WorldWideScience

Sample records for vidas listeria species

  1. VIDAS Listeria species Xpress (LSX).

    Science.gov (United States)

    Johnson, Ronald; Mills, John

    2013-01-01

    The AOAC GovVal study compared the VIDAS Listeria species Xpress (LSX) to the Health Products and Food Branch MFHPB-30 reference method for detection of Listeria on stainless steel. The LSX method utilizes a novel and proprietary enrichment media, Listeria Xpress broth, enabling detection of Listeria species in environmental samples with the automated VIDAS in a minimum of 26 h. The LSX method also includes the use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LSX presumptive results. In previous AOAC validation studies comparing VIDAS LSX to the U.S. Food and Drug Administration's Bacteriological Analytical Manual (FDA-BAM) and the U.S. Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) reference methods, the LSX method was approved as AOAC Official Method 2010.02 for the detection of Listeria species in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry, and as AOAC Performance Tested Method 100501 in a variety of foods and on environmental surfaces. The GovVal comparative study included 20 replicate test portions each at two contamination levels for stainless steel where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. In the stainless steel artificially contaminated surface study, there were 25 confirmed positives by the VIDAS LSX assay and 22 confirmed positives by the standard culture methods. Chi-square analysis indicated no statistical differences between the VIDAS LSX method and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LSX results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data in this study demonstrate that the VIDAS LSX method is an acceptable alternative method to the MFHPB-30 standard

  2. Listeria monocytogenes and other Listeria species in retail meat and ...

    African Journals Online (AJOL)

    Listeria monocytogenes and other Listeria species in retail meat and milk products in Addis Ababa, Ethiopia. Bayleyegn Molla, Roman Yilma, Daniel Alemayehu. Abstract. No Abstract Available Ethiop.J.Health Dev. Vol.18(3) 2004: 208-212. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL ...

  3. Evaluation of VIDAS UP Listeria assay (LPT) for the detection of Listeria in a variety of foods and environmental surfaces: First Action 2013.10.

    Science.gov (United States)

    Crowley, Erin; Bird, Patrick; Flannery, Jonathan; Benzinger, M Joseph; Fisher, Kiel; Boyle, Megan; Huffman, Travis; Bastin, Ben; Bedinghaus, Paige; Judd, William; Hoang, Thao; Agin, James; Goins, David; Johnson, Ronald L

    2014-01-01

    The VIDAS UP Listeria (LPT) is an automated rapid screening enzyme phage-ligand based assay for the detection of Listeria species in human food products and environmental samples. The VIDAS LPT method was compared in a multi-laboratory collaborative study to AOAC Official Method 993.12 Listeria monocytogenes in Milk and Dairy Products reference method following current AOAC guidelines. A total of 14 laboratories participated, representing government and industry, throughout the United States. One matrix, queso fresco (soft Mexican cheese), was analyzed using two different test portion sizes, 25 and 125 g. Samples representing each test portion size were artificially contaminated with Listeria species at three levels, an uninoculated control level [0 colony-forming units (CFU)/test portion], a low-inoculum level (0.2-2 CFU/test portion), and a high-inoculum level (2-5 CFU/test portion). For this evaluation, 1800 unpaired replicate test portions were analyzed by either the VIDAS LPT or AOAC 993.12. Each inoculation level was analyzed using the Probability of Detection (POD) statistical model. For the low-level inoculated test portions, difference in collaborator POD (dLPOD) values of 0.01, (-0.10, 0.13), with 95% confidence intervals, were obtained for both 25 and 125 g test portions. The range of the confidence intervals for dLPOD values for both the 25 and 125 g test portions contains the point 0.0 indicating no statistically significant difference in the number of positive samples detected between the VIDAS LPT and the AOAC methods. In addition to Oxford agar, VIDAS LPT test portions were confirmed using Agar Listeria Ottavani and Agosti (ALOA), a proprietary chromogenic agar for the identification and differentiation of L. monocytogenes and Listeria species. No differences were observed between the two selective agars. The VIDAS LPT method, with the optional ALOA agar confirmation method, was adopted as Official First Action status for the detection of Listeria

  4. listeria monocytogenes AND OTHER Listeria species IN POUL TRY ...

    African Journals Online (AJOL)

    BSN

    ABSTRACT. Many diseases of poultry, particularly Listeriosis may be disseminated by faecal contamination of the environment or water. An assessment of the prevalence of l . monocy1ogenes and other listeria species in poultry faeces often utilized as manure in soil supplements for maximum crop yield was evaluated.

  5. Listeria species in retail smoked fish at Jos, Nigeria | Chukwu ...

    African Journals Online (AJOL)

    The prevalence of Listeria species in 65 samples of smoked fish at the retail markets in Jos, Nigeria, is reported. The experimental samples which included 30 catfish (Clarias species) and 35 Tilapia were screened for Listeria monocytogenes and other Listeria species using a two-step enrichment method. Total Listeria ...

  6. Characteristics and distribution of Listeria spp., including Listeria species newly described since 2009.

    Science.gov (United States)

    Orsi, Renato H; Wiedmann, Martin

    2016-06-01

    The genus Listeria is currently comprised of 17 species, including 9 Listeria species newly described since 2009. Genomic and phenotypic data clearly define a distinct group of six species (Listeria sensu strictu) that share common phenotypic characteristics (e.g., ability to grow at low temperature, flagellar motility); this group includes the pathogen Listeria monocytogenes. The other 11 species (Listeria sensu lato) represent three distinct monophyletic groups, which may warrant recognition as separate genera. These three proposed genera do not contain pathogens, are non-motile (except for Listeria grayi), are able to reduce nitrate (except for Listeria floridensis), and are negative for the Voges-Proskauer test (except for L. grayi). Unlike all other Listeria species, species in the proposed new genus Mesolisteria are not able to grow below 7 °C. While most new Listeria species have only been identified in a few countries, the availability of molecular tools for rapid characterization of putative Listeria isolates will likely lead to future identification of isolates representing these new species from different sources. Identification of Listeria sensu lato isolates has not only allowed for a better understanding of the evolution of Listeria and virulence characteristics in Listeria but also has practical implications as detection of Listeria species is often used by the food industry as a marker to detect conditions that allow for presence, growth, and persistence of L. monocytogenes. This review will provide a comprehensive critical summary of our current understanding of the characteristics and distribution of the new Listeria species with a focus on Listeria sensu lato.

  7. Carrier status for Listeria monocytogenes and other Listeria species ...

    African Journals Online (AJOL)

    Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...

  8. Comparative evaluation of the VIDAS Listeria monocytogenes Xpress (LMX) for the detection of Listeria monocytogenes in a variety of foods.

    Science.gov (United States)

    Johnson, Ronald; Mills, John; Pittet, Jean-Louis; Hughes, Denise

    2013-01-01

    The VIDAS Listeria monocytogenes Xpress (LMX) test is an enzyme-linked fluorescent immunoassay designed for use with the automated VIDAS or mini-VIDAS instruments for the specific detection of L. monocytogenes using a 26 h proprietary enrichment broth. The VIDAS LMX method was validated according to harmonized AOAC Research Institute (RI) and Official Methods of Analysis guidelines in both the AOAC Performance Tested Method (PTM) and GovVal programs. In the PTM comparison studies, the VIDAS LMX method was compared to the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook, the U.S. Food and Drug Administration Bacteriological Analytical Manual, and AOAC Official Methods. The comparative food studies consisted of two main parts: internal testing and AOAC independent laboratory testing, which included seven food matrixes (deli ham, processed cheese, vanilla ice cream, cooked shrimp, smoked white fish, frozen spinach, and peanut butter). As part of the AOAC R1 GovVal program, the VIDAS LMX method was compared to the Health Canada MFHPB-30 method for the detection of L. monocytogenes in five ready-to-eat (RTE) meats (hot dogs, deli turkey, deli ham, fermented sausage, and liver paté). Twenty replicates of each inoculation level and five uninoculated controls were evaluated in each study. The LMX method also included the use ofchromogenic media, chromID Ottaviani Agosti agar and chromID L. mono. agar, for confirmation of LMX presumptive results. In both the PTM and GovVal evaluations, there were no significant differences in the Chi-square values for the LMX method when compared to reference methods. The additional parameters tested in the PTM evaluation (inclusivity, exclusivity, ruggedness, stability, and lot-to-lot) satisfied the AOAC RI performance requirements. In both the PTM and GovVal validation studies, the VIDAS LMX method demonstrated reliability as a rapid qualitative method for next-day detection of L

  9. Diversity of Listeria Species in Urban and Natural Environments

    Science.gov (United States)

    Overdevest, Jon; Fortes, Esther; Windham, Katy; Schukken, Ynte; Lembo, Arthur; Wiedmann, Martin

    2012-01-01

    A total of 442 Listeria isolates, including 234 Listeria seeligeri, 80 L. monocytogenes, 74 L. welshimeri, 50 L. innocua, and 4 L. marthii isolates, were obtained from 1,805 soil, water, and other environmental samples collected over 2 years from four urban areas and four areas representing natural environments. Listeria spp. showed similar prevalences in samples from natural (23.4%) and urban (22.3%) environments. While L. seeligeri and L. welshimeri were significantly associated with natural environments (P ≤ 0.0001), L. innocua and L. monocytogenes were significantly associated with urban environments (P ≤ 0.0001). Sequencing of sigB for all isolates revealed 67 allelic types with a higher level of allelic diversity among isolates from urban environments. Some Listeria spp. and sigB allelic types showed significant associations with specific urban and natural areas. Nearest-neighbor analyses also showed that certain Listeria spp. and sigB allelic types were spatially clustered within both natural and urban environments, and there was evidence that these species and allelic types persisted over time in specific areas. Our data show that members of the genus Listeria not only are common in urban and natural environments but also show species- and subtype-specific associations with different environments and areas. This indicates that Listeria species and subtypes within these species may show distinct ecological preferences, which suggests (i) that molecular source-tracking approaches can be developed for Listeria and (ii) that detection of some Listeria species may not be a good indicator for L. monocytogenes. PMID:22504820

  10. Identification of Listeria species by microarray-based assay.

    Science.gov (United States)

    Volokhov, Dmitriy; Rasooly, Avraham; Chumakov, Konstantin; Chizhikov, Vladimir

    2002-12-01

    We have developed a rapid microarray-based assay for the reliable detection and discrimination of six species of the Listeria genus: L. monocytogenes, L. ivanovii, L. innocua, L. welshimeri, L. seeligeri, and L. grayi. The approach used in this study involves one-tube multiplex PCR amplification of six target bacterial virulence factor genes (iap, hly, inlB, plcA, plcB, and clpE), synthesis of fluorescently labeled single-stranded DNA, and hybridization to the multiple individual oligonucleotide probes specific for each Listeria species and immobilized on a glass surface. Results of the microarray analysis of 53 reference and clinical isolates of Listeria spp. demonstrated that this method allowed unambiguous identification of all six Listeria species based on sequence differences in the iap gene. Another virulence factor gene, hly, was used for detection and genotyping all L. monocytogenes, all L. ivanovii, and 8 of 11 L. seeligeri isolates. Other members of the genus Listeria and three L. seeligeri isolates did not contain the hly gene. There was complete agreement between the results of genotyping based on the hly and iap gene sequences. All L. monocytogenes isolates were found to be positive for the inlB, plcA, plcB, and clpE virulence genes specific only to this species. Our data on Listeria species analysis demonstrated that this microarray technique is a simple, rapid, and robust genotyping method that is also a potentially valuable tool for identification and characterization of bacterial pathogens in general.

  11. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

    Science.gov (United States)

    Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

    2015-06-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed

    Science.gov (United States)

    Stea, Emma C.; Purdue, Laura M.; Jamieson, Rob C.; Yost, Chris K.

    2015-01-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. PMID:25819965

  13. Isolation and characterisation of Listeria species from ruminants in ...

    African Journals Online (AJOL)

    A cross sectional study was carried out to determine the prevalence of Listeria species in ruminants in Maiduguri. Three hundred faecal samples were randomly collected from ruminants at the Maiduguri central abattoir from January – March, 2011. One hundred faecal samples each were collected from cattle, sheep and ...

  14. Antimicrobial susceptibility profile of Listeria species isolated from ...

    African Journals Online (AJOL)

    The antimicrobial susceptibility profile of L. monocytogenes and other Listeria species isolated from some ready-to-eat (RTE) foods sold in Kano metropolis, north-western Nigeria was carried out using disc-diffusion method. The results obtained showed that L. monocytogenes was moderately susceptible to all the ...

  15. Prevalence of Listeria species in some foods and their rapid ...

    African Journals Online (AJOL)

    Purpose: To investigate the occurrence of Listeria spp., (particularly L. monocytogenes), in different foods and to compare diagnostic tools for their identification at species level. Methods: Samples of high protein foods such as raw meats and meat products and including beef products, chicken, fish and camel milk were ...

  16. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food.

    Science.gov (United States)

    Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K

    2015-09-08

    The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.

  17. Evaluation of mini-VIDAS rapid test for detection of Listeria monocytogenes from production lines of fresh to cold-smoked fish.

    Science.gov (United States)

    Vaz-Velho, M; Duarte, G; Gibbs, P

    2000-04-01

    This study was conducted to evaluate the efficacy of the mini-VIDAS Listeria monocytogenes (LMO) system (BioMérieux Vitek, Inc., Missouri, USA) for detection of L. monocytogenes in environmental and fish samples from three Portuguese cold-smoking plants and from their fresh fish suppliers. Mini-VIDAS-LMO is a fully automated system that uses fluorescent ELFA (Enzyme Linked Fluorescent Assay) technology for detection of Listeria monocytogenes antigens in food. It can be a rapid screening method alternative to time consuming classical isolation and identification. Two hundred and ninety five samples were tested in mini-VIDAS-LMO and in parallel by the ISO 11290-1 traditional protocol. The mini-VIDAS-LMO detected 8 of the 11 confirmed positive samples and presented 11 false positive results. The specificity of the mini-VIDAS-LMO found in this experiment was 0.96 and the sensitivity 0.73.

  18. Occurrence and distribution of Listeria monocytogenes and other Listeria species in ready-to-eat and raw meat products.

    Science.gov (United States)

    Mengesha, Desalegn; Zewde, Bayleyegn Molla; Toquin, Marie-Thérèse; Kleer, Josef; Hildebrandt, Goetz; Gebreyes, Wondwossen A

    2009-01-01

    The present study was undertaken to estimate the occurrence and distribution of Listeria monocytogenes and other Listeria species in ready-to-eat food items (pasteurized milk, cheese, ice cream, and cakes) and raw meat products (minced beef, pork, and chicken carcasses). A total of 711 randomly selected samples were collected from supermarkets and pastry shops in Addis Ababa, Ethiopia. Listeria monocytogenes and other Listeria species were isolated and identified according to the techniques recommended by the International Organization for Standardization (ISO 11290-1). Serotyping of L. monocytogenes strains was carried out at the French Food Safety Agency (AFSSA), Ploufragan, France. Of the 711 food samples examined, 189 (26.6%) were Listeria positive of which 34 (4.8%) were L. monocytogenes. Pork was the most contaminated with Listeria species (62.5%) followed by minced beef (47.7%), ice cream (42.7%), soft cheese (16.8%), chicken carcasses (16.0%), and cakes (12.1%). All pasteurized milk and cottage cheese samples examined were Listeria negative. Listeria monocytogenes strains were isolated in ready-to-eat food items consisting of ice cream (11.7%), cakes (6.5%), and soft cheese (3.9%) and in meat products ranging from 3.7% to 5.1%. Among the 34 isolates of L. monocytogenes serotyped, serotypes 4b/4e (n = 32), 4c, and 4e (n = 2) were identified. The presence of L. monocytogenes in some ready-to-eat food items could pose public health hazards to the consumer, particularly to the high-risk group of the population.

  19. Reservoirs of Listeria Species in Three Environmental Ecosystems

    Science.gov (United States)

    Linke, Kristina; Rückerl, Irene; Brugger, Katharina; Karpiskova, Renata; Walland, Julia; Muri-Klinger, Sonja; Tichy, Alexander; Wagner, Martin

    2014-01-01

    Soil and water are suggested to represent pivotal niches for the transmission of Listeria monocytogenes to plant material, animals, and the food chain. In the present study, 467 soil and 68 water samples were collected in 12 distinct geological and ecological sites in Austria from 2007 to 2009. Listeria was present in 30% and 26% of the investigated soil and water samples, respectively. Generally, the most dominant species in soil and water samples were Listeria seeligeri, L. innocua, and L. ivanovii. The human- and animal-pathogenic L. monocytogenes was isolated exclusively from 6% soil samples in regions A (mountainous region) and B (meadow). Distinct ecological preferences were observed for L. seeligeri and L. ivanovii, which were more often isolated from wildlife reserve region C (Lake Neusiedl) and from sites in proximity to wild and domestic ruminants (region A). The higher L. monocytogenes detection and antibiotic resistance rates in regions A and B could be explained by the proximity to agricultural land and urban environment. L. monocytogenes multilocus sequence typing corroborated this evidence since sequence type 37 (ST37), ST91, ST101, and ST517 were repeatedly isolated from regions A and B over several months. A higher L. monocytogenes detection and strain variability was observed during flooding of the river Schwarza (region A) and Danube (region B) in September 2007, indicating dispersion via watercourses. PMID:25002422

  20. Reservoirs of listeria species in three environmental ecosystems.

    Science.gov (United States)

    Linke, Kristina; Rückerl, Irene; Brugger, Katharina; Karpiskova, Renata; Walland, Julia; Muri-Klinger, Sonja; Tichy, Alexander; Wagner, Martin; Stessl, Beatrix

    2014-09-01

    Soil and water are suggested to represent pivotal niches for the transmission of Listeria monocytogenes to plant material, animals, and the food chain. In the present study, 467 soil and 68 water samples were collected in 12 distinct geological and ecological sites in Austria from 2007 to 2009. Listeria was present in 30% and 26% of the investigated soil and water samples, respectively. Generally, the most dominant species in soil and water samples were Listeria seeligeri, L. innocua, and L. ivanovii. The human- and animal-pathogenic L. monocytogenes was isolated exclusively from 6% soil samples in regions A (mountainous region) and B (meadow). Distinct ecological preferences were observed for L. seeligeri and L. ivanovii, which were more often isolated from wildlife reserve region C (Lake Neusiedl) and from sites in proximity to wild and domestic ruminants (region A). The higher L. monocytogenes detection and antibiotic resistance rates in regions A and B could be explained by the proximity to agricultural land and urban environment. L. monocytogenes multilocus sequence typing corroborated this evidence since sequence type 37 (ST37), ST91, ST101, and ST517 were repeatedly isolated from regions A and B over several months. A higher L. monocytogenes detection and strain variability was observed during flooding of the river Schwarza (region A) and Danube (region B) in September 2007, indicating dispersion via watercourses. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Identification of Listeria Species by Microarray-Based Assay

    OpenAIRE

    Volokhov, Dmitriy; Rasooly, Avraham; Chumakov, Konstantin; Chizhikov, Vladimir

    2002-01-01

    We have developed a rapid microarray-based assay for the reliable detection and discrimination of six species of the Listeria genus: L. monocytogenes, L. ivanovii, L. innocua, L. welshimeri, L. seeligeri, and L. grayi. The approach used in this study involves one-tube multiplex PCR amplification of six target bacterial virulence factor genes (iap, hly, inlB, plcA, plcB, and clpE), synthesis of fluorescently labeled single-stranded DNA, and hybridization to the multiple individual oligonucleot...

  2. Comparative transcriptomics of pathogenic and non-pathogenic Listeria species

    Science.gov (United States)

    Wurtzel, Omri; Sesto, Nina; Mellin, J R; Karunker, Iris; Edelheit, Sarit; Bécavin, Christophe; Archambaud, Cristel; Cossart, Pascale; Sorek, Rotem

    2012-01-01

    Listeria monocytogenes is a human, food-borne pathogen. Genomic comparisons between L. monocytogenes and Listeria innocua, a closely related non-pathogenic species, were pivotal in the identification of protein-coding genes essential for virulence. However, no comprehensive comparison has focused on the non-coding genome. We used strand-specific cDNA sequencing to produce genome-wide transcription start site maps for both organisms, and developed a publicly available integrative browser to visualize and analyze both transcriptomes in different growth conditions and genetic backgrounds. Our data revealed conservation across most transcripts, but significant divergence between the species in a subset of non-coding RNAs. In L. monocytogenes, we identified 113 small RNAs (33 novel) and 70 antisense RNAs (53 novel), significantly increasing the repertoire of ncRNAs in this species. Remarkably, we identified a class of long antisense transcripts (lasRNAs) that overlap one gene while also serving as the 5′ UTR of the adjacent divergent gene. Experimental evidence suggests that lasRNAs transcription inhibits expression of one operon while activating the expression of another. Such a lasRNA/operon structure, that we named ‘excludon', might represent a novel form of regulation in bacteria. PMID:22617957

  3. Applicability of the EN ISO 11290-1 standard method for Listeria monocytogenes detection in presence of new Listeria species.

    Science.gov (United States)

    Barre, Léna; Angelidis, Apostolos S; Boussaid, Djouher; Brasseur, Emilie Decourseulles; Manso, Eléonore; Gnanou Besse, Nathalie

    2016-12-05

    During the past six years, new species of the genus Listeria have been isolated from foods and other environmental niches worldwide. The Standard method EN ISO 11290-1 that is currently under revision will include in its scope all Listeria species in addition to L. monocytogenes. The objective of this project was to evaluate the ability of the Standard EN ISO 11290-1 method to detect and identify the newly discovered Listeria spp., and to assess potential over-growth effects of the new species in mixed cultures with L. monocytogenes during each step of the enrichment process. This objective was addressed by the generation of necessary data on the behavior of the new species during the pre-enrichment and the enrichment steps of the reference method as well as data on their phenotypic characteristics on rich and selective media used for isolation and identification. Most of the new Listeria species developed well on selective agar media for Listeria, however the recovery of some species was difficult due to poor growth in Half Fraser and Fraser broth. Good results (consistently positive) were obtained for confirmation at the genus level via the catalase test, the Gram test and the blueish appearance test on non-selective medium, but not with the VP test, as most of the new species yielded a negative result. In the light of results obtained in co-culture experiments and inhibition tests, and considering the growth rates in Half Fraser and Fraser broths, the new species do not seem to interfere with the detection of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Identification of six Listeria species by real-time PCR assay.

    Science.gov (United States)

    Hage, E; Mpamugo, O; Ohai, C; Sapkota, S; Swift, C; Wooldridge, D; Amar, C F L

    2014-06-01

    The Listeria genus comprises 10 recognized species. Listeria monocytogenes causes listeriosis in humans and other animals primarily via contaminated food or animal feed. Listeria ivanovii causes listeriosis in animals and on rare occasions in humans. The identification of nonpathogenic species of Listeria in foods indicates that conditions exist that support the growth of pathogenic strains and is used to facilitate the implementation of control and prevention measures. This study shows the development and evaluation of a 5'exonuclease real-time PCR assay for the rapid identification of Listeria seeligeri, Listeria welshimeri, L. monocytogenes, L. ivanovii, Listeria grayi and Listeria innocua. The assay consists of two triplexes that were evaluated using 53 cultures of Gram-positive bacteria, including 49 Listeria spp. from human, animal, food or food-processing environments. The assay was rapid, specific and reproducible and could identify each of the six species from a mixture of strains. The developed assay proved to be a powerful means of rapidly identifying Listeria species and could be usefully implemented in busy specialist reference laboratories. The identification of species of Listeria from foods is important to monitor pathogenic strains and facilitates the implementation of control measures. This study shows the development and evaluation of a 5'exonuclease real-time PCR assay for the rapid identification of L. seeligeri, L. welshimeri, L. monocytogenes and L. ivanovii, L. grayi, L. innocua. The developed assay proved to be specific, rapid and reproducible and therefore could be implemented in busy specialist reference laboratories. © 2014 The Society for Applied Microbiology.

  5. Isolation and characterization of Listeria species from rodents in natural environments in China.

    Science.gov (United States)

    Wang, Yan; Lu, Liang; Lan, Ruiting; Salazar, Joelle K; Liu, Jingli; Xu, Jianguo; Ye, Changyun

    2017-06-07

    Listeria is ubiquitous in a variety of environments and can be isolated from a wide range of animal hosts. Rodents are capable of carrying pathogenic bacteria in their intestines, such as Listeria, and can disseminate those pathogens into the natural environment and to where human activity occurs. In this study, we investigated the occurrence and antimicrobial susceptibility of Listeria spp. isolated from wild rodents found in natural environments in China. We collected 341 intestinal fecal samples of rodents from five different regions of China, all representing different rodent habitats. The antimicrobial susceptibility of the Listeria spp. isolates obtained were firstly assessed using the Kirby-Bauer disk diffusion method. Thirty-one samples were positive for Listeria spp., of which 11 were positive for Listeria monocytogenes and seven were positive for Listeria ivanovii. Other species identified include Listeria innocua, Listeria fleischmannii and Listeria floridensis. All Listeria spp. isolates were sensitive to the majority of the antimicrobials tested, but largely resistant to oxacillin (94.1%) and cefuroxime (70.6%). All L. monocytogenes isolates were further characterized by serotyping, multi-locus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). L. monocytogenes strains were grouped into three serotypes, five sequence types and five pulsotypes (PTs) by serotyping, MLST and PFGE, respectively. Almost half of the isolates (five of 11) belonged to serotype 1/2b, ST87 and PT1. This study determined that Listeria is carried in the intestinal tracts of wild rodents from multiple regions at a low rate, filling an epidemiological data gap on Listeria in natural environments in China.

  6. InstantLabs Listeria species food safety kit. Performance tested methods 041304.

    Science.gov (United States)

    Sharma, Neil; Bambusch, Lauren; Le, Thu; Morey, Amit

    2014-01-01

    The InstantLabs Listeria Species Food SafetyKitwas validated against the International Organization for Standardization (ISO) reference method 11290-1 for the detection of Listeria monocytogenes and other Listeria species. The matrixes (stainless steel, sealed concrete, cheddar cheese, raw shrimp, and hot dogs) were inoculated with approximately 1 CFU/test portion of various Listeria species to generate fractional positives (5-15) in 20 inoculated samples. Enrichments were also fractionally inoculated with L. monocytogenes for side-by-side testing of the InstantLabs Listeria monocytogenes Food Safety Kit. Stainless steel and sealed concrete samples were validated using 4 x 4" and 1 x 1" test areas, respectively, and enriched in Buffered Listeria Enrichment Broth (BLEB) at 35 +/- 1 degrees C for 22-28 h. All food samples were tested at 25 g or 25 mL and enriched in BLEB at 35 +/- 1 degrees C for 24-28 h. All samples were confirmed using the ISO reference method, regardless of initial screen result. The InstantLabs test method performed as well as or better than the reference method for the detection of Listeria species on stainless steel, sealed concrete, cheddar cheese, raw shrimp, and hot dogs. Inclusivity and exclusivity testing revealed no false negatives and no false positives among the 80 Listeria species and 30 non-Listeria species examined. The method was shown to be robust when variations were introduced to the enrichment time, the volume for DNA extraction, and the heat block time (data not shown).

  7. Prevalence and antimicrobial resistance of listeria species isolated from different types of raw meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein

    2012-12-01

    Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.

  8. Sensitivity of Listeria species, recovered from indigenous chickens ...

    African Journals Online (AJOL)

    Background: Resistance of bacteria to antibiotics and disinfectants has been reported widely in the world. Listeria monocytogenes is no exception, although normally it tends to be variably sensitive to many antibiotics and disinfectants. Objectives: To assess the susceptibility of Listeria isolates recovered from indigenous ...

  9. Geographical and meteorological factors associated with isolation of Listeria species in New York State produce production and natural environments.

    Science.gov (United States)

    Chapin, Travis K; Nightingale, Kendra K; Worobo, Randy W; Wiedmann, Martin; Strawn, Laura K

    2014-11-01

    Listeria species have been isolated from diverse environments, often at considerable prevalence, and are known to persist in food processing facilities. The presence of Listeria spp. has been suggested to be a marker for Listeria monocytogenes contamination. Therefore, a study was conducted to (i) determine the prevalence and diversity of Listeria spp. in produce production and natural environments and (ii) identify geographical and/or meteorological factors that affect the isolation of Listeria spp. in these environments. These data were also used to evaluate Listeria spp. as index organisms for L. monocytogenes in produce production environments. Environmental samples collected from produce production (n = 588) and natural (n = 734) environments in New York State were microbiologically analyzed to detect and isolate Listeria spp. The prevalence of Listeria spp. was approximately 33 and 34% for samples obtained from natural environments and produce production, respectively. Co-isolation of L. monocytogenes and at least one other species of Listeria in a given sample was recorded for 3 and 9% of samples from natural environments and produce production, respectively. Soil moisture and proximity to water and pastures were highly associated with isolation of Listeria spp. in produce production environments, while elevation, study site, and proximity to pastures were highly associated with isolation of Listeria spp. in natural environments, as determined by randomForest models. These data show that Listeria spp. were prevalent in both agricultural and nonagricultural environments and that geographical and meteorological factors associated with isolation of Listeria spp. were considerably different between the two environments.

  10. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    Directory of Open Access Journals (Sweden)

    Ebrahim Rahimi

    2014-02-01

    Full Text Available Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. Results: Using cultural method, 19 samples (7.3% were positive for Listeria spp. The highest prevalence of Listeria was found in raw water buffalo milk (11.8%, followed by raw bovine milk (10.6%, raw ovine milk (7.1%, and raw caprine milk (4.2% samples. All 37 camel milk samples from 20 camel breeding farms were negative for Listeria spp. The overall prevalence of Listeria was 7.3%, in which Listeria innocua was the most recovered species (4.2%; the remaining isolates were Listeria monocytogenes (1.9%, Listeria ivanovii (0.08% and Listeria seeligari (0.04%. The PCR assay could identify 8 Listeria-contaminated milk samples that were negative using the cultural method. Conclusions: The results presented in this study indicate the potential risk of infection with Listeria in people consuming raw and unpasteurized milk.

  11. Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets.

    Science.gov (United States)

    Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh

    2015-07-25

    The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.

  12. Control of Listeria species food safety at a poultry food production facility.

    Science.gov (United States)

    Fox, Edward M; Wall, Patrick G; Fanning, Séamus

    2015-10-01

    Surveillance and control of food-borne human pathogens, such as Listeria monocytogenes, is a critical aspect of modern food safety programs at food production facilities. This study evaluated contamination patterns of Listeria species at a poultry food production facility, and evaluated the efficacy of procedures to control the contamination and transfer of the bacteria throughout the plant. The presence of Listeria species was studied along the production chain, including raw ingredients, food-contact, non-food-contact surfaces, and finished product. All isolates were sub-typed by pulsed-field gel electrophoresis (PFGE) to identify possible entry points for Listeria species into the production chain, as well as identifying possible transfer routes through the facility. The efficacy of selected in-house sanitizers against a sub-set of the isolates was evaluated. Of the 77 different PFGE-types identified, 10 were found among two or more of the five categories/areas (ingredients, food preparation, cooking and packing, bulk packing, and product), indicating potential transfer routes at the facility. One of the six sanitizers used was identified as unsuitable for control of Listeria species. Combining PFGE data, together with information on isolate location and timeframe, facilitated identification of a persistent Listeria species contamination that had colonized the facility, along with others that were transient. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Fructose 1,6-Bisphosphate Aldolase, a Novel Immunogenic Surface Protein on Listeria Species.

    Science.gov (United States)

    Mendonça, Marcelo; Moreira, Gustavo Marçal Schmidt Garcia; Conceição, Fabricio Rochedo; Hust, Michael; Mendonça, Karla Sequeira; Moreira, Ângela Nunes; França, Rodrigo Correa; da Silva, Wladimir Padilha; Bhunia, Arun K; Aleixo, José Antonio G

    2016-01-01

    Listeria monocytogenes is a ubiquitous food-borne pathogen, and its presence in food or production facilities highlights the importance of surveillance. Increased understanding of the surface exposed antigens on Listeria would provide potential diagnostic and therapeutic targets. In the present work, using mass spectrometry and genetic cloning, we show that fructose-1,6-bisphosphate aldolase (FBA) class II in Listeria species is the antigen target of the previously described mAb-3F8. Western and dot blot assays confirmed that the mAb-3F8 could distinguish all tested Listeria species from close-related bacteria. Localization studies indicated that FBA is present in every fraction of Listeria cells, including supernatant and the cell wall, setting Listeria spp. as one of the few bacteria described to have this protein on their cell surface. Epitope mapping using ORFeome display and a peptide membrane revealed a 14-amino acid peptide as the potential mAb-3F8 epitope. The target epitope in FBA allowed distinguishing Listeria spp. from closely-related bacteria, and was identified as part of the active site in the dimeric enzyme. However, its function in cell surface seems not to be host cell adhesion-related. Western and dot blot assays further demonstrated that mAb-3F8 together with anti-InlA mAb-2D12 could differentiate pathogenic from non-pathogenic Listeria isolated from artificially contaminated cheese. In summary, we report FBA as a novel immunogenic surface target useful for the detection of Listeria genus.

  14. Fructose 1,6-Bisphosphate Aldolase, a Novel Immunogenic Surface Protein on Listeria Species

    Science.gov (United States)

    Conceição, Fabricio Rochedo; Hust, Michael; Mendonça, Karla Sequeira; Moreira, Ângela Nunes; França, Rodrigo Correa; da Silva, Wladimir Padilha; Aleixo, José Antonio G.

    2016-01-01

    Listeria monocytogenes is a ubiquitous food-borne pathogen, and its presence in food or production facilities highlights the importance of surveillance. Increased understanding of the surface exposed antigens on Listeria would provide potential diagnostic and therapeutic targets. In the present work, using mass spectrometry and genetic cloning, we show that fructose-1,6-bisphosphate aldolase (FBA) class II in Listeria species is the antigen target of the previously described mAb-3F8. Western and dot blot assays confirmed that the mAb-3F8 could distinguish all tested Listeria species from close-related bacteria. Localization studies indicated that FBA is present in every fraction of Listeria cells, including supernatant and the cell wall, setting Listeria spp. as one of the few bacteria described to have this protein on their cell surface. Epitope mapping using ORFeome display and a peptide membrane revealed a 14-amino acid peptide as the potential mAb-3F8 epitope. The target epitope in FBA allowed distinguishing Listeria spp. from closely-related bacteria, and was identified as part of the active site in the dimeric enzyme. However, its function in cell surface seems not to be host cell adhesion-related. Western and dot blot assays further demonstrated that mAb-3F8 together with anti-InlA mAb-2D12 could differentiate pathogenic from non-pathogenic Listeria isolated from artificially contaminated cheese. In summary, we report FBA as a novel immunogenic surface target useful for the detection of Listeria genus. PMID:27489951

  15. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Science.gov (United States)

    Morton, Josephine; Karoonuthaisiri, Nitsara; Charlermroj, Ratthaphol; Stewart, Linda D; Elliott, Christopher T; Grant, Irene R

    2013-01-01

    The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni). Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  16. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Directory of Open Access Journals (Sweden)

    Josephine Morton

    Full Text Available The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni. Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  17. Listeria Species in Broiler Poultry Farms: Potential Public Health Hazards.

    Science.gov (United States)

    Dahshan, Hesham; Merwad, Abdallah Mohamed Amin; Mohamed, Taisir Saber

    2016-09-28

    Broiler meat production worldwide has been plagued by lethal food-poisoning bacteria diseases, including listeriosis. A fatality rate of 15.6% was recorded in human beings in the EU in 2015. During 2013, a total of 200 poultry farm samples, including litter, chicken breast, farm feed, and drinking water, were collected to generate baseline data for the characterization of the genus Listeria in broiler poultry farms. Listeria spp. were detected in a total of 95 (47.5%) poultry farm samples. The isolates of Listeria spp. included L. innocua (28.5%), L. ivanovii (12.5%), L. welshimeri (4.5%), and L. monocytogenes and L. seeligeri (1% each). Listeria spp. contamination rates were higher in farm feed (70%), followed by litter (52.5%), chicken breasts (42.2%), and drinking water (10%). Almost all Listeria spp. isolates were resistant to more than three classes of antibiotics (multidrug resistant). Besides this, we observed a significant resistance level to penicillin and fluoroquinolone drugs. However, lower resistance levels were recorded for broad-spectrum cephalosporins. The inlA, inlC, and inlJ virulence genes were detected in almost all of the L. monocytogenes isolates. Thus, food safety management approaches and interventions at all stages of the broiler rearing cycle were needed to control cross-contamination and the zoonotic potential of listeriosis.

  18. Consumer method to control Salmonella and Listeria species in shrimp.

    Science.gov (United States)

    Edwards, Genevieve; Janes, Marlene; Lampila, Lucina; Supan, John

    2013-01-01

    The purpose of this study was to determine whether the current consumer method of boiling shrimp until floating and pink in color is adequate for destroying Listeria and Salmonella. Shrimp samples were submerged in bacterial suspensions of Listeria and Salmonella for 30 min and allowed to air dry for 1 h under a biosafety cabinet. Color parameters were then measured with a spectrophotometer programmed with the CIELAB system. Twenty-four shrimp samples were divided into groups (days 0, 1, or 2) and stored at 4°C. The samples were treated by placing them in boiling water (100°C) on days 0, 1, and 2. The shrimp were immediately removed from the boiling water once they floated to the surface, and color parameters were measured. Bacterial counts were determined, and the log CFU per gram was calculated. The effect of sodium tripolyphosphate on the color change of cooked shrimp also was determined. Initial bacterial counts on shrimp after air drying were 5.31 ± 0.14 log CFU/g for Salmonella Enteritidis, 5.24 ± 0.31 log CFU/g for Salmonella Infantis, 5.40 ± 0.16 log CFU/g for Salmonella Typhimurium, 3.91 + 0.11 log CFU/g for Listeria innocua, 4.45 ± 0.11 log CFU/g for Listeria monocytogenes (1/2a), and 3.70 ± 0.22 log CFU/g for Listeria welshimeri. On days 0, 1, and 2, all bacterial counts were reduced to nondetectable levels for shrimp samples that floated. The average time for shrimp to float was 96 ± 8 s. The bacterial counts remained at nondetectable levels (Listeria and Salmonella contamination, but color change is not a good indication of reduction of these pathogens because of the wide natural color variation.

  19. Prevalence of Listeria species in some foods and their rapid ...

    African Journals Online (AJOL)

    demonstrated in vegetables [8], shrimp (9), beef, milk and dairy products [10,11]; sewage [12] and soil [13]. Listeria spp. is widespread in the environment, but only ... containing dehydrated substances, with each microtubule corresponding to an individual test and without additional tests. The 10 tests were arylamidase (DIM ...

  20. Matrix-assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS Can Precisely Discriminate the Lineages of Listeria monocytogenes and Species of Listeria.

    Directory of Open Access Journals (Sweden)

    Teruyo Ojima-Kato

    Full Text Available The genetic lineages of Listeria monocytogenes and other species of the genus Listeria are correlated with pathogenesis in humans. Although matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS has become a prevailing tool for rapid and reliable microbial identification, the precise discrimination of Listeria species and lineages remains a crucial issue in clinical settings and for food safety. In this study, we constructed an accurate and reliable MS database to discriminate the lineages of L. monocytogenes and the species of Listeria (L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. grayi, and L. rocourtiae based on the S10-spc-alpha operon gene encoded ribosomal protein mass spectrum (S10-GERMS proteotyping method, which relies on both genetic information (genomics and observed MS peaks in MALDI-TOF MS (proteomics. The specific set of eight biomarkers (ribosomal proteins L24, L6, L18, L15, S11, S9, L31 type B, and S16 yielded characteristic MS patterns for the lineages of L. monocytogenes and the different species of Listeria, and led to the construction of a MS database that was successful in discriminating between these organisms in MALDI-TOF MS fingerprinting analysis followed by advanced proteotyping software Strain Solution analysis. We also confirmed the constructed database on the proteotyping software Strain Solution by using 23 Listeria strains collected from natural sources.

  1. Matrix-assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) Can Precisely Discriminate the Lineages of Listeria monocytogenes and Species of Listeria.

    Science.gov (United States)

    Ojima-Kato, Teruyo; Yamamoto, Naomi; Takahashi, Hajime; Tamura, Hiroto

    2016-01-01

    The genetic lineages of Listeria monocytogenes and other species of the genus Listeria are correlated with pathogenesis in humans. Although matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has become a prevailing tool for rapid and reliable microbial identification, the precise discrimination of Listeria species and lineages remains a crucial issue in clinical settings and for food safety. In this study, we constructed an accurate and reliable MS database to discriminate the lineages of L. monocytogenes and the species of Listeria (L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. grayi, and L. rocourtiae) based on the S10-spc-alpha operon gene encoded ribosomal protein mass spectrum (S10-GERMS) proteotyping method, which relies on both genetic information (genomics) and observed MS peaks in MALDI-TOF MS (proteomics). The specific set of eight biomarkers (ribosomal proteins L24, L6, L18, L15, S11, S9, L31 type B, and S16) yielded characteristic MS patterns for the lineages of L. monocytogenes and the different species of Listeria, and led to the construction of a MS database that was successful in discriminating between these organisms in MALDI-TOF MS fingerprinting analysis followed by advanced proteotyping software Strain Solution analysis. We also confirmed the constructed database on the proteotyping software Strain Solution by using 23 Listeria strains collected from natural sources.

  2. Longitudinal studies on Listeria monocytogenes and other Listeria species in two salmon processing plants

    OpenAIRE

    Klæboe, Halvdan; Rosef, Olav; Sæbø, Mona

    2005-01-01

    Two plants processing salmon fillets and cold smoked salmon were investigated for occurrence of Listeria in products and the environment. Analyses were conducted for a period of 31 weeks. At plant A, 252 samples were examined of which 97 were from unprocessed fish and 155 from cold-smoked fish. At plant B, 189 samples of unprocessed fish were investigated. The first examination of unprocessed fish at plant A showed a presence of L. monocytogenes and L. spp. in 81% and 19% of the samples respe...

  3. Evaluation of the Thermo Scientific SureTect Listeria species assay. AOAC Performance Tested Method 071304.

    Science.gov (United States)

    Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron

    2014-01-01

    The Thermo Scientific SureTect Listeria species Assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. This validation study was conducted using the AOAC Research Institute (RI) Performance Tested Methods program to validate the SureTect Listeria species Assay in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996 including amendment 1:2004 in a variety of foods plus plastic and stainless steel. The food matrixes validated were smoked salmon, processed cheese, fresh bagged spinach, cantaloupe, cooked prawns, cooked sliced turkey meat, cooked sliced ham, salami, pork frankfurters, and raw ground beef. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, fresh bagged spinach, and stainless steel surface samples) were analyzed independently as part of the AOAC-RI-controlled independent laboratory study by the University ofGuelph, Canada. Using probability of detection statistical analysis, a significant difference in favour of the SureTect assay was demonstrated between the SureTect and reference method for high level spiked samples of pork frankfurters, smoked salmon, cooked prawns, stainless steel, and low-spiked samples of salami. For all other matrixes, no significant difference was seen between the two methods during the study. Inclusivity testing was conducted with 68 different isolates of Listeria species, all of which were detected by the SureTect Listeria species Assay. None of the 33 exclusivity isolates were detected by the SureTect Listeria species Assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside of the recommended parameters open to variation, which demonstrated that the assay gave reliable performance. Accelerated stability testing was additionally conducted, validating the assay

  4. Evaluation of the Thermo Scientific™ SureTect™ Listeria species Assay.

    Science.gov (United States)

    Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko

    2014-03-01

    The Thermo Scientific™ SureTect™ Listeria species Assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. This validation study was conducted using the AOAC Research Institute (RI) Performance Tested MethodsSM program to validate the SureTect Listeria species Assay in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996 including amendment 1:2004 in a variety of foods plus plastic and stainless steel. The food matrixes validated were smoked salmon, processed cheese, fresh bagged spinach, cantaloupe, cooked prawns, cooked sliced turkey meat, cooked sliced ham, salami, pork frankfurters, and raw ground beef. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, fresh bagged spinach, and stainless steel surface samples) were analyzed independently as part of the AOAC-RI-controlled independent laboratory study by the University of Guelph, Canada. Using probability of detection statistical analysis, a significant difference in favour of the SureTect assay was demonstrated between the SureTect and reference method for high level spiked samples of pork frankfurters, smoked salmon, cooked prawns, stainless steel, and low-spiked samples of salami. For all other matrixes, no significant difference was seen between the two methods during the study. Inclusivity testing was conducted with 68 different isolates of Listeria species, all of which were detected by the SureTect Listeria species Assay. None of the 33 exclusivity isolates were detected by the SureTect Listeria species Assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside of the recommended parameters open to variation, which demonstrated that the assay gave reliable performance. Accelerated stability testing was additionally conducted, validating the

  5. Presence of Listeria species in fresh meats from retail markets in Serbia

    Directory of Open Access Journals (Sweden)

    Dimić Gordana R.

    2010-01-01

    Full Text Available Listeria spp. are Gram positive, short, non-sporing rods, microaerophilic. Of the six species currently recognized, Listeria monocytogenes is the most important as it causes a range of infections in humans and animals. The organism can be found in a wide variety of habitats including the soil, food processing environments and raw foods. The ability of the organism to grow at refrigeration temperatures is of major importance in food production. This study examines the presence of Listeria species in fresh meat. 29 samples (chicken, pork and beef meat. This bacteria was found in 82.7% of analyzed samples; 7 L. innocua, 8 L. monocytogenes and 9 L. welshimeri (of all isolates. L. innocua prevailed in pork meat (40%, L. monocytogenes in chicken and pork meat (30%, and L. welshimeri in beef meat (44.4%.

  6. Evaluation of 3M™ Molecular Detection Assay (MDA) Listeria for the Detection of Listeria species in Selected Foods and Environmental Surfaces: Collaborative Study, First Action 2014.06.

    Science.gov (United States)

    Bird, Patrick; Flannery, Jonathan; Crowley, Erin; Agin, James; Goins, David; Monteroso, Lisa; Benesh, DeAnn

    2015-01-01

    The 3M™ Molecular Detection Assay (MDA) Listeria is used with the 3M Molecular Detection System for the detection of Listeria species in food, food-related, and environmental samples after enrichment. The assay utilizes loop-mediated isothermal amplification to rapidly amplify Listeria target DNA with high specificity and sensitivity, combined with bioluminescence to detect the amplification. The 3M MDA Listeria method was evaluated using an unpaired study design in a multilaboratory collaborative study and compared to the AOAC Official Method of AnalysisSM (OMA) 993.12 Listeria monocytogenes in Milk and Dairy Products reference method for the detection of Listeria species in full-fat (4% milk fat) cottage cheese (25 g test portions). A total of 15 laboratories located in the continental United States and Canada participated. Each matrix had three inoculation levels: an uninoculated control level (0 CFU/test portion), and two levels artificially contaminated with Listeria monocytogenes, a low inoculum level (0.2-2 CFU/test portion) and a high inoculum level (2-5 CFU/test portion) using nonheat-stressed cells. In total, 792 unpaired replicate portions were analyzed. Statistical analysis was conducted according to the probability of detection (POD) model. Results obtained for the low inoculum level test portions produced a difference in cross-laboratory POD value of -0.07 with a 95% confidence interval of (-0.19, 0.06). No statistically significant differences were observed in the number of positive samples detected by the 3M MDA Listeria method versus the AOAC OMA method.

  7. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

    Science.gov (United States)

    In the environment, many microorganisms coexist in communities as biofilms. The objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development was measured using crystal violet in 96-well microtiter pla...

  8. Evaluating the use of fatty acid profiles to differentiate human pathogenic and nonpathogenic Listeria species.

    Science.gov (United States)

    Whittaker, Paul

    2012-01-01

    Listeria monocytogenes is a Gram-positive human pathogen that is responsible for serious infections in immunocompromised individuals and pregnant women. Because of recent epidemics caused by food contaminated with L. monocytogenes, rapid methods for the detection of this pathogen in food are of interest. Capillary gas chromatography with flame ionization detection (GC-FID) was used to determine the cellular fatty acid profiles of six species of Listeria. The six different species are L. monocytogenes, L. ivanovii, L. innocua, L. welshimeri, L. seeligeri, and L. grayi. For GC-FID analysis, whole cell fatty acid methyl esters (FAMEs) from cells cultured on brain heart infusion (BHI) agar at 35 degrees C for 24 h were obtained by saponification, methylation, and extraction into hexane/methyl tert-butyl ether. A preliminary data set for 15 strains of Listeria species was prepared using fatty acid profiles from two or three replicates prepared on different days. Major fatty acids of the Listeria strains evaluated in this study were C15:0 iso, C15:0 ante iso, C16:0 iso, C16:0, C17:0 iso, and C17:0 ante iso. All of the major fatty acids differ significantly among these six species. The two fatty acids C17:0 ante iso and C15:0 ante iso showed the highest percentages, and the ratio of the two clearly showed significant differences between the human pathogen L. monocytogenes and the five nonpathogenic species. Analysis of FAMEs from Listeria strains grown on BHI agar by a GC-FID method is a sensitive procedure for identification of these organisms and differentiation between pathogenic and nonpathogenic species.

  9. Validation of the Applied Biosystems 7500 Fast Instrument for Detection of Listeria Species with the SureTect Listeria Species PCR Assay.

    Science.gov (United States)

    Cloke, Jonathan; Arizanova, Julia; Crabtree, David; Simpson, Helen; Evans, Katharine; Vaahtoranta, Laura; Palomäki, Jukka-Pekka; Artimo, Paulus; Huang, Feng; Liikanen, Maria; Koskela, Suvi; Chen, Yi

    2016-01-01

    The Thermo Scientific™ SureTect™ Listeria species Real-Time PCR Assay was certified during 2013 by the AOAC Research Institute (RI) Performance Tested Methods(SM) program as a rapid method for the detection of Listeria species from a wide range of food matrixes and surface samples. A method modification study was conducted in 2015 to extend the matrix claims of the product to a wider range of food matrixes. This report details the method modification study undertaken to extend the use of this PCR kit to the Applied Biosystems™ 7500 Fast PCR Instrument and Applied Biosystems RapidFinder™ Express 2.0 software allowing use of the assay on a 96-well format PCR cycler in addition to the current workflow, using the 24-well Thermo Scientific PikoReal™ PCR Instrument and Thermo Scientific SureTect software. The method modification study presented in this report was assessed by the AOAC-RI as being a level 2 method modification study, necessitating a method developer study on a representative range of food matrixes covering raw ground turkey, 2% fat pasteurized milk, and bagged lettuce as well as stainless steel surface samples. All testing was conducted in comparison to the reference method detailed in International Organization for Standardization (ISO) 6579:2002. No significant difference by probability of detection statistical analysis was found between the SureTect Listeria species PCR Assay or the ISO reference method methods for any of the three food matrixes and the surface samples analyzed during the study.

  10. Occurrence of Listeria species in different captive wild animals of Nandankanan Zoo, Baranga, Odisha, India

    Directory of Open Access Journals (Sweden)

    L.N. Sarangi

    2013-01-01

    Full Text Available Listeria species were isolated from faecal samples collected from different captive wild animals of Nandankanan Zoo, Baranga, Odisha, using selective enrichment medium. The isolates were characterized based on their cell morphology, biochemical and sugar fermentation characteristics as well as culture morphology. Further, in vitro and in vivo pathogenicity tests were carried out to assess the pathogenic potential of the isolates. Listeria were found in 24 (23.07% of the total 104 faecal samples. Listeria were isolated from the samples of tiger, bear, hyena, leopard, zebra, elephant, jackal, lion, barking deer, porcupine, chital, monkey and wild boar. Out of the 24 Listeria isolates 11 were confirmed as L. monocytogenes. The other 13 isolates included L. innocua, L. seeligeri, L. welshimeri and L. ivanovii. The pathogenicity study revealed that only four isolates were pathogenic. Three of these were L. monocytogenes isolated from tiger, hyena and elephant and one was L. ivanovii isolated from leopard. Antibiotic sensitivity of the 24 isolates was high towards ciprofloxacin, levofloxacin, amoxicillin, azithromycin and enrofloxacin. The isolates showed resistance towards oxytetracyclin, gentamicin, cephadroxil, penicillin- G and nalidixic acid.

  11. LEGER: knowledge database and visualization tool for comparative genomics of pathogenic and non-pathogenic Listeria species

    OpenAIRE

    Dieterich, Guido; Kärst, Uwe; Fischer, Elmar; Wehland, Jürgen; Jänsch, Lothar

    2005-01-01

    Listeria species are ubiquitous in the environment and often contaminate foods because they grow under conditions used for food preservation. Listeria monocytogenes, the human and animal pathogen, causes Listeriosis, an infection with a high mortality rate in risk groups such as immune-compromised individuals. Furthermore, L.monocytogenes is a model organism for the study of intracellular bacterial pathogens. The publication of its genome sequence and that of the non-pathogenic species Lister...

  12. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    Science.gov (United States)

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Effect of Filling Type and Heating Method on Prevalence of Listeria species and Listeria monocytogenes in Dumplings Produced in Poland.

    Science.gov (United States)

    Szymczak, Barbara; Dąbrowski, Waldemar

    2015-05-01

    The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®

  14. Mixed species biofilms of Listeria monocytogenes and Lactobacillus plantarum show enhanced resistance to benzalkonium chloride and peracetic acid

    NARCIS (Netherlands)

    Veen, van der S.; Abee, T.

    2011-01-01

    We investigated the formation of single and mixed species biofilms of Listeria monocytogenes strains EGD-e and LR-991, with Lactobacillus plantarum WCFS1 as secondary species, and their resistance to the disinfectants benzalkonium chloride and peracetic acid. Modulation of growth, biofilm formation,

  15. Method Modification Study for the Thermo Scientific SureTect™ Listeria Species Assay-Matrix Extension.

    Science.gov (United States)

    Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Chen, Yi; Ryser, Elliot; Carter, Mark

    2016-01-01

    The Thermo Scientific™ SureTect™ Listeria species assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. The assay was originally certified as Performance Tested Methods(SM) (PTM) 071304 in 2013. This report details the method modification study undertaken to extend the performance claims of the assay for matrixes of raw ground turkey, raw ground pork, bagged lettuce, raw pork sausages, pasteurized 2% fat milk, raw cod, pasteurized brie cheese, and ice cream. The method modification study was conducted using the AOAC Research Institute (RI) PTM program to validate the SureTect PCR assay in comparison to the reference method detailed in ISO 11290-1:1996 including amendment 1:2004. All matrixes were tested by Thermo Fisher Scientific (Basingstoke, United Kingdom). In addition, three matrixes (raw cod, bagged lettuce, and pasteurized brie cheese) were analyzed independently as part of the AOAC RI-controlled independent laboratory study by the University of Guelph, Canada. Using probability of detection statistical analysis, there was no significant difference in the performance between the SureTect assay and the International Organization for Standardization reference method for any of the matrixes analyzed in this study.

  16. Comparison of different selective methods for detection of Listeria species in surface water.

    Science.gov (United States)

    Bernagozzi, M; Sacchetti, R; Polenta, L; Bisbini, P

    1995-12-01

    Tests were carried out to evaluate the efficiency of various combinations of selective enrichment and plating techniques using pure cultures of Listeria monocytogenes, Listeria seeligeri and Listeria innocua in suspension and samples of surface water. The best yields for the various Listeria spp. were obtained after a single passage in LEB (Oxoid) or LEB Buffered (Oxoid) and after using Palcam and Oxford agar (Oxoid). Palcam agar was, however, shown to be the most efficient means of detecting the Listeria spp. in the natural water samples.

  17. Comparative proteome analysis of secretory proteins from pathogenic and nonpathogenic Listeria species.

    Science.gov (United States)

    Trost, Matthias; Wehmhöner, Dirk; Kärst, Uwe; Dieterich, Guido; Wehland, Jürgen; Jänsch, Lothar

    2005-04-01

    Extracellular proteins of bacterial pathogens play a crucial role in the infection of the host. Here we present the first comprehensive validation of the secretory subproteome of the Gram positive pathogen Listeria monocytogenes using predictive bioinformatic and experimental proteomic approaches. The previous original signal peptide (SP) prediction (Glaser et al., Science 2001, 294, 849-852) has been greatly improved by an in-depth analysis using seven different bioinformatic tools. Subsequent careful classification of the resulting data gives a probability dependent annotation of 121 putatively secreted proteins of which 45 are novel. Complementary proteomic analysis using both two-dimensional gel electrophoresis/matrix assisted laser desorption/ionization mass spectrometry and high performance liquid chromatography/electrospray ionization-mass spectrometry has identified 105 proteins in the culture supernatant of L. monocytogenes. Among these, we were able to detect all the currently known virulence factors with an SP showing the importance of this subproteome and demonstrating the reliability of the techniques used. The comparison between the L. monocytogenes wildtype and the nonpathogenic species Listeria innocua was performed to reveal proteins probably involved in pathogenicity and/or the adaptation to their respective lifestyles. In addition to the eight known virulence factors, all of which have no orthologous genes in L. innocua, eight additional proteins have been identified that exhibit the typical key feature defining the known listerial virulence factors. Further significant differences between the two species are evident in the group of cell wall and secretory proteins that warrant further study. Our investigation clearly demonstrates that the major difference between the pathogenic and nonpathogenic species, noted in the comparative genome analysis, manifests itself strongest in the secretome.

