa-Utreras

    2017-07-01

    Full Text Available Background. In Ecuador, studies about bacteria genre Listeria in artisanal cheeses are scarce, and in raw milk, practically nonexistent. Milk production is one of the main livestock activities in the province of Pichincha and it is essential to study these products. Since all the cantons that make up Pichincha are milk producers, three of them, Cayambe, Quito and Pedro Moncayo were randomly sampled. Objective. To determine Listeria spp. And Listeria monocytogenes in samples of raw milk and artisanal cheeses, respectively, using Real Time PCR. Methods. The application of the qPCR technique in the detection of microorganisms and especially of bacteria in food, is based on four fundamental aspects: its sensitivity, specificity, speed and processing capacity of large sample flow. It is possible to detect small amounts of pathogenic microorganisms, such as Listeria spp in raw milk, after extraction and quantification of total DNA. Results. In this study in raw milk, one positive was determined from a total of 60 samples, representing 1.6% of Listeria spp. and 16 positive samples of 45, representing 35.6% of Listeria monocytogenes in artisanal cheeses from three farms in the province of Pichincha. Conclusions. The results, according to the statistical analyzes carried out with the Kruskal - Wallis test, show that in Pichincha the bacterium is present in raw milk, but in non - representative quantities, whereas for Listeria monocytogenes there is statistical significance in the cheeses samples

  10. Antimicrobial Resistance Profiles of Listeria monocytogenes and Listeria innocua Isolated from Ready-to-Eat Products of Animal Origin in Spain.

    Science.gov (United States)

    Escolar, Cristina; Gómez, Diego; Del Carmen Rota García, María; Conchello, Pilar; Herrera, Antonio

    2017-06-01

    The objective of this work was to investigate the antimicrobial resistance in Listeria spp. isolated from food of animal origin. A total of 50 Listeria strains isolated from meat and dairy products, consisting of 7 Listeria monocytogenes and 43 Listeria innocua strains, were characterized for antimicrobial susceptibility against nine antimicrobials. The strains were screened by real-time PCR for the presence of antimicrobial resistance genes: tet M, tet L, mef A, msr A, erm A, erm B, lnu A, and lnu B. Multidrug resistance was identified in 27 Listeria strains, 4 belonging to L. monocytogenes. Resistance to clindamycin was the most common resistance phenotype and was identified in 45 Listeria strains; the mechanisms of resistance are still unknown. A medium prevalence of resistance to tetracycline (15 and 9 resistant and intermediate strains) and ciprofloxacin (13 resistant strains) was also found. Tet M was detected in Listeria strains with reduced susceptibility to tetracycline, providing evidence that both L. innocua and L. monocytogenes displayed acquired resistance. The presence of antimicrobial resistance genes in L. innocua and L. monocytogenes indicates that these genes may be transferred to commensal and pathogenic bacteria via the food chain; besides this, antibiotic resistance in L. monocytogenes could compromise the effective treatment of listeriosis in humans.

  11. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  12. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  13. Biosensor for the detection of Listeria monocytogenes: emerging trends

    KAUST Repository

    Soni, Dharmendra Kumar

    2018-05-23

    The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.

  14. Evaluation of Immune Responses Mediated by Listeria-Stimulated Human Dendritic Cells: Implications for Cancer Vaccine Therapy

    Science.gov (United States)

    2014-07-01

    include: 1) Listeria infection, including that mediated by attenuated strains, induces moDC, DDC , and LC maturation and activation. 2) Listeria...2f) Flow cytometry analysis of DCs for co-stimulatory and maturation markers (months 3-12) Result/status: Listeria-treated DDC -IDCs and LCs were...for moDCs, infection of DDC -IDCs and LCs with wild-type, LLO-deficient, and ActA- deficient Listeria induces the activation and maturation of DDC

  15. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  16. CELLULAR VACCINES IN LISTERIOSIS: ROLE OF THE LISTERIA ANTIGEN GAPDH.

    Directory of Open Access Journals (Sweden)

    Ricardo eCalderon-Gonzalez

    2014-02-01

    Full Text Available The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH, and several epitopes such as the LLO peptides, LLO189–201 and LLO91–99 and the GAPDH peptide, GAPDH1–22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1–22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91–99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1–22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes.

  17. Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH

    Science.gov (United States)

    Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M. Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L.; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Álvarez-Domínguez, Carmen

    2014-01-01

    The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189−201 and LLO91−99 and the GAPDH peptide, GAPDH1−22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1−22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91−99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1−22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes. PMID:24600592

  18. Recuperando vidas: uma proposta de atendimento

    Directory of Open Access Journals (Sweden)

    Celeste Anunciata Baptista Dias Moreira

    2009-09-01

    Full Text Available O presente artigo busca problematizar a respeito da atuação do Serviço Social em um centro de tratamento público destinado a adolescentes usuários e usuários abusivos de drogas no Rio de Janeiro - Centro de Tratamento Recuperando Vidas - gerenciado pelo Departamento Geral de Ações Socioeducativas (DEGASE, responsável pela execução de medidas socioeducativas no referido estado. Traz, ainda, as análises relativas aos limites impostos pela execução dessa política no sistema socioeducativo que atua com adolescentes em conflito com a lei, como também destaca as possibilidades que tal campo fértil traz à profissão.

  19. Algunas consideraciones sobre la calidad de vida

    Directory of Open Access Journals (Sweden)

    Miguel Lugones Botell

    2002-08-01

    Full Text Available Se expone qué recoge el concepto calidad de vida en el contexto médico, aunque está sujeto a diversas interpretaciones según el círculo social en que se mueva el que lo esgrime. Pertenece al ámbito de la subjetividad, pero tiene mucho que ver también con la objetividad que envuelve a la persona.This paper presents what is contained in the quality of life concept in the medical environment, although it is subject to a number of interpretations according to the social circle of the individual that puts forward such concept. It belongs to the field of subjectivity but it has a lot to do with the objectivity surrounding the individual.

  20. Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

    Directory of Open Access Journals (Sweden)

    N. Soultos

    2014-11-01

    Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

  1. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  2. A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death.

    Science.gov (United States)

    Vdovikova, Svitlana; Luhr, Morten; Szalai, Paula; Nygård Skalman, Lars; Francis, Monika K; Lundmark, Richard; Engedal, Nikolai; Johansson, Jörgen; Wai, Sun N

    2017-01-01

    Bacterial membrane vesicle (MV) production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes , a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo . We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO), is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae , VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts). Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

  3. A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death

    Directory of Open Access Journals (Sweden)

    Svitlana Vdovikova

    2017-05-01

    Full Text Available Bacterial membrane vesicle (MV production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes, a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo. We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO, is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae, VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts. Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

  4. Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

    Science.gov (United States)

    González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

    2001-11-01

    The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

  5. Efficacy of a variety of disinfectants against Listeria spp.

    Science.gov (United States)

    Best, M; Kennedy, M E; Coates, F

    1990-02-01

    The efficacy of 14 disinfectants against Listeria innocua and two strains of Listeria monocytogenes in the presence of organic matter was studied. Quantitative efficacy tests were used. Many of the disinfectants tested were not as effective on Listeria spp. when the test organisms were dried onto the surface of steel disks (carrier tests) as they were when the organisms were placed in suspension (suspension test). The presence of whole serum and milk (2% fat) further reduced the disinfectant capacities of most of the formulations studied. Only three disinfectants (povidone-iodine, chlorhexidine gluconate, and glutaraldehyde) were effective in the carrier test in the presence of serum; however, all three were ineffective when challenged with milk (2% fat). Only one solution, sodium dichloroisocyanurate, was effective in the presence of milk. All but four formulations (chloramine-T, phosphoric acid, an iodophor, and formaldehyde) were effective in the suspension tests, regardless of the organic load. L. monocytogenes was observed to be slightly more resistant to disinfection than L. innocua was. There was no difference in disinfectant susceptibility between the two strains of L. monocytogenes. These findings emphasize the need for caution in selecting an appropriate disinfectant for use on contaminated surfaces, particularly in the presence of organic material.

  6. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu

    2017-02-01

    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  7. Listeria monocytogenes infection in poultry and its public health importance with special reference to food borne zoonoses.

    Science.gov (United States)

    Dhama, Kuldeep; Verma, Amit Kumar; Rajagunalan, S; Kumar, Amit; Tiwari, Ruchi; Chakraborty, Sandip; Kumar, Rajesh

    2013-04-01

    Listeriosis is a disease that causes septicemia or encephalitis in humans, animals and birds. Although, the disease is rare and sporadic in poultry but if occurs then causes septicemia or sometimes localized encephalitis. Occasionally, the disease is seen in young chicks and the causative agent, like in humans and animals, is Listeria monocytogenes. The organism is capable to infect almost all animals and poultry; however, outbreaks of listeriosis are infrequent in birds. It is widely distributed among avian species and chickens, turkeys, waterfowl (geese, ducks), game birds, pigeons, parrots, wood grouse, snowy owl, eagle, canaries, which appear to be the most commonly affected. Chickens are thought to be the carriers of Listeria and also the prime reservoirs for the infection and thus contaminate the litter and environment of the poultry production units. Listeriosis is often noticed along with other poultry diseases such as coccidiosis, infectious coryza, salmonellosis, campylobacteriosis and parasitic infections, signifying the opportunistic nature of the organism. Intestinal colonization of poultry and the presence of L. monocytogenes in feces represent a potential source of the organism for listeriosis in ruminants. Man gets infection from raw broiler meat due to Listeria contamination and unhygienic conditions of the processing area, rather than acquiring direct infection from birds. With the changing food habits of the people, the health consciousness is also increasing and since listeriosis has now been recognized as an emerging food borne zoonoses. Therefore, this review has been compiled to make aware the poultry producers and the consumers of poultry meat/products regarding the importance of the disease and its public health significance.

  8. PASTEURISASI HIGH TEMPERATURE SHORT TIME (HTST) SUSU TERHADAP Listeria monocytogenes PADA PENYIMPANAN REFRIGERATOR

    OpenAIRE

    SABIL, SYAHRIANA

    2015-01-01

    2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

  9. Environmental prevalence and persistence of Listeria monocytogenes in cold-smoked trout processing plants

    Science.gov (United States)

    The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...

  10. Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

    Science.gov (United States)

    Lu, Chunye; Marjanovic, Olivera; Kiang, David

    2017-01-01

    ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

  11. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Listeria monocytogenes meningitis: serotype distribution and patient characteristics in The Netherlands, 1976-95

    NARCIS (Netherlands)

    Aouaj, Y.; Spanjaard, L.; van Leeuwen, N.; Dankert, J.

    2002-01-01

    Two hundred and seven cases of listeria meningitis that occurred in The Netherlands over 20 years were reviewed to study associations between Listeria monocytogenes serotype, age, underlying disease, and outcome. The mean annual incidence per 100000 population was 0.12 in 1981-90, decreasing to 0.07

  13. Small molecules targeting LapB protein prevent Listeria attachment to catfish muscle.

    Directory of Open Access Journals (Sweden)

    Ali Akgul

    Full Text Available Listeria monocytogenes is a Gram-positive foodborne pathogen and the causative agent of listeriosis. L. monocytogenes lapB gene encodes a cell wall surface anchor protein, and mutation of this gene causes Listeria attenuation in mice. In this work, the potential role of Listeria LapB protein in catfish fillet attachment was investigated. To achieve this, boron-based small molecules designed to interfere with the active site of the L. monocytogenes LapB protein were developed, and their ability to prevent L. monocytogenes attachment to fish fillet was tested. Results indicated that seven out of nine different small molecules were effective in reducing the Listeria attachment to catfish fillets. Of these, three small molecules (SM3, SM5, and SM7 were highly effective in blocking Listeria attachment to catfish fillets. This study suggests an alternative strategy for reduction of L. monocytogenes contamination in fresh and frozen fish products.

  14. Listeria monocytogenes following orthotopic liver transplantation: Central nervous system involvement and review of the literature

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Listeria monocytogene is a well-recognized cause of bacteremia in immunocompromised individuals, including solid organ transplant recipients, but has been rarely reported following orthotopic liver transplantation. We describe a case of listeria meningitis that occurred within a week after liver transplantation. The patient developed a severe headache that mimicked tacrolimus encephalopathy, and was subsequently diagnosed with listeria meningitis by cerebrospinal fluid culture. The infection was successfully treated with three-week course of intravenous ampicillin. Recurrent hepatitis C followed and was successfully treated with interferon alfa and ribavirin. Fourteen cases of listeriosis after orthotopic liver transplantation have been reported in the English literature. Most reported cases were successfully treated with intravenous ampicillin. There were four cases of listeria meningitis, and the mortality of them was 50%.Early detection and treatment of listeria meningitis are the key to obtaining a better prognosis.

  15. Long-term mortality in patients diagnosed with Listeria monocytogenes meningitis: A Danish nationwide cohort study

    DEFF Research Database (Denmark)

    Roed, Casper; Engsig, Frederik Neess; Omland, Lars Haukali

    2012-01-01

    OBJECTIVES: To determine the long-term mortality, the causes of death and the incidence of cancer in listeria meningitis patients. METHODS: Nationwide, population-based cohort study including all adult patients diagnosed with listeria meningitis from 1977 to 2006 and alive 1 year after diagnosis......, and an age-and gender-matched, population control cohort. Kaplan-Meier tables, Cox regression analysis and cumulative incidence function were used as outcome analyses. RESULTS: We identified 114 listeria meningitis patients and 1026 population controls. The adjusted mortality rate ratio (MRR) for listeria...... meningitis patients the first 5 years of follow-up was 2.35(95% confidence interval (CI) 1.60-3.45) thereafter the MRR was 0.93(95% CI: 0.56-1.55). Listeria meningitis patients had an increased risk of death due to cancer the first 5 years of follow-up, and in the same period patients above 50 years of age...

  16. Impact of Listeria Inoculation and Aerated Steam Sanitization on Volatile Emissions of Whole Fresh Cantaloupes.

    Science.gov (United States)

    Forney, Charles F; Fan, Lihua; Bezanson, Gregory S; Ells, Timothy C; LeBlanc, Denyse I; Fillmore, Sherry

    2018-04-01

    Rapid methods to detect bacterial pathogens on food and strategies to control them are needed to mitigate consumer risk. This study assessed volatile emissions from whole cantaloupe melons (Cucumis melo) as an indicator of Listeria contamination and in response to steam vapor decontamination. Cantaloupe were inoculated with Listeria innocua, a nonpathogenic surrogate for L. monocytogenes, then exposed to 85 °C steam for 240 s (4 min) followed by rapid chilling and storage for 0, 7, 10, or 14 days at 4, 7, or 10 °C. Volatile emissions from whole melons were collected on Carbopack B/Carboxen 1000 headspace collection tubes and analyzed by gas chromatography-mass spectroscopy following thermal desorption. Introduction of L. innocua to cantaloupe rind resulted in a reduction of aromatic compound emission. However, this response was not unique to Listeria contamination in that steam vapor treatment also reduced emission of these compounds. As well, steam vapor treatment diminished the number of viable Listeria and indigenous microflora while causing physiological injury to melon rind. Heat treatment had no significant effects on flesh firmness, color, titratable acidity, or soluble solids, but the production of typical aroma volatiles during postharvest ripening was inhibited. No unique volatile compounds were detected in Listeria contaminated melons. While changes in volatile emissions were associated with Listeria inoculation, they could not be differentiated from heat treatment effects. Results indicate that volatile emissions cannot be used as a diagnostic tool to identify Listeria contamination in whole cantaloupe melons. The detection of pathogen contamination on fresh produce is a continuing challenge. Using a nondestructive screening method, the presence of surrogate Listeria innocua on fresh whole cantaloupes was shown to alter the emissions of aromatic volatiles from whole cantaloupes. However, these altered emissions were not found to be unique to Listeria

  17. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  18. Un orden urbano: Paisaje, calidad de vida y sustentabilidad

    OpenAIRE

    Hans Fox Timmling

    2008-01-01

    La calidad de vida regional representa entonces un conjunto de metas por medio de las cuales las sociedades se aseguran que las transformaciones territoriales y espaciales proporcionen una mejor existencia a sus habitantes, tanto de la sociedad como también la sustentabilidad de todos los procesos naturales que fundamentan la vida social en una región. Los Planes de Ordenamiento Territorial, ciertamente han de enmarcarse en esta meta más general de aumentar la calidad de vida regional y la su...

  19. The antimicrobial action of resveratrol against Listeria monocytogenes in food-based models and its antibiofilm properties.

    Science.gov (United States)

    Ferreira, Susana; Domingues, Fernanda

    2016-10-01

    Resveratrol (3,5,4'-trihydroxy-trans-stilbene) is a natural phytoalexin synthesized by plants in response to stress. This compound has several beneficial documented properties, namely anti-inflammatory, antioxidant, neuroprotective and antimicrobial activities. In this study the antimicrobial activity of resveratrol against Listeria monocytogenes and Listeria innocua was investigated. Resveratrol had a minimum inhibitory concentration of 200 µg mL(-1) for the tested strains, with time-kill curves demonstrating bacteriostatic activity. Inhibition of biofilm formation was also assessed, with resveratrol strongly inhibiting biofilm formation by both species even at subinhibitory concentrations. Overall, resveratrol showed antimicrobial properties on planktonic cells and on biofilm formation ability. Considering the potential use of resveratrol as a food preservative, the antimicrobial efficacy of resveratrol in food was studied in milk, lettuce leaf model and chicken juice. Resveratrol retained greater efficacy in both lettuce leaf model and chicken juice, but milk had a negative impact on its antilisterial activity, indicating a possible reduction of resveratrol availability in milk. This study reinforces resveratrol as an antimicrobial agent, pointing out its antibiofilm activity and its potential use as preservative in some food matrices. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  20. Uma vida que se esvai no Parkinson

    Directory of Open Access Journals (Sweden)

    Eliane Michelini Marraccini

    Full Text Available A doença de Parkinson é uma síndrome neurológica de evolução lenta e progressiva que emerge na idade madura e velhice. A crescente debilitação física contrasta com a manutenção da integridade mental, na maioria dos pacientes até o fim da vida. Nessa enfermidade incurável, que costuma perdurar por longos anos, surgem importantes reações físicas diante da progressiva incapacitação, com profundos reflexos na subjetividade do paciente. Este trabalho refere-se ao atendimento de uma paciente, acompanhada em seu processo de conscientização e elaboração da irreversibilidade da doença. Ao final,é ressaltada a intrínseca articulação somatopsíquica, com destaque para a depressão na acentuação dos sintomas parkinsonianos.

  1. Transtornos alimentares: patologia ou estilo de vida?

    Directory of Open Access Journals (Sweden)

    Liliane de Jesus Bittencourt

    2013-01-01

    Full Text Available A internet se apresenta como um novo espaço de reconfiguração das relações sociais, por isso jovens com transtornos alimentares vêm utilizando-a como forma de expressão, através das comunidades pró-anorexia e bulimia. Este artigo visa compreender a diferença entre o discurso hegemônico e a crença destas jovens, a partir das teorias antropológicas sobre a influência da cultura na saúde e na doença, da teoria da bioascese e das teorias feministas. Usando a interpretação de sentidos, percebe-se que os transtornos alimentares são considerados estilos de vida, nos quais se busca fugir ao sofrimento através do controle dos corpos e dos desejos. Há uma trama entre controle, poder e dominação, no qual as jovens pleiteiam autonomia e independência, a sociedade define e normatiza seus corpos, e dessa forma, impõem uma dominação, e os profissionais, baseados nos discursos da saúde, intentam ensiná-las como controlá-los, exercendo, de certa forma, um poder sobre o outro.

  2. DISPOSITIVO DAS DROGAS E GOVERNO DA VIDA

    Directory of Open Access Journals (Sweden)

    Wanderson Vilton Silva

    Full Text Available Resumo Na perspectiva da Psicologia Social em diálogo com as teorizações de Michel Foucault e Giorgio Agamben, o objetivo deste artigo é problematizar de que maneira as drogas são constituídas como explicação para assassinatos de moradores de rua, construindo práticas e discursos relacionados ao governo da vida e da morte nas cidades. O material que apresentamos consiste em textos midiáticos e documentos públicos elaborados entre julho de 2010 e novembro de 2012 abordando tais assassinatos. Analisamos como o dispositivo das drogas formula uma ambiguidade e uma complexidade importantes para o governo dos moradores de rua a partir da construção de oposições: criminoso ou em situação de vulnerabilidade social. Procuramos contribuir criticamente com políticas públicas que visem os diversos modos de existir na cidade, pensar os espaços urbanos, os modos de governo e os processos de subjetivação, considerando a análise da ambiguidade e da complexidade produzidas em torno do dispositivo das drogas.

  3. A leitura: um passaporte para a vida

    Directory of Open Access Journals (Sweden)

    Armindo Teixeira Mesquita

    2011-06-01

    Full Text Available Nas sociedades actuais, a capacidade para usar material escrito é indispensável ao acesso a todo tipo de informação, tornando o uso da leitura cada vez mais necessário à participação real do cidadão em actividades produtivas e colectivas, porque ajuda a formar seres pensantes. O contacto com os livros deve ser iniciado o mais cedo possível, não só pelo manuseio, como também pela história contada ou pelos jogos rítmicos. Com efeito, na idade da infância, toda a energia do indivíduo é dirigida para a construção da sua identidade. Logo, as primeiras leituras entram no período da formação e da fundação, isto é, consignamos à leitura uma grande força de desenvolvimento pessoal. Os livros, para além de auxiliares na aprendizagem do mundo, formam o leitor no gosto. Formar o gosto e possibilitar escolhas são realidades fundamentais na vida adulta.

  4. Vida, saber y bioética

    Directory of Open Access Journals (Sweden)

    Zoraida Enríquez O´Farrill

    Full Text Available Los grandes cambios ocurridos en el mundo como resultado de la Revolución Científico Técnica, imponen el análisis de las consideraciones éticas fundamentales basadas en la concepción marxista, referida a que el mundo de los objetos engendrados por la actividad del hombre condiciona todo el desarrollo de los sentidos y de la psicología humana, a la conciencia del hombre. En el presente trabajo se analizan, entre otras, algunas concepciones que producen una ruptura en el pensamiento científico contemporáneo, centrado en la bioética, el ambientalismo holista, la epistemología de segundo orden y el pensamiento complejo, rasgos que caracterizan la sociedad actual en su desarrollo, dado el énfasis en la ciencia, la tecnología, la técnica y el cambio acelerado en la vida social, que produce también rasgos de deshumanización.

  5. Vidas célebres, vidas minúsculas: Vasari, Foucault, Michon

    Directory of Open Access Journals (Sweden)

    Kelvin Falcão

    2014-12-01

    Full Text Available O primeiro movimento deste ensaio consiste no esboço de um percurso breve a partir da obra de Michel Foucault, rastreando o uso do significante “vidas” em alguns textos do autor francês. Dois eixos são delineados a partir daí: o primeiro deles diz respeito à leitura foucaultiana das “vidas célebres” de Giorgio Vasari; o segundo diz respeito às “vidas infames”, que Foucault rastreia nos arquivos policiais franceses. Em seguida, inicia-se um desvio em direção à literatura do século XX, considerando o envolvimento da ficção com a emergência da discursividade biográfica, sua ressonância política e o emprego crítico, mais uma vez, do significante “vidas”. Com esse contexto de fundo estabelecido, o ensaio conclui-se com uma análise de Vidas minúsculas, do escritor francês Pierre Michon. The first movement of this essay is to outline a brief path from the work of Michel Foucault, tracking the use of the signifier “lives” in some texts of the French author. Two axes are delineated from there, the first one concerns Foucault’s reading of “renowed lives” by Giorgio Vasari; the second concerns the “infamous lives”, which Foucault traces from the French police files. Then begins a shift toward twentiethcentury literature, considering the involvement of fiction with the emergence of biographical discourse, its political resonance and, again, the critical use of the signifier “lives”. With this background context established, the essay concludes with a analysis of Small Lives, by French writer Pierre Michon.

  6. Un orden urbano: Paisaje, calidad de vida y sustentabilidad

    Directory of Open Access Journals (Sweden)

    Hans Fox Timmling

    2008-05-01

    Este artículo reflexiona sobre algunos de esas vías posibles, como medios para alcanzar logros y resultados parciales que sumen hacia la gran propuesta de una mejor calidad de vida global regional y local.

  7. Patogénesis de Listeria monocytogenes, microorganismo zoonotico emergente

    Directory of Open Access Journals (Sweden)

    Kirvis Torres

    2005-05-01

    Full Text Available Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertidoen sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelularde otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismocuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria dealimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de los marcadores devirulencia de este microorganismo, la biología celular de las interacciones de los marcadores de virulenciacon los receptores de la célula hospedero, el citoesqueleto, las vías de transducción de señales y losmecanismos de inmunidad mediada por células del hospedero. El propósito de esta revisión es describiralgunas características taxonómicas y filogenéticas de Listeria monocytogenes , la incidencia humana yanimal de varios serotipos, la fisiopatología de la infección , modelos animales y de cultivo celular utilizadospara estudios de virulencia, las poblaciones de riesgo, manifestaciones clínicas de listeriosis humana yanimal, el tratamiento, la organización genética y evolución de los determinantes de virulencia, losmecanismos empleados para interactuar con la célula hospedera, y los mecanismos para escapar de losprocesos de muerte celular y pasar de una célula infectada a otra. La información recopilada resulta degran importancia para el personal de salud, industria, consumidores y población de riesgo; razón por lacual Listeria monocytogenes es un patógeno que representa una amenaza para la salud pública mundial.

  8. Un orden urbano: Paisaje, calidad de vida y sustentabilidad

    OpenAIRE

    Hans Fox Timmling

    2008-01-01

    La calidad de vida regional representa entonces un conjunto de metas por medio de las cuales las sociedades se aseguran que las transformaciones territoriales y espaciales proporcionen una mejor existencia a sus habitantes, tanto de la sociedad como también la sustentabilidad de todos los procesos naturales que fundamentan la vida social en una región. Los Planes de Ordenamiento Territorial, ciertamente han de enmarcarse en esta meta más general de aumentar la calidad de vid...

  9. Listeria monocytogenes HAZARD MANAGEMENT IN A TYPICAL PRODUCT: THE CIAUSCOLO

    Directory of Open Access Journals (Sweden)

    S Fisichella

    2013-02-01

    Full Text Available The aim of the present study is to investigate operative procedures that allow to minimize Listeria monocytogenes (L. m. hazard in the main traditional sausage of the internal areas of Marche (Italy: the Ciauscolo, that has received the quality trademark PGI. It is made from lean cuts of well mature pork that is finely minced, adding fat which give the salami his characteristic softness and flavour. It is characterized by having a very little maturing period that determine high aw levels and, for this peculiarity, it allows L. m development.

  10. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  11. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  12. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  13. Urban prevalence of Listeria spp. and Listeria monocytogenes in public lavatories and on shoe soles of facility patrons in the European capital city Vienna.

    Science.gov (United States)

    Schoder, D; Schmalwieser, A; Szakmary-Brändle, K; Stessl, B; Wagner, M

    2015-05-01

    The aim of this study was to determine the prevalence of Listeria spp. and Listeria monocytogenes (L. monocytogenes) in urban public lavatories and on shoe soles of facility patrons in a European capital city. More than 91% of all municipal public lavatories in Vienna close to public hubs were included in this study. Overall, 373 swab samples of public lavatories and shoes of facility patrons were enriched, according to ISO 11290-1. Listeria monocytogenes isolates were subtyped using pulsed-field gel electrophoresis. A total of 24 samples were positive for Listeria spp., yielding an overall prevalence of 6.4% (24/373). Listeria monocytogenes was found in 2.1% (8/373) of all samples. Swabs from lavatories in parks, container lavatories and lavatories at markets had the highest prevalences of 20.7% (6/29), 20% (2/10) and 12.5% (1/8) Listeria spp., respectively. These detection rates were statistically significantly higher than those associated with lavatories in shopping centres (P = 0.003, P = 0.002, P = 0.02) and at public transport locations (P = 0.0004, P = 0.005, P = 0.02). Shoes sampled at Christmas markets showed the highest Listeria spp. and L. monocytogenes prevalences of 80% (4/5) and 40% (2/5), respectively. With regard to shoe type, Listeria spp. detection rates were 14.3% (3/21; winter boots), 13.3% (2/15; hiking boots), sport shoes (5.9%; 2/34) and brogues (5.1%; 4/79). No Listeria spp. were found on shoe soles that had smooth treads (0/76), while Listeria spp. were detected on 19.5% (8/41) of medium depth tread shoe types and on 9.4% (3/32) of deep tread shoes. These data suggest that soil environment is still one of the most important reservoirs for the foodborne pathogen L. monocytogenes. © 2014 Blackwell Verlag GmbH.

  14. Sobre el derecho a la vida y la eutanasia

    Directory of Open Access Journals (Sweden)

    Rafael Chamorro Fletes

    2001-06-01

    Full Text Available En este artículo se analizan los problemas que se derivan del conflicto entre el derecho a la vida y la eutanasia, estudiando el efecto que produce considerar el derecho a la vida como un derecho discrecional 0 como un derecho obligatorio; todo ello, relacionándolo con la teoría de los límites de los derechos fundamentales y con los tipos de eutanasia que podemos distinguir: voluntaria, involuntaria y no voluntaria. También se aborda cómo el proceso de desacralización de la vida, al hacer más énfasis en la calidad de la vida realiza una transición del concepto de "vida sagrada" al de "dignidad de la persona" en Cuanto supremo valor humano, intentando con esto aportar una solución. En definitiva se presenta el análisis de un conflicto que requiere la ponderación de bienes tan preciados como la vida, la autonomía y la dignidad humana.

  15. Vi-da: vitiligo diagnostic assistance mobile application

    Science.gov (United States)

    Nugraha, G. A.; Nurhudatiana, A.; Bahana, R.

    2018-03-01

    Vitiligo is a skin disorder in which white patches of depigmentation appear on different parts of the body. Usually, patients come to hospitals or clinics to have their vitiligo conditions assessed. This can be very tiring to the patients, as vitiligo treatments usually take a relatively long period of time, which can range from months to years. To address this challenge, we present in this paper a prototype of an Android-based mobile application called Vi-DA, which stands for Vitiligo Diagnostic Assistance. Vi-DA consists of three subsystems, which are user sign-up subsystem, camera and image analysis subsystem, and progress report subsystem. The mobile application was developed in Java programming language and uses MySQL as the database system. Vi-DA adopts a vitiligo segmentation algorithm to segment input image into normal skin area, vitiligo skin area, and non-skin area. Results showed that Vi-DA gave comparable results to the previous system implemented in Matlab. User acceptance testing results also showed that all respondents agreed on the usefulness of the system and agreed to use Vi-DA again in the future. Vi-DA benefits both dermatologists and patients as not only a computer-aided diagnosis (CAD) tool but also as a smart application that can be used for self-assessment at home.

  16. LA VIDA AL NATURAL Y LA INVENCIÓN DE LA VIDA

    Directory of Open Access Journals (Sweden)

    Fábio de Melo Sene

    2010-12-01

    Full Text Available El concepto de vida, bajo el punto de vista biológico, con énfasis en lareproducción, principal característica de los seres vivos, es presentadohistóricamente articulado con los diversos embates o cuestiones éticas,morales, y o legales, a lo largo de ese recorrido histórico, de acuerdo con elconsenso relativo a cada época. Inicialmente, fue establecida la distinciónnecesaria entre procesos naturales y procesos resultantes de accionesantrópicas. Se consideró como invención todo procedimiento o hacerrelativos al desarrollo cultural de la humanidad. Así, a lo largo del recorridose confrontan posiciones pasadas y actuales, haciéndose amplia discusión alrespecto de asuntos recientes como: fecundación artificial, clonación,transgénicos, células-madre y la creación de vida en el laboratorio.

  17. La larga vida de dos rocas orensanas

    Directory of Open Access Journals (Sweden)

    García Quintela, Marco V.

    2011-12-01

    Full Text Available We study two rocks, a rock carving and a «rocky sanctuary » from the Ourense province (Spain, with two complementary methodologies, landscape archeology and «biography» (Kopytoff of objects. We start with their description in Christian texts, and then we observe that their relation with important hillforts forms a localization pattern, and finally we propose to date that relationship in the Iron Age. This chronology of the rocks and the following Christian reevaluation leads towards their «social life». These analyses are pertinent in the current debate about the chronology of the Galician rock art, and we propose that the use and meaning in the long term is as important as the initial moment of the carving.Se estudian dos rocas, un petroglifo y un «santuario rupestre » de la provincia de Ourense, con dos metodologías complementarias, la arqueología del paisaje y la «biografía» (Kopytoff de los objetos. Partiendo de su descripción en textos cristianos se considera el patrón de localización que conforman en relación con castros importantes, relación que se propone fechar en la Edad del Hierro. Esta adscripción cronocultural y su posterior resemantización cristiana lleva a la consideración de su «vida social». Estas aproximaciones inciden en el debate sobre la datación del arte rupestre en Galicia y se propone que, más allá del momento de grabado inicial, se estudie su uso y sentido en la larga duración.

  18. Qualidade de vida em doentes com asma

    Directory of Open Access Journals (Sweden)

    Lara Noronha Ferreira

    2010-01-01

    Full Text Available Resumo: Neste artigo é descrito um estudo, cujo objectivo é a medição da qualidade de vida relacionada com a saúde (QdVRS de doentes com asma e a apresentação de uma primeira aproximação aos valores normativos, com base no SF-6D, para aquele tipo de doentes. Pretende-se ainda averiguar a capacidade de medidas genéricas de medição da QdVRS distinguirem grupos em termos de características sociodemográficas. Aplicaram-se, por entrevista pessoal, as versões portuguesas do EQ-5D, do SF-6D, do AQLQ(S e do ACQ a uma amostra representativa da população portuguesa com asma.A maioria dos indivíduos não apresentou problemas significativos nas dimensões medidas, excepto na função física, onde os indivíduos reportaram limitações moderadas. Em média, os inquiridos apresentam valores de utilidade de 0,86. Os homens, os mais jovens, os solteiros, os indivíduos com habilitações literárias mais elevadas, os empregados, os indivíduos com rendimentos mais elevados e aqueles que residiam em zonas urbanas foram os que reportaram níveis de utilidade mais elevados. Por outro lado, os indivíduos que se encontravam num estádio mais avançado da doença reportaram, como era de esperar, níveis médios de utilidade inferiores aos dos que se encontravam num estádio menos grave da doença. Foram obtidos valores normativos para o SF-6D para doentes com asma por género, grupo etário, estado civil, habilitações literárias, situação profissional, local de residência e rendimento médio mensal líquido.As medidas de utilidade baseadas em preferências utilizadas neste estudo discriminam adequadamente grupos de doentes com asma, de acordo com grupos sociodemográficos. Os valores normativos obtidos podem ser usados em estudos de avaliação económica e estudos clínicos, uma vez que incorporam as preferências dos doentes

  19. Cleaning and Disinfection of Biofilms Composed of Listeria monocytogenes and Background Microbiota from Meat Processing Surfaces

    Science.gov (United States)

    Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-01-01

    ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and

  20. Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

    Science.gov (United States)

    Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-06-30

    Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

  1. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  2. Aprendizajes en sincronía con la vida

    Directory of Open Access Journals (Sweden)

    Flor Abarca-Alpízar

    2017-08-01

    Full Text Available Como humanidad sufrimos la desconexión y separación con la vida toda. Esta ruptura impuesta por el paradigma mecanicista predominante en los últimos cuatrocientos años, nos ha llevado a olvidar la visión holista promovida por las culturas originarias y ancestrales. Esta situación prevalece también en los sistemas educativos dominados por la enseñanza memorística y fragmentada, alejada de la vida, del ser y sentir de las personas aprendientes. Para la superación de la crisis planetaria actual es urgente recuperar la visión holista de la vida y del aprendizaje, para lo cual los procesos docentes universitarios son claves para la formación de personas profesionales comprometidas con la plenitud de la vida sobre la tierra. El sentido de este ensayo es reflexionar sobre la importancia que tiene para la superación de la crisis planetaria actual la recuperación de nuestra conectividad con la vida del planeta tierra en sincronicidad con los aprendizajes, porque los procesos vitales y los procesos de aprendizaje son la misma cosa. Este ensayo está organizado en tres momentos. El primero parte del intercambio de seres, saberes, sentires y experiencias para recuperar nuestra conexión perdida con la vida en nuestro planeta tierra. Un segundo momento donde presentamos reflexiones y conceptualización por medio de la construcción colectiva de conocimientos, con apoyo de personas especialistas en la visión holista y los procesos de interaprendizaje, necesarios para salvar la vida toda. El tercer momento de este ensayo está elaborado con propuestas, claves, signos y señales para la conexión de los procesos vitales en sincronía con los procesos de aprendizaje necesarios en los tiempos actuales.