  18. Characterization of nonpathogenic Listeria species isolated from food and food processing environment.

    Science.gov (United States)

    Korsak, Dorota; Szuplewska, Magdalena

    2016-12-05

    A total of 127 Listeria isolates from food and food processing environments, including 75 L. innocua, 49 L. welshimeri, 2 L. seeligeri and 1L. grayi were tested for susceptibility to eight antimicrobials, benzalkonium chloride (BC), cadmium and arsenic. The isolates were also screened for the presence of extrachromosomal genetic elements - plasmids, and their restriction pattern types were determined. All strains were susceptible to ampicillin, ciprofloxacin, erythromycin, gentamicin, rifampicin, trimethoprim and vancomycin. Two of the L. innocua isolates showed resistance to tetracycline and minocycline. The resistance was determined by the presence of chromosomal localization of tet(M) gene, which was not integrated in the transposon Tn916-Tn1545 family. Of analyzed isolates, 18.11% and 55.91% isolates were resistant to BC and cadmium, respectively, but all were susceptible to arsenic. Resistance to BC was correlated with resistance to cadmium - all BC resistant isolates were also resistant to cadmium. On the other hand, 67.61% of cadmium-resistant isolates were susceptible to BC, suggesting that cadmium and BC resistance were not always concurrent in Listeria species. 48.03% of isolates contained plasmids. The size of most of the identified replicons was in the range of 50-90kb. All plasmids were classified into 12 groups with identical restriction pattern (I-XII). Interestingly, plasmids belonging to the same group were determined in isolates of the same species. Only in one case, plasmids with I-type profile were identified in L. innocua and L. welshimeri. There was an association between resistance to BC and plasmid DNA presence: all resistant isolates carried a plasmid. A correlation between resistance to cadmium and plasmid carriage was also observed in L. innocua and L. seeligeri isolates, but among resistant L. welshimeri, 23.08% of isolates did not have plasmids. This may suggest that resistance is associated with determinants located within the

  19. Listeria (Listeriosis)

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search The CDC Listeria (Listeriosis) Note: Javascript is disabled or is not ... Compartir Get answers to commonly asked questions about Listeria Listeria information en español Learn how CDC’s Listeria ...

  20. PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

    Directory of Open Access Journals (Sweden)

    Imad al Kassaa

    2016-06-01

    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  1. Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method.

    Science.gov (United States)

    Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou

    2015-06-01

    For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

    Directory of Open Access Journals (Sweden)

    Yunfeng Xu

    2017-09-01

    Full Text Available In the natural environments microorganisms coexist in communities as biofilms. Since foodborne pathogens have varying abilities to form biofilms, investigation of bacterial interactions in biofilm formation may enhance our understanding of the persistence of these foodborne pathogens in the environment. Thus the objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development after 24 h was measured using crystal violet in 96-well microtiter plate. Scanning electron microscopy and cell enumeration were employed after growth on stainless steel coupons. When compared with their single species counterparts, the dual species biofilms exhibited a significant increase in biofilm biomass. The number of L. monocytogenes in co-culture biofilms on stainless steel also increased significantly. However, there was no effect on the biofilm formation of L. monocytogenes when cultured with R. insidiosa separated by a semi-permeable membrane-linked compartment or cultured in R. insidiosa cell-free supernatant, indicating that direct cell-cell contact is critical for this interaction.

  3. Determination of virulence and antibiotic resistance pattern of biofilm producing Listeria species isolated from retail raw milk.

    Science.gov (United States)

    Osman, Kamelia M; Samir, Ahmed; Abo-Shama, Usama H; Mohamed, Essam H; Orabi, Ahmed; Zolnikov, Tara

    2016-11-08

    One of the foodborne pathogens is Listeria monocytogenes, which causes serious invasive illness in elderly and immunocompromised patients, pregnant women, newborns and infants ranking second after salmonellosis because of its high case fatality rate. Listerial cow mastitis marked by abnormal milk, increased cell counts and reduced production has not been reported. Therefore, apparently healthy cows can be reservoirs of L. monocytogenes. A number of 203 udder milk samples from apparently healthy animals (buffalo, n = 100; cow, n = 103) were collected and tested for Listeria. Isolated colonies on the PALCAM agar were Listeria species confirmed according to their biochemical and the Christie-Atkins-Munch-Petersen (CAMP) reactions. The Listeria species pathogenicity of was tested by phosphatidylinositol-specific phospholipase C, DL-alanine-β-naphthylamide HCl, Dalanine-p-nitroanilide tests, chick embryo, mice inoculation tests, Vero cell cytotoxicity and biofilm formation. The virulence-associated genes, hlyA, plcB, actA and iap associated with Listeria were molecularly assayed. The 17 isolated Listeria spp. represented a prevalence rate of 8.4 %. Of these 3 (1.4 %), 2 (1 %), 5 (2.5 %), 4 (2 %) and 3 (1.5 %) were confirmed as L. monocytogenes, L. innocua, L. welshimeri, L. seelegeri, respectively. While the L. monocytogenes isolate displayed all the four virulence-associated genes, L. seelegeri carried the hlyA gene only. The L. monocytogenes had a strong in vitro affinity to form a biofilm, in particular serotype 4 which is associated with human infections. L. monocytogenes showed resistance for 9/27 antibiotics. The biofilm forming capability of the Listeria spps. makes them particularly successful in colonizing surfaces within the host thus being responsible for persistence infections and due to their antimicrobial resistant phenotype that this structure confers. In addition, strains belonging to serotypes associated with human infections and

  4. Prevalence and antimicrobial susceptibility profile of listeria species from ready-to-eat foods of animal origin in Gondar Town, Ethiopia

    OpenAIRE

    Garedew, Legesse; Taddese, Ayele; Biru, Tigist; Nigatu, Seleshe; Kebede, Elias; Ejo, Mebrat; Fikru, Abraham; Birhanu, Tamiru

    2015-01-01

    Background Listeriosis, mostly caused by Listeria monocytogenes species, has become a major concern to public health authorities due to its clinical severity and high mortality rate, particularly in high risk groups. Currently, there is limited information regarding the prevalence and antimicrobial susceptibility profiles of listeria species in ready-to-eat foods of animal origin in Gondar town, Ethiopia. The aim of this study was to determine the prevalence and antimicrobial susceptibility p...

  5. LEGER: knowledge database and visualization tool for comparative genomics of pathogenic and non-pathogenic Listeria species.

    Science.gov (United States)

    Dieterich, Guido; Kärst, Uwe; Fischer, Elmar; Wehland, Jürgen; Jänsch, Lothar

    2006-01-01

    Listeria species are ubiquitous in the environment and often contaminate foods because they grow under conditions used for food preservation. Listeria monocytogenes, the human and animal pathogen, causes Listeriosis, an infection with a high mortality rate in risk groups such as immune-compromised individuals. Furthermore, L.monocytogenes is a model organism for the study of intracellular bacterial pathogens. The publication of its genome sequence and that of the non-pathogenic species Listeria innocua initiated numerous comparative studies and efforts to sequence all species comprising the genus. The Proteome database LEGER (http://leger2.gbf.de/cgi-bin/expLeger.pl) was developed to support functional genome analyses by combining information obtained by applying bioinformatics methods and from public databases to improve the original annotations. LEGER offers three unique key features: (i) it is the first comprehensive information system focusing on the functional assignment of genes and proteins; (ii) integrated visualization tools, KEGG pathway and Genome Viewer, alleviate the functional exploration of complex data; and (iii) LEGER presents results of systematic post-genome studies, thus facilitating analyses combining computational and experimental results. Moreover, LEGER provides an unpublished membrane proteome analysis of L.innocua and in total visualizes experimentally validated information about the subcellular localizations of 789 different listerial proteins.

  6. Detection of Listeria spp. using ACTERO listeria enrichment media.

    Science.gov (United States)

    Claveau, David; Olishevskyy, Sergiy; Giuffre, Michael; Martinez, Gabriela

    2014-01-01

    ACTERO Listeria Enrichment Media (ACTERO Listeria) is a selective medium developed for a single-step recovery and enrichment of Listeria spp. from environmental samples. Robustness testing of the ACTERO Listeria medium demonstrated good performance when minor changes were introduced to the incubation temperature and time. All 54 Listeria strains tested, representing the most frequently isolated Listeria species from food (L. monocytogenes, L. ivanovii, L. seeligeri, L. welshimeri, and L. grayi), were successfully enriched in ACTERO Listeria. None of the 30 nontarget strains tested in the exclusivity study was recovered after incubation in ACTERO Listeria. Recovery of Listeria was consistent across three independently produced lots of the ACTERO Listeria, and the prepared medium was stable for 45 days when stored at 4 degrees C in the dark. Matrix studies performed with environmental sponge samples from plastic and stainless steel surfaces demonstrated similar recovery of Listeria spp. in a single-step enrichment using ACTERO Listeria from plastic, and significantly better recovery from stainless steel surfaces when compared to the U.S. Department of Agriculture-Food Safety and Inspection Service reference method. The results of this study prove that ACTERO Listeria Enrichment Media can be effectively used in replacement of the two-step enrichment suggested by the reference method without affecting the recovery of Listeria spp. from environmental samples.

  7. Isolation and Confirmation of Listeria Species from Seafood off Goa Region by Polymerase Chain Reaction.

    Digital Repository Service at National Institute of Oceanography (India)

    Gawade, L.; Barbuddhe, S.B.; Bhosle, S.

    Several food borne outbreaks have highlighted the importance of Listeria monocytogenes to the public health and have been recognized as an emerging, important food borne pathogen, and a causative agent of listerioses. A number of genes are involved...

  8. Isolation and characterization of Listeria species from rodents in natural environments in China

    OpenAIRE

    Wang, Yan; Lu, Liang; Lan, Ruiting; Salazar, Joelle K; Liu, Jingli; Xu, Jianguo; Ye, Changyun

    2017-01-01

    Listeria is ubiquitous in a variety of environments and can be isolated from a wide range of animal hosts. Rodents are capable of carrying pathogenic bacteria in their intestines, such as Listeria, and can disseminate those pathogens into the natural environment and to where human activity occurs. In this study, we investigated the occurrence and antimicrobial susceptibility of List eria spp. isolated from wild rodents found in natural environments in China. We collected 341 intestinal fecal ...

  9. Detection, identification, and typing of Listeria species from baled silages fed to dairy cows.

    Science.gov (United States)

    Nucera, D M; Grassi, M A; Morra, P; Piano, S; Tabacco, E; Borreani, G

    2016-08-01

    Anaerobiosis, critical for successful ensilage, constitutes a challenge in baled silages. The loss of complete anaerobiosis causes aerobic deterioration and silages undergo dry matter and nutrient losses, pathogen growth, and mycotoxin production. Silage may represent an ideal substrate for Listeria monocytogenes, a pathogen of primary concern in several cheeses. The aim of this research was to investigate the occurrence of Listeria in baled silage fed to cows producing milk for a protected designation of origin cheese, and to characterize isolates by repetitive sequence-based PCR. Listeria spp. were detected in 21 silages and L. monocytogenes in 6 out of 80 of the analyzed silages; 67% of positives were found in molded zones. Results of the PCR typing showed genotypic homogeneity: 72.9 and 78.8% similarity between strains of Listeria spp. (n=56) and L. monocytogenes (n=24), respectively. Identical profiles were recovered in molded and nonmolded areas, indicating that contamination may have occurred during production. The application of PCR allowed the unambiguous identification of Listeria isolated from baled silages, and repetitive sequence-based PCR allowed a rapid and effective typing of isolates. Results disclose the potential of the systematic typing of Listeria in primary production, which is needed for the understanding of its transmission pathways. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

    OpenAIRE

    DAILEY, RACHEL C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

    2014-01-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product,...

  11. Prevalence and antimicrobial resistance of Listeria, Salmonella, and Yersinia species isolates in ducks and geese.

    Science.gov (United States)

    Jamali, Hossein; Radmehr, Behrad; Ismail, Salmah

    2014-04-01

    The aims of this study were to determine the prevalence and antimicrobial resistance of Listeria, Salmonella, and Yersinia spp. isolated from duck and goose intestinal contents. A total of 471 samples, including 291 duck and 180 goose intestinal contents, were purchased from wet markets between November 2008 and July 2010. Listeria, Salmonella, and Yersinia spp. were isolated from 58 (12.3%), 107 (22.7%), and 80 (17%) of the samples, respectively. It was concluded that Listeria ivanovii, Salmonella Thompson, and Yersinia enterocolitica were the predominant serovars among Listeria, Salmonella, and Yersinia spp., respectively. Moreover, resistance to tetracycline was common in Listeria (48.3%) and Salmonella spp. (63.6%), whereas 51.3% of the Yersinia spp. isolates were resistant to cephalothin. Therefore, continued surveillance of the prevalence of the pathogens and also of emerging antibiotic resistance is needed to render possible the recognition of foods that may represent risks and also ensure the effective treatment of listeriosis, salmonellosis, and yersiniosis.

  12. Prevalence and antimicrobial susceptibility profile of listeria species from ready-to-eat foods of animal origin in Gondar Town, Ethiopia.

    Science.gov (United States)

    Garedew, Legesse; Taddese, Ayele; Biru, Tigist; Nigatu, Seleshe; Kebede, Elias; Ejo, Mebrat; Fikru, Abraham; Birhanu, Tamiru

    2015-05-12

    Listeriosis, mostly caused by Listeria monocytogenes species, has become a major concern to public health authorities due to its clinical severity and high mortality rate, particularly in high risk groups. Currently, there is limited information regarding the prevalence and antimicrobial susceptibility profiles of listeria species in ready-to-eat foods of animal origin in Gondar town, Ethiopia. The aim of this study was to determine the prevalence and antimicrobial susceptibility pattern of Listeria species isolated from ready-to-eat food of animal origin from public dinning places in Gondar town, Ethiopia. A cross sectional study on ready-toeat foods of animal origin sampled from major supermarkets, butcher shops, pastry shops, restaurants and hotels was carried out. Culture, biochemical and sugar tests were conducted for listeria species identification and disc diffusion test was performed to study the antimicrobial susceptibility profiles of the isolates. Out of 384 food samples examined, 96 (25%) were positive for Listeria species. Listeria monocytogenes was detected in 24 (6.25%) of the samples. Listeria monocytogenes was isolated from cake, raw meat, ice cream, minced beef, fish, unpasteurized milk and pizza in that order from higher to lower rate. Assessment of antimicrobial susceptibility profile of L. monocytogenes revealed the presence of four multi-drug resistant isolates. The higher resistance rate was recorded for penicillin, nalidixic acid, tetracycline and chloramphenicol, in decreasing order. All L. monocytogenes identified in the current study were sensitive to amoxicillin, cephalothin, cloxacillin, sulfamethoxazole, gentamicin and vancomycin. The presence of L. monocytogenes including drug resistant and multidrug resistant isolates in some ready-to-eat food items is an indicator of the presence of public health hazards to the consumer, particularly to the high-risk groups. Hence awareness creation on food safety and implementation of regulations

  13. Prevalence of Listeria species in camel sausages from retail markets in Aydin province in Turkey and RAPD analysis of Listeria monocytogenes Isolates

    Directory of Open Access Journals (Sweden)

    Ozbey Gokben

    2006-06-01

    Full Text Available Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%, Listeria innocua from 14 samples (14% and Listeria welshimeri from two samples(2%. A 701 bp fragment of listeriolysin O sequence for L. monocytogenes was amplified using specific primers by polymerase chain reaction (PCR for confirmation of the identification. A random primer (OPA-11 was used in a random amplified polymorphic DNA (RAPD assay. This detected five different band profiles amongst the L. monocytogenes isolates, indicating a relatively large amount of genetic heterogeneity amongst the nine isolates. The study has highlighted the need for improved strategies for food safety, in particular appropriate hygienic precautions to avoid contamination of sausage during the manufacturing process and appropriate preservation techniques during storage and transport, to prevent transmission of Listeria spp to consumers at home and abroad.

  14. Permanent colonization of creek sediments, creek water and limnic water plants by four Listeria species in low population densities.

    Science.gov (United States)

    Lang-Halter, Evi; Schober, Steffen; Scherer, Siegfried

    2016-09-01

    During a 1-year longitudinal study, water, sediment and water plants from two creeks and one pond were sampled monthly and analyzed for the presence of Listeria species. A total of 90 % of 30 sediment samples, 84 % of 31 water plant samples and 67 % of 36 water samples were tested positive. Generally, most probable number counts ranged between 1 and 40 g-1, only occasionally >110 cfu g-1 were detected. Species differentiation based on FT-IR spectroscopy and multiplex PCR of a total of 1220 isolates revealed L. innocua (46 %), L. seeligeri (27 %), L. monocytogenes (25 %) and L. ivanovii (2 %). Titers and species compositions were similar during all seasons. While the species distributions in sediments and associated Ranunculus fluitans plants appeared to be similar in both creeks, RAPD typing did not provide conclusive evidence that the populations of these environments were connected. It is concluded that (i) the fresh-water sediments and water plants are year-round populated by Listeria, (ii) no clear preference for growth in habitats as different as sediments and water plants was found and (iii) the RAPD-based intraspecific biodiversity is high compared to the low population density.

  15. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants.

    Science.gov (United States)

    Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra

    2011-01-01

    A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.

  16. Reduced detectability of Listeria monocytogenes in the presence of Listeria innocua.

    Science.gov (United States)

    Zitz, Ulrike; Zunabovic, Marija; Domig, Konrad J; Wilrich, Peter-Theodor; Kneifel, Wolfgang

    2011-08-01

    Recent foodborne crises have demonstrated the importance of monitoring food safety. In terms of microbiological criteria, food safety requires the reliable detection of pathogens such as Listeria monocytogenes along the food chain by appropriate analytical methods. However, indications exist that accompanying Listeria innocua strains suppress the growth of L. monocytogenes during selective enrichment, which may cause reduced or even inhibited detection. To study these effects, the limit of detection of L. monocytogenes was investigated in the presence of L. innocua using the International Organization for Standardization standard method ISO 11290-1 and the VIDAS LDUO system, an automated method based on enzyme-linked fluorescence technology. The challenge was to provide low initial Listeria concentrations at sufficient precision to quantify the influence on the probability of detection of L. monocytogenes. The application of reference materials appropriate for quantitative test methods and a standardized dilution procedure were necessary to ensure accurate CFU levels of defined proportions of mixtures of both Listeria species. During selective enrichment, overgrowth of L. monocytogenes by L. innocua could be confirmed, leading to high rates of false-negative results. Moreover, with both methods, a significant decrease in the detectability of L. monocytogenes could be quantified at ratios of 2:1 at very low concentrations representative of natural contamination levels often found in foods and environments. It is concluded that there is a need to improve existing procedures with respect to selective enrichment, as well as the detection techniques.

  17. Evaluation of 3M Molecular Detection Assay (MDA) 2-Listeria for the Detection of Listeria Species in Select Foods and Environmental Surfaces: Collaborative Study, First Action 2016.07.

    Science.gov (United States)

    Bird, Patrick; Flannery, Jonathan; Crowley, Erin; Agin, James; Goins, David; Monteroso, Lisa

    2017-01-01

    3M Molecular Detection Assay (MDA) 2-Listeria uses loop-mediated isothermal amplification and bioluminescence detection to rapidly detect Listeria species in a broad range of food types and environmental surfaces. Using an unpaired study design, MDA 2-Listeria was compared with the U.S. Department of Agriculture, Food Safety and Inspection Service's Microbiology Laboratory Guidebook Chapter 8.09 "Isolation and identification of Listeria monocytogenes from red meat, poultry and egg products, and environmental samples" reference method for the detection of Listeria in deli turkey and raw chicken breast fillet. Technicians from 13 laboratories located within the continental United States and Canada participated in the collaborative study. Each matrix was evaluated at three levels of contamination: uninoculated control (0 CFU/test portion), low inoculum (0.2-2 CFU/test portion), and high inoculum (2-5 CFU/test portion). Statistical analysis was conducted according to the probability of detection (POD) statistical model. Results obtained for the low-inoculum-level test portions produced a difference between two laboratory POD values (dLPOD) with 95% confidence intervals of 0.04 (-0.08, 0.17) for deli turkey, indicating the difference between the methods was not statistically significant at the P = 0.05. For raw chicken breast fillet, a dLPOD value with 95% confidence interval of 0.16 (0.04, 0.28) indicated a statistically significant difference between the two methods, with an observed higher proportion of positive results by the candidate method than the reference method.

  18. Occurrence of Listeria species in meat, chicken products and human stools in Assiut city, Egypt with PCR use for rapid identification of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashraf Mohamed Abd El-Malek

    Full Text Available The present research was conducted to check the presence of Listeria spp. in some meat and chicken products purchased from retail supermarkets in Assiut (Egypt. A total of 100 samples including 25 samples each of minced frozen beef, luncheon, frozen chicken legs and frozen chicken breast fillets were collected over a 7-month period between January and July 2009 and analyzed for the presence of Listeria spp. In addition, 28 stool cultures examined for Listeria spp. from hospitalized children resident in Assiut Pediatric University Hospital with diarrhea or fever. Out of the total 100 meat samples examined, Listeria spp. were detected in 8 (32% of minced frozen beef, 8 (32% of luncheon, 13 (52% of frozen chicken leg and 14 (56% of frozen chicken fillet samples analyzed, respectively. Regarding the examined 28 stool cultures from hospitalized children with underlying disease in Assiut Univ. hospital, 2 (7.14% were found positive for Listeria spp. For identification of L. monocytogenes using polymerase chain reaction (PCR, two primers were selected to detect 217-pb fragment ofthe prfA (transcriptional activator of the virulence factor gene for L. monocytogenes. 13 selected Listeria isolates displayed beta-haemolysis on sheep blood agar and positive CAMP test were further identified using PCR. PCR results showed that L. monocytogenes were confirmed in one of minced imported frozen meat examined, two of luncheon samples and two of frozen chicken legs with the total incidence of 5 isolates (5% from the total 100 examined food samples. This suggests the presence of a significant public health hazard linked to the consumption of these meat and chicken products sold in Assiut city contaminated with L. monocytogenes. The public health significance of these pathogens as well as recommended sanitary measures was discussed. [Veterinary World 2010; 3(8.000: 353-359

  19. Enzyme-Benzalkonium chloride combined strategies to remove Listeria monocytogenes mixed-species biofilms /

    OpenAIRE

    Rodríguez-López, P.

    2017-01-01

    Bibliografia Listeria monocytogenes está considerada una de las bacterias patógenas transmitidas por alimentos de mayor relevancia en Europa. En la naturaleza, se encuentra formando biopelículas multiespecie, estructuras de resistencia constituidas por una matriz extracelular que actúa de barrera protectora frente a agentes externos, dificulta su acción y genera concentraciones subletales en el interior de la biopelícula. En el ámbito industrial, es habitual que las biopelículas estén expu...

  20. Microbiological safety of sandwiches from hospitals and other health care establishments in the United Kingdom with a focus on Listeria monocytogenes and other Listeria species.

    Science.gov (United States)

    Little, C L; Barrett, N J; Grant, K; McLauchlin, J

    2008-02-01

    In the United Kingdom between 1999 and 2004, there were four outbreaks of Listeria monocytogenes infection associated with sandwiches purchased from or provided in hospitals. Elderly or immunocompromised individuals and pregnant women are particularly vulnerable to infection; therefore, the focus of this study was on sandwiches served in health care establishments. Of 3,249 sandwich samples collected between April 2005 and March 2006, 3.3% were of unsatisfactory microbiological quality because of high levels of Enterobacteriaceae (2.0%; > or = 10(4) CFU/g for sandwiches not containing salad), Escherichia coli (0.8%; > or = 10(2) CFU/g), Staphylococcus aureus (0.6%; > or = 10(2) CFU/g), and/or Listeria spp. (0.1%; two samples with L. welshimeri at 1.8 x 10(2) and 7.4 x 10(3) CFU/g and one sample with L. seeligeri at 1.8 x 10(3) CFU/g). Overall, 7.6% of sandwiches were contaminated with Listeria spp. L. monocytogenes was detected in 2.7% (88) of samples: 87 samples at Listeria spp. and L. monocytogenes was found in sandwiches collected from hospital cafeterias, shops, or wards and in sandwiches stored and/or displayed at temperatures higher than 8 degrees C. The presence of Listeria spp. and L. monocytogenes also was associated with sandwiches that (i) were supplied from outside the establishment, (ii) were prepacked, (iii) had a main sandwich filling of poultry meat, or (iv) contained salad ingredients, soft cheese, and/or mayonnaise. Control of L. monocytogenes in sandwich manufacturing and within health care establishments is essential to minimize the potential for consumption of this bacterium at levels hazardous to health. The findings from this study support the proposal that manufacturers supplying sandwiches to health care establishments should follow the British Sandwich Association recommended guidelines of complete absence of L. monocytogenes in sandwiches at the point of production.

  1. Evaluation of reduction of Fraser incubation by 24h in the EN ISO 11290-1 standard on detection and diversity of Listeria species.

    Science.gov (United States)

    Gnanou Besse, Nathalie; Favret, Sandra; Desreumaux, Jennifer; Decourseulles Brasseur, Emilie; Kalmokoff, Martin

    2016-05-02

    The EN ISO 11290-1 method for the isolation of Listeria monocytogenes from food is carried out using a double enrichment in Fraser broths. While the method is effective it is also quite long requiring 4-7 days to process a contaminated food, and may be adversely affected by inter-strain and/or inter-species competition in samples containing mixed Listeria populations. Currently, we have little information on the impact of competition on food testing under routine conditions. Food samples (n=130) were analyzed using the standard method and the evolution of Listeria populations in 89 naturally contaminated samples followed over the entire enrichment process. In most instances, maximum increase in L. monocytogenes population occurred over the first 24h following sub-culture in Full Fraser broth and strain recovery was similar at both 24 and 48 h, indicating that the second enrichment step can be reduced by 24h without impacting the recovery of L. monocytogenes or affecting the sensitivity of the method. In approximately 6% of naturally contaminated samples the presence of competing Listeria species adversely impacted L. monocytogenes population levels. Moreover, these effects were more pronounced during the latter 24h of the Fraser enrichment, and potentially could affect or complicate the isolation of these strains. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  3. [Measuring the control and decrease in prevalence of Listeria monocytogenes species in foods of animal origin].

    Science.gov (United States)

    Caplan, Marius Eduard

    2011-01-01

    A large distributed bacterium, Listeria monocytogenes has been isolated from water and fresh vegetables, raw meat and processed meat (all types), and raw, salted and smoked fish. L. monocytogenes grows at low oxygen concentrations and at low temperatures, surviving for a long time in the environment, in the processing plant, as well as on the equipment, instruments and during storage at the refrigeration temperature. L. monocytogenes causes invasive listeriosis, often affecting immunocompromised individuals. Epidemiologically, listeriosis appears as sporadic cases and outbreaks, with an incidence of 3-8 cases/1000000 inhabitants, run-down in most countries, reflecting the measures compulsory in food processing industry. The purpose of this review is to describe the measures regarding the implementation of Current Good Manufacturing Practice (CGMP), to protrude the integrity of cold chain through preparing, packing and holding food, including household refrigerating, and to increase a good communication, particularly for consumers at increased risk of listeriosis.

  4. Roka Listeria detection method using transcription mediated amplification to detect Listeria species in select foods and surfaces. Performance Tested Method(SM) 011201.

    Science.gov (United States)

    Hua, Yang; Kaplan, Shannon; Reshatoff, Michael; Hu, Ernie; Zukowski, Alexis; Schweis, Franz; Gin, Cristal; Maroni, Brett; Becker, Michael; Wisniewski, Michele

    2012-01-01

    The Roka Listeria Detection Assay was compared to the reference culture methods for nine select foods and three select surfaces. The Roka method used Half-Fraser Broth for enrichment at 35 +/- 2 degrees C for 24-28 h. Comparison of Roka's method to reference methods requires an unpaired approach. Each method had a total of 545 samples inoculated with a Listeria strain. Each food and surface was inoculated with a different strain of Listeria at two different levels per method. For the dairy products (Brie cheese, whole milk, and ice cream), our method was compared to AOAC Official Method(SM) 993.12. For the ready-to-eat meats (deli chicken, cured ham, chicken salad, and hot dogs) and environmental surfaces (sealed concrete, stainless steel, and plastic), these samples were compared to the U.S. Department of Agriculture/Food Safety and Inspection Service-Microbiology Laboratory Guidebook (USDA/FSIS-MLG) method MLG 8.07. Cold-smoked salmon and romaine lettuce were compared to the U.S. Food and Drug Administration/Bacteriological Analytical Manual, Chapter 10 (FDA/BAM) method. Roka's method had 358 positives out of 545 total inoculated samples compared to 332 positive for the reference methods. Overall the probability of detection analysis of the results showed better or equivalent performance compared to the reference methods.

  5. LAP, an alcohol acetaldehyde dehydrogenase enzyme in Listeria, promotes bacterial adhesion to enterocyte-like Caco-2 cells only in pathogenic species.

    Science.gov (United States)

    Jagadeesan, Balamurugan; Koo, Ok Kyung; Kim, Kwang-Pyo; Burkholder, Kristin M; Mishra, Krishna K; Aroonnual, Amornrat; Bhunia, Arun K

    2010-09-01

    Listeria adhesion protein (LAP), an alcohol acetaldehyde dehydrogenase (lmo1634), interacts with host-cell receptor Hsp60 to promote bacterial adhesion during the intestinal phase of Listeria monocytogenes infection. The LAP homologue is present in pathogens (L. monocytogenes, L. ivanovii) and non-pathogens (L. innocua, L. welshimeri, L. seeligeri); however, its role in non-pathogens is unknown. Sequence analysis revealed 98 % amino acid similarity in LAP from all Listeria species. The N-terminus contains acetaldehyde dehydrogenase (ALDH) and the C-terminus an alcohol dehydrogenase (ADH). Recombinant LAP from L. monocytogenes, L. ivanovii, L. innocua and L. welshimeri exhibited ALDH and ADH activities, and displayed strong binding affinity (K(D) 2-31 nM) towards Hsp60. Flow cytometry, ELISA and immunoelectron microscopy revealed more surface-associated LAP in pathogens than non-pathogens. Pathogens exhibited significantly higher adhesion (Ppathogens; however, pretreatment of bacteria with Hsp60 caused 47-92 % reduction in adhesion only in pathogens. These data suggest that biochemical properties of LAP from pathogenic Listeria are similar to those of the protein from non-pathogens in many respects, such as substrate specificity, immunogenicity, and binding affinity to Hsp60. However, protein fractionation analysis of extracts from pathogenic and non-pathogenic Listeria species revealed that LAP was greatly reduced in intracellular and cell-surface protein fractions, and undetectable in the extracellular milieu of non-pathogens even though the lap transcript levels were similar for both. Furthermore, a LAP preparation from L. monocytogenes restored adhesion in a lap mutant (KB208) of L. monocytogenes but not in L. innocua, indicating possible lack of surface reassociation of LAP molecules in this bacterium. Taken together, these data suggest that LAP expression level, cell-surface localization, secretion and reassociation are responsible for LAP

  6. Removal of Listeria monocytogenes dual-species biofilms using combined enzyme-benzalkonium chloride treatments.

    Science.gov (United States)

    Rodríguez-López, Pedro; Carballo-Justo, Alba; Draper, Lorraine A; Cabo, Marta L

    2017-01-01

    The effects of pronase (PRN), cellulase (CEL) or DNaseI alone or combined with benzalkonium chloride (BAC) against Listeria monocytogenes-carrying biofilms were assayed. The best removal activity against L. monocytogenes-Escherichia coli biofilms was obtained using DNaseI followed by PRN and CEL. Subsequently, a modified logistic model was used to quantify the combined effects of PRN or DNaseI with BAC. A better BAC performance after PRN compared to DNaseI eradicating L. monocytogenes was observed. In E. coli the effects were the opposite. Finally, effects of DNaseI and DNaseI-BAC treatments were compared against two different L. monocytogenes-carrying biofilms. DNaseI-BAC was more effective against L. monocytogenes when co-cultured with E. coli. Nonetheless, comparing the removal effects after BAC addition, these were higher in mixed-biofilms with Pseudomonas fluorescens. However, a high number of released viable cells was observed after combined treatments. These results open new perspectives of enzymes as an anti-biofilm strategy for environmental pathogen control.

  7. Species and serovars of the genus Listeria lsolated from different sources in Brazil from 1971 to 1997

    Directory of Open Access Journals (Sweden)

    Hofer Ernesto

    2000-01-01

    Full Text Available Using phenotype techniques, characterization was made to species and serovar of 3,112 strains of Listeria, isolated from different sources of infection such as human (247-7.9% and animals (239-7.6%, as well as from various routes of infection, including food (2,330-74.8% and environmental constituents (296-9.5%, all coming from different regions of the country and collected during the period 1971-1997. The following species were recovered in the cultures analysed: L. monocytogenes (774-24.8%, L. innocua (2,269-72.9%, L. seeligeri (37-1.1%, L. welshimeri (22-0.7%, L. grayi (9-0.2%, and L. ivanovii (1-0.03%. L. monocytogenes was represented by ten serovars, the most prevalent being 4b (352-11.3%, 1/2a (162-5.2%, and 1/2b (148-4.7%. The predominant serovar in L. innocua was 6a (2,093-67.2%. Considerations about laboratory methods for diagnosis and epidemiological aspects are presented on the basis of the results obtained.

  8. Antimicrobial resistance and virulence signatures of Listeria and Aeromonas species recovered from treated wastewater effluent and receiving surface water in Durban, South Africa.

    Science.gov (United States)

    Olaniran, Ademola O; Nzimande, Sphephile B T; Mkize, Ndumiso G

    2015-10-24

    Treated wastewater effluent has been found to contain high levels of contaminants, including disease-causing bacteria such as Listeria and Aeromonas species. The aim of this study was to evaluate the antimicrobial resistance and virulence signatures of Listeria and Aeromonas spp. recovered from treated effluents of two wastewater treatment plants and receiving rivers in Durban, South Africa. A total of 100 Aeromonas spp. and 78 Listeria spp. were positively identified based on biochemical tests and PCR detection of DNA region conserved in these genera. The antimicrobial resistance profiles of the isolates were determined using Kirby Bauer disc diffusion assay. The presence of important virulence genes were detected via PCR, while other virulence determinants; protease, gelatinase and haemolysin were detected using standard assays. Highest resistance was observed against penicillin, erythromycin and nalidixic acid, with all 78 (100%) tested Listeria spp displaying resistance, followed by ampicillin (83.33%), trimethoprim (67.95%), nitrofurantoin (64.10%) and cephalosporin (60.26%). Among Aeromonas spp., the highest resistance (100%) was observed against ampicillin, penicillin, vancomycin, clindamycin and fusidic acid, followed by cephalosporin (82%), and erythromycin (58%), with 56% of the isolates found to be resistant to naladixic acid and trimethoprim. Among Listeria spp., 26.92% were found to contain virulence genes, with 14.10, 5.12 and 21% harbouring the actA, plcA and iap genes, respectively. Of the 100 tested Aeromonas spp., 52% harboured the aerolysin (aer) virulence associated gene, while lipase (lip) virulence associated gene was also detected in 68% of the tested Aeromonas spp. The presence of these organisms in effluents samples following conventional wastewater treatment is worrisome as this could lead to major environmental and human health problems. This emphasizes the need for constant evaluation of the wastewater treatment effluents to ensure

  9. The species-specific mode of action of the antimicrobial peptide subtilosin against Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Kuijk, van S.J.A.; Noll, K.S.; Chikindas, M.L.

    2012-01-01

    Aims: To elucidate the molecular mechanism of action of the antimicrobial peptide subtilosin against the foodborne pathogen Listeria monocytogenes Scott A. Methods and Results: Subtilosin was purified from a culture of Bacillus amylliquefaciens. The minimal inhibitory concentration of subtilosin

  10. Molecular analysis of dominant species in Listeria monocytogenes-positive biofilms in the drains of food processing facilities.

    Science.gov (United States)

    Liu, Yanlan; Zhang, Hongmei; Wu, Changli; Deng, Wenjia; Wang, Dong; Zhao, Guifen; Song, Jiankun; Jiang, Yan

    2016-04-01

    Listeria monocytogenes exhibits symbiotic codependence with the dominant commensal bacteria, which may help it avoid being removed or inactivated by disinfectants in local environments. In this study, we investigated L. monocytogenes-positive biofilms at food production facilities, and the dominant bacterial species of the biofilms were identified to determine the properties of the microbiological background. For this purpose, the ISO 11290 method was used for the detection and isolation of L. monocytogenes, and the species were further identified based on 16S rRNA and hly genes. 16S rRNA gene-based cloning, terminal restriction fragment length polymorphism, and denaturing gradient gel electrophoresis were combined to evaluate the dominant bacteria of the drain biofilms. Out of 100 drain samples, 8 were naturally contaminated with L. monocytogenes. Three molecular methods consistently showed that Pseudomonas psychrophila, Pseudomonas sp., and Klebsiella oxytoca were dominant species in 3Q, 5Q, and 6Q samples; Aeromonas hydrophila and Klebsiella sp. were significantly dominant in 1-2, 1-3, and 3-2 samples; A. hydrophila and K. oxytoca were dominant in the 2-3 sample; and A. hydrophila and Pseudomonas sp. were prominent in the 3-3 sample. Different biofilms from the same plant shared common bands, suggesting that similar bacteria can be found and can be dominant in different biofilms. This study provides a better understanding of the dominant compositions in these bacterial communities. Further studies to determine the mechanism of co-culture with L. monocytogenes will be of critical importance in predicting effective disinfection strategies.

  11. Effects of Cover Crop Species and Season on Population Dynamics of Escherichia coli and Listeria innocua in Soil

    Science.gov (United States)

    Reed-Jones, Neiunna L.; Marine, Sasha Cahn; Everts, Kathryne L.

    2016-01-01

    Cover crops provide several ecosystem services, but their impact on enteric bacterial survival remains unexplored. The influence of cover cropping on foodborne pathogen indicator bacteria was assessed in five cover crop/green manure systems: cereal rye, hairy vetch, crimson clover, hairy vetch-rye and crimson clover-rye mixtures, and bare ground. Cover crop plots were inoculated with Escherichia coli and Listeria innocua in the fall of 2013 and 2014 and tilled into the soil in the spring to form green manure. Soil samples were collected and the bacteria enumerated. Time was a factor for all bacterial populations studied in all fields (P innocua diminished somewhat but persisted, independently of season. In an organic field, the cover crop was a factor for E. coli in year 1 (P = 0.004) and for L. innocua in year 2 (P = 0.011). In year 1, E. coli levels were highest in the rye and hairy vetch-rye plots. In year 2, L. innocua levels were higher in hairy vetch-rye (P = 0.01) and hairy vetch (P = 0.03) plots than in the rye plot. Bacterial populations grew (P innocua numbers were observed after tilling (P innocua abundance in a transitional field (P < 0.05). Overall, the impacts of cover crops/green manures on bacterial population dynamics in soil varied, being influenced by bacterial species, time from inoculation, soil temperature, rainfall, and tillage; this reveals the need for long-term studies. PMID:26729724

  12. Effects of Cover Crop Species and Season on Population Dynamics of Escherichia coli and Listeria innocua in Soil.

    Science.gov (United States)

    Reed-Jones, Neiunna L; Marine, Sasha Cahn; Everts, Kathryne L; Micallef, Shirley A

    2016-01-04

    Cover crops provide several ecosystem services, but their impact on enteric bacterial survival remains unexplored. The influence of cover cropping on foodborne pathogen indicator bacteria was assessed in five cover crop/green manure systems: cereal rye, hairy vetch, crimson clover, hairy vetch-rye and crimson clover-rye mixtures, and bare ground. Cover crop plots were inoculated with Escherichia coli and Listeria innocua in the fall of 2013 and 2014 and tilled into the soil in the spring to form green manure. Soil samples were collected and the bacteria enumerated. Time was a factor for all bacterial populations studied in all fields (P cover crop was a factor for E. coli in year 1 (P = 0.004) and for L. innocua in year 2 (P = 0.011). In year 1, E. coli levels were highest in the rye and hairy vetch-rye plots. In year 2, L. innocua levels were higher in hairy vetch-rye (P = 0.01) and hairy vetch (P = 0.03) plots than in the rye plot. Bacterial populations grew (P cover crops/green manures on bacterial population dynamics in soil varied, being influenced by bacterial species, time from inoculation, soil temperature, rainfall, and tillage; this reveals the need for long-term studies. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Detection of Listeria species in refrigerated chicken carcasses using Clearview tm and a modified conventional culture method Detecção de Listeria spp em carcaças refrigeradas de frangos empregando Clearview e um método convencional de cultura modificado

    Directory of Open Access Journals (Sweden)

    Márcia R. Pelisser

    2001-06-01

    Full Text Available The occurence of Listeria species in refrigerated chicken carcasses was evaluated, comparing the conventional culture methodology of FDA, modified by the introduction of a secondary enrichment step prior plating, and the ClearviewTM rapid method (Oxoid, UK Ltd. Forty-eight refrigerated whole chicken carcasses purchased from supermarkets in Florianópolis, SC, Brazil, were analysed. Listeria species occured in 21 (43.7% samples. Using the Clearview method, 17 (35.4% samples were positive for Listeria species. Of these isolates, 11 (23% were L. monocytogenes, 4 (8.3% L. innocua, 1 (2.1% L. welshimeri and 1 (2.1% L. seeligeri. Using the conventional culture methodology of FDA (with modifications, 14 (29.2% samples were positive for Listeria species. Among these 7 (14.6% were L. monocytogenes, 6 (12.5% L. innocua and 1 (2.1% L. seeligeri. With the Clearview rapid method plus API Listeria for identification, results were confirmed to Listeria species level within 115-139 h. Using the conventional culture method of FDA (with modifications plus API Listeria, results were confirmed within 120-160 h. However, the Clearview method could indicate the presence of Listeria organisms in only 43 h. Results given by the methods were in moderate concordance and the differences between them were not significant (C.I. = 95%.Avaliou-se a ocorrência de Listeria spp em carcaças refrigeradas de frango, comparando-se a metodologia convencional recomendada pelo FDA, modificada pela introdução de uma segunda etapa de enriquecimento antes do plaqueamento, e o método rápido ClearviewTM (Oxoid, UK, Ltd. Foram analisadas 48 carcaças de frango de diferentes marcas e supermercados de Florianópolis, Brasil. Listeria spp foi encontrada em 21 (43,7% amostras. Através do método Clearview encontrou-se 17 (35,4% amostras positivas para Listeria spp, das quais 11 (23% eram L. monocytogenes, 4 (8.3% L. innocua, 1 (2.1% L. welshimeri e 1 (2.1% L. seeligeri. Através do m

  14. Identification of Conserved and Species-Specific Functions of the Listeria monocytogenes PrsA2 Secretion Chaperone

    Science.gov (United States)

    Cahoon, Laty A.

    2015-01-01

    The Gram-positive bacterium Listeria monocytogenes is a facultative intracellular pathogen that relies on the regulated secretion and activity of a variety of proteins that sustain life within diverse environments. PrsA2 has recently been identified as a secreted peptidyl-prolyl cis/trans isomerase and chaperone that is dispensable for bacterial growth in broth culture but essential for L. monocytogenes virulence. Following host infection, PrsA2 contributes to the proper folding and activity of secreted proteins that are required for bacterial replication within the host cytosol and for bacterial spread to adjacent cells. PrsA2 is one member of a family of Gram-positive secretion chaperones that appear to play important roles in bacterial physiology; however, it is not known how these proteins recognize their substrate proteins or the degree to which their function is conserved across diverse Gram-positive species. We therefore examined PrsA proteins encoded by a variety of Gram-positive bacteria for functional complementation of L. monocytogenes mutants lacking prsA2. PrsA homologues encoded by Bacillus subtilis, Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus mutans, Staphylococcus aureus, and Lactococcus lactis were examined for functional complementation of a variety of L. monocytogenes PrsA2-associated phenotypes central to L. monocytogenes pathogenesis and bacterial cell physiology. Our results indicate that while selected aspects of PrsA2 function are broadly conserved among diverse Gram-positive bacteria, PrsA2 exhibits unique specificity for L. monocytogenes target proteins required for pathogenesis. The L. monocytogenes PrsA2 chaperone thus appears evolutionarily optimized for virulence factor secretion within the host cell cytosol while still maintaining aspects of activity relevant to more general features of Gram-positive protein translocation. PMID:26216425

  15. [Listeria monocytogenes in human infections].

    Science.gov (United States)

    Kołakowska, Agnieszka; Madajczak, Grzegorz

    2011-01-01

    The Listeria genus is distinguished into six species from which just one--Listeria monocytogenes is pathogenic for humans. The main route of acquisition of Listeria is through the ingestion of contaminated food products. An important element of the L. monocytogenes pathogenesis infection is affiliation with high-risk group of immunocompromised patients, infants or pregnant women, who infected by this microorganism can lead to miscarriage. Listeriosis can appear in the form of sepsis, infection of the nervous system or local abscesses. Another form of listeriosis is gastrointestinal tract infection--noticed in case of food poisoning outbreak.

  16. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

    Science.gov (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

    2016-01-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

  17. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

    Science.gov (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

    2015-04-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  18. Prevalence and level of Listeria monocytogenes and other Listeria species in selected retail ready-to-eat foods in the United Kingdom.

    Science.gov (United States)

    Little, C L; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J

    2009-09-01

    Although listeriosis is a rare cause of human disease in the United Kingdom, an increase in the number of cases has been observed since 2001, almost exclusively in persons older than 60 years. This increase prompted this study on the microbiological safety of ready-to-eat (RTE) foods, which included those types potentially linked to cases of listeriosis. Between May 2006 and April 2007, 6,984 RTE foods were sampled (2,168 sliced meats, 1,242 hard cheese, 1,088 sandwiches, 878 butter, 725 spreadable cheese, 515 confectionery products containing cream, and 368 probiotic drinks). The food types with the highest prevalence of Listeria monocytogenes were sandwiches (7.0%) and sliced meats (3.7% within shelf life, 4.2% end of shelf life). L. monocytogenes at > 100 CFU/g (exceeding the European Commission's food safety criteria limit) only occurred in sandwiches (0.4%) and sliced meats (0.7% within shelf life, 1.0% end of shelf life). Contamination with L. monocytogenes at >100 CFU/g was more frequent in meats that were prepacked and/or of pack size > or = 300 g and in sandwiches that were supplied prepacked that contained salad vegetables as an ingredient. Satisfactory microbiological quality was associated with premises on which the management was trained in food hygiene and those that complied with hazard analysis and critical control point principles. This study provides important information about the microbiological safety of RTE foods and demonstrates that the control of L. monocytogenes in such foods, and in particular sandwiches and sliced meats, is essential in order to minimize the risk of this bacterium being present at levels hazardous to health at the point of consumption.

  19. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes

    OpenAIRE

    Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.

    2017-01-01

    The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments...

  20. Modelling the growth of Listeria monocytogenes in Mediterranean fish species from aquaculture production.

    Science.gov (United States)

    Bolívar, Araceli; Costa, Jean Carlos Correia Peres; Posada-Izquierdo, Guiomar D; Valero, Antonio; Zurera, Gonzalo; Pérez-Rodríguez, Fernando

    2018-02-05

    Over the last couple of decades, several studies have evaluated growth dynamics of L. monocytogenes in lightly processed and ready-to-eat (RTE) fishery products mostly consumed in Nordic European countries. Other fish species from aquaculture production are of special interest since their relevant consumption patterns and added value in Mediterranean countries, such as sea bream and sea bass. In the present study, the growth of L. monocytogenes was evaluated in fish-based juice (FBJ) by means of optical density (OD) measurements in a temperature range 2-20 °C under different atmosphere conditions (i.e. reduced oxygen and aerobic). The Baranyi and Roberts model was used to estimate the maximum growth rate (μ max ) from the observed growth curves. The effect of storage temperature on μ max was modelled using the Ratkowsky square root model. The developed models were validated using experimental growth data for L. monocytogenes in sea bream and sea bass fillets stored under static and dynamic temperature conditions. Overall, models developed in FBJ provided fail-safe predictions for L. monocytogenes growth. For the model generated under reduced oxygen conditions, bias and accuracy factor for growth rate predictions were 1.15 and 1.25, respectively, showing good performance to adequately predict L. monocytogenes growth in Mediterranean fish products. The present study provides validated predictive models for L. monocytogenes growth in Mediterranean fish species to be used in microbial risk assessment and shelf-life studies. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Listeria floridensis sp. nov., Listeria aquatica sp. nov., Listeria cornellensis sp. nov., Listeria riparia sp. nov. and Listeria grandensis sp. nov., from agricultural and natural environments.

    Science.gov (United States)

    den Bakker, Henk C; Warchocki, Steven; Wright, Emily M; Allred, Adam F; Ahlstrom, Christina; Manuel, Clyde S; Stasiewicz, Matthew J; Burrell, Angela; Roof, Sherry; Strawn, Laura K; Fortes, Esther; Nightingale, Kendra K; Kephart, Daniel; Wiedmann, Martin

    2014-06-01

    Sampling of agricultural and natural environments in two US states (Colorado and Florida) yielded 18 Listeria-like isolates that could not be assigned to previously described species using traditional methods. Using whole-genome sequencing and traditional phenotypic methods, we identified five novel species, each with a genome-wide average BLAST nucleotide identity (ANIb) of less than 85% to currently described species. Phylogenetic analysis based on 16S rRNA gene sequences and amino acid sequences of 31 conserved loci showed the existence of four well-supported clades within the genus Listeria; (i) a clade representing Listeria monocytogenes, L. marthii, L. innocua, L. welshimeri, L. seeligeri and L. ivanovii, which we refer to as Listeria sensu stricto, (ii) a clade consisting of Listeria fleischmannii and two newly described species, Listeria aquatica sp. nov. (type strain FSL S10-1188(T) = DSM 26686(T) = LMG 28120(T) = BEI NR-42633(T)) and Listeria floridensis sp. nov. (type strain FSL S10-1187(T) = DSM 26687(T) = LMG 28121(T) = BEI NR-42632(T)), (iii) a clade consisting of Listeria rocourtiae, L. weihenstephanensis and three novel species, Listeria cornellensis sp. nov. (type strain TTU A1-0210(T) = FSL F6-0969(T) = DSM 26689(T) = LMG 28123(T) = BEI NR-42630(T)), Listeria grandensis sp. nov. (type strain TTU A1-0212(T) = FSL F6-0971(T) = DSM 26688(T) = LMG 28122(T) = BEI NR-42631(T)) and Listeria riparia sp. nov. (type strain FSL S10-1204(T) = DSM 26685(T) = LMG 28119(T) = BEI NR- 42634(T)) and (iv) a clade containing Listeria grayi. Genomic and phenotypic data suggest that the novel species are non-pathogenic. © 2014 IUMS.

  2. Listeria monocytogenes transiently alters mitochondrial dynamics during infection

    OpenAIRE

    Stavru, Fabrizia; Bouillaud, Frederic; Sartori, Anna; Ricquier, Daniel; Cossart, Pascale

    2011-01-01

    Mitochondria are essential and highly dynamic organelles, constantly undergoing fusion and fission. We analyzed mitochondrial dynamics during infection with the human bacterial pathogen Listeria monocytogenes and show that this infection profoundly alters mitochondrial dynamics by causing transient mitochondrial network fragmentation. Mitochondrial fragmentation is specific to pathogenic Listeria monocytogenes, and it is not observed with the nonpathogenic Listeria innocua species or several ...

  3. Incidence and pathogenicity profile of Listeria sp. isolated from food ...

    African Journals Online (AJOL)

    Listeria species were isolated from all samples except the pork and goat meat samples. The highest incidence (100%) was observed in the soil and surface swab samples, respectively, followed by the vegetable samples (85%) and the beef samples (80%). Only Listeria monocytogenes and Listeria ivanovii were pathogenic ...

  4. Multiplex T-RFLP allows for increased target number and specificity: detection of Salmonella enterica and six species of Listeria in a single test.

    Directory of Open Access Journals (Sweden)

    Geoffrey N Elliott

    Full Text Available A multiplex T-RFLP test was developed to detect and identify Salmonella enterica and all six species of Listeria inoculated into milk at minimal levels. Extensive in silico analysis was used to design a fifteen-primer, six-amplimer methodology and in vitro application showed target organism DNA, when amplified individually, yielded the predicted terminal restriction fragments (TRFs following digestion. Non-target organisms were either not-amplified or yielded TRFs which did not interfere with target identification. Multiple target DNA analysis gave over 86% detection of total TRFs predicted, and this was improved to over 90% detection of total TRFs predicted when only two target DNA extracts were combined analysed. Co-inoculation of milk with five strains each of the target species of S. enterica and L. monocytogenes, along with five strains of the non-target species E. coli was followed by enrichment in SEL medium for M-TRFLP analysis. This allowed for detection of both target species in all samples, with detection of one S. enterica and two Listeria TRFs in all cases, and detection of a second S. enterica TRF in 91% of cases. This was from an initial inoculum of <5 cfu per 25 ml milk with a background of competing E. coli present, and gave a result from sampling of under 20 hours. The ability to increase target species number without loss of sensitivity means that extensive screening can be performed at reduced cost due to a reduction in the number of tests required.

  5. Listeria Infection (Listeriosis)

    Science.gov (United States)

    Listeria infection Overview Listeria infection is a foodborne bacterial illness that can be very serious for pregnant women and people with impaired immune systems. Listeria infection is most commonly contracted by eating improperly ...

  6. Listeria and Pregnancy

    Science.gov (United States)

    ... Events Advocacy For Patients About ACOG Listeria and Pregnancy Home For Patients Search FAQs Listeria and Pregnancy ... Pregnancy PFS013, January 2017 PDF Format Listeria and Pregnancy Fact Sheets Food Poisoning in Pregnant Women The ...

  7. Listeria Genomics

    Science.gov (United States)

    Cabanes, Didier; Sousa, Sandra; Cossart, Pascale

    The opportunistic intracellular foodborne pathogen Listeria monocytogenes has become a paradigm for the study of host-pathogen interactions and bacterial adaptation to mammalian hosts. Analysis of L. monocytogenes infection has provided considerable insight into how bacteria invade cells, move intracellularly, and disseminate in tissues, as well as tools to address fundamental processes in cell biology. Moreover, the vast amount of knowledge that has been gathered through in-depth comparative genomic analyses and in vivo studies makes L. monocytogenes one of the most well-studied bacterial pathogens. This chapter provides an overview of progress in the exploration of genomic, transcriptomic, and proteomic data in Listeria spp. to understand genome evolution and diversity, as well as physiological aspects of metabolism used by bacteria when growing in diverse environments, in particular in infected hosts.

  8. Bruker Biotyper Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry System for Identification of Nocardia, Rhodococcus, Kocuria, Gordonia, Tsukamurella, and Listeria Species

    Science.gov (United States)

    Lee, Tai-Fen; Du, Shin-Hei; Teng, Shih-Hua; Liao, Chun-Hsing; Sheng, Wang-Hui; Teng, Lee-Jene

    2014-01-01

    We evaluated whether the Bruker Biotyper matrix-associated laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) system provides accurate species-level identifications of 147 isolates of aerobically growing Gram-positive rods (GPRs). The bacterial isolates included Nocardia (n = 74), Listeria (n = 39), Kocuria (n = 15), Rhodococcus (n = 10), Gordonia (n = 7), and Tsukamurella (n = 2) species, which had all been identified by conventional methods, molecular methods, or both. In total, 89.7% of Listeria monocytogenes, 80% of Rhodococcus species, 26.7% of Kocuria species, and 14.9% of Nocardia species (n = 11, all N. nova and N. otitidiscaviarum) were correctly identified to the species level (score values, ≥2.0). A clustering analysis of spectra generated by the Bruker Biotyper identified six clusters of Nocardia species, i.e., cluster 1 (N. cyriacigeorgica), cluster 2 (N. brasiliensis), cluster 3 (N. farcinica), cluster 4 (N. puris), cluster 5 (N. asiatica), and cluster 6 (N. beijingensis), based on the six peaks generated by ClinProTools with the genetic algorithm, i.e., m/z 2,774.477 (cluster 1), m/z 5,389.792 (cluster 2), m/z 6,505.720 (cluster 3), m/z 5,428.795 (cluster 4), m/z 6,525.326 (cluster 5), and m/z 16,085.216 (cluster 6). Two clusters of L. monocytogenes spectra were also found according to the five peaks, i.e., m/z 5,594.85, m/z 6,184.39, and m/z 11,187.31, for cluster 1 (serotype 1/2a) and m/z 5,601.21 and m/z 11,199.33 for cluster 2 (serotypes 1/2b and 4b). The Bruker Biotyper system was unable to accurately identify Nocardia (except for N. nova and N. otitidiscaviarum), Tsukamurella, or Gordonia species. Continuous expansion of the MALDI-TOF MS databases to include more GPRs is necessary. PMID:24759706

  9. Bruker biotyper matrix-assisted laser desorption ionization-time of flight mass spectrometry system for identification of Nocardia, Rhodococcus, Kocuria, Gordonia, Tsukamurella, and Listeria species.

    Science.gov (United States)

    Hsueh, Po-Ren; Lee, Tai-Fen; Du, Shin-Hei; Teng, Shih-Hua; Liao, Chun-Hsing; Sheng, Wang-Hui; Teng, Lee-Jene

    2014-07-01

    We evaluated whether the Bruker Biotyper matrix-associated laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) system provides accurate species-level identifications of 147 isolates of aerobically growing Gram-positive rods (GPRs). The bacterial isolates included Nocardia (n = 74), Listeria (n = 39), Kocuria (n = 15), Rhodococcus (n = 10), Gordonia (n = 7), and Tsukamurella (n = 2) species, which had all been identified by conventional methods, molecular methods, or both. In total, 89.7% of Listeria monocytogenes, 80% of Rhodococcus species, 26.7% of Kocuria species, and 14.9% of Nocardia species (n = 11, all N. nova and N. otitidiscaviarum) were correctly identified to the species level (score values, ≥ 2.0). A clustering analysis of spectra generated by the Bruker Biotyper identified six clusters of Nocardia species, i.e., cluster 1 (N. cyriacigeorgica), cluster 2 (N. brasiliensis), cluster 3 (N. farcinica), cluster 4 (N. puris), cluster 5 (N. asiatica), and cluster 6 (N. beijingensis), based on the six peaks generated by ClinProTools with the genetic algorithm, i.e., m/z 2,774.477 (cluster 1), m/z 5,389.792 (cluster 2), m/z 6,505.720 (cluster 3), m/z 5,428.795 (cluster 4), m/z 6,525.326 (cluster 5), and m/z 16,085.216 (cluster 6). Two clusters of L. monocytogenes spectra were also found according to the five peaks, i.e., m/z 5,594.85, m/z 6,184.39, and m/z 11,187.31, for cluster 1 (serotype 1/2a) and m/z 5,601.21 and m/z 11,199.33 for cluster 2 (serotypes 1/2b and 4b). The Bruker Biotyper system was unable to accurately identify Nocardia (except for N. nova and N. otitidiscaviarum), Tsukamurella, or Gordonia species. Continuous expansion of the MALDI-TOF MS databases to include more GPRs is necessary. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

    DEFF Research Database (Denmark)

    Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

    2000-01-01

    A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...

  11. Behavior of Listeria monocytogenes in a multi-species biofilm with Enterococcus faecalis and Enterococcus faecium and control through sanitation procedures.

    Science.gov (United States)

    da Silva Fernandes, Meg; Kabuki, Dirce Yorika; Kuaye, Arnaldo Yoshiteru

    2015-05-04

    The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8 days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8 days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8 days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8 days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organismsbiofilms under all tested conditions (counts of the all microorganisms biofilms under all the test conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Listeria monocytogenes-carrying consortia in food industry. Composition, subtyping and numerical characterisation of mono-species biofilm dynamics on stainless steel.

    Science.gov (United States)

    Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta

    2015-08-03

    In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    2000-01-01

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment...... using CHR.4.17; Fraser and Fraser broths. L. monocytogenes was isolated from two of 71 broiler hocks, yielding an estimated flock prevalence of 3%. The flock prevalence of L. inocua was estimated to 13%, and it was speculated that the potential of this apathogenic bacteria to grow faster than L....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua...

  14. Development of a Novel Listeria Enrichment Broth for the Isolation of Pathogenic Listeria.

    Science.gov (United States)

    Liu, Dongxin; Wang, Yan; Wang, Yi; Zhang, Lu; Luo, Lijuan; Liu, Kai; Ye, Changyun

    2017-10-01

    Listeriosis, the disease caused by pathogenic Listeria species, can present severe symptoms in susceptible people. The goal of this study was to develop a novel enrichment broth, Listeria allose enrichment broth (LAEB), to improve isolation of Listeria monocytogenes and Listeria ivanovii from samples through incorporating a specific carbohydrate and reducing inhibitor concentrations. Other coexisting bacteria, particularly Listeria innocua, can interfere with the isolation of pathogenic Listeria in such ways as overgrowth of L. innocua and the generation of inhibitory metabolites. The incorporation of allose into the novel LAEB was effective for slowing the growth of L. innocua and other nontarget microorganisms. We determined that 35°C and pH 7.0 under aerobic conditions are optimal for Listeria growth in this medium. The novelty of the use of LAEB is the single enrichment procedure at 35°C for 24 h, obviating the need for a secondary enrichment medium. In 50 simulated samples, the sensitivity of the LAEB method (86%) was higher than that of the International Organization for Standardization (EN ISO) method (70%). In 142 naturally contaminated samples tested, the isolation rate for pathogenic Listeria with the LAEB method was 26.0% (37 of 142 samples), which was significantly higher than the 17.6% (25 of 142 samples) for the EN ISO method. Higher isolation rates and a quicker and easier protocol make the novel LAEB method an appropriate alternative for the isolation of pathogenic Listeria.

  15. 9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Control of Listeria monocytogenes in... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria..., such as Listeria species, to verify the effectiveness of their sanitation procedures in the post...

  16. Co-culture with Listeria monocytogenes within a dual-species biofilm community strongly increases resistance of Pseudomonas putida to benzalkonium chloride.

    Directory of Open Access Journals (Sweden)

    Efstathios Giaouris

    Full Text Available Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS, as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC used in inadequate (sub-lethal concentration (50 ppm. The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90% of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation.

  17. Co-Culture with Listeria monocytogenes within a Dual-Species Biofilm Community Strongly Increases Resistance of Pseudomonas putida to Benzalkonium Chloride

    Science.gov (United States)

    Giaouris, Efstathios; Chorianopoulos, Nikos; Doulgeraki, Agapi; Nychas, George-John

    2013-01-01

    Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS), as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC) used in inadequate (sub-lethal) concentration (50 ppm). The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species) did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90%) of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE) analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation. PMID:24130873

  18. Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces.

    Science.gov (United States)

    Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth

    2013-01-01

    This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

  19. Tolerance development in Listeria monocytogenes-Escherichia coli dual-species biofilms after sublethal exposures to pronase-benzalkonium chloride combined treatments.

    Science.gov (United States)

    Rodríguez-López, Pedro; Cabo, Marta López

    2017-10-01

    This study was designed to assess the effects that sublethal exposures to pronase (PRN) and benzalkonium chloride (BAC) combined treatments have on Listeria monocytogenes-Escherichia coli dual-species biofilms grown on stainless steel in terms of tolerance development (TD) to these compounds. Additionally, fluorescence microscopy was used to observe the changes of the biofilm structure. PRN-BAC exposure was carried out using three different approaches and TD was evaluated treating biofilms with a final 100 μg/ml PRN followed by 50 μg/ml BAC combined treatment. Results showed that exposure to PRN-BAC significantly decreased the number of adhered L. monocytogenes (P coli counts remained generally unaltered. It was also demonstrated that the incorporation of recovery periods during sublethal exposures increased the tolerance of both species of the mixed biofilm to the final PRN-BAC treatment. Moreover, control biofilms became more resistant to PRN-BAC if longer incubation periods were used. Regardless of the treatment used, log reduction values were generally lower in L. monocytogenes compared to E. coli. Additionally, microscopy images showed an altered morphology produced by sublethal PRN-BAC in exposed L. monocytogenes-E. coli dual-species biofilms compared to control samples. Results also demonstrated that L. monocytogenes-E. coli dual-species biofilms are able to develop tolerance to PRN-BAC combined treatments depending on way they have been previously exposed. Moreover, they suggest that the generation of bacterial tolerance should be included as a parameter for sanitation procedures design. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Zdravotní rizika spojená s rodem Listeria

    OpenAIRE

    KARBANOVÁ, Aneta

    2016-01-01

    This bachelor thesis is concerned with the health risks associated with the genus Listeria, especially with the species Listeria monocytogenes and Listeria ivanovii inducing listeriosis. As for humans, listeriosis occurs rather sporadically, nevertheless, it can cause outbreaks, listeriosis can also become a hospital infection. Listeriosis is dangerous primarily for pregnant women where it can cause abortions and for individuals with weakened immune systems where it may even cause encephaliti...

  1. IS THE DISTRIBUTION OF LISTERIA SPP. ISOLATED FROM ALL-NATURAL, MIXED SPECIES, PASTURED-RAISED BROILER FARMS RELATED TO DIFFERENTIAL GROWTH?

    Science.gov (United States)

    Background: Listeria spp. represent an important foodborne pathogen, but relatively little is known about its environmental prevalence on poultry farms. Considering the environmental exposure inherent with pasture-raised production systems, these types of alternative poultry management systems repr...

  2. Listeria booriae sp. nov. and Listeria newyorkensis sp. nov., from food processing environments in the USA.

    Science.gov (United States)

    Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C

    2015-01-01

    Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.

  3. Foodborne Listeria monocytogenes: A Real Challenge in Quality Control.

    Science.gov (United States)

    Pusztahelyi, Tünde; Szabó, Judit; Dombrádi, Zsuzsanna; Kovács, Szilvia; Pócsi, István

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen, and the detection and differentiation of this bacterium from the nonpathogenic Listeria species are of great importance to the food industry. Differentiation of Listeria species is very difficult, even with the sophisticated MALDI-TOF MS technique because of the close genetic relationship of the species and the usual gene transfer. The present paper emphasizes the difficulties of the differentiation through the standardized detection and confirmation according to ISO 11290-1:1996 and basic available L. monocytogenes detection methods and tests (such as API Listeria test, MALDI-TOF MS analysis, and hly gene PCR). With the increase of reports on the pathogenesis of atypical Listeria strains in humans, the significance of species level determination has become questionable, especially in food quality control, and the detection of pathogenic characteristics seems to be more relevant.

  4. Foodborne Listeria monocytogenes: A Real Challenge in Quality Control

    Directory of Open Access Journals (Sweden)

    Tünde Pusztahelyi

    2016-01-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen, and the detection and differentiation of this bacterium from the nonpathogenic Listeria species are of great importance to the food industry. Differentiation of Listeria species is very difficult, even with the sophisticated MALDI-TOF MS technique because of the close genetic relationship of the species and the usual gene transfer. The present paper emphasizes the difficulties of the differentiation through the standardized detection and confirmation according to ISO 11290-1:1996 and basic available L. monocytogenes detection methods and tests (such as API Listeria test, MALDI-TOF MS analysis, and hly gene PCR. With the increase of reports on the pathogenesis of atypical Listeria strains in humans, the significance of species level determination has become questionable, especially in food quality control, and the detection of pathogenic characteristics seems to be more relevant.

  5. Vida = Life

    Directory of Open Access Journals (Sweden)

    Canguilhem, Georges

    2015-01-01

    Full Text Available Em 1973, Georges Canguilhem publica, na Encyclopédie Universalis, um extenso verbete histórico do conceito “Vida” na biologia e nas ciências da vida. A seguinte tradução do verbete é baseada na segunda edição, reimpressão publicada em 1989, nas páginas 546-553

  6. Listeria monocytogenes transiently alters mitochondrial dynamics during infection.

    Science.gov (United States)

    Stavru, Fabrizia; Bouillaud, Frédéric; Sartori, Anna; Ricquier, Daniel; Cossart, Pascale

    2011-03-01

    Mitochondria are essential and highly dynamic organelles, constantly undergoing fusion and fission. We analyzed mitochondrial dynamics during infection with the human bacterial pathogen Listeria monocytogenes and show that this infection profoundly alters mitochondrial dynamics by causing transient mitochondrial network fragmentation. Mitochondrial fragmentation is specific to pathogenic Listeria monocytogenes, and it is not observed with the nonpathogenic Listeria innocua species or several other intracellular pathogens. Strikingly, the efficiency of Listeria infection is affected in cells where either mitochondrial fusion or fission has been altered by siRNA treatment, highlighting the relevance of mitochondrial dynamics for Listeria infection. We identified the secreted pore-forming toxin listeriolysin O as the bacterial factor mainly responsible for mitochondrial network disruption and mitochondrial function modulation. Together, our results suggest that the transient shutdown of mitochondrial function and dynamics represents a strategy used by Listeria at the onset of infection to interfere with cellular physiology.

  7. Listeria fleischmannii sp. nov., isolated from cheese.

    Science.gov (United States)

    Bertsch, David; Rau, Jörg; Eugster, Marcel R; Haug, Martina C; Lawson, Paul A; Lacroix, Christophe; Meile, Leo

    2013-02-01

    A study was performed on three isolates (LU2006-1(T), LU2006-2 and LU2006-3), which were sampled independently from cheese in western Switzerland in 2006, as well as a fourth isolate (A11-3426), which was detected in 2011, using a polyphasic approach. The isolates could all be assigned to the genus Listeria but not to any known species. Phenotypic and chemotaxonomic data were compatible with the genus Listeria and phylogenetic analysis based on 16S rRNA gene sequences confirmed that the closest relationships were with members of this genus. However, DNA-DNA hybridization demonstrated that the isolates did not belong to any currently described species. Cell-wall-binding domains of Listeria monocytogenes bacteriophage endolysins were able to attach to the isolates, confirming their tight relatedness to the genus Listeria. Although PCR targeting the central portion of the flagellin gene flaA was positive, motility was not observed. The four isolates could not be discriminated by Fourier transform infrared spectroscopy or pulsed-field gel electrophoresis. This suggests that they represent a single species, which seems to be adapted to the environment in a cheese-ripening cellar as it was re-isolated from the same type of Swiss cheese after more than 5 years. Conjugation experiments demonstrated that the isolates harbour a transferable resistance to clindamycin. The isolates did not exhibit haemolysis or show any indication of human pathogenicity or virulence. The four isolates are affiliated with the genus Listeria but can be differentiated from all described members of the genus Listeria and therefore they merit being classified as representatives of a novel species, for which we propose the name Listeria fleischmannii sp. nov.; the type strain is LU2006-1(T) ( = DSM 24998(T)  = LMG 26584(T)).

  8. Occurrence of Listeria Monocytogenes in Irrigation Water and ...

    African Journals Online (AJOL)

    In this study, thirty water samples obtained from rivers, streams and ponds used for irrigation of vegetables at thirty different sites in Jos, Plateau state, Nigeria were analyzed for the presence Listeria monocytogenes and other Listeria species using the two-step enrichment method. Ten samples each spinach, lettuce and ...

  9. Rapid Identification and Classification of Listeria spp. and Serotype Assignment of Listeria monocytogenes Using Fourier Transform-Infrared Spectroscopy and Artificial Neural Network Analysis.

    Directory of Open Access Journals (Sweden)

    K F Romanolo

    Full Text Available The use of Fourier Transform-Infrared Spectroscopy (FT-IR in conjunction with Artificial Neural Network software NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains of Listeria spp. to give a biochemical fingerprint from which identification of unknown samples were made. This technology was able to accurately distinguish the Listeria species with 99.03% accuracy. Eleven serotypes of Listeria monocytogenes including 1/2a, 1/2b, and 4b were identified with 96.58% accuracy. In addition, motile and non-motile forms of Listeria were used to create a more robust model for identification. FT-IR coupled with NeuroDeveloper™ appear to be a more accurate and economic choice for rapid identification of pathogenic Listeria spp. than current methods.

  10. Prevalence and level of Listeria monocytogenes and other Listeria sp. in ready-to-eat minimally processed and refrigerated vegetables.

    Science.gov (United States)

    Kovačević, Mira; Burazin, Jelena; Pavlović, Hrvoje; Kopjar, Mirela; Piližota, Vlasta

    2013-04-01

    Minimally processed and refrigerated vegetables can be contaminated with Listeria species bacteria including Listeria monocytogenes due to extensive handling during processing or by cross contamination from the processing environment. The objective of this study was to examine the microbiological quality of ready-to-eat minimally processed and refrigerated vegetables from supermarkets in Osijek, Croatia. 100 samples of ready-to-eat vegetables collected from different supermarkets in Osijek, Croatia, were analyzed for presence of Listeria species and Listeria monocytogenes. The collected samples were cut iceberg lettuces (24 samples), other leafy vegetables (11 samples), delicatessen salads (23 samples), cabbage salads (19 samples), salads from mixed (17 samples) and root vegetables (6 samples). Listeria species was found in 20 samples (20 %) and Listeria monocytogenes was detected in only 1 sample (1 %) of cut red cabbage (less than 100 CFU/g). According to Croatian and EU microbiological criteria these results are satisfactory. However, the presence of Listeria species and Listeria monocytogenes indicates poor hygiene quality. The study showed that these products are often improperly labeled, since 24 % of analyzed samples lacked information about shelf life, and 60 % of samples lacked information about storage conditions. With regard to these facts, cold chain abruption with extended use after expiration date is a probable scenario. Therefore, the microbiological risk for consumers of ready-to-eat minimally processed and refrigerated vegetables is not completely eliminated.

  11. Validation of the ANSR Listeria method for detection of Listeria spp. in environmental samples.

    Science.gov (United States)

    Wendorf, Michael; Feldpausch, Emily; Pinkava, Lisa; Luplow, Karen; Hosking, Edan; Norton, Paul; Biswas, Preetha; Mozola, Mark; Rice, Jennifer

    2013-01-01

    ANSR Listeria is a new diagnostic assay for detection of Listeria spp. in sponge or swab samples taken from a variety of environmental surfaces. The method is an isothermal nucleic acid amplification assay based on the nicking enzyme amplification reaction technology. Following single-step sample enrichment for 16-24 h, the assay is completed in 40 min, requiring only simple instrumentation. In inclusivity testing, 48 of 51 Listeria strains tested positive, with only the three strains of L. grayi producing negative results. Further investigation showed that L. grayi is reactive in the ANSR assay, but its ability to grow under the selective enrichment conditions used in the method is variable. In exclusivity testing, 32 species of non-Listeria, Gram-positive bacteria all produced negative ANSR assay results. Performance of the ANSR method was compared to that of the U.S. Department of Agriculture-Food Safety and Inspection Service reference culture procedure for detection of Listeria spp. in sponge or swab samples taken from inoculated stainless steel, plastic, ceramic tile, sealed concrete, and rubber surfaces. Data were analyzed using Chi-square and probability of detection models. Only one surface, stainless steel, showed a significant difference in performance between the methods, with the ANSR method producing more positive results. Results of internal trials were supported by findings from independent laboratory testing. The ANSR Listeria method can be used as an accurate, rapid, and simple alternative to standard culture methods for detection of Listeria spp. in environmental samples.

  12. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  13. Vidas paralelas

    Directory of Open Access Journals (Sweden)

    José Fernando Valencia Grajales

    2009-07-01

    artístico del autor colombiano a quien sin asomos de duda podemos equiparar guardando las distancias tanto temporales, contextuales y la magnitud de las obras de ambos artistas. Esta aproximación se realizara en los puntos que los asemejan y se relatara a manera de paralelos y yuxtaposición de hechos que los marcaran de por vida.

  14. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

    Science.gov (United States)

    Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

    2014-09-01

    A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Validation of the ANSR® Listeria Method for Detection of Listeria spp. in Selected Foods.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Wendorf, Michael; Gray, R Lucas; Walton, Kayla; Pinkava, Lisa; Mozola, Mark; Rice, Jennifer

    2015-01-01

    ANSR® Listeria was previously certified as Performance Tested Method(SM) 101202 for detection of Listeria spp. on selected environmental surfaces. This study proposes a matrix extension to the method for detection of Listeria spp. in selected food matrixes. The method is an isothermal nucleic acid amplification assay based on the nicking enzyme amplification reaction technology. Following single-step sample enrichment for 16-24 h, the assay is completed in less than 50 min, requiring only simple instrumentation. Inclusivity testing was performed using a panel of 51 strains of Listeria spp., representing the species L. grayi, L. innocua, L. ivanovii, L. monocytogenes, L. seeligeri, and L. welshimeri. All strains tested were detected by the ANSR assay. Exclusivity testing of 30 strains representing non-Listeria Gram-positive bacteria yielded no evidence of cross-reactivity. Performance of the ANSR method for detection of Listeria spp. was compared to that of reference culture procedures for pasteurized liquid egg, pasteurized 2% milk, Mexican-style cheese, ice cream, smoked salmon, lettuce, cantaloupe, and guacamole. Data obtained in these unpaired studies and analyzed using a probability of detection model demonstrated that there were no statistically significant differences in results between the ANSR and reference culture methods, except for milk at 16 h and cantaloupe. In milk and smoked salmon, ANSR sensitivity was low at 16 h and therefore the recommended incubation time is 24 h. In cantaloupe, ANSR was found to be more sensitive than the reference culture method at both 16 and 24 h in independent laboratory testing. The ANSR Listeria method can be used as an accurate, rapid, and simple alternative to standard culture methods for detection of Listeria spp. in selected food types.

  16. Fatal Case of Listeria innocua Bacteremia

    OpenAIRE

    Perrin, Monique; Bemer, Michel; Delamare, Catherine

    2003-01-01

    Listeria innocua is widespread in the environment and in food. This species has to date never been described in association with human disease. We report a case of fatal bacteremia caused by L. innocua in a 62-year-old patient.

  17. Fatal case of Listeria innocua bacteremia.

    Science.gov (United States)

    Perrin, Monique; Bemer, Michel; Delamare, Catherine

    2003-11-01

    Listeria innocua is widespread in the environment and in food. This species has to date never been described in association with human disease. We report a case of fatal bacteremia caused by L. innocua in a 62-year-old patient.

  18. Comparison of two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples

    OpenAIRE

    Budniak Sylwia; Kędrak-Jabłońska Agnieszka; Szczawińska Anna; Reksa Monika; Krupa Marek; Szulowski Krzysztof

    2016-01-01

    Introduction: The aim of the study was to optimise and compare two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples including the liver, brain, and blood. Material and Methods: Three strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used. Additionally, five other species of bacterium were used to evaluate the specificity of the tests. Results: Sp...

  19. Comparison of two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples

    Directory of Open Access Journals (Sweden)

    Budniak Sylwia

    2016-12-01

    Full Text Available Introduction: The aim of the study was to optimise and compare two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples including the liver, brain, and blood. Material and Methods: Three strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used. Additionally, five other species of bacterium were used to evaluate the specificity of the tests. Results: Specific amplification products were obtained for both multiplex PCR assays, which confirmed the tested strains as Listeria spp. and L. monocytogenes, respectively. Isolates of other species did not yield PCR products. Conclusion: Both multiplex PCR assays proved to be significantly sensitive and highly-specific methods for the detection of Listeria strains.

  20. Listeria Infections (For Parents)

    Science.gov (United States)

    ... life-threatening infection. How Is Listeriosis Treated? Healthy kids, teens, and adults with a Listeria infection typically don' ... November 2017 More on this topic for: Parents Kids Teens Staying Healthy During Pregnancy Why Is Hand Washing ...

  1. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  2. Coselection of Cadmium and Benzalkonium Chloride Resistance in Conjugative Transfers from Nonpathogenic Listeria spp. to Other Listeriae

    Science.gov (United States)

    Katharios-Lanwermeyer, S.; Rakic-Martinez, M.; Elhanafi, D.; Ratani, S.; Tiedje, J. M.

    2012-01-01

    Resistance to the quaternary ammonium disinfectant benzalkonium chloride (BC) may be an important contributor to the ability of Listeria spp. to persist in the processing plant environment. Although a plasmid-borne disinfectant resistance cassette (bcrABC) has been identified in Listeria monocytogenes, horizontal transfer of these genes has not been characterized. Nonpathogenic Listeria spp. such as L. innocua and L. welshimeri are more common than L. monocytogenes in food processing environments and may contribute to the dissemination of disinfectant resistance genes in listeriae, including L. monocytogenes. In this study, we investigated conjugative transfer of resistance to BC and to cadmium from nonpathogenic Listeria spp. to other nonpathogenic listeriae, as well as to L. monocytogenes. BC-resistant L. welshimeri and L. innocua harboring bcrABC, along with the cadmium resistance determinant cadA2, were able to transfer resistance to other nonpathogenic listeriae as well as to L. monocytogenes of diverse serotypes, including strains from the 2011 cantaloupe outbreak. Transfer among nonpathogenic Listeria spp. was noticeably higher at 25°C than at 37°C, whereas acquisition of resistance by L. monocytogenes was equally efficient at 25 and 37°C. When the nonpathogenic donors were resistant to both BC and cadmium, acquisition of cadmium resistance was an effective surrogate for transfer of resistance to BC, suggesting coselection between these resistance attributes. The results suggest that nonpathogenic Listeria spp. may behave as reservoirs for disinfectant and heavy metal resistance genes for other listeriae, including the pathogenic species L. monocytogenes. PMID:22904051

  3. Coselection of cadmium and benzalkonium chloride resistance in conjugative transfers from nonpathogenic Listeria spp. to other Listeriae.

    Science.gov (United States)

    Katharios-Lanwermeyer, S; Rakic-Martinez, M; Elhanafi, D; Ratani, S; Tiedje, J M; Kathariou, S

    2012-11-01

    Resistance to the quaternary ammonium disinfectant benzalkonium chloride (BC) may be an important contributor to the ability of Listeria spp. to persist in the processing plant environment. Although a plasmid-borne disinfectant resistance cassette (bcrABC) has been identified in Listeria monocytogenes, horizontal transfer of these genes has not been characterized. Nonpathogenic Listeria spp. such as L. innocua and L. welshimeri are more common than L. monocytogenes in food processing environments and may contribute to the dissemination of disinfectant resistance genes in listeriae, including L. monocytogenes. In this study, we investigated conjugative transfer of resistance to BC and to cadmium from nonpathogenic Listeria spp. to other nonpathogenic listeriae, as well as to L. monocytogenes. BC-resistant L. welshimeri and L. innocua harboring bcrABC, along with the cadmium resistance determinant cadA2, were able to transfer resistance to other nonpathogenic listeriae as well as to L. monocytogenes of diverse serotypes, including strains from the 2011 cantaloupe outbreak. Transfer among nonpathogenic Listeria spp. was noticeably higher at 25°C than at 37°C, whereas acquisition of resistance by L. monocytogenes was equally efficient at 25 and 37°C. When the nonpathogenic donors were resistant to both BC and cadmium, acquisition of cadmium resistance was an effective surrogate for transfer of resistance to BC, suggesting coselection between these resistance attributes. The results suggest that nonpathogenic Listeria spp. may behave as reservoirs for disinfectant and heavy metal resistance genes for other listeriae, including the pathogenic species L. monocytogenes.

  4. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Aude Locatelli

    2017-12-01

    Full Text Available The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%, L. monocytogenes (17.4%, and Listeria welshimeri (15.1%. Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate to determine if culture medium [tripticase soy broth (TSB and University of Vermont modified Listeria enrichment broth (UVM], inoculum concentration (102 or 105 CFU/ml, or incubation temperature (20, 30, and 42°C differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of

  5. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes

    Science.gov (United States)

    Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.

    2017-01-01

    The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (102 or 105 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of L. innocua

  6. Rapid identification and classification of Listeria spp. and serotype assignment of Listeria monocytogenes using fourier transform-infrared spectroscopy and artificial neural network analysis

    Science.gov (United States)

    The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software, NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains...

  7. Detection of Listeria monocytogenes in pigs and pork.

    Science.gov (United States)

    Kanuganti, Sreenivas R; Wesley, Irene V; Reddy, P Gopal; McKean, James; Hurd, H Scott

    2002-09-01

    In this study, we surveyed hogs (n = 300) as well as pork products (ground pork and raw chitterlings) for Listeria monocytogenes. Pig specimens collected before (tonsil swabs) and after slaughter (tonsils, lymph nodes, carcass swabs, and rectal contents) were examined for L. monocytogenes by enrichment with conventional enrichment broths followed by subculturing to selective agar. A multiplex polymerase chain reaction assay targeting the highly conserved 16S rRNA gene of the Listeria species as well as the hlyA gene unique to L. monocytogenes was used to screen aliquots of the enrichment (method I) as well as to confirm presumptive Listeria colonies from Columbia agar with 0.05% glucose supplemented with polymyxin B-acriflavine-lithium chloride-ceftazidime-aesculin-mannitol (PALCAM; method II). Subculturing to PALCAM agar was the more sensitive of the two methods on the basis of the overall detection of Listeria. For hog tissues, method I detected L. monocytogenes (0.87% positive) and no other Listeria spp. in all samples (n = 1,849). In contrast, method II detected significantly more (P enrichments with University of Vermont modified Listeria enrichment broth; plating to PALCAM slightly improved recovery (9%). Overall, ground pork samples (n = 340) harbored L. monocytogenes (45% positive) and other Listeria species (1.5% positive), as determined by method I. Subculturing to PALCAM significantly (P < 0.05) improved the detection of L. monocytogenes (50.2%) but not that of other Listeria species (1.7%). L. monocytogenes isolates (n = 243) were assigned to serotype 1 (53.5%), serotype 4 (25%), and serotypes other than 1 and 4 (21.4%).

  8. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  9. Transfer of antibiotic resistance from Enterococcus faecium of fermented meat origin to Listeria monocytogenes and Listeria innocua.

    Science.gov (United States)

    Jahan, M; Holley, R A

    2016-04-01

    Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.

  10. Listeria prevalence and Listeria monocytogenes serovar diversity at cull cow and bull processing plants in the United States.

    Science.gov (United States)

    Guerini, Michael N; Brichta-Harhay, Dayna M; Shackelford, T Steven D; Arthur, Terrance M; Bosilevac, Joseph M; Kalchayanand, Norasak; Wheeler, Tommy L; Koohmaraie, Mohammad

    2007-11-01

    Listeria monocytogenes, the causative agent of epidemic and sporadic listeriosis, is routinely isolated from many sources, including cattle, yet information on the prevalence of Listeria in beef processing plants in the United States is minimal. From July 2005 through April 2006, four commercial cow and bull processing plants were sampled in the United States to determine the prevalence of Listeria and the serovar diversity of L. monocytogenes. Samples were collected during the summer, fall, winter, and spring. Listeria prevalence on hides was consistently higher during cooler weather (28 to 92% of samples) than during warmer weather (6 and 77% of samples). The Listeria prevalence data collected from preevisceration carcass ranged from undetectable in some warm season samples to as high as 71% during cooler weather. Listeria on postintervention carcasses in the chill cooler was normally undetectable, with the exception of summer and spring samples from one plant where > 19% of the carcasses were positive for Listeria. On hides, L. monocytogenes serovar 1/2a was the predominant serovar observed, with serovars 1/2b and 4b present 2.5 times less often and serovar 1/2c not detected on any hides sampled. L. monocytogenes serovars 1/2a, 1/2c, and 4b were found on postintervention carcasses. This prevalence study demonstrates that Listeria species are more prevalent on hides during the winter and spring and that interventions being used in cow and bull processing plants appear to be effective in reducing or eliminating Listeria contamination on carcasses.

  11. Listeria Placental Infection

    Directory of Open Access Journals (Sweden)

    José A. Véázquez-Boland

    2017-06-01

    Full Text Available The Gram-positive facultative intracellular bacterium Listeria monocytogenes is the causative agent of listeriosis, a severe food-borne infection. Pregnant women are at risk of contracting listeriosis, which can potentially lead to miscarriage, stillbirth, preterm birth, and congenital neonatal infections. While other systemic bacterial infections may result in adverse pregnancy outcomes at comparable frequencies, L. monocytogenes has particular notoriety because fetal complications largely occur in the absence of overt illness in the mother, delaying medical intervention. Here, we briefly review the pathophysiology and mechanisms of maternofetal listeriosis, discussed in light of a recent mBio report on Listeria transplacental infection in a nonhuman primate model.

  12. Contribution of Selective Conditions to Microbial Competition in Four Listeria Selective Enrichment Formulations.

    Science.gov (United States)

    Keys, Ashley L; Hitchins, Anthony D; Smiley, R Derike

    2016-11-01

    Microbial competition during selective enrichment negatively affects Listeria monocytogenes populations and may hinder the subsequent detection or recovery of this organism. Competition assays among 10 selected strains of Listeria and Citrobacter braakii were performed in buffered Listeria enrichment broth, 3-(N-morpholino)propanesulfonic acid-buffered Listeria enrichment broth, University of Vermont medium-modified Listeria enrichment broth, and Fraser broth. The individual contributions of each selective agent in these media were also assessed, as well as the contribution of incubation temperature. Acriflavine hydrochloride and sodium nalidixate were ineffective at preventing the overgrowth of C. braakii ; this resulted in substantially lower populations of Listeria than when the competitor was absent. At the higher levels, both of these selective agents were detrimental to Listeria populations. The highest enrichment populations of Listeria were observed when either NaCl or LiCl was present. In the absence of selective agents, the final populations of Listeria following competitive growth with C. braakii were not substantially affected by temperature; however, in the presence of selective agents, the Listeria populations were statistically higher at the higher incubation temperature. There are a limited number of selective agents available for use in Listeria -specific enrichment media, resulting in formulations that are only somewhat selective for this species. The optimization of current formulations may help researchers to improve Listeria recovery, particularly from products with a high microbial load. The understanding of the behavior and interactions between target and nontarget microorganisms in the presence of these available selective agents is a necessary step in the optimization of Listeria selective enrichment formulations.

  13. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus.

    Science.gov (United States)

    Nowakiewicz, Aneta; Zięba, Przemysław; Ziółkowska, Grażyna; Gnat, Sebastian; Muszyńska, Marta; Tomczuk, Krzysztof; Majer Dziedzic, Barbara; Ulbrych, Łukasz; Trościańczyk, Aleksandra

    2016-01-01

    The objective of the study was to examine a population of free-living carnivorous mammals most commonly found in Poland (red fox, beech marten, and raccoon) for the occurrence of bacteria that are potentially pathogenic for humans and other animal species and to determine their virulence potential (the presence of selected virulence genes). From the total pool of isolates obtained (n = 328), we selected 90 belonging to species that pose the greatest potential threat to human health: Salmonella spp. (n = 19; 4.51%), Yersinia enterocolitica (n = 10; 2.37%), Listeria monocytogenes and L. ivanovii (n = 21), and Staphylococcus aureus (n = 40; 9.5%). The Salmonella spp. isolates represented three different subspecies; S. enterica subsp. enterica accounted for a significant proportion (15/19), and most of the serotypes isolated (S. Typhimurium, S. Infantis, S. Newport and S. Enteritidis) were among the 10 non-typhoidal Salmonella serotypes that are most often responsible for infections in Europe, including Poland. Y. enterococlitica was detected in the smallest percentage of animals, but 60% of strains among the isolates tested possessed the ail gene, which is responsible for attachment and invasion. Potentially pathogenic Listeria species were isolated from approx. 5% of the animals. The presence of all tested virulence genes was shown in 35% of L. monocytogenes strains, while in the case of the other strains, the genes occurred in varying numbers and configurations. The presence of the inlA, inlC, hlyA, and iap genes was noted in all strains, whereas the genes encoding PI-PLC, actin, and internalin Imo2821 were present in varying percentages (from 80% to 55%). S. aureus was obtained from 40 individuals. Most isolates possessed the hla, hld (95% for each), and hlb (32.5%) genes encoding hemolysins as well as the gene encoding leukotoxin lukED (70%). In a similar percentage of strains (77.5%), the presence of at least one gene encoding enterotoxin was found, with 12

  14. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus.

    Directory of Open Access Journals (Sweden)

    Aneta Nowakiewicz

    Full Text Available The objective of the study was to examine a population of free-living carnivorous mammals most commonly found in Poland (red fox, beech marten, and raccoon for the occurrence of bacteria that are potentially pathogenic for humans and other animal species and to determine their virulence potential (the presence of selected virulence genes. From the total pool of isolates obtained (n = 328, we selected 90 belonging to species that pose the greatest potential threat to human health: Salmonella spp. (n = 19; 4.51%, Yersinia enterocolitica (n = 10; 2.37%, Listeria monocytogenes and L. ivanovii (n = 21, and Staphylococcus aureus (n = 40; 9.5%. The Salmonella spp. isolates represented three different subspecies; S. enterica subsp. enterica accounted for a significant proportion (15/19, and most of the serotypes isolated (S. Typhimurium, S. Infantis, S. Newport and S. Enteritidis were among the 10 non-typhoidal Salmonella serotypes that are most often responsible for infections in Europe, including Poland. Y. enterococlitica was detected in the smallest percentage of animals, but 60% of strains among the isolates tested possessed the ail gene, which is responsible for attachment and invasion. Potentially pathogenic Listeria species were isolated from approx. 5% of the animals. The presence of all tested virulence genes was shown in 35% of L. monocytogenes strains, while in the case of the other strains, the genes occurred in varying numbers and configurations. The presence of the inlA, inlC, hlyA, and iap genes was noted in all strains, whereas the genes encoding PI-PLC, actin, and internalin Imo2821 were present in varying percentages (from 80% to 55%. S. aureus was obtained from 40 individuals. Most isolates possessed the hla, hld (95% for each, and hlb (32.5% genes encoding hemolysins as well as the gene encoding leukotoxin lukED (70%. In a similar percentage of strains (77.5%, the presence of at least one gene encoding enterotoxin was found, with 12

  15. Investigating Listeria Outbreaks

    Centers for Disease Control (CDC) Podcasts

    2013-01-04

    Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDC’s Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks.  Created: 1/4/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 1/8/2013.

  16. Postenrichment Population Differentials Using Buffered Listeria Enrichment Broth: Implications of the Presence of Listeria innocua on Listeria monocytogenes in Food Test Samples†

    Science.gov (United States)

    KEYS, ASHLEY L.; DAILEY, RACHEL C.; HITCHINS, ANTHONY D.; SMILEY, R. DERIKE

    2016-01-01

    The recovery of low levels of Listeria monocytogenes from foods is complicated by the presence of competing microorganisms. Nonpathogenic species of Listeria pose a particular problem because variation in growth rate during the enrichment step can produce more colonies of these nontarget cells on selective and/or differential media, resulting in a preferential recovery of nonpathogens, especially Listeria innocua. To gauge the extent of this statistical barrier to pathogen recovery, 10 isolates each of L. monocytogenes and L. innocua were propagated together from approximately equal initial levels using the current U.S. Food and Drug Administration’s enrichment procedure. In the 100 isolate pairs, an average 1.3-log decrease was found in the 48-h enrichment L. monocytogenes population when L. innocua was present. In 98 of the 100 isolate pairs, L. innocua reached higher levels at 48 h than did L. monocytogenes, with a difference of 0.2 to 2.4 log CFU/ml. The significance of these population differences was apparent by an increase in the difficulty of isolating L. monocytogenes by the streak plating method. L. monocytogenes went completely undetected in 18 of 30 enrichment cultures even after colony isolation was attempted on Oxoid chromogenic Listeria agar. This finding suggests that although both Listeria species were present on the plate, the population differential between them restricted L. monocytogenes to areas of the plate with confluent growth and that isolated individual colonies were only L. innocua. PMID:24215687

  17. Postenrichment population differentials using buffered Listeria enrichment broth: implications of the presence of Listeria innocua on Listeria monocytogenes in food test samples.

    Science.gov (United States)

    Keys, Ashley L; Dailey, Rachel C; Hitchins, Anthony D; Smiley, R Derike

    2013-11-01

    The recovery of low levels of Listeria monocytogenes from foods is complicated by the presence of competing microorganisms. Nonpathogenic species of Listeria pose a particular problem because variation in growth rate during the enrichment step can produce more colonies of these nontarget cells on selective and/or differential media, resulting in a preferential recovery of nonpathogens, especially Listeria innocua. To gauge the extent of this statistical barrier to pathogen recovery, 10 isolates each of L. monocytogenes and L. innocua were propagated together from approximately equal initial levels using the current U. S. Food and Drug Administration's enrichment procedure. In the 100 isolate pairs, an average 1.3-log decrease was found in the 48-h enrichment L. monocytogenes population when L. innocua was present. In 98 of the 100 isolate pairs, L. innocua reached higher levels at 48 h than did L. monocytogenes, with a difference of 0.2 to 2.4 log CFU/ml. The significance of these population differences was apparent by an increase in the difficulty of isolating L. monocytogenes by the streak plating method. L. monocytogenes went completely undetected in 18 of 30 enrichment cultures even after colony isolation was attempted on Oxoid chromogenic Listeria agar. This finding suggests that although both Listeria species were present on the plate, the population differential between them restricted L. monocytogenes to areas of the plate with confluent growth and that isolated individual colonies were only L. innocua.

  18. Study on contamination of sheep meat in Shahrekord area with Listeria ivanovii and determination its antibiotic resistance pattern

    Directory of Open Access Journals (Sweden)

    Farid Khalili Borujeni

    2013-06-01

    Full Text Available Background and objectives: Listeria monocytogenes and Listeria ivanovii are two pathogenic species of Listeria. The role of Listeria ivanovii is important in abortion, stillbirth, septicemia in animals and this bacterium sometimes is pathogenic in humans. Contamination of ovine carcasses during the slaughter and processing can cause foodborne infections in humans. In this study we examined the contamination of sheep meat in slaughter house of Shahrekord city to Listeria ivanovii and determined its antibiotic resistance pattern.Material and Methods: A total 200 samples of sheep meat were collected from abattoir and processed by use of two enrichment method. After doing specific biochemical tests and PCR, Listeria spp was identified and antibiotic resistance of isolated Listeria were tested by the agar disc diffusion method. Results: The contamination of sheep carcasses with listeria was 2.5% (5 out of 200 samples. All five isolates (2.5% were recognized as Listeria ivanovii and were resistant to four antibiotics, sensitive to six antibiotics and intermediate to other antibiotics.  Conclusion: According to the contamination rate in sheep carcasses with Listeria ivanovii and the relatively high antibiotic resistance specified in this bacteria, the role of red meat in transmission of Listeria spp. and appropriate use of antibiotics against this bacteria should be considered.

  19. Listeria weihenstephanensis sp. nov., isolated from the water plant Lemna trisulca taken from a freshwater pond.

    Science.gov (United States)

    Lang Halter, Evi; Neuhaus, Klaus; Scherer, Siegfried

    2013-02-01

    The phylogenetic position and phenotypic characteristics of two non-spore-forming bacilli similar to members of the genus Listeria were studied. The gram-reaction-positive, slightly motile, facultatively anaerobic strains were isolated from the water plant Lemna trisulca sampled from a freshwater pond in Bavaria, Germany. Although no identification was possible employing the API Listeria test (bioMérieux), 16S rRNA sequence analysis confirmed a close phylogenetic similarity to Listeria rocourtiae DSM 22097(T) (99.0 % sequence similarity) and a more distant relationship to other Listeria species (96.0 % to Listeria monocytogenes DSM 20600(T) and 95.0 % similarity to Listeria grayi DSM 20601(T)). DNA-DNA hybridization analysis between the isolates and Listeria rocourtiae DSM 22097(T) yielded a similarity of 22.5 %. Analysis of partial sequences of sigB, prs, recA and HSP60 were studied and compared with those of other members of the genus Listeria and Brochothrix thermosphacta DSM 20171(T) supporting the relationships indicated by 16S rRNA gene sequences. The studied isolates were non-haemolytic and were not associated with cases of human or animal disease. While the results demonstrate that the strains belong to the genus Listeria, phenotypic and genotypic differences from Listeria rocourtiae DSM 22097(T) suggest that the strains represent a novel species for which the name Listeria weihenstephanensis sp. nov. is proposed; the type strain is WS 4560(T) ( = DSM 24698(T) = LMG 26374(T)), with WS 4615 ( = DSM 24699 = LMG 26375) as a second strain of the species.

  20. Ventriculoperitoneal shunt infection with Listeria innocua.

    Science.gov (United States)

    Karli, Arzu; Sensoy, Gulnar; Unal, Nevzat; Yanik, Keramettin; Cigdem, Halit; Belet, Nursen; Sofuoglu, Ayse

    2014-08-01

    Listeria species may cause life-threatening events including meningitis and invasive infection in newborns, pregnant women, older and immunodeficient people. The most common Listeria species that causes infection is L. monocytogenes. It is known that Listeria innocua has no pathogenicity. A 9-month-old baby had ventriculoperitoneal shunt and was treated with adrenocorticotropic hormone because of infantile spasms. He was brought to hospital with fever and vomiting. Upon physical examination, the patient seemed uncomfortable and had a temperature of 38.6°C. Laboratory results were as follows: hemoglobin, 6.7 g/dL; leukocyte count, 5420/mm(3) ; platelet count, 169,000/mm(3) ; and C-reactive protein, 100 mg/L (normal <5 mg/L). On analysis of cerebrospinal fluid (CSF), leukocyte count was 480/mm(3) , protein was 46 mg/dL and CSF glucose was 35 mg/dL. L. innocua was isolated in CSF culture. We describe this unusual case of ventriculoperitoneal shunt infection with L. innocua. © 2014 Japan Pediatric Society.

  1. Listeria monocytogenes: antibiotic resistance in food production.

    Science.gov (United States)

    Lungu, Bwalya; O'Bryan, Corliss A; Muthaiyan, Arunachalam; Milillo, Sara R; Johnson, Michael G; Crandall, Philip G; Ricke, Steven C

    2011-05-01

    Listeria monocytogenes is an opportunistic human pathogen that causes listeriosis, a disease that mainly affects the immunocompromised, the elderly, infants, and pregnant women. Listeriosis has become increasingly common in the last 25 years since the first foodborne outbreak was noted. Treatment for listeriosis currently consists primarily of supportive therapy in conjunction with the use of intravenous antibiotics. Antibiotics have been commercially available for over 60 years for treatment of a myriad of clinical diseases. Bacteria resistant to antibiotics have been developing over this same period. This review seeks to elucidate the extent of antibiotic resistance in L. monocytogenes, the possible transmission mechanisms, and contributing factors to distribution of antibiotic resistance among Listeria species, and possible control strategies.

  2. Listeria Placental Infection.

    Science.gov (United States)

    Vázquez-Boland, José A; Krypotou, Emilia; Scortti, Mariela

    2017-06-27

    The Gram-positive facultative intracellular bacterium Listeria monocytogenes is the causative agent of listeriosis, a severe food-borne infection. Pregnant women are at risk of contracting listeriosis, which can potentially lead to miscarriage, stillbirth, preterm birth, and congenital neonatal infections. While other systemic bacterial infections may result in adverse pregnancy outcomes at comparable frequencies, L. monocytogenes has particular notoriety because fetal complications largely occur in the absence of overt illness in the mother, delaying medical intervention. Here, we briefly review the pathophysiology and mechanisms of maternofetal listeriosis, discussed in light of a recent mBio report on Listeria transplacental infection in a nonhuman primate model. Copyright © 2017 Vázquez-Boland et al.

  3. A population genetics-based and phylogenetic approach to understanding the evolution of virulence in the genus Listeria.

    Science.gov (United States)

    den Bakker, Henk C; Bundrant, Brittany N; Fortes, Esther D; Orsi, Renato H; Wiedmann, Martin

    2010-09-01

    The genus Listeria includes (i) the opportunistic pathogens L. monocytogenes and L. ivanovii, (ii) the saprotrophs L. innocua, L. marthii, and L. welshimeri, and (iii) L. seeligeri, an apparent saprotroph that nevertheless typically contains the prfA virulence gene cluster. A novel 10-loci multilocus sequence typing scheme was developed and used to characterize 67 isolates representing six Listeria spp. (excluding L. grayi) in order to (i) provide an improved understanding of the phylogeny and evolution of the genus Listeria and (ii) use Listeria as a model to study the evolution of pathogenicity in opportunistic environmental pathogens. Phylogenetic analyses identified six well-supported Listeria species that group into two main subdivisions, with each subdivision containing strains with and without the prfA virulence gene cluster. Stochastic character mapping and phylogenetic analysis of hly, a gene in the prfA cluster, suggest that the common ancestor of the genus Listeria contained the prfA virulence gene cluster and that this cluster was lost at least five times during the evolution of Listeria, yielding multiple distinct saprotrophic clades. L. welshimeri, which appears to represent the most ancient clade that arose from an ancestor with a prfA cluster deletion, shows a considerably lower average sequence divergence than other Listeria species, suggesting a population bottleneck and a putatively different ecology than other saprotrophic Listeria species. Overall, our data suggest that, for some pathogens, loss of virulence genes may represent a selective advantage, possibly by facilitating adaptation to a specific ecological niche.

  4. Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics.

    Science.gov (United States)

    Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A

    2014-05-01

    The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

  5. listeria monocytogenes AND OTHER Listeria species IN POUL TRY ...

    African Journals Online (AJOL)

    BSN

    often utilized as manure in soil supplements for maximum crop yield was evaluated. The results of the ... the food chain having been isolated from pasture, soil, water supplies. meat and dairy products among other .... The application of poultry manures to agricultural land without adequate decontamination or elimination of ...

  6. 32-Phosphorus selectively delivered by listeria to pancreatic cancer demonstrates a strong therapeutic effect

    Science.gov (United States)

    Chandra, Dinesh; Selvanesan, Benson Chellakkan; Yuan, Ziqiang; Libutti, Steven K; Koba, Wade; Beck, Amanda; Zhu, Kun; Casadevall, Arturo; Dadachova, Ekaterina; Gravekamp, Claudia

    2017-01-01

    Our laboratory has developed a novel delivery platform using an attenuated non-toxic and non-pathogenic bacterium Listeria monocytogenes that infects tumor cells and selectively survives and multiplies in metastases and primary tumors with help of myeloid-derived suppressor cells (MDSC) and immune suppression in the tumor microenvironment (TME). 32P was efficiently incorporated into the Listeria bacteria by starvation of the bacteria in saline, and then cultured in phosphorus-free medium complemented with 32P as a nutrient. Listeria-32P kills tumor cells through both 32P-induced ionizing radiation and Listeria-induced reactive oxygen species (ROS). The levels of 32P and Listeria were studied in various normal and tumor tissues, at sequential time points after injection of mice with pancreatic cancer (syngeneic model Panc-02). We found that 32P and Listeria predominantly accumulated in tumors and metastases, with their highest accumulation 4 hrs (32P) and 3 days (Listeria) after injection. Listeria also penetrated the transgenic KPC (conditionally express endogenous Kras-G12D and p53-R172H mutant alleles) pancreatic tumors and metastases. This is remarkable since KPC tumors, like human tumors, exhibit a stromal barrier, which prevents most drugs from penetrating the pancreatic tumors. Therapeutic treatment with Listeria -32P resulted in a strong reduction of the growth of pancreatic cancer at early and late stages in Panc-02 and KPC mice. These results highlight the power of Listeria as new delivery platform of anticancer agents to the TME. Not only were therapeutic levels of radioactive Listeria reached in tumors and metastases but the selective delivery also led to minimal side effects. PMID:28186976

  7. Enzyme-linked imunoassays for the detection of Listeria sp. and Salmonella sp. in sausage: a comparison with conventional methods

    Directory of Open Access Journals (Sweden)

    T.M. Benetti

    2013-09-01

    Full Text Available This study was carried out comparing the conventional methods (ISO 11290-1 and BAM method, 2008 and system mini-Vidas® (Biomerieux, for detection of Listeria sp. and Salmonella sp. in cooled sausage. The immunoenzymatic method has shown to be effective for the detection of target pathogens, it has presented itself as an excellent screening method.

  8. Enzyme-linked imunoassays for the detection of Listeria sp. and Salmonella sp. in sausage: a comparison with conventional methods.

    Science.gov (United States)

    Benetti, T M; Monteiro, C L B; Beux, M R; Abrahão, W M

    2013-01-01

    This study was carried out comparing the conventional methods (ISO 11290-1 and BAM method, 2008) and system mini-Vidas® (Biomerieux), for detection of Listeria sp. and Salmonella sp. in cooled sausage. The immunoenzymatic method has shown to be effective for the detection of target pathogens, it has presented itself as an excellent screening method.

  9. Listeria spp. in Street-Vended Ready-to-Eat Foods

    OpenAIRE

    El-Shenawy, Moustafa; El-Shenawy, Mohamed; Ma?es, Jordi; Soriano, Jose M.

    2011-01-01

    Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contamina...

  10. PRESENCE OF Listeria monocytogenes IN HEALTHY CATTLE AT SLAUGHTERING: FIRST RESULTS

    Directory of Open Access Journals (Sweden)

    G. Colavita

    2010-03-01

    Full Text Available Listeria monocytogenes is an ubiquitous pathogen occasionally present in the intestinal tract of various animal species. The aim of this study was to assess the incidence of Listeria spp. and Listeria monocytogenes in faeces of healthy cattle at slaughtering. Listeria spp. was isolated in 18 out of 220 (8.2% faecal samples, and Listeria monocytogenes was isolated in 3 faecal samples (1.4%. From the 220 faecal samples were also isolated 9 strains of L. grayi, 4 strains of L. innocua and 2 strains of L. ivanovii. Although limited, our results show that animal faeces can represent a source of L. monocytogenes contamination of carcasses in abattoirs and can be a potential hazard to human health.

  11. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  12. [Listeria monocytogenes infections].

    Science.gov (United States)

    Pasquier, Léna; Chuard, Christian

    2017-10-11

    Listeria monocytogenes infections are caused by food ingestion. They are not only transmitted by animal products, but also by secondarily contaminated fruits and vegetables. They preferentially affect pregnant women, patients of extreme ages and the immu-nocompromised, and manifest as a gastroenteritis, bacteremia, meningo-encephalitis or maternal-fetal infection. Diagnosis is achieved by culture of usually sterile sites. The preferred treatment is amoxicillin with or without gentamicin. For patients at risk, prevention is based on avoiding at-risk food or cooking it when possible.

  13. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

  14. Views on Lepa Vida (Fair Vida

    Directory of Open Access Journals (Sweden)

    Barbara Pregelj

    2015-04-01

    Full Text Available “Lepa Vida” (Fair Vida is one of the most common motifs in Slovenian literature. The motif is from a folk song with many variants which in the course of time, and with each new author's view, assumed further layers. So far there have been 43 literary variations on the Fair Vida motif recorded since 1932, as well as many instances of arrangements for children and youth. In this paper I present the main characteristics of the motif in folk literature, in France Prešeren (“Od Lepe Vide”; “Of the Fair Vida”, and in Andrej Rozman Roza Lepa Vida v akciji (Fair Vida in Action, that is, the source/original, the canonical, and the subversive. I initially present the findings about the origins of the motif, the sociological-historical background against which it came into being, as well as comparative elements of intercultural and chronotope views and the image of the Other. In the light of comparisons with other Slovenian myths (especially King Matjaž, Martin Krpan, and Peter Klepec I present the (often rather restrictive view of literary criticism which frequently reduces the Fair Vida motif to the motif of longing, one of the most common motifs in Slovenian literature. I contrast this with more modern interpretative views that take into account both feminist theory and analysis of the discourse of power as it derives from the repeated (subversive, parodic reading of the motif which Andrej Rozman Roza presents in Lepa Vida v akciji.

  15. Magnetic bead based immuno-detection of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables using the Bio-Plex suspension array system.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-04-01

    Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.

  16. Identification ofListeriaSpp. Strains Isolated from Meat Products and Meat Production Plants by Multiplex Polymerase Chain Reaction.

    Science.gov (United States)

    Mazza, Roberta; Piras, Francesca; Ladu, Daniela; Putzolu, Miriam; Consolati, Simonetta Gianna; Mazzette, Rina

    2015-11-02

    Listeriosis is a foodborne disease caused by Listeria monocytogenes and is considered as a serious health problem, due to the severity of symptoms and the high mortality rate. Recently, other Listeria species have been associated with disease in human and animals. The aim of this study was to develop a multiplex polymerase chain reaction (PCR) in order to simultaneously detect six Listeria species (L. grayi , L. welshimeri , L. ivanovii , L. monocytogenes , L. seeligeri , L. innocua) in a single reaction. One hundred eighteen Listeria spp . strains, isolated from meat products (sausages) and processing plants (surfaces in contact and not in contact with meat), were included in the study. All the strains were submitted to biochemical identification using the API Listeria system. A multiplex PCR was developed with the aim to identify the six species of Listeria . PCR allowed to uniquely identify strains that had expressed a doubtful profile with API Listeria The results suggest that the multiplex PCR could represent a rapid and sensitive screening test, a reliable method for the detection of all Listeria species, both in contaminated food and in clinical samples, and also a tool that could be used for epidemiological purposes in food-borne outbreaks. A further application could be the development of a PCR that can be directly applied to the pre-enrichment broth.