  3. A Computational Study of Amensalistic Control of Listeria monocytogenes by Lactococcus lactis under Nutrient Rich Conditions in a Chemostat Setting

    Directory of Open Access Journals (Sweden)

    Hassan Khassehkhan

    2016-09-01

    Full Text Available We study a previously introduced mathematical model of amensalistic control of the foodborne pathogen Listeria monocytogenes by the generally regarded as safe lactic acid bacteria Lactococcus lactis in a chemostat setting under nutrient rich growth conditions. The control agent produces lactic acids and thus affects pH in the environment such that it becomes detrimental to the pathogen while it is much more tolerant to these self-inflicted environmental changes itself. The mathematical model consists of five nonlinear ordinary differential equations for both bacterial species, the concentration of lactic acids, the pH and malate. The model is algebraically too involved to allow a comprehensive, rigorous qualitative analysis. Therefore, we conduct a computational study. Our results imply that depending on the growth characteristics of the medium in which the bacteria are cultured, the pathogen can survive in an intermediate flow regime but will be eradicated for slower flow rates and washed out for higher flow rates.

  4. Sublethal injury and virulence changes in Listeria monocytogenes and Listeria innocua treated with antimicrobials carvacrol and citral.

    Science.gov (United States)

    Silva, A; Genovés, S; Martorell, P; Zanini, S F; Rodrigo, D; Martinez, A

    2015-09-01

    The aim of this study was to evaluate the effect of two antimicrobial substances, carvacrol and citral, on Listeria monocytogenes and Listeria innocua cells, as well as possible virulence changes in injured cells, using Caenorhabditis elegans as a model test. The results indicated that the percentage of sublethal damage was higher in L. monocytogenes than in L. innocua. The results of the study carried out by using C. elegans indicated that C. elegans fed in a lawn of L. monocytogenes previously treated with carvacrol showed a loss in life span (p ≤ 0.05) as compared with L. monocytogenes treated with citral, Escherichia coli OP50 as a negative control, and treated and untreated L. innocua. Egg laying was also affected: worms fed in a lawn of treated and untreated L. monocytogenes laid fewer eggs than those fed in a lawn of treated and untreated L. innocua or fed with OP50 as a negative control. Worms fed in a lawn of treated and untreated L. innocua also laid fewer eggs than those fed with OP50 as a negative control. A phenotype named bag of worms and an undescribed new one, "vulva inflammation", were also observed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Linezolid and dexamethasone experience in a serious case of listeria rhombencephalitis.

    Science.gov (United States)

    Yılmaz, Pakize Ö; Mutlu, Nevzat M; Sertçelik, Ahmet; Baştuğ, Aliye; Doğu, Cihangir; Kışlak, Sümeyye

    2016-01-01

    Listeria rhombencephalitis is a rare cause of brain stem encephalitis. We report a case with a history of immunosupressive therapy due to Takayasu's arteritis that was treated with corticosteroids and linezolid for Listeria rhombencephalitis. A 63-year-old woman was admitted to the hospital with fever, headache, nausea, and vomiting. The patient's body temperature was 38°C, and she had a stiff neck. Listeria monocytogenes was isolated from the cerebrospinal fluid (CSF), and penicillin G and gentamicin treatment was initiated. Linezolid and dexamethasone were added. Due to hematuria and thrombocytopenia, the linezolid was discontinued. In immunocompromised patients with CNS infections, Listeria rhombencephalitis should be suspected. Linezolid can be used in combination with dexamethasone. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  6. Characteristics of the biologically active 35-kDa metalloprotease virulence factor from Listeria monocytogenes

    NARCIS (Netherlands)

    Coffey, A; van den Burg, B; Veltman, R; Abee, T

    Listeria monocytogenes, a facultative intracellular pathogen, synthesizes an extracellular protease which is responsible for the maturation of phosphatidylcholine phospholipase C (lecithinase), a virulence factor involved in cell-to-cell spread. This work describes the environmental parameters

  7. Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling

    Science.gov (United States)

    Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pat...

  8. Growth inhibition of Listeria spp. on Camembert cheese by bacteria producing inhibitory substances.

    Science.gov (United States)

    Sulzer, G; Busse, M

    1991-12-01

    Bacterial strains exhibiting antimicrobial activity towards other bacteria are quite common in nature. During the past few years several genera have been shown to exert inhibitory action against Listeria. spp. In the present work strains of Enterococcus, Lactobacillus and Lactococcus were tested for their influence on the development of Listeria spp. on Camembert cheese. Partial or complete inhibition of growth of Listeria spp. was observed using various inhibitory bacteria. Complete inhibition occurred when the inhibitory strain was used as a starter culture and there was a low level of contamination with Listeria spp. during the first stage of ripening. Very little inhibition occurred if the inhibitory strain was added together with the starter culture.

  9. Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

    NARCIS (Netherlands)

    Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

    2009-01-01

    Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

  10. Research and identification of pathogenic bacteria 'Salmonella and Listeria' in food

    International Nuclear Information System (INIS)

    Harizi Khalil

    2009-01-01

    The sums propose to evaluate the bacterial contamination of certain food taken randomly by two pathogenic bacteria (Salmonella and Listeria) considering the evolution of the diseases of food oignon. For that 78 food samples of different origins were analysed. 2 stocks of the Listeria kind and 3 stocks of the salmonella kind were insulated and identified by biochemical and molecular tests. The pathogenic isolates were identified by coloration gram, test catalase, insulation on specific culture media and Api (20 E for Salmonella and Api listeria. At the end, the PCR were realized to amplify the gene iap which codes for the protein p60 at listeria as well as a sequence clonee randomly specific of Salmonella.

  11. Calidad de vida en adultos del Paraguay con enfermedad celiaca

    Directory of Open Access Journals (Sweden)

    Raúl Emilio Real-Delor

    2018-01-01

    Full Text Available La enfermedad celiaca altera el estado emocional, las relaciones sociales, la autonomía y la percepción de la salud, afectando la calidad de vida relacionada a la salud. Los objetivos fueron determinar la calidad de vida relacionada a la salud en adolescentes y adultos con enfermedad celiaca e investigar los factores que la afectan. Se realizó un estudio observacional, prospectivo, realizado en adolescentes y adultos del Paraguay portadores de enfermedad celiaca con al menos 6 meses en dieta sin gluten. Se aplicó el cuestionario CD-QOL. Fueron incluidos 114 sujetos, con edad media 30±10 años, siendo 58% del sexo femenino. La calidad de vida fue buena en 25%, regular en 49% y mala en 26%. Los factores asociados significativamente a mejor calidad de vida fueron el sexo femenino, el grupo etario >30 años y realizar actividades fuera del hogar. Se concluye que la calidad de vida de los celiacos adolescentes y adultos es regular en 49% de los encuestados.

  12. Microbial background flora in small-scale cheese production facilities does not inhibit growth and surface attachment of Listeria monocytogenes.

    Science.gov (United States)

    Schirmer, B C T; Heir, E; Møretrø, T; Skaar, I; Langsrud, S

    2013-10-01

    The background microbiota of 5 Norwegian small-scale cheese production sites was examined and the effect of the isolated strains on the growth and survival of Listeria monocytogenes was investigated. Samples were taken from the air, food contact surfaces (storage surfaces, cheese molds, and brine) and noncontact surfaces (floor, drains, and doors) and all isolates were identified by sequencing and morphology (mold). A total of 1,314 isolates were identified and found to belong to 55 bacterial genera, 1 species of yeast, and 6 species of mold. Lactococcus spp. (all of which were Lactococcus lactis), Staphylococcus spp., Microbacterium spp., and Psychrobacter sp. were isolated from all 5 sites and Rhodococcus spp. and Chryseobacterium spp. from 4 sites. Thirty-two genera were only found in 1 out of 5 facilities each. Great variations were observed in the microbial background flora both between the 5 producers, and also within the various production sites. The greatest diversity of bacteria was found in drains and on rubber seals of doors. The flora on cheese storage shelves and in salt brines was less varied. A total of 62 bacterial isolates and 1 yeast isolate were tested for antilisterial activity in an overlay assay and a spot-on-lawn assay, but none showed significant inhibitory effects. Listeria monocytogenes was also co-cultured on ceramic tiles with bacteria dominating in the cheese production plants: Lactococcus lactis, Pseudomonas putida, Staphylococcus equorum, Rhodococcus spp., or Psychrobacter spp. None of the tested isolates altered the survival of L. monocytogenes on ceramic tiles. The conclusion of the study was that no common background flora exists in cheese production environments. None of the tested isolates inhibited the growth of L. monocytogenes. Hence, this study does not support the hypothesis that the natural background flora in cheese production environments inhibits the growth or survival of L. monocytogenes. Copyright © 2013 American

  13. Rapid identification and source-tracking of Listeria monocytogenes using MALDI-TOF mass spectrometry.

    Science.gov (United States)

    Jadhav, Snehal; Gulati, Vandana; Fox, Edward M; Karpe, Avinash; Beale, David J; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A

    2015-06-02

    Listeria monocytogenes is an important foodborne pathogen responsible for the sometimes fatal disease listeriosis. Public health concerns and stringent regulations associated with the presence of this pathogen in food and food processing environments underline the need for rapid and reliable detection and subtyping techniques. In the current study, the application of matrix assisted laser desorption/ionisation-time-of-flight mass spectrometry (MALDI-TOF MS) as a single identification and source-tracking tool for a collection of L. monocytogenes isolates, obtained predominantly from dairy sources within Australia, was explored. The isolates were cultured on different growth media and analysed using MALDI-TOF MS at two incubation times (24 and 48 h). Whilst reliable genus-level identification was achieved from most media, identification at the species level was found to be dependent on culture conditions. Successful speciation was highest for isolates cultured on the chromogenic Agar Listeria Ottaviani Agosti agar (ALOA, 91% of isolates) and non-selective horse blood agar (HBA, 89%) for 24h. Chemometric statistical analysis of the MALDI-TOF MS data enabled source-tracking of L. monocytogenes isolates obtained from four different dairy sources. Strain-level discrimination was also observed to be influenced by culture conditions. In addition, t-test/analysis of variance (ANOVA) was used to identify potential biomarker peaks that differentiated the isolates according to their source of isolation. Source-tracking using MALDI-TOF MS was compared and correlated with the gold standard pulsed-field gel electrophoresis (PFGE) technique. The discriminatory index and the congruence between both techniques were compared using the Simpsons Diversity Index and adjusted Rand and Wallace coefficients. Overall, MALDI-TOF MS based source-tracking (using data obtained by culturing the isolates on HBA) and PFGE demonstrated good congruence with a Wallace coefficient of 0.71 and

  14. Characterization of Listeria monocytogenes isolated from Ganges water, human clinical and milk samples at Varanasi, India.

    Science.gov (United States)

    Soni, Dharmendra K; Singh, Rakesh K; Singh, Durg V; Dubey, Suresh K

    2013-03-01

    Listeria monocytogenes isolated from Ganges water, human clinical and milk samples were characterized by antibiotic susceptibility, serotype identification, detection of virulence genes and ERIC- and REP-PCR fingerprint analyses. All isolates were uniformly resistant to ampicillin, except two isolates, and showed variable resistance to gentamicin, cotrimoxazole, ofloxacin, rifampicin and tetracycline. Of the 20 isolates found positive for pathogens, seven (four human and three water isolates) belong to serogroups 4b, 4d and 4e; six (one human and five water isolates) belong to serogroups 1/2c and 3c; four milk isolates belong to serogroups 1/2b and 3b; and three milk isolates belong to serogroups 1/2a and 3a. Two water isolates, all human isolates, except one (Pb1) lacking inlJ gene, and three milk isolates possess inlA, inlC, plcA, prfA, actA, hlyA and iap genes. The remaining water and milk isolates showed variable presence of inlJ, plcA, prfA, and iap genes. ERIC- and REP-PCR based analyses collectively indicated that isolates of human clinical samples belong to identical or similar clone and isolates of water and milk samples belong to different clones. Overall study demonstrates the prevalence of pathogenic L. monocytogenes species in the environmental and clinical samples. Most of the isolates were resistant to commonly used antibiotics. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Occurrence and genetic characterization of Listeria spp. in minimally processed vegetables commercialized in Porto Alegre, Brazil

    OpenAIRE

    Verdin, Sylvia Elisa Frizzo; Silva, Silvia Regina Pavan da; Pereira, Dariane Castro; Schatkoski, Aline Modelski; Corção, Gertrudes

    2007-01-01

    Minimally processed vegetables go through many steps before they are refrigerated, selection, washing, peeling, cutting, disinfection and finally packaging. However, if no care is taken at the origin of the raw materials and in the processing stages, there is a chance of finding pathogenic bacteria, such as Listeria monocytogenes, which are able to grow at low temperatures. The aim of this research was to verify the occurrence of Listeria sp. in minimally processed vegetables sold in Porto Al...

  16. Coupling conducting polymers and mediated electrochemical responses for the detection of Listeria

    International Nuclear Information System (INIS)

    Minett, A.I.; Barisci, J.N.; Wallace, G.G.

    2003-01-01

    Different signal generation techniques were investigated for the development of a biosensor for Listeria monocytogenes. Conventional amperometry at an antibody-containing polypyrrole film electrode was found to be unsuccessful in detecting levels below 10 6 cells ml -1 . More successful was the coupling of a covalently modified film with the use of electron mediators in a single device. This sensor was capable of reproducibly detecting Listeria at levels of 10 5 cells ml -1 in 30 min

  17. The influence of Listeria monocytogenes cells on the primary immunologic response in irradiated mice

    International Nuclear Information System (INIS)

    Borowski, J.; Jokoniuk, P.

    1977-01-01

    The influence of killed Listeria monocytogenes cells on the primary immunologic response in mice irradiated with 300 or 500 R was studied. The immunologic response of the mice to sheep red blood cells used as antigen was assessed at the cellular level (by counting PFC) and humoral level. Injection of killed Listeria monocytogenes cells before irradiation of the mice diminished the immunosuppressive effect of roentgen radiation. Injection of the cells after irradiation accelerated regeneration of immunologic reactivity in the irradiated mice. (author)

  18. Distribution of the bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk

    Science.gov (United States)

    Terekhova, V. E.; Sosnin, V. A.; Buzoleva, L. S.; Shakirov, R. B.

    2010-04-01

    The Amur River’s influence on the distribution of the opportunistic bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk is discussed. The presence of Listeria in the seawater, sea ice, and sediments on the northeastern Sakhalin shelf and slope supports the idea of its connection with the Amur River discharge. The hypothesis of the allochtonic parentage of L. monocytogenes in the sea’s development is proved.

  19. FRECUENCIA DE Listeria spp., EN QUESOS COLOMBIANOS COSTEÑOS

    Directory of Open Access Journals (Sweden)

    Janneth Gallegos.

    2007-12-01

    Full Text Available Objetivo. Determinar la frecuencia de Listeria spp., en quesos frescos costeños, distribuidos en plazas de mercado populares de las ciudades de Montería y Cereté. Materiales y métodos. Teniendo en cuenta la importancia económica de esta zona ganadera para Colombia se tomaron 217 muestras entre Junio y Agosto de 2005, los aislamientos obtenidos fueron identificados por pruebas bioquímicas presuntivas, PCRMúltiple (L1-U1/LF-LR y pruebas bioquímicas para confirmación de especie. Adicionalmente, se determinó la frecuencia de las especies del género y se caracterizó la resistencia antimicrobiana de las cepas de mayor frecuencia. Resultados. Las pruebas bioquímicas y la PCR detectaron 49 aislamientos positivos para Listeria (22.58%, de los cuales 16.33% (8/49 correspondieron a Montería y 24.40% (41/168 a Cereté. La frecuencia por especies fue 14.75% para L. ivanovii, 2.30% para L. innocua, 1.84% para L. welshimeri y 1.38% para L. seeligeri, no se detectó L. monocytogenes. Sólo 3/32 cepas de L. ivanovvi (9.38% mostraron resistencia a penicilina, estreptomicina y eritromicina respectivamente. Conclusiones. Los resultados confirman que los quesos costeños están frecuentemente contaminados con Listeria spp. La presencia de L. ivanovii patógeno involucrado en algunos casos de infecciones oportunistas en humanos y L. innocua; microorganismo utilizado en muchas industrias de alimento como indicador del grado o calidad de sanitización; demuestra que las condiciones de producción y expendio no son adecuadas y que el consumo de queso costeño no es seguro. La resistencia antimicrobiana aunque baja muestra posibilidades para la transmisión horizontal y/o vertical de los genes de resistencia.

  20. Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

    Science.gov (United States)

    Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

    2012-06-01

    The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

  1. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  2. Salud masculina: estilo de vida, enfermedades y riesgos

    Directory of Open Access Journals (Sweden)

    Richard S. Pelman, MD

    2014-01-01

    Full Text Available Los hombres de todo el mundo siguen teniendo tasas más altas de morbilidad y mortalidad que su contraparte femenina. El resultado de esto es que los hombres viven menos y de forma menos sana, lo que impacta a las familias, comunidades, economías y sociedades. La mayoría de las causas subyacentes están relacionadas con estilos de vida evitables y modificables elegidos por los hombres. Las epidemias causadas por obesidad y diabetes están directamente relacionadas con el tabaquismo, mala alimentación, exceso de consumo de alcohol, y estilos de vida sedentarios. Si los médicos y autoridades responsables desean cambiar realmente el mal estado de salud de los hombres, deben concentrarse en las enfermedades evitables que son resultado de estilos de vida y comportamientos.

  3. SEXUALIDADE E SUAS VICISSITUDES NA ESCOLHA DE VIDA RELIGIOSA CONSAGRADA

    Directory of Open Access Journals (Sweden)

    Nilvete Soares Gomes

    2015-12-01

    Full Text Available ResumoA sexualidade humana, por vezes, se traduziu e se traduz num fenômeno complexo. Se no cenário sociocultural se encontram impasses para uma compreensão eximida de tabus da sexualidade, considera-se desafio maior quando se trata da sexualidade no contexto religioso. Para jovens religiosas, as reais motivações para a escolha de vida consagrada poderão não estar evidentes. Este ensaio teórico propõe explorar elementos que possibilitam compreender como se dá a vivência da sexualidade, suas vicissitudes e os atravessamentos da escolha de vida religiosa consagrada. O estudo discute o conceito de sublimação, conforme teoria psicanalítica freudiana, a fim de subsidiar reflexões para institutos de vida consagrada e comunidade científica acerca das vicissitudes da sexualidade.

  4. Conceptos y definiciones de la vida y la muerte celular Conceptos y definiciones de la vida y la muerte celular

    Directory of Open Access Journals (Sweden)

    Fernando Anaya Velázquez

    2012-02-01

    Full Text Available En el presente trabajo se revisa la información científica sobre las definiciones y conceptos sobre la vida y la muerte celular. Se describen las características generales de la vida biológica y los seres vivos, así como de la muerte celular. Aunque se sabe cómo ocurre la vida y la muerte de las células aún no se tiene una definición precisa de qué es la vida y qué es la muerte biológica. Finalmente, derivado de los recientes avances en la genómica sintética, se concluye que es necesario actualizar los conceptos y definiciones sobre la vida y la muerte en la biología. In the present work scientific concepts and definitions about life and cell death are revised.General properties of biological life and live organisms as well as cellular death are described.Although it is known how life and death occur in cells, a convincing definition is stilllacking on what are biological life and death. Finally, the recent reported experiments onsynthetic genomics raise the importance to updating concepts and definitions of life anddeath in biology.

  5. Detection of Listeria spp. in food handling areas of retail food stores in the state of Pernambuco, Brazil

    Directory of Open Access Journals (Sweden)

    Mariana Gomes Ferreira Machado de Siqueira

    2017-07-01

    Full Text Available Abstract The identification of Listeria spp. in food handling areas is of great concern to health surveillance agencies, and their control is often hampered by the ability of the bacteria to grow and maintain themselves even under adverse conditions. The present study aimed to isolate and identify Listeria spp. in the food handling areas of 10 retail food stores in the state of Pernambuco, Brazil. Eighty-six swab samples were collected from equipment, utensils and surfaces used for processing ready-to-eat meat products. The Dry and Wet Swabbing Methods (3M™ Quick Swabs and 3M™ Petrifilm™ Plates were used to identify Listeria spp. Contamination by Listeria monocytogenes was confirmed by the Real-time Polymerase Chain Reaction (qPCR. The hygienic and sanitary conditions of the food handling areas of each store were also assessed. Listeria spp. was isolated in eight stores (80%. Of the 86 swab samples analyzed, 27 (31.2% [confidence interval 21.81% to 42.30%] were positive for Listeria spp. and only one (3.7% was confirmed as Listeria monocytogenes. The main contamination sites were the floor (50.0%, the plastic cutting board (42.9% and the knife (40.0%. None of the hygienic and sanitary conditions assessed in the present study were associated with contamination by Listeria spp. (p = 0.700. It was concluded that Listeria spp. was widely distributed in the retail food stores studied, being a possible risk factor for public health.

  6. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    DEFF Research Database (Denmark)

    Gaini, Shahin

    2015-01-01

    A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

  7. A última escolha: repensar a morte em vida

    OpenAIRE

    Roque, Margarida Abenta

    2010-01-01

    Tese de mestrado, Filosofia, Universidade de Lisboa, Faculdade de Letras, 2010 A presente dissertação de mestrado em Filosofia, intitulada A última escolha: repensar a morte em vida, consistirá numa análise expositiva de natureza ética das opções de final de vida que se colocam aos indivíduos doentes ou em estado terminal, abstendo-se de juízos de matriz legal ou jurídica. Tomando Peter Singer como autor de referência intelectual nesta dissertação, o nosso ponto de partida cons...

  8. Infertilidad masculina, estilo de vida y nutrición

    OpenAIRE

    Velicia Izquierdo, Andrea

    2012-01-01

    La reproducción es un aspecto de vital importancia en nuestras vidas. Por ello, es importante analizar la posible relación de los estilos de vida actuales, con el aumento de la infertilidad masculina en las últimas décadas. Material y métodos: Se llevó a cabo una búsqueda exhaustiva en las principales bases de datos científicas (Pubmed, Science direct y The Cochrane Library). Se descartaron los estudios que no cumplían los criterios de inclusión, y se procedió a analizar los resultados de ...

  9. Calidad de vida y discapacidad auditiva en Chile

    OpenAIRE

    Suazo Díaz, Pilar

    2016-01-01

    [ES] La pérdida auditiva es una discapacidad sensorial que genera diversas dificultades en el desarrollo biopsicosocial de las personas que la padecen, pudiendo afectar a su calidad de vida. La investigación que se presenta buscó describir y analizar la percepción de calidad de vida (CV) de las personas en situación de discapacidad auditiva de Chile. Para este efecto, se utilizó metodología mixta explicativa secuencial. En el abordaje cuantitativo participaron 102 personas con pérdidas de...

  10. Factores determinantes de la esperanza de vida en Chile

    Directory of Open Access Journals (Sweden)

    Planck Barahona-Urbina

    2011-12-01

    Full Text Available Introducción: En las últimas décadas, Chile ha experimentado un fuerte crecimiento económico, lo que ha permitido mejorar las condiciones de vida de los ciudadanos. Objetivos: Determinar los factores asociados a la esperanza de vida en Chile. Diseño: Análisis econométrico. Lugar: Chile. Intervenciones: Aplicación del modelo de regresión múltiple con series temporales para el análisis de la esperanza de vida en Chile. Se utilizó datos de naturaleza agregada del Instituto Nacional de Estadística (INE y el Banco Central de Chile para el período comprendido entre 1988 y 2008. Se utilizó como variable dependiente la esperanza de vida en años y, como variables explicativas, el PIB per cápita, número de médicos, número de enfermeras y gasto público en salud. Principales medidas de resultados: Factores asociados a la esperanza de vida. Resultados: Luego del análisis, los resultados han puesto de manifiesto que el ingreso per cápita, el número de médicos, número de enfermeras y el gasto en salud resultaron ser estadísticamente significativos, es decir, tienen un efecto positivo sobre la esperanza de vida de las personas. Conclusiones: A la luz de los resultados podría argumentarse lo beneficioso que puede resultar en términos cuantitativos un aumento del PIB per cápita a la hora de conseguir una mayor esperanza de vida de las personas. Igualmente, los resultados sugieren el efecto positivo que produce un incremento del número de personal médico en el país dado, pues esta variable ha permitido satisfacer la demanda sanitaria cada vez más creciente de la población. El aumento del presupuesto social en salud ha sido una variable que ha tenido un resultado positivo a la hora de valorar su efecto en la mejora de las condiciones de vida en Chile.

  11. La asistencia al final de la vida: la ortotanasia

    OpenAIRE

    Gamarra, Maria del Pilar

    2011-01-01

    La muerte es un hecho natural e inevitable, que pone fin a la vida. En un sistema sanitario construido sobre el modelo de la terapia curativa, los profesionales de la salud han sido formados y han desarrollado su actividad como si el proceso de la muerte no existiera.Muchos profesionales no tienen incorporada la actuación en el abordaje del paciente en el final de su vida, cómo comunicar la verdad de la situación irreversible, los tratamientos paliativos y el apoyo emocional al paciente y a s...

  12. Personalidades vocacionais e processos de carreira na vida adulta

    OpenAIRE

    Magalhães, Mauro de Oliveira; Gomes, William B.

    2007-01-01

    Esta pesquisa abordou a relação entre interesses vocacionais e os processos de comprometimento e entrincheiramento na carreira em diferentes fases da vida. Uma amostra de 733 profissionais (415 homens e 318 mulheres) respondeu a medidas de comprometimento e de entrincheiramento na carreira. Os sujeitos foram categorizados de acordo com o interesse vocacional predominante na tipologia de Holland. As análises revelaram interação entre estágio de vida e personalidade vocacional para os escores d...

  13. Tres enfoques Deontológicos Acerca de la Vida

    Directory of Open Access Journals (Sweden)

    Edgar Antonio López

    2007-01-01

    Full Text Available Este artículo presenta tres aproximaciones deontológicas a algunos problemas referidos al comienzo, el fin y la reproducción de la vida humana, así como a la preservación de la vida -humana y no humana- en el planeta. En primer lugar se presenta la deontología clásica de Kant y luego las deontologías contemporáneas de Hans Jonas y de Jürgen Habermas.

  14. Una biografía inmoral: La vida de Aldao

    OpenAIRE

    Manzoni, Celina

    2011-01-01

    Las escrituras del yo, cuyo valor documental es innegable en la cultura americana del siglo XIX, realizan en Sarmiento un peculiar deslizamiento entre lo autobiográfico y lo biográfico. Los pasa- jes desde la escritura de la propia vida, que lee- mos en Mi defensa de 1843 y en Viajes de 1849, a la escritura de la vida de los otros (en Aldao y Facundo , ambos de 1845), parecen culminar en Recuerdos de provincia que logra reunir los dos mov...

  15. Formas de Vida Economica en el Arte Rupestre Levantino

    Directory of Open Access Journals (Sweden)

    Francisco JORDÁ CERDÁ

    2009-10-01

    Full Text Available Parece fuera de toda duda que las pinturas rupestres levantinas, dado su carácter eminentemente narrativo e historicista, son una buena fuente de información para estudiar la vida y costumbres de los pueblos entre los que vivían los artistas que las realizaron. En sus múltiples y variadas escenas nos encontramos con fragmentos de su vida diaria, de sus actividades económicas e incluso podemos atisbar los rasgos de su organización social y de sus ideas religiosas.

  16. Phages of Listeria offer novel tools for diagnostics and biocontrol

    Directory of Open Access Journals (Sweden)

    Martin J Loessner

    2014-04-01

    Full Text Available Historically, bacteriophages infecting their hosts have perhaps been best known and even notorious for being a nuisance in dairy-fermentation processes. However, with the rapid progress in molecular microbiology and microbial ecology, a new dawn has risen for phages. This review will provide an overview on possible uses and applications of Listeria phages, including phage-typing, reporter phage for bacterial diagnostics, and use of phage as biocontrol agents for food safety. The use of phage-encoded enzymes such as endolysins for the detection and as antimicrobial will also be addressed. Desirable properties of candidate phages for biocontrol will be discussed. While emphasizing the enormous future potential for applications, we will also consider some of the intrinsic limitations dictated by both phage and bacterial ecology.

  17. Spontaneous Bacterial Peritonitis Caused by Infection with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Michael Vincent F. Tablang

    2008-11-01

    Full Text Available Spontaneous bacterial peritonitis is a severe and life-threatening complication in patients with ascites caused by advanced liver disease. The organisms most commonly involved are coliform bacteria and third-generation cephalosporins are the empiric antibiotics of choice. This is an uncommon case of spontaneous bacterial peritonitis caused by Listeria monocytogenes in a female patient with liver cirrhosis from autoimmune hepatitis. She did not improve with ceftriaxone and her course was complicated by hepatic encephalopathy, seizures and multi-organ failure. This case emphasizes that a high index of suspicion should be maintained for timely diagnosis and treatment. Listerial peritonitis should be suspected in patients with end-stage liver disease and inadequate response to conventional antibiotics within 48–72 h. Ampicillin/sulbactam should be initiated while awaiting results of ascitic fluid or blood culture.

  18. Inactivation of Listeria monocytogenes in milk by pulsed electric field.

    Science.gov (United States)

    Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

    1998-09-01

    Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

  19. Review of Prosthetic Joint Infection from Listeria monocytogenes.

    Science.gov (United States)

    Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

    2016-12-01

    Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

  20. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  1. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio

    2014-02-01

    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  2. Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Analía L. Laciar

    2000-03-01

    Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

  3. Combination of endolysins and high pressure to inactivate Listeria monocytogenes.

    Science.gov (United States)

    van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F

    2017-12-01

    Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

    Science.gov (United States)

    Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

    2017-06-01

    Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. EL ARTE ES VIDA Y LA VIDA ES ARTE: LA PINTURA DE JOSÉ DEL CARMEN HERNÁNDEZ

    Directory of Open Access Journals (Sweden)

    Bogdan Piotrowski

    2014-01-01

    Full Text Available Se presenta aquí la obra artística de José del Carmen Hernández desde la premisa según la cual, al valorar su pintura podemos hablar del arte de la vida y de la vida artística plena. Se resalta su esforzada trayectoria de vida que lo ha llevado desde un humilde origen campesino hasta la formación artística académica y a través de tertulias de artistas en diferentes partes del mundo. Al destacar su obra pictórica, escultórica, mural y abstracta, se concluye con el vínculo actual del artista con su propia realidad y la esperanza como motor de su obra frente a la constata - ción de las violencias persistentes.

  6. VIDA, VOLUNTAD DE PODER Y DESAPROPIACION: UNA LECTURA SOBRE LA NOCION MADURA-TARDIA DE VIDA EN NIETZSCHE

    OpenAIRE

    TERRA POLANCO, CONSTANZA

    2012-01-01

    La presente investigación tiene como propósito indagar el concepto de vida en Nietzsche presente en su obra madura-tardía y póstuma. Este concepto de vida nietzscheano fue engendrado a la par de uno de sus pensamientos más célebres, a saber, la voluntad de poder. De esta manera, esta tesis se concentrará en la lectura, análisis e interpretación de la idea de vida en Nietzsche a la luz de la voluntad de poder. Lo que se propone en esta tesis es, por un lado, determinar qué se...

  7. La conciliación de la vida laboral y familiar como proyecto de calidad de vida desde la igualdad

    OpenAIRE

    Papí Gálvez, Natalia

    2005-01-01

    Artículo inserto en dos proyectos subvencionados por el Instituto de la Mujer: «El género en el desarrollo socioeconómico. Los perfiles laborales y la calidad de vida: Un estudio dinámico», BOE 15/02/2001, y «La mujer en la empresa publicitaria. Políticas de conciliación de la vida familiar y laboral. En torno al techo de cristal», BOE 30/01/2004.

  8. Vida política y vida literaria : inventario de 1902-1931

    Directory of Open Access Journals (Sweden)

    José Carlos Mainer

    1993-01-01

    Full Text Available Los treinta años de vida española que transcurren de 1902 a 1931 constituyen un período de conflictos —latentes o expresos— a los que caracteriza, por encima de todo, una conciencia de frustración histórica y a los que sacuden las búsquedas extremistas de solución para los males de la patria: de raíz autoritaria y tradicionalista las unas, de ascedencia milenarista y utópica las otras, de corte europeizante y modernizador aquellas pocas. Todas se empeñan en resolver a su modo términos del problema que son sustancialmente idénticos y que casi siempre reconocen como punto de partida el dilema tradición-innovación. Ninguna, empero, logra prevalecer sobre las otras y si lo hace es tributando enormes tensiones a la convivencia nacional y propiciando aquella idea —que no deja de ser una forma de ideológica percepción del país— que siente la coexistencia difícil de varias Españas; la imagen federal frente a la unitaria, la católica frente a la laica, la europea frente a la etnocéntrica, la rural frente a la urbana, la racionalista frente a la intuitiva.

  9. ASPECTOS DA VIDA COTIDIANA NA VIDA DO TRABALHADOR: O ESTRANHAMENTO DO TRABALHO E DA CIDADE

    Directory of Open Access Journals (Sweden)

    Leonardo Luiz Cordeiro Ferreira da Silva

    2017-07-01

    Full Text Available A vida cotidiana do trabalhador da atual sociedade é marcada pela falta de tempo, não lhe sobrando muito tempo para desempenhar outras atividades sem que sejam as profissionais. Parte deste tempo, o trabalhador usa para se deslocar de casa ao trabalho e para volta a casa, evidenciando um modelo precário de transporte público. Além deste excessivo tempo gasto no transporte público, acrescenta-se o fato de como a sociedade moderna coloca o trabalho como atividade central (DAL ROSSO, 2006, desta maneira, a cultura do trabalho como atividade central afasta o ser humano de si, retirando-os o tempo para atividades de lazer, cuidados com suas saúdes, cuidado com a casa, com os filhos e familiares, para estudos e qualificação. Assim sendo, será aqui analisado como esta falta de tempo contribui para alienação e estranhamento deste trabalhador.

  10. Fatores associados com a qualidade de vida de homens idosos

    Directory of Open Access Journals (Sweden)

    Darlene Mara dos Santos Tavares

    2013-06-01

    Full Text Available Inquérito domiciliário, transversal e analítico que objetivou descrever as características sociodemográficas, de saúde e a qualidade de vida de homens idosos e verificar os fatores socioeconômicos e de saúde associados à qualidade de vida. Participaram 804 homens idosos. Os dados foram coletados pelos instrumentos: Older Americans Resources and Services(OARS, World Health Organization Quality of Life - Bref (WHOQOL-BREF e Health Organization Quality of Life Assessment for Older Adults(WHOQOL-OLD. Foram realizados análise descritiva, teste t-Student, correlação de Pearson e regressão linear múltipla (p <0,05. Predominaram idosos com 60├ 70 anos, casados, 4├ 8 anos de estudo e renda de um salário mínimo. Os menores escores de qualidade de vida foram no domínio físico e na faceta autonomia e estiveram associados a ausência de companheira e de escolaridade, baixa renda, maior número de morbidades e incapacidade funcional. A incapacidade funcional foi o que mais influenciou a qualidade de vida, excetuando-se o domínio físico e a faceta intimidade.

  11. Estilo de vida y enfermedad cardiovascular en el hombre

    Directory of Open Access Journals (Sweden)

    Dr. I. Rafael Rondanelli

    2014-01-01

    Los cambios hacia un estilo de vida cardiosaludable en el hombre adulto, deberían comenzar por el control médico preventivo a partir de los 30 años de edad y considerar en general, actividad física regular, nutrición cardiosaludable, suspensión completa del tabaquismo y control del peso corporal.

  12. Qualidade de vida, ponto de partida ou resultado final?

    Directory of Open Access Journals (Sweden)

    Alby Duarte Rocha

    Full Text Available O que é qualidade de vida e o quanto podemos medir dela? Pensa-se em qualidade de vida como resultado das políticas públicas e desenvolvimento de uma sociedade, onde os determinantes socioambientais se manifestam como atributo de seus atores. Ao mesmo tempo, pode-se entender esta idéia no outro extremo da análise, a partir da percepção de uma população protagonista de sua realidade, do que vem a ser qualidade de vida segundo ela mesma. Partindo-se dos aspectos conceituais de qualidade de vida, passou-se a adotar os conceitos de diferenciais intra-urbanos como a melhor maneira de caracterizar os desajustes e as desigualdades urbanas, para assim entender os componentes da iniqüidade desse meio. A primeira iniciativa marcou a utilização do método genebrino ou distancial. Hoje, já na segunda versão desse método, incorporou-se a esse contexto outras metodologias que possibilitam maior consistência de análise para ampliar a validade dessas medições. Soma-se a esse contexto, a análise de cluster e o Sistema de Informações Geográficas, tanto no cenário intra-urbano, quanto intermunicipal.