  17. La terrible vida eterna

    National Research Council Canada - National Science Library

    Ordorica, Ana Paula

    2006-01-01

    ... se aboque al tema de la vida eterna. ?Quien en su sano juicio, con esta vision del mundo, quisiera extender la vida por toda una eternidad? Provocador, indomable, incomodo, insolente, amargado y certero. Estos son solo algunos adjetivos que se han utilizado para describir al enfant terrible de la literatura francesa. Michel Houellebecq, el huerfano, aba...

  18. Phylogenetic Profiles of In-House Microflora in Drains at a Food Production Facility: Comparison and Biocontrol Implications of Listeria-Positive and -Negative Bacterial Populations

    Science.gov (United States)

    Solomon, Katie; Moore, John E.; Wall, Patrick G.; Fanning, Séamus

    2014-01-01

    Listeria species experience complex interactions with other microorganisms, which may promote growth and colonization of the organism in local environments or negatively affect them. This study investigated the microbial community at a food production facility, examining interactions between Listeria and the associated microbiome. Listeria species can be transferred between zones in the production environment by individuals or equipment, and drains may act as a reservoir for the organism, reflecting the microbial flora potentially in the production environment. Drains that were colonized by Listeria species and those determined to be free of Listeria were examined. In each case, 16S rRNA gene analysis was performed using the PhyloChip platform. Some general similarities in bacterial population structure were observed when Listeria-negative and -positive drain communities were compared, with some distinct differences also noted. These included increased populations of the genera Prevotella and Janthinobacterium associated with the absence of Listeria species, whereas Enterococcus and Rhodococcus were in higher abundance in drains colonized by Listeria species. Based on these results, a selection of bacterial species were grown in coculture biofilm with a Listeria monocytogenes strain identified as having colonized a drain at the facility. Mixed-species biofilm experiments showed that Janthinobacterium inhibited attachment and subsequent biofilm formation of L. monocytogenes; however, Enterococcus gallinarum significantly increased it. The results of this study suggest the microbial community in food processing facilities can impact the colonization of Listeria species and that influencing the microbiome in favor of antilisterial species may reduce the colonization of Listeria species and limit the likelihood of product/process contamination. PMID:24657862

  19. The overgrowth of Listeria monocytogenes by other Listeria spp. in food samples undergoing enrichment cultivation has a nutritional basis.

    Science.gov (United States)

    Besse, Nathalie Gnanou; Barre, Lena; Buhariwalla, Colin; Vignaud, Marie Léone; Khamissi, Elissa; Decourseulles, Emilie; Nirsimloo, Marjorie; Chelly, Minyar; Kalmokoff, Martin

    2010-01-01

    The isolation of Listeria monocytogenes from food is carried out using a double enrichment. In cases where multiple Listeria species are present within the original sample, L. monocytogenes can be overgrown during enrichment by other species of listeria present in the original sample. From a practical perspective, this can result in a false negative or complicate the ability of public health investigators to match food and clinical isolates. We have further investigated this phenomenon by analysing the growth kinetics of single species and pairs of different species over the ISO 11290-1 enrichment process. The overgrowth of a strain of L. monocytogenes by a strain of Listeria innocua resulted primarily from interactions which occurred in late exponential phase, where it was observed that growth of both strains stopped when the dominant strain reached stationary phase. In a second mixed culture, the dominant L. monocytogenes strain suppressed the exponential growth rate of the second Listeria welshimeri strain. Both findings suggest that the overgrowth could partially be explained in terms of a nutritional competition. Multi-factor analysis of Fraser broth constituents and growth temperatures using both stressed and non-stressed inoculants failed to identify any single factor in the ISO 11290-1 methodology which would contribute to the overgrowth phenomenon in our model system. Furthermore, species was not a significant factor in observed differences in growth parameters among a wider array of strains which had been stressed or not stressed prior to grown in Fraser broths, even though some strains had significantly faster growth rates than others. Limiting diffusion in Fraser broth through the addition of agar significantly reduced the extent of the overgrowth in experiments using mixtures of strains originally isolated from foods where overgrowth had been previously observed. Taken together, these findings support that the overgrowth phenomenon in most instances

  20. The Antibiofilm Effect of Ginkgo biloba Extract Against Salmonella and Listeria Isolates from Poultry.

    Science.gov (United States)

    Wu, Yan; Park, Keun Cheol; Choi, Beom Geun; Park, Jin Hwa; Yoon, Ki Sun

    2016-05-01

    Salmonella spp. and Listeria spp. are common foodborne pathogens in poultry and have caused a large number of outbreaks worldwide. Biofilm formation is common in the food industry and is also a mechanism of antimicrobial resistance. The aim of this work was to investigate the antimicrobial effect and mechanism of Ginkgo biloba extract against the biofilm formation of Salmonella and Listeria isolates from poultry at retail markets. Bacteria detection, isolation, and enumeration were carried out on 27 chicken and 29 ducks at retail markets. The effects of temperature and G. biloba extract against biofilm formation of Salmonella and Listeria isolates were measured using the crystal violet assay and swimming and swarming motilities. The monitoring results of Salmonella and Listeria in 56 poultry carcasses at retail markets in Korea showed that the prevalence of Salmonella spp. in poultry was low (5.4%), but the prevalence of Listeria spp (78.6%) was high. L. innocua was the predominant serotype (80%) in the isolated Listeria species. Temperature, strain, and surface affected the biofilm formation of Salmonella spp. and Listeria spp. L. innocua showed the best biofilm formation ability on a 96-well plate, while Salmonella Enteritidis formed the most biofilm on a glass slide. Biofilm formation abilities of Salmonella spp. and Listeria spp. were increased with the increase of temperature. G. biloba extract at 75 μg/mL significantly inhibited biofilm formation of Salmonella spp. and Listeria spp (p Listeria, but not L. monocytogenes. The findings of this study provided the basis for the application of G. biloba extract as a food additive to promote the quality and safety of poultry products.

  1. Phylogenomic grouping of Listeria monocytogenes.

    Science.gov (United States)

    Doijad, Swapnil; Weigel, Markus; Barbuddhe, Sukhadeo; Blom, Jochen; Goesmann, Alexander; Hain, Torsten; Chakraborty, Trinad

    2015-09-01

    The precise delineation of lineages and clonal groups are a prerequisite to examine within-species genetic variations, particularly with respect to pathogenic potential. A whole-genome-based approach was used to subtype and subgroup isolates of Listeria monocytogenes. Core-genome typing was performed, employing 3 different approaches: total core genes (CG), high-scoring segment pairs (HSPs), and average nucleotide identity (ANI). Examination of 113 L. monocytogenes genomes available in-house and in public domains revealed 33 phylogenomic groups (PGs). Each PG could be differentiated into a number of genomic types (GTs), depending on the approach used: HSPs (n = 57 GTs), CG (n = 71 GTs), and ANI (n = 83 GTs). Demarcation of the PGs was concordant with the 4 known lineages and led to the identification of sublineages in the lineage groups I, II, and III. In addition, PG assignments had discriminatory power similar to multi-virulence-locus sequence typing types and clonal complexes of multilocus sequence typing. Clustering of genomically highly similar isolates from different countries, sources, and isolation dates using whole-genome-based PG suggested that dispersion of phylogenomic clones of L. monocytogenes preceded their subsequent evolution. Classification according to PG may act as a guideline for future epidemiological studies.

  2. Dynamics of biofilm formation by Listeria monocytogenes on stainless steel under mono-species and mixed-culture simulated fish processing conditions and chemical disinfection challenges.

    Science.gov (United States)

    Papaioannou, Eleni; Giaouris, Efstathios D; Berillis, Panagiotis; Boziaris, Ioannis S

    2018-02-21

    The progressive ability of a six-strains L. monocytogenes cocktail to form biofilm on stainless steel (SS), under fish-processing simulated conditions, was investigated, together with the biocide tolerance of the developed sessile communities. To do this, the pathogenic bacteria were left to form biofilms on SS coupons incubated at 15°C, for up to 240h, in periodically renewable model fish juice substrate, prepared by aquatic extraction of sea bream flesh, under both mono-species and mixed-culture conditions. In the latter case, L. monocytogenes cells were left to produce biofilms together with either a five-strains cocktail of four Pseudomonas species (fragi, savastanoi, putida and fluorescens), or whole fish indigenous microflora. The biofilm populations of L. monocytogenes, Pseudomonas spp., Enterobacteriaceae, H 2 S producing and aerobic plate count (APC) bacteria, both before and after disinfection, were enumerated by selective agar plating, following their removal from surfaces through bead vortexing. Scanning electron microscopy was also applied to monitor biofilm formation dynamics and anti-biofilm biocidal actions. Results revealed the clear dominance of Pseudomonas spp. bacteria in all the mixed-culture sessile communities throughout the whole incubation period, with the in parallel sole presence of L. monocytogenes cells to further increase (ca. 10-fold) their sessile growth. With respect to L. monocytogenes and under mono-species conditions, its maximum biofilm population (ca. 6logCFU/cm 2 ) was reached at 192h of incubation, whereas when solely Pseudomonas spp. cells were also present, its biofilm formation was either slightly hindered or favored, depending on the incubation day. However, when all the fish indigenous microflora was present, biofilm formation by the pathogen was greatly hampered and never exceeded 3logCFU/cm 2 , while under the same conditions, APC biofilm counts had already surpassed 7logCFU/cm 2 by the end of the first 96h of

  3. Keep Listeria Out of Your Kitchen

    Science.gov (United States)

    ... For Consumers Home For Consumers Consumer Updates Keep Listeria Out of Your Kitchen Share Tweet Linkedin Pin ... If you eat food contaminated with bacteria called Listeria , you could get so sick that you have ...

  4. Comparative Genomics of Listeria Sensu Lato: Genus-Wide Differences in Evolutionary Dynamics and the Progressive Gain of Complex, Potentially Pathogenicity-Related Traits through Lateral Gene Transfer.

    Science.gov (United States)

    Chiara, Matteo; Caruso, Marta; D'Erchia, Anna Maria; Manzari, Caterina; Fraccalvieri, Rosa; Goffredo, Elisa; Latorre, Laura; Miccolupo, Angela; Padalino, Iolanda; Santagada, Gianfranco; Chiocco, Doriano; Pesole, Graziano; Horner, David S; Parisi, Antonio

    2015-07-15

    Historically, genome-wide and molecular characterization of the genus Listeria has concentrated on the important human pathogen Listeria monocytogenes and a small number of closely related species, together termed Listeria sensu strictu. More recently, a number of genome sequences for more basal, and nonpathogenic, members of the Listeria genus have become available, facilitating a wider perspective on the evolution of pathogenicity and genome level evolutionary dynamics within the entire genus (termed Listeria sensu lato). Here, we have sequenced the genomes of additional Listeria fleischmannii and Listeria newyorkensis isolates and explored the dynamics of genome evolution in Listeria sensu lato. Our analyses suggest that acquisition of genetic material through gene duplication and divergence as well as through lateral gene transfer (mostly from outside Listeria) is widespread throughout the genus. Novel genetic material is apparently subject to rapid turnover. Multiple lines of evidence point to significant differences in evolutionary dynamics between the most basal Listeria subclade and all other congeners, including both sensu strictu and other sensu lato isolates. Strikingly, these differences are likely attributable to stochastic, population-level processes and contribute to observed variation in genome size across the genus. Notably, our analyses indicate that the common ancestor of Listeria sensu lato lacked flagella, which were acquired by lateral gene transfer by a common ancestor of Listeria grayi and Listeria sensu strictu, whereas a recently functionally characterized pathogenicity island, responsible for the capacity to produce cobalamin and utilize ethanolamine/propane-2-diol, was acquired in an ancestor of Listeria sensu strictu. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  6. VODENJE ROBOTSKEGA MEHANIZMA VIDA

    OpenAIRE

    Zupanec, Nejc

    2011-01-01

    V diplomskem delu je predstavljeno vodenje robotskega mehanizma vida, ki posnema delovanje človeškega vida in premike glave. Vsebuje postopek, kako nastaviti lastnosti karte NI-motion PCI-7354, aplikacijo za osnovne premike motorjev v programskem paketu LabView, postopek nastavljanja parametrov regulacije v skladu z zahtevami po prenihaju in nastavitvenim časom ter postopek za realizacijo dinamične analize mehanizma.

  7. A defined, glucose-limited mineral medium for the cultivation of Listeria spp.

    Science.gov (United States)

    Schneebeli, Rudolf; Egli, Thomas

    2013-04-01

    Members of the genus Listeria are fastidious bacteria with respect to their nutritional requirements, and several minimal media described in the literature fail to support growth of all Listeria spp. Furthermore, strict limitation by a single nutrient, e.g., the carbon source, has not been demonstrated for any of the published minimal media. This is an important prerequisite for defined studies of growth and physiology, including "omics." Based on a theoretical analysis of previously published mineral media for Listeria, an improved, well-balanced growth medium was designed. It supports the growth, not only of all tested Listeria monocytogenes strains, but of all other Listeria species, with the exception of L. ivanovii. The growth performance of L. monocytogenes strain Scott A was tested in the newly designed medium; glucose served as the only carbon and energy source for growth, whereas neither the supplied amino acids nor the buffering and complexing components (MOPS [morpholinepropanesulfonic acid] and EDTA) supported growth. Omission of amino acids, trace elements, or vitamins, alone or in combination, resulted in considerably reduced biomass yields. Furthermore, we monitored the specific growth rates of various Listeria strains cultivated in the designed mineral medium and compared them to growth in complex medium (brain heart infusion broth [BHI]). The novel mineral medium was optimized for the commonly used strain L. monocytogenes Scott A to achieve optimum cell yields and maximum specific growth rates. This mineral medium is the first published synthetic medium for Listeria that has been shown to be strictly carbon (glucose) limited.

  8. Occurrence of Listeria spp. in critical control points and the environment of Minas Frescal cheese processing.

    Science.gov (United States)

    Silva, Isabella M M; Almeida, R C C; Alves, M A O; Almeida, P F

    2003-03-25

    Critical control points (CCPs) associated with Minas Frescal cheese (a Brazilian soft white cheese, eaten fresh) processing in two dairy factories were determined using flow diagrams and microbiological tests for detection of Listeria monocytogenes and other species of Listeria. A total of 218 samples were collected along the production line and environment. The CCPs identified were reception of raw milk, pasteurization, coagulation and storage. Thirteen samples were positive for Listeria; 9 samples were Listeria innocua, 2 were Listeria grayi and 2 were L. monocytogenes. In factory A, Listeria was found in 50% of raw milk samples, 33.3% of curd samples, 16.7% of pasteurized milk samples, 16.7% of cheese samples and 25% of rubber pipes used to transport the whey. The microorganism was not obtained from environmental samples in this plant. In factory B, Listeria was found in one sample of raw milk (16.7%) and in three samples of environment (17.6%) and L. monocytogenes was obtained from raw milk (16.7%) and the floor of the cheese refrigeration room (14.3%). Two serotypes, 4b and 1/2a, were observed among the strains of L. monocytogenes isolated, both which are frequently involved in outbreaks of food-borne listeriosis and sporadic cases of the disease all over the world.

  9. O direito à vida

    Directory of Open Access Journals (Sweden)

    Luciana Mendes Pereira Roberto

    2004-12-01

    Full Text Available The Life is the basic property of the human being, because without the life, there is no way to talk about other rights, not even about the personality ones. According to this understanding, each single man has the right to the life, ie, the right to live, and not even it, he also has the right to a full and a dignified life, respect to their values and requirements. In this study, the start of the life to the Right is showed, as well its ending, with the death. Also, it is tried to elucidate the life as a primordial right of the personality, and the sanctions of even transgression.A Vida é o bem fundamental do ser humano, pois sem a vida, não há que se falar em outros direitos, nem mesmo os de personalidade. Com base nesse entendimento, todo o homem tem direito à vida, ou seja, o direito de viver e não apenas isso, tem o direito de uma vida plena e digna, respeito aos seus valores e necessidades. Procura-se, neste estudo, mostrar o início da vida para o Direito, bem como o seu fim, com a morte. Busca-se também elucidar a vida como direito primordial da personalidade, e as sanções de tal transgressão.

  10. Identificação de Listeria monocytogenes em placentas humanas e espécimes de aborto pela técnica de imunoistoquímica Identification of Listeria monocytogenes in human placentas and abortion species through immunohistochemical technique

    Directory of Open Access Journals (Sweden)

    Jussara Pires Schwab

    2003-06-01

    Full Text Available A listeriose é causada por um microrganismo que se encontra amplamente disseminado na natureza e tem sido isolado do solo, de fezes humanas e de animais e pode, eventualmente, contaminar os alimentos. A Listeria monocytogenes é patogênica para o homem e tornou-se o principal patógeno nas doenças transmitidas pelos alimentos. Tendo-se em vista que a incidência de listeriose humana não é bem conhecida e as placentites possuem aspecto morfológico inespecífico e não são, muitas vezes, investigadas para este fator etiológico, surgiu a motivação para desenvolver a técnica de imunoistoquímica para o diagnóstico de Listeria monocytogenes em placentas ou produtos de aborto, utilizando um anticorpo policlonal anti-Listeria (Biodesign®. Um projeto-piloto foi realizado a partir do material encontrado em dez placentas provenientes de abortos ou partos prematuros ocorridos no ano de 2000 no Hospital de Clínicas de Porto Alegre (HCPA. As lâminas foram analisadas através do exame microscópico convencional (HE e de imunoistoquímica (IHQ. Os resultados deste projeto revelaram a presença de Listeria monocytogenes em cinco dos dez (50% casos estudados. Todos os casos apresentaram alterações sugestivas de processo inflamatório agudo supurativo. Frente a estes achados torna-se importante considerar a infecção por Listeria monocytogenes detectável por IHQ como um elemento no diagnóstico da patogenia do aborto ou das infecções perinatais, podendo este achado contribuir para o tratamento dos recém-nascidos ou das parturientes. As características microscópicas de listeriose na placenta, embora não-patognomônicas, permitem ao patologista um diagnóstico presuntivo, e a confirmação pode ser realizada pelo método de imunoistoquímica.Listeria monocytogenes, a food-borne, human-infecting pathogen, is widespread in nature and has been isolated from soil, human and animal feces. Since the incidence of human listeriosis is not well

  11. Listeria Meningitis in an Immunocompetent Child.

    Science.gov (United States)

    Villa, Giovanna; Diana, Maria Cristina; Solari, Nicoletta; Bandettini, Roberto; Sorrentino, Stefania; Loy, Anna; Losurdo, Giuseppe; Renna, Salvatore

    2017-08-01

    Listeria monocytogenes is a facultative anerobic, gram-positive bacillus that is isolated from the soil, vegetables, and wild or domestic animals. Listeria infection is usually found in the older adults, immunocompromised patients, pregnant women, and newborns, whereas it is rare in healthy infants and children. Listeria monocytogenes may cause meningitis, meningoencephalitis, brain abscess, pyogenic arthritis, osteomyelitis, and liver abscess in children. The course of meningoencephalitis by Listeria is often severe and even fatal. Complications such as acute hydrocephalus, brain abscess, and spine abscess can develop, and the mortality associated with listeriosis is significantly high. We present a case of a previously healthy 7-year-old boy who developed Listeria monocytogenes meningitis.

  12. Comparative genomics of the bacterial genus Listeria: Genome evolution is characterized by limited gene acquisition and limited gene loss

    Science.gov (United States)

    2010-01-01

    Background The bacterial genus Listeria contains pathogenic and non-pathogenic species, including the pathogens L. monocytogenes and L. ivanovii, both of which carry homologous virulence gene clusters such as the prfA cluster and clusters of internalin genes. Initial evidence for multiple deletions of the prfA cluster during the evolution of Listeria indicates that this genus provides an interesting model for studying the evolution of virulence and also presents practical challenges with regard to definition of pathogenic strains. Results To better understand genome evolution and evolution of virulence characteristics in Listeria, we used a next generation sequencing approach to generate draft genomes for seven strains representing Listeria species or clades for which genome sequences were not available. Comparative analyses of these draft genomes and six publicly available genomes, which together represent the main Listeria species, showed evidence for (i) a pangenome with 2,032 core and 2,918 accessory genes identified to date, (ii) a critical role of gene loss events in transition of Listeria species from facultative pathogen to saprotroph, even though a consistent pattern of gene loss seemed to be absent, and a number of isolates representing non-pathogenic species still carried some virulence associated genes, and (iii) divergence of modern pathogenic and non-pathogenic Listeria species and strains, most likely circa 47 million years ago, from a pathogenic common ancestor that contained key virulence genes. Conclusions Genome evolution in Listeria involved limited gene loss and acquisition as supported by (i) a relatively high coverage of the predicted pan-genome by the observed pan-genome, (ii) conserved genome size (between 2.8 and 3.2 Mb), and (iii) a highly syntenic genome. Limited gene loss in Listeria did include loss of virulence associated genes, likely associated with multiple transitions to a saprotrophic lifestyle. The genus Listeria thus provides

  13. Comparative and functional genomics of Listeria spp.

    Science.gov (United States)

    Hain, Torsten; Steinweg, Christiane; Chakraborty, Trinad

    2006-10-20

    The genus Listeria comprises a group of non-sporulating, Gram-positive, soil bacteria belonging to the low G+C group of microorganisms. The genus consists of only six species, L. monocytogenes, L. ivanovii, L. seeligeri, L. innocua, L. welshimeri, and L. grayi.L. monocytogenes and L. ivanovii are the only known pathogens of this group. Comparative whole-genome sequencing of representative strains comprising the entire genus is currently being performed and nearing completion. In the genus Listeria, genome reduction has led to the generation of non-pathogenic species from pathogenic progenitor strains. Indeed, many of the regions absent in the non-pathogenic species represent commonly deleted genes. Speciation and diversity of strains has been achieved by horizontal gene transfer of DNA encoding novel genes probably required for niche specific survival. The sequencing of several listerial genomes has also been accompanied by studies using global strategies involving whole-genome transcriptional profiling and proteomics to examine the adaptative changes of L. monocytogenes to growth in different environments and to catalogue the genes mediating these responses. We review this data and present information on the expression profile of L. monocytogenes EGD-e inside the vacuolar and the cytosolic environments of the host cell using whole-genome microarray analysis. Of the 484 genes regulated during intracellular growth 41 genes are species-specific, being absent from the genome of the non-pathogenic L. innocua CLIP 11262 strain. There were 25 genes that are strain-specific i.e. absent from the genome of the L. monocytogenes F2365 serotype 4b strain suggesting heterogeneity in the gene pool required for intracellular survival of L. monocytogenes in host cells.

  14. Listeria Endocarditis: A Diagnostic Challenge

    Directory of Open Access Journals (Sweden)

    Wilhelmina J. A. R. M. Valckx MD

    2017-04-01

    Full Text Available A 74-year-old hemodialysis patient with a history of an atrial septum defect closure, coronary bypass surgery, and a St. Jude aortic prosthetic valve was diagnosed with pneumonia and volume overload. Blood cultures were positive for Listeria monocytogenes, and amoxicillin was given for 2 weeks. Immediately after discontinuation of amoxicillin, fever relapsed. Transthoracic and transesophageal echocardiography showed no sign of endocarditis. Given the fever relapse and 3 positive minor Duke criteria, an 18F-FDG PET-CT scan (18F-fluorodeoxyglucose-positron emission tomography-computed tomography scan was performed. This scan showed activity at the aortic root, proximal ascending aorta, and inferior wall of the heart, making Listeria monocytogenes endocarditis a likely explanation. Amoxicillin was given for 6 weeks with good clinical result. Diagnosing a life-threatening Listeria monocytogenes endocarditis can be challenging and an 18F-FDG PET-CT scan can be helpful.

  15. Atypical cerebral listeriosis associated with Listeria innocua in a beef bull.

    Science.gov (United States)

    Rocha, Paulo Ricardo Dell'Armelina; Dalmasso, Alessandra; Grattarola, Carla; Casalone, Cristina; Del Piero, Fabio; Bottero, Maria Teresa; Capucchio, Maria Teresa

    2013-02-01

    Natural infections of cattle associated with Listeria innocua have not been reported. This report describes the first case of cerebral listeriosis in a bull due to Listeria innocua. The animal presented neurological signs characterized by weakness, incoordination and recumbency. Histopathologic evaluation of brain tissue revealed multifocal microabscesses, perivascular lymphocytic cuffing, vasculitis, oedema and haemorrhages. All lesions extended from the medulla oblongata to the basal nuclei/parietal cortex area. Indirect immunohistochemistry labelled for Listeria sp. in the brain tissue, but not for Listeria monocytogenes, neurotropic Flaviviruses, BVDV, bovine Herpesvirus 1, Chlamydophila spp. and Histophilus somni. PCR was negative for ovine herpesvirus. L. innocua was isolated from brainstem and identified by biochemical tests (Camp and beta-hemolysis negative). Subsequently, the species was confirmed by a duplex PCR and minisequencing assays. L. innocua should be histologically considered as a differential diagnosis of thrombotic meningoencephalitis, malignant catarrhal fever and cerebral listeriosis due to L. monocytogenes in cattle. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Presence of Listeria and Salmonella spp. in retail chicken in Northern Ireland.

    Science.gov (United States)

    Soultos, N; Koidis, P; Madden, R H

    2003-01-01

    Retail packs of fresh chicken in Northern Ireland were sampled to determine the frequency with which they were contaminated with Salmonella and Listeria spp. Packs of chicken were chosen from supermarkets ensuring a diverse range of EU producer codes were sampled. Salmonellas were isolated using BS EN 12824: 1998 methodology, biotyped and serotyped whilst Listeria spp. were isolated based on EN ISO 11290-1: 1996 procedures and identified using a multiplex PCR system utilizing genus and species specific primers. Only three of 205 samples yielded Salmonella spp. indicating that measures undertaken by the poultry industry to control this pathogen have apparently been successful. However, Listeria spp. were present in 38 of 80 samples tested (48%) and 14 (18%) yielded Listeria monocytogenes. Thus Salmonella controls do not markedly affect this pathogen and retail packs of raw chicken must be considered a potential source of L. monocytogenes, and appropriate precautions taken to prevent infection.

  17. Characterization of antibiotic resistance in Listeria spp. isolated from slaughterhouse environments, pork and human infections.

    Science.gov (United States)

    Moreno, Luisa Z; Paixão, Renata; Gobbi, Débora D S; Raimundo, Daniele C; Ferreira, Thais P; Moreno, Andrea M; Hofer, Ernesto; Reis, Cristhiane M F; Matté, Glavur R; Matté, Maria H

    2014-04-15

    Listeria species are susceptible to most antibiotics. However, over the last decade, increasing reports of multidrug-resistant Listeria spp. from various sources have prompted public health concerns. The objective of this study was to characterize the antibiotic susceptibility of Listeria spp. and the genetic mechanisms that confer resistance. Forty-six Listeria spp. isolates were studied, and their minimal inhibitory concentrations of antibiotics were determined by microdilution using Sensititre standard susceptibility MIC plates. The isolates were screened for the presence of gyrA, parC, lde, lsa(A), lnu(A), and mprF by PCR, and the amplified genes were sequenced. All isolates were susceptible to penicillin, ampicillin, tetracycline, erythromycin, and carbapenems. Resistance to clindamycin, daptomycin, and oxacillin was found among L. monocytogenes and L. innocua, and all species possessed at least intermediate resistance to fluoroquinolones. GyrA, parC, and mprF were detected in all isolates; however, mutations were found only in gyrA sequences. A high daptomycin MIC, as reported previously, was observed, suggesting an intrinsic resistance of Listeria spp. to daptomycin. These results are consistent with reports of emerging resistance in Listeria spp. and emphasize the need for further genotypic characterization of antibiotic resistance in this genus.

  18. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  19. Phenotypic and genotypic characterization of atypical Listeria monocytogenes and Listeria innocua isolated from swine slaughterhouses and meat markets.

    Science.gov (United States)

    Moreno, Luisa Zanolli; Paixão, Renata; de Gobbi, Debora Dirani Sena; Raimundo, Daniele Cristine; Porfida Ferreira, Thais Sebastiana; Micke Moreno, Andrea; Hofer, Ernesto; dos Reis, Cristhiane Moura Falavina; Matté, Glavur Rogério; Matté, Maria Helena

    2014-01-01

    In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  20. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C

    2008-08-01

    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  1. Listeriomics: an Interactive Web Platform for Systems Biology of Listeria.

    Science.gov (United States)

    Bécavin, Christophe; Koutero, Mikael; Tchitchek, Nicolas; Cerutti, Franck; Lechat, Pierre; Maillet, Nicolas; Hoede, Claire; Chiapello, Hélène; Gaspin, Christine; Cossart, Pascale

    2017-01-01

    As for many model organisms, the amount of Listeria omics data produced has recently increased exponentially. There are now >80 published complete Listeria genomes, around 350 different transcriptomic data sets, and 25 proteomic data sets available. The analysis of these data sets through a systems biology approach and the generation of tools for biologists to browse these various data are a challenge for bioinformaticians. We have developed a web-based platform, named Listeriomics, that integrates different tools for omics data analyses, i.e., (i) an interactive genome viewer to display gene expression arrays, tiling arrays, and sequencing data sets along with proteomics and genomics data sets; (ii) an expression and protein atlas that connects every gene, small RNA, antisense RNA, or protein with the most relevant omics data; (iii) a specific tool for exploring protein conservation through the Listeria phylogenomic tree; and (iv) a coexpression network tool for the discovery of potential new regulations. Our platform integrates all the complete Listeria species genomes, transcriptomes, and proteomes published to date. This website allows navigation among all these data sets with enriched metadata in a user-friendly format and can be used as a central database for systems biology analysis. IMPORTANCE In the last decades, Listeria has become a key model organism for the study of host-pathogen interactions, noncoding RNA regulation, and bacterial adaptation to stress. To study these mechanisms, several genomics, transcriptomics, and proteomics data sets have been produced. We have developed Listeriomics, an interactive web platform to browse and correlate these heterogeneous sources of information. Our website will allow listeriologists and microbiologists to decipher key regulation mechanism by using a systems biology approach.

  2. El tiempo en la vida humana. Disfrutar la vida.

    OpenAIRE

    Fernández-Crehuet, José María

    2016-01-01

    La conciliación de la vida profesional, familiar y personal es una tarea que estará presente durante toda nuestra vida y no siempre será sencilla. En la medida en que descubramos el sentido de nuestra vida, identificando nuestra misión, el camino que hemos de recorrer y la meta a alcanzar, podremos priorizar e integrar los distintos roles que tenemos que ejercer disfrutando del tiempo de nuestra vida.

  3. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  4. Tu proyecto de vida

    OpenAIRE

    Ramos, Georgina

    2012-01-01

    - Párrafo Inicial - Conociendo a Liliana N. - La intervención de la psicóloga Adriana - Tu proyecto de vida - Referencias - Notas de enseñanza o Resumen o Objetivos o Temas relacionados o Plan de aplicación para el aprendizaje o Análisis o Epílogo

  5. Prevalence of Listeria monocytogenes in the river receiving the effluent of municipal wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Atefeh Taherkhani

    2013-01-01

    Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.

  6. Prevalence of Listeria monocytogenes in poultry meat

    OpenAIRE

    ELMALI,Mehmet; Hayriye Yeşim CAN; Yaman, Hilmi

    2015-01-01

    Abstract The objectives of this study were i) to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii) to confirm the isolates by PCR, based on prs and hly A gene sequences, iii) to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces) bought from different markets in Hatay province were analysed. Listeria spp. was isolate...

  7. The VIDA programme

    DEFF Research Database (Denmark)

    Jensen, Bente; Iannone, Rosa Lisa

    This case study describes the VIDA programme (knowledge-based efforts for socially disadvantaged children in daycare), an innovative professional development programme for those working with 3-6-year-old children in Denmark. The case study is part of WP3’s work on ‘Professional Development: Impact...... and Innovation’ within the project ‘Curriculum Quality Analysis and Impact Review of European Education and Care’ (CARE). The programme at the centre of this case builds on theory drawn from research on child development, social disadvantage related to issues of social inequality, and research on organisational...... programme period (2010-2013) and beyond?; 2) What is the impact of the VIDA approach to professional development on i) educators’ practices regarding high quality ECEC (output), ii) child outcomes (outcome), and iii) improved practice at the municipal level (impact in a broader sense)?; and 3) Which factors...

  8. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

    Science.gov (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

    2017-01-01

    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  9. La vida universitaria

    OpenAIRE

    INCOLDA

    2010-01-01

    Cuando ingreses a la universidad, se presentará un cambio considerable en tu estilo de vida. Si inicias esta etapa con la misma mentalidad del bachillerato, corres el peligro de enfrentarte a un fracaso. Todo cambia. Ya no tienes tareas semejantes a aquellas del colegio. Si no estudias por tu propia iniciativa, nadie se dará cuenta sino hasta cuando se publiquen las notas de los exámenes y ya no hay nada para hacer

  10. Methods for the isolation and identification of Listeria spp. and Listeria monocytogenes: a review.

    Science.gov (United States)

    Gasanov, Uta; Hughes, Denise; Hansbro, Philip M

    2005-11-01

    Listeria monocytogenes is an important food-borne pathogen and is widely tested for in food, environmental and clinical samples. Identification traditionally involved culture methods based on selective enrichment and plating followed by the characterization of Listeria spp. based on colony morphology, sugar fermentation and haemolytic properties. These methods are the gold standard; but they are lengthy and may not be suitable for testing of foods with short shelf lives. As a result more rapid tests were developed based on antibodies (ELISA) or molecular techniques (PCR or DNA hybridization). While these tests possess equal sensitivity, they are rapid and allow testing to be completed within 48 h. More recently, molecular methods were developed that target RNA rather than DNA, such as RT-PCR, real time PCR or nucleic acid based sequence amplification (NASBA). These tests not only provide a measure of cell viability but they can also be used for quantitative analysis. In addition, a variety of tests are available for sub-species characterization, which are particularly useful in epidemiological investigations. Early typing methods differentiated isolates based on phenotypic markers, such as multilocus enzyme electrophoresis, phage typing and serotyping. These phenotypic typing methods are being replaced by molecular tests, which reflect genetic relationships between isolates and are more accurate. These new methods are currently mainly used in research but their considerable potential for routine testing in the future cannot be overlooked.

  11. A review of the ecology, genomics, and stress response of Listeria innocua and Listeria monocytogenes.

    Science.gov (United States)

    Milillo, Sara R; Friedly, Erik C; Saldivar, Joshua C; Muthaiyan, Arunachalam; O'Bryan, Corliss; Crandall, Philip G; Johnson, Michael G; Ricke, Steven C

    2012-01-01

    Listeria monocytogenes is a Gram-positive foodborne pathogen responsible for a severe disease occurring in immuno-compromised populations. Foodborne illness caused by L. monocytogenes is a serious public health concern because of the high associated mortality. Study of the closely related, but nonpathogenic Listeria innocua has accounted for a better understanding of the behavior of L. monocytogenes in environments beyond the laboratory. Traditionally, the ecological co-habitation, genomic synteny, and physiological similarity of the two species have supported use of L. innocua for predicting the behavior of L. monocytogenes in farm and food processing environments. However, a careful review of the current literature indicates that in a given situation it may not be prudent to use L. innocua as a surrogate for L. monocytogenes without prior confirmation of their similar phenotypes, as an increasing number of studies have arisen demonstrating differences in L. monocytogenes and L. innocua stress response, and furthermore, there are differences among the L. monocytogenes subgroups. Future research should take into consideration that multiple surrogates might be required to accurately model even a single condition depending on the L. monocytogenes subgroup of interest.

  12. Establishment of a simple and rapid identification method for Listeria spp. by using high-resolution melting analysis, and its application in food industry.

    Science.gov (United States)

    Ohshima, Chihiro; Takahashi, Hajime; Phraephaisarn, Chirapiphat; Vesaratchavest, Mongkol; Keeratipibul, Suwimon; Kuda, Takashi; Kimura, Bon

    2014-01-01

    Listeria monocytogenes is the causative bacteria of listeriosis, which has a higher mortality rate than that of other causes of food poisoning. Listeria spp., of which L. monocytogenes is a member, have been isolated from food and manufacturing environments. Several methods have been published for identifying Listeria spp.; however, many of the methods cannot identify newly categorized Listeria spp. Additionally, they are often not suitable for the food industry, owing to their complexity, cost, or time consumption. Recently, high-resolution melting analysis (HRMA), which exploits DNA-sequence differences, has received attention as a simple and quick genomic typing method. In the present study, a new method for the simple, rapid, and low-cost identification of Listeria spp. has been presented using the genes rarA and ldh as targets for HRMA. DNA sequences of 9 Listeria species were first compared, and polymorphisms were identified for each species for primer design. Species specificity of each HRM curve pattern was estimated using type strains of all the species. Among the 9 species, 7 were identified by HRMA using rarA gene, including 3 new species. The remaining 2 species were identified by HRMA of ldh gene. The newly developed HRMA method was then used to assess Listeria isolates from the food industry, and the method efficiency was compared to that of identification by 16S rDNA sequence analysis. The 2 methods were in coherence for 92.6% of the samples, demonstrating the high accuracy of HRMA. The time required for identifying Listeria spp. was substantially low, and the process was considerably simplified, providing a useful and precise method for processing multiple samples per day. Our newly developed method for identifying Listeria spp. is highly valuable; its use is not limited to the food industry, and it can be used for the isolates from the natural environment.

  13. Listeria spp. in Street-Vended Ready-to-Eat Foods.

    Science.gov (United States)

    El-Shenawy, Moustafa; El-Shenawy, Mohamed; Mañes, Jordi; Soriano, Jose M

    2011-01-01

    Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥10(3) CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin). Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food.

  14. Identification of non-Listeria spp. bacterial isolates yielding a β-D-glucosidase-positive phenotype on Agar Listeria according to Ottaviani and Agosti (ALOA).

    Science.gov (United States)

    Angelidis, Apostolos S; Kalamaki, Mary S; Georgiadou, Sofia S

    2015-01-16

    Agar Listeria according to Ottaviani and Agosti (ALOA) is the mandatory medium used for the detection and enumeration of Listeria monocytogenes in foods according to the official International Organization for Standardization (ISO) methods. On ALOA, Listeria spp. appear as bluish-green colonies due to the production of β-D-glucosidase, an enzyme that cleaves 5-bromo-4-chloro-3-indolyl-β-D-glucopyranoside, a chromogenic substrate included in the formulation of the medium. The present work reports on bacterial isolates (n=64) from ready-to-eat soft cheeses, which are able to grow on ALOA, forming bluish-green colonies and therefore phenotypically resemble Listeria spp. All isolates were also capable of growing on the selective media PALCAM and RAPID L'mono. The isolates were characterised with biochemical tests including those specified in the ISO standards for the confirmation of Listeria spp. and identified via partial sequencing of their 16S rRNA gene. According to sequencing results the isolates represented 12 different bacterial species or species-groups belonging to seven different genera: Bacillus spp. (B. circulans, B. clausii, B. licheniformis and B. oleronius), Cellulosimicrobium spp. (C. funkei), Enterococcus spp. (E. faecalis, E. faecium/durans), Kocuria spp. (K. kristinae), Marinilactibacillus spp. (M. psychrotolerans), Rothia spp. (R. terrae) and Staphylococcus spp. (S. sciuri and S. saprophyticus subsp. saprophyticus/xylosus). Cellulosimicrobium spp. have never been previously isolated from foods. These results significantly extend the list of bacteria previously known as capable of growing on ALOA as bluish-green colonies and suggest that there may be room for further improvement in the medium's inhibitory properties towards non-Listeria spp., Gram-positive bacteria present in foods. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji

    2008-09-01

    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  16. Methods used for the detection and subtyping of Listeria monocytogenes.

    Science.gov (United States)

    Jadhav, Snehal; Bhave, Mrinal; Palombo, Enzo A

    2012-03-01

    Listeria monocytogenes is an important foodborne pathogen responsible for non-invasive and invasive diseases in the elderly, pregnant women, neonates and immunocompromised populations. This bacterium has many similarities with other non-pathogenic Listeria species which makes its detection from food and environmental samples challenging. Subtyping of L. monocytogenes strains can prove to be crucial in epidemiological investigations, source tracking contamination from food processing plants and determining evolutionary relationships between different strains. In recent years there has been a shift towards the use of molecular subtyping. This has led to the development of new subtyping techniques such as multi-locus variable number tandem repeat analysis (MLVA) and multi-locus sequence based typing (MLST). This review focuses on the available methods for Listeria detection including immuno-based techniques and the more recently developed molecular methods and analytical techniques such as matrix-assisted laser desorption/ionisation time-of-flight based mass spectrometry (MALDI-TOF MS). It also includes a comparison and critical analysis of the available phenotypic and genotypic subtyping techniques that have been investigated for L. monocytogenes. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. An allelopathy based model for the Listeria overgrowth phenomenon.

    Science.gov (United States)

    Fgaier, Hedia; Kalmokoff, Martin; Ells, Timothy; Eberl, Hermann J

    2014-01-01

    In a standard procedure of food safety testing, the presence of the pathogenic bacterium Listeria monocytogenes can be masked by non-pathogenic Listeria. This phenomenon of Listeria overgrowth is not well understood. We present a mathematical model for the growth of a mixed population of L. innocua and L. monocytogenes that includes competition for a common resource and allelopathic control of L. monocytogenes by L. innocua when this resource becomes limited, which has been suggested as one potential explanation for the overgrowth phenomenon. The model is tested quantitatively and qualitatively against experimental data in batch experiments. Our results indicate that the phenomenon of masked pathogens can depend on initial numbers of each population present, and on the intensity of the allelopathic effect. Prompted by the results for the batch setup, we also analyze the model in a hypothetical chemostat setup. Our results suggest that it might be possible to operate a continuous growth environment such that the pathogens outcompete the non-pathogenic species, even in cases where they would be overgrown in a batch environment. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Prevalence of Listeria monocytogenes in ready-to-eat food of animal origin

    OpenAIRE

    Borović, Branka; Baltić, Tatjana; Lakićević, Brankica; Janković, Vesna; Mitrović, Radmila; Jovanović, Jelena; Lilić, Slobodan

    2014-01-01

    In this study, the presence of Listeria monocytogenes in ready- to- eat meat, milk and fish products has been investigated. In addition, the presence of L. monocytogenes on food - contact surfaces, as a potential source of food contamination, has been investigated as well. Samples were analyzed by fluorescent immunoenzyme assay on miniVidas® device and by standard microbiological SRPS EN ISO 11290-1: 2010 and SRPS EN ISO 11290-2: 2010 methods. Out of 881 food samples tested, 12,25% were Liste...

  19. Estadios de la vida

    Directory of Open Access Journals (Sweden)

    Alberto Londoño Alvarez

    1966-10-01

    Full Text Available Cada obra de arte presupone un hombre que la ha creado. Un hombre con todo lo que posee de aptitudes para su oficio y de fuerza interna de visión; un hombre formado por sus ascendientes, su generación, su pueblo, su nación y su raza; un hombre que nació en el estilo de su época y que vive en el estadio de la vida que el curso natural de las cosas le depara.

  20. Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes.

    Science.gov (United States)

    Lee, Sang-Hee; Ahn, Ji-Young; Lee, Kyeong-Ah; Um, Hyun-Ju; Sekhon, Simranjeet Singh; Sun Park, Tae; Min, Jiho; Kim, Yang-Hoon

    2015-06-15

    As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating food contaminated with the bacteria. We have developed an aptamer-based sandwich assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Detection of Antibiotic Resistant Listeria spp. in Beef Burgers Distributed in Ahvaz City, Iran

    Directory of Open Access Journals (Sweden)

    Maktabi

    2016-03-01

    Full Text Available Background Listeria spp. are able to be survive in many foods during frozen storage. One particular species, Listeria monocytogenes, is one of the most important food-borne pathogens globally. The antimicrobial resistance of pathogenic microorganisms is a worldwide public health concern because of increasing global trade and travel. Objectives The aim of this study was to evaluate the occurrence and antibiotic resistance of Listeria spp. in the Iranian beef burgers distributed in Ahvaz city. Materials and Methods During a five-month period, 150 frozen burgers were purchased from local markets in Ahvaz city, and tested for presence of Listeria spp. The experimental procedure consisted of a one-step enrichment in Listeria enrichment broth, followed by plating on Oxford agar. Suspected colonies were subjected to subsequent biochemical tests and a polymerase chain reaction (PCR assay. The susceptibility of the isolates to various antibiotics was investigated using the Kirby-Bauer disk diffusion method, and the results were analyzed via the chi-square test and Fisher’s exact test using SPSS 16.0 software. Results Out of 150 samples, only two were contaminated with Listeria innocua, and the statistical analysis showed no significant differences in the prevalence of Listeria between companies (P > 0.05. One of the isolates was resistant to tetracycline and the other to co-trimoxazole. Both of the isolates showed an intermediate susceptibility to chloramphenicol; however, they were sensitive to the other tested antibiotics. Conclusions L. innocua is not a pathogen, but the presence of the bacterium could be an indicator of probable contamination with L. monocytogenes. Moreover, there is a potential risk to public health from the consumption of raw or undercooked burgers, which may increase the possibility of the acquisition of resistance to antibiotics.

  2. Anti-Listeria starters: in vitro selection and production plant evaluation.

    Science.gov (United States)

    Raimondi, Stefano; Popovic, Mina; Amaretti, Alberto; Di Gioia, Diana; Rossi, Maddalena

    2014-05-01

    Anti-Listeria bacterial starters are highly demanded by the meat industry. Novel bioprotective anti-Listeria starters were searched among Lactobacillus species strains isolated from artisanal sausages. The screening confirmed that anti-Listeria activity is a strain-specific property and yielded only 1 strain (of 36) exhibiting a satisfactory level of inhibition, L. delbrueckii WC0286. This strain was compared with two commercial bioprotective starters, SafePro B-SF-43 and SafePro B-LC-20, in a model simulating in vitro the first step of the fermentation process. The presence of the bioprotective starters did not modify the pH in such a way that could affect the safety or organoleptic properties of the product. Both SafePro B-SF-43 and SafePro B-LC-20 effected an important reduction of Listeria counts (0.56 and 0.72 log CFU g(-1), respectively, in 72 h), while the anti-Listeria effect of L. delbrueckii WC0286 was minor (0.15 log CFU g(-1)). These results discouraged the utilization of L. delbrueckii WC0286 for a challenge test in a pilot salami production, in favor of the best-performing bioprotective starter, SafePro B-LC-20. The test confirmed that SafePro B-LC-20 did not alter the acidification trend of sausages and was capable of inhibiting Listeria, which decreased by 1.21 log CFU g(-1). This information is relevant to address research activity toward the development of new bioprotective starters. The data herein presented demonstrate that the efficacy in Listeria control of potentially bioprotective bacterial starters requires further validation in real meat matrixes, possibly by using in vitro meat fermentation experiments to narrow down the list of candidates before pilot scale challenge tests.

  3. PCR-based methodologies for detection and characterization of Listeria monocytogenes and Listeria ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-06-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen responsible for listeriosis, a fatal disease. It is widely distributed in various foods and environmental sources. In this review, we focused on addressing PCR-based technologies, including conventional PCR, qPCR and droplet digital PCR (ddPCR. Specifically, we described (a conventional PCR and mono-, duplex- and multiplex-qPCR methodologies; (b development and applications of gene HlyA-, Iap-, PrfA – and SsrA-based conventional and qPCR assays as well as PCR assays targeting newly identified gene targets for specific detection of L. monocytogenes; differentiation of viable from dead L. monocytogenes by qPCR in conjugation with propidium monoazide pretreatment; PCR-based serotype identification of L. monocytogenes isolates; PCR-based detection of L. ivanovii, infecting ruminants, differentiation of L. monocytogenes from other Listeria species; and sigB-gene based PCR identification of Listeria spp; (c applications of ddPCR in detection of L. monocytogenes; and (d application of qPCR assays in detection and subtyping of L. monocytogenes in milk and dairy products; meats, meat products and meat-processing environment; and seafood, seafood products and processing environment. Our goal was to provide a relatively comprehensive overview of PCR-based methodologies available in detection, characterization and subtyping of various strains of L. monocytogenes in foods and environmental sources.

  4. Comparison of lithium chloride-phenylethanol-moxalactam and modified Vogel Johnson agars for detection of Listeria spp. in retail-level meats, poultry, and seafood.

    Science.gov (United States)

    Buchanan, R L; Stahl, H G; Bencivengo, M M; Del Corral, F

    1989-03-01

    The effectiveness of Modified Vogel Johnson agar and lithium chloride-phenylethanol-moxalactam agar for detection of Listeria spp. in foods was compared by using the media to analyze retail-level meat, poultry, and seafood both by direct plating and in conjunction with a three-tube most-probable-number enrichment. The most-probable-number protocol detected Listeria species, including Listeria monocytogenes, in a substantial portion of the fresh meat and seafood samples. In most instances the Listeria levels were less than 2 CFU/g, which precluded detection by direct plating. Modified Vogel Johnson agar performed as well as did lithium chloride-phenylethanol-moxalactam agar and was considerably easier to use because of its ability to differentiate Listeria spp. from other microorganisms.

  5. Food Safety for Moms to Be: While You're Pregnant - Listeria

    Science.gov (United States)

    ... for Moms-To-Be: While You're Pregnant - Listeria Share Tweet Linkedin Pin it More sharing options ... Main Page What Is Foodborne Illness? | Listeria | Toxoplasma Listeria : Frequently Asked Questions "What is Listeria monocytogenes?" It's ...

  6. Listeria monocytogenes en comidas preparadas

    OpenAIRE

    Vila Brugalla, Montserrat

    2013-01-01

    Tradicionalmente Listeria monocytogenes no era considerado como un importante patógeno transmitido a través de los alimentos y, en consecuencia, no había recibido mucha atención por parte de la industria alimentaria. Los índices de listeriosis en la población humana siempre habían estado enormemente ensombrecidos por otras enfermedades transmitidas por los alimentos como la salmonelosis o la campilobacterosis, y la confirmación de brotes era poco frecuente. Sin embargo, los brotes de listerio...

  7. Control of Listeria monocytogenes growth in a ready-to-eat poultry product using a bacteriophage.

    Science.gov (United States)

    Bigot, B; Lee, W-J; McIntyre, L; Wilson, T; Hudson, J A; Billington, C; Heinemann, J A

    2011-12-01

    A bacteriophage (phage) that infected strains of the species Listeria monocytogenes as well as Listeria ivanovii and Listeria welshimeri, but not Listeria grayi or Listeria innocua, was isolated from sheep faeces. The phage had a contractile tail and an icosohedral head indicating that it was a myovirus, and was morphologically similar to phage A511. At 30 °C, phages added at 5.2 × 10⁷ PFU ml⁻¹ prevented the growth in broth of L. monocytogenes present at approximately twice this concentration for 7 h, but re-growth occurred such that the concentration after 24 h incubation was similar in both control and phage-treated cultures. At the same temperature, but on the surface of vacuum-packed ready-to-eat chicken breast roll, there was an immediate 2.5 log₁₀ CFU cm⁻² reduction in pathogen concentration following addition of phages and then re-growth. However, at a temperature reflecting that at which a chilled food might be held (5 °C), this re-growth was prevented over 21 days incubation. The data suggest a dose-dependent rapid reduction in pathogen concentration followed by no continued phage-mediated effect. These results, alongside other published data, indicate that a high concentration of phages per unit area is required to ensure significant inactivation of target pathogens on food surfaces. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Performance of two alternative methods for Listeria detection throughout Serro Minas cheese ripening.

    Science.gov (United States)

    Mata, Gardênia Márcia Silva Campos; Martins, Evandro; Machado, Solimar Gonçalves; Pinto, Maximiliano Soares; de Carvalho, Antônio Fernandes; Vanetti, Maria Cristina Dantas

    2016-01-01

    The ability of pathogens to survive cheese ripening is a food-security concern. Therefore, this study aimed to evaluate the performance of two alternative methods of analysis of Listeria during the ripening of artisanal Minas cheese. These methods were tested and compared with the conventional method: Lateral Flow System™, in cheeses produced on laboratory scale using raw milk collected from different farms and inoculated with Listeria innocua; and VIDAS(®)-LMO, in cheese samples collected from different manufacturers in Serro, Minas Gerais, Brazil. These samples were also characterized in terms of lactic acid bacteria, coliforms and physical-chemical analysis. In the inoculated samples, L. innocua was detected by Lateral Flow System™ method with 33% false-negative and 68% accuracy results. L. innocua was only detected in the inoculated samples by the conventional method at 60-days of cheese ripening. L. monocytogenes was not detected by the conventional and the VIDAS(®)-LMO methods in cheese samples collected from different manufacturers, which impairs evaluating the performance of this alternative method. We concluded that the conventional method provided a better recovery of L. innocua throughout cheese ripening, being able to detect L. innocua at 60-day, aging period which is required by the current legislation. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  9. Occurrence of Listeria monocytogenes in salami

    Directory of Open Access Journals (Sweden)

    Borges Maria de Fatima

    1999-01-01

    Full Text Available Eighty-one samples of four different types of salami (Friolan, Hamburguese, Italian and Milanese, belonging to five brands, and purchased at Rio de Janeiro market, were evaluated for the occurrence of Listeria monocytogenes. The pathogen was detected in 13.3% of Italian type samples of salami, while L. innocua occurred in 6.5% of the Italian type and in 16.6% of the Milanese type. The remaining samples were negative for Listeria spp.

  10. Escrever a vida, o texto

    Directory of Open Access Journals (Sweden)

    Claudio Adriano Elias Soares

    2007-10-01

    Full Text Available Viver e escrever são duas tarefas quase impossíveis de se abarcar somente pela aprendizagem, pois sempre há, diante do leitor, o desafio e a possibilidade de aprender e crescer, crescer e aprender. Através da reescrita, da vida, dos textos, vive-se mais e melhor. Em O Texto, ou: a Vida, Moacyr Scliar guia o leitor pela narrativa de seus setenta anos de vida e seus, também, mais de setenta livros publicados. Um processo contínuo de ouvinte e contador, de aprendiz e de feiticeiro das palavras.

  11. Prevalence and Fingerprinting of Listeria monocytogenes Strains Isolated from Raw Whole Milk in Farm Bulk Tanks and in Dairy Plant Receiving Tanks

    OpenAIRE

    Waak, Elisabet; Tham, Wilhelm; Danielsson-Tham, Marie-Louise

    2002-01-01

    The incidence of Listeria species in raw whole milk from farm bulk tanks and from raw milk in storage at a Swedish dairy plant was studied. Listeria monocytogenes was found in 1.0% and Listeria innocua was found in 2.3% of the 294 farm bulk tank (farm tank) milk specimens. One farm tank specimen contained 60 CFU of L. monocytogenes ml−1. L. monocytogenes was detected in 19.6% and L. innocua was detected in 8.5% of the milk specimens from the silo receiving tanks at the dairy (dairy silos). Mo...

  12. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  13. Enhanced detection and enumeration of Listeria monocytogenes from foodstuffs and food-processing environments.

    Science.gov (United States)

    Johansson, T

    1998-03-03

    Listeria monocytogenes blood agar (LMBA) was compared to Listeria selective agar based on lithium chloride and ceftazidime (LA) and to the Oxford and Palcam media recommended by ISO and IDF for the detection and enumeration of L. monocytogenes from foodstuffs and food-processing environments. LMBA is based on trypticase soy agar with the following additions: sheep blood (5%) and as selective agents lithium chloride (10 g/l), polymyxin B sulphate (10 mg/l) and ceftazidime (20 mg/l), whereas the selectivity of LA is based on lithium chloride (15 g/l) and ceftazidime (15 g/l). The media were compared in the detection of L. monocytogenes after enrichment from naturally contaminated foodstuffs (n = 423) and from food-processing environments (n = 93), and in the enumeration of the species from naturally contaminated foodstuffs (n = 287). LMBA was superior both to the standard media and to LA in detection after enrichment and also in enumeration, except in the case of fresh broiler cut samples. The overall sensitivities of the Palcam, Oxford, LA and LMBA media were 68%, 67%, 74% and 96% in detection after enrichment and 64%, 73%, 76% and 80% in the enumeration of the species from ready to eat foods. The superiority of LMBA is based on distinguishing L. monocytogenes from other Listeria species by detection of beta-hemolysis, whereas the other media gave false-negative results because of the overgrowth of Listeria spp. other than L. monocytogenes, especially in detection after enrichment. A more selective medium than LMBA would have been required for the enumeration of the species from samples with high levels of competitive bacteria other than Listeria spp. The results indicate the need for a more specific isolation medium for L. monocytogenes in addition to those recommended by ISO and IDF for both detection and enumeration. LMBA offers an alternative to be used in combination with either Palcam or Oxford as well as with LA.