  13. De una vida amenazada a una vida anhelada: Atisbos a una teología de la vida en diálogo con la literatura

    Directory of Open Access Journals (Sweden)

    Alberto Toutin

    2007-01-01

    Full Text Available En el seminario interno de la Facultad nos hemos interrogado acerca de la vida, ese misterio fascinante y vulnerable a la vez. En ese marco, hemos querido escuchar la voz de los escritores, en dos novelas. Pedro Páramo (1955 del escritor mexicano Juan Rulfo (1917-1986 y La Amortajada (1938 de la escritora chilena María Luisa Bombal (1910-1980. En ambos casos sus protagonistas nos hablan desde el otro lado del sentido de la vida, desde la muerte, pero para radicalizar la pregunta acerca del sentido de la vida, de los encuentros que las han marcado, del cuerpo como mediación de esos encuentros. Un diálogo desde estas figuras del más allá de la vida en las que resuenan con una honda actualidad las grandes temáticas escatológicas de la teología paulina, acerca de la vida eterna como un estar para siempre con el Señor, y acerca del cuerpo con el que resucitaremosLife, that mystery at once fascinating and vulnerable, was examined at a recent faculty seminar. Within this framework, the author of this article endeavors to listen to the voice of the writers of two novels: Pedro Páramo (1955 by the Mexican writer Juan Rulfo (1917-1986, and La amortajada ["The Shrouded Woman"] (1938 by the Chilean writer María Luisa Bombal (1910-1980. In both cases the literary characters speak to us from the other side of the grave, in order to radicalize questions about life, about the meetings that have marked the characters, about the body as mediation of those meetings. Thus, a dialogue emerges from these figures beyond life, in which the great eschatological themes of Pauline theology resonate forcefully and, at the same time, permit a deep reflection upon eternal life as always being with the Lord, as well as regarding the kind of body with which we will rise again

  14. Occurrence of Listeria spp. in retail meat and dairy products in the area of Addis Ababa, Ethiopia.

    Science.gov (United States)

    Derra, Firehiwot Abera; Karlsmose, Susanne; Monga, Dharam P; Mache, Abebe; Svendsen, Christina Aaby; Félix, Benjamin; Granier, Sophie A; Geyid, Abera; Taye, Girum; Hendriksen, Rene S

    2013-06-01

    Listeriosis, a bacterial disease in humans and animals, is mostly caused by ingestion of Listeria monocytogenes via contaminated food and/or water, or by a zoonotic infection. Globally, listeriosis has in general a low incidence but a high case fatality rate. The objective of this study was to investigate the occurrence, antimicrobial profiles, and genetic relatedness of L. monocytogenes from raw meat and dairy products (raw milk, cottage cheese, cream cake), collected from the capital and five neighboring towns in Ethiopia. Two hundred forty food samples were purchased from July to December 2006 from food vendors, shops, and supermarkets, using a cross-sectional study design. L. monocytogenes were isolated and subjected to molecular serotyping. The genetic relatedness and antimicrobial susceptibility patterns were investigated using pulsed-field gel electrophoresis (PFGE) and minimum inhibitory concentration determinations. Of 240 food samples tested, 66 (27.5%) were positive for Listeria species. Of 59 viable isolates, 10 (4.1%) were L. monocytogenes. Nine were serotype 4b and one was 2b. Minimum inhibitory concentration determination and PFGE of the 10 L. monocytogenes isolates showed low occurrence of antimicrobial resistance among eight different PFGE types. The findings in this study correspond to similar research undertaken in Ethiopia by detecting L. monocytogenes with similar prevalence rates. Public education is crucial as regards the nature of this organism and relevant prevention measures. Moreover, further research in clinical samples should be carried out to estimate the prevalence and carrier rate in humans, and future investigations on foodborne outbreaks must include L. monocytogenes.

  15. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.

    Science.gov (United States)

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed

    2016-12-15

    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Atitude religiosa e sentido da vida: um estudo correlacional

    Directory of Open Access Journals (Sweden)

    Thiago Antônio Avellar de Aquino

    Full Text Available A presente pesquisa abordou o sentido da vida (Viktor Frankl e a atitude religiosa. Para a logoterapia, a religiosidade não significa necessariamente a opção por uma crença religiosa, mas pode ser uma das possíveis maneiras de o homem encontrar sentido para a vida. O objetivo deste estudo foi investigar a relação entre o sentido de vida e a atitude religiosa de forma transversal e correlacional. A amostra foi composta por 300 sujeitos de ambos os sexos, 37% homens e 63% mulheres, com idade média de 42 anos. Os instrumentos utilizados foram o Teste Propósito de Vida (PIL-Test, de James C. Crumbauch e Leonard T. Maholick, e a Escala de Atitude Religiosa/Espiritualidade, de Aquino. Os resultados apontam correlações positivas entre a atitude religiosa e a realização existencial, a atitude religiosa e a idade, o desespero existencial e o vazio existencial e a realização existencial e a idade, havendo também correlações negativas entre a atitude religiosa e o desespero existencial, a atitude religiosa e o vazio existencial, o desespero existencial e a realização existencial e o vazio existencial e a realização existencial. Concluiu-se que a atitude religiosa é uma forma de encontro de sentido de vida bem como um elemento de prevenção do vazio existencial e do desespero existencial.

  17. Encontros e confrontos entre a vida e o direito

    Directory of Open Access Journals (Sweden)

    Simone Maria Hüning

    2014-09-01

    Full Text Available Nosso objetivo é discutir os processos de objetivação, desqualificação e criminalização de uma comunidade tradicional de pescadores situada na orla urbana de Maceió, que trava uma luta contra a prefeitura municipal pelo direito à permanência e por investimentos nesse território. Com base nas pesquisas de Michel Foucault, propomos uma problematização dessas formas de objetivação, subjetivação e governo, analisando práticas e saberes que incidem sobre essa comunidade. Usamos registros produzidos em quatro anos de trabalho com essa comunidade, bem como documentos e materiais midiáticos que abordam o conflito. Discutimos a judicialização da vida em torno de dois aspectos: a discursos que operam como condições de possibilidade para sustentar a proposta de remoção dessa comunidade de seu território; b estratégias de resistência que afirmam a especificidade da vida nesse lugar. Trazemos esta situação para o debate sobre a judicialização da vida buscando não apenas problematizar as circunstâncias em que se passa a demandar mais intervenção jurídica no governo da vida, mas também afirmar que o que está em jogo nessa situação não é a mera aplicação e cumprimento da lei, e sim, os modos de vida dessa comunidade que confrontam a lógica de investimento e desenvolvimento urbano da cidade.

  18. El ser humano, su proyecto de vida vs. Calidad de vida en el trabajo como mediación

    Directory of Open Access Journals (Sweden)

    Janis S. Gelves Peña

    2010-01-01

    Full Text Available Resumen:El Trabajo, en el ser humano, media las diferentes percepciones socioculturales, y puede ser el comienzo deanálisis personal para un autoconocimiento profundo. También puede ayudar para que los proyectos de vida de lostrabajadores sean construidos en la inter-fase individual y social, siempre suponiendo una intervención conjuntade elementos afectivos, cognitivos y sociales. Un proyecto de vida tiende a caracterizarse como la realizaciónde una vocación, representando el más armonioso encuentro posible entre las aspiraciones individuales y losPalabras Claves:Proyecto de Vida, Ser Humano, Educación, Calidad de Vida en el Trabajo, Satisfacción, Mediación.AbstractWork in humans, mediates the socio-cultural perceptions, and may be the beginning of personal analysis fora deeper self-knowledge. It can also help to ensure that projects of life of workers are constructed in the interindividualand social stage, always assuming a joint intervention of elements affective, cognitive and social. Aproject of life tends to be characterized as the realization of a vocation, representing the most harmonious meetingforemost as human being.Keywords:Life Project, Human Being, Education, Quality of Working Life, Satisfaction, Mediation.

  19. 9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.

    Science.gov (United States)

    2010-01-01

    ... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...

  20. Complete genome sequence of Listeria monocytogenes strain MR310, isolated from a pastured-flock poultry farm system

    Science.gov (United States)

    Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...

  1. DERECHO A LA VIDA DIGNA EL CONCEPTO JURÍDICO DEL DOLOR DESDE EL DERECHO CONSTITUCIONAL

    OpenAIRE

    Gustavo Adolfo García Arango

    2007-01-01

    El concepto jurídico del dolor desde el derecho constitucional ha sido abarcado en una sola perspectiva: el reconocimiento del derecho fundamental a la vida, en condiciones dignas. El derecho a la vida se ve afectado por conexidad:cuando el dolor no permite lleva una vida equilibrada en todos sus aspectos, permite la protección constitucional a la vida. Se entiende que el cuerpo es el elemento central en una teoría sobre la vida digna; un cuerpo sufriente, enfermo es un cuerpo limitado y cond...

  2. Mode of antimicrobial action of vanillin against Escherichia coli, Lactobacillus plantarum and Listeria innocua.

    Science.gov (United States)

    Fitzgerald, D J; Stratford, M; Gasson, M J; Ueckert, J; Bos, A; Narbad, A

    2004-01-01

    To investigate the mode of action of vanillin, the principle flavour component of vanilla, with regard to its antimicrobial activity against Escherichia coli, Lactobacillus plantarum and Listeria innocua. In laboratory media, MICs of 15, 75 and 35 mmol l(-1) vanillin were established for E. coli, Lact. plantarum and L. innocua, respectively. The observed inhibition was found to be bacteriostatic. Exposure to 10-40 mmol l(-1) vanillin inhibited respiration of E. coli and L. innocua. Addition of 50-70 mmol l(-1) vanillin to bacterial cell suspensions of the three organisms led to an increase in the uptake of the nucleic acid stain propidium iodide; however a significant proportion of cells still remained unstained indicating their cytoplasmic membranes were largely intact. Exposure to 50 mmol l(-1) vanillin completely dissipated potassium ion gradients in cultures of Lact. plantarum within 40 min, while partial potassium gradients remained in cultures of E. coli and L. innocua. Furthermore, the addition of 100 mmol l(-1) vanillin to cultures of Lact. plantarum resulted in the loss of pH homeostasis. However, intracellular ATP pools were largely unaffected in E. coli and L. innocua cultures upon exposure to 50 mmol l(-1) vanillin, while ATP production was stimulated in Lact. plantarum cultures. In contrast to the more potent activity of carvacrol, a well studied phenolic flavour compound, the extent of membrane damage caused by vanillin is less severe. Vanillin is primarily a membrane-active compound, resulting in the dissipation of ion gradients and the inhibition of respiration, the extent to which is species-specific. These effects initially do not halt the production of ATP. Understanding the mode of action of natural antimicrobials may facilitate their application as natural food preservatives, particularly for their potential use in preservation systems employing multiple hurdles.

  3. A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.

    Science.gov (United States)

    Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan

    2016-04-01

    A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

  4. Faecal shedding and strain diversity of Listeria monocytogenes in healthy ruminants and swine in Northern Spain

    Directory of Open Access Journals (Sweden)

    Hurtado Ana

    2009-01-01

    Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.

  5. Modeling the growth of Listeria monocytogenes in mold-ripened cheeses.

    Science.gov (United States)

    Lobacz, Adriana; Kowalik, Jaroslaw; Tarczynska, Anna

    2013-06-01

    This study presents possible applications of predictive microbiology to model the safety of mold-ripened cheeses with respect to bacteria of the species Listeria monocytogenes during (1) the ripening of Camembert cheese, (2) cold storage of Camembert cheese at temperatures ranging from 3 to 15°C, and (3) cold storage of blue cheese at temperatures ranging from 3 to 15°C. The primary models used in this study, such as the Baranyi model and modified Gompertz function, were fitted to growth curves. The Baranyi model yielded the most accurate goodness of fit and the growth rates generated by this model were used for secondary modeling (Ratkowsky simple square root and polynomial models). The polynomial model more accurately predicted the influence of temperature on the growth rate, reaching the adjusted coefficients of multiple determination 0.97 and 0.92 for Camembert and blue cheese, respectively. The observed growth rates of L. monocytogenes in mold-ripened cheeses were compared with simulations run with the Pathogen Modeling Program (PMP 7.0, USDA, Wyndmoor, PA) and ComBase Predictor (Institute of Food Research, Norwich, UK). However, the latter predictions proved to be consistently overestimated and contained a significant error level. In addition, a validation process using independent data generated in dairy products from the ComBase database (www.combase.cc) was performed. In conclusion, it was found that L. monocytogenes grows much faster in Camembert than in blue cheese. Both the Baranyi and Gompertz models described this phenomenon accurately, although the Baranyi model contained a smaller error. Secondary modeling and further validation of the generated models highlighted the issue of usability and applicability of predictive models in the food processing industry by elaborating models targeted at a specific product or a group of similar products. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Cycles of light and dark co-ordinate reversible colony differentiation in Listeria monocytogenes.

    Science.gov (United States)

    Tiensuu, Teresa; Andersson, Christopher; Rydén, Patrik; Johansson, Jörgen

    2013-02-01

    Recently, several light receptors have been identified in non-phototrophic bacteria, but their physiological roles still remain rather elusive. Here we show that colonies of the saprophytic bacterium Listeria monocytogenes undergo synchronized multicellular behaviour on agar plates, in response to oscillating light/dark conditions, giving rise to alternating ring formation (opaque and translucent rings). On agar plates, bacteria from opaque rings survive increased levels of reactive oxygen species (ROS), as well as repeated cycles of light and dark, better than bacteria from translucent rings. The ring formation is strictly dependent on a blue-light receptor, Lmo0799, acting through the stress-sigma factor, σ(B) . A transposon screening identified 48 mutants unable to form rings at alternating light conditions, with several of them showing a decreased σ(B) activity/level. However, some of the tested mutants displayed a varied σ(B) activity depending on which of the two stress conditions tested (light or H(2) O(2) exposure). Intriguingly, the transcriptional regulator PrfA and the virulence factor ActA were shown to be required for ring formation by a mechanism involving activation of σ(B) . All in all, this suggests a distinct pathway for Lmo0799 that converge into a common signalling pathway for σ(B) activation. Our results show that night and day cycles co-ordinate a reversible differentiation of a L. monocytogenes colony at room temperature, by a process synchronized by a blue-light receptor and σ(B) . © 2013 Blackwell Publishing Ltd.

  7. A batuta da morte a orquestrar a vida

    Directory of Open Access Journals (Sweden)

    Altair Macedo Lahud Loureiro

    Full Text Available Com colocações de outros estudiosos da morte, teço e apresento apontamentos rápidos sobre a morte a organizar a vida. Esposo a idéia da necessidade da morte para que a vida tenha sentido nesta busca humana da completude. Endereço o olhar para uma situação especial de relação com a morte: a reação dos que ficam ao presenciar e sentir a morte de um dos seus idosos; daquele familiar, ou não, que assume o seu cuidado e acompanha o seu fim iminente; que presencia, humanamente impotente, a hora da solitária partida. Solitária morte, pois que exclusiva, própria daquele idoso do qual cuidava, do seu fim natural, por ser humano.

  8. El 98 en La Habana: sociedad y vida cotidiana

    Directory of Open Access Journals (Sweden)

    Barcia Zequeira, María del Carmen

    1998-04-01

    Full Text Available The author discusses the situation in Havana in the 1890's, specifically the city's everyday life before after the blockade by the U. S. fleet. She emphasizes the living conditions of anonymous men and women, the main actors in that complex time and place divided by class and ethnicity as well as gender.

    En este artículo se aborda la situación de La Habana a finales de los años noventa y específicamente la vida cotidiana antes y durante el bloqueo establecido por la flota de los Estados Unidos. Se hace hincapié en la vida de los hombres y mujeres anónimos que fueron los principales actores de aquella compleja etapa y en este contexto se destacan los elementos clasistas, étnicos y de género.

  9. Decisiones al final de la vida en México

    Directory of Open Access Journals (Sweden)

    Edith González Moreno

    2015-01-01

    Full Text Available El presente ensayo aborda el tema de las decisiones al final de la vida en México (incluyendo el tema de la muerte medi - camente asistida. 2 Las reflexiones parten de algunos indicadores nacionales de mortalidad en nuestro país, donde el fenómeno de muerte en hospitales está apenas siendo igualado al número de muertes que venían ocurriendo fuera de ellos. Por lo anterior y a diferencia de otros países, el foco de atención en las cuestiones relacionadas con el final de la vida no deberá centrarse exclusivamente en el ámbito hospitalario. También se presentan algunos argumentos internacionales, elementos de la legislación vigente, así como la influencia de los paternalismos médico y jurídico en México.

  10. Vitamin D and asthma-life after VIDA?

    Science.gov (United States)

    Brehm, John M

    2014-09-01

    The vitamin D hypothesis postulates that lower vitamin D levels are causally associated with increased asthma risk and asthma severity. Multiple epidemiological studies have shown an inverse relationship between circulating vitamin D levels (in the form of 25-hydroxy vitamin D) and asthma severity and control and lung function. However, in the recently published vitamin D and asthma (VIDA) study, vitamin D supplementation failed to show an improvement in asthma control in adults. This article reviews the current epidemiological and trial evidence for vitamin D and asthma and explores some of the possible alternative explanations for previous findings (including "reverse causation" and the importance of studying children and adults). We also address some of the unique challenges of conducting vitamin D trials and potential ways to address them. Finally, I will argue for further clinical trials of vitamin D in asthma, especially in children, using knowledge gained from the VIDA trial.

  11. Arte e vida em Vigotski e o modernismo russo

    Directory of Open Access Journals (Sweden)

    Luana Maribele Wedekin

    2013-12-01

    Full Text Available Em sua obra "Psicologia da Arte" (concluída em 1925, L.S. Vigotski escreve sobre o tema arte e vida, dialogando com algumas das principais teorias estéticas de sua época. Objetiva-se neste estudo teórico contextualizar esses interlocutores e algumas das ideias desse autor, com a apresentação dos argumentos fundamentais sobre as relações entre arte e vida no embate entre as vertentes realistas e simbolistas do modernismo russo, especialmente na literatura e artes visuais. Conclui-se que a perspectiva de Vigotski acerca do tema, sintonizada com as grandes discussões estéticas de seu tempo, é ainda relevante para pensar as manifestações da arte contemporânea, seja em suas vertentes realistas ou no campo da performance.

  12. Juventude, projetos de vida e ensino médio

    Directory of Open Access Journals (Sweden)

    Geraldo Leão

    2011-12-01

    Full Text Available O artigo apresenta parte dos resultados de pesquisa desenvolvida com jovens estudantes do ensino médio do estado do Pará. Por meio da metodologia de Grupos de Discussão, a pesquisa abordou a realidade do ensino médio na ótica dos jovens, analisando a relação que eles estabeleciam entre os seus projetos de vida e as contribuições da escola para a sua realização. A investigação revelou grande diversidade de projetos juvenis, evidenciando estratégias elaboradas a partir do contexto social, das idades da vida e de uma determinada postura diante do futuro, expressão de um cenário sociocultural marcado pelas incertezas. Os jovens revelaram que a escola é alvo de muitas expectativas, mas apontaram os seus limites em corresponder às suas demandas.

  13. Sueño y calidad de vida

    OpenAIRE

    Miró, Elena; Cano-Lozano, Carmen; Buela-Casal, Gualberto

    2008-01-01

    Existe una estrecha interrelación entre los procesos de sueño y el estado general de salud física y psicológica de una persona. En el presente artículo se revisan algunas de las principales líneas de investigación que abordan las relaciones entre el sueño y la calidad de vida. Se analiza la influencia de los diferentes patrones de sueño (patrón de sueño corto, intermedio y largo) y de la calidad del sueño (sueño eficiente/no eficiente) en la salud y la calidad de vida. Se examinan las consecu...

  14. Bombeiros: um olhar sobre a qualidade de vida no trabalho

    Directory of Open Access Journals (Sweden)

    Janine Kieling Monteiro

    Full Text Available Este trabalho apresenta uma intervenção no corpo de bombeiros (São Leopoldo - RS realizada pelo NEPT (Núcleo de Excelência em Psicologia do Trabalho. Utilizamos um diagnóstico com sessenta e três entrevistas semi-estruturadas sobre o trabalho e funcionamento da corporação. Partindo da análise deste, propusemos palestras sobre estresse e qualidade de vida no trabalho (QVT. Foram levantados questionamentos acerca do mito do herói e do amor pela profissão bombeiro, que deixa em segundo plano seus problemas. Destacou-se o estresse no trabalho por situações traumáticas, como risco de vida eminente e mortes nos salvamentos. Entendemos que as intervenções contribuíram como espaço de escuta que propiciou reflexões a respeito da QVT.

  15. Use of vacuum-steam-vacuum and ionizing radiation to eliminate Listeria innocua from ham.

    Science.gov (United States)

    Sommers, Christopher; Kozempel, Michael; Fan, Xuetong; Radewonuk, E Richard

    2002-12-01

    Listeria spp. are a frequent postprocess contaminant of ready-to-eat (RTE) meat products, including ham. Vacuum-steam-vacuum (VSV) technology has been used successfully to eliminate Listeria innocua from hot dogs. Ionizing radiation can eliminate Listeria spp. from RTE meats. However, the excessive application of either technology can cause changes in product quality, including structural changes, changes in cure color (redness), and lipid oxidation. In this study, two cycles of VSV were combined with 2.0 kGy of ionizing radiation to obtain 4.40- and 4.85-log10 reductions of L. innocua on ham meat and skin, respectively. The use of both treatments resulted in an additive, as opposed to synergistic, reduction of L. innocua on ham. The combination treatment did not cause statistically significant changes in product structure, color (redness), or lipid oxidation.

  16. Wild birds and silage as reservoirs of Listeria in the agricultural environment.

    Science.gov (United States)

    Fenlon, D R

    1985-12-01

    A method for the isolation of listeria which enabled a more rapid detection of the organism was used to examine samples of silage and bird faeces. Faecal samples indicated that seagulls feeding at sewage works had a higher rate of carriage than those elsewhere. Faecal samples from rooks generally suggested a low incidence of listeria except on one occasion when eight of twenty samples contained Listeria monocytogenes: this coincided with the nesting season and the peak period for listeriosis in sheep. The incidence of L. monocytogenes in clamp silages ranged from 2.5-5.9%, but in samples of big bale silages the incidence was 22.2% and, when mouldy samples were selected, 44%.

  17. Frequency, virulence genes and antimicrobial resistance of Listeria spp. isolated from bovine clinical mastitis.

    Science.gov (United States)

    Jamali, Hossein; Radmehr, Behrad

    2013-11-01

    The aims of this study were to determine the prevalence, characteristics and antimicrobial resistance of Listeria spp. isolated from bovine clinical mastitis in Iran. Listeria spp. were detected in 21/207 bovine mastitic milk samples from dairy farms in Iran, comprising L. monocytogenes (n=17), L. innocua (n=3) and L. ivanovii (n=1). L. monocytogenes isolates were grouped into serogroups '4b, 4d, 4e', '1/2a, 3a', '1/2b, 3b, 7' and '1/2c, 3c'; all harboured inlA, inlC and inlJ virulence genes. Listeria spp. were most frequently resistant to penicillin G (14/21 isolates, 66.7%) and tetracyclines (11/21 isolates, 52.4%). Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. The effect of centaurein on interferon-γ expression and Listeria infection in mice

    International Nuclear Information System (INIS)

    Chang, S.-L.; Yeh, H.-H.; Lin, Y.-S.; Chiang, Y.-M.; Wu, T.-K.; Yang, W.-C.

    2007-01-01

    We previously found that centaurein enhanced IFN-γ transcription in T cells. Here, we demonstrate that centaurein increased the IFN-γ expression in T and NK cells and the serum IFN-γ level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-γ but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-γ expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection via a modulation of IFN-γ expression

  19. Genetic characteristics of Japanese clinical Listeria monocytogenes isolates.

    Directory of Open Access Journals (Sweden)

    Satoko Miya

    Full Text Available Listeria monocytogenes causes foodborne illnesses through consumption of ready-to-eat foods. Although 135-201annual listeriosis cases have been estimated in Japan, the details regarding the clinical isolates such as infection source, virulence level, and other genetic characteristics, are not known. In order to uncover the trends of listeriosis in Japan and use the knowledge for prevention measures to be taken, the genetic characteristics of the past human clinical isolates needs to be elucidated. For this purpose, multilocus tandem-repeat sequence analysis (MLTSA and multi-virulence-locus sequence typing (MVLST were used in this study. The clinical isolates showed a variety of genetically distant genotypes, indicating they were from sporadic cases. However, the MVLST profiles of 7 clinical isolates were identical to those of epidemic clone (EC I isolates, which have caused several serious outbreaks in other countries, suggesting the possibility that they have strong virulence potential and originated from a single outbreak. Moreover, 6 Japanese food isolates shared their genotypes with ECI isolates, indicating that there may be risks for listeriosis outbreak in Japan. This is the first investigational study on genetic characteristics of Japanese listeriosis isolates. The listeriosis cases happened in the past are presumably sporadic, but it is still possible that some isolates with strong virulence potential have caused listeriosis outbreaks, and future listeriosis risks also exist.

  20. Flagellar motility is critical for Listeria monocytogenes biofilm formation.

    Science.gov (United States)

    Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto

    2007-06-01

    The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.

  1. LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

    Directory of Open Access Journals (Sweden)

    T Civera

    2013-02-01

    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  2. Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

    Science.gov (United States)

    Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

    2014-12-01

    The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

  3. Low prevalence of Listeria monocytogenes in cull sows and pork.

    Science.gov (United States)

    Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

    2008-03-01

    The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

  4. ASSESSMENT OF ACTION OF DISINFECTANTS AGAINST LISTERIA MONOCYTOGENES BIOFILMS

    Directory of Open Access Journals (Sweden)

    T. K. CABEÇA

    2008-12-01

    Full Text Available

    The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.

  5. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  6. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi

    2007-10-01

    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  7. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Deciphering the landscape of host barriers to Listeria monocytogenes infection.

    Science.gov (United States)

    Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

    2017-06-13

    Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

  9. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen

    2012-07-01

    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  10. Carcinoma epidermoide del margen anal contra calidad de vida

    Directory of Open Access Journals (Sweden)

    Miguel A Reyes Argudín

    Full Text Available La calidad de vida de los pacientes debe tenerse en cuenta. Esta representa el resultado final de la actuación médica desde la perspectiva del paciente. En ocasiones solo nos basamos en este criterio para tomar decisiones terapéuticas ante determinadas enfermedades, como el carcinoma epidermoide de margen anal en estadío terminal. El tratamiento y conducta con fines paliativos tiene como objetivo mejorar la calidad de vida de estas personas. Presentamos el caso de paciente varón de 48 años de edad que acude a consulta por presentar lesión en el ano que no le permitía sentarse y después de realizársele todo el estudio necesario para determinar su diagnóstico definitivo (carcinoma epidermoide de ano evaluarlo y determinar el tratamiento requerido para el grado de la enfermedad, nos percatamos que el tratamiento radical no cambiaba la evolución de su estado y se decide tratamiento paliativo para mejorar la calidad de vida. En ocasiones acuden a consulta pacientes que al culminar su estudio, obtienen el diagnóstico de una enfermedad avanzada y es, a partir de este momento, que nuestro pensamiento médico debe cambiar y encaminar nuestros esfuerzos a mejorar la calidad de vida y no llevarlos a un final tormentoso con el objetivo de revertir la evolución de una enfermedad que no tiene regresión.

  11. Prevalence of coliforms, Salmonella, Listeria, and Campylobacter associated with eggs and the environment of conventional cage and free-range egg production.

    Science.gov (United States)

    Jones, D R; Anderson, K E; Guard, J Y

    2012-05-01

    There is a desire by US consumers for eggs produced by hens in alternative production systems. As the retail shell-egg market offers these products to accommodate consumer demands, additional information is needed to ensure processing methodologies result in safe eggs from all egg sources. A study was conducted to determine if there were differences in the prevalence of coliforms, Salmonella, Listeria, and Campylobacter on and within eggs and in the environment of a sister flock of conventional cage and free-range laying hens. Microbial sampling occurred approximately every 6 wk between 20 and 79 wk of age. A random sampling of typical coliform colonies produced 371 viable isolates for biochemical identification. Twenty-nine genera or species of bacteria were identified. There was a significantly greater (P free-range nest box swabs compared with that in the free-range grass and conventional cage swab samples (number of positives: 8 nest box, 1 grass, 0 cage). Seven isolates of Listeria innocua were detected with no significant difference in prevalence between the treatments. Isolates were associated with eggshells (2 free-range floor, 1 cage) and the free-range environment (2 nest box, 2 grass). There were 21 Salmonella isolates detected between all sample locations, with no significant difference in the prevalence of Salmonella detection between the treatments. Additional studies are needed to fully understand the effect of alternative production methods on the prevalence of pathogens and coliforms associated with nest-run eggs and the production environment.

  12. Inhibitory activity of Lactobacillus plantarum LMG P-26358 against Listeria innocua when used as an adjunct starter in the manufacture of cheese

    LENUS (Irish Health Repository)

    2011-08-30

    Abstract Lactobacillus plantarum LMG P-26358 isolated from a soft French artisanal cheese produces a potent class IIa bacteriocin with 100% homology to plantaricin 423 and bacteriocidal activity against Listeria innocua and Listeria monocytogenes. The bacteriocin was found to be highly stable at temperatures as high as 100°C and pH ranges from 1-10. While this relatively narrow spectrum bacteriocin also exhibited antimicrobial activity against species of enterococci, it did not inhibit dairy starters including lactococci and lactobacilli when tested by well diffusion assay (WDA). In order to test the suitability of Lb. plantarum LMG P-26358 as an anti-listerial adjunct with nisin-producing lactococci, laboratory-scale cheeses were manufactured. Results indicated that combining Lb. plantarum LMG P-26358 (at 108 colony forming units (cfu)\\/ml) with a nisin producer is an effective strategy to eliminate the biological indicator strain, L. innocua. Moreover, industrial-scale cheeses also demonstrated that Lb. plantarum LMG P-26358 was much more effective than the nisin producer alone for protection against the indicator. MALDI-TOF mass spectrometry confirmed the presence of plantaricin 423 and nisin in the appropriate cheeses over an 18 week ripening period. A spray-dried fermentate of Lb. plantarum LMG P-26358 also demonstrated potent anti-listerial activity in vitro using L. innocua. Overall, the results suggest that Lb. plantarum LMG P-26358 is a suitable adjunct for use with nisin-producing cultures to improve the safety and quality of dairy products.

  13. Biotechnical paving of recombinant enterocin A as the candidate of anti-Listeria agent.

    Science.gov (United States)

    Hu, Xiaoyuan; Mao, Ruoyu; Zhang, Yong; Teng, Da; Wang, Xiumin; Xi, Di; Huang, Jianzhong; Wang, Jianhua

    2014-08-28

    Enterocin A is a classic IIa bacteriocin isolated firstly from Enterococcus faecium CTC492 with selective antimicrobial activity against Listeria strains. However, the application of enterocin A as an anti-Listeria agent has been limited due to its very low native yield. The present work describes high production of enterocin A through codon optimization strategy and its character study. The gene sequence of enterocin A was optimized based on preferential codon usage in Pichia pastoris to increase its expression efficiency. The highest anti-Listeria activity reached 51,200 AU/ml from 180 mg/l of total protein after 24 h of induction in a 5-L fermenter. Recombinant enterocin A (rEntA), purified by gel filtration chromatography, showed very strong activity against Listeria ivanovii ATCC 19119 with a low MIC of 20 ng/ml. In addition, the rEntA killed over 99% of tested L. ivanovii ATCC19119 within 4 h when exposed to 4 × MIC (80 ng/ml). Moreover, it showed high stability under a wide pH range (2-10) and maintained full activity after 1 h of treatment at 80°C within a pH range of 2-8. Its antimicrobial activity was enhanced at 25 and 50 mM NaCl, while 100-400 mM NaCl had little effect on the bactericidal ability of rEntA. The EntA was successfully expressed in P. pastoris, and this feasible system could pave the pre-industrial technological path of rEntA as a competent candidate as an anti-Listeria agent. Furthermore, it showed high stability under wide ranges of conditions, which could be potential as the new candidate of anti-Listeria agent.

  14. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection.

    Directory of Open Access Journals (Sweden)

    Ana Camejo

    2009-05-01

    Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.

  15. Host resistance of CD18 knockout mice against systemic infection with Listeria monocytogenes

    Science.gov (United States)

    Wu, Huaizhu; Prince, Joseph E.; Brayton, Cory F.; Shah, Chirayu; Zeve, Daniel; Gregory, Stephen H.; Smith, C. Wayne; Ballantyne, Christie M.

    2003-01-01

    Mice with targeted mutations of CD18, the common beta2 subunit of CD11/CD18 integrins, have leukocytosis, impaired transendothelial neutrophil emigration, and reduced host defense to Streptococcus pneumoniae, a gram-positive extracellular bacterium. Previous studies using blocking monoclonal antibodies suggested roles for CD18 and CD11b in hepatic neutrophil recruitment and host innate response to Listeria monocytogenes, a gram-positive intracellular bacterium. We induced systemic listeriosis in CD18 knockout (CD18-ko) and wild-type (WT) mice by tail vein injection with Listeria. By 14 days postinjection (dpi), 8 of 10 WT mice died, compared with 2 of 10 CD18-ko mice (P Listeria organisms in livers and spleens were similar in both groups at 20 min postinfection. By 3, 5, and 7 dpi, however, numbers of Listeria organisms were significantly lower in livers and spleens of CD18-ko mice than in WT mice. Histopathology showed that following Listeria infection, CD18-ko mice had milder inflammatory and necrotizing lesions in both spleens and livers than did WT mice. Cytokine assays indicated that baseline interleukin-1beta and granulocyte colony-stimulating factor (G-CSF) levels were higher in CD18-ko mice than in WT mice and that CD18-ko splenocytes produced higher levels of interleukin-1beta and G-CSF than WT splenocytes under the same amount of Listeria stimulation. These findings show that CD18 is not an absolute requirement for antilisterial innate immunity or hepatic neutrophil recruitment. We propose that the absence of CD18 in the mice results in the priming of innate immunity, as evidenced by elevated cytokine expression, and neutrophilic leukocytosis, which augments antilisterial defense.

  16. Listeria arpJ gene modifies T helper type 2 subset differentiation.

    Science.gov (United States)

    Kanoh, Makoto; Maruyama, Saho; Shen, Hua; Matsumoto, Akira; Shinomiya, Hiroto; Przybilla, Karin; Gouin, Edith; Cossart, Pascale; Goebel, Werner; Asano, Yoshihiro

    2015-07-15

    Although the T-cell subset differentiation pathway has been characterized extensively from the view of host gene regulation, the effects of genes of the pathogen on T-cell subset differentiation during infection have yet to be elucidated. Especially, the bacterial genes that are responsible for this shift have not yet been determined. Utilizing a single-gene-mutation Listeria panel, we investigated genes involved in the host-pathogen interaction that are required for the initiation of T-cell subset differentiation in the early phase of pathogen infection. We demonstrate that the induction of T helper types 1 and 2 (Th1 and Th2) subsets are separate phenomena and are mediated by distinct Listeria genes. We identified several candidate Listeria genes that appear to be involved in the host-Listeria interaction. Among them, arpJ is the strongest candidate gene for inhibiting Th2 subset induction. Furthermore, the analysis utilizing arpJ-deficient Listeria monocytogenes (Lm) revealed that the tumor necrosis factor (TNF) superfamily (Tnfsf) 9-TNF receptor superfamily (Tnfrsf) 9 interaction inhibits the Th2 response during Lm infection. arpJ is the candidate gene for inhibiting Th2 T-cell subset induction. The arpJ gene product influences the expression of Tnfsf/Tnfrsf on antigen-presenting cells and inhibits the Th2 T-cell subset differentiation during Listeria infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. El maestro como formador y cultor de la vida

    Directory of Open Access Journals (Sweden)

    Nahyr Remolina De Cleves

    2004-01-01

    Full Text Available El presente artículo describe y reflexiona sobre el proceso histórico del quehacer pedagógico y los aspectos fundamentales del maestro como formador y cultor de vida, desde la antigüedad hasta los albores del siglo XXI. El maestro auténtico posee unas características esenciales que lo distinguen como líder, formador y forjador de personas, potenciador de saberes y valores que coadyuvan al desarrollo humano. No sólo enseña contenidos e instruye sino que educa con las actitudes y ejemplos de vida. Se presentan aquí las cualidades del maestro integral en que se conjugan el conocimiento científico, las virtudes intelectuales, el sentido humanista, la visión prospectiva, creadora y transformadora, la defensa de la verdad y de la vida, el cultivo de los valores éticos, la edificación innovadora de la cultura y el compromiso permanente de educar para la libertad.

  18. Capacidade funcional, morbidades e qualidade de vida de idosos

    Directory of Open Access Journals (Sweden)

    Darlene Mara dos Santos Tavares

    2012-01-01

    Full Text Available La investigación tiene como objetivo describir el perfil demográfico, la capacidad funcional y la morbilidad de los ancianos, y verificar la calidad de vida relacionado con el número de incapacidad funcional y la morbilidad. Estudio transversal analítico llevado a cabo con 2.142 personas mayores. Los datos fueron recolectados en el hogar con un instrumento estructurado. El análisis se realizó distribución de frecuencias, F-test de ANOVA y Bonferroni (p<0,05. La mayoría eran mujeres, años, casado, años de escolaridad y los ingresos de un salario mínimo. Predominaron los adultos mayores discapacidades funcionales relacionadas con la movilidad y morbilidad, los problemas de visión más frecuente y la columna vertebral y la hipertensión. Las puntuaciones más altas de calidad de vida para las relaciones sociales y el funcionamiento de los sentidos y el más bajo para su desarrollo físico y la autonomía. El mayor número de incapacidad funcional y la morbilidad asociadas con bajas puntuaciones en la calidad de vida.