  14. Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

    Science.gov (United States)

    Alali, Walid Q; Schaffner, Donald W

    2013-07-01

    The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

  15. Occurrence of Listeria spp. in mattress dust of farm children in Bavaria.

    Science.gov (United States)

    Korthals, Melanie; Ege, Markus; Lick, Sonja; von Mutius, Erika; Bauer, Johann

    2008-07-01

    Several epidemiological studies have shown that the farm environment impacts allergy protection mechanisms in children. These associations are not well understood, but it is thought that contact to microorganisms may mediate this effect. For example, heat-inactivated Listeria (L.) monocytogenes have been successfully used as an adjuvant in mouse immunotherapy to modulate airway hyperreactivity and inflammation. In investigating the link between farming lifestyle and prevention of childhood allergy, we examined the prevalence of Listeria spp. in dust specimens from the environment of rural children. A total of 26 farms located in Bavaria (South Germany) were examined. Dust samples taken from mattresses (n=63), cow-sheds (n=30) and swine-sheds (n=10) were qualitatively screened for the presence of viable Listeria spp. according to the ISO 11290-1 method and additionally by L. monocytogenes specific iap-based real-time PCR. Isolates were further characterized by biochemical techniques, serology and multiplex PCR. Nineteen of 26 farms tested positive for Listeria spp. and seven were tested negative. The dominant species found by culturing methods were L. innocua (n=12) and L. monocytogenes (n=8). Viable Listeria spp. were detected in 8% of the mattress dust samples, whereas real-time PCR revealed 60% L. monocytogenes positive specimens. Regarding animal sheds, 28% of dust samples showed viable Listeria spp., while using real-time PCR found that 28% of specimens were L. monocytogenes positive. All strains of L. monocytogenes except one (4ab) belonged to the serotype 1/2a. Our data demonstrate that a substantial number of farm children's beds contain L. monocytogenes. The importance of this result regarding the health of children must be evaluated by epidemiological investigations on both the risk of listeriosis and the effects on protection against allergies.

  16. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

    Science.gov (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

    2015-07-02

    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Genetic Stability and Evolution of thesigBAllele, Used for Listeria Sensu Stricto Subtyping and Phylogenetic Inference.

    Science.gov (United States)

    Liao, Jingqiu; Wiedmann, Martin; Kovac, Jasna

    2017-06-15

    Sequencing of single genes remains an important tool that allows the rapid classification of bacteria. Sequencing of a portion of sigB , which encodes a stress-responsive alternative sigma factor, has emerged as a commonly used molecular tool for the initial characterization of diverse Listeria isolates. In this study, evolutionary approaches were used to assess the validity of sigB allelic typing for Listeria For a data set of 4,280 isolates, sigB allelic typing showed a Simpson's index of diversity of 0.96. Analyses of 164 sigB allelic types (ATs) found among the 6 Listeria sensu stricto species, representing these 4,280 isolates, indicate that neither frequent homologous recombination nor positive selection significantly contributed to the evolution of sigB , confirming its genetic stability. The molecular clock test provided evidence for unequal evolution rates across clades; Listeria welshimeri displayed the lowest sigB diversity and was the only species in which sigB evolved in a clocklike manner, implying a unique natural history. Among the four L. monocytogenes lineages, sigB evolution followed a molecular clock only in lineage IV. Moreover, sigB displayed a significant negative Tajima D value in lineage II, suggesting a recent population bottleneck followed by lineage expansion. The absence of positive selection along with the violation of the molecular clock suggested a nearly neutral mechanism of Listeria sensu stricto sigB evolution. While comparison with a whole-genome sequence-based phylogeny revealed that the sigB phylogeny did not correctly reflect the ancestry of L. monocytogenes lineage IV, the availability of a large sigB AT database allowed accurate species classification. IMPORTANCE sigB allelic typing has been widely used for species delineation and subtyping of Listeria However, an informative evaluation of this method from an evolutionary perspective was missing. Our data indicate that the genetic stability of sigB is affected by neither

  18. The Listeria monocytogenes LPXTG surface protein Lmo1413 is an invasin with capacity to bind mucin.

    Science.gov (United States)

    Mariscotti, Javier F; Quereda, Juan J; García-Del Portillo, Francisco; Pucciarelli, M Graciela

    2014-05-01

    Many Gram-positive bacterial pathogens use surface proteins covalently anchored to the peptidoglycan to cause disease. Bacteria of the genus Listeria have the largest number of surface proteins of this family. Every Listeria genome sequenced to date contains more than forty genes encoding surface proteins bearing anchoring-domains with an LPXTG motif that is recognized for covalent linkage to the peptidoglycan. About one-third of these proteins are present exclusively in pathogenic Listeria species, with some of them acting as adhesins or invasins that promote bacterial entry into eukaryotic cells. Here, we investigated two LPXTG surface proteins of the pathogen L. monocytogenes, Lmo1413 and Lmo2085, of unknown function and absent in non-pathogenic Listeria species. Lack of these two proteins does not affect bacterial adhesion or invasion of host cells using in vitro infection models. However, expression of Lmo1413 promotes entry of the non-invasive species L. innocua into non-phagocytic host cells, an effect not observed with Lmo2085. Moreover, overproduction of Lmo1413, but not Lmo2085, increases the invasion rate in non-phagocytic eukaryotic cells of an L. monocytogenes mutant deficient in the acting-binding protein ActA. Unexpectedly, production of full-length Lmo1413 and InlA exhibited opposite trends in a high percentage of L. monocytogenes isolates obtained from different sources. The idea of Lmo1413 playing a role as a new auxiliary invasin was also sustained by assays revealing that purified Lmo1413 binds to mucin via its MucBP domains. Taken together, these data indicate that Lmo1413, which we rename LmiA, for Listeria-mucin-binding invasin-A, may promote interaction of bacteria with adhesive host protective components and, in this manner, facilitate bacterial entry. Copyright © 2014 Elsevier GmbH. All rights reserved.

  19. InstantLabs Listeria monocytogenes food safety kit. Performance tested method 051304.

    Science.gov (United States)

    Sharma, Neil; Bambusch, Lauren; Le, Thu; Morey, Amit

    2014-01-01

    The InstantLabs Listeria monocytogenes Food Safety Kit was validated against the International Organization for Standardization (ISO) reference method 11290-1 for the detection of Listeria monocytogenes and other Listeria species. The matrixes (stainless steel, sealed concrete, ice cream, whole milk, cheddar cheese, raw shrimp, hot dogs, deli turkey, and lettuce) were inoculated with approximately 1 CFU/test portion of L. monocytogenes to generate fractional positives (5-15) in 20 inoculated samples. Enrichments were also fractionally inoculated with L. grayii for side-by-side testing of the Listeria Species Food Safety Kit. Stainless steel and sealed concrete samples were validated using 4 x 4" and 1 x 1 " test areas, respectively, and enriched in Buffered Listeria Enrichment Broth (BLEB) at 35 +/- 1degreesC for 22-28 h. All food samples were tested at 25 g and enriched in BLEB at 35 +/- 1 degreesC for 24-28 h. All samples were confirmed using the ISO reference method, regardless of initial screen result. The InstantLabs test method performed as well as or better than the reference method for the detection of L. monocytogenes on stainless steel and sealed concrete and in ice cream, whole milk, cheddar cheese, raw shrimp, hot dogs, deli turkey, and lettuce. Inclusivity and exclusivity testing revealed no false negatives and no false positives among the 50 L. monocytogenes serovars and 30 non-L. monocytogenes species examined. The method was shown to be robust when the enrichment times, volumes for DNA extraction, and heat block times were varied.

  20. 21 CFR 172.785 - Listeria-specific bacteriophage preparation.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Listeria-specific bacteriophage preparation. 172... FOOD FOR HUMAN CONSUMPTION Other Specific Usage Additives § 172.785 Listeria -specific bacteriophage preparation. The additive may be safely used as an antimicrobial agent specific for Listeria monocytogenes (L...

  1. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Draft Interagency Risk Assessment--Listeria monocytogenes in Retail Delicatessens: Notice of... Assessment--Listeria monocytogenes in Retail Delicatessens.'' This draft quantitative risk assessment (QRA... conditions, such as Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for...

  2. 21 CFR 866.3355 - Listeria spp. serological reagents.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Listeria spp. serological reagents. 866.3355... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3355 Listeria spp. serological reagents. (a) Identification. Listeria spp. serological reagents are devices that consist of...

  3. 78 FR 23901 - Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-04-23

    ... Food Safety and Inspection Service Interagency Risk Assessment--Listeria monocytogenes in Retail... risk assessment (QRA), ``Interagency Risk Assessment--Listeria monocytogenes in Retail Delicatessens... and on the FSIS Web site at http://www.fsis.usda.gov/PDF/Listeria-Transcript_062309.pdf ). II. Purpose...

  4. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Directory of Open Access Journals (Sweden)

    Deepti N. Nayak

    2015-06-01

    Full Text Available Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9% were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%, Listeria innocua (5, 27.7%, Listeria welshimeri (4, 22.2%, and L. monocytogenes (3, 16.6%. The highest prevalence was observed in milk samples (8. Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk. All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200 of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest

  5. Isolation, identification, and characterization of Listeria spp. from various animal origin foods.

    Science.gov (United States)

    Nayak, Deepti N; Savalia, C V; Kalyani, I H; Kumar, Rajeev; Kshirsagar, D P

    2015-06-01

    The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Total 200 samples comprising of milk, milk products, meat, and fish (50 each) collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence-associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Of the total 200 food samples of animal origin; 18 (9%) were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%), Listeria innocua (5, 27.7%), Listeria welshimeri (4, 22.2%), and L. monocytogenes (3, 16.6%). The highest prevalence was observed in milk samples (8). Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk). All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Listeria spp. was isolated from 9% (18/200) of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest prevalence in the milk samples. L. monocytogenes was isolated

  6. Age and growth of three Odontesthes species from Southern Brazil (Atherinopsidae, with reference to phylogenetic constraints in their life-history Idade e crescimento de três espécies de Odontesthes (Atherinopsidae do sul do Brasil, com observações sobre a relação entre filogenia e história de vida de peixes-rei

    Directory of Open Access Journals (Sweden)

    F. G. Becker

    2003-11-01

    Full Text Available The age and growth of three silverside species are described, and a discussion on possible phylogenetic constraints on life-history characteristics is presented. Samples were collected monthly between March 1992 and February 1993 in three freshwater coastal lakes. Standard length-total length (Ls-Lt and weight-length (Wt-Lt relationships studied showed interspecific differences in comparisons between juveniles and adults, males and females. Age was determined by scales. The three species presented a life-cycle duration of 4 to 5 years, with growth coefficients values (K between 0.37 and 0.63, and asymptotic lengths between 211 and 257 mm. Some interspecific differences may be useful for distinguishing between species (sexual and life-stage related patterns in Ls-Lt and Wt-Lt. The observed life-cycle ranges and maximum sizes were compared to those of other silversides and revealed a pattern coherent with available phylogenetic hypotheses at the supra-generic level, indicating that some life-history characteristics may be subject to phylogenetic constraints.Este estudo apresenta uma descrição das características de idade e crescimento de três espécies de Odontesthes, além de uma discussão sobre possíveis relações de características de história de vida com filogenia. Amostragens foram feitas mensalmente entre março/1992 e fevereiro/1993, em três lagoas costeiras do Rio Grande do Sul. As relações comprimento padrão-comprimento total (Ls-Lt e peso-comprimento (Wt-Lt revelaram diferenças interespecíficas nas comparações entre juvenis e adultos e entre machos e fêmeas. A idade foi determinada a partir das escamas. As três espécies apresentaram um ciclo de vida de 4 a 5 anos, com coeficientes de crescimento (K entre 0,37 e 0,63 e comprimentos assintóticos entre 211 e 257 mm. A duração do ciclo de vida e os tamanhos máximos foram comparados com aqueles de outras espécies de Atheriniformes e revelaram um padrão coerente com

  7. Application of SYBR Green I and TaqMan probe-based real-time PCRs for the identification of Listeria spp. and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Kędrak-Jabłońska Agnieszka

    2015-12-01

    Full Text Available The aim of the study was the application and comparison of real-time PCR methods based on the fluorescence of SYBR Green I intercalating dye and TaqMan probes for the detection of the 23S rDNA gene of Listeria spp. and the hlyA gene of Listeria monocytogenes. Five strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used for the experiments. Additionally, five strains of other species of bacteria were used for evaluation of the specificity of the tests. QuantiTect SYBR Green PCR and QuantiTect Probe PCR kits were selected for the study. In the first stage of the study, SYBR Green I real-time PCRs were performed under several methods, the first one allowing detection of the 23S rDNA gene and the remainder based on the amplification of the hlyA gene. In the next part, three varied in method TaqMan probe-based real-time PCRs allowing confirmation of strains belonging to Listeria spp. and L. monocytogenes were conducted. The observation of amplification curves in real-time PCR methods enabled the detection of both genes, and these methods demonstrated a significant sensitivity and high specificity. A high regression coefficient of 0.99 was found for all reactions. Specific amplification products were obtained for the 23S rDNA and hlyA genes, which confirmed the tested strains as Listeria spp. and L. monocytogenes respectively. Isolates of other microbial species did not yield real-time PCR products.

  8. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity.

    Science.gov (United States)

    Maury, Mylène M; Tsai, Yu-Huan; Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P C; Brisse, Sylvain; Lecuit, Marc

    2016-03-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking within-species heterogeneity in microbial virulence. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated either with food or with human central nervous system (CNS) or maternal-neonatal (MN) listeriosis. The latter clones are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS- and MN-associated clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we have uncovered multiple new putative virulence factors and demonstrate experimentally the contribution of the first gene cluster mediating L. monocytogenes neural and placental tropisms. This study illustrates the exceptional power in harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes.

  9. IDENTIFIKASI Listeria spp. PADA PANGAN JAJANAN BERBASIS IKAN DI KOTA BOGOR

    Directory of Open Access Journals (Sweden)

    Elia Yuswita

    2016-06-01

    Full Text Available L. monocytogenes contamination in processed food, especially fish-based snack, may results from contaminated raw materials, underprocessed or recontamination. The aims of this study were to identify the presence of Listeria spp. especially L. monocytogenes by PCR method and biochemical methods, as well as calculate the prevalence of Listeria spp. in fish-based snack food in Bogor. This study was conducted of 4 steps: (1 determination of L. monocytogenes’s DNA limit detection, (2 sample preparation, (3 identification of L. monocytogenes with real-time PCR, and (4 identification of Listeria spp. with biochemical methods. The results showed that DNA detection limits of L. monocytogenes in fish meatball and otak-otak were at 8.3x102 and 2.9x102 CFU/g, respectively. The study on 65 samples indicated that contamination of L. monocytogenes was not observed, but other species of Listeria spp., namely L. grayi and L. innocua, were found. The prevalence of L. grayi and L. innocua in siomay was at 5.9%, while the prevalence of L. grayi in shrimp meatballs, fish meat balls, fried meatballs was at 8.3, 9.1, and 50%, respectively. Furthermore, L. innocua from takoyaki samples with a prevalence of 20% was observed.

  10. Occurrence and antimicrobial susceptibility of Listeria monocytogenes isolated from brined white cheese in Jordan.

    Science.gov (United States)

    Osaili, Tareq M; Al-Nabulsi, Anas A; Taha, Mohammad H; Al-Holy, Murad A; Alaboudi, Akram R; Al-Rousan, Walid M; Shaker, Reyad R

    2012-09-01

    Listeria monocytogenes is a serious foodborne pathogen that has been isolated from different dairy food products. Several foodborne outbreaks of listeriosis have been associated with consumption of cheese. The aims of this study were to determine the occurrence of L. monocytogenes and Listeria spp. in brined white cheese (BWC) sold in Jordan, and to determine the susceptibility of isolated L. monocytogenes to antimicrobials. Three hundred and fifty samples of 5 different types of BWC (akkawi, boiled, halloumi, pasteurized, and shellal) were collected from a local market in Jordan. The ISO (11290-1) procedure was followed for isolation and identification of Listeria spp. from cheese samples and a polymerase chain reaction (PCR) technique was used for confirmation of L. monocytogenes isolates. The VITEK2 automated system was used for testing antimicrobial susceptibility of L. monocytogenes isolates. The overall prevalence of Listeria spp. in cheese sample was 27.1%. L. monocytogenes was isolated from 39 (11.1%) samples. Other isolated species were L. grayi (6.9%), L. innocua (2%), L. ivanovii (4%), L. seeligeri (2%), and L. welshimeri (0.3%). The pH values and salt concentrations of L. monocytogenes positive cheese samples ranged from 5.10 to 6.32 and 5.64 to 13.16, respectively. L. monocytogenes isolates were sensitive or intermediate susceptible to imipenem, gentamicin, linezolid, teicoplanin, vancomycin, fusidic acid, trimethoprim/sulfamethoxazole, benzylpenicillin, ciprofloxacin, erythromycin, tetracycline, and rifampicin, but resistant to fosfomycin, oxacillin, and clindamycin. © 2012 Institute of Food Technologists®

  11. Prevalence of Listeria monocytogenes in Idiazabal cheese.

    Science.gov (United States)

    Arrese, E; Arroyo-Izaga, M

    2012-01-01

    Raw-milk cheese has been identified in risk assessment as a food of greater concern to public health due to listeriosis. To determine the prevalence and levels of Listeria monocytogenes in semi-hard Idiazabal cheese manufactured by different producers in the Basque Country at consumer level. A total of 51 Idiazabal cheese samples were obtained from 10 separate retail establishments, chosen by stratified random sampling. Samples were tested using the official standard ISO procedure 11290-1 for detection and enumeration methods. All cheese samples tested negative for L. monocytogenes. However, 9.8% tested positive for Listeria spp., different from L. monocytogenes. Positive samples came from two brands, two were natural and three were smoked. The presence of Listeria spss. suggests that the cheese making process and the hygiene whether at milking or during cheese making could be insufficient.

  12. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  13. Structural and functional diversity in Listeria cell wall teichoic acids.

    Science.gov (United States)

    Shen, Yang; Boulos, Samy; Sumrall, Eric; Gerber, Benjamin; Julian-Rodero, Alicia; Eugster, Marcel R; Fieseler, Lars; Nyström, Laura; Ebert, Marc-Olivier; Loessner, Martin J

    2017-10-27

    Wall teichoic acids (WTAs) are the most abundant glycopolymers found on the cell wall of many Gram-positive bacteria, whose diverse surface structures play key roles in multiple biological processes. Despite recent technological advances in glycan analysis, structural elucidation of WTAs remains challenging due to their complex nature. Here, we employed a combination of ultra-performance liquid chromatography-coupled electrospray ionization tandem-MS/MS and NMR to determine the structural complexity of WTAs from Listeria species. We unveiled more than 10 different types of WTA polymers that vary in their linkage and repeating units. Disparity in GlcNAc to ribitol connectivity, as well as variable O-acetylation and glycosylation of GlcNAc contribute to the structural diversity of WTAs. Notably, SPR analysis indicated that constitution of WTA determines the recognition by bacteriophage endolysins. Collectively, these findings provide detailed insight into Listeria cell wall-associated carbohydrates, and will guide further studies on the structure-function relationship of WTAs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Non-Specific Reactions during Immunomagnetic Separation of Listeria

    Directory of Open Access Journals (Sweden)

    Iveta Zachová

    2005-01-01

    Full Text Available Problems occurring during the immunomagnetic separation (IMS of Listeria using immunomagnetic particles Dynabeads® anti-Listeria (Dynal Biotech, Norway were specified. Characteristics of these particles were compared with anti-Listeria spp. magnetite particles (Quantum Magnetics, USA. Pure cultures of Listeria innocua, Arthrobacter spp., Bacillus subtilis, Citrobacter braakii, Escherichia coli, Enterobacter aerogenes, Enterobacter cloacae and Staphylococcus aureus were used to evaluate non-specific reactions during IMS. Gram-positive microorganisms, especially Staphylococcus aureus and Arthrobacter spp., were found to be responsible for non-specific reactions in most cases. The capacity of Dynabeads® anti-Listeria particles was determined to be about 10 % of the initial pure cultures of Listeria spp., after 10 min of incubation. Non-specific reactions during IMS of Listeria were examined on the artificially inoculated food samples in which Gram-positive bacteria showed the highest percentage of capture. Influence of washing in two buffers was also studied.

  15. Uncommon manifestations of Listeria monocytogenes infection.

    Science.gov (United States)

    Chavada, Ruchir; Keighley, Caitlin; Quadri, Syed; Asghari, Ray; Hofmeyr, Ann; Foo, Hong

    2014-12-03

    Listeria monocytogenes causes gastroenteritis, meningitis and bacteraemia in immunocompromised, pregnant patients, the elderly as well in immunocompetent patients. Focal infections with this organism are uncommon, especially in sporadic (non-outbreak) setting, require high index of suspicion and are challenging to diagnose. We present 3 cases of Listeria monocytogenes presenting as focal infections to our hospitals, all of which are the first reported cases from Australia. Three unrelated cases of unique focal infections caused by Listeria monocytogenes are presented. 1) A 73 year old Caucasian lady on immunosuppression for colorectal cancer presented with prosthetic knee joint septic arthritis, 2) An 83 year old Caucasian man presented with prosthetic vascular graft infection and 3) A 60 year old Asian man with perianal abscess. Except for case 1, the other cases had a prolonged duration of symptoms on presentation. Listeria was not thought to be causative organism in any of these cases until microbiological specimens isolated the organism. Matrix Associated Laser Desorption/Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) assisted in making an earlier diagnosis of the infection in all three cases. All of these patients had Listeria monocytogenes isolated from clinical specimens. They were managed with antibiotics and surgery with favourable outcomes. Public health investigations to determine any dietary association were done, however no intervention was thought to be necessary in any of the cases except provide dietary advice. The first two cases highlight the importance of microbiological sampling in serious infections for definitive antibiotic therapy to be administered. Sporadic focal infections with Listeria occur infrequently and are often not diagnosed till culture results from microbiological specimens become available. Dietary history should be an important aspect of thorough clinical history and food consumption advice is crucial in

  16. Prevalence, identification by a DNA microarray-based assay of human and food isolates Listeria spp. from Tunisia.

    Science.gov (United States)

    Hmaïed, F; Helel, S; Le Berre, V; François, J-M; Leclercq, A; Lecuit, M; Smaoui, H; Kechrid, A; Boudabous, A; Barkallah, I

    2014-02-01

    We aimed at evaluating the prevalence of Listeria species isolated from food samples and characterizing food and human cases isolates. Between 2005 and 2007, one hundred food samples collected in the markets of Tunis were analysed in our study. Five strains of Listeria monocytogenes responsible for human listeriosis isolated in hospital of Tunis were included. Multiplex PCR serogrouping and pulsed field gel electrophoresis (PFGE) applying the enzyme AscI and ApaI were used for the characterization of isolates of L. monocytogenes. We have developed a rapid microarray-based assay to a reliable discrimination of species within the Listeria genus. The prevalence of Listeria spp. in food samples was estimated at 14% by using classical biochemical identification. Two samples were assigned to L. monocytogenes and 12 to L. innocua. DNA microarray allowed unambiguous identification of Listeria species. Our results obtained by microarray-based assay were in accordance with the biochemical identification. The two food L. monocytogenes isolates were assigned to the PCR serogroup IIa (serovar 1/2a). Whereas human L. monocytogenes isolates were of PCR serogroup IVb, (serovars 4b). These isolates present a high similarity in PFGE. Food L. monocytogenes isolates were classified into two different pulsotypes. These pulsotypes were different from that of the five strains responsible for the human cases. We confirmed the presence of Listeria spp. in variety of food samples in Tunis. Increased food and clinical surveillance must be taken into consideration in Tunisia to identify putative infections sources. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  17. Monitoring transmission routes of Listeria spp. in smoked salmon production with repetitive element sequence-based PCR techniques.

    Science.gov (United States)

    Zunabovic, M; Domig, K J; Pichler, I; Kneifel, W

    2012-03-01

    Various techniques have been used for tracing the transmission routes of Listeria species and for the assessment of hygiene standards in food processing plants. The potential of repetitive element sequence-based PCR (Rep-PCR) methods (GTG₅ and REPI + II) for the typing of Listeria isolates (n = 116), including Listeria monocytogenes (n = 46), was evaluated in a particular situation arising from the relocation of a company producing cold-smoked salmon. Pulsed-field gel electrophoresis (PFGE) using three restriction enzymes (ApaI, AscI, and SmaI) was used for comparison. Identical transmission scenarios among two companies could be identified by cluster analysis of L. monocytogenes isolates that were indistinguishable by both Rep-PCR and PFGE. The calculated diversity index (DI) indicates that Rep-PCR subtyping of Listeria species with primer sets GTG₅ and REPI + II has a lower discrimination power than does PFGE. When concatenated Rep-PCR cluster analysis was used, the DI increased from 0.934 (REPI + II) and 0.923 (GTG₅) to 0.956. The discrimination power of this method was similar to that of PFGE typing based on restriction enzyme Apa I (DI = 0.955). Listeria welshimeri may be useful as an indicator for monitoring smoked salmon processing environments. Rep-PCR meets the expectations of a reasonable, fast, and low-cost molecular subtyping method for the routine monitoring of Listeria species. The discriminatory power as characterized by the DI sufficiently quantifies the probability of unrelated isolates being characterized as different subtypes. Therefore, Rep-PCR typing based on two primer systems (GTG₅ and REPI + II) may be a useful tool for monitoring industrial hygiene.

  18. REGRA, VIDA, FORMA DE VIDA: INVESTIDA DE GIORGIO AGAMBEN

    Directory of Open Access Journals (Sweden)

    Daniel Arruda Nascimento

    2015-07-01

    Full Text Available Acompanhando a nova investida de Giorgio Agamben coma publicação de Altissima povertà: regole monastiche e forma divita, livro que inaugura a quarta e definitiva parte de seu projetofilosófico denominado genericamente de Homo sacer, tem opresente trabalho como linha mestra o exame da evolução da noçãode vida nua, pela interposição de um novo propósito conceitual:forma de vida. Trata-se de identificar um tipo de vida que se vinculatão estreitamente à sua forma que resulta inseparável dela. Trata-setambém de refletir, agora sobre o pano de fundo da tradição teóricade orientação franciscana, a relação entre vida e direito, penetrandoum pouco mais no ponto de intersecção entre o modelo jurídicoinstitucionale o modelo biopolítico do poder, aproximando-nos deassinaturas que permitam uma melhor visualização daspossibilidades quando se cuida de tornar inoperantes dispositivos dedomínio.

  19. Otitis media supurada por Listeria grayi

    OpenAIRE

    Fajardo Olivares, Miguel; Santos Morano, Amparo; Zarallo Cortés, Luis

    2014-01-01

    Resumen: La listeriosis es una enfermad que afecta tanto en la edad adulta como en la etapa perinatal, generalmente en forma de septicemia y afectación del SNC. De las seis especies que componen el género, sólo se consideran patógenas Listeria monocitogenes y Listeria iovanii, debido a que expresan una proteína, listerolisina O, que es el principal factor de virulencia para sobrevivir dentro del macrófago. Sin embargo, bajo determinadas circunstancias (inóculo bacteriano elevado, pacientes co...

  20. Comparative study of the effects of citral on the growth and injury of Listeria innocua and Listeria monocytogenes cells.

    Science.gov (United States)

    Silva-Angulo, Angela B; Zanini, Surama F; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio

    2015-01-01

    This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 10(2) and 10(6) cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral.

  1. Tabela de vida de fertilidade de três espécies neotropicais de Trichogrammatidae em ovos de hospedeiros alternativos como critério de seleção hospedeira Fertility life table of three neotropical species of Trichogrammatidae on factitious hosts as a criterion for selection of hosts

    Directory of Open Access Journals (Sweden)

    Nivia da Silva Dias

    2010-03-01

    Full Text Available Tabela de vida de fertilidade de três espécies neotropicais de Trichogrammatidae em ovos de hospedeiros alternativos como critério de seleção hospedeira. O objetivo deste trabalho foi selecionar o hospedeiro alternativo que permita o melhor desenvolvimento das três espécies neotropicais de tricogramatídeos, Trichogramma atopovirilia Oatman & Platner, 1983; Trichogramma bruni Nagaraja, 1983 e Trichogrammatoidea annulata De Santis, 1972, utilizando-se como parâmetro comparativo as tabelas de vida de fertilidade nos respectivos hospedeiros. Foram estimados a duração média de uma geração (T, taxa líquida de reprodução (Ro, razão infinitesimal (r m e a razão finita de aumento (λ. A tabela de vida de fertilidade pode ser utilizada para selecionar o hospedeiro alternativo mais adequado para as espécies de tricogramatídeos. Corcyra cephalonica (Stainton, 1865 (Lepidoptera, Pyralidae foi o hospedeiro alternativo mais adequado para criação de T. annulata e de T. bruni, enquanto que para T. atopovirilia, Anagasta kuehniella (Zeller, 1879 (Lepidoptera, Pyralidae e/ou C. cephalonica foram os hospedeiros mais adequados. Sitotroga cerealella (Olivier, 1819 (Lepidoptera, Gelechiidae apresentou baixa capacidade de aumento populacional para as três espécies de parasitóides, sendo, portanto, uma espécie inadequada como hospedeiro alternativo para as mesmas.The objective of this work was to select the factitious host that permit the best development of three neotropical Trichogrammatidae species, Trichogramma atopovirilia Oatman & Platner, 1983; Trichogramma bruni Nagaraja, 1983, and Trichogrammatoidea annulata De Santis, 1972, using the fertility life table on their respective hosts as a comparative parameter. Mean generation time (T, net reproductive rate (Ro, intrinsic rate of natural increase (r m and the finite rate of increase (λ were estimated. A fertility life table is useful to select the most adequate factitious hosts for the

  2. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin

    2015-01-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

  3. Rapid detection of listeria spp. using an internalin A aptasensor based on carbon-metal nanohybrid structures

    Science.gov (United States)

    Vanegas, D. C.; Rong, Yue; Schwalb, N.; Hills, K. D.; Gomes, C.; McLamore, E. S.

    2015-05-01

    Foodborne outbreaks caused by Listeria monocytogenes continue to raise major public health concerns worldwide. In the United States alone, the centers for disease control and prevention have confirmed the occurrence of 183 cases of listeriosis with 39 fatalities within the last 3 years. Standard methods for the detection of pathogenic strains require up to 7 days to yield results, thus faster techniques with the same level of reliability for bacteria detection are desirable. This study reports on the development of a rapid, accurate, and sensitive electrochemical biosensor for rapid testing of Listeria spp. based on the selective binding of InlA aptamers to internalins in the cell membrane of the target bacteria. Hybrid nanomaterial platforms based on reduced graphene oxide and nanoplatinum were deposited onto Pt/Ir electrodes for enhancing electrochemical transduction during the recognition events. InlA aptamers were immobilized onto the nanomaterial platforms via metal-thiol adsorption. Aptamer loading onto different platform nanostructures was investigated through cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The detection mechanism was evaluated by recording the electrochemical response to several bacterial dilutions in PBS buffer using the non-pathogenic species Listeria innocua. These preliminary results show that the aptasensor can be tuned for detection of Listeria concentrations as low as 100 CFU/ml in less than 3 hours (including incubation time and data analysis). The developed aptasensor opens a promising direction for rapid testing of Listeria monocytogenes in food products.

  4. VIDA I København

    DEFF Research Database (Denmark)

    Jensen, Bente

    Konklusion og perspektiver Samlet set kan det konkluderes, at ny viden fra VIDA i København-uddannelsen er blevet implementeret i fornyelse af praksisser i en stor del af institutionerne, hovedsageligt, som det er nævnt, som det kommer til udtryk på lederniveau. Det er især principperne om...... refleksion, systematik og håndtering af viden, der synes at være slået igennem. I forhold til princippet om organisatorisk læring peger analysen på, at der kan være en række udfordringer i flere institutioner i forhold til at ”formidle”, dele og ”sælge” VIDA-modellen og VIDA i København-viden til den samlede...... har endvidere givet et indblik i, hvilke faktorer der kan virke henholdsvis styrkende og hæmmende i et projektforløb som VIDA i København. Her har det vist sig, at tid, ledelse, struktur og rutiner i den organisatoriske praksis spiller en rolle som mulige hindringer, men også, at der hvor det ser ud...

  5. Mathematical Model of Interaction Between Bacteriocin-Producing Lactic Acid Bacteria and Listeria. Part 2: Bifurcations and Applications.

    Science.gov (United States)

    Delboni, Roberta Regina; Yang, Hyun Mo

    2017-10-01

    The big challenge for the food industry is the attending to demands for minimally processed foods, avoiding intense heat treatments and reducing the addition of chemical preservatives, but at the same time ensuring microbiological safety of these products. Lactic acid bacteria are traditionally used in the production of fermented foods. They are responsible for the production of antimicrobial compounds, such as organic acids and bacteriocins, which are protein compounds with bactericidal effect against related species and bacteria such as Listeria monocytogenes and Staphylococcus aureus. Aiming to study quantitatively the biological control as a technique of conservation, we developed a mathematical model to describe the interaction between lactic acid bacteria and Listeria in the food. The steady state and dynamical trajectories analyses of the model permit us to study the suitability of including lactic acid bacteria in order to reduce the growth of Listeria in food.

  6. Listeria SPP. and enteric pathogens in raw meat: a survey in the Ferrara area.

    Science.gov (United States)

    Maini, P; Gaiani, R; Piva, I; Zampino, L; Bicocchi, R; Bucci, G

    1989-01-01

    The Authors report the results of a study performed on 113 samples of raw meat of 6 different animal species in order to evaluate the extent of contamination by some organisms responsible for food-borne infections. A total of 2 strains of Salmonella (1.7%), 36 of Yersinia (31.8%), 35 of Campylobacter (30.9%) and 13 of Listeria (11.5%) were isolated. The possible role of contaminated meat in cases of human listeriosis is pointed out.

  7. Búsqueda de vida en Marte

    Directory of Open Access Journals (Sweden)

    Rafael Navarro-González

    2005-01-01

    Full Text Available La misión astrobiológica más importante que se ha realizado hasta la fecha ha sido sin duda el proyecto Vikingo de la NASA. Esta misión consistió en tres experimentos biológicos especialmente diseñados para la búsqueda de indicadores de vida en las capas superficiales del suelo marciano. Los tres experimentos dieron resultados positivos. Sin embargo, el análisis de materia orgánica en el suelo marciano demostró la ausencia total de carbono orgánico. Este hallazgo fue utilizado como uno de los argumentos más sólidos en contra de la existencia de vida en la superficie del planeta Marte. Como preparación para futuras misiones a Marte en búsqueda de vida es necesario probar los instrumentos en localidades terrestres que pudieran ser ambientes análogos a Marte. Uno de los desiertos más áridos del planeta es el de Atacama, en el norte de Chile. Estudios químicos y microbiológicos del suelo de Atacama sugieren que el corazón del desierto es en realidad un buen análogo de Marte, ya que no posee vida macroscópica y microscópica, tiene niveles muy bajos de materia orgánica, y sus suelos son muy reactivos. En colaboración con científicos franceses y estadounidenses, estamos preparando una misión robótica dirigida por la NASA para la búsqueda de vida pasada o presente en Marte por lo que el Desierto de Atacama en Chile es el escenario para la preparación de esta misión espacial.

  8. con mala calidad de vida

    Directory of Open Access Journals (Sweden)

    Agustín Martín-Rodríguez

    2007-01-01

    Full Text Available En este estudio ex post facto se ha analizado si los familiares de pacientes con mala calidad de vida presentan diferencias en las variables clínicas de personalidad y relaciones familiares en función de que el paciente haya estado o no ingresado en una Unidad de Cuidados Intensivos. Seleccionamos dos grupos: 29 familiares de pacientes traumatizados graves transcurridos cuatro años de su ingreso en una UCI de Traumatología y con mala calidad de vida (debido a secuelas físicas y/o psicológicas tras el ingreso, tales como traumatismos craneoencefálicos, politraumatismos y tetraplejias traumáticas y 32 familiares de pacientes con mala calidad de vida con cuatro años de evolución de su enfermedad física (hipertensión, diabetes, artritis reumatoide y síndrome de intestino irritable que no han estado ingresados en la UCI. Para alcanzar nuestro objetivo empleamos una Encuesta Psicosocial y los siguientes instrumentos: Cuestionario de Análisis Clínico, Escala de Clima Social en la Familia y Escala de Adaptación Psicosocial de la Enfermedad. Los resultados mostraron que los familiares de pacientes con mala calidad de vida que estuvieron ingresados en la UCI hace cuatro años, presentan diferencias significativas en las variables agitación y expresividad comparados con los familiares de pacientes con mala calidad de vida que no han estado ingresados en la UCI.

  9. Evaluation of the anti-Listeria potentials of some plant-derived triterpenes.

    Science.gov (United States)

    Penduka, Dambudzo; Mosa, Rebamang; Simelane, Mthokozisi; Basson, Albert; Okoh, Anthony; Opoku, Andy

    2014-07-23

    Listeriosis is a fatal disease caused by pathogenic Listeria bacteria and it is most prevalent in immune-compromised individuals. The increase in numbers of immune-compromised individuals against a background of Listeria antibiotic resistance, limits listeriosis treatment options. This therefore calls for research into substitute treatments, of which, medicinal plants derived compounds offer a viable alternative. The broth microdilution assay was used to determine the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of three plant triterpenes namely 3β-hydroxylanosta-9,24-dien-21-oic acid, methyl-3β-hydroxylanosta-9,24-dien-21-oate and 3β-acetylursolic acid, against Listeria monocytogenes, Listeria ivanovii and Listeria grayi species. The chequerboard method was used to assess the interactions between the triterpenes and conventional antibiotics: ampicillin, neomycin, gentamicin and penicillin G. The lactate dehydrogenase membrane damage method was used to assess the triterpenes' membrane damaging potentials against the Listeria bacteria. The triterpenes' MIC values were found to range from 0.185 to 1.67 mg/ml while, the MBC determination assay results revealed that the test triterpenes were bacteriostatic against the Listeria bacteria. The interactions involving 3β-hydroxylanosta-9,24-dien-21-oic acid were mainly additive with ampicillin and synergistic with neomycin, gentamicin and penicillin G. The interactions involving methyl-3β-hydroxylanosta-9,24-dien-21-oate were mainly antagonistic with ampicillin, indifferent with neomycin, ranging from synergistic to indifference with gentamicin and synergistic with penicillin G. The interactions involving 3β-acetylursolic acid were mainly indifferent with ampicillin, synergistic with neomycin and gentamicin while ranging between synergistic and additive with penicillin G. The low levels of cytosolic lactate dehydrogenase released from the cells treated with 4× MIC concentration

  10. [Listeria monocytogenes in women of reproductive age].

    Science.gov (United States)

    Aljicević, Mufida; Beslagić, Edina; Zvizdić, Sukrija; Hamzić, Sadeta; Mahmutović, Sabina

    2005-01-01

    Listeria monocytogenes (LM) is gram-positive bacteria linear shaped which grows good also at refrigerator temperature (4 degrees C). The bacteria is resistant on high and low temperatures. This bacteria can be found in the dirt, rotted vegetation, vegetables and fruit, milk and dairy products, and also in the meat and processed meat. This bacteria cause disease called Listeriosis. This bacteria attacks at first people with weak immune system like infants, pregnant women, people with chronic diseases, people with HIV and people who are 60 and over. Pregnant women can transfer Listeria through the placenta, from mother to child and that can cause premature delivery, premature birth, early rupture of placenta or still born. Find out if there is serological respond by female patients in the reproductive age who had spontaneous abortion and female patients in the reproductive age who never had the spontaneous abortion. By agglutination serologic method it had been researched if there is any antibody on Listeria monocytogenes. Two groups were included in testing: experimental and control group with a total of 60 patients. In experimental group there were 18 (60%) positive samples. In control group there were 8 (26.70%) positive samples. The results investigations have shown that there is serological respond to Listeria monocytogenes in the women of reproductive age. The number of positive patients was greater in women who had spontaneous abortion compared to women who never had the spontaneous abortion.

  11. Prevalence, antimicrobial resistance profiles of Listeria ...

    African Journals Online (AJOL)

    Listeria monocytogenes is known to cause epidemic and sporadic cases of listeriosis. The present study investigated the occurrence, antibiograms and molecular serotypes of the organism in various retail outlets in Gaborone, Botswana. Food samples were obtained randomly from selected supermarkets and street vendors ...

  12. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  13. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    Both in Europe and worldwide cheese has caused important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...

  14. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...

  15. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  16. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  17. Molecular serotype and evolutionary lineage of Listeria ...

    African Journals Online (AJOL)

    The molecular serotypes and the evolutionary lineage of Listeria monocytogenes isolated from various foods in Nigeria are yet to be documented. Consequently, popular uncooked food items known locally as Okazi Utazi, Onugbu, Ogbono, Garri and Egusi obtained from plants botanically known as Gnetum africanum, ...

  18. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. A Sheep in Wolf's Clothing: Listeria innocua Strains with Teichoic Acid-Associated Surface Antigens and Genes Characteristic of Listeria monocytogenes Serogroup 4

    Science.gov (United States)

    Lan, Zheng; Fiedler, Franz; Kathariou, Sophia

    2000-01-01

    Listeria monocytogenes serotype 4b has been implicated in numerous food-borne epidemics and in a substantial fraction of sporadic listeriosis. A unique lineage of the nonpathogenic species Listeria innocua was found to express teichoic acid-associated surface antigens that were otherwise expressed only by L. monocytogenes of serotype 4b and the rare serotypes 4d and 4e. These L. innocua strains were also found to harbor sequences homologous to the gene gtcA, which has been shown to be essential for teichoic acid glycosylation in L. monocytogenes serotype 4b. Transposon mutagenesis and genetic studies revealed that the gtcA gene identified in this lineage of L. innocua was functional in serotype 4b-like glycosylation of the teichoic acids of these organisms. The genomic organization of the gtcA region was conserved between this lineage of L. innocua and L. monocytogenes serotype 4b. Our data are in agreement with the hypothesis that, in this lineage of L. innocua, gtcA was acquired by lateral transfer from L. monocytogenes serogroup 4. The high degree of nucleotide sequence conservation in the gtcA sequences suggests that such transfer was relatively recent. Transfer events of this type may alter the surface antigenic properties of L. innocua and may eventually lead to evolution of novel pathogenic lineages through additional acquisition of genes from virulent listeriae. PMID:11029438

  20. Hablar del sentido de la vida

    OpenAIRE

    Jean Grondin

    2012-01-01

    La pregunta por la vida, es un preguntar por y desde el sentido de lo que es y porta la vida. Interesa destacar la pregunta socrática o filosófica por el "sentido de la vida", en términos de existencia y realidad. La existencia del sentido la porta la vida; sin embargo, la dirección, la reflexión, la significación y, sobre todo, el sentir el sentido, es la tarea humana que le toca realizar a quien se pregunta por el thelos de la vida, su fin o finalidad. La naturaleza del mundo es lingüística...

  1. Use of a novel medium, the Polymyxin Ceftazidime Oxford Medium, for isolation of Listeria monocytogenes from raw or non-pasteurized foods.

    Science.gov (United States)

    Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A

    2016-05-01

    Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. New Aspects Regarding Evolution and Virulence of Listeria monocytogenes Revealed by Comparative Genomics and DNA Arrays

    Science.gov (United States)

    Doumith, Michel; Cazalet, Christel; Simoes, Natalie; Frangeul, Lionel; Jacquet, Christine; Kunst, Frank; Martin, Paul; Cossart, Pascale; Glaser, Philippe; Buchrieser, Carmen

    2004-01-01

    Listeria monocytogenes is a food-borne bacterial pathogen that causes a wide spectrum of diseases, such as meningitis, septicemia, abortion, and gastroenteritis, in humans and animals. Among the 13 L. monocytogenes serovars described, invasive disease is mostly associated with serovar 4b strains. To investigate the genetic diversity of L. monocytogenes strains with different virulence potentials, we partially sequenced an epidemic serovar 4b strain and compared it with the complete sequence of the nonepidemic L. monocytogenes EGDe serovar 1/2a strain. We identified an unexpected genetic divergence between the two strains, as about 8% of the sequences were serovar 4b specific. These sequences included seven genes coding for surface proteins, two of which belong to the internalin family, and three genes coding for transcriptional regulators, all of which might be important in different steps of the infectious process. Based on the sequence information, we then characterized the gene content of 113 Listeria strains by using a newly designed Listeria array containing the “flexible” part of the sequenced Listeria genomes. Hybridization results showed that all of the previously identified virulence factors of L. monocytogenes were present in the 93 L. monocytogenes strains tested. However, distinct patterns of the presence or absence of other genes were identified among the different L. monocytogenes serovars and Listeria species. These results allow new insights into the evolution of L. monocytogenes, suggesting that early divergence of the ancestral L. monocytogenes serovar 1/2c strains from the serovar 1/2b strains led to two major phylogenetic lineages, one of them including the serogroup 4 strains, which branched off the serovar 1/2b ancestral lineage, leading (mostly by gene loss) to the species Listeria innocua. The identification of 30 L. monocytogenes-specific and several serovar-specific marker genes, such as three L. monocytogenes serovar 4b

  3. Listeria Monocytogenes: a rare cause of endophthalmitis, a case report

    National Research Council Canada - National Science Library

    Katherine M. Gaskell; Gwyn Williams; Kathie Grant; Susan Lightman; Gauri Godbole

    2017-01-01

    Listeria monocytogenes is a known cause of gastroenteritis. Invasive disease can follow bacteremia causing meningoencephalitis, endocarditis and spontaneous miscarriages in immunocompromised patients and pregnant women respectively...

  4. Characterization of Listeria monocytogenes and Listeria innocua from a vegetable processing plant by RAPD and REA.

    Science.gov (United States)

    Aguado, V; Vitas, A I; García-Jalón, I

    2004-02-01

    The incidence of Listeria monocytogenes in a vegetable processing plant was investigated over a 23-month period. Frozen ready-to-eat vegetable samples, well as the plant environment, were sampled. The molecular subtyping techniques, Random Amplified Polymorphic DNA (RAPD) and Restriction Endonuclease Analyses (REA), were performed to help investigate the origin and routes of Listeria dissemination. The low and sporadic incidence of L. monocytogenes made it impossible to establish an epidemiological sequence in the processing plant, though a case of cross-contamination between tomato and ratatouille was detected. Listeria innocua subtyping, however, allowed us to determine the prevalence of several strains in vegetables, and their presence on machinery samples suggested the possibility of cross-contamination during processing. The low incidence of L. monocytogenes indicated that the risk of listeriosis transmission by vegetable consumption is low. On the other hand, the isolation of the same strain of L. innocua in several surveys pointed out the risk of colonisation on surfaces and machinery. The persistence of Listeria spp. is a cause for concern as can lead to future contamination of vegetables processed in the plant and to a possible increased risk for health. Therefore, periodic controls for the presence of Listeria spp. and a further review of the cleaning and disinfection procedures used in frozen vegetable plants are recommended.

  5. Molecular pathogenesis of Listeria monocytogenes in the alternative model host Galleria mellonella.

    Science.gov (United States)

    Joyce, Susan A; Gahan, Cormac G M

    2010-11-01

    Larvae of Galleria mellonella, the greater wax moth, provide an alternative infection model for many human pathogens as they are amenable to use at elevated incubation temperatures (37 °C). This study and a parallel study by Mukherjee et al. [Mukherjee, K., Altincicek, B., Hain, T., Domann, E., Vilcinskas, A. & Chakraborty, T. (2010). Appl Environ Microbiol 76, 310-317] establish this insect host as an appropriate model to investigate the pathogenesis of Listeria species. In this study we show that inoculation with Listeria monocytogenes initiates a dynamic infection in G. mellonella and that production of the cytolysin listeriolysin O (LLO) is necessary for toxicity and bacterial growth. Production of LLO by the non-pathogenic species Lactococcus lactis is sufficient to induce mortality in the insect model. We employed real-time bioluminescence imaging to examine the dynamics of listerial growth and virulence gene expression in the G. mellonella model. Analysis of lux promoter fusions demonstrated significant induction of virulence gene expression upon introduction of the pathogen into insects at both 30 and 37 °C. The host response to listerial infection was examined which demonstrated that haemocyte destruction accompanies L. monocytogenes pathogenesis and is preceded by activation of the phenoloxidase system. Furthermore, we demonstrate that Listeria innocua is pathogenic to G. mellonella through a persistence mechanism that implicates an alternative mechanism for pathogenicity in this model.

  6. An approach towards public health and foodborne human listeriosis--the Austrian Listeria monitoring.

    Science.gov (United States)

    Asperger, H; Wagner, M; Brandl, E

    2001-01-01

    The Institute for Milk Hygiene, Milk Technology and Food Science has launched a Listeria monitoring for Austrian cheese factories in 1988 which is nowadays a valuable tool to control the safety of cheese production. It is a means to qualify the proper hygienic conditions in the participating cheese plants. Proper hygiene protects cheese plants from getting contaminated by L. monocytogenes. The preventive elimination of foodborne pathogens facilitates a thriving economical development of the domestic cheese industry as contamination by L. monocytogenes may lead to a stop of delivery, product recall and other costly measures. This report comprehensively describes the principle of the monitoring including a description of the microbiological and molecular tools. It summarizes data on the detection frequency of Listeria contamination with respect to the different matrices under investigation. Furthermore an overview is given on the course of 17 contamination periods in 10 cheese plants and the outcome of the decontamination endeavours is described. Apart from epidemiological investigations, this report summarizes data regarding molecular species confirmation in the genus Listeria as the species assignment was comparatively examined by both conventional microbiology and molecular tools. Genotyping by Pulsed Field Gel Electrophoresis was applied in three plants which were confronted with a long term contamination period. The data presented in this paper rely on results which were collected through a decade of investigation (1990-2000).

  7. Listeria spp. in Street-Vended Ready-to-Eat Foods

    Directory of Open Access Journals (Sweden)

    Moustafa El-Shenawy

    2011-01-01

    Full Text Available Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin. Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food.

  8. Ocorrência de Listeria monocytogenes em queijo artesanal tipo coalho comercializado na cidade de Manaus-AM, Brasil Occurrence of Listeria monocytogenes in handmade type cheese coagulum marketed in the city of Manaus-Amazonas, Brazil

    Directory of Open Access Journals (Sweden)

    Simone de Nazaré Melo Ramos

    2003-12-01

    Full Text Available A ocorrência de Listeria sp. em queijo artesanal tipo coalho comercializado na cidade de Manaus foi estudada. No período de março a maio de 1998 foram coletadas 58 amostras do produto em feiras e mercados localizados em seis zonas da cidade de Manaus. Em duas amostras de queijo foram identificadas duas espécies de Listeria: L. monocytogenes e L. innocua. A primeira espécie é reconhecidamente patogênica para o ser humano. Os resultados apresentados demonstraram haver risco de transmissão de enfermidades pelo consumo de queijos processados sem os devidos cuidados de higiene.The occurrence of Listeria sp. in cheese craft type coagulum marketed in the city of Manaus was studied. In the period of March to May of 1998 58 samples of the product were collected at fairs and located markets in six areas of the city. In two cheese samples we identified two species of Listeria: L. monocytogenes and L. innocua. The first species was found fobe pathogenic for the human being. The results demonstrated there to be risk of transmission of illnesses from the consumption of cheeses processed without the due hygiene care.

  9. [Presence of total coliforms, Escherichia coli and Listeria sp. in enteral formulas].

    Science.gov (United States)

    Arias, M L; Monge, R; Rodríguez, J

    1998-03-01

    The presence of total coliforms, Escherichia coli and Listeria sp. was evaluated in 65 samples of enteral nutrition formulas. In more than the 75% of the samples made up from cooked vegetables, fruits or meat broth, the score level of total coliforms was of 10(4) UFC/g. In 12-31% of the different enteral food formula, E. coli was isolated in levels ranging form 3.0 x 10(2) to 2.1 x 10(4) UFC/g. Enteral nutrition formulas made out of fruits and those elaborated with meal broth presented this agent more frequently and in bigger quantities. Listeria sp. was isolated in 17% of the fruit preparations and in enteral formulas made with milk. L. grayi, L welshimeri and L. innocua were the species found.

  10. A PNPase Dependent CRISPR System in Listeria

    Science.gov (United States)

    Sesto, Nina; Touchon, Marie; Andrade, José Marques; Kondo, Jiro; Rocha, Eduardo P. C.; Arraiano, Cecilia Maria; Archambaud, Cristel; Westhof, Éric; Romby, Pascale; Cossart, Pascale

    2014-01-01

    The human bacterial pathogen Listeria monocytogenes is emerging as a model organism to study RNA-mediated regulation in pathogenic bacteria. A class of non-coding RNAs called CRISPRs (clustered regularly interspaced short palindromic repeats) has been described to confer bacterial resistance against invading bacteriophages and conjugative plasmids. CRISPR function relies on the activity of CRISPR associated (cas) genes that encode a large family of proteins with nuclease or helicase activities and DNA and RNA binding domains. Here, we characterized a CRISPR element (RliB) that is expressed and processed in the L. monocytogenes strain EGD-e, which is completely devoid of cas genes. Structural probing revealed that RliB has an unexpected secondary structure comprising basepair interactions between the repeats and the adjacent spacers in place of canonical hairpins formed by the palindromic repeats. Moreover, in contrast to other CRISPR-Cas systems identified in Listeria, RliB-CRISPR is ubiquitously present among Listeria genomes at the same genomic locus and is never associated with the cas genes. We showed that RliB-CRISPR is a substrate for the endogenously encoded polynucleotide phosphorylase (PNPase) enzyme. The spacers of the different Listeria RliB-CRISPRs share many sequences with temperate and virulent phages. Furthermore, we show that a cas-less RliB-CRISPR lowers the acquisition frequency of a plasmid carrying the matching protospacer, provided that trans encoded cas genes of a second CRISPR-Cas system are present in the genome. Importantly, we show that PNPase is required for RliB-CRISPR mediated DNA interference. Altogether, our data reveal a yet undescribed CRISPR system whose both processing and activity depend on PNPase, highlighting a new and unexpected function for PNPase in “CRISPRology”. PMID:24415952

  11. Diferencias en las historias de vida de dos especies de isópodos bopíridos (Isopoda: Epicaridea que parasitan al nape Neotrypaea uncinata (Milne-Edwards, 1837 (Decapoda: Thalassinidea Different life histories of two species of bopyrid isopods (Isopoda, Epicaridea, parasites of the ghost shrimp Neotrypaea uncinata (H. Milne Edwards, 1837 (Decapoda: Thalassinidea

    Directory of Open Access Journals (Sweden)

    GABRIELA MUÑOZ

    2001-12-01

    Full Text Available En ambientes costeros de Concepción, Chile, se han registrado dos especies de isópodos, Ione ovata Shiino, 1964 e Ionella agassizi Bonnier, 1900, parásitos en las cámaras branquiales del nape Neotrypaea uncinata (H. Milne Edwards, 1837. La prevalencia de parasitismo sin embargo, es mucho menor en Ione ovata quien además presenta menor frecuencia de parejas cohabitando una misma branquia, aunque posee una especificidad comparativamente menor que I. agassizi. Esto sugiere que ambas especies poseen historias de vida contrastantes. Para mejorar el entendimiento de las causas de estas diferencias, en este estudio se analizan y comparan algunos rasgos de la historia de vida de los isópodos (fecundidad, tamaño de los huevos, inversión reproductiva, y capacidad de los machos para colonizar napes no parasitados. Ione agassizi tuvo una menor fecundidad, y huevos de mayor tamaño que I. ovata. Sin embargo, no hubo diferencias en la inversión reproductiva entre ambas especies, ni en su relación con el tamaño corporal del isópodo. Los machos de I. ovata poseen mayor habilidad que los de I. agassizi para colonizar nuevos napes no parasitados, ya que pudieron permanecer en nuevos hospedadores y rediferenciarse sexualmente en hembras. Se considera que sería necesario estimar la sobrevivencia durante el tiempo total de vida de estos parásitos para mejorar la interpretación de estos resultadosOn coastal habitats near Concepción city, Chile, there are two isopod species Ione ovata Shiino, 1964, and Ionella agassizi Bonnier, 1900 both occupying the gill chambers of the ghost shrimp Neotrypaea uncinata (H. Milne Edwards, 1837. However, in I. ovata, the prevalence is smaller, there is a low frequency of coupled isopods in the same gill chamber, and is less host specific than I. agassizi. These observations suggest that both isopod species have different life histories. To improve the understanding of the causes of these differences some life history

  12. ISG15 counteracts Listeria monocytogenes infection

    Science.gov (United States)

    Radoshevich, Lilliana; Impens, Francis; Ribet, David; Quereda, Juan J; Nam Tham, To; Nahori, Marie-Anne; Bierne, Hélène; Dussurget, Olivier; Pizarro-Cerdá, Javier; Knobeloch, Klaus-Peter; Cossart, Pascale

    2015-01-01

    ISG15 is an interferon-stimulated, linear di-ubiquitin-like protein, with anti-viral activity. The role of ISG15 during bacterial infection remains elusive. We show that ISG15 expression in nonphagocytic cells is dramatically induced upon Listeria infection. Surprisingly this induction can be type I interferon independent and depends on the cytosolic surveillance pathway, which senses bacterial DNA and signals through STING, TBK1, IRF3 and IRF7. Most importantly, we observed that ISG15 expression restricts Listeria infection in vitro and in vivo. We made use of stable isotope labeling in tissue culture (SILAC) to identify ISGylated proteins that could be responsible for the protective effect. Strikingly, infection or overexpression of ISG15 leads to ISGylation of ER and Golgi proteins, which correlates with increased secretion of cytokines known to counteract infection. Together, our data reveal a previously uncharacterized ISG15-dependent restriction of Listeria infection, reinforcing the view that ISG15 is a key component of the innate immune response. DOI: http://dx.doi.org/10.7554/eLife.06848.001 PMID:26259872

  13. Photodynamic Inactivation of Food Pathogen Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Irina Buchovec

    2010-01-01

    Full Text Available The aim of this study is to examine the possibility to inactivate food pathogen Listeria monocytogenes by nonthermal antimicrobial treatment – photosensitization. L. monocytogenes was incubated with 5-aminolevulinic acid (ALA (7.5 mM for 0–2 h to produce endogenous photosensitizers and then illuminated with visible light. The LED-based light source used for the illumination of L. monocytogenes emitted light at λ=400 nm with energy density of 20 mW/cm2. The illumination time varied from 0 to 20 min, and a total energy dose reached 0–24 J/cm2. The obtained results reveal that L. monocytogenes can effectively produce endogenous porphyrins after incubation with 7.5 mM ALA. Subsequent illumination of cells with visible light significantly decreased their viability in vitro (4 log. After adhesion of Listeria to the surface of packaging material and following photosensitization, the surface-attached bacterial population was inactivated by 3.7 log. In addition, most resistant Listeria biofilms are susceptible to this treatment. Their inactivation reached 3.1 log under certain experimental conditions. The cells and biofilms of Gram-positive bacteria L. monocytogenes ATCL3C 7644 could be effectively inactivated by ALA-based photosensitization in the solution as well as adhered onto the surface of packaging material in a nonthermal way.

  14. "Vidas secas": a (hyperintertextual reading

    Directory of Open Access Journals (Sweden)

    Giselda Maria Dutra Bandoli

    2016-04-01

    Full Text Available This work conducts a reflection on the notions of hypertext from a few updated views of Vidas Secas by Graciliano Ramos. Our purpose is to carry out the reading of an art object, dissociating hypertext from the idea of a device enabled only by electronic media. Thus, we show that hypertext is also manifested in printed texts, and postulate that literary language can be a manifestation of hypertextuality. Finally, we perform an intertextual reading of the book, seeking to highlight the dialogue between this and other works by representative Brazilian authors.

  15. Vida artificial, el nuevo paradigma

    Directory of Open Access Journals (Sweden)

    José Jesús Martínez Páez

    1998-05-01

    Full Text Available Se presenta una síntesis cronológica de los hechos más importantes en el desarrollo teórico y de simulación computacional, que han llevado a la formación de un nuevo paradigma que se conoce como vida artificial; se analizan sus características y sus príncipales líneas de investigación. Finalmente, se hace una descripción de su trabajo en la Universidad Nacional.

  16. Estilo de vida en gastritis

    OpenAIRE

    María Paola Yumbay Yallica; Freddy Bayardo Iza Anguisaca; Tatiana Rivera

    2017-01-01

    Objetivo: Determinar como los estilos de vida inciden en la gastritis de los estudiantes de Segundo Semestre de Enfermería de la Facultad Ciencias de la Salud de la Universidad Técnica de Ambato. Material y métodos: El estudio es no experimental con un diseño descriptivo de corte transversal, se relacionan con las variables involucradas, además es de corta duración en un periodo corto de tiempo, el instrumento utilizado fueron dos encuestas a treinta personas, la primera encuesta sobre la var...

  17. Vida artificial, el nuevo paradigma

    OpenAIRE

    José Jesús Martínez Páez

    2011-01-01

    Se presenta una síntesis cronológica de los hechos más importantes en el desarrollo teórico y de simulación computacional, que han llevado a la formación de un nuevo paradigma que se conoce como vida artificial; se analizan sus características y sus príncipales líneas de investigación. Finalmente, se hace una descripción de su trabajo en laUniversidad Nacional.

  18. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

  19. application à une population de Listeria monocytogenes CIP 7831 ...

    African Journals Online (AJOL)

    Etude de l'impact de la variation de la température sur les activités microbiennes : application à une population de Listeria monocytogenes CIP 7831, Listeria monocytogenes Scott A CIP 103575 et Escherichia coli ATCC 25922.

  20. Listeria Occurrence in Poultry Flocks: Detection and Potential Implications

    Science.gov (United States)

    Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli, and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes, possesses a high mortality rate (approximately20%) and is considered one of the m...

  1. Occurrence of listeria monocytogenes in bulked raw milk and ...

    African Journals Online (AJOL)

    fermented dairy product sold at most informal milk cooling points in Uganda, were assessed for occurrence of Listeria spp. and Listeria monocytogenes. Total plate counts (TPC), holding temperature, pH and titratable acidity were also determined in all the milk products at the point of collection using standard methods.

  2. Cerebrospinal fluid inflammatory markers in patients with Listeria monocytogenes meningitis

    NARCIS (Netherlands)

    Koopmans, Merel M.; Brouwer, Matthijs C.; Geldhoff, Madelijn; Seron, Mercedes Valls; Houben, Judith; van der Ende, Arie; van de Beek, Diederik

    2014-01-01

    Listeria monocytogenes meningitis is the third most common cause of bacterial meningitis and is associated with high rates of mortality and unfavorable outcome. We analyzed 101 cytokines, chemokines and complement factors in CSF of adult patients with Listeria meningitis included in a prospective

  3. Antibiotic resistant pattern of environmental isolates of Listeria ...

    African Journals Online (AJOL)

    SERVER

    2007-09-19

    Sep 19, 2007 ... Incidence of Listeria monocytogenes in cow manure, agricultural soil, and common vegetables sold in major markets in ... Key words: Listeria monocytogenes, vegetable, cow dung, antibiotic resistance, environmental isolates. ... and authenticated in the Herbarium Unit of the Department of Plant. Science ...

  4. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...

  5. Leaf life span and nitrogen content in semideciduous forest tree species (Croton priscus and Hymenaea courbaril Duração da vida da folha e conteúdo de nitrogênio em espécies arbóreas (Croton priscus e Hymenaea courbaril de floresta semidecídua

    Directory of Open Access Journals (Sweden)

    Claudia Regina Baptista Haddad

    2004-01-01

    Full Text Available In comparison to deciduous species, evergreen plants have lower leaf nutrient contents and higher leaf life span, important mechanisms for nutrient economy, allowing the colonization of low fertility soils. Strategies to conserve nitrogen in two semideciduous tropical forest tree species, with different leaf life spans were analyzed. The hypothesis was the fact that the two species would present different nitrogen conservation mechanisms in relation to chemical (total nitrogen, protein, chlorophyll, and proteolytic activity, functional (leaf life span, N-use efficiency, and N-resorption efficiency, morphological (specific leaf mass leaf characteristics, and total nitrogen in the soil. Hymenaea courbaril L. presented lower nitrogen compounds in leaves, longer leaf life span, higher N-use efficiency, and higher specific leaf mass, while absorbing proportionally less nitrogen from the soil than Croton priscus Croizat. These characteristics can contribute for a better nitrogen economy strategy of H. courbaril. No relationship was found between leaf life span and N resorption efficiency, nor between leaf life span, protease activity and nitrogen mobilization. The electrophoretic profiles of proteolytic enzymes in young leaves of the two species presented more bands with enzymatic activity than other kinds of leaves.Comparadas a espécies decíduas, as sempre-verdes têm menos nutrientes nas folhas, que também são mais longevas. Estes mecanismos são importantes para economia de nutrientes, e permitem a colonização de solos com baixa fertilidade. Foram analisadas estratégias de conservação de nitrogênio em duas espécies de floresta semidecídua, que aparentemente apresentavam longevidades foliares diferentes. Para isto foram comparados mecanismos químicos (concentrações de nitrogênio total, de proteína e clorofila e atividade proteolítica, funcionais (duração de vida das folhas, eficiência do uso de nitrogênio e eficiência de

  6. Listeria monocytogenes behaviour in presence of non-UV-irradiated titanium dioxide nanoparticles.

    Directory of Open Access Journals (Sweden)

    Maria Grazia Ammendolia

    Full Text Available Listeria monocytogenes is the agent of listeriosis, a food-borne disease. It represents a serious problem for the food industry because of its environmental persistence mainly due to its ability to form biofilm on a variety of surfaces. Microrganisms attached on the surfaces are a potential source of contamination for environment and animals and humans. Titanium dioxide nanoparticles (TiO2 NPs are used in food industry in a variety of products and it was reported that daily exposure to these nanomaterials is very high. Anti-listerial activity of TiO2 NPs was investigated only with UV-irradiated nanomaterials, based on generation of reactive oxigen species (ROS with antibacterial effect after UV exposure. Since both Listeria monocytogenes and TiO2 NPs are veicolated with foods, this study explores the interaction between Listeria monocytogenes and non UV-irradiated TiO2 NPs, with special focus on biofilm formation and intestinal cell interaction. Scanning electron microscopy and quantitative measurements of biofilm mass indicate that NPs influence both production and structural architecture of listerial biofilm. Moreover, TiO2 NPs show to interfere with bacterial interaction to intestinal cells. Increased biofilm production due to TiO2 NPs exposure may favour bacterial survival in environment and its transmission to animal and human hosts.

  7. Effect of Ozone Treatment on Inactivation of Escherichia coli and Listeria sp. on Spinach

    Directory of Open Access Journals (Sweden)

    Shreya Wani

    2015-03-01

    Full Text Available The efficacy of “gaseous” ozone in reducing numbers and re-growth of food-borne pathogens, (Escherichia coli and Listeria spp., on leafy salads was investigated using spinach. A preliminary in vivo study showed 1-log reduction in six strains of E. coli and two species of Listeria spp. on spinach exposed to 1 ppm ozone for 10 min. A range of ozone treatments were explored to deliver optimal bacterial inactivation while maintaining the visual appearance (color of produce. Exposure to a higher ozone concentration for a shorter duration (10 ppm for 2 min significantly reduced E. coli and Listeria spp. viable counts by 1-log and the pathogens did not re-grow following treatment (over a nine-day storage period. Impacts of 1 and 10 ppm ozone treatments were not significantly different. Approximately 10% of the pathogen population was resistant to ozone treatment. We hypothesized that cell age may be one of several factors responsible for variation in ozone resistance. E. coli cells from older colonies demonstrated higher ozone resistance in subsequent experiments. Overall, we speculate that gaseous ozone treatment constitutes the basis for an alternative customer-friendly method to reduce food pathogen contamination of leafy produce and is worth exploring on a pilot-scale in an industrial setting.

  8. Prevalence of food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran.

    Science.gov (United States)

    Akya, A; Najafi, A; Moradi, J; Mohebi, Z; Adabagher, S

    2013-05-01

    Listeria monocytogenes is a human pathogen causing serious diseases. We aimed to determine food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Samples (185 dairy, 187 meat products and 158 ready-to-eat foods such as salads) were randomly collected from markets. After processing, samples were cultured in half-Fraser and Fraser broth followed by cultivation on PALCAM and Oxford media. Confirmatory tests including carbohydrate utilization were performed on isolates to determine species. Bacteria were isolated from 66/530 samples (12.5%). Meat products showed the highest (27.2%) and dairy products the lowest (3.8%) contamination rates. L. innocua was found in 56 (10.6%) samples, but L. monocytogenes was only found in 3 samples (0.6%). The results indicate that the rate of contamination with L. monocytogenes, even for ready-to-eat foods, was low but for other Listeria spp., in particular strains of L. innocua, the rate of contamination was higher, suggesting that more control on food sanitation is required.

  9. Effects of Dielectrophoresis on Growth, Viability and Immuno-reactivity of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Bhunia Arun K

    2008-04-01

    Full Text Available Abstract Dielectrophoresis (DEP has been regarded as a useful tool for manipulating biological cells prior to the detection of cells. Since DEP uses high AC electrical fields, it is important to examine whether these electrical fields in any way damage cells or affect their characteristics in subsequent analytical procedures. In this study, we investigated the effects of DEP manipulation on the characteristics of Listeria monocytogenes cells, including the immuno-reactivity to several Listeria-specific antibodies, the cell growth profile in liquid medium, and the cell viability on selective agar plates. It was found that a 1-h DEP treatment increased the cell immuno-reactivity to the commercial Listeria species-specific polyclonal antibodies (from KPL by ~31.8% and to the C11E9 monoclonal antibodies by ~82.9%, whereas no significant changes were observed with either anti-InlB or anti-ActA antibodies. A 1-h DEP treatment did not cause any change in the growth profile of Listeria in the low conductive growth medium (LCGM; however, prolonged treatments (4 h or greater caused significant delays in cell growth. The results of plating methods showed that a 4-h DEP treatment (5 MHz, 20 Vpp reduced the viable cell numbers by 56.8–89.7 %. These results indicated that DEP manipulation may or may not affect the final detection signal in immuno-based detection depending on the type of antigen-antibody reaction involved. However, prolonged DEP treatment for manipulating bacterial cells could produce negative effects on the cell detection by growth-based methods. Careful selection of DEP operation conditions could avoid or minimize negative effects on subsequent cell detection performance.

  10. Listeria spp. and Listeria monocytogenes contamination in ready-to-eat sandwiches collected from vending machines

    Directory of Open Access Journals (Sweden)

    Francesca Cossu

    2016-05-01

    Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  11. Quantitative Detection of Listeria monocytogenes and Listeria innocua by Real-Time PCR: Assessment of hly, iap, and lin02483 Targets and AmpliFluor Technology

    Science.gov (United States)

    Rodríguez-Lázaro, David; Hernández, Marta; Scortti, Mariela; Esteve, Teresa; Vázquez-Boland, José A.; Pla, Maria

    2004-01-01

    We developed and assessed real-time PCR (RTi-PCR) assays for the detection and quantification of the food-borne pathogen Listeria monocytogenes and the closely related nonpathogenic species L. innocua. The target genes were hly and iap for L. monocytogenes and lin02483 for L. innocua. The assays were 100% specific, as determined with 100 Listeria strains and 45 non-Listeria strains, and highly sensitive, with detection limits of one target molecule in 11 to 56% of the reactions with purified DNA and 3 CFU in 56 to 89% of the reactions with bacterial suspensions. Quantification was possible over a 5-log dynamic range, with a limit of 15 target molecules and R2 values of >0.996. There was an excellent correspondence between the predicted and the actual numbers of CFU in the samples (deviations of <23%). The hly-based assay accurately quantified L. monocytogenes in all of the samples tested. The iap-based assay, in contrast, was unsuitable for quantification purposes, underestimating the bacterial counts by 3 to 4 log units in a significant proportion of the samples due to serovar-related target sequence variability. The combination of the two assays enabled us to classify L. monocytogenes isolates into one of the two major phylogenetic divisions of the species, I and II. We also assessed the new AmpliFluor technology for the quantitative detection of L. monocytogenes by RTi-PCR. The performance of this system was similar to that of the TaqMan system, although the former system was slightly less sensitive (detection limit of 15 molecules in 45% of the reactions) and had a higher quantification limit (60 molecules). PMID:15006755

  12. Forældreinddragelse i Vida

    DEFF Research Database (Denmark)

    Berliner, Peter; Kousholt, Dorte

    2012-01-01

    I VIDA-projektet indgår forældreinddragelse og -samarbejde som en betydningsfuld del. I undersøgelsen af VIDA-projektet er der foretaget interview med ledere i de deltagende institutioner. I dette kapitel behandles de dele af interviewene, der omhandler, hvordan lederne forstår betydningen af...

  13. Vida cotidiana y trasnformaciones silenciosas

    OpenAIRE

    Godall, Teresa

    2014-01-01

    Este artículo pone en cuestión la concepción clásica de educación cotidiana en educación infantil, basada todavía en actividades colectivas como eje vertebrador de la vida del grupo y especialmente en la enseñanza-aprendizaje de hábitos donde se valora sobre todo que el niño lo haga todo solo en vez de velar especialmente por las necesidades y los intereses individuales, dando valor a la palabra cuidado y a la relación entre adulto y niño o entre adulto y un pequeño grupo de niños y niñas en ...

  14. O consumo na vida digital

    Directory of Open Access Journals (Sweden)

    Iuri Yudi Furukita Baptista

    2016-02-01

    Full Text Available O modelo de consumo não possui as mesmas características sempre: suas relações, motivações, formatos, espaços, interesses e atividades são construções sociais que se modificam atreladas ao cenário econômico, político e tecnológico. O presente trabalho repassa o surgimento da sociedade do consumidor para então conjecturar sobre as propriedades distintivas do consumo na vida digital. O que se defende ao final é que o consumidor já não se restringe ao papel de consumir.

  15. Escrituras de la vida cotidiana

    Directory of Open Access Journals (Sweden)

    Federico Baeza

    2012-07-01

    Full Text Available Diversas producciones en las artes visuales y performáticas de la última década, se han puesto como objetivo la constitución de estrategias escriturales,en tanto transcripción y, más precisamente, configuración de experiencias extraídas de la vida de todos los días. Las narraciones alrededor de distintos núcleos del ámbito de la cotidianidad, como la cocina, la conversación o el habitar, entre otros tópicos ya señalados por Michel de Certeau1, aparecen en el centro de estas operaciones que recorren el eje entre la historia reciente como episodio colectivo y la singularidad de las historias de vida volviendo a reivindicar lo personal como político. Dichas operaciones artísticas, que funcionan como ready-mades de experiencias personales, precisan de estrategias de transcripción de las textualidades de la vida cotidiana que incluyen narraciones biográficas, recuerdos, particulares usos de los objetos, entre otras prácticas de las “artes del hacer” cotidiano. Abordaremos estas operaciones escriturarias desde la selección de obras de tres artistas argentinos contemporáneos que inscriben su trabajo en este vasto horizonte de problemáticas cercano a la noción de “espacio biográfico”.2 De la producción de Verónica Gómez nos centraremos fundamentalmente en uno de sus primeros trabajos, Casa Museo (2003-2005, en el que la artista desarrolla diversos procedimientos sobre objetos del recuerdo que parodian lo científico y rememoran juegos infantiles en una institución apócrifa alojada en la casa de sus abuelos. Luego observaremos la obra de Gabriel Baggio cuya producción se centra en la conexión entre historia personal e historia colectiva, en los mecanismos culturales que se ponen en juego al aprender prácticas u oficios de “nuestros mayores”, en el diseño de circuitos de contacto interpersonal y en la observación de las prácticas estéticas de todos los días (cocinar, tejer, habitar. Finalmente nos

  16. Ciudad "versus" calidad de vida

    Directory of Open Access Journals (Sweden)

    Roberto Goycoolea Infante

    2015-04-01

    Full Text Available El hombre es de por sí comunitario, ya que sin nuestros semejantes sería imposible la vida humana. Desde los inicios de la humanidad ha requerido de la compañía, colaboración y aceptación de otros seres semejantes a él. La afinidad de pensamiento, territorio, defensa, religiones... son algunos aglutinantes de los clanes, las tribus, los grupos, sectas, partidos, movimientos y de muchas otras organizaciones que conocemos. Todos ellos tienen un pensamiento de cómo los hombres debemos vivir y luchan por lo que creemos verdadero y beneficioso para nuestra comunidad.

  17. Prebisch y Urquidi: vidas paralelas

    Directory of Open Access Journals (Sweden)

    Joseph Hodara

    2008-01-01

    Full Text Available Este ensayo se propone sugerir “trayectorias paralelas” en la vida y en la obra de Raúl Prebisch y de Víctor L. Urquidi. Argentino el primero y mexicano el segundo, ambos fueron impulsados por una pasión convergente: comprender las razones estructurales del subdesarrollo económico y social latinoamericano y plantear medidas gubernamentales que moderasen los efectos negativos de las circunstancias internas y externas que distorsionan la evolución regional contemporánea. Sin embargo, las disparidades entre ambos fueron considerables. Prebisch fue el caudillo intelectual que, armado con la Comisión Economía para la América Latina (CEPAL, enhebró un nuevo discurso desarrollista que los gobiernos formalmente incorporaron. Tuvo el talento de absorber las ideas de múltiples autores y colaboradores, y, sin darles el debido crédito, formuló un paradigma que presidió desde la década de los cincuenta hasta los ochenta la ponderación de las relaciones entre la “periferia latinoamericana” y el “centro”, eufemismo que señalaba principalmente a Estados Unidos. Urquidi, al contrario, fue un empresario intelectual que gestó El Colegio de México como institución mexicana de altos estudios en múltiples ramas, desde las ciencias sociales a la historia y la literatura. Fue un investigador de amplios horizontes y cultura. Y sus póstumas refl exiones sobre la evolución económica y social de América Latina se caracterizan por un áspero pesimismo. Ambos esperan a un Plutarco que narre con pulcritud las peripecias de sus vidas.

  18. Estilo de vida en gastritis

    Directory of Open Access Journals (Sweden)

    María Paola Yumbay Yallica

    2017-05-01

    Full Text Available Objetivo: Determinar como los estilos de vida inciden en la gastritis de los estudiantes de Segundo Semestre de Enfermería de la Facultad Ciencias de la Salud de la Universidad Técnica de Ambato. Material y métodos: El estudio es no experimental con un diseño descriptivo de corte transversal, se relacionan con las variables involucradas, además es de corta duración en un periodo corto de tiempo, el instrumento utilizado fueron dos encuestas a treinta personas, la primera encuesta sobre la variable independiente refiriéndonos a los estilos de vida con diez preguntas y la segunda encuesta sobre la variable dependiente que es la gastritis con diez preguntas. Resultados: Se obtuvo como resultados que no tienen horarios fijos de alimentación por lo cual producirán o tendrán el riesgo de contraer no solo la gastritis sino también otras patologías que dañaran su organismo y producirán su muerte. Conclusión: La mala nutrición puesto a que es el proceso mediante el cual los seres vivos incorporan, modifican y eliminan sustancias procedentes del exterior, absorbidas durante el proceso digestivo. La gastritis es la inflamación del revestimiento del estómago, puede ser de tipo agudo, de aparición rápida y resolución en pocos días, o de tipo crónico, en cuyo caso puede persistir durante años y producir úlcera péptica. En algunos casos, ésta puede llevar a la formación de úlceras y aumentar el padecer cáncer de estómago.

  19. Cold-active halophilic bacteria from the ice-sealed Lake Vida, Antarctica.

    Science.gov (United States)

    Mondino, Lindsay J; Asao, Marie; Madigan, Michael T

    2009-10-01

    Lake Vida is a large, permanently ice-covered lake in the Victoria Valley of the McMurdo Dry Valleys, Antarctica and is unique among Dry Valley lakes because it is ice-sealed, with an ice-cover of nearly 19 m. Enrichment cultures of melt-water from Lake Vida 15.9 m ice yielded five pure cultures of aerobic, heterotrophic bacteria. Of these, one strain grew at -8 degrees C and the four others at -4 degrees C. All isolates were either halotolerant or halophilic, with two strains capable of growth at 15% NaCl. Phylogenetic analysis revealed the Lake Vida isolates to be Gammaproteobacteria, related to species of Psychrobacter and Marinobacter. This is the first report of pure cultures of bacteria from Lake Vida, and the isolates displayed a phenotype consistent with life in a cold hypersaline environment.

  20. Pulsiones de Vida y Muerte

    Directory of Open Access Journals (Sweden)

    Guillermo Sánchez Medina

    2001-12-01

    Full Text Available

    Cuando hacemos alusión a las pulsiones o a su energía, lo estamos haciendo a cargas eléctricas y a partículas subatómicas; así mismo nos referimos a "estímulos endógenos y exógenos", "señales", "excitaciones", "deseos", "necesidades", "afectos y emociones", "transmisiones e impulsos", originados
    en los "instintos".
    Conocemos desde la perspectiva del psicoanálisis de Freud (en su trabajo sobre Meta psicología en 1915, cómo el instinto es un concepto limítrofe entre lo mental y lo somático, siendo la representación psíquica del estímulo, originado en el organismo que elige la mente.
    Por lo tanto los instintos no serían sino la organización de "fuerzas" para la vida y la muerte orgánica, que buscan restablecer un orden y estado de interrelación y movimiento con otras fuerzas (cargas opuestas, antimateria y/o antipartículas, que perturban ese funcionamiento o por el contrario, actúan para conservar el equilibrio y orden; he ahí un concepto proveniente o que nos lleva también a la teoría de la complejidad y caos.
    Los instintos (de vida-eros y muerte-tanatos vigilarían el destino de los organismos elementales que sobreviven al individuo total, proporcionándoles un refugio seguro mientras se encuentran indefensos contra los estímulos del mundo externo, y a la vez facilitando su encuentro o nacimiento en la estructura de los nucleótidos del ADN, que son la base biológica del instinto sexual, que preservan la especie y.restablecen un estado previo, el que puede ser la misma involución y la inercia. Todos estos fenómenos no significan que exista una tendencia a la perfección; de aquí que la muerte interna sea también natural como la vida, la que tiene su escape en la ya mencionada supervivencia, defensa y conservación de la especie. De tal forma, la biología no va en contravía de los instintos
    de muerte. "Por su parte al reservorio del instinto de vida le damos, en psicoan

  1. Prevalence of Listeria monocytogenes in traditional ice cream, Yazd, IRAN (1394 and compared to other studies in different parts of Iran

    Directory of Open Access Journals (Sweden)

    Negar Hamidian

    2017-07-01

    Full Text Available 1-Mortazavi S, Gods rohani M, Juyande H. milk and dairy products technology. The University Ferdowsi Mashhad; 1996. p. 266. 2-Azadnia P, Ghasemi M, Abbasi M, Taarof N, Jashni M. Microbial Quality of Traditional Ice Cream Produced by Small-Scale Manufacturers in Khormoj and Its Comparison with the Iranian National Standard. Journal of Animal and Veterinary Advances 2011;10(6:742-4. 3- Ziabari Mirnezami H. What do you know about milk (Milk chemical technology: Tehran University; 1996. 4-Movassagh MH, Movassagh A, Mahmoodi H, Servatkhah F, Sourorbakhsh MR. Microbiological contamination of the traditional chocolate Ice cream sold in the Northwest Region of Iran. Global Veterinaria 2011;6(3:269-71. 5-Karim G, Razavilar V, Akhonndzade A. survey contamination of traditional ice cream to bacteria causing the infection and food poisoning[persian]. Tehran University Faculty of Veterinary 1374;50:71-8. 6-Kanbakan U, Con A, Ayar A. Determination of microbiological contamination sources during ice cream production in Denizli, Turkey. Food Control 2004;15(6:463-70. 7- Fallah AA, Saei-Dehkordi SS, Rahnama M, Tahmasby H, Mahzounieh M. Prevalence and antimicrobial resistance patterns of  Listeria  species isolated from poultry products marketed in Iran. Food Control 2012;28(2:327-32. 8-Farber J, Peterkin P. Listeria monocytogenes, a food-borne pathogen. Microbiological reviews 1991;55(3:476. 9-Navratilova P, Schlegelova J, Sustackova A, Napravnikova E, Lukasova J, Klimova E. Prevalence of Listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. Veterinarni Medicina-UZPI 2004;49. 10-Williams SK, Roof S, Boyle EA, Burson D, Thippareddi H, Geornaras I, et al. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants. J Food Prot 2011;74(1:63-77. 11-Halter E, Neuhaus K, Scherer S. Listeria weihenstephanensis sp. nov

  2. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene (cadA4) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette (cadA4C), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation.IMPORTANCEListeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and tolerate

  3. Listeria spp. no processamento de lingüiça frescal em frigoríficos de Pelotas, RS, Brasil Listeria spp. in the processing of fresh sausages in slaughterhou ses from Pelotas, RS, Brazil

    Directory of Open Access Journals (Sweden)

    Wladimir Padilha da Silva

    2004-06-01

    Full Text Available Alimentos intensamente manipulados, como as lingüiças mistas do tipo frescal são freqüentemente responsáveis pela veiculação de enfermidades transmitidas por alimentos. Devido ao risco à saúde pública que a bactéria Listeria monocytogenes representa, este trabalho teve como objetivo estudar a presença de Listeria spp., em especial de L. monocytogenes, durante o processamento de lingüiças mistas do tipo frescal, em três frigoríficos com inspeção sanitária estadual, em Pelotas-RS. Para isso, analisou-se a matéria-prima utilizada no preparo da lingüiça, os equipamentos da linha de processamento e o produto final. Isolou-se Listeria spp. em 100% das 41 amostras analisadas, nos 3 estabelecimentos estudados. Dentre as diferentes espécies, L. innocua foi aquela isolada com maior freqüência, em 97,6% das amostras, seguida por L. monocytogenes em 29,3% e L. welshimeri em 24,4%. A presença destes microrganismos nas amostras analisadas, em especial no produto final, demonstra a necessidade de readequação nas práticas de limpeza e sanificação das plantas de processamento analisadas, bem como representa risco potencial de listeriose ao consumidor.Food that is highly manipulated, such as fresh sausages, is frequently responsible for spreading food borne diseases. Due to the threat that the bacterium Listeria monocytogenes represents to public health, the aim of this work was to study the presence of Listeria spp., especially Listeria monocytogenes, during processing of fresh sausages, in three slaughterhouses with state food inspection, in the city of Pelotas, Brazil. The raw material used for the sausage elaboration, the equipment used in the processing and the end products were analyzed. The results showed Listeria spp. in 100% of the 41 samples analyzed. Among the different species, L. innocua was the most frequent, isolated from 97.6% of the samples, followed by the L. monocytogenes and L. welshimeri that were isolated from

  4. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-09-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  6. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  7. Rhombencephalitis Caused by Listeria monocytogenes in Humans and Ruminants: A Zoonosis on the Rise?

    Science.gov (United States)

    Oevermann, Anna; Zurbriggen, Andreas; Vandevelde, Marc

    2010-01-01

    Listeriosis is an emerging zoonotic infection of humans and ruminants worldwide caused by Listeria monocytogenes (LM). In both host species, CNS disease accounts for the high mortality associated with listeriosis and includes rhombencephalitis, whose neuropathology is strikingly similar in humans and ruminants. This review discusses the current knowledge about listeric encephalitis, and involved host and bacterial factors. There is an urgent need to study the molecular mechanisms of neuropathogenesis, which are poorly understood. Such studies will provide a basis for the development of new therapeutic strategies that aim to prevent LM from invading the brain and spread within the CNS. PMID:20204066

  8. 3M™ Molecular detection system versus MALDI-TOF mass spectrometry and molecular techniques for the identification of Escherichia coli 0157:H7, Salmonella spp. &Listeria spp.

    Science.gov (United States)

    Loff, Marché; Mare, Louise; de Kwaadsteniet, Michele; Khan, Wesaal

    2014-06-01

    The aim of this study was to compare standard selective plating, conventional PCR (16S rRNA and species specific primers), MALDI-TOF MS and the 3M™ Molecular Detection System for the routine detection of the pathogens Listeria, Salmonella and Escherichia coli 0157:H7 in wastewater and river water samples. MALDI-TOF MS was able to positively identify 20/21 (95%) of the E. coli isolates obtained at genus and species level, while 16S rRNA sequencing only correctly identified 6/21 (28%) as E. coli strains. None of the presumptive positive Listeria spp. and Salmonella spp. isolates obtained by culturing on selective media were positively identified by MALDI-TOF and 16S rRNA analysis. The species-specific E. coli 0157:H7 PCR described in this present study, was not able to detect any E. coli 0157:H7 strains in the wastewater and river water samples analysed. However, E. coli strains, Listeria spp., L. monocytogenes and Salmonella spp. were detected using species specific PCR. Escherichia coli 0157:H7, Listeria spp. and Salmonella spp. were also sporadically detected throughout the sampling period in the wastewater and river water samples analysed by the 3M™ Molecular Detection System. MALDI-TOF MS, which is a simple, accurate and cost-effective detection method, efficiently identified the culturable organisms, while in the current study both species specific PCR (Listeria spp. and Salmonella spp.) and 3M™ Molecular Detection System could be utilised for the direct routine analysis of pathogens in water sources. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. QUALIDADE DE VIDA EM GESTANTES COM CARDIOPATIA

    OpenAIRE

    Silmara Meneguin; Caroline de Lima Xavier

    2013-01-01

    Investigación descriptiva, exploratoria y transversal con objeto de describir la calidad de vida percibida en gestantes con cardiopatía. El Índice de Calidad de Vida de Ferrans y Powers fue aplicado en 42 pacientes, a partir del segundo trimestre de embarazo, entre enero del 2008 y marzo del 2009. Fueron usados la estadística descriptiva, análisis de variancia y test t de Student. La mediana del score total de calidad de vida fue relativamente alta (23,9) y el dominio socioeconómico el más co...

  10. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

    Science.gov (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

    2013-04-01

    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  11. 4610 Volume 11 No. 2 March 2011 OCCURRENCE OF LISTERIA ...

    African Journals Online (AJOL)

    user

    2011-03-02

    Mar 2, 2011 ... Listeria spp. was higher in bulked raw milk than in fermented milk. ... fermented dairy products were within the acceptable limits for human consumption. ..... This work was supported by Islamic Development Bank (IDB) of the ...

  12. Organelle targeting during bacterial infection: insights from Listeria.

    Science.gov (United States)

    Lebreton, Alice; Stavru, Fabrizia; Cossart, Pascale

    2015-06-01

    Listeria monocytogenes, a facultative intracellular bacterium responsible for severe foodborne infections, is now recognized as a multifaceted model in infection biology. Comprehensive studies of the molecular and cellular basis of the infection have unraveled how the bacterium crosses the intestinal and feto-placental barriers, invades several cell types in which it multiplies and moves, and spreads from cell to cell. Interestingly, although Listeria does not actively invade host cell organelles, it can interfere with their function. We discuss the effect of Listeria on the endoplasmic reticulum (ER) and the mechanisms leading to the fragmentation of the mitochondrial network and its consequences, and review the strategies used by Listeria to subvert nuclear functions, more precisely to control host gene expression at the chromatin level. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Listeria innocua and Salmonella panama in mussels: a comparative study.

    Science.gov (United States)

    Plusquellec, A; Monfort, P; Piclet, G; Rio, L

    1998-09-01

    Bivalve molluscs are exposed to a wide range of contamination by pathogenic bacteria and viruses. Therefore, the behavior of bacterial pathogens in bivalves after harvesting is important in terms of food safety. Mussels were artificially contaminated with Listeria innocua and Salmonella panama, held under different conditions, and then examined for Listeria and Salmonella viable counts. In a simplified depuration system, L. innocua levels were lower than those observed for S. panama in mussels during the same period and under the same conditions. This result may be related to the rapid die-off reported for Listeria in seawater. In mussels stored in air, the two pathogens presented similar behaviors: levels of both pathogens remained constant in mussels during the storage period in air. However, in shucked mussels Listeria innocua counts increased with the duration of storage, whereas Salmonella panama showed a slight decrease.

  14. Antibiotic resistance of Escherichia coli, Listeria and Salmonella ...

    African Journals Online (AJOL)

    Antibiotic resistance of Escherichia coli, Listeria and Salmonella isolates from retail ... Antibiotics sensitivity test was assayed on thirty (30) isolates (10 each for ... their way into human population through food chain and occupational exposure.

  15. Listeria monocytogenes in Aquatic Food Products—A Review

    National Research Council Canada - National Science Library

    Jami, Mansooreh; Ghanbari, Mahdi; Zunabovic, Marija; Domig, Konrad J; Kneifel, Wolfgang

    2014-01-01

    With the increased demand for lightly preserved and/or ready‐to‐eat (RTE) food products, the prevalence of the foodborne pathogen Listeria monocytogenes has increased, which is a public health concern...

  16. Simvastatin enhances protection against Listeria monocytogenes infection in mice by counteracting Listeria-induced phagosomal escape.

    Directory of Open Access Journals (Sweden)

    Suraj P Parihar

    Full Text Available Statins are well-known cholesterol lowering drugs targeting HMG-CoA-reductase, reducing the risk of coronary disorders and hypercholesterolemia. Statins are also involved in immunomodulation, which might influence the outcome of bacterial infection. Hence, a possible effect of statin treatment on Listeriosis was explored in mice. Statin treatment prior to subsequent L. monocytogenes infection strikingly reduced bacterial burden in liver and spleen (up to 100-fold and reduced histopathological lesions. Statin-treatment in infected macrophages resulted in increased IL-12p40 and TNF-α and up to 4-fold reduced bacterial burden within 6 hours post infection, demonstrating a direct effect of statins on limiting bacterial growth in macrophages. Bacterial uptake was normal investigated in microbeads and GFP-expressing Listeria experiments by confocal microscopy. However, intracellular membrane-bound cholesterol level was decreased, as analyzed by cholesterol-dependent filipin staining and cellular lipid extraction. Mevalonate supplementation restored statin-inhibited cholesterol biosynthesis and reverted bacterial growth in Listeria monocytogenes but not in listeriolysin O (LLO-deficient Listeria. Together, these results suggest that statin pretreatment increases protection against L. monocytogenes infection by reducing membrane cholesterol in macrophages and thereby preventing effectivity of the cholesterol-dependent LLO-mediated phagosomal escape of bacteria.

  17. Characterization of plasmids from Listeria monocytogenes and Listeria innocua strains isolated from short-ripened cheeses.

    Science.gov (United States)

    Margolles, A; de los Reyes-Gavilán, C G

    1998-02-17

    The plasmid content of 30 isolates of Listeria monocytogenes and 18 isolates of Listeria innocua obtained from short-ripened cheeses was analysed. The isolates of L. monocytogenes serogroup 1 harboured a single plasmid, pLM33 (33.2 kbp), whereas the serogroup 4 isolates did not contain plasmids. One group of L. innocua strains harboured the plasmid pLI71 (71 kbp) and another one contained two plasmids: pLI59 (59.5 kbp) and pLI56 (56.5 kbp). These plasmid groups were in accordance with clusters previously defined by pulsed-field gel electrophoresis analysis of the chromosomal DNA of Listeria isolates. Plasmids pLM33, pLI71 and pLI59 shared homology regions of at least 20 kbp. Plasmid pLI56 did not encode genes for any known character (such as carbohydrate fermentation, resistance to antibiotics, heavy metals or disinfectants, growth at low pH, NaCl tolerance or thermal inactivation by pasteurisation) and displayed different characteristics to the other three plasmids. It was also the only one cured from the parent strain and the sole plasmid not digested by the restriction enzyme PstI. In addition, its lack of homology with pLM33, pLI71 and pLI59 enhanced the possibility of a different origin for plasmid pLI56.

  18. Comparison between Listeria monocytogenes single and multipathogen detection methods

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues de Souza

    2017-12-01

    Full Text Available Multipathogen detection methods have been used to provide a broad range of microorganism detection. We aimed to identify the most searched pathogens in L. monocytogenes detection methods and evaluate if there are sensitivity and specificity differences between single and multipathogen methods. A systematic review was performed by including studies carried out in order to detect L. monocytogenes in a broad range of food sample. A total of 2770 records were retrieved, of which 191 were selected. The majority of the studies (104 presented multipathogen detection, other 87 searched for L. monocytogenes specifically. From the studies for multipathogen detection; other Listeria species (19.4%, Salmonella spp. (21.6%, E. coli O157:H7 (13.2%, Staphylococcus spp. (9.7%, E. coli (5.7% were more frequently reported. Sensitivity and specificity calculations were derived from only 26 studies, because they compared their data with an official method. Sensitivity and specificity values were close to 100%, showing that others characteristics such as time and cost should be considered to evaluate alternative methods in further research. As a conclusion, evidence generated regarding L. monocytogenes identification methods contribute to method improvements and listeriosis control.

  19. Listeria monocytogenes: Strain Heterogeneity, Methods, and Challenges of Subtyping.

    Science.gov (United States)

    Nyarko, Esmond B; Donnelly, Catherine W

    2015-12-01

    Listeria monocytogenes is a food-borne bacterial pathogen that is associated with 20% to 30% case fatality rate. L. monocytogenes is a genetically heterogeneous species, with a small fraction of strains (serotypes 1/2a, 1/2b, 4b) implicated in human listeriosis. Monitoring and source tracking of L. monocytogenes involve the use of subtyping methods, with the performance of genetic-based methods found to be superior to phenotypic-based ones. Various methods have been used to subtype L. monocytogenes isolates, with the pulsed-field gel electrophoresis (PFGE) being the gold standard. Although PFGE has had a massive impact on food safety through the establishment of the PulseNet, there is no doubt that whole genome sequence (WGS) typing is accurate, has a discriminatory power superior to any known method, and allows genome-wide differences between strains to be quantified through the comparison of nucleotide sequences. This review focuses on the different techniques that have been used to type L. monocytogenes strains, their performance challenges, and the tremendous impact WGS typing could have on the food safety landscape. © 2015 Institute of Food Technologists®

  20. Ocorrência de Listeria spp. e de Listeria monocytogenes, em um matadouro-frigorífico de bovinos do estado de São Paulo

    OpenAIRE

    Caselani, Kelly [UNESP; Prata, Luiz Francisco [UNESP; Bizari, Paula Adriana [UNESP; Pereira, Gener Tadeu [UNESP; de Marchi, Patrícia Gelli Feres [UNESP; Picinato, Mirelle Andréa de Carvalho [UNESP

    2013-01-01

    We evaluated the presence of Listeria spp. and Listeria monocytogenes in environmental samples by means of swabs collected the bovine slaughter plant enabled to export, located in the state of Sao Paulo, Brazil. After the pre-enrichment at 30±1°C for 22 to 26h the samples were analyzed using the BAX System Listeria. Those positive for Listeria spp. were submitted a second PCR reaction to confirm the presence of Listeria monocytogenes. From 411 environmental samples analyzed, 62 (15.1%) were p...

  1. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    OpenAIRE

    Qi Zhu; Ravi Gooneratne; Malik Altaf Hussain

    2017-01-01

    Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that caus...

  2. Microbial quality and prevalence of Salmonella and Listeria in eggs

    OpenAIRE

    Manijeh Mahdavi; Mohammad Jalali; Hjieh Ghasemian Safaei; Ehsan Shamloo

    2012-01-01

    Aims: This study was undertaken to determine the microbial quality and the prevalence of Salmonella and Listeria in table eggs in Isfahan, Iran. Materials and Methods: A total of 525 samples were randomly collected from various shops in Isfahan, Iran. Microbial quality of eggs evaluated by coliform count and total bacterial viable counts. Also, detection of Listeria and Salmonella in egg contents and on eggs shells was performed. Results: The mean of total viable bacteria and colifor...

  3. Qualidade de vida de graduandos de enfermagem

    Directory of Open Access Journals (Sweden)

    Beatriz Marques de Oliveira

    2011-02-01

    Full Text Available O presente estudo objetivou descrever o perfil sociodemográfico dos estudantes de enfermagem e compreender o significado atribuído para sua atual qualidade de vida. Foram entrevistados 65 acadêmicos do 8º semestre do ano de 2007, por meio da aplicação de questionário autoreferido, com informações de dados sociodemográficos e questões abertas sobre qualidade de vida. A população de estudo foi predominantemente do sexo feminino, solteira, com idade entre 22 a 24 anos e com diferentes percepções sobre sua qualidade de vida, apreendidas por meio da vivência de fatores favoráveis e desfavoráveis no decorrer dos anos de aprendizado. O estudo destacou a percepção da qualidade de vida sob a ótica do estudante de enfermagem

  4. La vida y la flecha del tiempo

    Directory of Open Access Journals (Sweden)

    Jaksel Nájera Mota

    2014-01-01

    Full Text Available La vida y la flecha del tiempo se fundamentan en una interrelación entre orden-desorden, muerte-vida, acumulación-pérdida que permite transformaciones y disipaciones en la estructura orgánica. Por lo anterior, se analizan algunos procesos metabólicos y de regeneración celular. Se demuestra que a pesar de los esfuerzos por retrasar el desgaste del organismo, la vida se mantiene dirigida a la degradación; sin embargo, es posible minimizar algunos problemas causados por el envejecimiento manteniendo una vida más saludable, con ejercicio y buena alimentación.

  5. QUALIDADE DE VIDA EM GESTANTES COM CARDIOPATIA

    Directory of Open Access Journals (Sweden)

    Silmara Meneguin

    2013-01-01

    Full Text Available Investigación descriptiva, exploratoria y transversal con objeto de describir la calidad de vida percibida en gestantes con cardiopatía. El Índice de Calidad de Vida de Ferrans y Powers fue aplicado en 42 pacientes, a partir del segundo trimestre de embarazo, entre enero del 2008 y marzo del 2009. Fueron usados la estadística descriptiva, análisis de variancia y test t de Student. La mediana del score total de calidad de vida fue relativamente alta (23,9 y el dominio socioeconómico el más comprometido (22,9. Fue observada tendencia entre embarazo no planeado y dominio socioeconómico (p=0,065. La calidad de vida de estos pacientes puede ser considerada buena pero, cuando el embarazo no fue planeado, contribuye para empeorar la dimensión socioeconómica. El embarazo de alto riesgo no influenció la calidad de vida, ya que la misma estuvo vinculada a significados de felicidad, satisfacción y realización personal. DESCRIPTORES: Calidad de vida. Gestación. CarInvestigación descriptiva, exploratoria y transversal con objeto de describir la calidad de vida percibida en gestantes con cardiopatía. El Índice de Calidad de Vida de Ferrans y Powers fue aplicado en 42 pacientes, a partir del segundo trimestre de embarazo, entre enero del 2008 y marzo del 2009. Fueron usados la estadística descriptiva, análisis de variancia y test t de Student. La mediana del score total de calidad de vida fue relativamente alta (23,9 y el dominio socioeconómico el más comprometido (22,9. Fue observada tendencia entre embarazo no planeado y dominio socioeconómico (p=0,065. La calidad de vida de estos pacientes puede ser considerada buena pero, cuando el embarazo no fue planeado, contribuye para empeorar la dimensión socioeconómica. El embarazo de alto riesgo no influenció la calidad de vida, ya que la misma estuvo vinculada a significados de felicidad, satisfacción y realización personal.

  6. Georges Canguilhem: sobre vida e conhecimento da vida [Georges Canguilhem: on life and knowledge of life

    OpenAIRE

    Filicio Mulinari

    2016-01-01

    Tendo como fundamento as obras de Georges Canguilhem, sobretudo a obra O normal e o patológico e os escritos "O pensamento e o vivente" e "O conceito e a vida", este artigo busca analisar o modo como Georges Canguilhem entende as noções de vida e conhecimento de vida, relacionando ambos os conceitos e indicando, nas linhas teóricas do filósofo francês, como é possível conhecimento o sobre a vida e o vivente. O artigo, inicialmente passando pelos conceitos de normal e patológico, buscará situa...

  7. Genome comparison of Listeria monocytogenes serotype 4a strain HCC23 with selected lineage I and lineage II L. monocytogenes strains and other Listeria strains.

    Science.gov (United States)

    Paul, Debarati; Steele, Chelsea; Donaldson, Janet R; Banes, Michelle M; Kumar, Ranjit; Bridges, Susan M; Arick, Mark; Lawrence, Mark L

    2014-12-01

    More than 98% of reported human listeriosis cases are caused by specific serotypes within genetic lineages I and II. The genome sequence of Listeria monocytogenes lineage III strain HCC23 (serotype 4a) enables whole genomic comparisons across all three L. monocytogenes lineages. Protein cluster analysis indicated that strain HCC23 has the most unique protein pairs with nonpathogenic species Listeria innocua. Orthology analysis of the genome sequences of representative strains from the three L. monocytogenes genetic lineages and L. innocua (CLIP11262) identified 319 proteins unique to nonpathogenic strains HCC23 and CLIP11262 and 58 proteins unique to pathogenic strains F2365 and EGD-e. BLAST comparison of these proteins with all the sequenced L. monocytogenes and L. innocua revealed 126 proteins unique to serotype 4a and/or L. innocua; 14 proteins were only found in pathogenic serotypes. Some of the 58 proteins unique to pathogenic strains F2365 and EGD-e were previously published and are already known to contribute to listerial virulence.

  8. Liofilchem® O.A. Listeria agar and direct CAMP test provided sooner Listeria monocytogenes identification from neonatal bacteremia

    OpenAIRE

    Savini, Vincenzo; Marrollo, Roberta; Serio, Annalisa; Paparella, Antonello; Argentieri, Angela Valentina; D’Antonio, Marianna; Coclite, Eleonora; Fusilli, Paola; Fazii, Paolo

    2014-01-01

    Listeria monocytogenes infection in pregnant women and newborns is a cause for serious concern, and invasive disease outcome strongly depends on prompt antibiotic therapy. To provide sooner identification from neonatal bacteremia we performed a CAMP test directly on positive blood aliquots and inoculated the Liofilchem® O.A. Listeria chromogenic agar as well, thus providing a 24-h turn-around time for response.

  9. Liofilchem(®) O.A. Listeria agar and direct CAMP test provided sooner Listeria monocytogenes identification from neonatal bacteremia.

    Science.gov (United States)

    Savini, Vincenzo; Marrollo, Roberta; Serio, Annalisa; Paparella, Antonello; Argentieri, Angela Valentina; D'Antonio, Marianna; Coclite, Eleonora; Fusilli, Paola; Fazii, Paolo

    2014-01-01

    Listeria monocytogenes infection in pregnant women and newborns is a cause for serious concern, and invasive disease outcome strongly depends on prompt antibiotic therapy. To provide sooner identification from neonatal bacteremia we performed a CAMP test directly on positive blood aliquots and inoculated the Liofilchem(®) O.A. Listeria chromogenic agar as well, thus providing a 24-h turn-around time for response.

  10. Listeria monocytogenes meningitis in an immunocompromised patient.

    Science.gov (United States)

    Barocci, Simone; Mancini, Alessio; Canovari, Benedetta; Petrelli, Enzo; Sbriscia-Fioretti, Emanuela; Licci, Alberto; D'Addesa, Simona; Petrini, Giancarlo; Giacomini, Marinella; Renzi, Antonella; Migali, Antonio; Briscolini, Sara

    2015-01-01

    This report describes a case of meningitis caused by Listeria monocytogenes in a stem cell transplant recipient on immunosuppressive therapy for cutaneous chronic graft-versus host disease. A 59-year-old woman had undergone allogeneic stem cell transplantation (from a matched unrelated donor) 13 months previously for chronic lymphocytic leukemia. She was on regular hematologic follow-up. Though her previous malignancy has been in remission, she was immunosuppressed due to the pharmacological treatment. We describe a meningitis caused by a typical food-borne pathogen, dangerous in patients with impaired cell-mediated immunity. Moreover the bacterium had a multidrug resistance, a rare characteristic in clinical listeriosis. Rapid diagnosis and treatment are key factors in these cases. We chose ampicillin and rifampicin that allowed a complete resolution of the clinical manifestations.

  11. Adenovirus-based vaccine against Listeria monocytogenes

    DEFF Research Database (Denmark)

    Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech

    2013-01-01

    The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... class II-associated invariant chain (Ii) greatly enhances both the presentation of most target Ags, as well as overall protection against viral infection, such as lymphocytic choriomeningitis virus (LCMV). The present study extends this vaccination concept to include protection against intracellular...... bacteria, using Listeria monocytogenes as a model organism. Protection in C57BL/6 mice against recombinant L. monocytogenes expressing an immunodominant epitope of the LCMV glycoprotein (GP33) was greatly accelerated, augmented, and prolonged following vaccination with an adenoviral vaccine encoding GP...

  12. Special Handling for Ready-to-Eat, Refrigerated Foods: Reducing the Risks of Foodborne Listeria

    Science.gov (United States)

    ... Food Home Food Resources for You Consumers Preventing Listeria Infections: What You Need to Know Share Tweet ... so important. How to Reduce Your Risk from Listeria : 3 Easy Steps There are three very simple ...

  13. [Detection of Salmonella, Listeria spp., Vibrio spp., and Yersinia enterocolitica in frozen seafood and comparison with enumeration for faecal indicators: implication for public health].

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Fanelli, I; Grasso, G M

    2004-01-01

    Infections transmitted through consumption of contaminated seafood is a significant source of human morbidity. The aim of this study was to compare the detection of Salmonella, Listeria, Vibrio, and Yersinia enterocolitica in frozen seafood with results from enumeration of conventional faecal indicators. A total of 213 crustaceans or molluscs were purchased from local vendors in Italy: 74% were harvested in Italy, 25% from other European countries and 1% from outside Europe. Listeria spp. was isolated from 20% of samples, Vibrio spp. from 11%, Salmonella from 3% and Y. enterocolitica from 1%. Listeria species isolated were L. monocytogenes, L. innocua, L. welshimeri, L. ivanovii and L. seeligeri. Vibrio species isolated were V. alginolyticus and V. fluvialis. The most contaminated shellfish for both faecal indicator microrganism and pathogens were hen clams (6% contained Salmonella, 27% Listeria spp. and 3% Y. enterocolitica), while from 27% of shrimps Vibrio spp. was recovered. Higher levels of faecal indicators were recovered from samples harvested outside Europe, and 66% of samples harvested in Thailand were contaminated from Salmonella. Significant differences were found in the levels of contamination of seafoods depending upon the freezing regime, but there was a limited association between presence of potential pathogens (particularly Vibrio spp.) and conventional faecal indicators. Hence, we suggest reconsideration of current legal parameters to evaluate microbiological quality of seafood.

  14. Simultaneous Detection of Escherichia coli, Salmonella enterica, Listeria monocytegenes and Bacillus cereus by Oligonucleotide Microarray

    Directory of Open Access Journals (Sweden)

    Meysam Sarshar

    2015-11-01

    Full Text Available Background: Traditional laboratory methods to detect pathogenic bacteria are time consuming and laborious. Therefore, it is essential to use powerful and reliable molecular methods for quick and simultaneous detection of microbial pathogens. Objectives: The current study aimed to evaluate the capability and efficiency of 23S rDNA sequence for rapid and simultaneous detection of four important food-borne pathogens by an oligonucleotide microarray technique. Materials and Methods: The 23S rDNA sequences of Escherichia coli, Salmonella enterica, Listeria monocytogenes and Bacillus cereus were obtained from GenBank databases and used to design the oligonucleotide probes and primers by Vector NTI software. Oligonucleotide probes were placed on a nylon membrane and hybridization was performed between probes and 23S rDNA digoxigenin-labeled polymerase chain reaction (PCR products. Hybridization signals were visualized by NBT/BCIP color development. Results: Positive hybridization color was produced for Escherichia coli, Salmonella enterica, Listeria monocytogenes and Bacillus cereus. The oligonucleotide microarray detected all bacterial strains in a single reaction in less than five hours. The sensitivity of the performed microarray assay was 103 cfu/mL for each species of pathogen. No cross reaction was found between the tested bacterial species. Conclusions: The obtained results indicated that amplification of 23S rDNA gene followed by oligonucleotide microarray hybridization is a rapid and reliable method to identify and discriminate foodborne pathogens tested under the study.

  15. A portable cell-based optical detection device for rapid detection of Listeria and Bacillus toxins

    Science.gov (United States)

    Banerjee, Pratik; Banada, Padmapriya P.; Rickus, Jenna L.; Morgan, Mark T.; Bhunia, Arun K.

    2005-11-01

    A mammalian cell-based optical biosensor was built to detect pathogenic Listeria and Bacillus species. This sensor measures the ability of the pathogens to infect and induce cytotoxicity on hybrid lymphocyte cell line (Ped-2E9) resulting in the release of alkaline phosphatase (ALP) that can be detected optically using a portable spectrophotometer. The Ped-2E9 cells were encapsulated in collagen gel matrices and grown in 48-well plates or in specially designed filtration tube units. Toxin preparations or bacterial cells were introduced and ALP release was assayed after 3-5 h. Pathogenic L. monocytogenes strains or the listeriolysin toxins preparation showed cytotoxicity ranging from 55% - 92%. Toxin preparations (~20 μg/ml) from B. cereus strains showed 24 - 98% cytotoxicity. In contrast, a non-pathogenic L. innocua (F4247) and a B. substilis induced only 2% and 8% cytotoxicity, respectively. This cell-based detection device demonstrates its ability to detect the presence of pathogenic Listeria and Bacillus species and can potentially be used onsite for food safety or in biosecurity application.

  16. Occurrence of Listeria spp. in Effluents of French Urban Wastewater Treatment Plants

    Science.gov (United States)

    Paillard, Delphine; Dubois, Véronique; Thiebaut, Rodolphe; Nathier, Fany; Hoogland, Emilie; Caumette, Pierre; Quentin, Claudine

    2005-01-01

    Listeria spp. were found in most treated waters (84.4%) and raw sludge (89.2%) of six French urban wastewater treatment plants and one composting facility, examined monthly over a 1-year period. Most strains belonged to Listeria monocytogenes, serotypes 4b/4e being predominant. Sludge composting and liming reduced or prevented Listeria contamination. PMID:16269804

  17. 77 FR 58804 - Testing of Product Samples for Listeria monocytogenes: Changes in Procedures

    Science.gov (United States)

    2012-09-24

    ... Food Safety and Inspection Service Testing of Product Samples for Listeria monocytogenes: Changes in... Inspection Service (FSIS) is announcing changes in procedures for Listeria (L.) monocytogenes product... products for laboratory analysis (21 U.S.C. 642(a) and 460(b)). RTE Sampling Programs for Listeria...

  18. DETECTION AND CHARACTERISATION OF LISTERIA ISOLATES COLLECTED ALONG THE GORGONZOLA PDO PRODUCTION CHAIN

    Directory of Open Access Journals (Sweden)

    D. Nucera

    2011-08-01

    Full Text Available Considering that Listeria monocytogenes represents a concern in the production of Gorgonzola PDO cheese, this study was aimed to investigate the presence of Listeria along one Gorgonzola PDO production chain. L. monocytogenes subtype diversity was also investigated in order to identify possible reservoirs and dissemination routes. One dairy plant and its conferring farms (N=20 were selected and samples were collected in 4 visits in order to investigate seasonal variability. In each of them, producer tank milk (N=80, Gorgonzola producer tanks (N=12, Gorgonzola producer environmental samples (N=108 were collected, for a total of 200 samples. L. innocua was isolated from 3 milk samples (4%; L. monocytogenes alone was detected in 3 environmental samples (16% and L. innocua in 11 (58%. Both species were present in 5 samples. All Listeria strains isolated were typed through ERIC and REP PCRs. For each samples, if possible 5 colonies were selected for typing, for a total of 76 isolates. The analyses allowed the differentiation of L. monocytogenes and L. innocua in 9 and 7 PCR profiles (P, respectively. The former showed an overall similarity value of 75% and the latter of 81%. P1 (N=3 of L. monocytogenes was present in multiple sources (ripening surfaces and salting equipment and P5 (N=6 in different sampling rounds (January and June 2009. P1 (N=25 and P2 (N=15 of L. innocua were found in multiple sources (performing equipment, ripening surfaces, salting equipment, moving carts and in multiple sample rounds (P1: May 2008, January and June 2009; P2: June and October 2009. The presence of a few highly similar strains of L. monocytogenes in the production chain, as suggested by the profiles retrieved from different sources/sampling rounds, indicates the presence of persistent and niche-adapted strains. However, no profile was shared between raw milk and environmental samples, suggesting that the plant environment, not the incoming raw milk, is the source

  19. Recombinant Probiotic Expressing Listeria Adhesion Protein Attenuates Listeria monocytogenes Virulence In Vitro

    Science.gov (United States)

    Koo, Ok Kyung; Amalaradjou, Mary Anne Roshni; Bhunia, Arun K.

    2012-01-01

    Background Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP) aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. Methodology/Principal Findings The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (LbpLAP) to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to LbpLAP for 1, 4, 15, or 24 h significantly (Pmonocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, LbpLAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. LbpLAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, LbpLAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. Conclusions/Significance Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, LbpLAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise for the use of recombinant probiotics in preventing L. monocytogenes infection in high

  20. Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states.

    Science.gov (United States)

    Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F

    2014-11-01

    Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

  1. The unrelated surface proteins ActA of Listeria monocytogenes and IcsA of Shigella flexneri are sufficient to confer actin-based motility on Listeria innocua and Escherichia coli respectively.

    Science.gov (United States)

    Kocks, C; Marchand, J B; Gouin, E; d'Hauteville, H; Sansonetti, P J; Carlier, M F; Cossart, P

    1995-11-01

    Listeria monocytogenes and Shigella flexneri are two unrelated facultative intracellular pathogens which spread from cell to cell by using a similar mode of intracellular movement based on continuous actin assembly at one pole of the bacterium. This process requires the asymmetrical expression of the ActA surface protein in L. monocytogenes and the IcsA (VirG) surface protein in S. flexneri. ActA and IcsA share no sequence homology. To assess the role of the two proteins in the generation of actin-based movement, we expressed them in the genetic context of two non-actin polymerizing, non-pathogenic bacterial species, Listeria innocua and Escherichia coli. In the absence of any additional bacterial pathogenicity determinants, both proteins induced actin assembly and propulsion of the bacteria in cytoplasmic extracts from Xenopus eggs, as visualized by the formation of characteristic actin comet tails. E. coli expressing IcsA moved about two times faster than Listeria and displayed longer actin tails. However, actin dynamics (actin filament distribution and filament half-lives) were similar in IcsA- and ActA-induced actin tails suggesting that by using unrelated surface molecules, L. monocytogenes and S. flexneri move intracellularly by interacting with the same host cytoskeleton components or by interfering with the same host cell signal transduction pathway.

  2. DNA fingerprinting by ERIC-PCR for comparing Listeria spp. strains isolated from different sources in San Luis: Argentina Caracterización molecular por ERIC-PCR de cepas de Listeria spp. aisladas de diversos orígenes en San Luis: Argentina

    Directory of Open Access Journals (Sweden)

    A. Laciar

    2006-04-01

    Full Text Available In this study, a total of 24 Listeria spp. strains were analyzed. Twenty-two isolates were obtained in San Luis (Argentina from human, animal, and food samples. Two types of strains, Listeria monocytogenes CLIP 22762 and Listeria innocua CLIP 74915, were included as reference strains. All isolates were biochemically identified and characterized by serotyping, phage typing, and amplification of the flaA gene by polymerase chain reaction (PCR. Repetitive intergenic consensus (ERIC sequence-based PCR was used to generate DNA fingerprints. On the basis of ERIC-PCR fingerprints, Listeria spp. strains were divided into three major clusters matching origin of isolation. ERIC-PCR fingerprints of human and animal isolates were different from those of food isolates. In addition, groups I and II included ten L. monocytogenes strains, and only one Listeria seeligeri strain. Group III included nine L. innocua strains and four L. monocytogenes strains. Computer evaluation of ERIC-PCR fingerprints allowed discrimination between the tested serotypes 1/2b, 4b, 6a, and 6b within each major cluster. The index of discrimination calculated was 0.94. This study suggests that the ERIC-PCR technique provides an alternative method for the identification of Listeria species and the discrimination of strains within one species.En este estudio se analizaron 24 cepas de Listeria spp. De ellas, 22 fueron obtenidas en San Luis (Argentina, a partir de muestras humanas, de animales y alimentos. Se incluyeron 2 cepas de referencia Listeria monocytogenes CLIP 22762 y Listeria innocua CLIP 74915. Todos los aislamientos fueron identificados bioquímicamente y caracterizados por serotipificación, fagotipificación y detección del gen flaA por reacción en cadena de la polimerasa (PCR. Se generaron perfiles de bandas de ADN mediante la amplificación de secuencias repetitivas de consenso intergénico de enterobacterias (ERIC-PCR. De acuerdo a los resultados obtenidos por ERIC

  3. Management of Pregnant Women With Presumptive Exposure to Listeria monocytogenes.

    Science.gov (United States)

    2014-08-05

    : Listeriosis is predominantly a foodborne illness, with sporadic and outbreak-related cases tied to consumption of food contaminated with listeria (Listeria monocytogenes). The incidence of listeriosis associated with pregnancy is approximately 13 times higher than in the general population. Maternal infection may present as a nonspecific, flu-like illness with fever, myalgia, backache, and headache, often preceded by diarrhea or other gastrointestinal symptoms. However, fetal and neonatal infections can be severe, leading to fetal loss, preterm labor, neonatal sepsis, meningitis, and death. Pregnant women have been advised to avoid foods with a high risk of contamination with listeria. An exposed pregnant woman with a fever higher than 38.1°C (100.6°F) and signs and symptoms consistent with listeriosis for whom no other cause of illness is known should be simultaneously tested and treated for presumptive listeriosis. No testing, including blood and stool cultures, or treatment is indicated for an asymptomatic pregnant woman who reports consumption of a product that was recalled or implicated during an outbreak of listeria contamination. A pregnant woman who ate a product that was recalled because of listeria contamination and who is afebrile but has signs and symptoms consistent with a minor gastrointestinal or flu-like illness can be managed expectantly.

  4. [A case of Listeria monocytogenes meningitis in an immunocompetent infant].

    Science.gov (United States)

    Pattarino, G; Arrigoni, S; Grazioli, R; De Palma, A; di Natale, B

    2006-08-01

    Listeria Monocytogenes meningitis is a rare affection after the neonatal period, but in immunocompromised patients. Listeria Monocytogenes is a Gram-positive, facultative intracellular bacterium frequently causing infection in pregnant women, in patients with cell-mediated immunity deficit and in the early and late stages of life. We present a case of Listeria Monocytogenes meningitis in an immunocompetent nomad 8-month-child, preceded by gastroenteritis. Although gastrointestinal symptoms may be due to intestinal infection by Listeria, the concomitant presence of other bacteric or viral enteric pathogens may have promoted bacterium intestinal translocation and generated disseminated disease. The main transmission route of infection after the neonatal period is ingestion of contaminated food. A diet history was taken after isolation of the bacterium in liquor and showed that the child was an eater of undercooked hot-dogs. Despite the frequency of clinical complication in such affection, the outcome in this patient was a complete recovery. Although the infection is extremely infrequent in healthy children, physicians should always consider Listeria as a possible etiologic agent of meningitis in pediatric patients, regardless of their age or immunological status, especially in patients living in precarious sanitary conditions, where weaning times and conditions are not respected and a suitable food cooking is not assured.

  5. [Characteristic of Listeria spp. bacteria isolated from food products].

    Science.gov (United States)

    Majczyna, Danuta; Białasiewicz, Danuta

    2006-01-01

    The frequency of occurrance of Listeria strains in different food products was determined. Biochemical characteristic of the isolated strains was achieved in accordance with procedure included in PNEN ISO 11290 standard, genus was determined byApiListeria (bioMéieux) test. Sensitivity to selected antibacterial medicines was investigated using disck method and Mueller-Hinton 2 Agar medium. From the 577 examinated food samples 126 strains of Listeria were isolated and among them: 34.1% L. monocytogenes, 36,5% L. welshimeri, 19.0% L. innocua, 3.17% L. grayi, 0.79% L. seeligeri, 0.79% L. seeligeri/welshinmeri and 5.56% L. ivelshimeri/innocua. L. monocytogenes strains most often were found in minced pork, culinary products and in frozen vegetables. On the base of ApiListeria (bioMéieux) test the isolated L. monocytogenes strains were qualified into 2 biochemical types. It was found that all L. monocytogenes were sensitive to sulphametaksazol/trimetoprim and ampicyllin, 25% of strains were moderatety sensitive to penicillin and only 2 L. monocytogenes strains were resistant to gentamicin. Presence of Listeria spp. microorganisms in food products may be an production hygiene indicator for critical control point and show the possibility of contamination with L. monocytogenes strains.

  6. Origens da vida Origins of life

    Directory of Open Access Journals (Sweden)

    Augusto Damineli

    2007-04-01

    Full Text Available Apresentamos um panorama geral das idéias sobre a origem da vida na história. Após delinearmos os principais temas necessários para o entendimento da origem da vida, mostramos as características básicas da vida atual e as relações entre os seres vivos que sugerem um ancestral comum. Revemos as condições químicas pré-bióticas no ambiente terrestre e fora dele. Quanto ao aparecimento da vida, confrontamos as principais vertentes sobre a precedência do código genético ou do metabolismo. Evidenciamos a curta janela de tempo para o estabelecimento da vida na Terra, indicando a facilidade de esse processo ocorrer no Universo. Finalmente, são apresentados os fundamentos dos projetos atuais de procura de vida fora de nosso planeta.We present a historical perspective about the ideas concerning the origin of life. After displaying the main topics necessary for understanding life’s origin, the main characteristics of the present life forms and their relationships are shown, suggesting a common ancestor. The conditions for prebiotic chemistry in terrestrial or interplanetary environments are reviewed. We put in context the arguments about the early origin of replicators versus metabolism. The very narrow window for life settlement in the early Earth is stressed, pointing to the likelihood of life arising in other places in the Universe. Finally, we present the cornerstones of current search for life outside our planet.

  7. Maltose and maltodextrin utilization by Listeria monocytogenes depend on an inducible ABC transporter which is repressed by glucose.

    Directory of Open Access Journals (Sweden)

    Shubha Gopal

    2010-04-01

    Full Text Available In the environment as well as in the vertebrate intestine, Listeriae have access to complex carbohydrates like maltodextrins. Bacterial exploitation of such compounds requires specific uptake and utilization systems.We could show that Listeria monocytogenes and other Listeria species contain genes/gene products with high homology to the maltodextrin ABC transporter and utilization system of B. subtilis. Mutant construction and growth tests revealed that the L. monocytogenes gene cluster was required for the efficient utilization of maltodextrins as well as maltose. The gene for the ATP binding protein of the transporter was located distant from the cluster. Transcription analyses demonstrated that the system was induced by maltose/maltodextrins and repressed by glucose. Its induction was dependent on a LacI type transcriptional regulator. Repression by glucose was independent of the catabolite control protein CcpA, but was relieved in a mutant defective for Hpr kinase/phosphorylase.The data obtained show that in L. monocytogenes the uptake of maltodextrin and, in contrast to B. subtilis, also maltose is exclusively mediated by an ABC transporter. Furthermore, the results suggest that glucose repression of the uptake system possibly is by inducer exclusion, a mechanism not described so far in this organism.

  8. Isolamento de bactérias láticas produtoras de bacteriocinas e sua aplicação no controle de Listeria monocytogenes em queijo frescal de leite de cabra

    OpenAIRE

    Danielle Nader Furtado

    2010-01-01

    Listeria monocytogenes causa a listeriose, uma doença zoonótica grave que causa infecções do sistema nervoso central (meningite, encefalite e meningoencefalite), bacteremia primária e septicemia. A doença apresenta baixa morbidade e alta mortalidade e acomete, principalmente, grupos de risco, como mulheres grávidas, neonatos, indivíduos imunocomprometidos e idosos. L. monocytogenes tem sido encontrada com freqüência em alimentos in natura e/ou processados, como queijos e outros produtos lácte...

  9. Tinta indeleble. Guillermo Cano vida y obra

    OpenAIRE

    Bejarano, Diana Ximena; Universidad de San Buenaventura

    2013-01-01

    Recoger un legado de 42 años de vida periodística y transitar los espacios familiares y de amigos de uno de los cronistas más importantes de Colombia es el propósito del libro Tinta indeleble. Guillermo Cano vida y obra. De esta manera, la fundación que lleva su nombre da a conocer con una narrativa acogedora, las mejores vivencias de un profesional empírico que a lo largo de su trayectoria fundó los principios éticos y morales del periodismo colombiano. El libro hace un recuento histórico y ...

  10. Miguel Fisac Serna. Arquitecto. Vida y obra.

    OpenAIRE

    Rojo Tejerina, Juan Jesús

    2013-01-01

    Se pretende realizar una recopilación de datos acerca de la figura de Miguel Fisac, tanto referentes a su vida privada, como profesional, ya que ambas están muy relacionadas entre sí. Este compendio de información me sirve para conocer las diferentes etapas por las que ha ido discurriendo su larga vida y su trayectoria profesional. Estas etapas son: - Década de los 40, predomina el estilo clasicista. - Década de los 50, utilización de nuevas soluciones espaciales, formales y const...

  11. Specific biological properties of Listeria innocua spp. isolated in Primorye Territory

    Directory of Open Access Journals (Sweden)

    E. A. Zaitseva

    2017-01-01

    Full Text Available Rationale: Most cases of listeriosis are caused by the pathogenic Listeria monocytogenes. Some cases of isolation of L.  innocua with pathogenicity factors from foods have been published, as well as on the cases of the disease in humans caused by this species. Aim: To assess biological properties including potential pathogenicity of L.  innocua, isolated from food and environmental objects. Materials and methods: We performed microbiological study of L. innocua cultures isolated from foods (n=35 and environmental objects (n=15 on the territory of Primorye Territory (Russian Federation, as well as assessment of their sensitivity to antibiotics. Results: The studied L.  innocua cultures showed stable phenotypic features of their biological properties, such as morphology, typical colony growth on the medium with characteristic odor of fermented milk, blue or blue-green luminescence induced by inclined light, presence of catalase activity and absence of the oxidase activity. Only 38±6.9% of L.  innocua demonstrated movements at T 22 °С. L.  innocua cultures did not ferment mannitol (100% of cultures; they degraded ramnose to its acid without gas (70±6.5% and degraded xylose (42.8±7%. Listeria isolated from vegetables and environmental objects could ferment ramnose (92.8±7.2% of the studied cultures and xylose (28.5±12.5% more frequently than L. innocua isolated from meat and fish foods. L.  innocua demonstrated variable biochemical activities towards mannose (92±3.8%, saccharose (85.7±7.8% and melesitose (76.2±9.5%. L. innocua cultures with hemolytic activity (34±6.7% (α or β  type were isolated, more commonly from fish products. All Listeria irrespective of their isolation source showed lipase activity. L.  innocua cultures from foods and environmental objects were highly sensitive to antimicrobials from the following classes: penicillins (ampicillin, carbenicillin, combined amoxicillin and clavulanic acid, aminoglycosides

  12. Green fluorescent protein labeling of Listeria, Salmonella, and Escherichia coli O157:H7 for safety-related studies.

    Directory of Open Access Journals (Sweden)

    Li Ma

    Full Text Available Many food safety-related studies require tracking of introduced foodborne pathogens to monitor their fate in complex environments. The green fluorescent protein (GFP gene (gfp provides an easily detectable phenotype so has been used to label many microorganisms for ecological studies. The objectives of this study were to label major foodborne pathogens and related bacteria, including Listeria monocytogenes, Listeria innocua, Salmonella, and Escherichia coli O157:H7 strains, with GFP and characterize the labeled strains for stability of the GFP plasmid and the plasmid's effect on bacterial growth. GFP plasmids were introduced into these strains by a CaCl(2 procedure, conjugation or electroporation. Stability of the label was determined through sequential propagation of labeled strains in the absence of selective pressure, and rates of plasmid-loss were calculated. Stability of the GFP plasmid varied among the labeled species and strains, with the most stable GFP label observed in E. coli O157:H7. When grown in nonselective media for two consecutive subcultures (ca. 20 generations, the rates of plasmid loss among labeled E. coli O157:H7, Salmonella and Listeria strains ranged from 0%-30%, 15.8%-99.9% and 8.1%-93.4%, respectively. Complete loss (>99.99% of the plasmid occurred in some labeled strains after five consecutive subcultures in the absence of selective pressure, whereas it remained stable in others. The GFP plasmid had an insignificant effect on growth of most labeled strains. E. coli O157:H7, Salmonella and Listeria strains can be effectively labeled with the GFP plasmid which can be stable in some isolates for many generations without adversely affecting growth rates.

  13. Green fluorescent protein labeling of Listeria, Salmonella, and Escherichia coli O157:H7 for safety-related studies.

    Science.gov (United States)

    Ma, Li; Zhang, Guodong; Doyle, Michael P

    2011-04-04

    Many food safety-related studies require tracking of introduced foodborne pathogens to monitor their fate in complex environments. The green fluorescent protein (GFP) gene (gfp) provides an easily detectable phenotype so has been used to label many microorganisms for ecological studies. The objectives of this study were to label major foodborne pathogens and related bacteria, including Listeria monocytogenes, Listeria innocua, Salmonella, and Escherichia coli O157:H7 strains, with GFP and characterize the labeled strains for stability of the GFP plasmid and the plasmid's effect on bacterial growth. GFP plasmids were introduced into these strains by a CaCl(2) procedure, conjugation or electroporation. Stability of the label was determined through sequential propagation of labeled strains in the absence of selective pressure, and rates of plasmid-loss were calculated. Stability of the GFP plasmid varied among the labeled species and strains, with the most stable GFP label observed in E. coli O157:H7. When grown in nonselective media for two consecutive subcultures (ca. 20 generations), the rates of plasmid loss among labeled E. coli O157:H7, Salmonella and Listeria strains ranged from 0%-30%, 15.8%-99.9% and 8.1%-93.4%, respectively. Complete loss (>99.99%) of the plasmid occurred in some labeled strains after five consecutive subcultures in the absence of selective pressure, whereas it remained stable in others. The GFP plasmid had an insignificant effect on growth of most labeled strains. E. coli O157:H7, Salmonella and Listeria strains can be effectively labeled with the GFP plasmid which can be stable in some isolates for many generations without adversely affecting growth rates.

  14. Limitation in the detection of Listeria monocytogenes in food in the presence of competing Listeria innocua.

    Science.gov (United States)

    Oravcová, K; Trncíková, T; Kuchta, T; Kaclíková, E

    2008-02-01

    Detectability of Listeria monocytogenes at 10(0) CFU per food sample in the presence of Listeria innocua using standard microbiological detection was evaluated and compared with the real-time PCR-based method. Enrichment in half-Fraser broth followed by subculture in Fraser broth according to EN ISO 11290-1 was used. False-negative detection of 10(0) CFU L. monocytogenes was obtained in the presence of 10(1) CFU L. innocua per sample using the standard detection method in contrast to more than 10(5) CFU L. innocua per sample using real-time PCR. Identification of L. monocytogenes on the chromogenic medium by the standard procedure was impossible if L. innocua was able to overgrow L. monocytogenes by more than three orders of magnitude after the enrichment in model samples. These results were confirmed using naturally contaminated food samples. Standard microbiological method was insufficient for the reliable detection of 10(0) CFU L. monocytogenes in the presence of more than 10(0) CFU of L. innocua per sample. On the other hand, if the growth of L. monocytogenes was sufficient to reach the concentration equal to the detection limit of PCR, the amount of the other microflora present in the food sample including L. innocua was not relevant for success of the PCR detection of L. monocytogenes. After the enrichment, the PCR detection is more convenient than the standard one as PCR detection is not compromised by other present microflora.

  15. Evaluation of applied biosystems MicroSEQ real-time PCR system for detection of Listeria spp. in food and environmental samples.

    Science.gov (United States)

    Petrauskene, Olga V; Cao, Yanxiang; Zoder, Patrick; Wong, Lily Y; Balachandran, Priya; Furtado, Manohar R; Tebbs, Robert S

    2012-01-01

    A complete system for real-time PCR detection of Listeria species was validated in five food matrixes and five environmental surfaces, namely, hot dogs, roast beef, lox (smoked salmon), pasteurized whole cow's milk, dry infant formula, stainless steel, plastic cutting board, ceramic tile, rubber sheets, and sealed concrete. The system consists of the MicroSEQ Listeria spp. Detection Kit, two sample preparation kits (PrepSEQ Nucleic Acid Extraction Kit and PrepSEQ Rapid Spin Sample Preparation Kit), the Applied Biosystems 7500 Fast Real-Time PCR instrument, and the RapidFinderTM Express v1.1 Software for data analysis. The test method was compared to the ISO 11290-1 reference method using an unpaired study design. The MicroSEQ Listeria spp. Detection Kit and the ISO 11290-1 reference method showed equivalent detection based on Chi-square analysis for all matrixes except hot dogs. For hot dogs, the MicroSEQ method detected more positives than the reference method for the low- and high-level inoculations, with all of the presumptive positives confirmed by the reference method. An independent validation study confirmed these findings on lox and stainless steel surface. The MicroSEQ kit detected all 50 Listeria strains tested and none of the 31 nontarget bacteria strains.

  16. Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

    DEFF Research Database (Denmark)

    Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

    2017-01-01

    dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

  17. COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    G. Tantillo

    2013-02-01

    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  18. Comparison of conventional culture method and fluorescent in situ hybridization technique for detection of Listeria spp. in ground beef, turkey, and chicken breast fillets in İzmir, Turkey.

    Science.gov (United States)

    Baysal, Ayse Handan

    2014-12-01

    The occurrence of Listeria species in refrigerated fresh chicken breast fillet, turkey breast fillet, and ground beef was evaluated, comparing the conventional culture method and fluorescent in situ hybridization (FISH). FISH uses hybridization of a nucleic acid sequence target of a microorganism with a specific DNA probe labeled with a fluorochrome and imaging by a fluorescence microscope. First, Listeria was inoculated in chicken breast fillet, turkey breast fillet, or ground beef, and the applicability of the FISH method was evaluated. Second, Listeria was detected in fresh chicken breast fillet, turkey breast fillet, and ground beef by culture and FISH methods. Listeria was isolated from 27 (37.4%) of 216 samples by the standard culture method, whereas FISH detected 25 (24.7%) preenriched samples. Of these isolates, 17 (63%) were L. innocua, 6 (22%) L. welshimeri, and 4 (14.8%) L. seeligeri. Overall, the prevalences of Listeria spp. found with the conventional culture method in chicken breast fillet, turkey breast fillet, and ground beef were 9.7, 6.9, and 20.8%, whereas with the FISH technique these values were 11.1, 6.9, and 16.7%, respectively. The molecular FISH technique appears to be a cheap, sensitive, and time-efficient procedure that could be used for routine detection of Listeria spp. in meat. This study showed that retail raw meats are potentially contaminated with Listeria spp. and are, thus, vehicles for transmitting diseases caused by foodborne pathogens, underlining the need for increased precautions, such as implementation of hazard analysis and critical control points and consumer food safety education.

  19. How does Listeria monocytogenes combat acid conditions?

    Science.gov (United States)

    Smith, James L; Liu, Yanhong; Paoli, George C

    2013-03-01

    Listeria monocytogenes, a major foodborne pathogen, possesses a number of mechanisms that enable it to combat the challenges posed by acidic environments, such as that of acidic foods and the gastrointestinal tract. One mechanism employed by L. monocytogenes for survival at low pH is the adaptive acid tolerance response (ATR) in which a short adaptive period at a nonlethal pH induces metabolic changes that allow the organism to survive a lethal pH. Overcoming acid conditions by L. monocytogenes involves a variety of regulatory responses, including the LisRK 2-component regulatory system, the SOS response, components of the σ(B) regulon, changes in membrane fluidity, the F0F1-ATPase proton pump, and at least 2 enzymatic systems that regulate internal hydrogen ion concentration (glutamate decarboxylase and arginine deiminase). It is not clear if these mechanisms exert their protective effects separately or in concert, but it is probable that these mechanisms overlap. Studies using mutants indicate that the glutamate decarboxylase system can protect L. monocytogenes when the organism is present in acidic juices, yogurt, salad dressing, mayonnaise, and modified CO2 atmospheres. The glutamate decarboxylase system also has a role in protecting L. monocytogenes against the acidic environment of the stomach. There is a need to study other acid resistance mechanisms of L. monocytogenes to determine their effectiveness in protecting the organism in acidic foods or during transit through the acid stomach.

  20. Silver As Antibacterial toward Listeria monocytogenes.

    Science.gov (United States)

    Belluco, Simone; Losasso, Carmen; Patuzzi, Ilaria; Rigo, Laura; Conficoni, Daniele; Gallocchio, Federica; Cibin, Veronica; Catellani, Paolo; Segato, Severino; Ricci, Antonia

    2016-01-01

    Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs) or silver nitrate (AgNO3). Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  1. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba

    2016-04-01

    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  2. [A Listeria breast abscess in a man].

    Science.gov (United States)

    Marsaudon, E; Berthy, J; Mamoune, S; Deniel, A; Ksiyer, S; Tiuca, D

    2018-01-09

    Listeriosis is a food-borne illness leading to bacteriemia or central nervous system infection especially in pregnant women or high-risk patients. It is rarely a localized infection. Breast contamination has rarely been reported in lactating women. We report a breast abscess in man. A 80 year old man, hypertensive and arrhythmic, was explored for weakness and dehydration. Type 2 diabetes and chronic lymphocytic leukemia were diagnosed. Clinical examination disclosed a breast abcess related to L monocytogenes infection. Histopathological study also revealed a breast subcutaneous infiltration by chronic lymphocytic leukemia. Listeriosis sometimes uncover an unknown immunosuppression, especially in the elderly. Breast is a non-sterile tissue containing a stable microbiome partly from digestive origin. It can thereby be contaminated by Listeria. The specific cutaneous infiltrate of chronic lymphocytic leukemia can create the conditions for a local infection. Copyright © 2017 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  3. Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.

    Science.gov (United States)

    Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo

    2014-12-01

    This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were pregnant women and immunocompromised individuals.

  4. The evolution and epidemiology of Listeria monocytogenes in Europe and the United States.

    Science.gov (United States)

    Lomonaco, Sara; Nucera, Daniele; Filipello, Virginia

    2015-10-01

    Listeria monocytogenes is an opportunistic food-borne pathogen responsible for listeriosis, a disease associated with high mortality rates. L. monocytogenes causes invasive syndromes and case-fatality can be as high as 30%, in specific high-risk population groups such as the elderly, immuno-compromised individuals, fetuses and newborns. Acquisition of the disease is mainly due to consumption of contaminated (predominantly ready-to-eat) food. We aimed to provide a state-of-the-art collection of different likely evolutionary models, based on recombination and positive selection, and the phylogenetic relationship between lineages of L. monocytogenes and between them and other Listeria species. We described the most recent findings in comparative pan-genomics, considering the core and accessory genome in relation to virulence and adaptation to different environments. Finally, this review illustrates L. monocytogenes epidemiology and transmission in humans, foods and animals, the surveillance systems of the European Union and United States and the application of molecular techniques as a core tool in epidemiological investigation. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Incidence of Listeria spp. and Listeria monocytogenes in a poultry processing environment and in poultry products and their rapid confirmation by multiplex PCR.

    OpenAIRE

    Lawrence, L M; Gilmour, A

    1994-01-01

    The incidence of Listeria spp. and Listeria monocytogenes in a poultry processing plant and in raw and cooked poultry products was determined over a 6-month period. Within the raw and cooked poultry processing environments, 46% (36 of 79) and 29% (51 of 173) of the samples contained Listeria spp. while 26% (21 of 79) and 15% (27 of 173) contained L. monocytogenes, respectively. Various sites within the processing environment were found to be consistently positive for L. monocytogenes througho...

  6. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  7. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  8. Antimicrobial susceptibility of listeria monocytogenes from food products

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Knöchel, Susanne; Hasman, Henrik

    2007-01-01

    This study was conducted to determine the susceptibility of Listeria monocytogenes isolated from food products to antimicrobial agents commonly used for treatment of infections with gram-positive bacteria, and to disinfectants. A total of 114 L. monocytogenes retail isolates were tested for susce......This study was conducted to determine the susceptibility of Listeria monocytogenes isolated from food products to antimicrobial agents commonly used for treatment of infections with gram-positive bacteria, and to disinfectants. A total of 114 L. monocytogenes retail isolates were tested...

  9. Listeria spp. occurrence in equipments and processing plants of meat/ Listeria spp. ocorrência em equipamentos e ambientes de processamento de carne bovina

    Directory of Open Access Journals (Sweden)

    Luís Augusto Nero

    2004-05-01

    Full Text Available Exopolysaccharides, biopolymers or hydrosolubles gums, are produced by a great variety of microorganisms and possess physical, structural and chemical properties quite homogeneous, in relation to derived from algae and plants. The production is relatively independent on climatic conditions, faster obtaining of the finished product and need small space. Biopolymers have been studied thoroughly in the last years. Due to wide diversity in structure and physical properties, the microbial polysaccharides possess a lot of applications in food, pharmaceutical, oil, cosmetics, textile, inks and agricultural products among others industries. Some of those applications, include uses as emulsifying, stabilizing, binding, jellifying, clotting, lubricants, film coated, thickening and suspender agents. The parameters that have most influenced the process of exopolysaccharides biosyntheses have been the microorganism, the culture medium composition, pH and temperature of incubation. The exopolysaccharide production can be developed by species of Gram-negative and Gram-positive bacteria, some microalgae and many moulds. This work discusses the influence of these parameters during the production process and exopolysaccharides biosyntheses by bacteria.O objetivo desta pesquisa foi estabelecer a ocorrência de Listeria monocytogenes em diversos pontos de plantas de processamento de carne bovina em 01 abatedouro e 05 casas de carnes localizados na região norte do Paraná. Para a detecção de Listeria spp. em 124 amostras de equipamentos/utensílios e instalações, utilizou-se a metodologia preconizada pelo United States Departament of Agriculture (USDA, com identificação das espécies por testes bioquímicos e posterior confirmação pelo API Listeria (bioMérieux. Os resultados obtidos indicaram freqüências de 6,25% de L. monocytogenes; 68,75% de L. innocua; 18,75% de L. welshimeri; 4,17% de L. seeligeri e 2,08% de L. grayi. As amostras positivas para L

  10. Georges Canguilhem: sobre vida e conhecimento da vida [Georges Canguilhem: on life and knowledge of life

    Directory of Open Access Journals (Sweden)

    Filicio Mulinari

    2016-06-01

    Full Text Available Tendo como fundamento as obras de Georges Canguilhem, sobretudo a obra O normal e o patológico e os escritos "O pensamento e o vivente" e "O conceito e a vida", este artigo busca analisar o modo como Georges Canguilhem entende as noções de vida e conhecimento de vida, relacionando ambos os conceitos e indicando, nas linhas teóricas do filósofo francês, como é possível conhecimento o sobre a vida e o vivente. O artigo, inicialmente passando pelos conceitos de normal e patológico, buscará situar e fundamentar o conceito de vida enquanto "atividade normativa". Após isso, na segunda parte, buscará expor o tratamento dado por Canguilhem aos problemas relativos ao conhecimento da vida, analisando as questões histórico-filosóficas relacionadas ao problema e, por fim, as descobertas da biologia contemporânea que permitiram a Canguilhem lançar novos caminhos ao tema tratado.

  11. Calidad de vida y felicidad: no es exactamento lo mismo

    NARCIS (Netherlands)

    R. Veenhoven (Ruut)

    2001-01-01

    textabstractLa " Calidad de vida" se concibe como un amplio concepto que abarca tres significados: 1) Calidad del entorno en que vivimos; 2) Calidad de acción y 3) Disfrute subjetivo de la vida. La " Felicidad " se incluye en este último significado. Se define como la apreciación completa de la vida

  12. Ozone Inactivation of Acid Stressed Listeria Monocytogenes and Listeria Innocua in Orange Juice Using a Bubble Column

    OpenAIRE

    Patil, Sonal; Valdramidis, Vasilis; Frias, Jesus Maria; Cullen, Patrick; Bourke, Paula

    2010-01-01

    Orange juice inoculated with Listeria monocytogenes strains ATCC 7644, NCTC 11994 and Listeria innocua NCTC 11288 (106 CFU/ml) as challenge microorganisms was treated with direct ozone at 0.098mg/min/ml for different time periods (0-8 min) using an ozone bubble column. Ozone treatment of mild acid stressed and mild acid stress-habituated (pH 5.5) cells of L. monocytogenes resulted in higher inactivation times compared to control non-acid stressed cells. Additionally acid stressed cells habitu...

  13. Antibiotic susceptibility of Listeria monocytogenes in Argentina.

    Science.gov (United States)

    Prieto, Mónica; Martínez, Claudia; Aguerre, Lorena; Rocca, María Florencia; Cipolla, Lucía; Callejo, Raquel

    2016-02-01

    Listeria monocytogenes is the causative agent of listeriosis, a food-borne disease that mainly affects pregnant women, the elderly, and immunocompromised patients. The primary treatment of choice of listeriosis is the combination of ampicillin or penicillin G, with an aminoglycoside, classically gentamicin. The second-choice therapy for patients allergic to β-lactams is the combination of trimethoprim with a sulfonamide (such as co-trimoxazole). The aim of this study was to analyze the antimicrobial susceptibility profile of strains isolated from human infections and food during the last two decades in Argentina. The minimal inhibitory concentration (MIC) of 8 antimicrobial agents was determined for a set of 250 strains of L. monocytogenes isolated in Argentina during the period 1992-2012. Food-borne and human isolates were included in this study. The antibiotics tested were ampicillin, chloramphenicol, trimethoprim-sulfamethoxazole, erythromycin, gentamicin, penicillin G, tetracycline and rifampicin. Breakpoints for penicillin G, ampicillin and trimethoprim-sulfamethoxazole were those given in the CLSI for L. monocytogenes. CLSI criteria for staphylococci were applied to the other antimicrobial agents tested. Strains were serotyped by PCR, and confirmed by an agglutination method. Strains recovered from human listeriosis patients showed a prevalence of serotype 4b (71%), with the remaining 29% corresponding to serotype 1/2b. Serotypes among food isolates were distributed as 62% serotype 1/2b and 38% serotype 4b. All antimicrobial agents showed good activity. The strains of L. monocytogenes isolated in Argentina over a period of 20 years remain susceptible to antimicrobial agents, and that susceptibility pattern has not changed during this period. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  14. [Listeria monocytogenes meningitis in children in France].

    Science.gov (United States)

    Crouzet-Ozenda, L; Haas, H; Bingen, E; Lécuyer, A; Levy, C; Cohen, R

    2008-12-01

    Listeriosis is a serious invasive disease which affects mainly pregnant women, newborns and immunocompromised adults. To analyze specifically the epidemiological and clinical data of the meningitis due to Listeria monocytogenes (Lm), from the French Network of Surveillance of Bacterial Meningitis in childhood. Patients were aged 0 to 18 years. The diagnosis was based on a combination of a feverish meningeal syndrome and a positive culture of cerebrospinal fluid (CSF) and/or a positive PCR in the CSF and/or positive blood culture associated with a pleiocytose. Among 2539 cases of bacterial meningitis recorded in 6 years (2001 to 2006), 18 cases were due to Lm (0.7 %) (sex ratio M / F : 0.8). The average of age was 2.5 years (median : 0.5 ; ext : 0-15.1). The serotype of Lm was 4B in half of the cases. Most cases have occured in summer and autumn. Two patients presented an acquired or congenital immunodeficiency. Fifty-six percent (n=10) were younger than 1 year, among them, 7 were newborns. The CSF direct microbiologic investigation was suggestive of Lm (Gram positive bacilli) only in two cases, but the culture of CSF was positive for 16 patients and the blood culture was positive for 2 other patients. Three of 18 patients died between 7 and 13 days after admittance : a premature baby of 25 weeks'gestational age, two full-term newborns of 2 days and 1.5 months old. The mortality rate was 16.7 % before the age of 1 year (no death after this age). Meningitis due to Lm remains a rare disease, including in neonatal period. The recent increase of cases in adults requires to maintain vigilance in children especially since direct examination of CSF can rarely allow the diagnosis.

  15. A New Perspective on Listeria monocytogenes Evolution

    Science.gov (United States)

    Ragon, Marie; Wirth, Thierry; Hollandt, Florian; Lavenir, Rachel; Lecuit, Marc; Le Monnier, Alban; Brisse, Sylvain

    2008-01-01

    Listeria monocytogenes is a model organism for cellular microbiology and host–pathogen interaction studies and an important food-borne pathogen widespread in the environment, thus representing an attractive model to study the evolution of virulence. The phylogenetic structure of L. monocytogenes was determined by sequencing internal portions of seven housekeeping genes (3,288 nucleotides) in 360 representative isolates. Fifty-eight of the 126 disclosed sequence types were grouped into seven well-demarcated clonal complexes (clones) that comprised almost 75% of clinical isolates. Each clone had a unique or dominant serotype (4b for clones 1, 2 and 4, 1/2b for clones 3 and 5, 1/2a for clone 7, and 1/2c for clone 9), with no association of clones with clinical forms of human listeriosis. Homologous recombination was extremely limited (r/m<1 for nucleotides), implying long-term genetic stability of multilocus genotypes over time. Bayesian analysis based on 438 SNPs recovered the three previously defined lineages, plus one unclassified isolate of mixed ancestry. The phylogenetic distribution of serotypes indicated that serotype 4b evolved once from 1/2b, the likely ancestral serotype of lineage I. Serotype 1/2c derived once from 1/2a, with reference strain EGDe (1/2a) likely representing an intermediate evolutionary state. In contrast to housekeeping genes, the virulence factor internalin (InlA) evolved by localized recombination resulting in a mosaic pattern, with convergent evolution indicative of natural selection towards a truncation of InlA protein. This work provides a reference evolutionary framework for future studies on L. monocytogenes epidemiology, ecology, and virulence. PMID:18773117

  16. Human heat-shock protein 60 receptor-coated paramagnetic beads show improved capture of Listeria monocytogenes in the presence of other Listeria in food.

    Science.gov (United States)

    Koo, O K; Aroonnual, A; Bhunia, A K

    2011-07-01

    To investigate the suitability of human Hsp60, a receptor for Listeria adhesion protein (LAP), on paramagnetic beads (PMB) to capture Listeria monocytogenes from food in the presence of other Listeria to facilitate rapid and specific detection of this pathogen. Commercially available streptavidin-coated PMBs were linked with biotinylated Hsp60 (PMB-Hsp60), and the bacterial capture efficiency from pure culture and meat samples was determined. Capture rate was also compared with the monoclonal antibody (MAb)-C11E9-coated beads (PMB-C11E9) and the commercial Dynabeads anti-Listeria. Captured cells were detected and quantified by plating on selective medium, quantitative real-time PCR (qPCR) and a light-scattering sensor. Overall, all ligand-coated beads had similar capture efficiency (varied from 1·8 to 9·2%) for L. monocytogenes under the conditions employed, and the minimum cell number required to achieve such capture was 10³ CFU ml⁻¹. PMB-Hsp60 had significantly greater capture efficiency for pathogenic Listeria (P Listeria. In contrast, PMB-C11E9 and Dynabeads anti-Listeria had similar capture efficiency for both. The efficacy of all PMBs to capture L. monocytogenes in the presence of Listeria innocua from food matrices was compared. Although Dynabeads anti-Listeria had the overall best capture efficiency, PMB-Hsp60 was able to selectively capture L. monocytogenes even in the presence of 10-100-fold more L. innocua cells from enriched meat samples. Data show that the human cell receptor, Hsp60, is suitable for the capture of pathogenic Listeria on PMB in the presence of other Listeria in food. As pathogen interaction with host cells is highly specific, host cell receptors could be used as alternate capture molecules on PMB to aid in specific detection of pathogens. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  17. Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.

    Science.gov (United States)

    Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando

    2012-01-01

    Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.

  18. Listeria Monocytogenes: a rare cause of endophthalmitis, a case report

    Directory of Open Access Journals (Sweden)

    Katherine M. Gaskell

    2017-01-01

    Diagnostic delay commonly occurs in endogenous endophthalmitis and exacerbates an already poor visual prognosis. Listeria spp. must be considered in ocular inflammation following gastroenteritis. The intraocular inflammation subsided but surgical intervention was required to remove vitreous debris and improve visual acuity.

  19. Invasive Listeria monocytogenes infections in the Netherlands, 1995-2003

    NARCIS (Netherlands)

    Doorduyn, Y.; de Jager, C. M.; van der Zwaluw, W. K.; Wannet, W. J. B.; van der Ende, A.; Spanjaard, L.; van Duynhoven, Y. T. H. P.

    2006-01-01

    In order to add to the limited data available about the incidence of invasive Listeria monocytogenes infection in the Netherlands, two studies were conducted. In the first study, data on hospital patients with listeriosis in the period 1995-2003 were obtained from the National Medical Registration

  20. Microbial quality and prevalence of Salmonella and Listeria in eggs

    Directory of Open Access Journals (Sweden)

    Manijeh Mahdavi

    2012-01-01

    Full Text Available Aims: This study was undertaken to determine the microbial quality and the prevalence of Salmonella and Listeria in table eggs in Isfahan, Iran. Materials and Methods: A total of 525 samples were randomly collected from various shops in Isfahan, Iran. Microbial quality of eggs evaluated by coliform count and total bacterial viable counts. Also, detection of Listeria and Salmonella in egg contents and on eggs shells was performed. Results: The mean of total viable bacteria and coliform counts in the egg contents were 3.95 × 10 4 CFU/g and 4.94 × 10 3 CFU/g, respectively. Salmonella and Listeria were not found on the shell or content of eggs. Enterobacteriaceae families were found in 357 of 525 (68.28% and 276 of 525 (52.44% of egg shell and egg content samples, respectively. Moreover, Pseudomonas aeruginosa was isolated from 175 (33.41% and 144 (25.37% of egg shell and egg content, respectively. The isolated Enterobacteriaceae were included: Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Buttiauxella agrestis, Cedecea lapagei, Cedecea davisae and Erwinia herbicola. Conclusion: The findings of the present study indicate although Salmonella and Listeria were not found in egg samples; however, there is an urgent need to improve the hygienic level of consumed eggs.

  1. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    Prof. Ogunji

    Bacterial infections were reported as major causes (Smith et al., 2009). This was supported by the isolation of Staphylococcus aureus, Streptococcus agalactiae, Escherichia coli, Bacillus spp and Listeria monocytogenes from aborted placenta bits by Mirdamadi (2005) and Kaur et al. (2007) in some cases of spontaneous ...

  2. Presence of Listeria monocytogenes in silage products of Shahrekord city

    Directory of Open Access Journals (Sweden)

    Ali Sharifzadeh

    2015-06-01

    Full Text Available Objective: To investigate the presence of Listeria monocytogenes in the silage samples. Methods: Silage samples obtained from 150 different farms in Shahrekord city (Iran and after DNA extraction, all samples were analyzed by PCR technique using one pair of primers for presence of this pathogen. The amplified products were detected on 1.5% agarose gel electrophoresis. Results: Listeria monocytogenes was isolated in 4 (2% of the 150 samples. The detection of this bacterium from silage samples in Shahrekord city indicated that these products could create a serious risk in public health of animal and human. The findings showed that in positive silage samples for Listeria monocytogenes, the pH value was about five and it was due to bacterial activity in these products. Conclusions: The quality of silage and hygiene parameters and good herd health management play an important role in the microbiological quality of herd and farm. Considering the high specificity and sensitivity of the employed PCR technique, it is recommended to be useful technique for identification of Listeria monocytogenes.

  3. Effect of Listeria monocytogenes inoculation, sodium acetate and ...

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... combination treatments. Key words: Listeria monocytogenes, nisin, sodium acetate, microbial quality, chemical quality, grass carp. ... Eight batches were dipped in pre-chilled (4°C) aqueous solution. (0, 0.1 and 0.2% nisin ... serial solution was prepared with a normal saline (0.85% NaCl) and used for the ...

  4. Studies on the risk assessment of Listeria monocytogenes

    NARCIS (Netherlands)

    Notermans, S.; Dufrenne, J.; Teunis, P.; Chackraborty, T.

    1998-01-01

    Humans are frequently exposed to Listeria monocytogenes, and high numbers may be ingested during consumption of certain types of food. However, epidemiological investigations show that listeriosis is a rare disease. Risk assessment studies using an animal mouse model indicate that almost all L.

  5. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  6. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  7. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  8. Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

    African Journals Online (AJOL)

    One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

  9. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

  10. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  11. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...

  12. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...

  13. Antibiotic resistant pattern of environmental isolates of Listeria ...

    African Journals Online (AJOL)

    Incidence of Listeria monocytogenes in cow manure, agricultural soil, and common vegetables sold in major markets in Ado-Ekiti, Nigeria was determined. Antibiotic resistant pattern of the isolates was examined by paper disk assay. A total of 196 environmental samples were cultured on a selective medium out of which ...

  14. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...

  15. Neonatal infection with Listeria monocytogenes: Rare, but serious

    NARCIS (Netherlands)

    Van Stuijvenberg, M.; Spanjaard, L.; Bergman, K.A.

    2006-01-01

    Between 1993 and 2003, three infants, two girls and a boy, were found to have an invasive infection with Listeria monocytogenes. They received intensive care including respiratory and circulatory support, antibiotics, and treatment of the neurological complications when possible. One of the girls

  16. Listeria monocytogenes : the nature, public health aspects and ...

    African Journals Online (AJOL)

    New food borne infectious diseases have continued to emerge world over in the food industries. Listeria monocytogenes, an intracellular bacterium has become an emerging food borne pathogen that causes listeriosis; a zoonotic disease, posing serious risks to public health; in livestock industries, pregnant mothers, ...

  17. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  18. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  19. Bacteriocin from Honeybee Beebread Enterococcus avium, Active against Listeria monocytogenes

    Science.gov (United States)

    Audisio, M. Carina; Terzolo, Horacio R.; Apella, María C.

    2005-01-01

    Enterococcus avium isolated from Apis mellifera beebread produces a thermoresistant bacteriocin with a strain-dependent inhibitory effect on Listeria and without effect on gram-negative bacteria. The bacteriocin appeared to be a polypeptide of about 6 kDa. Genetic analyses revealed no extrachromosomal material in E. avium. PMID:15933045

  20. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  1. Listeria monocytogenes Biofilms in the Wonderland of Food Industry

    Science.gov (United States)

    Colagiorgi, Angelo; Bruini, Ilaria; Di Ciccio, Pierluigi Aldo; Zanardi, Emanuela; Ghidini, Sergio; Ianieri, Adriana

    2017-01-01

    The foodborne pathogen Listeria monocytogenes is a concern in food safety because of its ability to form biofilm and to persist in food industry. In this mini-review, the issue represented by this pathogen and some of the latest efforts performed in order to investigate the composition of biofilms formed by L. monocytogenes are summarized. PMID:28869552

  2. Utilization of exogenous siderophores and natural catechols by Listeria monocytogenes.

    OpenAIRE

    Simon, N.; Coulanges, V; Andre, P.; Vidon, D J

    1995-01-01

    Listeria monocytogenes does not produce siderophores for iron acquisition. We demonstrate that a number of microbial siderophores and natural iron-binding compounds are able to promote the growth of iron-starved L. monocytogenes. We suggest that the ability of L. monocytogenes to use a variety of exogenous siderophores and natural catechols accounts for its ubiquitous character.

  3. Listeria monocytogenes Biofilms in the Wonderland of Food Industry.

    Science.gov (United States)

    Colagiorgi, Angelo; Bruini, Ilaria; Di Ciccio, Pierluigi Aldo; Zanardi, Emanuela; Ghidini, Sergio; Ianieri, Adriana

    2017-09-04

    The foodborne pathogen Listeria monocytogenes is a concern in food safety because of its ability to form biofilm and to persist in food industry. In this mini-review, the issue represented by this pathogen and some of the latest efforts performed in order to investigate the composition of biofilms formed by L. monocytogenes are summarized.

  4. Listeria monocytogenes Biofilms in the Wonderland of Food Industry

    Directory of Open Access Journals (Sweden)

    Angelo Colagiorgi

    2017-09-01

    Full Text Available The foodborne pathogen Listeria monocytogenes is a concern in food safety because of its ability to form biofilm and to persist in food industry. In this mini-review, the issue represented by this pathogen and some of the latest efforts performed in order to investigate the composition of biofilms formed by L. monocytogenes are summarized.

  5. GROWTH OF NATURALLY OCCURING Listeria innocua IN COPPA DI TESTA

    Directory of Open Access Journals (Sweden)

    G. Merialdi

    2010-06-01

    Full Text Available Coppa di testa is a traditional cooked pork salami produced in different Italian regions. The main raw material is deboned meat of pork head with the addition of tongue and rind. After a long (3-5 h high temperature (97°C cooking, additives and flavourings are added and the salami is prepared. After cooling the salami is often portioned and vacuum- packaged. In this study the growth of naturally occurring contamination of Listeria innocua in three batches of vacuum packaged Coppa di testa, stored at 4°C for 80 days, is described. The average max was 0.24 (days-1 and the average doubling time was 2.87 days. The maximum growth level ranged from 4.90 to 8.17 (log10 cfu/g. These results indicate that Coppa di testa definitely supports the growth of Listeria innocua in the considered storage conditions. Taking into account that at 4°C Listeria monocytogenes strains are associated with higher grow rates than L. innocua, these results emphasize the importance of preventing Listeria monocytogenes contamination in the production stages following cooking.

  6. 4610 Volume 11 No. 2 March 2011 OCCURRENCE OF LISTERIA ...

    African Journals Online (AJOL)

    user

    2011-03-02

    Mar 2, 2011 ... Listeria spp. was higher in bulked raw milk than in fermented milk. ... insufficiently heat-treated milk is still practiced among some communities. Fermented dairy products, produced at small-scale, are normally produced using ..... Eyles MJ Trends in food borne disease and implications for the dairy industry.

  7. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  8. LISTERIA MONOCYTOGENES IN THE CONTEXT OF THE NEW COMMUNITY REGULATIONS

    Directory of Open Access Journals (Sweden)

    A. Bragagnolo

    2008-02-01

    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  9. Longitudinal studies on Listeria in smoked fish plants: impact of intervention strategies on contamination patterns.

    Science.gov (United States)

    Lappi, Victoria R; Thimothe, Joanne; Nightingale, Kendra Kerr; Gall, Kenneth; Scott, Virginia N; Wiedmann, Martin

    2004-11-01

    Four ready-to-eat smoked fish plants were monitored for 2 years to study Listeria contamination patterns and the impact of plant-specific Listeria control strategies, including employee training and targeted sanitation procedures, on Listeria contamination patterns. Samples from the processing plant environment and from raw and finished product were collected monthly and tested for Listeria spp. and Listeria monocytogenes. Before implementation of intervention strategies, 19.2% of raw product samples (n = 276), 8.7% of finished product samples (n = 275), and 26.1% of environmental samples (n = 617) tested positive for Listeria spp. During and after implementation of Listeria control strategies, 19.0% of raw product samples (n = 242), 7.0% of finished product samples (n = 244), and 19.5% of environmental samples (n = 527) were positive for Listeria spp. In one of the four fish plants (plant 4), no environmental samples were positive for L. monocytogenes, and this plant was thus excluded from statistical analyses. Based on data pooled from plants 1, 2, and 3, environmental Listeria spp. prevalence was significantly lower (P Listeria prevalence for floor drains was similar before and after implementation of controls (49.6 and 54.2%, respectively). Regression analysis revealed a significant positive relationship (P Listeria control strategies. Molecular subtyping (EcoRI ribotyping) revealed that specific L. monocytogenes ribotypes persisted in three processing plants over time. These persistent ribotypes were responsible for all six finished product contamination events detected in plant 1. Ribotype data also indicated that incoming raw material is only rarely a direct source of finished product contamination. While these data indicate that plant-specific Listeria control strategies can reduce cross-contamination and prevalence of Listeria spp. and L. monocytogenes in the plant environment, elimination of persistent L. monocytogenes strains remains a considerable

  10. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)

    ALESSANDRA PARO RODRIGUES CESAR

    2011-06-01

    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  11. Identification and Characterization of a Peptidoglycan Hydrolase, MurA, of Listeria monocytogenes, a Muramidase Needed for Cell Separation

    OpenAIRE

    Carroll, Shannon A.; Hain, Torsten; Technow, Ulrike; Darji, Ayub; Pashalidis, Philippos; Joseph, Sam W.; Chakraborty, Trinad

    2003-01-01

    A novel cell wall hydrolase encoded by the murA gene of Listeria monocytogenes is reported here. Mature MurA is a 66-kDa cell surface protein that is recognized by the well-characterized L. monocytogenes-specific monoclonal antibody EM-7G1. MurA displays two characteristic features: (i) an N-terminal domain with homology to muramidases from several gram-positive bacterial species and (ii) four copies of a cell wall-anchoring LysM repeat motif present within its C-terminal domain. Purified rec...

  12. METÁFORAS DA VIDA PLENA

    Directory of Open Access Journals (Sweden)

    Eunice Terezinha Piazza Gai

    2007-08-01

    Full Text Available O texto constitui uma reflexão sobre a metáfora da vida plena associada às idéias de utopia e de paraíso perdido, presentes em dois textos narrativos. Um, intitulado “Quando a vida era plena não existia a história”, pertence ao livro de Thomas Merton, A via de Chuang Tzu e o outro, “O sonho de um homem ridículo”, é de Dostoievski. O estudo volta-se para a análise dos textos narrativos, para alguns aspectos teóricos sobre a metáfora e para a linguagem, colocando em pauta a dupla face de que esta se constitui: portadora de sentido e ao mesmo tempo, testemunha da incompletude e carência humanas.

  13. Invasive Listeria monocytogenes infections in the Netherlands, 1995-2003.

    Science.gov (United States)

    Doorduyn, Y; de Jager, C M; van der Zwaluw, W K; Wannet, W J B; van der Ende, A; Spanjaard, L; van Duynhoven, Y T H P

    2006-07-01

    In order to add to the limited data available about the incidence of invasive Listeria monocytogenes infection in the Netherlands, two studies were conducted. In the first study, data on hospital patients with listeriosis in the period 1995-2003 were obtained from the National Medical Registration (study 1). In the second study, hospital discharge letters for patients whose Listeria isolates were received by the Netherlands Reference Laboratory for Bacterial Meningitis (NRLBM) in the period 1999-2003 were retrieved (study 2). Serotyping and pulsed-field gel electrophoresis (PFGE) were used to subtype the various strains of Listeria. These reviews revealed 283 hospital patients and 159 patients with Listeria isolates. Discharge letters were received for 107 (67%) patients. The mean annual incidence of listeriosis in both studies was 2.0 per million inhabitants. The main clinical manifestations were meningitis (incidence: 0.9 and 1.0 per million in studies 1 and 2, respectively) and septicaemia (incidence: 0.08 and 1.0 per million, respectively). Listeriosis in pregnancy was rare (incidence: 1.3 and 2.4 per 100,000 pregnancies over 24 weeks of gestation, respectively). Predisposing conditions were present in 47 and 71% of the patients in studies 1 and 2, respectively. The mortality due to listeriosis was 18%. Serotypes 4b, 1/2a, and 1/2b were responsible for 96% of the cases of human listeriosis. Listeriosis is rare in the Netherlands, but its clinical course is severe and the resulting mortality is high. Therefore, the current recommendations for pregnant women to avoid high-risk foods should be continued. These dietary recommendations should also be given to individuals with predisposing conditions, since they, too, are at risk of Listeria infection.

  14. Inhibition of listeriolysin O oligomerization by lutein prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Liu, Bowen; Teng, Zihao; Wang, Jianfeng; Lu, Gejin; Deng, Xuming; Li, Li

    2017-01-01

    The foodborne pathogenic bacterial species Listeria monocytogenes (L. monocytogenes) has caused incalculable damages to public health, and its successful infection requires various virulence factors, including Listeriolysin O (LLO). By forming pores in phagosomal membranes and even in some organelles, LLO plays an indispensable role in the ability of L. monocytogenes to escape from host immune attacks. Because of its critical role, LLO offers an appropriate therapeutic target against L. monocytogenes infection. Here, lutein, a natural small molecule existing widely in fruits and vegetables, is demonstrated as an effective inhibitor of LLO that works by blocking its oligomerization during invasion without showing significant bacteriostatic activity. Further assays applying lutein in cell culture models of invasion and in animal models showed that lutein could effectively inhibit L. monocytogenes infection. Overall, our results indicate that lutein may represent a promising and novel therapeutic agent against L. monocytogenes infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Optical biosensors with an integrated Mach-Zehnder Interferometer for detection of Listeria monocytogenes.

    Science.gov (United States)

    Sarkar, Dibyo; Gunda, Naga Siva Kumar; Jamal, Iqbal; Mitra, Sushanta K

    2014-08-01

    In this work, we have demonstrated an efficient optical immunoassay technique for the detection of a food-borne pathogen, Listeria monocytogenes, using a Mach-Zehnder Interferometer (MZI) configuration. We have investigated ten different MZI configurations with angular and Sbend Y-junction geometries. An efficient Hydrofluoric acid (HF) based technique was used for rapid and specific binding of L. monocytogenes to the sensor arm of the MZI biosensor. The MZI biosensor was able to detect L. monocytogenes at concentrations of the order of 10(5) CFU/ml, which is lower than the infection dose for healthy human beings. SEM analysis and light intensity measurements showed the biosensor is highly selective to L. monocytogenes over other microbial species (such as Escherichia coli). Finally, a novel calibration scheme of the MZI biosensor was developed from experimental data that can be used for determining unknown concentrations of L. monocytogenes.

  16. Listeria monocytogenes Infection in a Sugar Glider (Petaurus breviceps) - New Mexico, 2011.

    Science.gov (United States)

    Nichols, M; Takacs, N; Ragsdale, J; Levenson, D; Marquez, C; Roache, K; Tarr, C L

    2015-06-01

    Listeria monocytogenes is a Gram-positive, facultative anaerobic, rod-shaped bacterium that can infect and cause disease in many species. In this case report, we describe a case of L. monocytogenes infection causing sepsis in a sugar glider (Petaurus breviceps). The sugar glider consumed a varied diet consisting of human food items, including cantaloupe. A nationwide outbreak of L. monocytogenes foodborne illness associated with cantaloupes occurred simultaneously with this incident case. In this case, the bacterial strains from the outbreak and glider were genetically distinct. Although rare, veterinarians should be aware of the emergence of foodborne pathogens' ability to infect exotic animals residing in domestic environments. © 2014 Blackwell Verlag GmbH.

  17. SUEÑO Y CALIDAD DE VIDA

    Directory of Open Access Journals (Sweden)

    Gualberto Buela-Casal

    2005-06-01

    Full Text Available Existe una estrecha interrelación entre los procesos de sueño y el estado general de salud física y psicológica de una persona. En el presente artículo se revisan algunas de las principales líneas de investigación que abordan las relaciones entre el sueño y la calidad de vida. Se analiza la influencia de los diferentes patrones de sueño (patrón de sueño corto, intermedio y largo y de la calidad del sueño (sueño eficiente/no eficiente en la salud y la calidad de vida. Se examinan las consecuencias sobre la salud de ciertos cambios en el sueño que son muy frecuentes en nuestro actual estilo de vida, tales como la privación de sueño o el trabajar en un sistema de turnos rotatorios o de trabajo nocturno, y de algunos de los trastornos del sueño más importantes como el insomnio o la apnea. El sueño es sin duda un excelente indicador del estado de salud de las personas tanto en muestras clínicas como en la población general. El desarrollo de estrategias preventivas y de intervención que reduzcan las alteraciones del sueño redundará en una mejor calidad de vida.

  18. Isolation and lytic activity of the Listeria bacteriophage endolysin LysZ5 against Listeria monocytogenes in soya milk.

    Science.gov (United States)

    Zhang, Hui; Bao, Hongduo; Billington, Craig; Hudson, J Andrew; Wang, Ran

    2012-08-01

    The endolysin gene (lysZ5) from the genome of the Listeria monocytogenes phage FWLLm3 was cloned in Escherichia coli and characterized. Comparative sequence analysis revealed that lysZ5 resembled the murein hydrolase ply511 encoded by L. monocytogenes phage A511. The encoded protein LysZ5 had a predicted molecular mass of 35.8 kDa and was expressed in E. coli as an N-terminal fusion protein of 41.5 kDa. Addition of purified fusion protein to lawns of indicator bacteria showed that LysZ5 could lyse L. monocytogenes, Listeria innocua and Listeria welshimeri, but not Staphylococcus aureus or Enterococcus faecalis. The purified protein was able to kill L. monocytogenes growing in soya milk, with the pathogen concentration reduced by more than 4 log₁₀ CFU ml⁻¹ after 3 h incubation at 4 °C. As far as we know, this is the first report of a Listeria phage endolysin to control pathogens in soya milk and to demonstrate endolysin activity in foods at refrigeration temperatures. Moreover, LysZ5 may also be useful for biocontrol in other ready-to-eat foods. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Qualidade de vida de adolescentes modelos profissionais

    Directory of Open Access Journals (Sweden)

    Luciana Pires

    Full Text Available Muitas adolescentes deixam suas famílias para seguir a profissão de modelo, sonhando com um futuro glamoroso. O presente estudo caso-controle analisou a qualidade de vida de 74 adolescentes do sexo feminino, sendo 37 modelos, agenciadas em São Paulo, com delineamento transversal, utilizando o World Health Organization Quality of Life - versão breve (WHOQOL-BREF, que avalia qualidade de vida global e os domínios físico, psicológico, social e ambiental. Utilizou-se o Critério Brasil 2008, para avaliação do nível socioeconômico e para parear o grupo controle. Em geral, o grupo de modelos obteve médias superiores ao grupo de não modelos, sendo esta diferença significante apenas no domínio psicológico. Observou-se que as adolescentes modelos apresentaram uma qualidade de vida semelhante à das não modelos.

  20. Qualidade de vida na epilepsia infantil

    Directory of Open Access Journals (Sweden)

    SOUZA ELISABETE ABIB PEDROSO DE

    1999-01-01

    Full Text Available A epilepsia é desordem crônica que ocorre principalmente na infância e adolescência. Tradicionalmente, o tratamento da epilepsia enfatiza aspectos neurológicos mais do que fatores psicológicos. A aten��ão voltada simplesmente para o controle das crises no contexto clínico pode não ser suficiente para entender a grande amplitude de problemas que afetam a qualidade de vida das crianças com epilepsia. Muitas das dificuldades psicossociais dos adultos com epilepsia desenvolvem-se a partir de complicações associadas ao início da doença. Crianças com epilepsia têm alta prevalência de problemas de comportamento e aprendizagem. Avaliar a qualidade de vida em crianças com epilepsia é importante, especialmente porque elas passam por períodos críticos de desenvolvimento, durante os quais são desenvolvidas habilidades cognitivas e sociais. A fim de instrumentalizar o profissional que atende crianças epilépticas, este estudo apresenta um inventário simplificado de qualidade de vida, no qual são abordados aspectos culturais, pessoais, sociais e relacionamento familiar e social. Esta investigação possibilita maior conhecimento sobre a criança e um melhor direcionamento nas condutas terapêuticas.

  1. PROGRAMA DE ATENDIMENTO À ADOLESCENTES GRÁVIDAS E A CONSTRUÇÃO DE UM PROJETO DE VIDA

    OpenAIRE

    Kudlowiez, Sara

    2013-01-01

    O objetivo deste de trabaho foi compreender o projetode vida de adolescentes grávidas. Para tanto, foram investigadas suas expectativas de futuro antes e após a gravidez, e, posteriormente, se a gravidez fazia parte de seus projetos de vida. Percebeu-se que a maioria das adolescentes entrevistadas não planejou a gravidez, nem sequer tinha pensado sobre a gravidez em si , e nas prováveis repercussões desse fato em suas vidas. Participaram da pesquisa, 16 adolescentes grávidas, na faixa etária ...

  2. RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

    Science.gov (United States)

    Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

    2012-01-01

    Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

  3. Listeria phospholipases subvert host autophagic defenses by stalling pre-autophagosomal structures

    Science.gov (United States)

    Tattoli, Ivan; Sorbara, Matthew T; Yang, Chloe; Tooze, Sharon A; Philpott, Dana J; Girardin, Stephen E

    2013-01-01

    Listeria can escape host autophagy defense pathways through mechanisms that remain poorly understood. We show here that in epithelial cells, Listeriolysin (LLO)-dependent cytosolic escape of Listeria triggered a transient amino-acid starvation host response characterized by GCN2 phosphorylation, ATF3 induction and mTOR inhibition, the latter favouring a pro-autophagic cellular environment. Surprisingly, rapid recovery of mTOR signalling was neither sufficient nor necessary for Listeria avoidance of autophagic targeting. Instead, we observed that Listeria phospholipases PlcA and PlcB reduced autophagic flux and phosphatidylinositol 3-phosphate (PI3P) levels, causing pre-autophagosomal structure stalling and preventing efficient targeting of cytosolic bacteria. In co-infection experiments, wild-type Listeria protected PlcA/B-deficient bacteria from autophagy-mediated clearance. Thus, our results uncover a critical role for Listeria phospholipases C in the inhibition of autophagic flux, favouring bacterial escape from host autophagic defense. PMID:24162724

  4. Formylpeptide receptors are critical for rapid neutrophil mobilization in host defense against Listeria monocytogenes

    Science.gov (United States)

    Liu, Mingyong; Chen, Keqiang; Yoshimura, Teizo; Liu, Ying; Gong, Wanghua; Wang, Aimin; Gao, Ji-Liang; Murphy, Philip M.; Wang, Ji Ming

    2012-01-01

    Listeria monocytogenes (Listeria) causes opportunistic infection in immunocompromised hosts with high mortality. Resistance to Listeria depends on immune responses and recruitment of neutrophils of the immune system into infected sites is an early and critical step. Mouse neutrophils express two G protein-coupled formylpeptide receptor subtypes Fpr1 and Fpr2 that recognize bacterial and host-derived chemotactic molecules including Listeria peptides for cell migration and activation. Here we report deficiency in Fprs exacerbated the severity of the infection and increased the mortality of infected mice. The mechanism involved impaired early neutrophil recruitment to the liver with Fpr1 and Fpr2 being sole receptors for neutrophils to sense Listeria chemoattractant signals and for production of bactericidal superoxide. Thus, Fprs are essential sentinels to guide the first wave of neutrophil infiltration in the liver of Listeria-infected mice for effective elimination of the invading pathogen. PMID:23139859

  5. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  6. Listeria monocytogenes - kvantitatiivisen määritysmenetelmän validointi

    OpenAIRE

    Riihiaho, Matti

    2012-01-01

    Listeria monocytogenes on elintarvikelaboratorioissa tutkittava patogeeninen bakteeri, joka voi pahimmillaan aiheuttaa jopa kuoleman ihmiselle. Listeria monocytogenes on gram-positiivinen bakteeri, jota esiintyy yleisesti maaperässä, eläimissä, kasveissa, vedessä ja rehuissa. Listeria-sukuun kuuluu seitsemän eri lajia, joista L. monocytogenes on ainoa, joka voi aiheuttaa ruokamyrkytyksiä ihmiselle. Riskiryhmiin kuuluvat vastustuskyvyltään alentuneet ihmiset kuten vanhukset, raskaana olevat, v...

  7. [Construction and Fluorescence Analysis of the Recombinant Listeria ivanovii Strain Expressing Green Fluorescent Protein].

    Science.gov (United States)

    Zhang, Xiang; Su, Lin; Liu, Si-Jing; Li, Yong-Yu; Jiang, Ming-Juan; Huang, Huan; Wang, Chuan

    2017-11-01

    Constructing the recombinant Listeria ivanovii strain expressing green fluorescent protein to provide an important tool for study of Listeria ivanovii. The promoter of Listeria monocytogenes Listeriolysin O (phly) and the green fluorescent protein (GFP) gene were fused by SOEing PCR,and then ligated the fusion gene into plasmid pCW to result in recombinant plasmid pCW-phly-GFP. Recombinant plasmid was electroporated into Listeria ivanovii,and fluorescence microscope was used to analyze the expression of GFP. To observe the stability of recombinant plasmid and the stable expression of GFP in Listeria ivanovii,bacteria were cultured in the BHI broth with or without erythromycin for several generations. The stability of recombinant plasmid pCW-phly-GFP and fluorescent protein in each generation of bacteriawas studied by extracting plasmids and observing fluorescence. The exactness of recombinant plasmid pCW-phly-GFP was confirmed with restrictive endonuclease assay and sequence analysis. Under the fluorescence microscope,the green fluorescence was obvious in Listeria ivanovii carried with pCW-phly-GFP. The recombinant plasmid pCW-phly-GFP was stable in Listeria ivanovii and the GFP kept expressing in a high level under the pressure of erythromycin. The prokaryotic expression plasmid pCW-phly-GFP containing GFP gene was successfully constructed. Listeria ivanovii carried with the plasmid efficiently expressed GFP. This research provides an important tool for further study of Listeria ivanovii as a vaccine carrier.

  8. Specific gene probe for detection of biotyped and serotyped Listeria strains.

    OpenAIRE

    Notermans, S; Chakraborty, T; Leimeister-Wächter, M; Dufrenne, J; Heuvelman, K J; Maas, H; Jansen, W; Wernars, K; Guinee, P

    1989-01-01

    A total of 284 strains of Listeria, including all known serovars and biovars together with Listeria grayi and Listeria murrayi, were biotyped and serotyped. Biotyping and serotyping could be done in 2 days. A gene probe encoding a delayed hypersensitivity factor (DTH) was used in the detection of pathogenic biotypes and serotypes of the tested strains. The gene was found in all 117 tested Listeria monocytogenes strains of serogroups 1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4c, 4d, 4e, 4ab, and 7. It was...

  9. Diversity of the genus Listeria in slaughterhouse and factories of the poultry industry

    Directory of Open Access Journals (Sweden)

    Artur Smânia Júnior

    2006-12-01

    Full Text Available One of the aims of microbial diversity studies is to indicate the structure of a community in a specific place, allowing species identification and population quantification. Food factories need to be monitored for contamination by surface analyses, indicating a possible flux of pathogens in order that they may be interrupted before the contamination of the final product occurs. Combining studies of microbial diversity with contamination control programs, it is possible to identify species and to track possible routes of contamination. The study was restricted to an important bacterium affecting a single sample factory. The genus Listeria comprises six species, and L. monocytogenes is a human pathogenic bacterium. The study pointed to the uninterrupted flux of two species of the genus (L. innocua and L. welshimeri from possible sources of contamination to points of contact with the final product. However, the bacterium L. monocytogenes was only found at the sources. Concerning genus diversity, a community of 66.07% of L. innocua, 17.86% of L. monocytogenes, 15.18% of L. welshimeri and 0.89% L. grayi murray was identified.

  10. InlB-mediated Listeria monocytogenes internalization requires a balanced phospholipase D activity maintained through phospho-cofilin

    NARCIS (Netherlands)

    Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li

    Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into

  11. Concepción energética y universal de la vida

    OpenAIRE

    Morales Macedo, Carlos

    2010-01-01

    La vida es independiente de la materia; La vida es consubstancial con el universo; La vida actúa como una energía superior; Difusión, circulación y continuidad de la vida; Universalidad de la vida; El nuevo concepto ante las clásicas doctrinas fundamentales de la vida; La nueva concepción de la vida ante las modernas teorías organicistas; Resumen y conclusiones.

  12. Estilos de vida en estudiantes universitarios

    Directory of Open Access Journals (Sweden)

    Martha Muñoz Argel

    2013-07-01

    Full Text Available Abstract This research paper aims to identify life style based on specific practices and beliefs and to analyze the socio-economical stratum at a university level. The research design is transversal and descriptive and the tool used was the Practices and Beliefs About Life Style Questionnaire. The socioeconomical stratum was established through database entry and an enrollment category assigned by the university. For the sample 180 students were chosen through a random and systematic sampling method. The results show the prevalence of a healthy life style with discrepancies between practices and beliefs. In relation to the socio-economic stratum, differences were not showed. Resumen El presente artículo de investigación tiene como objetivo identificar el estilo de vida a partir de las prácticas y las creencias, así como analizar la variable estrato socioeconómico en el contexto del nivel educativo universitario. El diseño de investigación es transversal descriptivo y el instrumento utilizado fue el Cuestionario de Prácticas y Creencias sobre el Estilo de Vida. El estrato socioeconómico se estableció mediante la base de datos de ingreso y categoría de matrícula asignada por la universidad. La muestra fue constituida por 180 estudiantes universitarios, que fueron seleccionados mediante muestreo aleatorio por conglomerado y sistemático. Los resultados muestran la prevalencia del estilo de vida saludable, con discrepancias entre prácticas y creencias, y en relación con el estrato socioeconómico, no se presentaron diferencias significativas.

  13. El prematuro: una esperanza de vida

    OpenAIRE

    Betancur R., Diana Helena; Fundación Valle de Lili; Garzón F., Lucía

    1999-01-01

    Factores prenatales de riesgo para el feto/Alteraciones inherentes a la prematuréz/Manejo del niño prematuro/ ¿Existe relación entre la actividad física y los partos prematuros?/ ¿Cómo se puede prevenir la prematuréz?/ ¿El recién nacido prematuro puede llevar una vida normal una vez es dado de alta?/ ¿Qué tipo de alimentación deberá recibir el prematuro?/ ¿Cuándo debe usted consultar a su pediatra?

  14. A vida singular de um jovem militante

    Directory of Open Access Journals (Sweden)

    Áurea Maria Guimarães

    2012-01-01

    Full Text Available Esse artigo é fruto de uma pesquisa realizada no período de 2007 a 2010, junto a jovens militantes da cidade de Campinas, com o objetivo de compreender as diferentes maneiras que conduziam esses jovens tanto a reproduzir um modelo de vida quanto a criar outras possibilidades de militância na relação com esse modelo. Entre as histórias orais de vida narradas por jovens que militavam em diferentes grupos ou instituições, escolhi a vida de Biula, representante do movimento estudantil secundarista, procurando evidenciar que a singularidade desta vida, como também e a de outros jovens, estava conectada à problematização que faziam no interior de certas práticas, histórica e culturalmente constituídas, possibilitando a criação de novas formas de subjetivação nas quais se modificava a experiência que tinham deles mesmos na relação com os seus heróis ou modelos de referência. Palavras-chave: história oral – transcriação – heróis – resistência - processos de singularização.   THE SINGULAR LIFE OF A YOUNG MILITANT ABSTRACT   This article is the result of a research carried out from 2007 to 2010 with   young militants in the city of Campinas, aiming to understand the different ways which conducted these youngsters to both reproduce a life model and create other possibilities of militancy in the relationship with this model. Among oral stories narrated by young militants from different groups or institutions, I have chosen the life of Biula, a representative of the secondary students’ movement, trying to show that the singularity of this life and other youngsters’ lives was connected to the problematization they promoted within certain practices, historically and culturally built, thus enabling the creation of new subjectification modes in which the experience they had of themselves in the relationship with their heroes or reference models has changed. Key words: oral history -  transcreation – heroes

  15. Estilo de vida y salud reproductiva

    OpenAIRE

    García-Hjarles, Marco Antonio

    2014-01-01

    El objetivo de este artículo es demostrar los efectos de los múltiples estilos de vida sobre la salud reproductiva del hombre y de la mujer. Los factores a tomar en cuenta principalmente son los siguientes: 1) la edad, 2) el consumo de drogas, 3) la dieta y el peso, 4) alguna prescripción de fármacos, 5) el estrés y 6) la contaminación ambiental. La edad del hombre o de la mujer es un factor que puede alterar la fertilidad, ya que debido al estudio, trabajo u otros factores las parejas decide...

  16. Daniel Mato: una vida de interculturalidad

    Directory of Open Access Journals (Sweden)

    Alejandro Maldonado Fermín

    2011-04-01

    Full Text Available El presente artículo es una biografía intelectual necesariamente incompleta de uno de los autores latinoamericanos contemporáneos más emblemáticos y polémicos en el campo de los estudios sobre cultura, política y comunicación: Daniel Mato. Mediante el recorrido por algunos momentos clave de su vida y la manera como éstos guardan relación con sus obras, se ofrece una panorámica de este intelectual-activista, como forma de homenajear su trayectoria intelectual.

  17. La vida social y los tratamientos

    OpenAIRE

    Ballera Rovira, Georgina

    2012-01-01

    Cada día se acentúa más la tendencia de estudiar los casos en psicología dentro de un contexto social y también de encontrar soluciones de terapia colectiva, según la gravedad del caso. Esta orientación actual es muy comprensible si se tienen en cuenta varios factores: 1) La larga estadía de los pacientes en los hospitales o clínicas mentales; 2) La necesidad de mejorar las relaciones, interpersonales entre los enfermos, los cuales por su misma enfermedad, pierden capacidad para la vida socia...

  18. Las Computadoras en la Vida del Hombre

    OpenAIRE

    González S., Fabio

    2015-01-01

    En todas las épocas de la historia del hombre es posible observar como el descubrimiento de nueva.., tecnologías ha producido cambios notorios en su sistema de vida. El uso de bs metales en la fabricación de herramientas y armas produjo cambios en los hábitos sociales del hombre primitivo. La invención de la imprenta permitió difundir los conocimientos y la cultura en forma rápida y precisa superando el método lento y caro de los manuscritos de la Edad Media. Algunas invenciones han traído co...

  19. La vida en el pensamiento caribe

    Directory of Open Access Journals (Sweden)

    Francisco Avella

    2014-02-01

    Full Text Available Para llegar a una interpretación del pensamiento caribe se puede pensar en un breve recorrido histórico que resulta insuficiente a la hora de brindar a la polifonía del caribe contemporáneo. Se hace necesario, desde este escrito, aludir a la vida cotidiana del caribe que se ofrece como una amalgama de voces que se liberan más allá de los simples estamentos políticos que toma como referente la esclavitud.

  20. Vivir las Ideas, Idear la Vida

    Directory of Open Access Journals (Sweden)

    Rodrigo Iván Sepúlveda López de Mesa.

    2008-01-01

    Full Text Available El suicidio entre los nativos, permite entender la enfermedad mental como la saturación de la adversidad, la experiencia de un lugar en el mundo estrangulado por un ethos cultural sumergido en la violencia, lleva al suicidio como un rito de paso hacia la vida de ensueño. En este sentido, la terapia es un tipo de relación con el otro, en la que tangetiality, la subjetividad y el subjuntivo efectos sociales de apoyo como una relación hacia la fexibility.

  1. Voz, trabalho docente e qualidade de vida

    OpenAIRE

    Renata Jardim

    2006-01-01

    Introdução: O estudo das relações entre o processo de trabalho docente, as reais condições sob as quais ele se desenvolve e o adoecimento vocal dos professores, constitui um desafio e uma necessidade para se entender a dinâmica saúde-doença nesse grupo populacional. Objetivos: buscou-se conhecer as diferentes conceituações de disfonia utilizadas e suas repercussões nos resultados dos estudos de prevalência dos problemas vocais em docentes. Investigou-se a qualidade de vida relacionada à voz (...

  2. Detección de Listeria spp. y Listeria monocytogenes en muestras de leche cruda y quesos artesanales respectivamente, mediante PCR en Tiempo Real

    Directory of Open Access Journals (Sweden)

    Viviana Pamela Chiluisa-Utreras

    2017-07-01

    Full Text Available Background. In Ecuador, studies about bacteria genre Listeria in artisanal cheeses are scarce, and in raw milk, practically nonexistent. Milk production is one of the main livestock activities in the province of Pichincha and it is essential to study these products. Since all the cantons that make up Pichincha are milk producers, three of them, Cayambe, Quito and Pedro Moncayo were randomly sampled. Objective. To determine Listeria spp. And Listeria monocytogenes in samples of raw milk and artisanal cheeses, respectively, using Real Time PCR. Methods. The application of the qPCR technique in the detection of microorganisms and especially of bacteria in food, is based on four fundamental aspects: its sensitivity, specificity, speed and processing capacity of large sample flow. It is possible to detect small amounts of pathogenic microorganisms, such as Listeria spp in raw milk, after extraction and quantification of total DNA. Results. In this study in raw milk, one positive was determined from a total of 60 samples, representing 1.6% of Listeria spp. and 16 positive samples of 45, representing 35.6% of Listeria monocytogenes in artisanal cheeses from three farms in the province of Pichincha. Conclusions. The results, according to the statistical analyzes carried out with the Kruskal - Wallis test, show that in Pichincha the bacterium is present in raw milk, but in non - representative quantities, whereas for Listeria monocytogenes there is statistical significance in the cheeses samples

  3. Antimicrobial Resistance Profiles of Listeria monocytogenes and Listeria innocua Isolated from Ready-to-Eat Products of Animal Origin in Spain.

    Science.gov (United States)

    Escolar, Cristina; Gómez, Diego; Del Carmen Rota García, María; Conchello, Pilar; Herrera, Antonio

    2017-06-01

    The objective of this work was to investigate the antimicrobial resistance in Listeria spp. isolated from food of animal origin. A total of 50 Listeria strains isolated from meat and dairy products, consisting of 7 Listeria monocytogenes and 43 Listeria innocua strains, were characterized for antimicrobial susceptibility against nine antimicrobials. The strains were screened by real-time PCR for the presence of antimicrobial resistance genes: tet M, tet L, mef A, msr A, erm A, erm B, lnu A, and lnu B. Multidrug resistance was identified in 27 Listeria strains, 4 belonging to L. monocytogenes. Resistance to clindamycin was the most common resistance phenotype and was identified in 45 Listeria strains; the mechanisms of resistance are still unknown. A medium prevalence of resistance to tetracycline (15 and 9 resistant and intermediate strains) and ciprofloxacin (13 resistant strains) was also found. Tet M was detected in Listeria strains with reduced susceptibility to tetracycline, providing evidence that both L. innocua and L. monocytogenes displayed acquired resistance. The presence of antimicrobial resistance genes in L. innocua and L. monocytogenes indicates that these genes may be transferred to commensal and pathogenic bacteria via the food chain; besides this, antibiotic resistance in L. monocytogenes could compromise the effective treatment of listeriosis in humans.

  4. Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

    Directory of Open Access Journals (Sweden)

    Wanessa Altimiras Costa

    2009-12-01

    Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

  5. Epidemiological Survey of Listeria monocytogenes in a gravlax salmon processing line Epidemiologia de Listeria monocytogenes em uma linha de processamento de salmão gravlax

    Directory of Open Access Journals (Sweden)

    C.D. Cruz

    2008-06-01

    Full Text Available Listeria monocytogenes is a cause of concern to food industries, mainly for those producing ready-to-eat (RTE products. This microorganism can survive processing steps such as curing and cold smoking and is capable of growing under refrigeration temperatures. Its presence in RTE fish products with extended shelf life may be a risk to the susceptible population. One example of such a product is gravlax salmon; a refrigerated fish product not exposed to listericidal processes and was the subject of this study. In order to evaluate the incidence and dissemination of L. monocytogenes 415 samples were collected at different steps of a gravlax salmon processing line in São Paulo state, Brazil. L. monocytogenes was confirmed in salmon samples (41%, food contact surfaces (32%, non-food contact surfaces (43% and of food handlers' samples (34%, but could not be detected in any ingredient. 179 L. monocytogenes isolates randomly selected were serogrouped and typed by PFGE. Most of L. monocytogenes strains belonged to serogroup 1 (73%. 61 combined pulsotypes were found and a dendrogram identified six clusters: most of the strains (120 belonged to cluster A. It was suggested that strains arriving into the plant via raw material could establish themselves in the processing environment contaminating the final product. The wide dissemination of L. monocytogenes in this plant indicates that a great effort has to be taken to eliminate the microorganism from these premises, even though it was not observed multiplication of the microorganism in the final product stored at 4ºC up to 90 days.Listeria monocytogenes é um patógenode grande preocupação para as indústrias alimentícias, principalmente aquelas produtoras de alimentos prontos para consumo (RTE. Este microrganismo pode sobreviver às etapas de cura e defumação a frio, além de tolerar temperaturas de refrigeração. A presença de L. monocytogenes em pescados RTE com vida de prateleira longa

  6. Listeria Monocytogenes: a rare cause of endophthalmitis, a case report.

    Science.gov (United States)

    Gaskell, Katherine M; Williams, Gwyn; Grant, Kathie; Lightman, Susan; Godbole, Gauri

    2017-01-01

    Listeria monocytogenes is a known cause of gastroenteritis. Invasive disease can follow bacteremia causing meningoencephalitis, endocarditis and spontaneous miscarriages in immunocompromised patients and pregnant women respectively. We present the first case in England of endogenous endophthalmitis caused by L. monocytogenes following acute gastroenteritis in an immunocompetent host. A 50-year-old South Asian female presented with acute painful unilateral visual loss occurring shortly after an episode of self-limiting gastroenteritis. On examination, the eye was very inflamed with a hypopyon uveitis. A vitreous biopsy confirmed growth of L.monocytogenes serotype 1/2a. Diagnostic delay commonly occurs in endogenous endophthalmitis and exacerbates an already poor visual prognosis. Listeria spp. must be considered in ocular inflammation following gastroenteritis. The intraocular inflammation subsided but surgical intervention was required to remove vitreous debris and improve visual acuity.

  7. Well-known but rare pathogen in neonates: Listeria monocytogenes.

    Science.gov (United States)

    Cekmez, F; Tayman, C; Saglam, C; Cetinkaya, M; Bedir, O; Gnal, A; Tun, T; Sarici, S Ü

    2012-10-01

    Listeria monocytogenes is a very important life-threatening bacteria in certain risk groups such as neonates, pregnant women, elderly people, transplant recipients and others with impaired cell-mediated immunity. However, its infections are very rare in healthy children. Reports of listeriosis in newborn period are limited. We report a case of neonatal listeriosis with erythematous rash, intractable convulsions, severe early neonatal sepsis, disseminated intravascular coagulation, multiple organ dysfunction syndrome and death. Although an empirical antibiotic therapy including ampicillin (semisentetic penicillin) and aminoglycoside combination is effective by the means of a probable Listeria infection, the progression of the very early-onset disease may be fatal, despite vigorous treatment efforts as in our case.

  8. Case of contamination by Listeria monocytogenes in mozzarella cheese

    Directory of Open Access Journals (Sweden)

    Sara Greco

    2014-03-01

    Full Text Available Following a Listeria monocytogenes detection in a mozzarella cheese sampled at a dairy plant in Lazio Region, further investigations have been conducted both by the competent Authority and the food business operatordairy factory (as a part of dairy factory HACCP control. In total, 90 dairy products, 7 brine and 64 environmental samples have been tested. The prevalence of Listeria monocytogenes was 24.4% in mozzarella cheese, and 9.4% in environmental samples, while brines were all negatives. Forty-seven strains of L. monocytogenes have been isolated, all belonging to 4b/4e serotype. In 12 of these, the macrorestriction profile has been determined by means of pulsed field gel electrophoresis. The profiles obtained with AscI enzyme showed a 100% similarity while those obtained with ApaI a 96.78% similarity. These characteristics of the isolated strains jointly with the production process of mozzarella cheese has allowed to hypothesise an environmental contamination.

  9. Listeria Monocytogenes: a rare cause of endophthalmitis, a case report

    OpenAIRE

    Gaskell, Katherine M.; Williams, Gwyn; Grant, Kathie; Lightman, Susan; Godbole, Gauri

    2017-01-01

    Listeria monocytogenes is a known cause of gastroenteritis. Invasive disease can follow bacteremia causing meningoencephalitis, endocarditis and spontaneous miscarriages in immunocompromised patients and pregnant women respectively. We present the first case in England of endogenous endophthalmitis caused by L. monocytogenes following acute gastroenteritis in an immunocompetent host. A 50-year-old South Asian female presented with acute painful unilateral visual loss occurring shortly after a...

  10. Outbreak of Listeria monocytogenes in an urban poultry flock

    OpenAIRE

    Crespo, Rocio; Garner, Michael M; Hopkins, Sharon G; Shah, Devendra H.

    2013-01-01

    Background Listeria monocytogenes infection is most commonly recognized in ruminants, including cattle, sheep, and goats; but it is rarely diagnosed in poultry. This report describes an outbreak of L. monocytogenes in a backyard poultry flock. Also, it points out the importance of collaboration between veterinarians and public health departments and the possible implications of zoonotic diseases. Case presentation Depression, lack of appetite, labored breathing, and increased mortality were n...

  11. Inhibitory effects of raw carrots on Listeria monocytogenes.

    OpenAIRE

    Beuchat, L R; Brackett, R E

    1990-01-01

    The survival and growth of two strains of Listeria monocytogenes on raw and cooked carrots stored at 5 and 15 degrees C and in carrot juice media at 30 degrees C were investigated. The influence of shredding, chlorine treatment, and packaging under an atmosphere containing 3% O2 and 97% N2 on the behavior of L. monocytogenes and naturally occurring microflora was determined. Populations of viable L. monocytogenes decreased upon contact with whole and shredded raw carrots but not cooked carrot...

  12. Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH

    Science.gov (United States)

    Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M. Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L.; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Álvarez-Domínguez, Carmen

    2014-01-01

    The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189−201 and LLO91−99 and the GAPDH peptide, GAPDH1−22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1−22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91−99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1−22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes. PMID:24600592

  13. Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH.

    Science.gov (United States)

    Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Alvarez-Domínguez, Carmen

    2014-01-01

    The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189-201 and LLO91-99 and the GAPDH peptide, GAPDH1-22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1-22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91-99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1-22-specific CD4(+) and CD8(+) immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4(+) and CD8(+) epitopes.

  14. CELLULAR VACCINES IN LISTERIOSIS: ROLE OF THE LISTERIA ANTIGEN GAPDH.

    Directory of Open Access Journals (Sweden)

    Ricardo eCalderon-Gonzalez

    2014-02-01

    Full Text Available The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH, and several epitopes such as the LLO peptides, LLO189–201 and LLO91–99 and the GAPDH peptide, GAPDH1–22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1–22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91–99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1–22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes.

  15. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  16. Adherence characteristics of Listeria strains isolated from three ready-to-eat meat processing plants.

    Science.gov (United States)

    Kushwaha, Kalpana; Muriana, Peter M

    2009-10-01

    Over 1,560 non-food contact surface swabs and raw meat ingredient samples were collected from three ready-to-eat meat processing plants (520 from each plant) from 1998 to 1999, resulting in the recovery of 259 isolates of Listeria obtained from postprocess areas including drains, floors, garbage bins, cart wheels, walls, equipment surfaces, tables, brooms, pallet jacks, hoses, ladders, and waste chutes. We further examined 246 of the 259 isolates for adherence phenotype and used PCR to identify those that were Listeria monocytogenes. Adherence was classified as weak, moderate, or strong depending on results obtained with all Listeria isolates by using a fluorescent microplate adherence assay. Among the 246 isolates, there were 61 weakly, 148 moderately, and 37 strongly adherent Listeria, of which 130 (53%) were found to be L. monocytogenes. Plants A and B provided similar recoveries of 39 (7.5%) and 43 (8.3%) Listeria-positive isolates, including 9 (23.1% of Listeria) and 41 (95.3% of Listeria) identified as L. monocytogenes, respectively, that were weakly or moderately adherent. In plant C, we recovered 164 Listeria-positive samples (31.5% isolation rate), which included 80 L. monocytogenes-positive samples (49.8% of Listeria spp.), 52 of which were moderately adherent, as well as all 9 strongly adherent isolates of L. monocytogenes obtained in this study. Adherence properties of Listeria may allow persistence and recurrence in plant environments, potentially increasing the chance of eventual product contamination, and this emphasizes the need for sanitary approaches to prevent colonization by Listeria as well as product antimicrobial interventions should the sanitation barrier be breached.

  17. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  18. Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

    Directory of Open Access Journals (Sweden)

    N. Soultos

    2014-11-01

    Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

  19. Estudio de calidad de vida en discapacidad intelectual

    OpenAIRE

    Delgado Gutiérrez, Estrella

    2014-01-01

    El Trabajo Fin de Grado se centra en el análisis de la calidad de vida en personas atendidas en el C.E. Padre Zegrí de Valladolid, utilizando la escala de calidad de vida de Schalock y Keith. La discapacidad resulta de la interacción entre la persona y el entorno social que la rodea. Calidad de vida es el grado en el que una persona disfruta de una vida satisfactoria. Perfiles de apoyo individualizados, mejorarán el funcionamiento de los discapacitados psíquicos, su inclusión social y su cali...

  20. Kapitel 3, VIDA-Refleksionsværktøjet

    DEFF Research Database (Denmark)

    Stougaard, Karen; Nielsen, Margit Margrethe

    2013-01-01

    I dette kapitel beskrives VIDA-refleksionsværktøjet og dets anvendelse. VIDA-refleksionsværktøjet er IT-baseret værktøj, som er udviklet til at undersøge børn og voksnes handlekompetencer i daginstitutioner......I dette kapitel beskrives VIDA-refleksionsværktøjet og dets anvendelse. VIDA-refleksionsværktøjet er IT-baseret værktøj, som er udviklet til at undersøge børn og voksnes handlekompetencer i daginstitutioner...

  1. Autonomia e vulnerabilidade na vida dos adolescentes

    Directory of Open Access Journals (Sweden)

    Renata R. de Oliveira

    2007-05-01

    Full Text Available Este trabalho foi realizado com a finalidade de estabelecer relações entre os princípios éticos da autonomia e vulnerabilidade e a vida de adolescentes, pessoas reconhecidamente passíveis de síndromes depressivas, uso abusivo de drogas ilícitas, alcoolismo e tabagismo. Famílias desestruturadas, pais ausentes, companhia de amigos que levam a diferentes vícios, facilidade de acesso a fontes desencontradas de informações e uma sociedade indiferente afetam o desenvolvimento normal dos jovens. Considera-se, ainda, o grande desafio apresentado a profissionais de saúde em agir na busca de reduzir a vulnerabilidade dos adolescentes e permitir que os mesmo usem de autonomia com responsabilidade na tomada de decisões em suas vidas pessoais. O cuidado com os mesmos deve ser mais integral e ativo e a sociedade ainda não reconheceu adequadamente a importância de cuidar do desenvolvimento saudável desse imenso contingente humano.

  2. A parentalidade no ciclo de vida

    Directory of Open Access Journals (Sweden)

    André de Carvalho-Barreto

    2013-03-01

    Full Text Available Esta investigação realizou uma revisão da literatura nacional relacionada à parentalidade na Psicologia. Foi feita uma busca nas bases SciELO, PePSIC e IndexPsi, obtendo-se 32 artigos. Desses, 46% eram teóricos, 50% empíricos e 4% revisão da literatura. As principais linhas de pesquisa sobre a parentalidade localizadas nas produções foram a Parentalidade na transição de vida (f=10, a Relação de gênero na parentalidade (f=7, a Parentalidade em contextos adversos (f=7, a Parentalidade na adoção (f=5 e a Parentalidade homoafetiva (f=3. Dois dos principais resultados foram a polissemia no conceito de parentalidade e a confusão conceitual entre parentalidade e paternidade. Concluiu-se que o estudo da parentalidade é ainda recente no Brasil, por isso são necessárias mais pesquisas para ampliar sua compreensão, as quais devem incluir outras fases do desenvolvimento além da vida adulta, além de aspectos do desenvolvimento normativo.

  3. Ciencia, desarrollo humano y calidad de vida

    Directory of Open Access Journals (Sweden)

    Rocío Calderón García

    2009-01-01

    Full Text Available En la sociedad contemporánea, la ciencia y la tecnología se hanconvertido en el centro alrededor del cual se entretejen las rela-ciones sociales y la vida social. La sociedad del conocimiento,como se le ha denominado al modelo de la sociedad a la que as-piraríamos, precisamente por el desarrollo que ha tenido el cono-cimiento tecnológico y cientíęco en estos momentos, se convierteen el ámbito natural para que el tema de la tecnociencia formeparte de los procesos formativos y constitutivos de las nuevasidentidades sociales. El hecho de entender como la poblaciónincorpora los conceptos de ciencia y tecnología en sus agendasde discusión en la toma de decisiones sobre su vida y en sus ac-tividades cotidianas, se convierte hoy en día en una explicaciónnecesaria para entender los procesos de formación y expresióndel ser humano contemporáneo.

  4. Do valor da vida senciente e autoconsciente

    Directory of Open Access Journals (Sweden)

    Milene Consenso Tonetto

    2004-01-01

    Full Text Available O objetivo principal deste trabalho é analisar a posição assumida por Peter Singer em relação à questão do valor da vida dos seres humanos e não-humanos. Reconstruo, primeiramente, a argumentação desenvolvida por Singer no artigo Animals and Value of Life no qual questiona se é moralmente correto tirar a vida de animais para fins de nutrição ou experimentação. Analiso, em segundo lugar, diferentes posições, a saber: algumas tradições religiosas; os filósofos clássicos: René Descartes e Jeremy Bentham; os filósofos contemporâneos: Tom Regan e Michael Tooley; as filósofas feministas: Nel Noodings e Carol Gilligan. Finalmente, avalio criticamente o conceito de pessoa utilizado por Singer e sua posição em relação aos animais não-humanos.

  5. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Comparative genomic and morphological analyses of Listeria phages isolated from farm environments.

    Science.gov (United States)

    Denes, Thomas; Vongkamjan, Kitiya; Ackermann, Hans-Wolfgang; Moreno Switt, Andrea I; Wiedmann, Martin; den Bakker, Henk C

    2014-08-01

    The genus Listeria is ubiquitous in the environment and includes the globally important food-borne pathogen Listeria monocytogenes. While the genomic diversity of Listeria has been well studied, considerably less is known about the genomic and morphological diversity of Listeria bacteriophages. In this study, we sequenced and analyzed the genomes of 14 Listeria phages isolated mostly from New York dairy farm environments as well as one related Enterococcus faecalis phage to obtain information on genome characteristics and diversity. We also examined 12 of the phages by electron microscopy to characterize their morphology. These Listeria phages, based on gene orthology and morphology, together with previously sequenced Listeria phages could be classified into five orthoclusters, including one novel orthocluster. One orthocluster (orthocluster I) consists of large genome (~135-kb) myoviruses belonging to the genus “Twort-like viruses,” three orthoclusters (orthoclusters II to IV) contain small-genome (36- to 43-kb) siphoviruses with icosahedral heads, and the novel orthocluster V contains medium-sized-genome (~66-kb) siphoviruses with elongated heads. A novel orthocluster (orthocluster VI) of E. faecalis phages, with medium-sized genomes (~56 kb), was identified, which grouped together and shares morphological features with the novel Listeria phage orthocluster V. This new group of phages (i.e., orthoclusters V and VI) is composed of putative lytic phages that may prove to be useful in phage-based applications for biocontrol, detection, and therapeutic purposes.

  7. Listeria monocytogenes: maternal-foetal infections in Denmark 1994-2005

    DEFF Research Database (Denmark)

    Smith, Birgitte; Kemp, Michael; Ethelberg, Steen

    2009-01-01

    Maternal-foetal infection by Listeria monocytogenes is a rare complication in pregnancy. In the period 1994-2005, 37 culture-confirmed cases of maternal-foetal Listeria monocytogenes infections were reported in Denmark. We examined 36 patients' files in order to evaluate risk factors, clinical...

  8. Listeria monocytogenes and Escherichia coli septicemia and meningoencephalitis in a 7-day-old llama.

    OpenAIRE

    Frank, N; Couëtil, L L; Clarke, K A

    1998-01-01

    Listeria monocytogenes and Escherichia coli were isolated from blood collected on presentation and tissues samples taken postmortem. Listeria monocytogenes was isolated from cerebrospinal fluid collected antemortem. The importance of passive transfer of immunity, the subtlety of neurologic signs in early meningitis, and considering blood-CSF penetration in antimicrobial selection are discussed.

  9. 75 FR 47524 - Notice of Request for a Revision of a Currently Approved Information Collection (Listeria...

    Science.gov (United States)

    2010-08-06

    ... Collection (Listeria Monocytogenes Control for Ready-to-Eat Products) AGENCY: Food Safety and Inspection... information collection regarding Listeria monocytogenes (L. monocytogenes) for ready-to-eat (RTE) meat and... plant data, which supports an estimate of fewer total burden hours. DATES: Comments on this notice must...

  10. [A fatal case of Listeria monocytogenes sepsis and meningitis in a patient with Wegener's granulomatosis].

    Science.gov (United States)

    Tonkić, Marija; Grgić, Dusanka; Goić-Barisić, Ivana; Novak, Anita; Milas, Ivo; Bradarić, Nikola

    2006-12-01

    The bacillus Listeria monocytogenes is widely distributed in the environment. Listeria monocytogenes most often causes infection in the neonates, pregnant women, elderly and immunosuppressed persons. We report on a case of fatal sepsis and meningitis in a 59-year-old woman receiving cyclophosphamide and glucocorticoid therapy for Wegener's granulomatosis over a 10-year period. Listeriosis should be suspected in case of sepsis and/or meningitis in patients who receive immunosuppressive agents. Since meningitis due to Listeria monocytogenes is not distinguishable clinically from other types of bacterial meningitis, antibiotics against Listeria monocytogenes should be included in the initial empirical therapy of bacterial meningitis in immunosuppressed patients, antibiotics against Listeria monocytogenes should be included.

  11. Long-term mortality in patients diagnosed with Listeria monocytogenes meningitis: A Danish nationwide cohort study

    DEFF Research Database (Denmark)

    Roed, Casper; Engsig, Frederik Neess; Omland, Lars Haukali

    2012-01-01

    OBJECTIVES: To determine the long-term mortality, the causes of death and the incidence of cancer in listeria meningitis patients. METHODS: Nationwide, population-based cohort study including all adult patients diagnosed with listeria meningitis from 1977 to 2006 and alive 1 year after diagnosis......, and an age-and gender-matched, population control cohort. Kaplan-Meier tables, Cox regression analysis and cumulative incidence function were used as outcome analyses. RESULTS: We identified 114 listeria meningitis patients and 1026 population controls. The adjusted mortality rate ratio (MRR) for listeria...... meningitis patients the first 5 years of follow-up was 2.35(95% confidence interval (CI) 1.60-3.45) thereafter the MRR was 0.93(95% CI: 0.56-1.55). Listeria meningitis patients had an increased risk of death due to cancer the first 5 years of follow-up, and in the same period patients above 50 years of age...

  12. Reflexiones sobre la crisis. Vidas y Memorias

    Directory of Open Access Journals (Sweden)

    Estela Vázquez

    2009-11-01

    Full Text Available El artículo se plantea analizar la deslegitimación de la política y de los políticos, así como del acto de votar. Encuadrado en el marco del contexto de la crisis argentina de los últimos años, quiere responder, por medio de la entrevista oral y la historia de vida, a cómo se ve desde la ciudadanía el ejercicio de la democracia, las prácticas políticas, la alternancia en el poder y de qué forma todo esto influye en las vidas personales de los entrevistados. Asimismo, se entrelaza el análisis del espectáculo político con el público que ofrecen los medios de comunicación y de entretenimiento, con lo que se viene a concluir que es cada vez más difícil distinguir en el debate social la ficción de los hechos y personajes verdaderamente reales. Para este trabajo se analizan tres trayectorias laborales de ex-empleados de la administración pública, y sus apreciaciones sobre el despido, vinculando estas experiencias de vida a la formación de sus ideas sobre la política y los políticos.. Sus lugares de trabajo eran el Registro Civil, la Secretaría de Educación y la Legislatura, respectivamente.__________________ABSTRACT:This article tries to analyse the discredit of politics and politicians along with the act of voting. Placed in the context of the Argentine crisis, it wants to determinate through oral interview and life story how citizens see the exercise of democracy, the political practices and the power switching, to establish how they have influenced in the lifes of the persons being interviewed. At the same time, it interlaces an analysis of he political spectacle shown to the public by the media, to conclude that is becoming more a more difficult to distinguish the fiction from the real characters in the social debate.

  13. Forældreinvolvering i Vida-projektet

    DEFF Research Database (Denmark)

    Berliner, Peter; Kousholt, Dorte

    2012-01-01

    Kapitlet redegør for resultater af og diskuterer den del af et VIDA-survey, der omhandler forældresamarbejde og -involvering (VIDA-Basis+). Kapitlet præsenterer resultater vedrørende ændringer i forældresamarbejdets karakter, omfang og prioritering i de deltagende dagtilbud. Derudover foretages en...

  14. Identification of the insulin-like growth factor II receptor as a novel receptor for binding and invasion by Listeria monocytogenes.

    Science.gov (United States)

    Gasanov, Uta; Koina, Craig; Beagley, Kenneth W; Aitken, R John; Hansbro, Philip M

    2006-01-01

    The gram-positive bacterium Listeria monocytogenes causes a life-threatening disease known as listeriosis. The mechanism by which L. monocytogenes invades mammalian cells is not fully understood, but the processes involved may provide targets to prevent and treat listeriosis. Here, for the first time, we have identified the insulin-like growth factor II receptor (IGFIIR; also known as the cation-independent mannose 6-phosphate receptor (CI)M6PR or CD222) as a novel receptor for binding and invasion of Listeria species. Random peptide phage display was employed to select a peptide sequence by panning with immobilized L. monocytogenes cells; this peptide sequence corresponds to a sequence within the mannose 6-phosphate binding site of the IGFIIR. All Listeria spp. specifically bound the labeled peptide but not a control peptide, which was demonstrated using fluorescence spectrophotometry and fluorescence-activated cell sorting. Further evidence for binding of the receptor by L. monocytogenes and L. innocua was provided by affinity purification of the bovine IGFIIR from fetal calf serum by use of magnetic beads coated with cell preparations of Listeria spp. as affinity matrices. Adherence to and invasion of mammalian cells by L. monocytogenes was significantly inhibited by both the synthetic peptide and mannose 6-phosphate but not by appropriate controls. These observations indicate a role for the IGFIIR in the adherence and invasion of L. monocytogenes of mammalian cells, perhaps in combination with known mechanisms. Ligation of IGFIIR by L. monocytogenes may be a novel mechanism that contributes to the regulation of infectivity, possibly in combination with other mechanisms.

  15. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  16. CUIDADO: EIXO DA VIDA, DESAFIO DA ENFERMAGEM

    Directory of Open Access Journals (Sweden)

    Flávia Souza Ramos

    2011-01-01

    Full Text Available Neste artigo, fazemos uma reflexão sobre o que seja cuidado, cuidado de enfermagem e de algumas premissas e consequências da realização deste cuidado. Assumimos o cuidado como componente essencial para a vida e dependente do amor, com as dimensões do eu, do outro e do planeta. Na enfermagem, o desafio que se coloca é como transformar este cuidado em cuidado terapêutico no qual, sujeito enfermo e sujeito cuidador se relacionem para buscar uma maior autonomia do primeiro, sempre com base em valores como conhecimento e respeito mútuo, ou seja: como realizar um cuidado mais plástico, mais arte ao lado da técnica, conhecendo o outro a partir do seu olhar.

  17. Recuperando vidas: uma proposta de atendimento

    Directory of Open Access Journals (Sweden)

    Celeste Anunciata Baptista Dias Moreira

    2009-09-01

    Full Text Available O presente artigo busca problematizar a respeito da atuação do Serviço Social em um centro de tratamento público destinado a adolescentes usuários e usuários abusivos de drogas no Rio de Janeiro - Centro de Tratamento Recuperando Vidas - gerenciado pelo Departamento Geral de Ações Socioeducativas (DEGASE, responsável pela execução de medidas socioeducativas no referido estado. Traz, ainda, as análises relativas aos limites impostos pela execução dessa política no sistema socioeducativo que atua com adolescentes em conflito com a lei, como também destaca as possibilidades que tal campo fértil traz à profissão.

  18. Regulaciones de la vida urbana colonial

    Directory of Open Access Journals (Sweden)

    Jorge Núñez Sánchez

    2006-11-01

    Full Text Available Este ensayo analiza ciertas normas dictadas por la Corona con el propósito de regular la vida urbana a lo largo del período colonial. El artículo centra su estudio en algunas disposiciones que buscaban refrenar el desorden público y mantener el orden y las normas del "buen vivir". Bajo esta perspectiva, se analizan algunas prácticas culturales que se apartaban de estas regulaciones, entre las que se incluyeron los albazos y carnavales. Muchas de estas manifestaciones fueron percibidas por el poder colonial como muestras de primitivismo latente. No obstante, el juego de carnaval, entre otras prácticas, se mantuvo reacio a acatar estas regulaciones.

  19. Vida: Análisis de contenido

    Directory of Open Access Journals (Sweden)

    Daniel Raffo

    2015-01-01

    Full Text Available Las condiciones higiénicas, sanitarias y de salubridad en el Perú son similares al resto de pueblos de América Latina. Desatada la epidemia los medios de comunicación fueron los aliados eficaces en esta perentoria lucha contra la enfermedad y los primeros en difundir las primeras señales de alerta y las advertencias para evitar que la propagación se produjera con celeridad. Destaca el valor de la revista VIDA, suplemento de salud, semanal, modelo para imitar, que está dirigida a los sectores de más bajos ingresos, se transformó en un auxiliar en la lucha contra el cólera.

  20. "Dinkis" : marcando un nuevo estilo de vida

    OpenAIRE

    Delgado Brull, María Teresa; Gómez, Domingo

    2006-01-01

    El término «dinki» responde a las siglas en inglés «double income no kids» (doble sueldo sin hijos). Los «dinkis» son parejas de jóvenes que a pesar de convivir, tener dos sueldos y cierta holgura económica, no tienen ni desean tener hijos, para poder mantener un buen nivel de vida (dedicando buena parte de su sueldo a salir, comer fuera, viajar...). El fenómeno «dinki» no es más que la constatación de una realidad ya existente,pues según un estudio realizado por la consultora Milward Brown S...