  19. Judicialização da vida na contemporaneidade

    Directory of Open Access Journals (Sweden)

    Camilla Felix Barbosa de Oliveira

    Full Text Available Este artigo visa a empreender um estudo sobre o fenômeno da judicialização da vida na contemporaneidade. Por judicialização, compreende-se o movimento de regulação normativa e legal do viver, do qual os sujeitos se apropriam para a resolução dos conflitos, reproduzindo uns com os outros o controle, o julgamento e a punição das condutas. Nesse sentido, objetiva-se analisar os efeitos dos discursos e das práticas jurídicas sobre as subjetividades, ou seja, sobre as formas de os sujeitos se relacionarem, experimentarem e conceberem suas vidas. Para tanto, utilizar-se-á como disparadores leis, políticas e ações relacionadas à alienação parental e ao bullying, evidenciando as lógicas patológicas e judicializantes que as embasam e suas aproximações com o campo psi. Por fim, propõe-se que a Psicologia esteja em permanente reflexão ético-política, a fim de fomentar a construção de práticas psi inovadoras, que rompam os aprisionamentos produzidos pelo movimento de judicialização e que inaugurem desvios a serviço da valorização da vida.

  20. Projeto de vida no discurso de jovens músicos

    Directory of Open Access Journals (Sweden)

    Aline Moreira Gonçalves

    2012-12-01

    Full Text Available Investiga-se o que é a música para jovens músicos de São João Del Rei, cidade da região do Campo das Vertentes, Minas Gerais, que convive cotidianamente com bandas e orquestras bicentenárias e onde o fazer musical é forte referência na vida das pessoas, especialmente na de crianças e adolescentes. Tendo-se como referencial teórico a psicossociologia e suas noções de imaginário social, projeto de vida e grupo como sistema cultural, simbólico e imaginário, foram entrevistados 21 jovens vinculados a corporações musicais da cidade. As entrevistas transcritas passaram por procedimentos derivados da análise arqueológica do discurso. Buscou-se explicitar o papel da atividade musical na construção de projetos de vida dos jovens, isso é , nas modalidades de inserção social desses sujeitos no contexto de sua realidade, suas formas de projetar o futuro e lançar-se em busca de algo a ser realizado.

  1. Calidad de vida de cuidadores de adultos con accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    INNA ELIDA FLÓREZ TORRES

    2010-10-01

    Full Text Available Objetivo: describir la calidad de vida de los cuidadores familiares de adultos con secuelas de accidente cerebrovascular, en Cartagena, Colombia. Método: estudio descriptivo cuantitativo realizado durante el segundo semestre de 2008. Muestra no probabilística por conveniencia de 97 cuidadores. Se empleó el instrumento propuesto por Ferrell et ál. Para valorar cada uno de los bienestares que integran la calidad de vida se utilizaron medidas de tendencia central y coeficiente de variación. Resultados: el grupo de cuidadores presentó en el bienestar físico un promedio de 11,1 con relación al máximo puntaje, lo que indica el peor estado de salud; los bienestares psicológico y social tuvieron promedios de 48,8 y 21,9, respectivamente, con menor afectación. El mejor estado se halló en el bienestar espiritual, con promedio de 22,6. Conclusiones: la experiencia de ser cuidador modifica de manera importante la calidad de vida de las personas; los cuidadores, como fuente importante de cuidado informal, requieren apoyo de los sistemas de salud y, como parte de este, de los profesionales de enfermería.

  2. VIDA COMERCIAL DE PITAHAYA AMARILLA TRATADA CON 1-MCP

    Directory of Open Access Journals (Sweden)

    LILIANA SERNA-COCK

    Full Text Available 1-metilciclopropeno (1-MCP, un inhibidor del etileno, ha sido utilizado para extender la vida comercial de diferentes frutas. El objetivo de este trabajo fue evaluar el efecto de la aplicación de soluciones acuosas de 10, 100 y 200 gL-1 de 1-MCP, con tiempos de exposición de 1, 5 y 10 minutos, sobre la vida comercial de pitahaya amarilla en estado de madurez 4. Durante 15 días de almacenamiento (25 ± 2°C y 75% de humedad relativa, se evaluaron cambios físicos como la pérdida de peso y la aparición de pardeamiento; y se midieron cambios químicos como sólidos solubles, pH, acidez e índice de madurez. Se presentaron diferencias significativas entre los tratamientos. Los resultados demostraron que aplicaciones de 200 gL-1 de 1-MCP durante 10 minutos prolongó por tres días, la vida comercial de la pitahaya amarilla, y redujo cambios en los sólidos solubles y la acidez

  3. Prevalence and Antibiotic Resistance of Listeria Spp. Isolated from Ready-to-Eat Foods in Ankara

    OpenAIRE

    ŞİRELİ, Ufuk Tansel; GÜCÜKOĞLU, Ali

    2014-01-01

    In this study the presence of Listeria spp. is tested in 100 ready-to-eat food samples purchased from different stores and traditional food shops in the province of Ankara. The tested materials were 20 each of the following: mayonnaise based salad, kadınbudu köfte (fried meatball), fried liver, rice stuffed mussel, and green salad. Microbiological analyzes showed that 13 of 100 salad samples (13%) were contaminated with Listeria spp. while 10 of 100 salad samples (10%) were contaminated with ...

  4. Antimicrobial susceptibilities of Listeria monocytogenes human strains isolated from 1970 to 2008 in Brazil Susceptibilidade antimicrobiana de cepas humanas de Listeria monocytogenes isoladas no período de 1970 a 2008 no Brasil

    Directory of Open Access Journals (Sweden)

    Cristhiane Moura Falavina dos Reis

    2011-04-01

    Full Text Available INTRODUCTION: Listeria monocytogenes is the causative agent of listeriosis, a foodborne illness that affects mainly pregnant women, the elderly and immunocompromised patients. The primary treatment is a combination of ampicillin with an aminoglycoside, in addition to a second-choice drug represented by chloramphenicol, erythromycin, tetracycline and rifampicin. The aim of this study was to analyze the antimicrobial susceptibility profile of strains isolated from human sources in the last four decades. METHODS: Sixty-eight strains were selected from the culture collection of the Laboratory of Bacterial Zoonoses/LABZOO/FIOCRUZ isolated in different regions of Brazil from 1970 to 2008 and primarily isolated from cerebrospinal fluid and blood culture. Susceptibility tests to antimicrobials drugs were evaluated using the criteria established by Soussy using the Kirby-Bauer method and E-Test strips were used to determine the minimum inhibitory concentration (MIC. RESULTS: Among the strains tested, serovar L4b (60.3% was the most prevalent, followed by serovar 1/2a (20.6%, 1/2b (13.2% and the more uncommon serovars 1/2c, 3b and 4ab (5.9%. All strains were susceptible to ampicillin, cephalothin, erythromycin, gentamicin, teicoplanin and vancomycin. Only one strain (1.5% showed resistance to rifampin, and two (3% were resistant to trimethoprim-sulfamethoxazole. MICs with values up to 2μg/ml reinforce the need for microbiological surveillance. CONCLUSIONS: The study demonstrated low prevalence of strains resistant to the antimicrobial drugs indicated in the treatment of human listeriosis. Monitoring antimicrobial resistance profile is still very important to determine adequate treatment, especially in immunocompromised patients.INTRODUÇÃO: Listeria monocytogenes é o agente etiológico da listeriose, doença de origem alimentar que acomete principalmente grávidas, pacientes imunodeprimidos e idosos. O tratamento primário é a associação de

  5. Efeito do composto "mais vida" na ativação de macrófagos de ratos diabéticos Effects of "mais vida", a commercial natural mix, on the activation of macrophages from diabetic rats

    Directory of Open Access Journals (Sweden)

    E.L. França

    2012-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a atividade funcional de macrófagos de ratos diabéticos, através da liberação do ânion superóxido, na presença do composto "mais vida". Os animais foram divididos em dois grupos, controle (N=20 e diabético (N=20. Avaliou-se a glicemia, massa corpórea e a liberação de superóxido pelos macrófagos de baço de ratos. O composto "mais vida" foi obtido através da mistura de extratos de sete plantas, sendo Orbignia martiana Rodr., Tabebuia avellanedae L.G., Arctium lappa L., Rosa centifolia L., Maytenus ilicifolia Mart., Vernonia condensata Baker e Thuja occidentalis L. Observou-se que glicemia foi maior no grupo diabético. A liberação espontânea do ânion superóxido pelos macrófagos foi menor no grupo diabético. O composto "mais vida", independente dos níveis glicêmicos, aumentou a liberação de superóxido dos macrófagos. Quando as células foram estimuladas pelos extratos vegetais isolados, também houve aumento na liberação do ânion superóxido pelos macrófagos em ambos os grupos. As maiores liberações de superóxido ocorreram quando os macrófagos foram estimulados pela Thuja occidentalis L., Rosa centifolia L., Tabebuia avellanedae L.G. e Maytenus ilicifolia Mart. Estes dados sugerem que a ativação de macrófagos pelo composto "mais vida" pode representar um mecanismo alternativo de defesa para infecções em indivíduos diabéticos.This study investigated the effects of "mais vida", a commercial natural mix, on macrophages functional activity as evaluated by the superoxide release in diabetic rats. The animals were divided into two groups, control (N = 20 and diabetic (N = 20. This was achieved by determining blood glucose weight and the superoxide released by spleen macrophages. The "mais vida" mix was obtained by the combination of extracts from seven medicinal species, which were: Orbignia martiana Rodr., Tabebuia avellanedae L.G., Arctium lappa L., Rosa centifolia L

  6. Listeria monocytogenes impact on mature or old Pseudomonas fluorescens biofilms during growth at 4 and 20ºC

    Directory of Open Access Journals (Sweden)

    Puga eCH

    2016-02-01

    Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.

  7. Chemodenitrification in the cryoecosystem of Lake Vida, Victoria Valley, Antarctica.

    Science.gov (United States)

    Ostrom, N E; Gandhi, H; Trubl, G; Murray, A E

    2016-11-01

    Lake Vida, in the Victoria Valley of East Antarctica, is frozen, yet harbors liquid brine (~20% salt, >6 times seawater) intercalated in the ice below 16 m. The brine has been isolated from the surface for several thousand years. The brine conditions (permanently dark, -13.4 °C, lack of O 2 , and pH of 6.2) and geochemistry are highly unusual. For example, nitrous oxide (N 2 O) is present at a concentration among the highest reported for an aquatic environment. Only a minor 17 O anomaly was observed in N 2 O, indicating that this gas was predominantly formed in the lake. In contrast, the 17 O anomaly in nitrate (NO3-) in Lake Vida brine indicates that approximately half or more of the NO3- present is derived from atmospheric deposition. Lake Vida brine was incubated in the presence of 15 N-enriched substrates for 40 days. We did not detect microbial nitrification, dissimilatory reduction of NO3- to ammonium (NH4+), anaerobic ammonium oxidation, or denitrification of N 2 O under the conditions tested. In the presence of 15 N-enriched nitrite (NO2-), both N 2 and N 2 O exhibited substantial 15 N enrichments; however, isotopic enrichment declined with time, which is unexpected. Additions of 15 N-NO2- alone and in the presence of HgCl 2 and ZnCl 2 to aged brine at -13 °C resulted in linear increases in the δ 15 N of N 2 O with time. As HgCl 2 and ZnCl 2 are effective biocides, we interpret N 2 O production in the aged brine to be the result of chemodenitrification. With this understanding, we interpret our results from the field incubations as the result of chemodenitrification stimulated by the addition of 15 N-enriched NO2- and ZnCl 2 and determined rates of N 2 O and N 2 production of 4.11-41.18 and 0.55-1.75 nmol L -1  day -1 , respectively. If these rates are representative of natural production, the current concentration of N 2 O in Lake Vida could have been reached between 6 and 465 years. Thus, chemodenitrification alone is sufficient to explain the

  8. El mito de la vida verdadera en la «Vida secreta» de Salvador Dalí

    Directory of Open Access Journals (Sweden)

    Domingo Ródenas de Moya

    2012-12-01

    Full Text Available Este artículo se propone examinar cómo el mito de la mutatio vitae fue adoptado por Dalí como matriz narrativa de su autobiografía Vida secreta. Se sitúa el libro en el género del autorretrato que cultivó el pintor desde su juventud y en la tradición de las “vidas” ejemplares. La necesidad de reinventarse ante la sociedad norteamericana condujo a Dalí a identificar la cultura europea, en especial el arte de vanguardia, con la decadencia y la corrupción, en tanto él construía para sí mismo una coraza protectora con la firma de “salvador” del arte clásico. El crecimiento de esa coraza (o personaje público está narrado como el resultado de una revelación que da paso a una vida auténtica. En el relato de ese proceso, Gala aparece como el agente epifánico que cura al artista enfermo y redime al Dalí hombre. Vida secreta constituye una muestra excelente de autobiografía estetizada y supeditada a un objetivo: la configuración de una máscara pública que fuera a la vez marca registrada y coraza protectora. This paper aims to analyze how the myth of the mutatio vitae was adopted by Dalí as a narrative pattern in his autobiography Vida secreta. The book belongs to the genre of the self-portrait that he cultivated since his youth and it can also be considered part of the tradition of the “exemplary lives”. The need to reinvent himself in the eyes of American society brought Dalí to identify European culture, especially the art of avant-garde, with decadence and corruption, while he created for himself a protective cuirass, as the “salvador” of classical art. How he created this mask (or public figure is narrated as the result of a revelation which gives way to an authentic life. In the story of that process, Gala appears as the epiphanic agent who heals the sick artist and redeems Dalí, the man. Vida secreta is an excellent example of an aestheticised autobiography, subordinated to an object: setting a public mask

  9. The Effect of Oxygen on Bile Resistance in Listeria monocytogenes

    Science.gov (United States)

    Wright, Morgan L; Pendarvis, Ken; Nanduri, Bindu; Edelmann, Mariola J; Jenkins, Haley N; Reddy, Joseph S; Wilson, Jessica G; Ding, Xuan; Broadway, Paul R; Ammari, Mais G; Paul, Oindrila; Roberts, Brandy; Donaldson, Janet R

    2016-01-01

    Listeria monocytogenes is a Gram-positive facultative anaerobe that is the causative agent of the disease listeriosis. The infectious ability of this bacterium is dependent upon resistance to stressors encountered within the gastrointestinal tract, including bile. Previous studies have indicated bile salt hydrolase activity increases under anaerobic conditions, suggesting anaerobic conditions influence stress responses. Therefore, the goal of this study was to determine if reduced oxygen availability increased bile resistance of L. monocytogenes. Four strains representing three serovars were evaluated for changes in viability and proteome expression following exposure to bile in aerobic or anaerobic conditions. Viability for F2365 (serovar 4b), EGD-e (serovar 1/2a), and 10403S (serovar 1/2a) increased following exposure to 10% porcine bile under anaerobic conditions (P 0.05) in bile resistance between aerobic and anaerobic conditions, indicating that oxygen availability does not influence resistance in this strain. The proteomic analysis indicated F2365 and EGD-e had an increased expression of proteins associated with cell envelope and membrane bioenergetics under anaerobic conditions, including thioredoxin-disulfide reductase and cell division proteins. Interestingly, HCC23 had an increase in several dehydrogenases following exposure to bile under aerobic conditions, suggesting that the NADH:NAD+ is altered and may impact bile resistance. Variations were observed in the expression of the cell shape proteins between strains, which corresponded to morphological differences observed by scanning electron microscopy. These data indicate that oxygen availability influences bile resistance. Further research is needed to decipher how these changes in metabolism impact pathogenicity in vivo and also the impact that this has on susceptibility of a host to listeriosis. PMID:27274623

  10. Prevalence of Listeria monocytogenes in poultry production in France.

    Science.gov (United States)

    Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

    2008-10-01

    This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

  11. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

    Science.gov (United States)

    Soares, Charles A; Knuckley, Bryan

    2016-06-01

    Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  13. Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Aracelly Castro

    2013-09-01

    Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal.   doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482

  14. Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

    Science.gov (United States)

    Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

    2017-11-01

    The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

  15. How Listeria monocytogenes organizes its surface for virulence

    Science.gov (United States)

    Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier

    2014-01-01

    Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

  16. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  17. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  18. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

    2013-01-01

    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

  19. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  20. Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-10-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  1. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

    Directory of Open Access Journals (Sweden)

    Emmanuel Okpo

    2015-11-01

    Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

  2. Visualization of gold and platinum nanoparticles interacting with Salmonella enteritidis and Listeria monocytogenes

    DEFF Research Database (Denmark)

    Sawosz, Ewa; Chwalibog, André; Szeliga, Jacek

    2010-01-01

    -Au and nano-Pt respectively), with Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive), to reveal possibilities of constructing bacteria-nanoparticle vehicles. Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano...... as a vehicle to deliver nano-Pt to specific points in the body....

  3. Inactivation of Listeria monocytogenes by disinfectants and bacteriophages in suspension and stainless steel carrier tests

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

    2014-01-01

    To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after

  4. Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece.

    Science.gov (United States)

    Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P

    2011-06-01

    This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

  5. A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes

    Science.gov (United States)

    Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

  6. Extracting additional risk managers information from a risk assessment of Listeria monocytogenes in deli meats

    NARCIS (Netherlands)

    Pérez-Rodríguez, F.; Asselt, van E.D.; García-Gimeno, R.M.; Zurera, G.; Zwietering, M.H.

    2007-01-01

    The risk assessment study of Listeria monocytogenes in ready-to-eat foods conducted by the U.S. Food and Drug Administration is an example of an extensive quantitative microbiological risk assessment that could be used by risk analysts and other scientists to obtain information and by managers and

  7. Efficacy of antimicrobials extracted from organic pecan shell for inhibiting the growth of Listeria spp.

    Science.gov (United States)

    Babu, Dinesh; Crandall, Philip G; Johnson, Casey L; O'Bryan, Corliss A; Ricke, Steven C

    2013-12-01

    Growers and processors of USDA certified organic foods are in need of suitable organic antimicrobials. The purpose of the research reported here was to develop and test natural antimicrobials derived from an all-natural by-product, organic pecan shells. Unroasted and roasted organic pecan shells were subjected to solvent free extraction to produce antimicrobials that were tested against Listeria spp. and L. monocytogenes serotypes to determine the minimum inhibitory concentrations (MIC) of antimicrobials. The effectiveness of pecan shell extracts were further tested using a poultry skin model system and the growth inhibition of the Listeria cells adhered onto the skin model were quantified. The solvent free extracts of pecan shells inhibited Listeria strains at MICs as low as 0.38%. The antimicrobial effectiveness tests on a poultry skin model exhibited nearly a 2 log reduction of the inoculated cocktail mix of Listeria strains when extracts of pecan shell powder were used. The extracts also produced greater than a 4 log reduction of the indigenous spoilage bacteria on the chicken skin. Thus, the pecan shell extracts may prove to be very effective alternative antimicrobials against food pathogens and supplement the demand for effective natural antimicrobials for use in organic meat processing. © 2013 Institute of Food Technologists®

  8. A role for host cell exocytosis in InlB-mediated internalisation of Listeria monocytogenes.

    Science.gov (United States)

    Van Ngo, Hoan; Bhalla, Manmeet; Chen, Da-Yuan; Ireton, Keith

    2017-11-01

    The bacterial surface protein InlB mediates internalisation of Listeria monocytogenes into human cells through interaction with the host receptor tyrosine kinase, Met. InlB-mediated entry requires localised polymerisation of the host actin cytoskeleton. Apart from actin polymerisation, roles for other host processes in Listeria entry are unknown. Here, we demonstrate that exocytosis in the human cell promotes InlB-dependent internalisation. Using a probe consisting of VAMP3 with an exofacial green fluorescent protein tag, focal exocytosis was detected during InlB-mediated entry. Exocytosis was dependent on Met tyrosine kinase activity and the GTPase RalA. Depletion of SNARE proteins by small interfering RNA demonstrated an important role for exocytosis in Listeria internalisation. Depletion of SNARE proteins failed to affect actin filaments during internalisation, suggesting that actin polymerisation and exocytosis are separable host responses. SNARE proteins were required for delivery of the human GTPase Dynamin 2, which promotes InlB-mediated entry. Our results identify exocytosis as a novel host process exploited by Listeria for infection. © 2017 John Wiley & Sons Ltd.

  9. Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

    2010-01-01

    Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives, in the absence or presence of food debris from meat, fish and vegetables and at temperatures of 10, 25 and 37 °C was investigated. The pathogen survived best at 10 °C, and better at 25 °C than at

  10. Combined action of S-carvone and mild heat treatment on Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Karatzas, A.K.; Bennik, M.H.J.; Smid, E.J.; Kets, E.P.W.

    2000-01-01

    The combined action of the plant-derived volatile, S-carvone, and mild heat treatment on the food-borne pathogen, Listeria monocytogenes, was evaluated. The viability of exponential phase cultures grown at 8 °C could be reduced by 1.3 log units after exposure to S-carvone (5 mmol 1-1) for 30 min at

  11. [Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

    Science.gov (United States)

    Tian, Jing; Liu, Xiu-mei

    2009-09-01

    To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

  12. A dynamical systems approach to actin-based motility in Listeria monocytogenes

    Science.gov (United States)

    Hotton, S.

    2010-11-01

    A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

  13. Evaluation of Listeria monocytogenes survival and infectivity in non-traditional agricultural waters

    Science.gov (United States)

    Introduction: Listeria monocytogenes (Lm) is an enteric bacterium that can be found in environmental reservoirs. Restricted water availability for agriculture has increased interest in surface and reuse water sources which could potentially transmit Lm. Purpose: Persistence and infectivity of Lm re...

  14. Listeria monocytogenes infection of HD11, chicken macrophage-like cells.

    Science.gov (United States)

    Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G

    2017-04-01

    Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

  15. Listeria monocytogenes and Shigella flexneri Activate the NLRP1B Inflammasome.

    Science.gov (United States)

    Neiman-Zenevich, Jana; Stuart, Sarah; Abdel-Nour, Mena; Girardin, Stephen E; Mogridge, Jeremy

    2017-11-01

    Activation of the innate immune receptor NLRP1B leads to the formation of an inflammasome, which induces autoproteolytic processing of pro-caspase-1, and ultimately to the release of inflammatory cytokines and to the execution of pyroptosis. One of the signals to which NLRP1B responds is metabolic stress that occurs in cells deprived of glucose or treated with metabolic inhibitors. NLRP1B might therefore sense microbial infection, as intracellular pathogens such as Listeria monocytogenes and Shigella flexneri cause metabolic stress as a result of nutrient scavenging and host cell damage. Here we addressed whether these pathogens activate the NLRP1B inflammasome. We found that Listeria infection activated the NLRP1B inflammasome in a reconstituted fibroblast model. Activation of NLRP1B by Listeria was diminished in an NLRP1B mutant shown previously to be defective at detecting energy stress and was dependent on the expression of listeriolysin O (LLO), a protein required for vacuolar escape. Infections of either Listeria or Shigella activated NLRP1B in the RAW264.7 murine macrophage line, which expresses endogenous NLRP1B. We conclude that NLRP1B senses cellular infection by distinct invasive pathogens. Copyright © 2017 American Society for Microbiology.

  16. Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe

    Science.gov (United States)

    Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...

  17. Draft Genome Sequences of Historical Listeria monocytogenes from Human Listeriosis, 1933

    Science.gov (United States)

    We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent c...

  18. Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

    Science.gov (United States)

    Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

  19. Outbreak of Listeria monocytogenes infections linked to a pasteurized ice cream product served to hospitalized patients.

    Science.gov (United States)

    Rietberg, K; Lloyd, J; Melius, B; Wyman, P; Treadwell, R; Olson, G; Kang, M-G; Duchin, J S

    2016-10-01

    Two cases of hospital-acquired listeriosis were linked to a commercially produced, pasteurized ice cream mix. Manufacturers should implement safety measures from the Food Safety Modernization Act to minimize the risk of Listeria contamination. Dietary guidelines for persons at high risk of listeriosis may need revision to recognize the potential risk from pasteurized products.

  20. Certain dietary carbohydrates promote Listeria infection in a guinea pig model, while others prevent it

    DEFF Research Database (Denmark)

    Ebersbach, Tine; Jørgensen, Julie Boeck; Heegaard, Peter M. H.

    2010-01-01

    of five non-digestible carbohydrates on the resistance of guinea pigs to Listeria monocytogenes infections. Animals were fed a diet supplemented with 10% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral infection with a mixture...

  1. Effect of high pressure processing on reduction of Listeria monocytogenes in packaged Queso Fresco

    Science.gov (United States)

    The effect of high hydrostatic pressure processing (HPP) on the survival of a five-strain rifampicin-resistant cocktail of Listeria monocytogenes in Queso Fresco (QF) was evaluated as a post-packaging intervention. QF was made using pasteurized, homogenized milk, was starter-free and was not pressed...

  2. Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.

    Science.gov (United States)

    Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A

    2016-01-01

    The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.

  3. A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.

    LENUS (Irish Health Repository)

    van Pijkeren, Jan Peter

    2012-01-31

    Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.

  4. Vida útil sensorial del queso mantecoso por pruebas aceleradas

    OpenAIRE

    Sánchez-González, Jesús Alexander; Pérez Cueva, Joel André

    2016-01-01

    El objetivo del presente trabajo de investigación fue estimar la vida útil sensorial del queso mantecoso, de marcas comercializadas en Cajamarca, envasado al vacío: "cefop" y envasado a la presión atmosférica: "huacariz"; mediante pruebas aceleradas. Para este propósito, el queso "huacariz" se almacenó a 20, 28, 35 y 40 °C, mientras que para el queso "cefop" se trabajó con 20, 28 y 35 °C de almacenamiento, realizándose con éstos pruebas de aceptabilidad sensorial en función al tiempo de almac...

  5. Evaluación de la calidad de vida

    Directory of Open Access Journals (Sweden)

    Velarde-Jurado Elizabeth

    2002-01-01

    Full Text Available Este trabajo hace una revisión sobre la evolución del concepto de calidad de vida. Este concepto ha venido cobrando importancia ya que la mayor sobrevida de la población ha mejorado a expensas de un mayor número de personas con algún grado de discapacidad, y de personas con enfermedades crónicas que padecen los efectos de su enfermedad y del tratamiento. En 1948 la Organización Mundial de la Salud (OMS definió a la salud como el completo estado de bienestar físico, mental y social, y no sólo la ausencia de enfermedad, con lo cual el término evolucionó, desde una definición conceptual, hasta métodos objetivos, los cuales, mediante cuestionarios o instrumentos generan escalas e índices que permiten medir las dimensiones que conforman el estado de salud. Actualmente, la salud de una persona se evalúa más allá de su capacidad física y se toman en cuenta su contexto social y su salud mental. Las mediciones pueden estar basadas en encuestas directas a los pacientes, con referencia al inicio de la enfermedad, su diagnóstico y a los cambios de síntomas a través del tiempo. Este artículo presenta un inventario de 126 instrumentos utilizados para medir la calidad de vida en diversas poblaciones y enfermedades. Debido a que la calidad de vida se basa en mediciones con una carga variable de subjetividad, se requiere de métodos de evaluación válidos, reproducibles y confiables. El mejor conocimiento de las evaluaciones para medir calidad de vida permitirá incorporar estos instrumentos en la evaluación integral de individuos, en la conducción de ensayos clínicos y en la investigación de servicios de salud.

  6. Redacción: aprendizaje para la vida

    Directory of Open Access Journals (Sweden)

    Martiniano Acosta

    2014-02-01

    Full Text Available Este artículo muestra las deficiencias y dificultades que ofrece el oficio de redactar tanto en estudiantes como en profesionales. En ese sentido, redactar es un oficio que se ha venido echando de menos entre nuestros estudiantes, por esta razón, el artículo, trata de enfatizar sobre la importancia del texto escrito en la vida diaria. Por ello, se argumenta la necesidad de enfatizar y estimular este importante aspecto del lenguaje para alcanzar un profesional de excelencia en el campo de la lecto-escritura.

  7. Diseño y calidad de vida

    Directory of Open Access Journals (Sweden)

    Fabio Vinasco

    2016-01-01

    Full Text Available La inclusión del beneficiario del proceso en el taller de diseño se ha convertido en un eje de formación con cada vez mayor presencia académica; esta convocatoria de MasD busca presentar experiencias e investigaciones exitosas que pongan presente la necesidad de enfrentar tanto escenarios de diseño ligados a necesidades reales de nuestros entornos, como el aporte que hacemos desde el diseño al desenvolvimiento de la vida en escenarios de calidad y salubridad.

  8. Novela de la violencia: vida cotidiana e identidad cultural

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Valderrama H.

    1996-04-01

    Full Text Available Después de hacer una introducción de carácter teórico sobre el concepto de identidades colectivas, el autor describe los principales aspectos que intervienen en la dinámica de la vida cotidiana y en la tensión estructuración-desestructuración de las identidades en ocho obras de la literatura de la violencia en Colombia. Estos factores intervinientes son: la tensión legitimidad-ilegitimad de las instituciones políticas, el ejercicio violento del poder y la “exterioridad” como fuente de ordenamiento del mundo cotidiano y extracotidiano.

  9. Hacia un proyecto de vida a partir del proyecto constructivo

    OpenAIRE

    Cremaschi, Gustavo; Marsili, Luciana

    2014-01-01

    La población de las cárceles bonaerenses, hoy es del orden de las 25000 personas. Mayoritariamente está compuesta por jóvenes con escasa instrucción, poca o nula experiencia laboral, muy pobres, con orígenes familiares complejos, y casi sin excepción con proyecciones muy cortoplacistas de su vida. En particular la idea de la libertad, que anima a la totalidad de la población, pocas veces es correspondida con un proyecto tangible y real. En este panorama la idea de conseguir un trabajo digno p...

  10. Aplicación del paradigma de calidad de vida

    OpenAIRE

    Seminario de actualización metodológica en investigación sobre discapacidad Said (7º, 2010, Salamanca)

    2010-01-01

    [ES]El libro está compuesto por nueve capítulos en los que se desgranan los primeros resultados de las investigaciones que se están llevando a cabo en el proyecto "Aplicación del paradigma de calidad de vida a la intervención con personas con discapacidad desde una perspectiva integral", financiado por la Junta de Castilla y León al Grupo de Investigación de Excelencia GR197, que dirige Miguel Ángel Verdugo. En él se abordan temas relacionados con el cambio y la aplicación del paradigma de...

  11. Práticas alimentares no primeiro ano de vida

    OpenAIRE

    Lima, Ana Paula Esmeraldo; Javorski, Marly; Vasconcelos, Maria Gorete Lucena de

    2011-01-01

    O estudo buscou analisar a literatura publicada referente às práticas alimentares no primeiro ano de vida de filhos de mães adolescentes, por meio de uma revisão integrativa nas bases de dados Lilacs, Medline e Cochrane, no período de 2000 a 2010. Foram utilizadas as palavras-chave: adolescente, aleitamento materno, alimentação mista e nutrição do lactente, sendo selecionados onze artigos científicos, que compuseram a amostra do estudo. Os resultados apontaram a incipiência de pesquisas publi...

  12. Eugenesia y discapacidad: ¿calidad de vida o genocidio?

    OpenAIRE

    López Mainieri, Wendy

    2012-01-01

    En este artículo se pretenden analizar las implicaciones de la aplicación de técnicas eugenésicas en los embriones que presentan una discapacidad y si esta medida es realmente una estrategia viable para mejorar la calidad de vida, tanto de la persona como de su familia, o si es una forma solapada de genocidio, utilizada para liberar a la sociedad de la responsabilidad que tiene con respecto a la realización de adaptaciones y la creación de entornos accesibles.

  13. VULNERACIONES DE LA DIGNIDAD HUMANA AL FINAL DE LA VIDA

    OpenAIRE

    ROBERTO GERMÁN ZURRIARÁIN

    2017-01-01

    La muerte es constitutiva a la naturaleza humana y por ello tiene que acontecer de forma natural. Pero hay dos realidades que, principalmente, la falsifican: la eutanasia y la obstinación terapéutica. Dos opciones erróneas que no aceptan la realidad humana de la muerte (la primera adelantándola y la otra retrasándola). Desde el punto de vista filosófico y ético ambas son rechazadas, porque atentan contra la dignidad humana al final de la vida. Aparte de estas, en este artículo también se rech...

  14. Qualidade de vida de pessoas com estomias intestinais

    OpenAIRE

    Andrade, Rosane Sousa de

    2015-01-01

    Estomia é uma abertura de origem cirúrgica, quando há necessidade de desviar, temporária ou permanentemente, o trânsito normal da alimentação e/ou eliminações. O paciente com estomia de eliminação se vê diante de modificações em sua fisiologia, surgindo também à necessidade de cuidados com a bolsa coletora. Neste estudo, objetivou-se analisar a Qualidade de Vida (QV) de pessoas vivendo com Estomias Intestinais (EI), atendidos no Centro de Reabilitação Infantil e Adulto do Rio Grande do Norte ...

  15. O papel educativo da fotografia de vida selvagem

    Directory of Open Access Journals (Sweden)

    Cristina Bruzzo

    2013-03-01

    Full Text Available Este texto examina duas reportagens dos fotógrafos James Balog e Michael Nichols, da revista National Geographic, sobre animais selvagens em zoológicos para questionar o que nos ensinam as denominadas fotografias de animais a respeito do lugar reservado à vida selvagem na cultura contemporânea. Partindo das considerações do filósofo francês Didi-Huberman e de estudos sobre a domesticação, busca-se fornecer subsídios para compreender o propósito educativo da fotografia de animais.

  16. El perdón al final de la vida

    OpenAIRE

    Abreu Figueroa, Ana Gabriela

    2016-01-01

    El perdón se ha conceptualizado como un proceso de afrontamiento centrado en la emoción, que puede ayudar a las personas a manejar experiencias emocionales negativas. El proceso del perdón implica, entre otras cosas, evitar el resentimiento, reconceptualizar transgresiones pasadas y lograr un cambio de perspectiva espiritual y cognitiva, reduciendo la sintomatología y la mejora de su calidad de vida. Las intervenciones favorecedoras de perdón podrían ser particularmente beneficiosas para gara...

  17. Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz

    2010-08-01

    Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

  18. Sakacin-A antimicrobial packaging for decreasing Listeria contamination in thin-cut meat: preliminary assessment.

    Science.gov (United States)

    Barbiroli, Alberto; Musatti, Alida; Capretti, Giorgio; Iametti, Stefania; Rollini, Manuela

    2017-02-01

    Minimally processed ready-to-eat products are considered a high-risk food because of the possibility of contamination with pathogenic bacteria, including Listeria monocytogenes from the animal reservoir, and the minimal processing they undergo. In this study, a sakacin-A anti-Listeria active package was developed and tested on thin-cut veal meat slices (carpaccio). Enriched food-grade sakacin-A was obtained from a cell-free supernatant of a Lactobacillus sakei culture and applied (0.63 mg cm -2 ) onto the surface of polyethylene-coated paper sheets to obtain an active antimicrobial package. The coating retained antimicrobial features, indicating that the process did not affect sakacin-A functionality, as evidenced in tests carried out in vitro. Thin-cut veal meat slices inoculated with Listeria innocua (a surrogate of pathogenic L. monocytogenes) were laid on active paper sheets. After 48 h incubation at 4 °C, the Listeria population was found to be 1.5 log units lower with respect to controls (3.05 vs 4.46 log colony-forming units (CFU) g -1 ). This study demonstrates the possibility of using an antimicrobial coating containing sakacin-A to inhibit or decrease the Listeria population in ready-to-eat products, thus lowering the risk of food-related diseases. © 2016 The Authors. Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. © 2016 The Authors. Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

  19. Investigation of Listeria, Salmonella, and toxigenic Escherichia coli in various pet foods.

    Science.gov (United States)

    Nemser, Sarah M; Doran, Tara; Grabenstein, Michael; McConnell, Terri; McGrath, Timothy; Pamboukian, Ruiqing; Smith, Angele C; Achen, Maya; Danzeisen, Gregory; Kim, Sun; Liu, Yong; Robeson, Sharon; Rosario, Grisel; McWilliams Wilson, Karen; Reimschuessel, Renate

    2014-09-01

    The Veterinary Laboratory Investigation and Response Network (Vet-LIRN), in collaboration with the Food Emergency Response Network (FERN) and its Microbiology Cooperative Agreement Program (MCAP) laboratories, conducted a study to evaluate the prevalence of selected microbial organisms in various types of pet foods. The goal of this blinded study was to help the Center for Veterinary Medicine prioritize potential future pet food-testing efforts. The study also increased the FERN laboratories' screening capabilities for foodborne pathogens in animal feed matrices, since such pathogens may also be a significant health risk to consumers who come into contact with pet foods. Six U.S. Food and Drug Administration FERN MCAP laboratories analyzed approximately 1056 samples over 2 years. Laboratories tested for Salmonella, Listeria, Escherichia coli O157:H7 enterohemorrhagic E. coli, and Shiga toxin-producing strains of E. coli (STEC). Dry and semimoist dog and cat foods purchased from local stores were tested during Phase 1. Raw dog and cat foods, exotic animal feed, and jerky-type treats purchased through the Internet were tested in Phase 2. Of the 480 dry and semimoist samples, only 2 tested positive: 1 for Salmonella and 1 for Listeria greyii. However, of the 576 samples analyzed during Phase 2, 66 samples were positive for Listeria (32 of those were Listeria monocytogenes) and 15 samples positive for Salmonella. These pathogens were isolated from raw foods and jerky-type treats, not the exotic animal dry feeds. This study showed that raw pet foods may harbor food safety pathogens, such as Listeria monocytogenes and Salmonella. Consumers should handle these products carefully, being mindful of the potential risks to human and animal health.

  20. Listeria monocytogenes endophthalmitis - case report and review of risk factors and treatment outcomes.

    Science.gov (United States)

    Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig

    2016-07-16

    The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic