Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007
Bennett, Sophia Elizabeth
2017-01-01
Monsieur Etienne Blanc Premier vice-président de la Région Auvergne-Rhône-Alpes Délégué aux finances, à l'administration générale, aux économies budgétaires et aux politiques transfrontalières
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...
Horseshoes in modified Chen's attractors
International Nuclear Information System (INIS)
Huang Yan; Yang Xiaosong
2005-01-01
In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map
Titanisierung von Implantatoberflächen
Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.
Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.
DEFF Research Database (Denmark)
Gimpel, Denise
been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...
Premier's imaging IR limb sounder
Kraft, Stefan; Bézy, Jean-Loup; Meynart, Roland; Langen, Jörg; Carnicero Dominguez, Bernardo; Bensi, Paolo; Silvestrin, Pierluigi
2017-11-01
The Imaging IR Limb Sounder (IRLS) is one of the two instruments planned on board of the candidate Earth Explorer Core Mission PREMIER. PREMIER stands for PRocess Exploration through Measurements of Infrared and Millimetre-wave Emitted Radiation. PREMIER went recently through the process of a feasibility study (Phase A) within the Earth Observation Envelope Program. Emerging from recent advanced instrument technologies IRLS shall, next to a millimetre-wave limb sounder (called STEAMR), explore the benefits of three-dimensional limb sounding with embedded cloud imaging capability. Such 3D imaging technology is expected to open a new era of limb sounding that will allow detailed studies of the link between atmospheric composition and climate, since it will map simultaneously fields of temperature and many trace gases in the mid/upper troposphere and stratosphere across a large vertical and horizontal field of view and with high vertical and horizontal resolution. PREMIER shall fly in a tandem formation looking backwards to METOP's swath and thereby improve meteorological and environmental analyses.
International Nuclear Information System (INIS)
Hughes, B.D.; Frankel, N.E.; Ninham, B.W.
1990-01-01
An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs
Stability analysis of distributed order fractional chen system.
Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.
Stability Analysis of Distributed Order Fractional Chen System
Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508
Complete synchronization of two Chen-Lee systems
International Nuclear Information System (INIS)
Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T
2008-01-01
This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach
Eine praktische Anwendung von CMC-Flächen in der Bionik
Apeltauer, Christian
2011-01-01
Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...
Mechanical analysis of Chen chaotic system
International Nuclear Information System (INIS)
Liang, Xiyin; Qi, Guoyuan
2017-01-01
The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.
On a conjecture of Chen-Guo-Wang
Ning, Bo; Zheng, Yu
2015-01-01
Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...
Premier Wen hails sci-tech cooperation with CERN
2004-01-01
Premier Wen Jiabao met CERN's director general Dr Robert Aymar and physicist and Nobel laureate Dr Samuel Chao Chung Ting. Premier Wen emphasied the importance for China to collaborate on fundamental science (0.5 page)
DEFF Research Database (Denmark)
Gimpel, Denise
Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...
Premier Hospital Historical Data
U.S. Department of Health & Human Services — To provide a historical overview of the participating hospitals, before the first project report, Premier Healthcare Informatics has used data already available for...
Adaptive synchronization of hyperchaotic Chen system with uncertain parameters
International Nuclear Information System (INIS)
Park, Ju H.
2005-01-01
This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme
Mastering Adobe Premiere Pro CS6
Ekert, Paul
2013-01-01
Designed to be practical and engaging, Mastering Adobe Premiere Pro CS6 is a project-based book to help you truly augment your skills and become a film editing hotshot.If you're just starting out or even migrating from existing video editing software, then this book is for you. With rapid progression through practical examples constructed to be both engaging and useful, Mastering Adobe Premiere Pro CS6 is ideal for learning the sometimes complex workflows of this powerful application.
Management and marketing of sporting events: Nike Premier Cup Project
Nedbal, Jakub
2008-01-01
Title: Management and marketing ofsporting events: Nike Premier Cup project Points of thesis: Publish the Nike Premier Cup promotion campaign project and point out improvement possibilities for upcoming years based on analysis ofpast and present state. Methods: Data will be obtained by interview, observation, description analysis and SWOT analysis Results: Promotion campaign, improvement possibilities, final day schedule Keywords: SWOT analysis, promotion, management, marketing, Nike Premier ...
Chaos in the fractional order Chen system and its control
International Nuclear Information System (INIS)
Li Chunguang; Chen Guanrong
2004-01-01
In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied
A simple observer of the generalized Chen chaotic systems
International Nuclear Information System (INIS)
Sun, Y.-J.
2009-01-01
In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.
The age grading and the Chen-Ruan cup product
DEFF Research Database (Denmark)
A. Hepworth, Richard
2010-01-01
We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....
2010-07-01
... 39 Postal Service 1 2010-07-01 2010-07-01 false Vice Chairman. 4.2 Section 4.2 Postal Service UNITED STATES POSTAL SERVICE THE BOARD OF GOVERNORS OF THE U.S. POSTAL SERVICE OFFICIALS (ARTICLE IV) § 4.2 Vice Chairman. The Vice Chairman is elected by the Governors from among the members of the Board...
Policy Advice to Alberta’s New Premier
Directory of Open Access Journals (Sweden)
Jack M. Mintz
2014-09-01
Full Text Available On September 6th, 2014, members of the Progressive Conservative Party of Alberta elected Jim Prentice as leader of their party, and Premier of Alberta. The School of Public Policy assembled its key thinkers in economic, taxation, energy and natural resource policy to provide unsolicited but important advice to Premier Prentice on some areas of policy that matter most to Alberta, and that will demand the Premier’s attention as he takes office. These are opinion pieces, are not peer reviewed, and reflect the views of their authors alone.
Energy Technology Data Exchange (ETDEWEB)
Masselot, Y; Bataller, S; Ganivet, M; Guillet, H; Robillard, A; Stosskopf, F [Commissariat a l' Energie Atomique, Cadarache (France). Centre d' Etudes Nucleaires
1968-07-01
This report is the first in a series of three describing the processes, results and peculiar technical problems related to the manufacture of the first core of the fast reactor Rapsodie. A detailed study of manufacturing processes(pellets, pins, fissile sub-assemblies), the associated testings (raw materials, processed pellets and pins, sub-assemblies before delivery), manufacturing facilities and improvements for a second campaign are described. (author) [French] Ce rapport est le premier d'une serie de trois qui decrivent les procedes, les resultats et les problemes techniques particuliers de la fabrication du du premier coeur de la pile a neutrons rapides Rapsodie. Il comporte une etude detaillee des procedes de fabrication (pastilles, aiguilles, assemblages combustibles) et des methodes de controle associees (matieres premieres, pastilles et aiguilles en cours de fabrication, assemblages fissiles avant livraison), ainsi qu'une decription complete des installations de l'atelier de fabrication et les modifications apportees pour une deuxieme campagne. (auteur)
Immunogenicity of novel sulfadimethoxide conjugates | Chen ...
African Journals Online (AJOL)
Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...
Alternative implementation of the chaotic Chen-Lee system
International Nuclear Information System (INIS)
Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.
2009-01-01
The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.
High-intensity running in English FA Premier League soccer matches
DEFF Research Database (Denmark)
Bradley, Paul S.; Sheldon, William; Wooster, Blake
2009-01-01
The aims of this study were to (1) determine the activity profiles of a large sample of English FA Premier League soccer players and (2) examine high-intensity running during elite-standard soccer matches for players in various playing positions. Twenty-eight English FA Premier League games were...
The Role of Internet in Marketing Premiering Movies
Tuohimaa, Suvi
2010-01-01
The objective of this thesis was to find out about the role of Internet today in premiering movie marketing and whether Internet is a good tool for it. The hope was to obtain new information provided by moviegoers and to contribute something useful to the art of marketing premiering movies. This thesis was a part of the School of Business and Information Management's Innomajakka-project but did not have an official commissioner, so the topic for the thesis came from the writer's personal and ...
Hopf bifurcation analysis of Chen circuit with direct time delay feedback
International Nuclear Information System (INIS)
Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu
2010-01-01
Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit
Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems
International Nuclear Information System (INIS)
Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.
2009-01-01
This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.
Parametric study of the fractional-order Chen-Lee system
International Nuclear Information System (INIS)
Tam, L.M.; Tou, W.M.S.
2008-01-01
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found
Parametric study of the fractional-order Chen-Lee system
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)
2008-08-15
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.
Dynamics of fractional-ordered Chen system with delay
Indian Academy of Sciences (India)
Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...
Comparing numerical methods for the solutions of the Chen system
International Nuclear Information System (INIS)
Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.
2007-01-01
In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given
Impulsive synchronization of Chen's hyperchaotic system
International Nuclear Information System (INIS)
Haeri, Mohammad; Dehghani, Mahsa
2006-01-01
In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated
Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.
2018-03-01
This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.
Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge
Directory of Open Access Journals (Sweden)
Ana Maria Candela
2015-08-01
Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.
A numeric-analytic method for approximating the chaotic Chen system
International Nuclear Information System (INIS)
Mossa Al-sawalha, M.; Noorani, M.S.M.
2009-01-01
The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.
Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng
2015-12-11
Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.
A Brief Introduction of Air Traffic Management
Institute of Scientific and Technical Information of China (English)
1997-01-01
Air Traffic Management (ATM) started publication in 1995 by Air Traffic Management Bureau of CAAC. It is the first magazine about ATM field in CAAC. The chairman of Editorial Board of ATM is Mr. Bao Peide, Vice Minister of CAAC. Mr. Chen Ziye, Vice President of the 1st Research Institute of CAAC and Chen Xuhua, General Director of Air Traffic Management Bureau are vice chairmen of the editorial board, and six general directors of local air traffic management bureau and some professors and experts are members of the editorial board.
How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)
Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.
2017-01-01
In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…
Echographie devant une metrorragie du premier trimestre de ...
African Journals Online (AJOL)
Echographie devant une metrorragie du premier trimestre de grossesse sur uterus bicorne a issue favorable. Vaginal bleeding in a pregnant woman with a bicornuate uterus, ultrasound finding and favourable outcome.
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe
Spinner, Kaspar H.
2014-01-01
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132
Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?
Fan, Ka-Wai
2018-01-01
This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.
The long-term effect of premier pay for performance on patient outcomes.
Jha, Ashish K; Joynt, Karen E; Orav, E John; Epstein, Arnold M
2012-04-26
Pay for performance has become a central strategy in the drive to improve health care. We assessed the long-term effect of the Medicare Premier Hospital Quality Incentive Demonstration (HQID) on patient outcomes. We used Medicare data to compare outcomes between the 252 hospitals participating in the Premier HQID and 3363 control hospitals participating in public reporting alone. We examined 30-day mortality among more than 6 million patients who had acute myocardial infarction, congestive heart failure, or pneumonia or who underwent coronary-artery bypass grafting (CABG) between 2003 and 2009. At baseline, the composite 30-day mortality was similar for Premier and non-Premier hospitals (12.33% and 12.40%, respectively; difference, -0.07 percentage points; 95% confidence interval [CI], -0.40 to 0.26). The rates of decline in mortality per quarter at the two types of hospitals were also similar (0.04% and 0.04%, respectively; difference, -0.01 percentage points; 95% CI, -0.02 to 0.01), and mortality remained similar after 6 years under the pay-for-performance system (11.82% for Premier hospitals and 11.74% for non-Premier hospitals; difference, 0.08 percentage points; 95% CI, -0.30 to 0.46). We found that the effects of pay for performance on mortality did not differ significantly among conditions for which outcomes were explicitly linked to incentives (acute myocardial infarction and CABG) and among conditions not linked to incentives (congestive heart failure and pneumonia) (P=0.36 for interaction). Among hospitals that were poor performers at baseline, mortality was similar in the two groups of hospitals at the start of the study (15.12% and 14.73%; difference, 0.39 percentage points; 95% CI, -0.36 to 1.15), with similar rates of improvement per quarter (0.10% and 0.07%; difference, -0.03 percentage points; 95% CI, -0.08 to 0.02) and similar mortality rates at the end of the study (13.37% and 13.21%; difference, 0.15 percentage points; 95% CI, -0.70 to 1.01). We
CERN welcomes the Spanish Vice-President
Anaïs Schaeffer
2015-01-01
On 29 September, CERN had the pleasure of welcoming the Vice-President of the Government of Spain, Soraya Sáenz de Santamaría, for a visit of the Laboratory. From left to right: Lluis Miralles (Head of the General Infrastructure Services department), Soraya Sáenz de Santamaría (Vice-President of the Government of Spain) and José Miguel Jiménez (Head of the Technology department). The Vice-President was accompanied by Carmen Vela, Spanish Secretary of State for Research, Development and Innovation, Bernardo de Sicart Escoda, Ambassador of Spain to Switzerland, and Ana Menéndez Pérez, Permanent Representative of Spain to the United Nations and International Organizations in Geneva. Their tour started at LHC Point 1, where CERN Director-General Rolf Heuer welcomed them and gave them an introduction to CERN's activities. Jos&ea...
Chaos control of Chen chaotic dynamical system
International Nuclear Information System (INIS)
Yassen, M.T.
2003-01-01
This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results
China Report, Political, Sociological and Military Affairs, No. 445.
1983-08-11
2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681
TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET
Directory of Open Access Journals (Sweden)
Denis Dolinar
2015-12-01
Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.
22 CFR 40.24 - Prostitution and commercialized vice.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Prostitution and commercialized vice. 40.24... Certain Crimes § 40.24 Prostitution and commercialized vice. (a) Activities within 10 years preceding visa... United States solely, principally, or incidentally to engage in prostitution, or has engaged in...
Chaos synchronization between Chen system and Genesio system
International Nuclear Information System (INIS)
Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao
2007-01-01
This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes
Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter
Directory of Open Access Journals (Sweden)
Yee Hooi Min
2016-01-01
Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.
How to Revise, and Revise Really Well, for Premier Academic Journals
DEFF Research Database (Denmark)
LaPlaca, Peter J.; Lindgreen, Adam; Vanhamme, Joelle
2018-01-01
Most of the premier academic journals in all fields routinely have rejection rates of 80%, 95%, or higher. All journals prefer articles that make significant contributions to the field. Revising a manuscript and responding properly to the comments of reviewers and editors often is challenging....... This article discusses how to revise effectively a manuscript according to the (minor or major) comments of reviewers and editors for premier academic journals. We provide a series of tips for helping the authors in their endeavor, making the process less arduous and improving the possibility of a positive...
Scottish Premier League Reading Stars Evaluation Report
National Literacy Trust, 2009
2009-01-01
Scottish Premier League (SPL) Reading Stars uses the motivational power of football to attract families who need support with literacy into a positive and friendly learning environment. It ran for the first time between March and August 2009 and attracted 225 children and 190 adults to take part in a series of inspirational learning sessions in 23…
Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C
2016-07-01
Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.
An equilibrium point stabilization strategy for the Chen system
International Nuclear Information System (INIS)
Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo
2004-01-01
The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations
Generalized projective synchronization between Lorenz system and Chen's system
International Nuclear Information System (INIS)
Li Guohui
2007-01-01
On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well
Open Access Publishing in Indian Premier Research Institutions
Bhat, Mohammad Hanief
2009-01-01
Introduction: Publishing research findings in open access journals is a means of enhancing visibility and consequently increasing the impact of publications. This study provides an overview of open access publishing in premier research institutes of India. Method: The publication output of each institution from 2003 to 2007 was ascertained through…
Logistique de transport pour le projet LHC enseignements des premiers secteurs
Prodon, S
2003-01-01
Ce papier dresse un premier bilan de la logistique de transport mise en place pour l'installation du LHC. Les moyens de planification mis en oeuvre seront tout d'abord évoqués avec notamment les réunions avec les groupes utilisateurs, l'élaboration de procédures de transport, la génération de listings d'articles à transporter ou encore l'établissement d'un planning des ressources. Cependant, les premiers travaux d'installation du LHC ont fait apparaître des divergences importantes entre le planning logistique établi et la réalité du terrain. Ces écarts seront analysés, qu'il s'agisse de différences sur le volume de matériel à acheminer, d'opérations non planifiées, de changements de plannings entraînant de longues et délicates traversées de chantiers ou de manque de planification des besoins en personnel dans certaines zones. Tous ces enseignements acquis au cours des premiers travaux devraient permettre de dégager des voies d'amélioration à mettre en place pour les prochains secteur...
The Vices of Economists; The Virtues of the Bourgeoisie
McCloskey, Deirdre N.
1997-01-01
The 'vices' are three bad habits into which economists have fallen over the past fifty years: bad statistics, bad theory, and bad applications of statistics and theory to public affairs. This book details the vices, tracing them to the influence of three giants of the 1940s and 1950s in economics,
Physiological response of one of South Africa's premier freshwater ...
African Journals Online (AJOL)
Physiological response of one of South Africa's premier freshwater sport angling species, the Orange-Vaal smallmouth yellowfish Labeobarbus aeneus, ... These data suggest that catch-and-release causes physiological stress to fish, but nonetheless this practice can be a valuable fisheries management tool to ensure the ...
Directory of Open Access Journals (Sweden)
Fajar L. Suroso
2016-04-01
Full Text Available The debate over the vice-presidents’ authority reappeared in the administration of President Jokowi after the “authority expansion of the Chief of Presidency Staff” and the case of “Rizal Ramli vs Jusuf Kalla”. This article is intended to provide arguments for the idea of some parties to organize more explicit and detailed the authority of vice-president in the 1945 Constitution. The idea arises from the absence of further arrangement on the authority of vice-president in the 1945 Constitution. This article is systematized into 3 (three sub-theme; 1 the arrangement of the vice-presidents’ authority in the constitution for several countries; 2 The authority of the vice-president according to the 1945 Constitution, and 3 New resultant and the possibility of 1945 Constitution amendment. The result revealed a number of interesting things; 1 the constitutions of other countries do not specify the authority of the vice-president and put the vice-president as a “spare tire” when the president is absent; 2 no new resultant about the position and authority of the vice-president so that theoretically is not reason enough to regulate in detail the authority of the vice-president through the 1945 Constitution amendment; 3 arrangement in detail in the authority of vice-president in the 1945 Constitution holds the potential to confuse the presidential system design as the 1945 Constitution. Therefore, the possibility of vice-presidents’ authority arrangement in the 1945 Constitution through amendment is very small, both in terms of momentum and the substance of issues.
From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium
Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz
2017-06-01
Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.
[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].
Quan, Xiaohong; Li, Shuqian; Li, Ying
2017-03-12
Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.
Premiere toob lavale jalgpallimeeskonna, inimkatsed ja punase tooli / Kairi Prints
Prints, Kairi, 1977-
2012-01-01
Premiere 2012 osalevad neli Eesti tantsukunstnikku: Svetlana Grigorjeva tantsulavastusega "sõp rus est", Kaisa Selde, Kristina-Maria Heinsalu ja Christin Lunts tantsulavastusega "fie", esmakordselt võtab osa välismaalane - sakslanna Mareike Franz tantsulavastusega "Duett". Kõik esietenduvad 9. veebruaril Kanuti gildi saalis
The impact of dermatology in premier medicine journals.
Kheterpal, Meenal K; Ellis, Charles N
2011-01-01
In the past 15 years, research in dermatology has significantly increased. Dermatology-related contributions in premier medical journals such as The New England Journal of Medicine (NEJM) and The Journal of the American Medical Association (JAMA) are the representation of our field in the medical world. To analyze this representation, incidence of dermatology-related contributions in NEJM and JAMA during 3 separate years (during a 15-year period) was calculated.
Trichoberoard gastrique : Premier cas observe en milieu bur kina be ...
African Journals Online (AJOL)
Le trichobezoard est une concretion de cheveux, de poils ou de fibres de tapis et de debris alimentaire, localisee habituellement dans l'estomac. Le trichobezoard est une pathologie rare qui survient habituellement chez des adolescentes presentant des troubles psychiques. La premiere observation de trichobezoard a ete ...
Cao, Hanxiong
2012-01-01
The purpose of this thesis is going to analyze the success assets of English Premier League (which is now the most successful football league in the world) and the defects of Chinese Super League by analyzing the financial statements of the Premier League, and try to make some possible improvements for Chinese Super League according to the results of the analysis.
Computers for Schools Kenya se classe au premier rang | CRDI ...
International Development Research Centre (IDRC) Digital Library (Canada)
Cinq ans après avoir remis en service ses premiers ordinateurs recyclés et leur avoir trouvé un nouveau nid, l'organisation non gouvernementale Computers for Schools Kenya (CFSK) s'est mérité un prix convoité à l'échelle de l'Afrique pour son travail.
Effectiveness of in-season manager changes in English Premier League Football
Besters, Lucas; van Ours, Jan; van Tuijl, Martin
We analyze the performance effects of in-season manager changes in English Premier League football during the seasons 2000/2001–2014/2015. We find that some managerial changes are successful, while others are counterproductive. On average, performance does not improve following a managerial
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Directory of Open Access Journals (Sweden)
Richard K. Payne
2016-03-01
Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.
Theoretical and experimental study of Chen chaotic system with notch filter feedback control
International Nuclear Information System (INIS)
Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen
2010-01-01
Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)
Maximilien Brice
2002-01-01
L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.
Markel senior vice president to give Wachovia Lecture
Ho, Sookhan
2008-01-01
Markel Corporation's senior vice president and chief financial officer Richard R. Whitt will give a talk on Thursday, Nov. 13, as the Wachovia Distinguished Speaker in the Pamplin College of Business.
A Brief Introduction of Air Traffic Management
Institute of Scientific and Technical Information of China (English)
1997-01-01
Air Traffic Management(ATM)started publication in 1995 by Air Traffic Management Bureauof CAAC.It is the first magazine about ATM field in CAAC.The chairman of Editorial Board ofATM is Mr.Bao Peide,Vice Minister of CAAC.Mr.Chen Ziye,Vice President of the 1st ResearchInstitute of CAAC and Chen Xuhua,General Director of Air Traffic Management Bureau are vicechairmen of the editorial board,and six general directors of local air traffic management bureau andsome professors and experts are members of the editorial board.ATM includes more than 20 columns,which are communication,navigation,surveillance,air trafficmanagement,special articles(policy,planning and management of implementation of CNS/ATM
Vices Among Commercial Chickens in Maiduguri, Borno State ...
African Journals Online (AJOL)
Vices Among Commercial Chickens in Maiduguri, Borno State: Causes and Possible Intervention Strategies. ... Journal Home > Vol 8, No 2 (2009) > ... interviews with the farm managers and farm owners were employed for data collection.
Developing Virtue and Rehabilitating Vice: Worries about Self-Cultivation and Self-Reform
Battaly, Heather
2016-01-01
Aristotelian virtue theorists have emphasized the role of the self in developing virtue and in rehabilitating vice. But this article argues that, as Aristotelians, we have placed too much emphasis on self-cultivation and self-reform. Self-cultivation is not required for developing virtue or vice. Nor will "sophia"-inspired self-reform…
77 FR 28880 - Ocean Transportation Intermediary License Applicants
2012-05-16
... (NVO & OFF), 332 Hindry Avenue, Inglewood, CA 90301, Officers: Edison Chen, Manager (Qualifying..., Schiller Park, IL 60176, Officers: Scott A. Case, Vice President (Qualifying Individual), Thomas C. Case...
Market Segmentation, Targeting, Dan Brand Positioning Dari Winston Premier Surabaya
Tania, Debby
2014-01-01
Sejak tahun 2012 mulai terasa bahwa bisnis properti mengalami kenaikan di Indonesia. Banyak masyarakat Indonesia berinvestasi pada properti karena dianggap aman dan menguntungkan. Sehingga muncul banyak produk properti baru di Indonesia. Perkembangan properti di Indonesia menjadi peluang besar bagi Agen Properti untuk dapat menjalankan bisnisnya. Winston Premier sebagai salah satu Agen properti di Surabaya Barat yang baru berdiri memerlukan strategi pemasaran yang tepat untuk digunakan guna b...
Directory of Open Access Journals (Sweden)
Melan Yusuf Nomleni
2017-02-01
Full Text Available The amendment of Constitution has not met the the life of the nation’s demand, one of which is the of the tasks and authorities of the Vice President. This sparks multiple interpretations on the role and its legal implications toward the responsibility over the Vice President tasks and. The results show several reasons underlying obscurity of the tasks and authorities regulation of the Indonesian Vice President stated in 1945 Constitution, among which is the Indonesian governance. The obscure regulation of the Vice President tasks and authorities affects on his/her responsibility. Hence, the clear regulation related to the tasks and authorities of the Vice President as President Assistant in performing state governance is required. Keywords : Regulation, Vice President, Authorities
Herrera-Añazco, Percy; Valenzuela-Rodríguez, Germán; Pacheco-Mendoza, Josmel; Málaga, Germán
2017-10-19
To determine the scientific production of Research Vice-chancellors at Peruvian universities that have medical schools, as well as their academic degrees as an indirect way to evaluate their suitability for the position they hold. We searched all Peruvian universities that register medical schools. Of these, the scientific production of the universities registered in SCOPUS was identified in September of the 2016. The scientific production of the vice chancellors of investigation of these faculties of medicine was determined through the search of its scientific publications registered in SCOPUS and those reported in the National Registry of Researchers in Science and Technology. Academic degrees were obtained from the database of the National Superintendence of Higher University Education. The sample included 28 research vice chancellors. Only 4/28 had any publications. The average number of articles published by the vice chancellors of research was 1.71, the number of citations 23.1 on average and the H index 0.64. Besides, 22 Vice-chancellors of research had the degree of doctor, four had the degree of bachelor and two the degree of master. The scientific production of research vice chancellors is poor. The required academic grade requirement for the position is not met in all cases. It is likely that, having no research experience, his leadership in directing a university's research policies may be questioned.
Virtues, Vices, and Political Influence in the U.S. Senate.
ten Brinke, Leanne; Liu, Christopher C; Keltner, Dacher; Srivastava, Sameer B
2016-01-01
What qualities make a political leader more influential or less influential? Philosophers, political scientists, and psychologists have puzzled over this question, positing two opposing routes to political power--one driven by human virtues, such as courage and wisdom, and the other driven by vices, such as Machiavellianism and psychopathy. By coding nonverbal behaviors displayed in political speeches, we assessed the virtues and vices of 151 U.S. senators. We found that virtuous senators became more influential after they assumed leadership roles, whereas senators who displayed behaviors consistent with vices--particularly psychopathy--became no more influential or even less influential after they assumed leadership roles. Our results inform a long-standing debate about the role of morality and ethics in leadership and have important implications for electing effective government officials. Citizens would be wise to consider a candidate's virtue in casting their votes, which might increase the likelihood that elected officials will have genuine concern for their constituents and simultaneously promote cooperation and progress in government. © The Author(s) 2015.
40Ar-39Ar laser probe dating of individual clinopyroxene inclusions in Premier eclogitic diamonds
International Nuclear Information System (INIS)
Burgess, R.; Turner, G.; Laurenzi, M.; Harris, J.W.
1989-01-01
The ages of seven individual clinopyroxene inclusions in Premier diamonds of eclogitic association have been determined using the 40 Ar- 39 Ar dating technique. Syngenetic inclusions weighing between 10 and 130 μg were exposed on cleaved surfaces of the diamonds and analysed using a laser probe. The inclusion ages were found to be in the range 1111±35 to 1254±38 Ma with an average of 1185±94 Ma. The ages obtained are in good agreement with previous determinations made on aggregates of eclogitic inclusions from Premier diamonds and demonstrate the applicability of the laser probe to dating individual diamond inclusions. (orig.)
Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen
Thoma, Axel Michael
2017-01-01
Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.
Market size and attendance in English Premier League football
Buraimo, B; Simmons, R
2006-01-01
This paper models the impacts of market size and team competition for fan base on matchday attendance in the English Premier League over the period 1997-2004 using a large panel data set. We construct a comprehensive set of control variables and use tobit estimation to overcome the problems caused by sell-out crowds. We also account for unobserved influences on attendance by means of random effects attached to home teams. Our treatment of market size, with its use of Geographical Information ...
Jonsson, J.E.; Afton, A.D.
2009-01-01
Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.
Huang, Weiping; Li, Naiqi
2015-03-01
Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.
40Ar/39Ar laser-probe dating of diamond inclusions from the Premier kimberlite
International Nuclear Information System (INIS)
Phillips, D.; Onstott, T.C.; Harris, J.W.; Strathclyde Univ., Glasgow
1989-01-01
Inclusions encapsulated by diamonds at the time of their formation provide a means for determining diamond crystallization ages and the chemistry of the surrounding upper mantle at that time. Sm-Nd studies of peridotitic inclusions, from Cretaceous-age kimberlites in southern Africa, suggest that the diamonds formed 3.3 Gyr ago. By contrast, eclogite-suite inclusions generally yield younger ages, sometimes approaching the time of kimberlite eruption. Here we report the results of 40 Ar/ 39 Ar laser-probe analyses of individual eclogitic clinopyroxene inclusions from Premier diamonds, which yield a mean age of 1,198±14 Myr. This age agrees well with Sm-Nd and 40 Ar/ 39 Ar analyses on similar Premier inclusions, and is indistinguishable from the inferred time of emplacement of the host kimberlite (1,150-1,230 Myr), which implies that diamond formation was essentially synchronous with kimberlite generation. The extrapolated non-radiogenic 40 Ar/ 36 Ar ratio of 334±102 is similar to the present-day atmospheric composition. This value is inconsistent with Sr and Nd isotopic signatures from Premier eclogite inclusions, which suggest a depleted mantle source ( 40 Ar/ 36 Ar>20,000). Pre-entrapment equilibration of the inclusions with an 36 Ar-rich fluid is the most probable explanation for the low non-radiogenic ( 40 Ar/ 36 Ar) composition. (author)
Effectiveness of in-season manager changes in English Premier League Football
Besters, Lucas; van Ours, Jan; van Tuijl, Martin
2016-01-01
We analyze the performance effects of in-season manager changes in English Premier League football during the seasons 2000/2001–2014/2015. We find that some managerial changes are successful, while others are counterproductive. On average, performance does not improve following a managerial replacement. The successfulness of managerial turnover depends on specific highly unpredictable circumstances, as we illustrate through case-studies.
Executive Assistant to the Vice-President, Corporate Strategy and ...
International Development Research Centre (IDRC) Digital Library (Canada)
Job Summary Under the direction of the Vice-President, Corporate Strategy and ... between the Corporate Strategy and Communications Management sides of the team. ... Maintains personnel and human resources records for the Division.
Directory of Open Access Journals (Sweden)
Christine M Livingston
2009-10-01
Full Text Available Virus-Induced Chaperone-Enriched (VICE domains form adjacent to nuclear viral replication compartments (RC during the early stages of HSV-1 infection. Between 2 and 3 hours post infection at a MOI of 10, host protein quality control machinery such as molecular chaperones (e.g. Hsc70, the 20S proteasome and ubiquitin are reorganized from a diffuse nuclear distribution pattern to sequestration in VICE domains. The observation that VICE domains contain putative misfolded proteins suggests that they may be similar to nuclear inclusion bodies that form under conditions in which the protein quality control machinery is overwhelmed by the presence of misfolded proteins. The detection of Hsc70 in VICE domains, but not in nuclear inclusion bodies, indicates that Hsc70 is specifically reorganized by HSV-1 infection. We hypothesize that HSV-1 infection induces the formation of nuclear protein quality control centers to remodel or degrade aberrant nuclear proteins that would otherwise interfere with productive infection. Detection of proteolytic activity in VICE domains suggests that substrates may be degraded by the 20S proteasome in VICE domains. FRAP analysis reveals that GFP-Hsc70 is dynamically associated with VICE domains, suggesting a role for Hsc70 in scanning the infected nucleus for misfolded proteins. During 42 degrees C heat shock, Hsc70 is redistributed from VICE domains into RC perhaps to remodel viral replication and regulatory proteins that have become insoluble in these compartments. The experiments presented in this paper suggest that VICE domains are nuclear protein quality control centers that are modified by HSV-1 to promote productive infection.
RANKING THE SPECTATORS’ DIFFICULTIES IN PURCHASING ELECTRONIC TICKETS OF FOOTBALL PREMIER LEAGUE
Directory of Open Access Journals (Sweden)
Ahmad Narimani
2017-04-01
Full Text Available This study aimed to rank the spectators’ difficulties in buying electronic tickets of football premier league matches at Azadi stadium. The population consisted of all spectators of Esteghlal-Persepolis match in the fifteenth league at Azadi stadium (N= 100000. According to Morgan table and using simple random sampling method, 500 participants were selected as sample. A researcher-made questionnaire was used for collecting the data; its face validity was confirmed by 15 experts and performing a pilot study on 30 subjects, its Cronbach’s alpha was calculated to be 0.86. Using SPSS 22, the descriptive and inferential (including Friedman test statistics was applied for analyzing the data. The findings showed that there was a significant difference between rankings of difficulties in buying electronic tickets of Football premier league matches at Azadi Stadium. The difficulties were ranked as: problem in ticket systems, early selling out of electronic tickets, lack of confidence to electronic ticket sale, lack of skill to work with the internet, low speed of internet, and lack of access to the internet
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Richard K. Payne
2016-01-01
Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...
Un premier service mobile en Égypte qui relie les petits exploitants ...
International Development Research Centre (IDRC) Digital Library (Canada)
Un premier service mobile en Égypte qui relie les petits exploitants aux acheteurs. Un homme qui parle sur un téléphone mobile. Les petits exploitants agricoles dominent l'agriculture égyptienne, mais leur manque de connaissances en matière de commercialisation et de compétences techniques, ainsi qu'une mauvaise ...
2016-2017 Hospitality Expense Reports for Sylvain Dufour, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
Chantal Taylor
Lunch during the Annual Resources Branch Management-Regional. Directors Meeting. Date: 2016-11-16. Attendees: 20 (IDRC 19). Location: Ottawa. Total: $814.00. Comments: 2016-2017 Hospitality Expense Reports for. Sylvain Dufour, Vice-President, Resources, and. Chief Financial Officer.
Le jeu de la création : Le mangeur (2005 de Ying Chen
Directory of Open Access Journals (Sweden)
Nicole Dunham
2013-11-01
Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.
Directory of Open Access Journals (Sweden)
Mabel Tan
2015-03-01
Full Text Available This study used Bolman and Deal’s framework to examine the leadership frames of a vice-chancellor in a private university in Malaysia. Qualitative methods comprised interviews with the vice-chancellor and six of his staff reporting directly to him, document analysis, and observations. Atlas.ti was used to code the leadership frames. Content analysis revealed that the vice-chancellor exhibited three frames, showing a multi-frame leadership style. It reflects the vice-chancellor implements an effective leadership style and a high level of cognitive ability, which is important for the organizational effectiveness.
Energy Technology Data Exchange (ETDEWEB)
Mitchell, G.
2015-04-02
This presentation discusses the differences between the original Vehicle and Infrastructure Cash-Flow Evaluation (VICE) Model and the revamped version, VICE 2.0. The enhanced tool can now help assess projects to acquire vehicles and infrastructure, or to acquire vehicles only.
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
International Nuclear Information System (INIS)
Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou
2008-01-01
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)
2008-11-15
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.
2016-2017 Hospitality Expense Reports for Sylvain Dufour, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
Chantal Taylor
Resources Branch Management lunch during annual evaluation meeting of RB personnel. Date: 2016-05-04. Attendees: 7 (IDRC 7). Location: Ottawa. Total: $160.50. Comments: 2016-2017 Hospitality Expense Reports for. Sylvain Dufour, Vice-President, Resources, and. Chief Financial Officer.
2011-11-16
... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...
Les animateurs TICE du premier degré, quelle professionnalité ?
Villemonteix , François
2007-01-01
International audience; Les animateurs TICE du premier degré, quelle professionnalité ? Congrès international AREF 2007 (Actualité de la Recherche en Education et en Formation) François VILLEMONTEIX Doctorant Laboratoire EDA (Education et apprentissages) Université Paris 5 – La Sorbonne franç RÉSUMÉ. Dans le but de favoriser le développement d'usages instrumentés dans les classes de l'école primaire française, l'institution éducative a depuis les années 80 at...
Nasir Ibrahim, Daing
2013-12-01
Salam Malaysia! First and foremost, I want to thank all 2nd International Conference on Mechanical Engineering Research (ICMER 2013) organisers for inviting me to address and officiate this conference. This 2nd ICMER 2013 provides a platform to bring together not only researchers, postgraduate students but also industrial people. With this platform, ICMER will embark on a whole process of making new discoveries and then translating them into products and services for the marketplace and this is only made possible with people like all of you. I would like to congratulate the ICMER 2013 organisers for the achievement of collecting 208 papers for this conference. Submissions received from 17 local universities, 7 industrial companies and 9 different countries is a great achievement for UMP. I am very happy to welcome all of you from Malaysia, Iran, Turkey, Japan, India, Australia, Ireland, Saudi Arabia and Bangladesh to this conference. As one of Malaysia's Public Universities, UMP's main challenge is to remain competitive and relevant by offering high quality technical academic programmes and research activities, focusing on its niche areas. New knowledge and findings cannot be generated without any research and development (R&D) activities. These efforts will undoubtedly generate lots of interesting results and new knowledge either bring further commercialisation activities. The Malaysian government has invested a huge sum of Ringgits in R&D over the years. Therefore, UMP must produce more quality researchers and graduates to ensure Malaysia reaps the returns from these investments vice versa of progressive economic growth for the country. UMP's 2011-2015 Strategic Plan determines to strengthen and sustained its financial support by allocating research grants and industry collaboration and consultations through its business and commercial unit. On behalf of UMP, I would like to express my appreciation to all committee members of ICMER 2013 from Faculty of Mechanical
Directory of Open Access Journals (Sweden)
Jiraporn Napatsorn
2016-07-01
Full Text Available Consumers often choose virtue food to attain health goals and vice food to achieve indulgence goals. However, food and beverage companies have begun to nullify the vice and virtue categories by bundling vice and virtue ingredients into a single item (e.g. Yogurt with Oreo topping. This research contrasts how consumers from Asian and Western cultures evaluate such vice/virtue food bundles. Building on the perceptual processes and regulatory focus literatures, two cross-cultural experiments using participants in Thailand and the U.S. shows that Westerners prefer virtue-heavy bundles to vice-heavy bundles while Asians show similar preference across both types of bundle. Process measures revealed that Asians perceive greater fit between vice and virtue components in the bundles than Westerners and this perceived fit mediates the effect of culture on their food choice. Study 2 reveals the boundary condition. Specifically, when regulatory focus was manipulated, the effect of culture is no longer significant. The findings provide managerial implications for food and beverage companies as well as contributions to consumer behavior literature.
2017-2018 Travel Expense Reports for Joanne Charette, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
BB
2017-06-11 to 2017-06-14. Destination(s):. Montreal. Airfare: $0.00. Other. Transportation: $170.23. Accommodation: $793.75. Meals and. Incidentals: $103.67. Other: $0.00. Total: $1,067.65. Comments: 2017-2018 Travel Expense Reports for Joanne. Charette, Vice-President, Corporate Strategy and Communications.
2017-2018 Hospitality Expense Reports for Stephen McGurk, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
SD
Description: Lunch - Development research issues. Date: 2017-05-30. Attendees: 2 (IDRC 1). Location: Nairobi, Kenya. Total: $12.10. Comments: 2017-2018 Hospitality Expense Reports for. Stephen McGurk, Vice-President, Program and Partnership Branch.
2016-2017 Hospitality Expense Reports for Stephen McGurk, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
Beata Bialic
Description: Lunch to discuss IDRC programming. Date: 2016-10-04. Attendees: 2 (IDRC 1). Location: Ottawa. Total: $25.99. Comments: 2016-2017 Hospitality Expense Reports for. Stephen McGurk, Vice-President, Programs and Partnership Branch.
Lagle, Evelin, 1986-
2012-01-01
Uutele koreograafidele pühendatud sarja "Premiere" programmis osalevad tantsulavastustega neli tantsukunstnikku Eestist - Tallinna Ülikooli lõpetanud Svetlana Grigorjeva, Turu Kunstiakadeemia lõpetanud Kaisa Selde, Viljandi Kultuuriakadeemia lõpetanud Kristina-Maria Heinsalu ja Tallinna Ülikooli lõpetanud Christin Lunts
The Watts Premier Ultra 5 system was tested for removal of bacteria and viruses at NSF International's Laboratory. Watts Premier submitted ten units, which were split into two groups of five. One group received 25 days of conditioning prior to challenge testing, while the secon...
ABOUT THE SMART SPORTS DEVELOPMENT. EVIDENCE FROM THE UK PREMIERE LEAGUE
Directory of Open Access Journals (Sweden)
Vlad Ionut Dumitrache
2016-11-01
Full Text Available Smart economy implies the development of key factors like global economy growth, competition, economic progress, economic prosperity, innovation. In the European top-level football, like the case of the British Premier League, financial indicators have demonstrated that the factors that define smart economy can be identified. The new rules of the financial fair-play policies and the ever growing revenues for television rights have created a new market in sports economy, one that identifies itself with the criteria identifies in studies regarding smart economy. This paper comparatively examines the determinants of four indicators of the football team quality in the British Premier League, in order to find out whether a common set of potential determinants could be effective in improving all four indicators of quality, without worsening any of them. This allows finding what measures undertaken at the level of football teams could raise the football team quality. Considering the subjective and multidimensional nature of the football team quality, we first propose four indicators that might be appropriate to define this latent summative measure. Then we select a number of four potentially common determinants of the football team quality, and finally discuss the empirical results, based on panel generalized least squares regression models. The television broadcasting rights are found to be the most important determinant of the football team quality.
2016-2017 Hospitality Expense Report for Stephen McGurk, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
Chantal Taylor
Description: Dinner to discuss IDRC's programming with foreign official. Date: 2017-03-21. Attendees: 3 (IDRC 1). Location: Ottawa. Total: $66.29. Comments: 2016-2017 Hospitality Expense Report for. Stephen McGurk, Vice-President, Programs and Partnership Branch.
2016-2017 Travel Expense Reports for Sylvain Dufour, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
Beata Bialic
Date(s):. 2016-10-15 to 2016-10-21. Destination(s):. Orlando, FL (USA). Airfare: $497.01. Other. Transportation: $181.22. Accommodation: $1,216.70. Meals and. Incidentals: $853.72. Other: $53.05. Total: $2,801.70. Comments: 2016-2017 Travel Expense Reports for Sylvain. Dufour, Vice-President, Resources, and Chief.
Analisis Kualitas Pelayanan terhadap Kepuasan Konsumen Jasa Hotel Santika Premiere Semarang
Dewangga, Nandy; Hidayat, Wahyu; Widiartanto, Widiartanto
2014-01-01
The competition of global business today focusing on consumers is a strategic choice in business world in order to survive. For example, the tight competition of business in the company of hotel services is by improving the service quality to consumers. The problems in this research were the decreasing number of hotel service users and the increasing number of consumer complaint as the service users of Santika Premiere Hotel in Semarang from year to year. The aims of this research were to ide...
Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju
2016-07-21
Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016
Security problems for a pseudorandom sequence generator based on the Chen chaotic system
Özkaynak, Fatih; Yavuz, Sırma
2013-09-01
Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.
2016-2017 Travel Expense Reports for Stephen McGurk, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
Chantal Taylor
Date(s):. 2017-02-10. Destination(s):. Toronto. Airfare: $765.29. Other. Transportation: $82.91. Accommodation: $0.00. Meals and. Incidentals: $61.60. Other: $0.00. Total: $909.80. Comments: 2016-2017 Travel Expense Reports for. Stephen McGurk, Vice-President, Programs and Partnership Branch.
Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state
Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro
2014-01-01
We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...
The First Assembly Line of Large-longitudinally-welded Steel Pipe in China Went into Operation
Institute of Scientific and Technical Information of China (English)
Li Bing
2002-01-01
@@ On July 27, the first assembly line to produce JCOE large diameter Longitudinally-submerged-arc-welded steel pipe in China, Which is the key homemade equipment project of "West-East Gas Transmission"project, was put into production. Chen Gen, vice general manager of CNPC; Xie Zhiqiang and Liu Haisheng, assistant chief manager of CNPC; Shi Xingquan, vice president of PetroChina; and the president of Itochu-Marubeni Steel & iron Co., Ltd.of Japan; attended the opening ceremony and cut the ribbon.
International Nuclear Information System (INIS)
Moreno M, A.; Moreno B, A.
2000-01-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
2016-2017 Travel Expense Report for Stephen McGurk, Vice ...
International Development Research Centre (IDRC) Digital Library (Canada)
Beata Bialic
Purpose: Attend Canada-Israel Official Committee dinner. Date(s):. 2016-06-21. Destination(s):. Toronto. Airfare: $232.04. Other. Transportation: $118.84. Accommodation: $0.00. Meals and. Incidentals: $0.00. Other: $0.00. Total: $350.88. Comments: 2016-2017 Travel Expense Report for Stephen. McGurk, Vice-President ...
Energy Technology Data Exchange (ETDEWEB)
Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A
2000-07-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Purba, Mey Royani M.
2013-01-01
Quality of service is an expected level of excellence and control over the level of excellence to comply the customer wants. Satisfaction is the difference between the perceived performance with expectations. This study aimed to to identify and analyze the influence of the quality of services consisting of physical tangible, reliability, responsiveness, assurance, and empathy to customer satisfaction on Santika Premiere Dyandra Hotel. To measure service quality from the point of servic...
Black Generation Y gender differences in Premier Soccer League spectator motives : sport marketing
T.E. Mofokeng; A.L. Bevan-Dye
2014-01-01
The purpose of this study was to determine whether there are gender differences concerning Premier Soccer League (PSL) spectator motives amongst black Generation Y students in South Africa. In South Africa, the black Generation Y cohort (individuals born between 1986 and 2005) represents an important but under-researched market segment in that, in 2013, they made up 32 percent of the country's population. From a PSL marketing perspective, understanding the motives that drive game spectatorshi...
Student Town Meeting with Vice President Al Gore. Teacher's Guide.
Edwards, Amy N.
This teacher's guide accompanies a videotape of the same name. Vice President Albert Gore, Jr., discusses current issues with students who question Mr. Gore on such topics as the environment, reinventing government, voter participation, crime, and the United States' role in foreign affairs. Gore tailors his answers to the teenage audience as the…
Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass
Liu, Jian-Liang; Yu, Chengjie
2017-10-01
In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.
1989-07-06
harboring suspicions about neighboring states. Singa- pore’s Premier Lee Kuan Yew has pointed out many times that relationships between his country and...and blackmail in general are some corrupt phenomena emerging politically. The feudal ties of consanguinity and favoritism in some places are even... relationship and the giving of gifts in the distribution of materials and sale of products. Chen Shifu, deputy director of the Nantou District
Directory of Open Access Journals (Sweden)
David Hazemali
2016-12-01
Full Text Available This paper looks into the characterisation of Satan as the Capital Vice of Pride in John Milton’s Paradise Lost. It thus supports the findings of Robert Charles Fox, who in his study The Seven Deadly Sins in Paradise Lost first thoroughly analysed and comprehensively presented this issue and its importance in Milton’s epic. The authors of the study share Fox’s belief that Milton consciously used the system of the Seven Capital Vices in his epic as a structural device to present the entire scope of evil to the willing reader, and he achieved this by giving Satan and six other major denizens of Hell each the characteristics of a particular Vice. In other words, each of the seven major diabolical figures that appear in Paradise Lost embodies or personifies one of the Seven Capital Vices. As the most eloquent and characteristically perfected of the diabolical figures of Hell, Satan embodies Pride, the prime Capital Vice.
Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau
Ju, J.
2013-12-01
Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of
Haws, Kelly L; Liu, Peggy J
2016-08-01
Given the prevalence and rising rates of obesity in many countries, including the United States, much food decision-making research ultimately aims at understanding how consumers can make healthier choices. The two predominant choice paradigms used in food decision-making research ask consumers to choose (a) between a "vice" (or unhealthy food) and a "virtue" (or healthy food) or (b) among varying portion sizes of "vice." We propose a new food choice paradigm that encourages consumers to jointly consider both food type(s) choice and food portion size at each decision point. The purpose of this paradigm is two-fold. First, it aims to allow examination of more comprehensive eating behavior (e.g., to examine the overall composition of a plate of food rather than choice of a single food). Second, it aims to shift consumers towards including large proportions of virtues and smaller proportions of vice in their overall consumption portfolios. For this paradigm, we draw upon a recently introduced food product innovation called "vice-virtue bundles" (Liu et al., 2015) that illustrates the basis of this new food choice paradigm, in which food type(s) and portion decisions are made simultaneously. Accordingly, we first discuss relevant findings on vice-virtue bundles as well as the differences between simultaneous and sequential choice of multiple products. Second, we examine the benefits for managing and controlling one's consumption that are provided by vice-virtue bundles and this joint food choice paradigm more generally. Third and finally, we point out opportunities for future research by discussing (a) multiple factors that influence food choices, (b) decision processes affected by food choice paradigms, and (c) issues of generalizability related to the presence of vice-virtue bundles. Copyright © 2015 Elsevier Ltd. All rights reserved.
Manson Chicks and Microskirted Cuties : Pornification in Thomas Pynchon's Inherent Vice
Cook, S.J.|info:eu-repo/dai/nl/411939432
2015-01-01
Many sexual encounters in Thomas Pynchon’s fiction have occurred beyond the mainstream, generating theatres of perversity which dramatise the death wish and enact power relations from wider arenas. However, in Inherent Vice they change in nature. With the exception of scenes which use Charles Manson
Mahdavi Mohtasham, Hamid; Shahrbanian, Shahnaz; Khoshroo, Fatemeh
2018-01-01
The purpose of this study was to determine the epidemiology and history of knee injury and its impact on activity limitation among football premier league professional referees in Iran. This was a descriptive study. 59 Football Premier League professional referees participated in the study. The knee injury related information such as injury history and mechanism was recorded. Injury related symptoms and their impacts on the activity limitation, ability to perform activities of daily living as well participation in sports and recreational activities was obtained through the Knee Outcome Survey (KOS). The results indicated that 31 out of 59 participants reported the history of knee injury. In addition, 18.6%, 22.4% and 81% of the referees reported that they had been injured during the last 6 months of the last year, and at some point in their refereeing careers, respectively. Results further indicated that 48.8% of the injuries occurred in the non-dominant leg and they occurred more frequently during training sessions (52%). Furthermore, the value of KOS was 85 ± 13 for Activities of Daily Living subscale and 90 ± 9 for Sports and Recreational Activities subscale of the KOS. Knee injury was quite common among the Football Premier League professional referees. It was also indicated that the injuries occurred mainly due to insufficient physical fitness. Therefore, it is suggested that football referees undergo the proper warm-up program to avoid knee injury.
Asymmetry after hamstring injury in English Premier League: issue resolved, or perhaps not?
Barreira, P; Drust, B; Robinson, M A; Vanrenterghem, J
2015-06-01
Hamstring injuries constitute one of the most concerning injuries in English Premier League football, due to its high primary incidence but also its recurrence. Functional methods assessing hamstring function during high-risk performance tasks such as sprinting are vital to identify potential risk factors. The purpose of this study was to assess horizontal force deficits during maximum sprint running on a non-motorized treadmill in football players with previous history of hamstring strains as a pre-season risk-assessment in a club setting. 17 male football players from one Premier League Club were divided into 2 groups, experimental (n=6, age=24.5±2.3 years) and control (n=11, age=21.3±1.2 years), according to history of previous hamstring injury. Participants performed a protocol including a 10-s maximum sprint on a non-motorized treadmill. Force deficits during acceleration phase and steady state phases of the sprint were assessed between limbs and between groups. The main outcome measures were horizontal and vertical peak forces during the acceleration phase or steady state. There were no significant differences in peak forces between previously injured and non-injured limbs, or between groups, challenging the ideas around functional force deficits in sprint running as a diagnostic measure of hamstring re-injury risk. © Georg Thieme Verlag KG Stuttgart · New York.
is dependent not only on attracting high quality papers, but on the preservation of high standards in the overall editorial process. This requires, inter alia, a sympathetic managing editor to assist non-native English speakers in Europe and beyond to communicate their research findings with good clarity. We are highly fortunate that Dr j S G (Jim) McCulloch, who has had such a major impact on the success of the Journal of Hydrology, has agreed to take on the onerous task of launching and managing HESS. He will be supported by a panel of Scientific Editors and by an Editorial Board, who will advise him. We are indebted to Dr McCulloch and his editorial office team for their dedicated efforts in bringing this first issue to fruition. We also thank the authors, who have entrusted their papers to HESS, the reviewers who have responded so promptly and Arne Richter, the Secretary-General of EGS, for his continual support and enthusiasm for this venture. Finally, and most important of all, we appeal to you, and all members of the scientific community, to support HESS by * taking out a personal subscription; * arranging for an institutional subscription; * contributing your best papers; * helping with the peer review process. By rallying around HESS and giving it the priority which will ensure that high quality is achieved from the outset, we can, as a community, eventually match the achievements of WRR. You and future generations of European hydrologists will be the beneficiaries. Philip O'Kane Enda O'Connell EGS Vice-President Past-EGS Vice-President (Hydrological Sciences) (Hydrological Sciences)
Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing
2014-01-01
Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).
Effects of Vice-Principals' Psychological Empowerment on Job Satisfaction and Burnout
Schermuly, Carsten C.; Schermuly, Rene A.; Meyer, Bertolt
2011-01-01
Purpose: This paper aims to investigate the relationship between psychological empowerment, job satisfaction, and burnout among vice-principals (VPs) in primary schools. Design/methodology/approach: A total of 103 VPs at 103 different primary schools in Germany were surveyed with a questionnaire that assessed the four dimensions of psychological…
Leadership for Sustainability Perceptions in Higher Education Institutions in Oman
Hussain, Sadiq; Albarwani, Thuwayba
2015-01-01
This study explores leadership in higher education institutions in Oman where education for sustainability issues are a high priority. The Vice-chancellor of the premier university Sultan Qaboos University, Qaboos Sultanate of Oman, and his four senior management team members answer the following question: What are the concrete steps which have…
Le jeu de la création : Le mangeur (2005) de Ying Chen
Nicole Dunham
2013-01-01
Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...
Report to New England Governors and Eastern Canadian Premiers on climate change projects
International Nuclear Information System (INIS)
2002-08-01
The Premiers-Governors energy discussions are aimed at promoting joint energy cooperation between provinces and states. This report outlines the major accomplishments in the implementation of the Climate Change Action Plan adopted by the Conference in 1998. The project priorities for the coming year are also outlined. In 2001, the New England Governors (NEG) and the Eastern Canadian Premiers (ECP) directed the Environment Committee and the Northeast International Committee on Energy (NICE) to implement a plan to develop a regional emissions inventory so that participating jurisdictions would have common data for measuring progress. The plan also identified specific climate actions that could be readily implemented. This report describes the results of 5 working groups which were created to focus on the following potential categories: energy, transportation, inventory and registry, adaptation, and 'lead by example'. In addition to the working groups, the Climate Change Steering Committee developed 4 proposals for consideration for implementation. These were the LED Traffic Light Proposal, the College and University Partnerships in Emissions Reductions, State/Provincial Purchasing Programs for High Efficiency-Low Emission Office Equipment, and Use of Cleaner, More Energy-Efficient Vehicles in State/Provincial Fleets. The Steering Committee will also pursue other tasks in the coming year, including the study of other proposals for cost-effective measures that could contribute to the goals of the Climate Change Action Plan, examine Internet options for coordinating internal project work, examine opportunities to pursue climate action, and identify opportunities to improve vehicle fuel efficiency
Une forme urbaine du premier âge touristique: les promenades littorales
Directory of Open Access Journals (Sweden)
Franck DEBIÉ
1993-03-01
Full Text Available Les promenades maritimes caractérisent les stations de bord de mer du premier âge touristique (1850-1930. Elles traduisent dans le paysage un urbanisme spéculatif, à rapprocher de celui qui produit le square et le boulevard, et donnent lieu à une urbanisation du littoral sous forme de vastes appendices linéaires. Les pratiques sociales associées à la promenade rappellent celles du jardin de plaisir, et renvoient au même rêve d’une urbanité idéale, libérée des miasmes, des promiscuités sociales, des contraintes qui pèsent sur les amours et les jeux.
Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system
International Nuclear Information System (INIS)
Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun
2012-01-01
In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)
Chinese Dream——Concert in Commemoration of 115th Birth Anniversary of Premier Zhou Enlai Held
Institute of Scientific and Technical Information of China (English)
Our; Staff; Reporter
2013-01-01
<正>The theme song of the film The Founding of a Republic sung by male vocalists Dai Yuqiang and Wei Song reverberated in the Opera Hall at the National Center for the Performing Arts on the `evening of March 14. It marked the start of the concert in commemoration of the 115th anniversary of the birth of Premier Zhou Enlai, with "Chinese Dream" as the theme.
An Examination of the Instructional Leadership Role of High School Vice Principals
Larkin, Cynthia
2017-01-01
High school vice principals do not typically play a key role in the instructional leadership duties at their sites, as they are typically responsible for being their school's chief disciplinarians, managers of attendance, and supervisors of student activities and athletics. This study examined the role and responsibilities of high school vice…
Time scales: from Nabla calculus to Delta calculus and vice versa via duality
Caputo, M. Cristina
2009-01-01
In this note we show how one can obtain results from the nabla calculus from results on the delta calculus and vice versa via a duality argument. We provide applications of the main results to the calculus of variations on time scales.
Jean-Claude Gadmer
2012-01-01
24 February 2012 - Polish Vice-Rectors AGH University of Science and Technology Cracow visiting the ATLAS underground experimental area with Former Collaboration Spokesperson P. Jenni; Vice Rector J. Lis signs a collaboration agreement with A. Unnervik; Adviser T. Kurtyka and A. Siemko accompany the delegation throughout.
The Watts Premier WP-4V POU drinking water treatment system was tested for removal of aldicarb, benzene, cadmium, carbofuran, cesium, chloroform, dichlorvos, dicrotophos, fenamiphos, mercury, mevinphos, oxamyl, strontium, and strychnine. The WP-4V employs a reverse osmosis (RO) m...
DEFF Research Database (Denmark)
Bradley, Paul S; Carling, Chris; Archer, Dave
2011-01-01
The aim of this study was to examine the effect of playing formation on high-intensity running and technical performance during elite soccer matches. Twenty English FA Premier League games were analysed using a multiple-camera computerized tracking system (n = 153 players). Overall ball possession...
van der Heijde, Désirée; Breedveld, Ferdinand C.; Kavanaugh, Arthur; Keystone, Edward C.; Landewé, Robert; Patra, Kaushik; Pangan, Aileen L.
2010-01-01
To evaluate the efficacy and safety of initial combination treatment with adalimumab (ADA) and methotrexate (MTX) versus monotherapy with ADA or MTX during an open-label extension of PREMIER. Patients with early rheumatoid arthritis (RA) received blinded ADA plus MTX, ADA alone, or MTX alone for 2
Wormholes supported by phantom energy from Shan-Chen cosmological fluids
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)
2016-03-15
In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)
Etat des lieux des soins de premier recours des malades mentaux à Antananarivo : étude rétrospective
Bakohariliva, Hasina Andrianarivony; Rafehivola, Imisanavalona Hanitrinihaja; Raobelle, Evah Norotiana; Raharivelo, Adeline; Rajaonarison, Bertille Hortense
2018-01-01
Résumé Religion et guérisseurs traditionnels occupent encore une place prépondérante dans la prise en charge des maladies mentales à Madagascar. Ainsi, nous nous sommes fixés comme objectif d'établir un état des lieux sur les soins de premier recours des malades mentaux. Nous avons mené une étude rétrospective descriptive s'étalant sur une période de 16 mois allant de janvier 2014 en avril 2015 au sein du service de psychiatrie du CHU de Befelatanana à Antananarivo. La prévalence des psychoses était de 25%. Le genre féminin (53%), l'ethnie merina (77%), les étudiants (45%), le niveau d'étude secondaire (40%), les célibataires (72%), la religion protestante (45%), ainsi que le niveau socio-économique moyen (57,5%) étaient prédominants. Dans les paramètres cliniques, le mode de début brutal (52%), le premier recours à la religion (40%), la présence d'antécédents des cas similaire (90%), étaient majoritaires. La schizophrénie était la pathologie la plus rencontrée dans la moitié des cas. Le délai d'amélioration en cas de traitement religieux et traditionnels était dans la moitié des cas de plus de 10 jours d'hospitalisation. Les patients ayant reçu une prise en charge psychiatrique en premier recours, étaient améliorés dans 75 % cas en moins de 10jours. Le retard du recours aux soins psychiatriques est une réalité à Madagascar qui aggrave le pronostic des psychoses. PMID:29632623
Lunel, Alexandre
2005-03-01
After being appointed "premier physician" in 1731, Pierre Chirac, thanks to his influence with the king, tried to realize an ambitious project. Inspired by the creation of an Academie de Chirurgie by the "premier surgeon", Chirac decided to creation an Académie de Médecine in Paris. Under his guidance, it was planned to collect opinions from all doctors of the kingdom in order to enhance global knowledge of disease, symptoms and treatments. However, threatened with the loss of its secular superiority, the Paris University Medical School immediately opposed the project. Although well advanced, the project was finally abandoned on Chirac's death.
Cumming, Sean P; Brown, Daniel J; Mitchell, Siobhan; Bunce, James; Hunt, Dan; Hedges, Chris; Crane, Gregory; Gross, Aleks; Scott, Sam; Franklin, Ed; Breakspear, Dave; Dennison, Luke; White, Paul; Cain, Andrew; Eisenmann, Joey C; Malina, Robert M
2018-04-01
Individual differences in the growth and maturation have been shown to impact player performance and development in youth soccer. This study investigated Premier League academy players' experiences of participating in a tournament bio-banded for biological maturation. Players (N = 66) from four professional soccer clubs aged 11 and 14 years and between 85-90% of adult stature participated in a tournament. Players competed in three 11 vs 11 games on a full size pitch with 25-min halves. Sixteen players participated in four 15-min focus groups and were asked to describe their experiences of participating in the bio-banded tournament in comparison to age group competition. All players described their experience as positive and recommended the Premier League integrate bio-banding into the existing games programme. In comparison to age-group competitions, early maturing players described the bio-banded games more physically challenging, and found that they had to adapt their style of play placing a greater emphasis on technique and tactics. Late maturing players considered the games to be less physically challenging, yet appreciated the having more opportunity to use, develop and demonstrate their technical, physical, and psychological competencies. Bio-banding strategies appear to contribute positively towards the holistic development of young soccer players.
Monitoring evaluation of a spillway pilaster for Premiere Chute Dam
Energy Technology Data Exchange (ETDEWEB)
Crepeau, Louis; Kassem, Chakib [OSMOS Canada Inc., Montreal, (Canada)
2010-07-01
The Premiere-Chute hydroelectric power station, commissioned in 1968, has four hydraulic turbines for a total of 130 MW. One of the pilasters of the dam weir, built with pre-stressed concrete, showed a crack at the level of the post-tension cable. This paper presented an evaluation of the behaviour of the pilaster in question, No. 9. The main goal was to prevent any disruption to the gate opening through adequate monitoring for a long term data follow-up. Six long-base OSMOS type optical sensors were installed on each face of the spillway pilaster. The behaviour of the No. 9 pilaster was then compared with that of other pilasters with respect to the effects of temperature and water level fluctuation in the dam. After the pilasters had been monitored for six months, it was found that No. 9 pilaster showed the least deformation of all. It was therefore concluded that the behaviour of this pilaster was normal.
The Watts Premier M-2400 POE RO Drinking Water Treatment System was tested at the NSF Drinking Water Treatment Systems Laboratory for removal of the viruses fr and MS2, the bacteria Brevundimonas diminuta, and chemicals aldicarb, benzene, cadmium, carbofuran, cesium, chl...
Coexistence of Wormian Bones With Metopism, and Vice Versa, in Adult Skulls.
Cirpan, Sibel; Aksu, Funda; Mas, Nuket; Magden, Abdurrahman Orhan
2016-03-01
The aim of the study is to investigate coexistence of Wormian bones with metopism, and vice versa, in adult skulls. A total of 160 dry adult human skulls of unknown sex and ages were randomly selected from the Gross Anatomy Laboratory of Medical School of Dokuz Eylul University. The skulls were examined for presence of metopism, Wormian bones (WB), and coexistence of WBs with metopism and vice versa. Topographic distribution of the WBs was macroscopically evaluated within the skulls including metopism. The photographs were being taken with Canon 400B (55 mm objective). The frequency of metopism and WBs in 160 skulls is 7.50% (12/160) and 59.3% (95/160), respectively, P coexistence of WBs with metopism was found as 11 of 12 skulls (91.66%), whereas the incidence of coexistence of metopism with WBs was found as 11 of 95 skulls (11.58%), P coexistence of WBs with metopism (11/12, 91.66%) and coexistence of metopism with WBs (11/95, 11.58%). The factors leading to metopism may also lead to WBs, whereas that the factors leading to WBs may not lead to metopism.
National Literacy Trust, 2010
2010-01-01
Premier League Reading Stars (PLRS) is in its eighth year. To complement a pre-post quantitative survey, an impact evidence base was required to inform consideration of continued funding into 2011 and beyond. PLRS is very highly regarded among child participants, parents, and librarians. The structure of the scheme, its basis on football, and the…
Injury profile of a professional soccer team in the premier league of iran.
Hassabi, Mohammad; Mohammad-Javad Mortazavi, Seyed; Giti, Mohammad-Reza; Hassabi, Majid; Mansournia, Mohammad-Ali; Shapouran, Sara
2010-12-01
Despite numerous studies which have been done regarding soccer injuries worldwide, there is lack of available data considering the epidemiology of injuries in the Iranian soccer premier league, although it is the most popular sport in the country. The main goal of this research was to determine the incidence of physical injuries in the studied population, considering other characteristics such as site, type and mechanism as well. Twenty one adult male professional soccer players (age 24±3), members of a team (Tehran-Pas) participating in Iranian premier league, were followed during a 4-month period. The injury characteristics and exposure times were recorded by the team physician during all the matches and training sessions. The total exposure time was 2610 playing hours (2352 h of training versus 258 h of competition). Eighty six percent of the injuries were acute. Incidence of acute injuries was 16.5 (95% CI: 12-22) per 1000 hours of playing (11.5 per 1000 hrs of training and 62 per 1000 hrs of competition). The most common types of injuries were strains followed by contusions, each of which constituted 30% of acute injuries. More than 80% of injuries occurred in lower limbs, especially in thigh and groin regions. Nearly 60% of acute injuries occurred in dominant side of the body, and collision was the reason of about half of the acute injuries. Severity of more than 70% of the injuries was minor. On average each injury had led the player being off the field for about 10 days. The incidence of injury in this research is in range of numbers obtained in important international tournaments but the rate of injuries during training sessions is higher than comparable studies.
International Nuclear Information System (INIS)
Keppler, J.H.; Meritet, S.
2004-01-01
As part of the seminars that are organised on a regular basis, the Centre de Geopolitique de l'Energie et des Matieres Premieres has devoted, on the 2. of June, a day to China, its energetics outlook and the resulting economic and geopolitical challenges. (authors)
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Giafferri, Xiaomin
2008-01-01
Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...
Bryson, Alex; Chevalier, Arnaud
2014-01-01
Research on employers' hiring discrimination is limited by the unlawfulness of such activity. Consequently, researchers have focused on the intention to hire. Instead, we rely on a virtual labour market, the Fantasy Football Premier League, where employers can freely exercise their taste for racial discrimination in terms of hiring and firing. The setting allows us to eliminate co-worker, consumer-based and statistical discrimination as potential sources of discrimination, thus isolating the ...
Guillaume, Jeanneret
2014-01-01
Mr Lapo Pistelli Vice Minister at Foreign Affairs and International Cooperation, Member of the Italian Parliament (Chamber of Deputies), Italian Republic, signing the Guest Book with CERN Director-General R. Heuer ; Physics Department Head L. Mapelli also present
Directory of Open Access Journals (Sweden)
1997-01-01
of a new journal is dependent not only on attracting high quality papers, but on the preservation of high standards in the overall editorial process. This requires, inter alia, a sympathetic managing editor to assist non-native English speakers in Europe and beyond to communicate their research findings with good clarity. We are highly fortunate that Dr j S G (Jim McCulloch, who has had such a major impact on the success of the Journal of Hydrology, has agreed to take on the onerous task of launching and managing HESS. He will be supported by a panel of Scientific Editors and by an Editorial Board, who will advise him. We are indebted to Dr McCulloch and his editorial office team for their dedicated efforts in bringing this first issue to fruition. We also thank the authors, who have entrusted their papers to HESS, the reviewers who have responded so promptly and Arne Richter, the Secretary-General of EGS, for his continual support and enthusiasm for this venture. Finally, and most important of all, we appeal to you, and all members of the scientific community, to support HESS by * taking out a personal subscription; * arranging for an institutional subscription; * contributing your best papers; * helping with the peer review process. By rallying around HESS and giving it the priority which will ensure that high quality is achieved from the outset, we can, as a community, eventually match the achievements of WRR. You and future generations of European hydrologists will be the beneficiaries. Philip O'Kane Enda O'Connell EGS Vice-President Past-EGS Vice-President (Hydrological Sciences (Hydrological Sciences
A Vice-President from the Business World Brings a New Bottom Line to Penn.
van der Werf, Martin
1999-01-01
The executive vice-president of the University of Pennsylvania is credited with making significant changes in both the administration and the campus, using cost-cutting and change strategies from his business experience. Outsourcing, training for employees who might be terminated, substantial savings and new revenue, and gentrification of…
Verification testing of the Watts Premier M-Series M-15,000 RO Treatment System was conducted over a 31-day period from April 26, 2004, through May 26, 2004. This test was conducted at the Coachella Valley Water District (CVWD) Well 7802 in Thermal, California. The source water...
Directory of Open Access Journals (Sweden)
Mario D. Serrafero
2013-09-01
presidente. Y el vicepresidente puede esperar, a su vez, proyección hacia el futuro, incluso la sucesión presidencial. Así se ha señalado que constituye un campo de experiencia y preparación para el cargo máximo: hacia finales del siglo XX trece de los cuarenta presidentes norteamericanos sirvieron en la vicepresidencia. En síntesis, en este estudio se brinda un enfoque de análisis de la vicepresidencia y se tratan algunos de los problemas que ha presentado en los países de America Latina. Luego se realiza un análisis de la experiencia norteamericana y de la evolución de la institución en ese país. El análisis del caso norteamericano resulta útil para iniciar un debate sobre la vicepresidencia en la región, para explorar una necesaria agenda de investigación y como una de las alternativas posibles a la hora de su reforma. In the Presidential Regimes of Latin America, the institution of the Vice Presidency has been barely studied, unlike that of the United States. It only received some comments from authors such as Juan Linz, doubting its effectiveness and pointing out some of the issues surrounding its figure, like the criteria for nomination of candidates and conflicts with the Presidents. But Vice Presidency was practically not taken into account in the debate on presidencialism and parlamentarism, despite being the second place of importance in a presidential regime. With democracy back in the region, Vice Presidency has generated numerous political problems, but there virtually isn’t any academic debate on this. Severe tensions and conflicts between the President and Vice President, even Vice Presidents turned into opponent, are some of the problems observed. On the other hand, some Vice Presidents have taken, with varying success, the role of President be it because of the former’s death or because of political crisis that culminated with the resignation of the President. In the United States, historically, there has been a devalued image of Vice
Wisdom teeth: mankind's future third vice-teeth?
Zou, DuoHong; Zhao, Jun; Ding, WangHui; Xia, LunGuo; Jang, XinQuan; Huang, YuanLiang
2010-01-01
The third molar teeth (wisdom teeth) represent the last eruption of the teeth in the human dentition. Throughout evolution, the mandible has had a tendency to decrease in size; the third molar teeth are often impacted, resulting in incomplete tooth eruption that often causes clinical pericoronitis, dental caries, and pericemental abscess. Therefore, the wisdom teeth are often extracted. Moreover, wisdom teeth are often removed for clinical orthodontic treatment. On the other hand, tooth loss due to periodontal disease, dental caries, trauma, or a variety of genetic disorders continues to affect people's lives. Autologous tissues for dental tissue regeneration that could replace lost teeth could provide a vital alternative to currently available clinical treatments. To pursue this goal, we hypothesize that human third molar tooth buds can be obtained during development. Human wisdom tooth germination tissue could then be placed into an embryonic stem cell bank for storage. When the donor's other teeth are missing, embryonic stem cell and tissue engineering technologies, will permit the restoration of the missing teeth. Therefore wisdom teeth will be mankind's future third vice-teeth.
The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed
Chen, Chi-ju
2017-04-01
Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop
Brice, Maximilien
2016-01-01
Dr Hamad Al-Ibrahim Executive Vice President, Qatar Foundation Research and Development. Were present: CERN International Relations Unit, Adviser for Qatar P. Fassnacht; CERN Director for Research and Computing E. Elsen; Texas A&M Professor of Physics A. Safonov ; CERN Director for International Relations C. Warakaulle; Professor of Physics, Qatar University I.Al-Qaradawi; Executive Vice President H. Al-Ibrahim; CERN Director-General F. Gianotti; Ambassador Faisal Bin Abdulla Al-Henzab to the UNOG; Director of Research Computing, Texas A&M, Qatar O. Bouhali; Vice Dean, Texas A&M, Qatar E. Massad; Executive Director, Research Coordination & Special Initiatives, Qatar Foundation R&D D. Khoury.
Dr Jung Hyun KIM Vice Minister for Education, Science and Technology MEST Republic of Korea
Jean-Claude Gadmer
2010-01-01
He learnt about CERN's LHC computing grid project from Frédéric Hemmer, head of the information technology department. In addition, the vice-minister toured the ATLAS visitor centre, the CMS control centre, the ALICE experiment's exhibition and control room, and he met Korean scientists at CERN.
The Academic Role of the Vice President for Health Sciences: Can a Walrus Become a Unicorn?
Pellegrino, Edmund D.
1975-01-01
The Vice President for Health Sciences is a term used for the chief administrative officer of a multi-unit health science component of a university. This essay reviews this job, and the transformation it has undergone in the past. (Editor/PG)
The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...
Football fans and food: a case study of a football club in the English premier league.
Ireland, Robin; Watkins, Francine
2010-05-01
Although there is growing awareness of the impact of diet on health, little attention has been given to the food available in our sports stadia. We used a football club (Citygrene FC) - Citygrene is a fictional name - in the English Premier League as a case study to examine the attitudes of male and female football supporters to the food and drink available at their home stadium (Citygrene Stadium). The research design used five focus groups of male and female fans. The discourse was audiotaped, transcribed, coded and analysed for themes. A football stadium in the English Premier League, England. The participants were season ticket holders drawn from two stands at Citygrene Stadium. The research showed a high level of dissatisfaction with the food and drink supplied. There were key differences in the views of the male and female participants in the focus groups, with the women more concerned about wider issues such as the lack of healthy food. Both men and women were aware of their role as consumers and felt that there was an opportunity for Citygrene to improve their catering profits, if they provided a better selection of food and drink and an improved service. The study shows that there is a demand for healthier food options (and a wider choice of food and drink in general), which may provide an economic opportunity for stadium and catering managers. In addition, a stadium may be considered a potential 'healthy setting', which can serve as a supportive environment for healthier food choices.
Bunn, C.; Ireland, R.; Minton, J.; Holman, D.J.; Philpott, M.; Chambers, S.
2018-01-01
While the nature of gambling practices is contested, a strong evidence\\ud base demonstrates that gambling can become a serious disorder and have\\ud a range of detrimental effects for individuals, communities and societies.\\ud Over the last decade, football in the UK has become visibly entwined with\\ud gambling marketing. To explore this apparent trend, we tracked shirt\\ud sponsors in both the English and Scottish Premier Leagues since 1992 and\\ud found a pronounced increase in the presence of...
Tambunan, Susi Marta
2016-01-01
Santika Premiere Dyandra Hotel & Convention, Medan, is one of movers in hotel service industry which combines products and services, including the combination of service quality, price, and location in order to attract and provide satisfaction for its guests. It also pays attention to and gives expectation and needs for the guests by giving something correctly which are in line with the guests’ need by providing good performance so that they will be satisfied and will eventually be loyal to t...
Directory of Open Access Journals (Sweden)
Helen Peterson
2018-06-01
Full Text Available Applying a critical gendered lens, this article examines academic leadership ideals. It draws on a content analysis of job advertisements for Vice-Chancellors at Swedish higher education institutions from 1990 until 2018. The aim of the article is to investigate to what extent masculine or feminine wordings have been used to describe the ideal Vice-Chancellor in these documents. The analysis reveals that a shift in the leadership ideal has taken place during the time period investigated. Before this shift, during the 1990s, the ideal Vice-Chancellor was described as competitive, bold, strong, tough, decisive, driven, and assertive. These wordings are still included in the job advertisements from the 2000s and the 2010s. However, a more communicative and collaborative leadership ideal also emerges during these decades. There is thus a significant shift in how the leadership ideal is described. This shift is analyzed from a gendered perspective, suggesting that the traditional masculine-biased leadership ideal has decreased in influence with the feminine, transformational leadership ideal acting as a counterweight. The article argues that the shift in leadership ideals, as constructed in the job advertisements, mirrors the increase of women Vice-Chancellors appointed in the Swedish higher education sector.
Shepherd, Sue
2018-01-01
Deputy and pro-vice-chancellors (DVCs and PVCs) are core members of the executive team and play a pivotal role in university management. Nevertheless, they have rarely been the subject of empirical investigation. This study addresses this research gap, utilising a census to examine the size and remit of the DVC and PVC cohort in English pre-1992…
Directory of Open Access Journals (Sweden)
Hezron Sabar Rotua Tinambunan
2016-06-01
Full Text Available In the process of impeachment, Constitutional Court has the obligation to give its judgement to House of Representatives’s opinion regarding allegation of violation by the President and/or Vice President. Constitutional Court checks and judges House of Representatives’s opinion on whether or not the President and/or Vice President works fulfill Article 7A of Constitution of Republic Indonesia 1945 (UUD NRI 1945. The inspection done by Constitutional Court is the judicial process whose decision is in the form of justisil. The result of this impeachment process heavily depends on the judgement of People's Consultative Assembly in its plenary meeting which is also a politics forum, where President and/or Vice President could be dismissed or not. Constitutional Court’s judgement does not apply to People's Consultative Assembly, hence, the difference of Constitutional Court and People's Consultative Assembly’s judgement in plenary meeting that is very political by its nature is very likely to happen. Involvement of Constitutional Court in the procss of impeachment is, of course, different in each country. It depends on governance system in that particular country, it also relies on how much authority that is given by Constitution to Constitutional Court in the process of impeachment itself.
Directory of Open Access Journals (Sweden)
Jany Prihastuty
2017-04-01
Full Text Available Introduction: Quality of Nursing Work Life (QNWL is a thing that needs attention by human resource management approach. The purpose of this research was to provide develop model to increase QNWL in order to lower nurse’s intention to quit the Premier Hospital Surabaya. Methods: Design used in the structure was explanatory research. The independent variables was Internal factors (Individual factors, social and environment conceptual factors, operational factors, administrative factors where as the dependent variable from this study was intention to quit, and moderator variables QNWL random sampling technique. Total sample was 160 nurses, taken according to inclusion criteria. The research was conducted in Premier Hospital Surabaya from October 2012 - July 2013. Data were collected by using structured questionnaire. Data were then analyzed by using multiple linear regression test with level of significance of ≤ 0.05. Result: The results showed, QNWL was influenced by relationships inter-professional part of variabel social and environment conceptual factors, supervision monitoring part of variabel operational factors, career development part of variabel administrative factors. Intention to quit influenced by relationships between nurses, inter-departmental and inter-professional part of variabel social and environment conceptual factors and salaries and benefits part of variabel administrative factors with significant value p = 0.005. Discussion: It can be concluded good inter-professional relation, supervision monitoring, and good career development affected QNWL. Good relationships between nurses, inter-departmental and inter- professional led to lower intention to quit. Low salary and benefits led nurse’s intention to quit getting stronger.
Directory of Open Access Journals (Sweden)
Adam R. Nicholls
2017-05-01
Full Text Available All football teams that compete within the F. A. Premier League possess an academy, whose objective is to produce more and better home-grown players that are capable of playing professionally. These young players spend a large amount of time with their coach, but little is known about player’s perception of the coach–athlete relationship within F. A. Premier League Academies. The objectives of this study were to examine whether perceptions of the coach–athlete relationship changed over six months and if the coach–athlete relationship predicted self-reported goal achievement among F. A. Premier League academy players. This study included cross-sectional (n = 104 and longitudinal (n = 52 assessments, in which academy soccer players completed a measure of the coach–athlete relationship and goal achievement across either one or two time periods. The cross-sectional data were subjected to bivariate correlations, whereas the longitudinal data were analyzed using multiple regressions. Perceptions of the coach–athlete relationship remained stable over time. The coach–athlete relationship predicted the achievement of mastery goals six months later. Enhancing the quality of the coach–athlete relationship among elite adolescent athletes appears to be a suitable way of maximizing mastery achievement goals, particularly among developmental athletes who participate in team sports.
Energy Technology Data Exchange (ETDEWEB)
Chalot, A; Ginier, R; Sauvage, M [Association Euratom-CEA Cadarache (France). Centre d' Etudes Nucleaires
1964-07-01
This report deals with the first series of experiments carried out on the engineering model of Rapsodie and on an associated sodium facility set in a laboratory hall of Cadarache. It conveys more precisely: 1/ - The difficulties encountered during the erection and assembly of the engineering model and a compilation of the results of the first series of experiments and tests carried out on this installation (loading of the subassemblies preheating, thermal chocks...). 2/ - The experiments and tests carried out on the two prototypes control rod drive mechanisms which brought to the choice for the design of the definitive drive mechanism. As a whole, the results proved the validity of the general design principles adopted for Rapsodie. (authors) [French] Ce rapport traite des premiers essais realises sur la maquette du bloc pile de Rapsodie et sur une installation annexe de sodium, implantees dans un hall d'essais de Cadarache. Il fait part: 1/- Des difficultes eprouvees lors du montage de la maquette et rassemble les resultats des premiers essais effectues sur cette installation (chargement des assemblages, prechauffage, chocs thermiques...). 2/- Des essais realises sur deux prototypes de mecanisme de barre de controle qui ont conduit a la conception du mecanisme definitif. L'ensemble des resultats obtenus a permis de confirmer la validite des principes adoptes pour la pile Rapsodie. (auteurs)
Directory of Open Access Journals (Sweden)
Masha Itzhaki
2012-11-01
Full Text Available Les premiers pas du célèbre auteur S. Y. Agnon lors de son premier séjour à Jaffa (1908-1912 sont liés aux deux revues hébraïques : Ha-Omer, histoire d’un échec, et Ha-po‘el ha-tsa‘ir, histoire d’une réussite, et aux rédacteurs en chef de ces revues, les écrivains et pères spirituels du jeune Agnon, Sh. Ben Tzion, un écrivain esthétique, bourgeois, et Y. H. Brenner, un penseur tourmenté, un véritable intellectuel socialiste.The first period of the famous writer S. Y. Agnon in Jaffa (1908-1912 has a lot to do with two literary Hebrew periodicals: Ha-Omer, a story of a failure, and Ha-po‘el ha-tsa‘ir, a successful one, as well as with two major figures in Hebrew literary milieu at that time, the editors, Sh. Ben Tzion and Y. H. Brenner.
Prepaid cards: vulnerable to money laundering?
Stanley J. Sienkiewicz
2007-01-01
This paper discusses the potential money laundering threat that prepaid cards face as they enter the mainstream of consumer payments. Over the past year, several government agencies have issued reports describing the threat to the U.S. financial system, including the use of prepaid cards by money launderers. Also, this paper incorporates the presentations made at a workshop hosted by the Payment Cards Center at which Patrice Motz, executive vice president, Premier Compliance Solutions, and Pa...
Evaluation of sports nutrition knowledge of New Zealand premier club rugby coaches.
Zinn, Caryn; Schofield, Grant; Wall, Clare
2006-04-01
Little is known about if and how team coaches disseminate nutrition information to athletes. In a census survey, New Zealand premier rugby coaches (n = 168) completed a psychometrically validated questionnaire, received by either Internet or standard mail (response rate, 46%), identifying their nutrition advice dissemination practices to players, their level of nutrition knowledge, and the factors determining this level of knowledge. The majority of coaches provided advice to their players (83.8%). Coaches responded correctly to 55.6% of all knowledge questions. An independent t-test showed coaches who imparted nutrition advice obtained a significantly greater score, 56.8%, than those not imparting advice, 48.4% (P = 0.008). One-way ANOVA showed significant relationships between total knowledge score of all coaches and qualifications [F(1,166) = 5.28, P = 0.001], own knowledge rating [F(3,164) = 6.88, P = 0.001] and nutrition training [F(1,166) = 9.83, P = 0.002]. We conclude that these rugby coaches were inadequately prepared to impart nutrition advice to athletes and could benefit from further nutrition training.
Linear systems surviving the first breakdown; Systemes unbaires survivant a la premiere panne
Energy Technology Data Exchange (ETDEWEB)
Uberschlag, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1967-07-01
Various types of linear systems are described which are not affected by the first breakdown. They make it possible to operate continuously and are thus very reliable. This is because the first breakdown which occurs affects only very slightly the operation. These components can be replaced during working. The operation, the errors, and the detection are briefly considered in the case of three different designs of linear servo systems. An attempt at comparison is made, it could be developed in a particular case. (author) [French] On decrit divers types de systemes lineaires survivant a la premiere panne. Ils permettent un fonctionnement permanent et sont donc d'une tres grande fiabilite. En effet, une panne, qui peut etre signalee, perturbe peu le fonctionnement. Ces composants peuvent etre remplaces en marche. Les considerations de fonctionnement, d'erreur, de detection des pannes sont succinctement presentees, sur trois schemas de systemes lineaires asservis. Une tentative de comparaison est faite, qui pourrait etre developpee dans des cas precis. (auteur)
Fitzpatrick, Stephanie L; Bandeen-Roche, Karen; Stevens, Victor J; Coughlin, Janelle W; Rubin, Richard R; Brantley, Phillip J; Funk, Kristine L; Svetkey, Laura P; Jerome, Gerald J; Dalcin, Arlene; Charleston, Jeanne; Appel, Lawrence J
2014-04-01
To examine the behavioral processes through which lifestyle interventions impacted weight loss. The analyses were limited to overweight and obese Black and White adults randomized to a PREMIER lifestyle intervention (N = 501). Structural equation modeling was conducted to test the direct and indirect relationships of session attendance, days of self-monitoring diet and exercise, change in diet composition and exercise, and 6-month weight change. Greater session attendance was associated with increased self-monitoring, which was in turn significantly related to reduction in percent energy from total fat consumed. Change in percent energy from fat and self-monitoring was associated with 6-month percent change in weight. Both a decrease in fat intake and increase in self-monitoring are potential mediators of the relationship between attendance and weight change. The findings provide a reasonable model that suggests regular session attendance and use of behavioral strategies like self-monitoring are associated with improved behavioral outcomes that are associated with weight loss. Copyright © 2013 The Obesity Society.
Ireland, Gareth; North, Matthew R.; Petropoulos, George P.; Srivastava, Prashant K.; Hodges, Crona
2015-04-01
Acquiring accurate information on the spatio-temporal variability of soil moisture content (SM) and evapotranspiration (ET) is of key importance to extend our understanding of the Earth system's physical processes, and is also required in a wide range of multi-disciplinary research studies and applications. The utility and applicability of Earth Observation (EO) technology provides an economically feasible solution to derive continuous spatio-temporal estimates of key parameters characterising land surface interactions, including ET as well as SM. Such information is of key value to practitioners, decision makers and scientists alike. The PREMIER-EO project recently funded by High Performance Computing Wales (HPCW) is a research initiative directed towards the development of a better understanding of EO technology's present ability to derive operational estimations of surface fluxes and SM. Moreover, the project aims at addressing knowledge gaps related to the operational estimation of such parameters, and thus contribute towards current ongoing global efforts towards enhancing the accuracy of those products. In this presentation we introduce the PREMIER-EO project, providing a detailed overview of the research aims and objectives for the 1 year duration of the project's implementation. Subsequently, we make available the initial results of the work carried out herein, in particular, related to an all-inclusive and robust evaluation of the accuracy of existing operational products of ET and SM from different ecosystems globally. The research outcomes of this project, once completed, will provide an important contribution towards addressing the knowledge gaps related to the operational estimation of ET and SM. This project results will also support efforts ongoing globally towards the operational development of related products using technologically advanced EO instruments which were launched recently or planned be launched in the next 1-2 years. Key Words: PREMIER
Utopia and Debt in Postmodernity; or, Time Management in Inherent Vice
Directory of Open Access Journals (Sweden)
James Liner
2016-05-01
Full Text Available The category of postmodernism has come under renewed scrutiny in recent years. Indeed, it has become rather commonplace to pronounce the death or obsolescence of postmodernism today. Unsurprisingly, the increasingly questioned status of postmodernism also impacts the field of Pynchon studies. This article reads 'Inherent Vice' as symptomatic not of the end but of a transformation of postmodernism and postmodernity. Pynchon’s novel simultaneously registers a contemporary intensification of postmodern/late capitalism and, crucially, participates in a minor current in postmodernism, one which insists on collective agency and utopian thinking despite the atomization and isolation of subjects accomplished by late capitalism and which, against all odds, remembers how to think historically—or better, invents new ways of thinking historically.
CERN Photo Service
2008-01-01
21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.
Directory of Open Access Journals (Sweden)
Corbin Pierre
2014-07-01
Nous nous proposons d’examiner, dans l’histoire des dictionnaires généraux monolingues Larousse des origines à nos jours, une sélection de jalons de l’articulation entre structure conceptuelle et structure formelle des articles. Au regard de l’ampleur des données à couvrir, il ne pourra bien entendu s’agir que d’un survol, mais celui-ci permettra (1 de présenter le premier des trois modèles majeurs de codification des articles dans l’histoire des dictionnaires Larousse, celui qui trouve son origine dans le Nouveau dictionnaire de la langue française de 1856 ou ses éditions révisées, (2 de prendre en compte les dictionnaires proposés par cet éditeur en un siècle et demi qui ont repris le modèle de 1856 ou sa forme révisée, et (3 de présenter contrastivement au premier les deux autres modèles majeurs, qui trouvent leur ancrage chronologique respectivement dans le Grand dictionnaire universel du XIXe siècle de 1866-1876 et le Dictionnaire du français contemporain de 1966.
Pandey, Ambarish; Abdullah, Kazeen; Drazner, Mark H
2014-05-01
Although celebrity illnesses attract a significant amount of media attention in the United States, there are few studies that have looked at how celebrity health conditions impact the awareness of the illness in the general population. Recently, Vice President Cheney underwent left ventricular assist device (LVAD) implantation and subsequently a cardiac transplant. The aim of this study was to determine whether there was evidence of increased interest in these 2 procedures as assessed by social media. We determined the relative frequency of Google searches for LVAD and heart transplantation from 2004 to 2013 using Google trends. We also counted the number of YouTube videos and Twitter messages posted monthly concerning LVADs over a 7-year time frame. There was a significant spike in the Google search interest for LVAD and heart transplantation in the month when Vice President Cheney underwent the respective procedure. Similarly, there was a large increase in YouTube videos and Twitter messages concerning LVADs shortly after he was implanted. In total, these data support the concept that a public figure's illness can significantly influence the public's interest in that condition and its associated therapies. Copyright © 2014 Elsevier Inc. All rights reserved.
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Directory of Open Access Journals (Sweden)
Xiaomin Giafferri
2008-12-01
Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.
Hydrologic Regulation of Plant Rooting Depth and Vice Versa
Fan, Y.; Miguez-Macho, G.
2017-12-01
How deep plant roots go and why may hold the answer to several questions regarding the co-evolution of terrestrial life and its environment. In this talk we explore how plant rooting depth responds to the hydrologic plumbing system in the soil/regolith/bedrocks, and vice versa. Through analyzing 2200 root observations of >1000 species along biotic (life form, genus) and abiotic (precipitation, soil, drainage) gradients, we found strong sensitivities of rooting depth to local soil water profiles determined by precipitation infiltration depth from the top (reflecting climate and soil), and groundwater table depth from below (reflecting topography-driven land drainage). In well-drained uplands, rooting depth follows infiltration depth; in waterlogged lowlands, roots stay shallow avoiding oxygen stress below the water table; in between, high productivity and drought can send roots many meters down to groundwater capillary fringe. We explore the global significance of this framework using an inverse model, and the implications to the coevolution of deep roots and the CZ in the Early-Mid Devonian when plants colonized the upland environments.
Jones, David E.
2016-01-01
This study aimed to both draw awareness and increase understanding of how lived experiences across race, gender and sexual orientation social identities impact the leadership approach of Vice Presidents for Student Affairs. As the student demographic becomes increasingly more diverse on college and university campuses, higher education leaders…
Anderson, Liam; Orme, Patrick; Naughton, Robert J; Close, Graeme L; Milsom, Jordan; Rydings, David; O'Boyle, Andy; Di Michele, Rocco; Louis, Julien; Hambly, Catherine; Speakman, John Roger; Morgans, Ryland; Drust, Barry; Morton, James P
2017-06-01
In an attempt to better identify and inform the energy requirements of elite soccer players, we quantified the energy expenditure (EE) of players from the English Premier League (n = 6) via the doubly labeled water method (DLW) over a 7-day in-season period. Energy intake (EI) was also assessed using food diaries, supported by the remote food photographic method and 24 hr recalls. The 7-day period consisted of 5 training days (TD) and 2 match days (MD). Although mean daily EI (3186 ± 367 kcals) was not different from (p > .05) daily EE (3566 ± 585 kcals), EI was greater (p recovery from match play was not in accordance with guidelines to promote muscle glycogen storage.
Predicting Football Matches Results using Bayesian Networks for English Premier League (EPL)
Razali, Nazim; Mustapha, Aida; Yatim, Faiz Ahmad; Aziz, Ruhaya Ab
2017-08-01
The issues of modeling asscoiation football prediction model has become increasingly popular in the last few years and many different approaches of prediction models have been proposed with the point of evaluating the attributes that lead a football team to lose, draw or win the match. There are three types of approaches has been considered for predicting football matches results which include statistical approaches, machine learning approaches and Bayesian approaches. Lately, many studies regarding football prediction models has been produced using Bayesian approaches. This paper proposes a Bayesian Networks (BNs) to predict the results of football matches in term of home win (H), away win (A) and draw (D). The English Premier League (EPL) for three seasons of 2010-2011, 2011-2012 and 2012-2013 has been selected and reviewed. K-fold cross validation has been used for testing the accuracy of prediction model. The required information about the football data is sourced from a legitimate site at http://www.football-data.co.uk. BNs achieved predictive accuracy of 75.09% in average across three seasons. It is hoped that the results could be used as the benchmark output for future research in predicting football matches results.
What’s a Cricketer’s Worth? Predicting Bid Prices for Indian Premier League Auctions
Directory of Open Access Journals (Sweden)
Siddhartha K. RASTOGI
2017-04-01
Full Text Available Indian Premier League is a twenty-over format cricket tournament of teams representing different Indian cities. Beginning 2008, it is established now as a grand annual affair. The team franchises are auctioned on long term basis, whereas cricketers are auctioned every season under certain conditions. Despite such wealth of information, studies on IPL auctions are rare barring four cited models. The present paper studies the results of year 2011 English-style auction of cricketers and recalibrates the old yet most accurate model by Rastogi and Deodhar (2009. Both models use ordinary least square method of regression albeit with different variable. The old models lack predictive power, whereas the recalibrated model presented displays better predictive capability as compared to earlier models. It also succeeds in reducing overall predictability gap and stands significantly parsimonious vis-à-vis previous models. Further, the final model presented is applied on 2013 and 2014 auction data to show superior results.
Celik, Kazim
2013-01-01
Problem Statement: Role ambiguity and role conflict are considered issues that affect performance and lead to burnout. While numerous studies have analyzed role ambiguity or role conflict in relation to burnout or performance, few studies have studied all of these issues together. Since vice principals are expected to carry out a variety of…
La f trait fibrillation tement da n atriale, ans un serv fréquence vice ...
African Journals Online (AJOL)
raoul
gine de la fib es étaient plu âge > 50 ans e 16, 2010 fréquence vice de ca aba Souley ane Adama acie et Odo. Grand Yoff, D té de Médecin. Hôpital Généra on atriale es travail étaie la fibrillation t d'une étude atients hospit ale était de 5 nce feminine brillation était us fréquentes. (p=0,01) et e, facteur rdiologie ymane1, Bod.
NASA Names Premier X-Ray Observatory and Schedules Launch
1998-12-01
NASA's Advanced X-ray Astrophysics Facility has been renamed the Chandra X-ray Observatory in honor of the late Indian-American Nobel laureate, Subrahmanyan Chandrasekhar. The telescope is scheduled to be launched no earlier than April 8, 1999 aboard the Space Shuttle Columbia mission STS-93, commanded by astronaut Eileen Collins. Chandrasekhar, known to the world as Chandra, which means "moon" or "luminous" in Sanskrit, was a popular entry in a recent NASA contest to name the spacecraft. The contest drew more than six thousand entries from fifty states and sixty-one countries. The co-winners were a tenth grade student in Laclede, Idaho, and a high school teacher in Camarillo, CA. The Chandra X-ray Observatory Center (CXC), operated by the Smithsonian Astrophysical Observatory, will control science and flight operations of the Chandra X-ray Observatory for NASA from Cambridge, Mass. "Chandra is a highly appropriate name," said Harvey Tananbaum, Director of the CXC. "Throughout his life Chandra worked tirelessly and with great precision to further our understanding of the universe. These same qualities characterize the many individuals who have devoted much of their careers to building this premier X-ray observatory." "Chandra probably thought longer and deeper about our universe than anyone since Einstein," said Martin Rees, Great Britain's Astronomer Royal. "Chandrasekhar made fundamental contributions to the theory of black holes and other phenomena that the Chandra X-ray Observatory will study. His life and work exemplify the excellence that we can hope to achieve with this great observatory," said NASA Administrator Dan Goldin. Widely regarded as one of the foremost astrophysicists of the 20th century, Chandrasekhar won the Nobel Prize in 1983 for his theoretical studies of physical processes important to the structure and evolution of stars. He and his wife immigrated from India to the U.S. in 1935. Chandrasekhar served on the faculty of the University of
Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M
2014-10-01
The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.
ICAROG: a computer code that converts a WIMSD/4 format library of BCD code to binary and vice versa
International Nuclear Information System (INIS)
Caldeira, A.D.
1991-09-01
A program called ICAROG, developed for the CYBER 170/750 system, that converts from BCD to binary code and vice versa a nuclear data library in WIMSD/4 program format is presented. ICAROG has also the capability of separating from the library isotopes specified by the user. (author)
Directory of Open Access Journals (Sweden)
Chih-Hung Ko
2005-12-01
Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.
Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling
Sepehrinia, Reza; Chalangari, Fartash
2018-03-01
The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.
International Nuclear Information System (INIS)
Fesq, H.W.; Bibby, D.M.; Erasmus, C.S.; Kable, E.J.D.
1975-01-01
Neutron-activation studies of the impurity chemistry of more than 1500 natural diamonds from three South African kimberlite sources, Premier, Finsch, and Jagersfontein, provide evidence for the presence of submicroscopic inclusions of a quenched (or temperature re-equilibrated) melt from which these diamonds crystallized. These microscopic inclusions of parental magma contain variable amounts of fluids rich in water and carbon dioxide, as well as iron-nickelcopper-cobalt sulphides, and a major silicate phase, which is remarkably constant in composition irrespective of the source of the diamonds and the age of emplacement of their host kimberlite. These microscopic inclusions are present in varying amounts in all the diamonds that were analysed, and may even dominate the impurity chemistry of diamonds having observable mineral inclusions. An estimate of the composition of the major elements in the silicate melt indicates that the diamonds that were investigated crystallized from picritic magma rich in water and carbon dioxide in the presence of immiscible iron-nickel-copper-cobalt sulphides [af
Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n
Directory of Open Access Journals (Sweden)
Péter Bíró
2011-01-01
Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.
Le cru, le cuit et le pourri dans _Le vice-consul_ de Marguerite Duras
Directory of Open Access Journals (Sweden)
Hélène Caron
2011-05-01
Full Text Available Bien que plusieurs articles critiques aient déjà avancé de nouvelles perspectives sur le texte Le Vice-Consul (LVC de Marguerite Duras, l’analyse de la représentation de la nourriture dans ce roman n’a fait l’objet d’aucune étude. Cet article tente donc de combler cette lacune en proposant d’analyser les images du cru et du cuit, images qui se rejoignent sous les notions du pourri et de l’abject, tout en offrant quelques interprétations de l’un des passages critiques du roman où la folle mendiante croque la tête d’un poisson vivant.
Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.
2009-01-01
Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.
Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.
2008-01-01
We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.
Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan
Directory of Open Access Journals (Sweden)
M.-L. Lin
2005-01-01
Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.
Hirschheydt, Monika von
2015-01-01
Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014
Directory of Open Access Journals (Sweden)
Laurence Vincent-Durroux
2002-12-01
Full Text Available La préoccupation fréquente, chez les étudiants spécialistes d’autres disciplines que l’anglais, d’améliorer leur compréhension de l’anglais oral a motivé notre démarche de création d’un produit SIC (Systèmes d’Information et de Communication : MACAO (Modules d’Aide à la Compréhension de l’Anglais Oral. Le premier module, "S’entraîner à la reconnaissance", est réalisé et l’outil informatique s’est révélé particulièrement utile pour notre projet. Dans cet article, nous faisons état des difficultés récurrentes en compréhension de l’anglais oral : elles peuvent être dues à des attentes erronées fondées sur la dissymétrie entre la langue écrite et la langue orale, mais aussi à une reconnaissance difficile de certains morphèmes par l’existence de variantes phonologiques en fonction du contexte et par la proximité phonologique de certains morphèmes. Nous présentons également comment le contenu du premier module tente d’apporter des solutions à ces difficultés : en amenant les apprenants à prendre conscience du phénomène de réduction vocalique et d’inaccentuation qui touche certaines syllabes des mots aussi bien que certains éléments monosyllabiques de l’énoncé et en proposant un entraînement à la reconnaissance de ces éléments. Le module est en cours de validation avec une phase d’évaluation.French students who have English as part of their curriculum often express the wish to improve their comprehension of oral English. This led us to envisage the creation of a CALL product: MACAO (Modules to help in the comprehension of oral English. The first module has been created: "Training oneself for recognition". The computer was particularly adequate in this prospect. In this paper we present the most frequent difficulties in the comprehension of oral English: they can be related either to erroneous expectations based on the dissymmetry between the written form and the oral
Bennett, Sophia Elizabeth
2017-01-01
from left to right in 53__MA27642: Scuola di Alta Formazione al Management Project manager R. Movva; Agnelli Foundation Director A. Gavosto; Agnelli Foundation Head of Innovation A. Griva; Scuola di Alta Formazione al Management Director S. Pettochi; Agnelli Foundation Vice Chairman, and Fiat Chrysler Automobiles Chairman J. Elkann; CERN Director-General F. Gianotti; Director for International Relations C. Warakaulle; Management Liaison for the Italian Republic, Engineering Department Head R. Losito; Knowledge Transfer Group Leader G. Anelli. Signature of the Framework agreement between the Scuola di Alta Formazione al Management, represented by Director S. Petocchi and CERN, represented by Director-General F. Gianotti, witnessed by Agnelli Foundation Vice Chairman J. Elkann.
Music Export from Helsinki to Berlin and vice versa. Case study: Face of God and Ill Kommodity
Kuhn, Jennifer
2013-01-01
This is a product - oriented thesis. The aim is to conclude a guidebook about music export for young bands that are interested in playing a show abroad. The project: Music export from Helsinki to Berlin and vice versa. Case study: Face of God and Ill Kommodity, was used to learn from the praxis. The thesis describes the responsibilities of the project manager and brings project management and event planning together. The music export history of Finland and Germany is taken in considerat...
Anderson, Liam; Naughton, Robert J; Close, Graeme L; Di Michele, Rocco; Morgans, Ryland; Drust, Barry; Morton, James P
2017-12-01
The daily distribution of macronutrient intake can modulate aspects of training adaptations, performance and recovery. We therefore assessed the daily distribution of macronutrient intake (as assessed using food diaries supported by the remote food photographic method and 24-hr recalls) of professional soccer players (n = 6) of the English Premier League during a 7-day period consisting of two match days and five training days. On match days, average carbohydrate (CHO) content of the prematch (recovery from an evening kick-off) were similar (p > .05) though such intakes were lower than contemporary guidelines considered optimal for prematch CHO intake and postmatch recovery. On training days, we observed a skewed and hierarchical approach (p lunch (0.6 g·kg -1 )>breakfast (0.3 g·kg -1 )>evening snacks (0.1 g·kg -1 ). We conclude players may benefit from consuming greater amounts of CHO in both the prematch and postmatch meals so as to increase CHO availability and maximize rates of muscle glycogen resynthesis, respectively. Furthermore, attention should also be given to ensuring even daily distribution of protein intake so as to potentially promote components of training adaptation.
International Nuclear Information System (INIS)
2001-11-01
During the visit of the Vice-President of the people's republic of China at the Bugey nuclear power plant, EDF showed its will of cooperation with China in the energy domain. This document presents the main aspects of this cooperation: the chinese electric power system panorama, the EDF investments in China and the future development. (A.L.B.)
Les marqueurs d'aspect de dicto : 'à première vue', 'au premier abord', 'de prime abord'
Directory of Open Access Journals (Sweden)
Lenepveu Véronique
2012-07-01
Full Text Available On se propose d’étudier les locutions adverbiales "à première vue", "au premier abord", "de prime abord", trois locutions qui comportent une forme numérale ordinale et qui entretiennent des relations de proximité sémantique. Nous nous intéressons précisément au fonctionnement sémantique et pragmatique de ces locutions à valeur paradigmatisante (Nølke 1983, quand elles introduisent un point de vue (Anscombre & Ducrot 1983, Ducrot 1984, Nølke 1994. Dans cette perspective, nous faisons l’hypothèse d’un procès énonciatif, qui consiste à prendre en considération une situation, et qui vise à constituer un jugement stabilisé. Nous admettons alors que les locutions adverbiales 'à première vue', 'au premier abord', 'de prime abord', servent à sélectionner la phase initiale de ce procès énonciatif, ce qu’attestent les mises en corrélation possibles des trois marqueurs de point de vue avec des expressions qui signalent une évolution dans le temps du jugement du locuteur concernant une situation ('à mieux regarder', 'à y regarder de plus près', 'tout compte fait', 'tout bien considéré', .... L’étude de ces enchaînements, qui vont parfois au-delà du paragraphe, fait apparaître la capacité des trois locutions à initier un cadre (Charolles 1997, et à appeler un autre cadre dans lequel le jugement va être réévalué. En présentant le point de vue qu’elle introduit comme provisoire et en attente de confirmation, chacune de ces locutions anticipe ainsi sur la suite du texte, et s’inscrit dans une structure aspectuelle de dicto qui est celle d’un procès énonciatif de constitution d’un jugement stabilisé. Nous nous appuyons sur des énoncés attestés au XXème, sélectionnés sur "Frantext intégral", ou bien choisis dans Le Monde sur cederom (1995-96, 1999-2002.
Directory of Open Access Journals (Sweden)
Pao-Hwa Lin
2012-06-01
Full Text Available Background: The clinical significance of glycemic index (GI and glycemic load (GL is inconclusive. Objective : This study was conducted to examine the association of GI and GL with clinical cardiovascular disease (CVD risk factors including body weight, blood pressure (BP, serum lipids, fasting glucose, insulin and homocysteine over time among the PREMIER participants. Design: PREMIER was an 18-month randomized lifestyle intervention trial, conducted from 2000 to 2002, designed to help participants reduce BP by following the Dietary Approaches to Stop Hypertension (DASH dietary pattern, losing weight, reducing sodium and increasing physical activity. GI and GL were estimated from 24 h diet recall data at baseline, 6 and 18 months after intervention. PROC MIXED model was used to examine the association of changes in GI or GL with changes in CVD risk factors. Results: A total of 756 randomized participants, 62% females and 34% African Americans and who averaged 50.0±0.3 years old and 95.3±0.7 kg, were included in this report. Neither GI nor GL changes was associated with changes in any risk factors at 6 months. At 18 months, however, the GI change was significantly and positively associated with total cholesterol (TC change only (p<0.05, β = 23.80±12.11 mg/dL or 0.62±0.31 mmol/L with a significant age interaction. The GL change was significantly associated with TC (p=0.02, β = 0.28±0.15 mg/dL or 0.01±0.00 mmol/L positively and with low density lipoprotein cholesterol (LDL-C changes negatively (p=0.03, β = − 0.01±0.00 mg/dL or −0.00±0.00 mmol/L, and significant age interactions were observed for both. Conclusion: GI and GL was associated with TC and LDL-C after controlling for energy, fat and fiber intake and other potential confounders and the associations were modified by age. Further investigation into this relationship is important because of its potential clinical impact.
Club Pétanque
2016-01-01
Suite à notre Assemblée Générale du Mercredi 07 Avril 2016 voici la composition du comité : - Claude CERRUTI : Président - Gino DEBELLIS : Vice Président - Claude JOUVE : Trésorier - Michèle DUNAND : Secrétaire - Bernard GOICOECHEA: Communication - Alain PHILIPONA : Animation Le premier concours de la saison Challenge " Luigi BAVARESCO " aura lieu exceptionnellement le Mercredi 18 Mai 2016 à 18H et ceci pour une raison d'effectif pour l'organisation. Cette date a été modifiée par rapport au calendrier 2016. Merci de votre compréhension.
Sanfey, Hilary; Boehler, Margaret; DaRosa, Debra; Dunnington, Gary L
2012-07-01
The growing appreciation of the need to adopt an evidence-based approach to teaching and assessment has led to a demand for faculty who are well versed in best practices in education. Surgeons with interest and expertise in instruction, curriculum development, educational research, and evaluation can have an important impact on the educational mission of a department of surgery. The increased fervor for accountability in education together with the challenges imposed by accreditation agencies and hospitals has made educational leadership responsibilities more time consuming and complex. In response to this, an increasing number of department chairs created Vice Chair for Education positions to support clerkship and program directors and ensure the department's education mission statement is fulfilled. Copyright © 2012 Elsevier Inc. All rights reserved.
Maximilien Brice
2012-01-01
6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.
Zhang, Wen-Yan; Lin, Chao-Yuan
2017-04-01
The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.
Directory of Open Access Journals (Sweden)
Hongyang Zhang
2016-01-01
Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.
Laubser, Julien
2007-01-01
Le detecteur LHCb est l'une des quatre experiences de physique des particules installees sur la nouvelle chaine d'acceleration LHC (Large Hadron Collider) du CERN a Geneve. Afin de reduire la quantite de donnees destinees au stockage pour les analyses hors ligne, un dispositif de selection en ligne des collisions interessantes selon la physique a etudier est mis en place en parallele de la chaine d'acquisition des donnees. Ce dispositif est compose d'un premier niveau(niveau 0) realise par un systeme electronique complexe et d'un second niveau de selection realise par informatique HLT (High Level Trigger). L'unite de decision de niveau 0 (L0DU) est le systeme central du niveau 0 de declenchement. L0DU prend la decision d'accepter ou de rejeter la collision pour ce premier niveau a partir d'une fraction d'informations issues des sous-detecteurs les plus rapides (432 bits a 80 MHz). L'unite de decision est un circuit imprime 16 couches integrant des composants de haute technologie de type FPGA (Field Programmab...
Energy Technology Data Exchange (ETDEWEB)
Barloutaud, R; Leveque, A; Lehmann, P; Quidort, J [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires
1959-07-01
The reduced probabilities of deexcitation of the first two 2 + levels of {sup 184}W, {sup 186}W, {sup 188}Os, {sup 190}Os, {sup 192}Os and {sup 194}Pt have been deduced from coulombic excitation experiments on these nuclei.The results are included in a chart of the properties of the first two 2 + levels of even-even nuclei situated between masses 182 and 206. The variation of these properties as a function of nuclear distortion is compared with the various theoretical predictions concerning vibration levels. (author) [French] Les probabilites reduites de desexcitation des deux premiers niveaux 2 + de {sup 184}W, {sup 186}W, {sup 188}Os, {sup 190}Os, {sup 192}Os and {sup 194}Pt ont ete deduites des experiences d'excitation coulombienne de ces noyaux. Les resultats sont inseres dans une systematique des proprietes des deux premiers niveaux 2 + des noyaux pairs-pairs situes entre les masses 182 et 206. La variation de ces proprietes en fonction de la deformation nucleaire est comparee aux diverses predictions theoriques concernant les niveaux de vibration. (auteur)
Energy Technology Data Exchange (ETDEWEB)
Gonzales, John
2015-04-02
Presentation by Senior Engineer John Gonzales on Evaluating Investments in Natural Gas Vehicles and Infrastructure for Your Fleet using the Vehicle Infrastructure Cash-flow Estimation (VICE) 2.0 model.
Energy Technology Data Exchange (ETDEWEB)
Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)
2007-07-07
The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)
Directory of Open Access Journals (Sweden)
Estikowati Estikowati
2017-12-01
Full Text Available The study was conducted to determine the effect of the division of labor on the work efficiency of pastry employees at Hotel Santika Premiere Malang. Work efficiency relates to the product produced with the resources used. While the division of labor is a separator type of work done by individuals. Researchers used the Simple Linear Regression Analyze method to predict how far the value of the dependent variable will be changed if the independent variable is changed. From result of research of independent variable (X that is Division of labor and dependent variable (Y Work efficiency have significant relation. This is evidenced from the data processing is known significant value sebersar 0.003 <0.05, with the conclusion Ho rejected and Ha accepted that there is influence between the Division of labor (X on Efficiency of work. From the questionnaire data the authors conclude that the existing division of labor is not appropriate for employees so that the level of efficiency of employees decreased. Normal 0 false false false IN X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi; mso-ansi-language:IN;} The study was conducted to determine the effect of the division of labor on the work efficiency of pastry employees at Hotel Santika Premiere Malang. Work efficiency relates to the product produced with the resources used. While the division of labor is
Career development needs of vice chairs for education in departments of surgery.
Sanfey, Hilary; Boehler, Margaret; Darosa, Debra; Dunnington, Gary L
2012-01-01
To identify the career development needs Vice Chair for Education in Surgery Departments (VCESDs). In all, 33 VCESDs were invited to complete an online survey to identify the scope of duties, scholarly activity, job satisfaction, and career development needs. A total of 29/33 (88%) VCESDs responded. Time constraints were the most frequent impediment for MDs vs. PhDs (p teacher programs (1 ± 0), and program performance evaluation systems (1.33 ± 0.76) for PhDs. The skills deemed to be of greatest importance were ability to communicate effectively (1.27 ± 0.55), resolve personnel conflicts (1.32 ± 0.57), and introduce change (1.41 ± 0.59). PhDs revealed a greater need to learn strategies for dealing with disruptive faculty (1.0 ± 0 vs 2.15 ± 0.87). This information will inform the future career development of VCESDs and will assist Department Chairs who wish to recruit and retain VCESDs. Copyright © 2012 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.
Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.
2017-09-01
Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.
Conversion of radius of curvature to power (and vice versa)
Wickenhagen, Sven; Endo, Kazumasa; Fuchs, Ulrike; Youngworth, Richard N.; Kiontke, Sven R.
2015-09-01
Manufacturing optical components relies on good measurements and specifications. One of the most precise measurements routinely required is the form accuracy. In practice, form deviation from the ideal surface is effectively low frequency errors, where the form error most often accounts for no more than a few undulations across a surface. These types of errors are measured in a variety of ways including interferometry and tactile methods like profilometry, with the latter often being employed for aspheres and general surface shapes such as freeforms. This paper provides a basis for a correct description of power and radius of curvature tolerances, including best practices and calculating the power value with respect to the radius deviation (and vice versa) of the surface form. A consistent definition of the sagitta is presented, along with different cases in manufacturing that are of interest to fabricators and designers. The results make clear how the definitions and results should be documented, for all measurement setups. Relationships between power and radius of curvature are shown that allow specifying the preferred metric based on final accuracy and measurement method. Results shown include all necessary equations for conversion to give optical designers and manufacturers a consistent and robust basis for decision-making. The paper also gives guidance on preferred methods for different scenarios for surface types, accuracy required, and metrology methods employed.
Maximilien Brice
2012-01-01
Vice-president of the Senate of the Parliament of the Czech Republic, Alena Gajduskova was welcomed to CERN by Rolf Heuer, CERN’s director-general, on 14 and 15 February. Her time at CERN included the ATLAS Visitor Centre and underground experimental area, the LHC tunnel, the LHC superconducting-magnet test hall and the ALICE underground experimental area. She also heard a presentation on the LHC Computing Grid Project at CERN’s Computer Centre.
Descriptive epidemiology of injuries in a Brazilian premier league soccer team
Directory of Open Access Journals (Sweden)
Fachina RJ
2013-06-01
Full Text Available Rafael Júlio de Freitas Guina Fachina,1,2 Marília dos Santos Andrade,3 Fernando Roberto Silva,4 Silas Waszczuk-Junior,4 Paulo César Montagner,1 João Paulo Borin,1 Claudio Andre Barbosa de Lira5 1Departamento de Ciência do Esporte, Faculdade de Educação Física, Universidade Estadual de Campinas (UNICAMP, Campinas, Brazil; 2Confederação Brasileira de Basketball (CBB, Rio de Janeiro, Brazil; 3Departamento de Fisiologia, Universidade Federal de São Paulo, São Paulo, Brazil; 4Grêmio Barueri Futebol LTDA, Barueri, Brazil; 5Setor de Fisiologia Humana e do Exercício, Universidade Federal de Goiás, Câmpus Jataí, Jataí, Brazil Abstract: Soccer, which has a large number of participants, has a high injury incidence that causes both financial and time burdens. Therefore, knowledge about the epidemiology of soccer injuries could allow sports-medicine professionals, such as physicians and physiotherapists, to direct their work in specific preventive programs. Thus, our aim was to conduct an epidemiological survey of injuries sustained by professional soccer players from the same team who participated in the Brazilian championship premier league in 2009. To this end, we evaluated retrospectively player medical records from the team, which included name, date of birth, position, date of injury, mechanism of injury, and type of injury. In the period of study, 95 injuries were recorded: 42 (44.2% were recorded during matches, and 53 (55.8% during the training period. Injuries occurred more frequently in midfielders and strikers. All injuries happened in the lower limb, most of the injuries were muscular, and most occurred as the result of collisions with other athletes. In summary, this study demonstrates that there is a need for greater safety awareness in the training environment. Keywords: injuries, epidemiology, soccer players
Mobil positioning itself to become Canada's premier oil and gas company
International Nuclear Information System (INIS)
Thomas, A.
1994-01-01
To achieve its goal of becoming Canada's premier oil and gas company by the year 2000, Mobil Oil Canada is empowering its employees and applying appropriate technology to unlock resources and create value. Mobil produces 4.1 million m 3 of oil and natural gas liquids, 5.6 million m 3 /y of natural gas and 438,000 tonnes/y of sulfur. It also operates over 3,000 wells in western Canada and eleven gas processing plants, manages 1,700 km of pipeline, and has 33% interest in the Hibernia project on the Grand Banks. Oil lifting costs have decreased over the past three years from $3.40/bbl to $2.80/bbl and development costs are under $2/bbl. Innovative technology used to achieve high production and low costs include the use of three dimensional seismic surveys and horizontal drilling. Other techniques used at particular sites include installation of downhole injection regulators to control problems of segregation and metering between different water injection zones at the Carson Creek field, use of artificial lifts in gas wells, and a dual gas lift at the Rainbow Lake oil field. At the Lone Pine gas plant, the first Superclaus-99 sulfur recovery process was installed, reducing sulfur emissions by 60% and increasing recovery efficiency from 95% to 98%. Mobil has operated in Canada since 1940 and has made significant discoveries, including Canada's largest producing oil field, the Pembina. In 1971, Mobil discovered gas of commercial significance off the east coast and helped discover the Hibernia and Venture fields. The Hibernia project is scheduled to come on stream in 1997 and Mobil expects the economics of the project to be favorable, with a $12-13/bbl oil price needed to break even. 7 figs
Gauthier, Lionel
2012-01-01
Dans la seconde moitié du XIXe siècle, avec le développement du bateau à vapeur et du chemin de fer, et l’ouverture de nouveaux axes de transport comme le Canal de Suez, le voyage autour du monde devient envisageable pour les touristes. Ainsi, dès 1872 des tours du monde à forfait sont organisés, ce qui témoigne de l’entrée du voyage autour du monde dans l’industrie touristique naissante. Cet article étudie ces premiers voyages d’un nouveau genre à travers l’exemple de la Société des Voyages ...
Lehouck, Alexander
2017-01-01
L'argile est l'une des plus vieilles matières premières pour la fabrication de matériaux de construction. La chute de l'Empire romain a marqué la fin de l'utilisation de la brique au nord des Alpes. La brique ne ressurgit véritablement qu' à partir de la deuxième moitié du XIIe s. et de la première moitié du XIIe s.; dans la deuxième moitié du XIIIe s., la brique était devenue le matériau de construction le plus utilisé. Dans cet article, nous discutons les données concernant les premiers ...
Technical Performance Analysis of Iran Premier League Soccer Players in 2012-2013 Season
Directory of Open Access Journals (Sweden)
Javani Mohsen
2015-10-01
Full Text Available Background and purpose of study : analysis of IRAN premier league soccer players’ technical performance in season 2012-2013, using a computerized match analysis system (Borhan Mobin Development Management Co, IRAN. Material and methods: in this study, data were obtained from 120 players, who performed in competitions 90 minutes. The players were classified into 3 positional roles: defenders, midfielders and forwards. Technical performance variables analysis included: total passes, total successful passes, pass accuracy, total shots; total shots to target, shot accuracy, ball interception and ball losses. The data were statistically analyzed by one-way ANOVA, Kruskal-Wallis, Mann-Whitney U and Tukey post hoc test. Results : The findings of this study showed that players performed about 45 passes per competition. Midfielders and defenders had significantly higher number of passes than forwards. Pass accuracy was about 67% and there were no significant differences between positional roles. Also, the players performed about 0.8 shots per competition, forwards and midfielders had significantly higher number of shots than defenders. Shot accuracy was about 31%; midfielders and forwards had significantly higher shot accuracy than defenders. Forwards showed significantly lower ball interception and higher ball losses than other positions. Conclusion : The result of this study showed that there were significant differences between some technical actions in positional roles. Therefore, coaches can use this information for individualization of training according to playing positions and for optimization of training in the amateur game.
Directory of Open Access Journals (Sweden)
Vitor Principe
Full Text Available ABSTRACT This article aims to analyze the technical performance of football teams in the FA Premier League during the 2015/2016 season. Data of twenty clubs over 38 matches for each club are considered using 23 variables. These variables have been explored in the football literature and address different features of technical performance. The different configuration of the data for teams in detached segments motivated the multi-criteria approach, which enables identification of strong and weak sectors in each segment. The uncertainty as to the outcome of football matches and the imprecision of the measures indicated the use of Composition of Probabilistic Preferences (CPP to model the problem. “R” software was used in the modeling and computation. The CPP global scores obtained were more consistent with the final classification than those of other methods. CPP scores revealed different performances of particular groups of variables indicating aspects to be improved and explored.
Estimation de la survie des alevins de carpe (C. carpio au cours de leur premier mois d'existence
Directory of Open Access Journals (Sweden)
MOREAU J.
1979-10-01
Full Text Available Des observations réalisées sur deux stations piscicoles de Madagascar, dans des étangs ne recevant ni engrais ni nourriture, révèlent qu'au cours de leur premier mois les alevins de carpe (C. carpio subissent des mortalités voi-sines de 50 %. Ces dernières sont encore plus élevées en début et en fin de saison de reproduction. Au début, les fortes mortalités sont dues à la température trop basse et aux disponibilités alimentaires insuffisantes ; en fin de saison de reproduction, la température trop élevée et la mauvaise qualité des œufs sont sans doute en cause. Une fumure adéquate des étangs de grossissement des alevins et une alimentation correcte des géniteurs permettront peut-être de diminuer ces mortalités.
The White House Office of the Vice President has announced the signing of three Memoranda of Understanding (MOUs) that will make available an unprecedented international dataset to advance cancer research and care.
Putra Wijaya, I Dewa Made
2014-01-01
This research aims to study the consistency of the Act No 42 of 2008 concerning the generalelection on president and vice president related to the principles of democracy as stipulated inthe constitution of Indonesian republic of 1945. This research uses statutory and conceptualapproaches. The object of the research is the policy of the general election on president and vicepresident. While the subject of it are the parliament and government as legislator. The legalmaterial of the research co...
Tuggle, B.N.; Crites, John L.
1984-01-01
Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.
Directory of Open Access Journals (Sweden)
Frederick W. Stander
2016-04-01
Full Text Available Orientation: Local football contributes significantly to the social- and economic welfare of South Africa through its spectators. Understanding the motives and experiences of football spectators could provide opportunities for capitalising on football as revenue stream feeding the South African economy. Research purpose: To investigate how motives for sport consumption predict intrinsic psychological reward of South African premier league football spectators. Motivation for the study: Sport - particularly football - is an untapped resource for stimulating economic development and growth through its consumers. Spectators, who often experience their investment in the sport as deeply rewarding and meaningful, should participate more frequently in purchasing products or services associated with the sport. Through understanding the motives for sport consumption of South African premier league football spectators and the impact of these motives on intrinsic psychological reward experiences, football clubs are able to provide a targeted experience or service to spectators in order to further stimulate economic growth. Research design, approach and method: A census sample of 806 football spectators attending various matches at a football stadium in Soweto was drawn. A cross-sectional research design was implemented. This research was exploratory and descriptive. Structural equation modelling was implemented to assess the factor structures of the constructs, to confirm composite reliability of the measures and to assess the structural paths between the variables. Main findings: A predictive model for intrinsic psychological rewards (life satisfaction and meaning through the motivation for sport consumption (individual – and game related factors was confirmed. It was further established that motivation for sport consumption is significantly positively a related to and b associated with the experience of intrinsic psychological reward by South African
Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li
2015-04-16
Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of
Directory of Open Access Journals (Sweden)
Herveline Delhumeau
2009-05-01
Full Text Available Ymac a été classé par arrêté du 14 février 2008 au titre des monuments historiques en raison de l’intérêt ethnologique lié à sa fonction de bateau-pilote. (fig. n° 1Figure 1Ymac, ex-Radar III. Photographie après 2003. © Yannick Lafourcade.Construit en 1965 à Mavilette (Nouvelle-Ecosse, Canada par le chantier Alfred Boudreau, ce bateau traditionnel de pêche à coque en bois avait été initialement armé pour la pêche aux poissons plats par Alex Doucet, d’où son premier nom Alex D. Après avoir p...
Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'
Directory of Open Access Journals (Sweden)
Kay Schaffer
2006-09-01
Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.
The academic role of the vice president for health sciences: can a walrus become a unicorn?
Pellegrino, E D
1975-03-01
The post of vice president for the health sciences was first developed in an attempt to interpret, modulate, and buffer the growing power of the medical school in the university and the different values that have existed there. The job has been greatly transformed over the past 10 years as a consequence of a variety of factors. Now a genuine creative effort applied to the design of the administration of health sciences centers and how they fit into universities is needed. The present modes of organization are not equal to the challenges that must be faced. New designs must be created which will recognize the special place of the health sciences in today's world and yet keep its function within the university frame.
The first metallurgical tests on plutonium; Premiers essais metallurgiques sur le plutonium
Energy Technology Data Exchange (ETDEWEB)
Grison, E; Abramson, R; Anselin, F; Monti, H [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1958-07-01
Metallic plutonium was first prepared in France in January 1956, as soon as we had access to quantities of the order of several grams of plutonium, which had been extracted from the rods of the pile EL2 at Saclay. Since up to the present this reactor, of thermal power 2 000 kW, has been our only source of plutonium, we have so far only worked on experimental quantities sufficient for the basic tests but not for tests on a scale of possible applications. It is this work, carried out during this phase of preliminary research, which is described below. With the starting up of the plutonium extraction plant at Marcoule, where the reactor G1 has been operating at power for more than a year, we shall go on next to a another order of magnitude which will allow the manufacture and experimentation of prototype fuel elements. (author) [French] La premiere elaboration de plutonium metallique en France fut faite en janvier 1956, des que nous pumes disposer de quantites de plutonium de l'ordre de quelques grammes, qui avaient ete retires des barreaux de la pile EL2 de Saclay. Ce reacteur, d'une puissance thermique de 2 000 kW, ayant ete jusqu'a present notre seule source de plutonium, nous n'avons encore travaille que sur des quantites experimentales suffisantes pour les essais de base, mais non pour des essais a l'echelle d'applications possibles. Ce sont les travaux effectues pendant cette phase de recherches preliminaires qui seront evoques ci-dessous. Avec la mise eu route de l'usine d'extraction de plutonium de Marcoule, ou le reacteur G1 fonctionne en puissance depuis plus d'un an, nous allons passer prochainement a un autre ordre de grandeur, qui nous permettra la fabrication et l'experimentation d'elements combustibles prototypes. (auteur)
Alma N. Bamero
2006-01-01
This research entitled “Opium: The Evolution of Policies, the Tolerance of the Vice, and the Proliferation of Contraband Trade in the Philippines, 1843-1908” presents a discussion of the opium trade in Asia, the commercial networks it created, the political ties it strengthened, and the social relations itfostered. It also aims to reconstruct an aspect of Philippine social history in the nineteenth century through the use of archival materials that bear witness to the distribution and exploit...
International Nuclear Information System (INIS)
Deines, P.
1984-01-01
The carbon isotopic composition of 66 inclusion-containing diamonds from the Premier kimberlite, South Africa, 93 inclusion-containing diamonds and four diamonds of two diamond-bearing peridotite xenoliths from the Finsch kimberlite, South Africa was measured. The data suggest a relationship between the carbon isotopic composition of the diamonds and the chemical composition of the associated silicates. For both kimberlites similar trends are noted for diamonds containing peridotite-suite inclusions (P-type) and for diamonds containing eclogite-suite inclusions (E-type): Higher delta 13 C P-type diamonds tend to have inclusions lower in SiO 2 , Al 2 O 3 , Cr 2 O 3 , MgO, Mg/(Mg + Fe) and higher in FeO and CaO. Higher delta 13 C E-type diamonds tend to have inclusions lower in SiO 2 , Al 2 O 3 , MgO, Mg/(Mg + Fe), Na 2 O, K 2 O, TiO 2 and higher in CaO, Ca/(Ca + Mg). Consideration of a number of different models that have been proposed for the genesis of kimberlites, their zenoliths and diamonds shows that they are all consistent with the conclusion that in the mantle, regions exist that are characterized by different mean carbon isotopic compositions. (author)
Do Exchange Rates Really Help Forecasting Commodity Prices?
DEFF Research Database (Denmark)
Bork, Lasse; Kaltwasser, Pablo Rovira; Sercu, Piet
Chen et al. (2010) report that for ‘commodity currencies’, the exchange rate predicts the country’s commodity index but not vice versa. The commodity currency hypothesis is consistent with the Engle and West (2005) exchange rate model if the fundamental is chosen to be the country’s key export...... expectations, one should mostly observe contemporaneous correlations, not one-directional cross-predictability from one variable toward the other. Using three different data sets and various econometric techniques, we do find the contemporaneous correlations as predicted by the financial asset view......-averaged prices in the commodity index data that they use (price averaging induces spurious autocorrelation and predictability) and to features in their test procedures....
Message from Vice Chancellor, UMP
Nasir Ibrahim, Daing
2012-09-01
their hard work and relentless effort. Without their commitment and contributions, this event would not have been possible at this time. And with that, thank you again and wassalam. YH Profesor Dato' Dr Daing Nasir Ibrahim Vice Chancellor Universiti Malaysia Pahang
Jupri, Al
2017-04-01
In this article we address how Realistic Mathematics Education (RME) principles, including the intertwinement and the reality principles, are used to analyze geometry tasks. To do so, we carried out three phases of a small-scale study. First we analyzed four geometry problems - considered as tasks inviting the use of problem solving and reasoning skills - theoretically in the light of the RME principles. Second, we tested two problems to 31 undergraduate students of mathematics education program and other two problems to 16 master students of primary mathematics education program. Finally, we analyzed student written work and compared these empirical to the theoretical results. We found that there are discrepancies between what we expected theoretically and what occurred empirically in terms of mathematization and of intertwinement of mathematical concepts from geometry to algebra and vice versa. We conclude that the RME principles provide a fruitful framework for analyzing geometry tasks that, for instance, are intended for assessing student problem solving and reasoning skills.
General Accounting Office, Washington, DC. General Government Div.
In this report, the General Accounting Office (GAO) responds to a July 8, 1988, inquiry by the Chairman and Vice Chairman of the Joint Committee on Printing about the Government Printing Office's (GPO) efforts to acquire and supply microfiche copies of government documents to approximately 1,400 depository libraries. In August 1987, GPO had…
Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar
2015-09-29
The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.
Directory of Open Access Journals (Sweden)
Shah J Miah
2016-11-01
Full Text Available This paper presents a contemporary literature review of design science research (DSR studies in the domain of decision support systems (DSS development. The latest studies in the DSS design domain claim that DSR methodologies are the most popular design approach, but many details are still yet to be revealed for supporting this claim. In particular, it is important to thoroughly investigate the trends in either the form or deeper insights in use of DSR in this field. The aim of this study is to analyse the existing DSS design science studies to reveal insights into the use of DSR, so that we can outline research agenda for a special issue, based on findings of analysis. We selected articles (from 2005 to 2014 that were published in seven selected premier IS journals (ranked as A* in the ABDC journal ranking. The selected 57 sample articles are representative of DSS design studies that used DSR in theorising, designing, implementing, and evaluating DSS solutions. We discuss the theoretical positions of DSR for DSS development through six categories: DSS artefacts, DSR methods, DSR views, user involvement, DSS design innovations and problem domains. The findings indicate that new studies are needed to fill the knowledge gap in DSS design science, for more solid theoretical basis in near future.
Bennett, Sophia Elizabeth
2016-01-01
Monsieur Jean-Claude Marcourt Vice-Président du Gouvernement wallon, Ministre de l'Economie, de l'Industrie, de l'Innovation et du Numérique Vice-Président du Gouvernement de la Fédération Wallonie-Bruxelles, Ministre de l'Enseignement supérieur, de la Recherche et des Médias
Henderson, Claire; O'Hara, Stefanie; Thornicroft, Graham; Webber, Martin
2014-08-01
Football is increasingly used to facilitate recovery in mental health services, often in partnership with football clubs. However, few clubs have made mental health part of their corporate social responsibility programmes until recently. We report the impact on participants of the 'Imagine Your Goals' programme, run by 16 Premier League football clubs in conjunction with England's Time to Change programme to reduce mental health-related stigma and discrimination. Mixed methods evaluation used pre/post measures of well-being, access to social capital, focus groups held early on and towards the end of the two-year programmes, and questionnaires for coaching staff. There were no significant changes to participants' mental well-being scores between baseline and follow-up, nor to the total number of social resources accessible through their networks. However, there was a statistically significant increase at follow-up in the mean score of the personal skills subscale of the Resource Generator-UK. Participants' individual skills were also higher at follow-up. Qualitative data showed programmes had largely met participants' expectations in terms of socializing, providing structure and improving fitness levels, exceeded expectations in relationships with coaching staff and additional activities, but did not always meet them in improving football skills. Participants varied in their knowledge of exit opportunities, depending on which club's programme they attended. A minority of clubs reported difficulties in recruitment and concerns about planning for the future of the projects. Football clubs and the charitable foundations they set up can successfully deliver programmes to people with mental health problems which improve access to personal skills social capital and have other potential benefits.
Maximilien Brice
2009-01-01
HI-0902038 05: IT Department Head, F. Hemmer; US Google Vice President and Chief Internet Evangelist V. Cerf; Computing Security Officer and Colloquium Convenor D. R. Myers; Member of the Internet Society Advisory Council F. Flückiger; Director for Research and Scientific Computing, S. Bertolucci ; Honorary Staff Member, B. Segal. HI-0902038 16: Computing Security Officer and Colloquium Convenor D. R. Myers; UC Irvine, ATLAS Deputy Spokesperson elect A. J. Lankford; US Google Vice President and Chief Internet Evangelist V. Cerf; ATLAS Collaboration Spokesperson P. Jenni; IT Department Head, F. Hemmer.
Kerchner, Charles T.
2008-01-01
Reporting on a talk the author gave some months ago, the headline in "La Opinion," Los Angeles' premier Spanish language newspaper, declared the city's school system "en crisis permanente." No one wrote in to disagree. Indeed, at the end of "Learning from L.A.: Institutional Change in American Public Education" (Harvard Education Press) the author…
Institute of Scientific and Technical Information of China (English)
无
2006-01-01
@@ Li Qingping was born in Wuning County, Jiangxi Province, in 1954. Now, he is Vice Chairman of the Board of International Pearl, Jadeite and Jewelry Investment Company, General Manager & CEO of Ming Qin Jewelry Group.
Le premier partenariat public-privé pour l’irrigation au Maroc : durable pour tous ?
Directory of Open Access Journals (Sweden)
Houdret Annabelle
2016-03-01
Full Text Available Les partenariats public-privé (PPP sont un phénomène relativement récent dans le secteur de l’irrigation ; le projet El Guerdane au Maroc est ainsi le premier de son genre. Inauguré en 2008, le projet alimente en eau 10 000 ha de plantations d’agrumes. Les banques internationales de développement le présentent comme un succès, mais l’impact sur le développement local est, au mieux, mitigé. Alors que certains agriculteurs ont bénéficié de cette initiative, d’autres ont été marginalisés, en termes d’accès à l’eau, aux terres fertiles et au développement. Fondé sur des recherches de terrain extensives conduites entre 2005 et 2013, l’article révèle trois problèmes cruciaux du projet PPP : des effets souvent négatifs sur les revenus des acteurs et sur le développement ; un partage inégal des coûts, des bénéfices et des risques entre les secteurs public et privé ; un impact environnemental incertain. Sur la base de ces résultats, l’étude situe le projet dans le contexte plus large de l’évolution des rapports de force politico-économiques au Maroc.
Directory of Open Access Journals (Sweden)
Rebaz Sleman
2014-10-01
Full Text Available Purpose: to define the characteristics of the model command of technical and tactical training team participating in the Ukrainian Premier League First League. Material and Methods: the research was conducted using the method of peer review. The experts were involved 5 specialists football. Results: the mean values for the analyzed variables in 10 games. The various technical and tactical actions and their percentage in the overall structure of the game team statistics for 20 games, as well as some indicators of team play "Helios" Kharkov. Conclusions: the obtained quantitative and qualitative indicators (coefficient of marriage as a team on the technical and tactical actions, as well as separately for each technical and tactical reception. The performances allow you to make adjustments to the training process this command to improve sportsmanship.
Maximilien Brice
2003-01-01
Conference RSIS (The role of science in the information society) - Contributions to Economic Development - Building 40 S2 - B01 - Mr. Mohammad Nahavandian, Vice-President for Research, Institute for Humanities and Cultural Studies, Tehran.
Maximilien Brice
2010-01-01
1st October 2010 - Chinese Vice President of the Academy of Sciences signing the guest book and exchanging gifts with CERN Director for Research and Scientific Computing S. Bertolucci, witnessed by Adviser R. Voss
Maximilien Brice
2013-01-01
29 January 2013 - Japanese Toshiba Corporation Executive Officer and Corporate Senior Vice President O. Maekawa in the ATLAS visitor centre with representatives of the CERN-Japanese community led by Former Collaboration Spokesperson P. Jenni.
This week, Vice President Joe Biden announced progress on his global vision for the Cancer Moonshot. Announced were 10 new Memoranda of Understanding or Memoranda of Cooperation for international cancer research and care, as well as new efforts in the emerging scientific areas of precision oncology, the funding of collaborative research centers to address cancer disparities in low- and middle- income (LMIC) countries, and a strengthening of existing U.S. bilateral science and technology engagements around cancer.
Directory of Open Access Journals (Sweden)
Marie-Aline Barrachina
2009-01-01
Full Text Available La creación (20-05-1941, de la Vice Secretaría de la Educación Popular, pone un punto final a las ambiciones totalitarias de los falangistas, marca su definitiva derrota y la ineluctable instrumentalización de sus talentos propagandísticos. El proceso se realiza en tres etapas: desde el decreto de Unificación (19-04-1937, hasta el primer gobierno civil del régimen de Franco (31-01-1938; desde este mismo primer gobierno civil hasta la consolidación de la influencia de Serrano Súnyer (16-11-1940, acceso de Serrano a la cartera de relaciones internacionales; por fin, desde esta fecha, a la creación de la Vice Secretaría. El proceso consistió en externalizar las competencias intelectuales falangistas en un primer tiempo, de manera que no puedan actuar dentro de la administración del Movimiento sino directamente bajo el control del Estado (1937. Luego, en una segunda etapa, se instrumentalizaron estas competencias para organizar las estructuras administrativas de propaganda del nuevo Estado (1938-1940. Por fin, cuando ya estaba confirmada su total sumisión (1941, se devolvió a la administración del Movimiento su vocación inicial de propaganda, creando la Vice Secretaría. A finales de 1943, la Vice Secretaría ya es una enorme máquina administrativa generadora de empleos y sometida al Estado. Su traspaso en 1945 al Ministerio de la Educación — entonces entre las manos de los conservadores católicos— confirma que la era de los funcionarios del franquismo ya se ha sustituido a la de los militantes falangistas.
New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae
Directory of Open Access Journals (Sweden)
Hua-yan Chen
2017-01-01
Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n
Granato, Paul A; Chen, Li; Holiday, Iris; Rawling, Russell A; Novak-Weekley, Susan M; Quinlan, Tammy; Musser, Kimberlee A
2010-11-01
Campylobacter enteritis is a food-borne or waterborne illness caused almost exclusively by Campylobacter jejuni and, to a lesser extent, by Campylobacter coli. These organisms produce indistinguishable clinical diseases and together represent the second most common cause of bacterial diarrhea in the United States and the leading cause of enteric infection throughout the world. The conventional approach to the laboratory diagnosis of Campylobacter enteritis is based on the recovery of the organism from a stool specimen, which requires the use of a specialized medium incubated at 42°C for several days in an artificially created microaerophilic environment. Recently, several commercially available enzyme immunoassays (EIAs) have been developed for the direct detection of C. jejuni and C. coli in stool specimens. This study compared conventional culture with three EIA methods, the Premier CAMPY EIA (Meridian Bioscience, Cincinnati, OH), the ProSpecT Campylobacter EIA (Remel, Lenexa, KS), and the ImmunoCard STAT! CAMPY test (Meridian Bioscience, Cincinnati, OH), for the detection of C. jejuni and C. coli in 485 patient stool samples. Discordant results were arbitrated by using an in-house, real-time PCR assay that was developed and validated by a public health reference laboratory. Following analyses of the discrepant specimens by PCR, the sensitivity and specificity of both the Premier CAMPY and ProSpecT Campylobacter EIAs were 99.3% and 98%, respectively, while the ImmunoCard STAT! CAMPY test had a sensitivity of 98.5% and a specificity of 98.2%. By use of the PCR test as the reference standard, culture detected 127 of 135 Campylobacter-positive stool specimens, yielding a sensitivity of 94.1%. These results showed that the three EIAs evaluated in this study provide a rapid and reliable alternative for the laboratory diagnosis of enteric infections with C. jejuni and C. coli and that conventional culture may no longer be recognized as the "gold standard" for
Maximilien Brice
2010-01-01
(CERN-HI-1009225 02-12): visiting the LHC superconducting magnet test hall with Beams Department Head P. Collier; (CERN-HI-1009225 27-34): visiting the ATLAS visitor centre with Collaboration Spokesperson F. Gianotti and Deputy D. Charlton, University of Birmingham. D.Eastwood is accompnied by Pro-Vice-Chancellor and Head of College (Engineering and Physical Sciences) N. Weatherill and Head of School, School of Physics & Astronomy A.Schofield.
Anissa Afrite; Julien Mousques
2014-01-01
Dans le cadre d’un programme de recherche global sur le lien entre le regroupement pluriprofessionnel en soins de premiers recours dans les sites participant aux Expérimentations des nouveaux modes de rémunération (ENMR) et la performance des médecins généralistes en matière d’activité, de productivité, d’efficacité et d’efficience de leurs pratiques, cette recherche a pour objectif d’analyser la structure, l’organisation et le fonctionnement des maisons, pôles et centres de santé participant...
Kelly, J
2003-01-01
"Sir Alan Wilson, vice-chancellor of Leeds University, has made a career out of solving big problems. This week he landed himself one of the biggest. Appointed the government's first ever director general of higher education, he becomes responsible for advising Charles Clarke at a pivotal moment in the history of the sector" (1 page).
Girassol. A world premiere; Girassol. Une premiere mondiale
Energy Technology Data Exchange (ETDEWEB)
Magnan, J.Ph.; Serceau, A. [TotalFinaElf, La Defense, 92 - Courbevoie (France)
2002-06-01
Located at 150 km of the Angola coast, Girassol is the very first oil field integrally developed in deep sea conditions (1400 m). Girassol ensures today 8% of the production operated by TotalFinaElf company. This first step announces two other developments of comparable size on the same bloc (17): Dalia and Rosa-Lirio. This project, carried out with the participation of Angola companies, required 2.8 billions of US$ of investment. It significantly contributes to the development of a particularly rich oil province. This article describes the production equipment of the field: FPSO (floating production storage off-loading), mooring, tower risers, injection and production wells, bundles, flow-lines etc.. and the underwater operations required for the connecting of the bottom and surface equipments. (J.S.)
The Human Proteome Organization (HUPO) has released a video of the keynote speech given by the 47th Vice President of the United States of America Joseph R. Biden Jr. at the HUPO2017 Global Leadership Gala. Under the gala theme “International Cooperation in the Fight Against Cancer,” Biden recognized cancer as a collection of related diseases, the importance of data sharing and harmonization, and the need for collaboration across scientific disciplines as inflection points in cancer research.
Granato, Paul A.; Chen, Li; Holiday, Iris; Rawling, Russell A.; Novak-Weekley, Susan M.; Quinlan, Tammy; Musser, Kimberlee A.
2010-01-01
Campylobacter enteritis is a food-borne or waterborne illness caused almost exclusively by Campylobacter jejuni and, to a lesser extent, by Campylobacter coli. These organisms produce indistinguishable clinical diseases and together represent the second most common cause of bacterial diarrhea in the United States and the leading cause of enteric infection throughout the world. The conventional approach to the laboratory diagnosis of Campylobacter enteritis is based on the recovery of the organism from a stool specimen, which requires the use of a specialized medium incubated at 42°C for several days in an artificially created microaerophilic environment. Recently, several commercially available enzyme immunoassays (EIAs) have been developed for the direct detection of C. jejuni and C. coli in stool specimens. This study compared conventional culture with three EIA methods, the Premier CAMPY EIA (Meridian Bioscience, Cincinnati, OH), the ProSpecT Campylobacter EIA (Remel, Lenexa, KS), and the ImmunoCard STAT! CAMPY test (Meridian Bioscience, Cincinnati, OH), for the detection of C. jejuni and C. coli in 485 patient stool samples. Discordant results were arbitrated by using an in-house, real-time PCR assay that was developed and validated by a public health reference laboratory. Following analyses of the discrepant specimens by PCR, the sensitivity and specificity of both the Premier CAMPY and ProSpecT Campylobacter EIAs were 99.3% and 98%, respectively, while the ImmunoCard STAT! CAMPY test had a sensitivity of 98.5% and a specificity of 98.2%. By use of the PCR test as the reference standard, culture detected 127 of 135 Campylobacter-positive stool specimens, yielding a sensitivity of 94.1%. These results showed that the three EIAs evaluated in this study provide a rapid and reliable alternative for the laboratory diagnosis of enteric infections with C. jejuni and C. coli and that conventional culture may no longer be recognized as the “gold standard” for
Renshaw, Andrew
2016-01-01
Background There is an established risk of injury to young athletes exposed to high training loads. Identifying and monitoring injury risk is essential to aid prevention. The aim of this study was to use the consensus statement to determine the incidence and pattern of injury in 1 English Premier League soccer academy during 1 season. Methods A prospective cohort study included 181 elite academy soccer players during the 2012–2013 season. Players were divided into 5 age groups between 9 and 18 years. The number, type and incidence of injuries were recorded during matches and training. Incidence was calculated per 1000 hours of exposure. Results 127 injuries occurred during 29 346 hours of soccer exposure. 72% of injuries were non-contact related. Under (U)18 players sustained the highest number of match injuries. U12–14 players sustained the highest number of training injuries and injuries overall. U16 players sustained the highest number of severe injuries, and U18 players sustained the highest number of moderate injuries. U18 players sustained the highest number of injuries/1000 hours of training and overall. U15 players sustained the highest number of injuries/1000 hours of matches, the highest number of recurrent injuries and the highest incidence of recurrence. The most common injuries were muscle injuries in U15 and U18 players. The most common injury location was the anterior thigh, with the majority of these occurring in training. Conclusions Using the consensus statement, this study used a repeatable method to identify the injury profile of elite academy-level soccer players. PMID:27900186
Weston, Matthew; Castagna, Carlo; Impellizzeri, Franco M; Rampinini, Ermanno; Abt, Grant
2007-12-01
The aim of the present study was to examine the influence of first half activity, overall match intensity and seasonal variation on the physical match performances of English Premier League football referees. Match analysis data was collected using the Prozone match analysis system from 19 full-time professional referees during a total of 254 matches in the 2004-2005 season. Physical match performances were classified into three separate categories: 1, total distance covered (TD); 2, high-intensity running distance (running speed>5.5m/s, HIR); 3, average distance from infringements (DI). Using these match activity variables the influence of first half TD and HIR distances on second half activities and also the influence of players' match activities upon the referees' physical match performances were examined. The main finding of the present study was that the physical match performances of the referees were partly related to those of the players, in that the referees' HIR correlated with players' HIR (r=0.43, pphysical match performance of the referee. Further examination is required as to whether reduced physical performances in the second half of matches are a consequence of referee fatigue, tactical strategies on behalf of the referee or reduced player match activities resulting in a slower tempo of match.
McAleer, Stephen S; Gille, Justus; Bark, Stefan; Riepenhof, Helge
2015-08-01
The aim of this paper was to use a clinical example to describe a treatment strategy for the management of recurrent chronic groin pain and evaluate the evidence of the interventions. A professional footballer presented with chronic recurrent OP/PBS. The injury was managed successfully with a nine-point programme - 1. Acute pharmacological management. 2. Tone reduction of over-active structures. 3. Improved ROM at hips, pelvis and thorax. 4. Adductor strength. 5. Functional movement assessment. 6. Core stability. 7. Lumbo-pelvic control. 8. Gym-based strengthening. 9. Field-based conditioning/rehabilitation. The evidence for these interventions is reviewed. The player returned to full training and match play within 41 and 50 days, respectively, and experienced no recurrence of his symptoms in follow up at 13 months. This case report displays a nine-point conservative management strategy for OP/PBS, with non-time dependent clinical objective markers as the progression criteria in a Premier League football player. Copyright © 2015 Elsevier Ltd. All rights reserved.
Bennett, Sophia Elizabeth
2017-01-01
Mr Huidong LI Deputy Chairman and Secretary-General, Rev. Committee of Chinese Nationalist Party Vice President, Sun Yat-Sen Culture Interchange Association of China Member, Committee for Internal and Judicial Affairs of the National People's Congress of China
Directory of Open Access Journals (Sweden)
劉國兆 Kuo-Chao Liu
2014-12-01
Full Text Available 近年來受到國際大學評比及世界各國追求大學卓越政策的國際競爭趨勢影響,臺灣自2011年起推動「邁向頂尖大學計畫」。為了深入探討此政策背後潛藏的意識形態及價值預設,本研究採取後結構主義的理論觀點,並以論述分析的研究方法,以解構本政策中理所當然的本質性思維,並發掘政策論述中「權力/知識」的形構歷程,從而以位置性的概念,重新探索「邁向頂尖大學計畫」中的政策主體,並從不同位置去思考「邁向頂尖大學計畫」對於政策主體所具有的意義,進而反思主體突破結構限制的可能。 After being influenced in recent years by international university appraisals and the competitive trend toward the pursuit of excellence in countries all over the world, Taiwan has promoted a policy entitled the “Stepping towards Premier University Plan” since 2011. In order to thoroughly explore the underlying ideology behind this policy and its default values, this study takes a post-structuralism theoretical perspective, and uses discourse analysis to deconstruct the rationale of the policy. We uncover the process of construction of the “power / knowledge” discourse described in the policy, and thus from the positional concept, re-explore the policy body of the “Stepping towards Premier University Plan”. We consider the significance the “Stepping towards Premier University Plan” holds toward the policy body from different positions, and then reflect on the possibility of the policy body breaking through structural constraints.
2017-10-01
Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Energy Technology Data Exchange (ETDEWEB)
Coutrot, V; Delpuech, J; Fitoussi, L [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires
1960-07-01
This report gives the results of radiation measurements carried out on the first C.E.A. swimming-pool pile, Melusine. The purpose of these measurements, which were carried out during the starting-up period and the first ascents to 1 MW power, is to check the radiation intensity levels near the pile and from this to verify the safety calculation methods used. In addition certain special measurements, such as those performed in and above the water of the swimming-pool, in the channels and outside them etc..., should make it possible eventually to define the conditions under which the pile may be used for special jobs with less protection. In the first part of the report are given the results of radiation measurements carried out during runs at low power plateaux not exceeding 500 W: in particular measurements at variable water levels in the water of the swimming-pool and on the axis of the open channels. The results given in the second part deal with radiation measurements performed in various parts of the premises, studies on the activation of the plugs in the experimental channels and of the materials in the forward compartment, and also of the radioactivity of the swimming-pool water and the air used to cool the channels. (author) [French] Le present rapport a pour but de donner les resultats des mesures de rayonnement effectuees aupres de la premiere pile piscine du C.E.A.: la pile Melusine. Le but de ces mesures, effectuees pendant la periode de demarrage et les premieres montees a la puissance de 1 MW, est de controler les niveaux d'intensite de rayonnement aupres de la pile et par la de juger des methodes de calculs de protection utilisees. D'autre part, certaines mesures plus particulieres, telles que celles effectuees dans l'eau et au-dessus de l'eau de la piscine, dans les canaux et a l'exterieur de ceux-ci, etc..., doivent permettre de definir ulterieurement les conditions d'utilisation de la pile pour des fonctionnements particuliers avec des protections
Laurent Guiraud
2000-01-01
Visit of Mr. Susumu Yoda, Japanese Atomic Energy Commission, Mr. Nobuo Natsume, Vice-President, Central Research Institute of Electric Power Industry, Japan (CRIEPI), Mr. Nobuya Yoshiki, CRIEPI, Mrs. Seiko Ichikawa, Interpreter, with Mr. Taylor of CERN, visiting SM18
Patrice Loiez
1999-01-01
UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper
Maximilien Brice
2013-01-01
28 October 2013- Former US Vice President A. Gore signing the guest book with Technology Department Head F. Bordry, Head of International Relations R. Voss, Director for Research and Scientific Computing S. Bertolucci and CMS Collaboration Spokesperson J. Incandela.
Brunner, J; Hirsch, T; Steger, F
2016-05-01
Madness served primarily as a form of amusement for the spectators in operas of the seventeenth century. This representation was far removed from clinical reality. This circumstance changed in the eighteenth century at the time when tragic madness emerged in numerous operas. The opera buffa Arcifanfano-Re dei matti (Arcifanfano-King of fools, premiered in 1749 in Venice, text by Carlo Goldoni 1707-1793 and music by Baldassare Galuppi 1706-1785), which continuously enacts a realm of fools and is meant to appear amusing, is riddled with psychopathological abnormalities for which a retrospective diagnosis is methodologically rejected. However, the opera presents many subjects for working out a typology of fools based on outlasting personality traits of the protagonists. The libretto is investigated. A musical analysis is spared. The conceptualized typology of fools in the opera, which is oriented towards the seven main vices or deadly sins serves, in the tradition of moral satire, to critically hold up a mirror to the audience to reflect their own vices by an amusing characterization of the latter. Historically classified, the treatment of fools by means of isolation, custody, locking up in cages as well as authoritarian measures of submission reflects the custom in those days before humanizing the treatment of people with mental illness in the course of the Enlightenment and the French Revolution. The opera Arcifanfano is essentially characterized by continuous madness. A typology of the fools can be worked out from the precise depiction of the personalities. A mirror is held up to the spectators in terms of vices, in the tradition of the contemporary baroque opera. At the same time, the opera can be classified psychiatrically and historically as a seismograph of its time when in the seventeenth and eighteenth centuries people with mental illness were isolated and incarcerated.
Rapoport, Basil
2013-01-01
Background Thyrotropin receptor (TSHR) antibodies that stimulate the thyroid (TSAb) cause Graves' hyperthyroidism and TSHR antibodies which block thyrotropin action (TBAb) are occasionally responsible for hypothyroidism. Unusual patients switch from TSAb to TBAb (or vice versa) with concomitant thyroid function changes. We have examined case reports to obtain insight into the basis for “switching.” Summary TBAb to TSAb switching occurs in patients treated with levothyroxine (LT4); the reverse switch (TBAb to TSAb) occurs after anti-thyroid drug therapy; TSAb/TBAb alterations may occur during pregnancy and are well recognized in transient neonatal thyroid dysfunction. Factors that may impact the shift include: (i) LT4 treatment, usually associated with decreased thyroid autoantibodies, in unusual patients induces or enhances thyroid autoantibody levels; (ii) antithyroid drug treatment decreases thyroid autoantibody levels; (iii) hyperthyroidism can polarize antigen-presenting cells, leading to impaired development of regulatory T cells, thereby compromising control of autoimmunity; (iv) immune-suppression/hemodilution reduces thyroid autoantibodies during pregnancy and rebounds postpartum; (v) maternally transferred IgG transiently impacts thyroid function in neonates until metabolized; (vi) a Graves' disease model involving immunizing TSHR-knockout mice with mouse TSHR-adenovirus and transfer of TSHR antibody-secreting splenocytes to athymic mice demonstrates the TSAb to TBAb shift, paralleling the outcome of maternally transferred “term limited” TSHR antibodies in neonates. Finally, perhaps most important, as illustrated by dilution analyses of patients' sera in vitro, TSHR antibody concentrations and affinities play a critical role in switching TSAb and TBAb functional activities in vivo. Conclusions Switching between TBAb and TSAb (or vice versa) occurs in unusual patients after LT4 therapy for hypothyroidism or anti-thyroid drug treatment for Graves
Claudia Marcelloni
2008-01-01
21 January 2008 - Vice-President of the Human Rights Commission Z. Muhsin Al Hussein, Ambassador to United Nations A. Attar and their delegation from Saudi Arabia, visiting the ATLAS experimental cavern with Collaboration Spokesperson P. Jenni and Technical Coordinator M. Nessi.
Schmutz, J.A.; Laing, K.K.
2002-01-01
Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling
Directory of Open Access Journals (Sweden)
Ehsan Asadollahi
2017-10-01
Full Text Available The economic environment and business, advertising in sport is one of the ways that most companies to manage the brand, its products and expanding its market in the country. The aim of the present study investigates the effects of advertising on transfer of brand identity from the perspective of sports consumers in Premier League football. This study on the nature and purpose and in terms of descriptive and correlational in terms of search data, a survey was carried out that way. After face and content validity, reliability test using Cronbach's alpha for the questionnaire, the effect of advertising tools 0.89, questionnaire transfer brand identity was 0.86, respectively. In order to analyze the data, descriptive and inferential statistical methods for the calculation and processing information, and also Spss software packages and LISREL were used. The study findings also confirmed the emergence of structural equation and the findings of other researchers, showed a promotional tool to transfer of brand identity from the perspective of the Sports consumer was significant effect (Chi-Square/df=2/04, RMSEA=0/059, P-Value =0/0001. The effect of each variable prioritize research also showed use of tool television advertising has the greatest impact on consumers transfer of brand identity. According to the results, it can be said that managers, marketers and planners of advertising companies, organizations and clubs and sporting goods service provider using of the effectiveness of each advertising tool and provide an integrated program of tools and to inform, remind and convince consumers can transfer of brand identity or brand and achieve their advertising goals.
Powerful women leaders rise in Asia despite gender inequality.
Over the years, Asia has produced some of the worlds most formidable women leaders, including Indira Ghandi, Madame Mao, Benazir Bhutto, and Corazon Aquino. The list continues with South Asia's leaders, prime ministers, opposition leaders, and vice-presidents, however, such an impressive list does not reflect true equality nor enlightened gender politics. According to Sonny Lo, sociology professor at Hong Kong University, no Asian political system observes true gender equality. It is noted that these Asian leaders rose into prominence after the death or imprisonment of their fathers or husbands. Nevertheless, the elections of Anson Chan and life-long dissident Annette Lu, signal the emergence of a new model for women leaders in Asia. Still, Lo emphasizes that this new trend is merely a reflection of civil service equal opportunity rules. Lo adds that even Taiwan President Chen Sui-Bian's all-women cabinet does not reflect the nation's sentiment, but a wish to project an image.
International Nuclear Information System (INIS)
Zhang Dejiang
2009-01-01
Nuclear science and technology is one of the greatest scientific and technological achievements of mankind in the 20th century. Nuclear science and technology is widely applied in various sectors with over 50 years of development, such as energy, industry, agriculture, health, and environment protection, and is playing an important role in prospering economy, improving people's livelihood, and promoting sustainable development. With global economic development and rising energy consumption, supply of traditional energy source is becoming more stretched and climate change is becoming an increasingly severe challenge. It is a common task of the international community to develop and utilize clean and renewable energy sources and properly address growing contradiction among economic development, energy development and environment protection. Given its advantage as clean, safe and could be applied in large scale, more and more countries are placing importance on nuclear energy. Accelerating peaceful uses of nuclear energy is the common wishes and inevitable choice of many countries. China started the development of nuclear energy in the early 1950s, and with the efforts of over half a century, China has established a relatively complete nuclear industry system. The installed capacity of nuclear power reached 9100 MWe, and nuclear power generation accounts for 2% of the national total electricity generated. Nuclear energy is playing an incremental role for China's economic development. However, nuclear energy utilization is rather insufficient in China, its development level is behind countries which are advanced in nuclear energy use such as the United States and France, the rate of nuclear power generation in the total electricity generated still falls behind the world average level. China's energy supply mix is featured by coal dominant and low proportion of clean energy. To achieve sustainable energy and socio-economic development, China has formulated the energy development strategy of active promoting energy conservation and optimizing energy. structure. Accelerating nuclear power development and enhancing the ratio of clean energy such as nuclear power in the aggregate energy supply is the priority of China's energy development strategy. Currently, peaceful use of nuclear energy has entered a stage of rapid development. A batch of new nuclear power projects are starting construction in coastal areas, and preparation for other new projects is going on in orderly manner, demonstration projects of the introduction of third generation nuclear power technology are moving on smoothly. Scientific and research engineering programs such as China experimental fast reactor, high temperature gas-cooled reactor, and thermal nuclear fusion device are in positive progress. Nuclear fuel cycle industry continues its development and the ability of assured supply of nuclear fuel is being enhanced. China has always attached great importance to nuclear safety in its promotion of nuclear energy utilization, and established a fairly complete nuclear safety legal, regulatory and emergency management system which is in line with international best practices. China has issued series of instruments such as nuclear safety regulations, rules, guidelines, standards. Independent, strict, and efficient nuclear safety supervision and management and scientific management of nuclear facility operators have been put in place to ensure safe and secure operation of nuclear facilities. All these efforts have led to sound nuclear safety record and boosted public confidence in nuclear energy
Maximilien Brice
2010-01-01
2nd September 2010 - Japanese Senior Vice-Minister of the Environment I. Tajima signing the guest book with Director-General R. Heuer and visiting the ATLAS control room with physicists T. Kondo and H. Fukuda, Members of the ATLAS Collaboration and KEK.
2011-06-15
... Transportation Network Group, Inc., and Premier Wealth Management, Inc. (a/k/a Premiere Wealth Management, Inc... concerning the securities of Premier Wealth Management, Inc. (a/k/a Premiere Wealth Management, Inc.) because...
Directory of Open Access Journals (Sweden)
Ioannis Koubourlis
2009-01-01
Full Text Available Dans cet article, il est question d'un grand mystère de l'histoire du livre, celui de l'existence de trois versions différentes du premier volume du Voyage pittoresque de la Grèce (1782 de Choiseul-Gouffier, c'est-à-dire d'un ouvrage majeur pour la floraison des idées philhellènes dans l'Europe des XVIIIe-XIXe siècles. On sait, grâce à la correspondance de l'auteur, qu'il avait pris la décision de réviser son texte dès 1783, en raison de sa candidature pour le poste d'Ambassadeur de France à Constantinople. Par contre, on n'en sait pas davantage sur le lieu et le temps exacts où il a travaillé les deux nouvelles versions, portant également la date 1782, ni d'ailleurs sur les circonstances de leur édition. Sur la base d'une étude comparative des trois versions du texte, qui met l'accent sur l'argumentation avancée chaque fois par l'auteur, nous formulons ici une série d'hypothèses pour l'interprétation de ce mystère, que nous allons examiner dans leurs détails à partir d'une étude de bibliologie qui suivra le présent article.
Directory of Open Access Journals (Sweden)
Li Xi-Ying
2013-02-01
postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n
Guillaume, Jeanneret
2014-01-01
CERN-PHOTO-201411-245-95: from left to right: Professor D.Sc.Ph.D. Rajmund Bacewicz, Vice-Rector for Research, Warsaw University of Technology, CERN Director-General R. Heuer and Prof. Marek Jeżabek, Director-General, Henryk Niewodniczanski Institute of Nuclear Physics, Republic of Poland
Directory of Open Access Journals (Sweden)
Manuel Charcape-Ravelo
2013-05-01
Full Text Available El presente trabajo se llevó a cabo con la finalidad de conocer la composición de las fanerógamas del Santuario Regional de Piura Manglares San Pedro de Vice-Sechura. Su importancia radica en que es el manglar más austral del Pacífico de Sudamérica. Dicho trabajo fue realizado desde abril del 2000 hasta febrero del 2004. Para la realización del presente estudio se realizaron visitas periódicas cada dos meses al lugar, se colectaron las plantas bajo procedimientos estándar. Las muestras se determinaron en el lugar y algunas fueron llevadas al laboratorio de Botánica de la Universidad Nacional de Piura y al laboratorio de Botánica Fanerogámica de la Universidad Nacional de Trujillo para su determinación definitiva; luego, las muestras se depositaron en el herbario en formación de la Universidad Nacional de Piura. El manglar consiste en primer lugar de árboles y arbustos de Avicennia germinans (L. L. (Verbenaceae «mangle prieto». En el presente inventario se documentan un total de 44 especies de fanerógamas correspondiendo a 36 géneros en 21 familias para el manglar.
Directory of Open Access Journals (Sweden)
Laurence Pérennès
2011-12-01
Full Text Available La lutte contre le décrochage des étudiants de premier cycle à l’université est aujourd’hui inscrite dans les politiques des pouvoirs publics. Si les causes multifactorielles de l’échec à l’université sont bien identifiées, les outils de remédiation visant à « raccrocher » les étudiants sont encore souvent à l’état d’expérimentation dans les universités françaises. Ainsi, un cycle d’orientation et de consolidation (COC a été mis en place à l’Université de Bretagne Sud (UBS en 2001 dans le but d’identifier et d’accompagner les étudiants potentiellement décrocheurs du premier semestre universitaire. Cette étude, à travers une enquête et des entretiens, vise à dresser un bilan de ce dispositif.Tackling the issue of first-year undergraduate withdrawal from university studies is today part of French public policies. Although the multifactorial causes of university withdrawal have been identified, the remediation tools for student retention are still often experimental in French universities. Thus, a study program for personal and vocational guidance called Cycle d’orientation et de consolidation (C.O.C. was set up at the Université de Bretagne Sud (UBS in 2001 to identify and guide potential first-semester university drop-out students. This study, through a survey and interviews, aims at assessing the program.
Anna Pantelia
2013-01-01
6 March 2013 - Committee for Employment and Learning, Northern Ireland Legislative Assembly, United Kingdom of Great Britain and Northern Ireland in the LHC tunnel and visiting the LHCb experiment at LHC Point 8. Director for Accelerators and Technology S. Myers with Vice-Chair T. Buchanan.
Jean-Claude Gadmer
2011-01-01
11 July 2011 - Carleton University Ottawa, Canada Vice President (Research and International) K. Matheson in the ATLAS visitor centre with Collaboration Spokesperson F. Gianotti, accompanied by Adviser J. Ellis and signing the guest book with CERN Director for Research and Scientific Computing S. Bertolucci.
Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics
1998-07-01
Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62
Maximilien Brice
2011-01-01
Korean vice-minister II of education, science and technology, Kim Chang-Kyung, visiting the CMS experimental area at CERN on 19 January. He also had the opportunity to view part of the LHC tunnel, as well as to visit the CERN Control Centre.
Jean-Claude Gadmer
2010-01-01
Other members of the Uppsala University delegation: Vice Rector J.Nordgren; Director A. Fust and Physics Faculty Dean U. Danielsson. Visiting the Superconducting magnet test hall and CTF3 Facility with CLIC Collaboration and Uppsala University R. Ruber; in the ATLAS visitor centre with Collaboration Resources Manager M. Nordberg.
Institute of Scientific and Technical Information of China (English)
陳智超
2010-01-01
Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.
Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai
2013-01-01
van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis
Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska
2017-09-01
Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.
Reference: 291 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen
DEFF Research Database (Denmark)
Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.
2014-01-01
(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...
Anna Pantelia
2013-01-01
16 December 2013 - Hooke Professor of Experimental Physics and Pro Vice Chancellor University of Oxford Prof. I. Walmsley visiting the ATLAS cavern with ATLAS Collaboration Deputy Spokesperson T. Wengler, Physics Department, ATLAS Collaboration P. Wells and Chair, CMS Collaboration Board, Oxford University and Purdue University I. Shipsey
Maximilien Brice
2010-01-01
15 January 2010 - Vice-Chancellor & Chief Executive C. Snowden, University of Surrey, United Kingdom and Mrs Snowden visiting ALICE exhibition and experimental undeground area with Collabortion Spokesperson J. Schukraft and Beams Department Head P. Collier; Signature of the guest book with CERN Director-General R. Heuer.
U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...
Analysis of the Chinese Exchange Rate Stability
Directory of Open Access Journals (Sweden)
Youngrok Cheng
1998-03-01
Full Text Available Asian Financial Crisis now is moving to a relatively stable phase, and at this time, whether Chinese RMB will depreciate is raising the concern of the outside world. If we simply consider economic factors, we will find REER (Real Effective Exchange Rate increased around 10%, where depreciation factors are lurking. However, after Vice Premier Zhu Rongji took the responsibility of economic operation and fixed the fundamental key of developing stably, many foreign departments present good impetus of development. After that, Foreign Exchange Rate Reservation increases and major focus is put on long-term operation for debt structure. On the contrary, If Chinese RMB depreciates dramatically, there will be some uneasiness towards domestic economy and also the burden of paying debt should be increased, people may suffer the loss quite a lot. Especially even we consider the responsibility as the central country in this region and the political & economical factors causing the harmonious atmosphere of Sino-American relationship, it can be predicted that Chinese RMB cannot depreciate dramatically within 1-2 years.
Weiler, Richard; Monte-Colombo, Mathew; Mitchell, Adam; Haddad, Fares
2015-01-01
This case report illustrates and discusses the non-operative management of a complete anterior cruciate ligament (ACL) injury in an English Premier League football player, his return to play within 8 weeks and problem-free follow-up at 18 months post injury. When non-operative verses surgical ACL reconstruction is considered there are many fundamental gaps in our knowledge and currently, at elite level, there are no cases in cutting sports within the literature to guide these decisions. When the norm is for all professional footballers to be recommended surgery, it will be very challenging when circumstances and patient autonomy dictate a conservative approach, where prognosis, end points and risk are unclear and assumed to be high. This case challenges current dogma and provides a starting point for much needed debate about best practice, treatment options, research direction and not just at the elite level of sport. PMID:25917066
Directory of Open Access Journals (Sweden)
Stig Arve Sæther
2016-03-01
Full Text Available European top-level soccer clubs are continually looking for talented players. Few clubs, however, are willing to let youth players play at the highest senior level. Perhaps as a consequence, the search for talented players has resulted in an imbalance in the characteristics of these players, towards an overrepresentation of players born early in the selection year, an effect called the relative age effect (RAE. The RAE has been documented to be present among senior top-level players. Even so, few studies have investigated the effect among youth players at the senior level. The aim of this study is to examine RAE among U17-U20 players in the Norwegian premier league Tippeligaen in the 2009-2012 seasons. Participants were 315 male players born in 1990-1996. The results showed that 68% of the players were born in the two first quartiles of the year. The effect was even increasing in the four-year period. As we could expect based on the literature, the oldest players are given more playing time. However, the connection between playing time and RAE was inconsistent. Norwegian top-level soccer seems to be affected by the RAE when selecting their players. These players are not however guaranteed playing time because of the RAE.
Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China
Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min
2018-01-01
Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422
Maximilien Brice
2010-01-01
21 June 2010 - TUBITAK Vice President A. Adli signing the guest book with CERN Director-General R. Heuer, visiting the ATLAS control room at Point 1 with Former Collaboration Spokesperson P. Jenni and CMS Control Centre, building 354, with Collaboration Spokesperson G. Tonelli. Throughout accompanied by Adviser J. Ellis.
Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae
Directory of Open Access Journals (Sweden)
Mingqiang Wang
2017-12-01
Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.
Directory of Open Access Journals (Sweden)
Lisandra Estevez
2016-06-01
Full Text Available The French and Spanish courts were two of the most powerful cultural and political institutions in seventeenth-century Europe. Both rivals and allies, the French and Spanish crowns were bound by disputes and diplomacy. This anthology examines the Gallic and Iberian court systems from a comparative approach, filling an important lacuna in early modern political studies and diplomatic history. It is based on the proceedings of a seminar held at the Casa de Velázquez, Madrid in June 2010. Edited by Daniel Aznar, Guillaume Hanotin and Niels F. May, À la place du roi. Vice-rois, gouverneurs et ambassadeurs dans les monarchies française et espanole (XVIe-XVIIIe siècles unites ten essays by leading scholars of seventeenth-century French and Spanish history.
75 FR 42177 - Federated Enhanced Treasury Income Fund, et al.; Notice of Application
2010-07-20
... means return of capital for financial accounting purposes and not for tax accounting purposes. 9..., Federated Premier Intermediate Municipal Income Fund, Federated Premier Municipal Income Fund (collectively... shares of the Current Funds are listed on the New York Stock Exchange. The Premier Intermediate Municipal...
Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)
African Journals Online (AJOL)
Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.
Construction of full-length cDNA library of white flower Salvia ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.
Maximilen Brice
2011-01-01
23rd May 2011 - University of Liverpool Pro-Vice-Chancellor and Public Orator K. Everest (UK) Mrs Everest in the ATLAS visitor centre with Collaboration Deputy Spokesperson D. Charlton, in LHCb surface building with Collaboration Spokesperson A. Golutvin, accompanied throughout by P. Wells and Liverpool University T. Bowcock and M. Klein.
Raphaël Piguet
2011-01-01
31st August 2011 - Government of Japan R. Chubachi, Executive Member of the Council for Science and Technology Policy, Cabinet Office, Vice Chairman, Representative Corporate Executive Officer and Member of the Board, Sony Corporation, visiting the ATLAS experimental area with Former Collaboration Spokesperson P. Jenni and Senior physicist T. Kondo.
Pantelia, Anna
2014-01-01
17 January 2014 - Y. Sakurada Japanese Senior Vice Minister of Education, Culture, Sports, Science and Technology signing the Guest book with CERN Director-General R. Heuer and visiting the LHC tunnel at Point 1 with Technology Department Head J.M. Jiménez. Head of International Relations R. Voss present throughout.
African Journals Online (AJOL)
Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...
Steinfelder-Visscher, J.; Weerwind, P.W.; Teerenstra, S.; Brouwer, René
2006-01-01
BACKGROUND: Recently, the GEM Premier blood gas analyser was upgraded to the GEM Premier 3000. In addition to pH, pCO2, pO2, Na+, K+, Ca2+, and hematocrit measurement, glucose and lactate can be measured on the GEM Premier 3000. In this prospective clinical study, the analytical performance of the
Directory of Open Access Journals (Sweden)
Zhilin Chen
2017-02-01
Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.
Reference: 418 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua
The challenge of the second oil boom? [3. Millenium International Petroleum Conference
International Nuclear Information System (INIS)
Wells, M.
1997-01-01
The Third Millennium International Petroleum Conference is briefly reported at which the competitive challenges faced by the upstream industry were considered. An oil industry wanting to be successful in facing these challenges was perceived by Mobil Oil's Vice-President of Global Business Strategy as requiring the following attributes: the ability to partner with others; a truly global perspective; a balanced portfolio to manage risk; strong technological orientation; the capacity to attract an innovative work-force. The new background of energy geopolitics brought about by the integration of Russia, the CIS countries, China and India into the world market economy, was sketched by the former Exploration Director of Premier Oil. Attention was drawn to the concern and tension being created in the Middle East by the restructuring of oil and gas development arising out of the current US containment foreign policy. This policy is changing the geographical focus and regional strategies of US oil companies and contractors. Some examples of these were presented in papers by other US participants. Contributions from natioan producing companies from other countries demonstrated the opportunities offered to foreign countries by increased liberalisation. (UK)
Yanagihara, Shin; Yazaki-Sugiyama, Yoko
2018-04-12
Behavioral states of animals, such as observing the behavior of a conspecific, modify signal perception and/or sensations that influence state-dependent higher cognitive behavior, such as learning. Recent studies have shown that neuronal responsiveness to sensory signals is modified when animals are engaged in social interactions with others or in locomotor activities. However, how these changes produce state-dependent differences in higher cognitive function is still largely unknown. Zebra finches, which have served as the premier songbird model, learn to sing from early auditory experiences with tutors. They also learn from playback of recorded songs however, learning can be greatly improved when song models are provided through social communication with tutors (Eales, 1989; Chen et al., 2016). Recently we found a subset of neurons in the higher-level auditory cortex of juvenile zebra finches that exhibit highly selective auditory responses to the tutor song after song learning, suggesting an auditory memory trace of the tutor song (Yanagihara and Yazaki-Sugiyama, 2016). Here we show that auditory responses of these selective neurons became greater when juveniles were paired with their tutors, while responses of non-selective neurons did not change. These results suggest that social interaction modulates cortical activity and might function in state-dependent song learning. Copyright © 2018 Elsevier B.V. All rights reserved.
Indian Academy of Sciences (India)
Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...
Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...
African Journals Online (AJOL)
Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.
The vices of emperor Constans I in the fourth century histories
Directory of Open Access Journals (Sweden)
Milivojević Uroš
2008-01-01
Full Text Available The aim of this paper is to analyze the negative characteristics of the Roman emperor Constans I (337-350, according to the earliest preserved information from the late 4th century histories of Aurelius Victor, Eutropius Pseudo-Victor and Eunapius of Sardis. The earliest account of Constans' downfall is around 361 recorded by Aurelius Victor in his short history De Caesaribus. Victor wrote that Constans became more arrogant and aggressive after he defeated his elder brother Constantine II in 340. Also, he was not cautious enough for his young age, was hated due to his bad subordinates and did not respect his soldiers properly. But, the most outrageous fact was according to Victor, that the emperor had homosexual affinity towards his young and attractive barbarian hostages. The record of less moralistic Eutropius in his Breviarium ab Urbe condita, written in 369, is shorter but sharper. In the beginning the reign of Constans was vigorous and righteous but his character deteriorated after his illness. Following that, the young Augustus befriended himself with corrupted companions and turned to severe vices. His reign grew unbearable to his subjects and unpopular among the army ranks. Briefer then Eutropis is the testimony of an anonymous Latin author of Epitome de caesaribus who was contemporary to the Eastern Roman emperor Arcadius (395-408. This Pseudo-Victor wrote down that Constans devoted himself to hunting session, thus allowing plotters to dethrone him. Finally the single Greek author in this series, Eunapius (died after 404, whose istoria h meta Dexippon survived in fragments and Zosimus' late fifth century abridgment, called Constans the worst among the most intolerable tyrants. The Lydian sophist, as far as we could conclude from Zosimus', also recorded Constans' inclination towards young barbarians whom he allowed to mistreat his subjects. Because of wretchedness in the provinces of his realm, the courtiers led coup d'etat through
Quelques aspects du traitement de l’espace dans Portulan de Roland Pécout
Verny, Marie-Jeanne
2015-01-01
Sous le titre de Portulan, on a coutume de faire référence à deux volumes parus le premier en 1978 chez Vent Terrai, dans la collection « Documents ». le deuxième en 1980 chez Tarabusta à Montpellier. Le premier ouvrage s’intitule simplement : Portulan, sans référence à son caractère de premier volume, et comporte un sous-titre : « Itinerari en Orient ». Le deuxième ouvrage porte le titre de Portulan II. Sa quatrième de couverture fait mention de Portulan I et présente en substance le premier...
Indian Academy of Sciences (India)
Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.
Directory of Open Access Journals (Sweden)
Matthieu Dupas
2010-04-01
Full Text Available L’affaire Théophile est source de malentendus. Alors que l’historiographie du libertinage, en se concentrant sur le libertinage érudit a fini par oublier que la sodomie était un enjeu majeur du procès, les historiens de la répression homosexuelle abordent les relations sexuelles entre hommes dans une perspective essentialiste, gommant toute distinction entre sodomie au xviie siècle et homosexualité à l’époque contemporaine. Il s’agit donc la première partie de cet article de souligner que la sodomie est au cœur de l’affaire à la fois comme objet de représentation littéraire et comme pratique illicite. La seconde partie consiste dans une historicisation des discours ayant trait aux relations sexuelles entre hommes, qui montre qu’on ne saurait confondre « homosexualité masculine » et « sodomie ». Celle-ci désigne en effet des rapports anaux aussi bien entre hommes et femmes qu’entre hommes seuls ; lorsque la notion est mobilisée pour renvoyer à des relations anales entre hommes, elle ne constitue pas pour autant une orientation sexuelle ; en tant que concept issu de la théologie, elle ne relève pas de la sexualité ; aucune déviation de genre ne lui est associée. Dans une troisième partie, il s’agit de montrer que la notion de sodomie ne doit pas nous conduire à ignorer les autres discours pouvant porter sur les relations sexuelles entre hommes dans la France du premier xviie siècle et qu’à ce titre, on ne saurait se suffire de cette catégorie pour aborder la question. Bref, cet article a pour but de poser les premiers jalons d’une histoire de l’homosexualité masculine dans la France du xviie siècle d’un point de vue historiciste, sinon constructionniste.Sodomy in the Theophile de Viau affair: questions of gender and sexuality in early modern France.There is a puzzling misunderstanding about the Theophile affair. While the historiography of libertinism, focusing on erudite
National Research Council Canada - National Science Library
1993-01-01
...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...
Jean-Claude Gadmer
2013-01-01
30 August 2013 - Senior Vice Minister for Foreign Affairs in Japan M. Matsuyama signing the guest book with CERN Director-General; visit the ATLAS experimental cavern with ATLAS Spokesperson D. Charlton and visiting the LHC tunnel at Point 1 with former ATLAS Japan national contact physicist T. Kondo. R. Voss and K. Yoshida present throughout.
Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control
Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan
2014-03-01
This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.
Steinfelder-Visscher, J; Weerwind, P W; Teerenstra, S; Brouwer, M H J
2006-01-01
Recently, the GEM Premier blood gas analyser was upgraded to the GEM Premier 3000. In addition to pH, pCO2, pO2, Na+, K+, Ca2+, and hematocrit measurement, glucose and lactate can be measured on the GEM Premier 3000. In this prospective clinical study, the analytical performance of the GEM Premier 3000 was compared with the Ciba Corning 865 analyser for blood gas/electrolytes/metabolites, and for hematocrit with the Sysmex XE 2100 instrument. During a 6-month period, 127 blood samples were analysed on both the GEM Premier 3000 analyser and our laboratory analysers (Ciba Corning 865/Sysmex 2100 instrument), and compared using the agreement analysis for quantitative data. With the exception of K+, the other parameters (pCO2, pO2, Na+, Ca2+, hematocrit, glucose, and lactate) can be described in terms of the mean and standard deviation of the differences. For K+ measurement, a clear linear trend (r=0.79, panalyser seems to be suitable for point-of-care testing of electrolytes, metabolites, and blood gases during cardiopulmonary bypass. However, its downward bias in hematocrit values below 30% suggests that using the GEM Premier 3000 as a transfusion trigger leads to overtreatment with packed red cells.
New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration
Directory of Open Access Journals (Sweden)
Jun Chen
2016-12-01
Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.
Soil Behavior Under Blast Loading
2010-12-01
in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This
Directory of Open Access Journals (Sweden)
Walter Zidaric
2009-10-01
Full Text Available La Fanciulla del West is a “horse opera” resulting from the second collaboration between David Belasco and Giacomo Puccini. This work, specially composed for the American stage, which had its world premiere at New York’s Metropolitan Opera in December 1910, paved the way for American composers who increasingly focused on American History in their quest for a “national” opera. For the first time, Puccini resorted to genuine Indian music, a Zuni melody, which he re-elaborated for dramatic purposes and associated with the nostalgic mood of uprooted people, the miners who left their home country for America. The Other – the native American viewed from the vantage point of the white, as well as the foreigner – no longer represented a threat, as had been the case in the operatic repertoire before, but became part and parcel of a multicultural society, like the Italian immigrant to whom Puccini also paid tribute. The Zuni melody, which opens and closes the opera, contributes to giving a genuine twist to a score which is the first one to tackle the foundations of the American nation.
Maximilien Brice
2013-01-01
17 October 2013 - C. Ashton High Representative of the European Union for Foreign Affairs and Security Policy, Vice-President of the European Commission visiting the ATLAS cavern with ATLAS Collaboration Spokesperson D. Charlton; visiting the LHC tunnel at Point 1 with Technology Department Head F. Bordry and signing the Guest book with CERN Director-General R. Heuer.
Premier Hospital Quality Incentive Demonstration
U.S. Department of Health & Human Services — CMS is pursuing a vision to improve the quality of health care by expanding the information available about quality of care and through direct incentives to reward...
Suwart, Adam
2009-01-01
Wojciech Kóćka’s life could easily serve as a source material of many action and historical film screenplays. He has been hunted by the Nazi, has gone into hiding following threads by the NKVD and have had not an easy life in the first years of the communist Poland. In 1945 he was regarded as the most serious candidate for the position o f Prime Minister of a Lusatian Free State. He has never repudiated his Lusatian roots and became one of the most eminent intellectuals in the pos...
Directory of Open Access Journals (Sweden)
Esther Cloutier
2008-05-01
Full Text Available Nous sommes heureux de vous présenter ce nouveau numéro bilingue de la revue PISTES. Nous espérons ainsi faire connaître les travaux francophones sur la santé au travail dans le monde anglo-saxon. Nous vous rappelons que la traduction de ce numéro a été rendu possible grâce à une subvention du CRSH (Conseil de la recherche en sciences humaines du Canada ainsi qu’à la contribution de certains auteurs que nous tenons à remercier. Ce numéro aborde plusieurs thèmes de recherche reliés au travail...
Enhancing Classroom Creativity. Premier PD
Luna, Elizabeth; Ernst, Jeremy; Clark, Aaron; DeLuca, V. William; Kelly, Daniel
2018-01-01
Educators often hear about the need for students to be more creative, more free-thinking, and more exploratory throughout projects and class assignments. This article will highlight the importance of creating and implementing an open-classroom environment where students are confident in their ability to ask questions and capable of exploring a…
Directory of Open Access Journals (Sweden)
Neil R. Hogan
2012-02-01
Full Text Available Undergraduates use a wide range of information resources for academic and nonacademic purposes, including web sites that range from credible, peer reviewed, online journal sites, to biased and inaccurate promotional web sites. Students are taught basic critical appraisal skills, but do they apply these skills to make decisions about information in different web sites? In an experimental setting, undergraduate students examined pairs of web sites containing conflicting information based on different aspects of critical appraisal, namely credibility of the author of the information, purpose of the web site, and last update of the site, and answered multiple choice questions about the conflicting information. Results indicated that students failed to use critical appraisal criteria, and that while knowledge of and self-reported use of these criteria were related to each other, they were not related to behaviour. This research demonstrates the need for alternative strategies for critical appraisal instruction and assessment. Les étudiants de premier cycle consultent une vaste gamme de sources d’information à des fins universitaires et non universitaires, y compris des sites Web allant de revues en ligne crédibles et évaluées par des pairs à des sites Web promotionnels partials et inexacts. On enseigne aux étudiants des méthodes de base d’évaluation critique, mais mettent-ils ces méthodes en pratique pour prendre des décisions relativement à l’information tirée de différents sites Web? Dans un cadre expérimental, les étudiants de premier cycle ont étudié des paires de sites Web contenant des informations contradictoires en se fondant sur différents aspects de l’évaluation critique, notamment la crédibilité de l’auteur de l’information, l’intention du site Web et la dernière mise à jour du site, et ont répondu à des questions à choix multiples concernant les informations contradictoires. Les r
Kinetic investigation on enantioselective hydrolytic resolution of ...
African Journals Online (AJOL)
Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...
77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection
2012-02-27
... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...
1992-01-01
AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys
DEFF Research Database (Denmark)
Kuhlmann, Annelis
2016-01-01
William Shakespeare: King Lear. Iscenesættelse: Peter Langdal, Skuespilhuset, Store Scene, premiere den 5. februar 2016......William Shakespeare: King Lear. Iscenesættelse: Peter Langdal, Skuespilhuset, Store Scene, premiere den 5. februar 2016...
Effects of water stress and seed mass on germination and ...
African Journals Online (AJOL)
enoh
2012-03-01
Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...
Blazar Sequence in Fermi Era Liang Chen
Indian Academy of Sciences (India)
Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...
Directory of Open Access Journals (Sweden)
1989-01-01
Full Text Available L'auteur tente de montrer comment l'analyse de la composition de la délégation péruvienne au premier Congrès International des Américanistes peut fournir une vision différente du mouvement anthropologique au XIXème siècle, dans la mesure où la plupart des membres de cette délégation étaient peut-être plus préoccupés de représentation que de l'avancement des sciences humaines. D'où l'idée d'un intérêt pour l'archéologie considéré alors comme un acte de sociabilité. El autor intenta demostrar que el análisis de la delegación peruana al primer Congreso Internacional de Americanistas puede dar otra visión del movimiento antropológico en el siglo XIX, en la medida en que la mayoría de los miembros de esta delegación estaban tal vez más preocupados por su imagen pública que por el progreso de las ciencias humanas. En este caso, el interés por la arqueología sería sobre todo un acto de sociabilidad. The author intends to show how the analysis of the social composition of the peruvian delegation at the first International Congress of Americanists, can offer a different view upon the anthropological movement in the XlXth century, as far as most of the delegates were more worried of their public image instead of the advancement of human sciences. In this particular case, their interest on archaeology would be seen as a social act.
How Many Women Are Affected by or at Risk of Preeclampsia?
... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...
Proceedings – Mathematical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...
77 FR 43410 - Data Collection Available for Public Comments and Recommendations
2012-07-24
... the collections, to Sandra Johnston, Program Analyst, Office of Financial Assistance, Small Business... Premier Certified Lenders Program (PCLP) transfers considerable authority and autonomy to Premier...) that are held in account at financial institutions and about SBIC borrowings from financial...
The validity and accuracy in foot-to-foot bioelectrical impedance ...
African Journals Online (AJOL)
The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...
2010-06-28
... separation agreement entered into between Premier Election Solutions, Inc., its parent corporation... living for their families as a result of a noncompetition agreement and Separation Agreement in this... covenants contained within any employment agreement or separation agreement entered into between Premier...
Video Analysis of Musculoskeletal Injuries in Nigerian and English ...
African Journals Online (AJOL)
Video Analysis of Musculoskeletal Injuries in Nigerian and English Professional Soccer Leagues: A Comparative Study. ... The knee and the ankle were the most common injured parts. Most injuries were caused by tackling ... Keywords: Soccer Players, Nigerian Premier League, English Premier League. Musculoskeletal ...
Mechanisms of all-trans retinoic acid-induced differentiation of acute ...
Indian Academy of Sciences (India)
Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...
New St-chromosome-specific molecular markers for identifying ...
Indian Academy of Sciences (India)
et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...
Directory of Open Access Journals (Sweden)
Bruno Dufaÿ
2006-05-01
Full Text Available Cette note présente les premiers résultats des fouilles menées en 2003 et 2004 sur la quasi-totalité du fort Saint-Georges à Chinon (Indre-et-Loire. Celui-ci est l’un des trois éléments de la forteresse médiévale qui domine la ville. La fouille a permis de préciser la fonction du fort, construit dans la deuxième moitié du XIIe s., à l’époque où Chinon est le centre administratif des possessions continentales des Plantagenêt, rois d’Angleterre. Du point de vue militaire, il formait une fortification avancée, protégeant le château principal, selon une structure que Richard Cœur de Lion appliquera au Château Gaillard. À l’intérieur, de vastes bâtiments constituaient des logis, conçus peut-être au départ pour héberger la chancellerie royale.This article presents the first results of the excavations undertaken in 2003 and 2004 over almost all of the Fort Saint-Georges at Chinon (Indre-et-Loire, one of three elements of the medieval fortress which dominates the town. The excavation enabled us to clarify the function of the fort, built in the 2nd half of the 12th century at a time when Chinon was the administrative centre of the continental possesions of the Plantagenet King of England. From a military point of view, it formed an advanced fortification protecting the main castle, within a structure that Richard the Lionheart would apply to the Chayeau Gaillard. Inside, some vast buildings made up the dwellings, designed perhaps initially to house the royal chanceller.
LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities
Energy Technology Data Exchange (ETDEWEB)
Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2013-12-31
This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.
Moving Forward Vice Straight Ahead
2010-03-25
Association of Colleges and Schools, 3624 Market Street, Philadelphia, PA 19104, (215) 662-5606. The Commission on Higher Education is an...College is accredited by the Commission on Higher Education of the Middle States Association of Colleges and Schools, 3624 Market Street, Philadelphia...Public schools recognize their duty to educate and protect gay, lesbian, bisexual and transgender students.17 It is no longer uncommon to see gay
Michael Hoch
2012-01-01
30 January 2012 - Ecuadorian Ambassador Gallegos Chiriboga, Permanent Representative to the United Nations Office and other International Organisations at Geneva and San Francisco de Quito University Vice Chancellor C. Montùfar visiting CMS surface facilities and underground experimental area with CMS Collaboration L. Sulak and Collaboration Deputy Spokesperson T. Camporesi, throughout accompanied by Head of International Relations F. Pauss.
Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor
2015-09-01
Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Pitfalls in VAR based return decompositions: A clarification
DEFF Research Database (Denmark)
Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten
in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...
77 FR 17479 - Formations of, Acquisitions by, and Mergers of Bank Holding Companies
2012-03-26
... Bank, also of Encino. CU Bancorp also has applied to acquire Premier Commercial Bancorp, and thereby indirectly acquire Premier Commercial Bank, N.A., both of Anaheim, California. Board of Governors of the... FEDERAL RESERVE SYSTEM Formations of, Acquisitions by, and Mergers of Bank Holding Companies The...
African Journals Online (AJOL)
Dubihlela, J. 2009: September: Supplement - Articles Motivational factors affecting fan decisions to attend Premier Soccer League (PSL) games in South Africa Abstract · Vol 16, No 3 (2010) - Articles Dimensions of attachment among fans within the South African Premier Soccer League (PSL) and the relationship with ...
African Journal of Traditional, Complementary and Alternative ...
African Journals Online (AJOL)
Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.
Trend analysis and change point detection of annual and seasonal ...
Indian Academy of Sciences (India)
elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.
Directory of Open Access Journals (Sweden)
Constantin I. Ciobanu
2010-01-01
Full Text Available L’église St. Onuphre du monastère Lavrov (Ukraine occidentale, près de Staryi Sambir conserve des peintures murales qu’on a datées de la fin du XVe ou du début du XVIe siècle. Le but de la présente étude est de préciser les affinités d’ordre iconographique existentes entre les versions de l’«Hymne Acathiste» de Lavrov et des églises moldaves à peinture extérieure du temp du premier règne de Petru Rareş. Grâce à la rédaction de l’image de l’«Acathiste» de Probota, où le début du texte de la 17e strophe de l’«Hymne» est bien conservé, on peut constater qu’à Lavrov, dans l’image similaire, il ne s’agit pas de la 24e strophe de l’«Hymne» comme le croyait A. I. Rogov, maïs de la 17e strophe. Donc, on peut supposer, qu’à Lavrov il n’y avait pas de lacune dans la présentation des strophes 19–23 de l’«Hymne Acathiste».
The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations
2011-09-01
properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman
Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings
2015-07-01
resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G
Evaluation of effectiveness in a novel wound healing ointment ...
African Journals Online (AJOL)
Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...
2014-09-18
22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen
A comparative study assessing a new tool for occluding ...
African Journals Online (AJOL)
0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...
The roles of electronic books in the transformation of learning and instruction
Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel
2014-01-01
Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies
2009-09-01
this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...
Leonhardt, Corinna; Lehr, Dirk; Chenot, Jean-François; Keller, Stefan; Luckmann, Judith; Basler, Heinz-Dieter; Baum, Erika; Donner-Banzhoff, Norbert; Pfingsten, Michael; Hildebrandt, Jan; Kochen, Michael M.; Becker, Annette
2009-01-01
Objective: The assumption that low back pain (LBP) patients suffer from “disuse” as a consequence of high fear-avoidance beliefs is currently under debate. A secondary analysis served to investigate whether fear-avoidance beliefs are associated cross-sectionally and longitudinally with the physical activity level (PAL) in LBP patients. Methods: A total of 787 individuals (57% acute and 43% chronic LBP) were followed up over a period of one year with measurements of fear-avoidance beliefs and physical activity level. Fear-avoidance beliefs concerning physical activity were measured by the physical-activity subscale of the FABQ (Fear-Avoidance Beliefs Questionnaire), the physical activity level was assessed in weighted metabolic equivalents (MET) hours/week with a German self-report questionnaire. Data were investigated by structural equation modelling in a cross-lagged panel design for the whole sample and separately for acute and chronic LBP. Results: The acute and chronic sub sample increased their total physical activity level significantly after one year. The structural equation modelling results did not support the disuse-aspect inherent in the fear-avoidance belief model. Cross-lagged path coefficients were low (.04 and .05 respectively) and, therefore, did not allow to predict final physical activity by initial fear-avoidance beliefs or vice versa. Discussion: Consequently, due to missing links between fear-avoidance beliefs and physical activity in a longitudinal design, the assumptions of the fear-avoidance belief model have to be questioned. These findings are in line with other investigations published recently. Most probably, “fear-avoidance belief” represents a cognitive scheme that does not limit activity per se, but only is directed to the avoidance of specific movements. PMID:19742047
THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA
Institute of Scientific and Technical Information of China (English)
CHENTie-mei; SONGShi-mei; YUANDe-cheng
2003-01-01
Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.
Hunt, Kate; Wyke, Sally; Gray, Cindy M; Anderson, Annie S; Brady, Adrian; Bunn, Christopher; Donnan, Peter T; Fenwick, Elisabeth; Grieve, Eleanor; Leishman, Jim; Miller, Euan; Mutrie, Nanette; Rauchhaus, Petra; White, Alan; Treweek, Shaun
2014-04-05
The prevalence of male obesity is increasing but few men take part in weight loss programmes. We assessed the effect of a weight loss and healthy living programme on weight loss in football (soccer) fans. We did a two-group, pragmatic, randomised controlled trial of 747 male football fans aged 35-65 years with a body-mass index (BMI) of 28 kg/m(2) or higher from 13 Scottish professional football clubs. Participants were randomly assigned with SAS (version 9·2, block size 2-9) in a 1:1 ratio, stratified by club, to a weight loss programme delivered by community coaching staff in 12 sessions held every week. The intervention group started a weight loss programme within 3 weeks, and the comparison group were put on a 12 month waiting list. All participants received a weight management booklet. Primary outcome was mean difference in weight loss between groups at 12 months, expressed as absolute weight and a percentage of their baseline weight. Primary outcome assessment was masked. Analyses were based on intention to treat. The trial is registered with Current Controlled Trials, number ISRCTN32677491. 374 men were allocated to the intervention group and 374 to the comparison group. 333 (89%) of the intervention group and 355 (95%) of the comparison group completed 12 month assessments. At 12 months the mean difference in weight loss between groups, adjusted for baseline weight and club, was 4·94 kg (95% CI 3·95-5·94) and percentage weight loss, similarly adjusted, was 4·36% (3·64-5·08), both in favour of the intervention (pScottish Government and The UK Football Pools funded delivery of the programme through a grant to the Scottish Premier League Trust. The National Institute for Health Research Public Health Research Programme funded the assessment (09/3010/06). Copyright © 2014 Hunt et al. Open Access article distributed under the terms of CC BY-NC-ND. Published by Elsevier Ltd. All rights reserved.
2011-10-20
... premier global venue for capital raising, with a truly global franchise and presence in many of the world... management and the premier global venue for capital raising, with a truly global franchise and presence in... three NYSE Exchanges--NYSE, NYSE Arca and NYSE Amex--which provide marketplaces where investors buy and...
2011-09-01
applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D
Canivez, Gary L.; Kush, Joseph C.
2013-01-01
Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…
75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use
2010-01-28
... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...
Nuclear raw materials; Matieres premieres nucleaires
Energy Technology Data Exchange (ETDEWEB)
Cameron, J. [Division of Nuclear Power and Reactors, International Atomic Energy Agency, Vienna (Austria)
1970-01-15
It is clear that in the next decades there will be a substantial and increasing demand for uranium to fuel nuclear power stations. In a developing country, the discovery and development of uranium resources can be of importance either for the development of national nuclear power or for the commercial export of uranium. As the time taken between the start of a uranium exploration program and the uranium production stage.may be of the order of 6 - 10 years, it is now opportune to start new exploration so that advantage of the increased demand in the mid-1970s may be achieved. Thorium will also be of interest, but in the more distant future when the thorium cycle for advanced converters and breeder reactors is fully developed [French] Il est certain qu' au cours des prochaines décennies la demande d'uranium pour les centrales nucléaires sera importante et ne cessera de croître. Dans un pays en voie de développement, la découverte et la mise en valeur de ressources d'uranium peut avoir une grande importance, soit en vue de produire de l'énergie nucléoélectrique, soit en vue d'exporter l'uranium. Etant donné que les délais entre le démarrage d'un programme de prospection de l'uranium et le début de la production peuvent être de l'ordre de six ans, il est actuellement opportun de commencer les opérations d'exploration pour pouvoir profiter de la demande accrue qui s' affirmera vers le milieu de la prochaine décennie. Le thorium présentera aussi un certain intérêt, mais à plus long terme. Il faut pour cela que le cycle du thorium pour convertisseurs avancés et surgénérateurs ait été pleinement développé. (author)
World premiere. And the antimatter was
International Nuclear Information System (INIS)
Rouat, S.
1996-01-01
This paper gives an historical review of the discovery of antimatter. Nine anti-hydrogen atoms were produced in September 1995 by a German-Italian team using the CERN-LEAR. This exceptional event has convulsed the existing fundamental physics theories: the symmetry theory and the general relativity theory and its equivalence principle. The discovery of antimatter raises the question of the existence of an anti-universe and of where the antimatter could lie in the universe. The paper describes the experiment carried out at the CERN and the difficulties encountered for the measurement and the storage of antimatter particles. The possible forthcoming closure of the LEAR appears as a threat to future antimatter studies and developments using antimatter annihilation energy. (J.S.). 1 ref., 1 fig., 1 tab., 1 photo
2011-10-20
... management and the premier global venue for capital raising, with a truly global franchise and presence in... premier global venue for capital raising, with a truly global franchise and presence in many of the world... marketplaces where investors buy and sell listed companies' common stock and other securities as well as equity...
On the Physical Constitution of the Sun — Part I
Directory of Open Access Journals (Sweden)
Faye H.
2011-07-01
Full Text Available Patrice Robitaille (TAV College, Montreal, Canada provides a translation of Herv ́ e August Etienne Albans Faye’s classic report Sur la constitution physique du soleil , as it appeared in February 1865 within Les Mondes ,1865, v.7, 293–306. Herv ́ e Faye (Oc- tober 1, 1814 – July 4, 1902 led a distinguished life, both in science and public ser- vice. He was widely regarded as one of the premier astronomers of his day. He had studied under the great Franc ̧ois Arago. In 1843, he became a Chevalier de la Legion d’Honneur and, in 1877, served as the French Minister of Education (Catholic Ency- clopedia, 1913. Faye’s report On the Physical Constitution of the Sun was a crucial milestone in the history of astronomy. It was through this paper, that the Sun became viewed as devoid of a distinct surface. The work was also interesting as it presented Faye’s early conception of the gaseous Sun. In addition, through its submission, Faye had sought the approbation of Father Secchi relative to claims of simultaneous discov- ery (see P.M.Robitaille. A Thermodynamic History of the Solar Constitution — I: The Journey to a Gaseous Sun. Progr. Phys. , 2011, v.3, 3–25. Faye’s work would continue to impact solar physics until the 1920s.
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...
A reviewof the pharmacologicalmechanism of traditional Chinese ...
African Journals Online (AJOL)
A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...
African Journal of Biotechnology - Vol 10, No 60 (2011)
African Journals Online (AJOL)
Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...
Three novel antioxidants from Cinnamomum plants | Cheng | African ...
African Journals Online (AJOL)
Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.
van Achterberg, Cornelis; Long, Khuat Dang
2010-01-01
Abstract The species of seventeen genera of Agathidinae (Braconidae) from Vietnam are revised: Agathis Latreille, 1804, Bassus Fabricius, 1804; Biroia Szépligeti, 1900; Braunsia Kriechbaumer, 1894; Camptothlipsis Enderlein, 1920; Coccygidium de Saussure, 1892; Coronagathis gen. n. (type species: Coronagathis cornifera sp. n.); Cremnops Foerster, 1862; Disophrys Foerster, 1862; Earinus Wesmael, 1837; Euagathis Szépligeti, 1900; Gyragathis gen. n. (type species: Gyragathis quyi sp. n.), Gyrochus Enderlein, 1920; Lytopylus Foerster, 1862; Therophilus Wesmael, 1837; Troticus Brullé, 1846, and Zelodia gen. n. (type species: Zelomorpha varipes van Achterberg & Maetô, 1990). Keys to the Vietnamese species are given. Sixty-five species are recognised, of which twelve species are newly recorded for Vietnam: Bassus albifasciatus (Watanabe, 1934), Coccygidium angostura (Bhat & Gupta, 1977), Cremnops atricornis (Smith, 1874), stat. n., Disophrys erythrocephala Cameron, 1900, Gyrochus yunnanensis Wang, 1984, Lytopylus romani (Shestakov, 1940), comb. n., Therophilus festivus (Muesebeck, 1953), comb. n., Therophilus javanus (Bhat & Gupta, 1977), comb. n., Therophilus lienhuachihensis (Chou & Sharkey, 1989), comb. n., Therophilus marshi (Bhat & Gupta, 1977), comb. n., Zelodia absoluta (Chen & Yang, 1998), comb. n. and Zelodia longidorsata (Bhat & Gupta, 1977), comb. n. Forty-two species are new to science: Agathis citrinisoma sp. n., Bassus albobasalis sp. n., Bassus albozonatus sp. n., Biroia soror sp. n., Braunsia bicolorata sp. n., Braunsia devriesi sp. n., Braunsia maculifera sp. n., Braunsia nigrapiculata sp. n., Braunsia pumatica sp. n., Camptothlipsis hanoiensis sp. n., Coronagathis cornifera sp. n., Earinus aurantius sp. n., Earinus brevistigmus sp. n., Euagathis flavosoma sp. n., Disophrys maculifera sp. n., Disophrys quymanhi sp. n., Disophrys rhinoides sp. n., Gyragathis quyi sp. n., Therophilus annuliferus sp. n., Therophilus cattienensis sp. n., Therophilus
Lateral strukturierte Oberflächen zur THz-Strahlmanipulation
Jahn, David; Koch, Martin (Prof. Dr.)
2018-01-01
Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...
C. Huang , G. Zhao , HW Zhang & YQ Chen
Indian Academy of Sciences (India)
the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.
Chaos synchronization of the fractional-order Chen's system
International Nuclear Information System (INIS)
Zhu Hao; Zhou Shangbo; He Zhongshi
2009-01-01
In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.
Invisible smoke: third-party endorsement and the resurrection of heat-not-burn tobacco products.
Elias, Jesse; Ling, Pamela M
2018-06-06
Tobacco companies are introducing new 'heat-not-burn' cigarettes in dozens of countries. Historically, these products failed commercially, and independent researchers contested their health claims. The most prominent early heat-not-burn cigarette was RJ Reynolds's (RJR's) Premier, introduced in the USA in 1988. Curiously, The Lancet endorsed Premier as a 'near-perfect low tar cigarette' in a 1991 editorial, 2 years after Premier had been removed from the market. We examined the context of this endorsement. To ascertain what RJR knew about this endorsement, we systematically searched and analysed previously secret RJR documents in public archives and triangulated the industry document data with other published work. RJR had a long-standing interest in collaborating with outside scientists to endorse potentially reduced harm cigarettes. The author of The Lancet editorial had previously corresponded with RJR regarding Premier's health effects and market potential. Internally, RJR regarded The Lancet 's editorial, its stance on novel tobacco products, and its endorsement of Premier as major successes. While the editorial came too late to save Premier, RJR saw future business opportunities for novel products if endorsed by health authorities. Endorsement by high-impact medical journals and health authorities may be critical in helping heat-not-burn' products succeed where previous attempts have failed. Conflicts of interest influenced these endorsements in the past. Health leaders and academic journals should consider both conflicts of interest and the ethics of endorsing tobacco product substitution, as tobacco companies simultaneously work to promote cigarette smoking and undermine tobacco control globally. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors
2008-04-01
Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...
Kramer, D.A.
2012-01-01
Seawater and natural brines accounted for about 57 percent of magnesium compounds produced in the United States in 2011. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties LLC from well brines in Michigan. Caustic-calcined magnesia was recovered from seawater by Premier Magnesia LLC in Florida, from well brines in Michigan by Martin Marietta and from magnesite in Nevada by Premier Magnesia. Intrepid Potash Wendover LLC and Great Salt Lake Minerals Corp. recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from seawater by SPI Pharma Inc. in Delaware and Premier Magnesia in Florida, and by Martin Marietta from its brine operation in Michigan.
Meurtres et meurtriers dans l’œuvre d’Alfred Hitchcock
Directory of Open Access Journals (Sweden)
Sylvain Palfroy
2007-11-01
Full Text Available Le premier plan de The Lodger, - film considéré par Hitchcock comme son véritable premier film (chronologiquement son 3e, le premier « Hitchcock picture » comme il le dit à François Truffaut - montre en gros plan le visage d’une femme hurlant. Ce plan condense en lui une grande partie des éléments qui vont constituer la matière de l’œuvre : la femme, le sexe, le meurtre. Ce qui retient l’attention dans ce plan au-delà du cri - qui renvoie comme bien des cris cadrés par le cinéaste au célèbr...
The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica
Directory of Open Access Journals (Sweden)
Sollman Philip
2015-07-01
Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.
Maximilien Brice
2011-01-01
19 January 2011 - British University of Manchester, Vice-President and Dean for the Faculty of Engineering and Physical Sciences Professor of Structural Engineering School of Mechanical, Aerospace and Civil Engineering C. Bailey in CERN Control Centre with Department Head P. Collier; at LHCb with R. Lindner and ATLAS underground experimental area with Deputy Spokesperson D. Charlton, througout accompanied by . Collier with R. Appleby and F. Loebinger
Ologeanu-Taddei, R.; Pascal, A.; Tchobanian, R.; Fallery, B.; Bondarouk, Tatiana; Ruel, Hubertus Johannes Maria; Jongejan, J.; Oiry, E.
2013-01-01
Le premier travail prévu dans le cadre du projet Use.Org consistait à réaliser une synthèse pluridisciplinaire de la littérature. Dans un premier temps, nous avons synthétisé la littérature existante en SI sur les usages des outils collaboratifs. Ensuite, nous avons enrichi cette analyse en
(DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs
2012-12-21
increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha
The effects of growth time on the quality of graphene synthesized by ...
Indian Academy of Sciences (India)
by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.
African Journals Online (AJOL)
Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...
Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...
Hsieh, Hui-Chen
2016-01-01
Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…
Bamber, A I; Fitzsimmons, K; Cunniffe, J G; Beasor, C C; Mackintosh, C A; Hobbs, G
2012-01-01
The laboratory diagnosis of Clostridium difficile infection (CDI) needs to be accurate and timely to ensure optimal patient management, infection control and reliable surveillance. Three methods are evaluated using 810 consecutive stool samples against toxigenic culture: CDT TOX A/B Premier enzyme immunoassay (EIA) kit (Meridian Bioscience, Europe), Premier EIA for C. difficile glutamate dehydrogenase (GDH) (Meridian Bioscience, Europe) and the Illumigene kit (Meridian Bioscience, Europe), both individually and within combined testing algorithms. The study revealed that the CDT TOX A/B Premier EIA gave rise to false-positive and false-negative results and demonstrated poor sensitivity (56.47%), compared to Premier EIA for C. difficile GDH (97.65%), suggesting this GDH EIA can be a useful negative screening method. Results for the Illumigene assay alone showed sensitivity, specificity, negative predictive value (NPV) and positive predictive value (PPV) of 91.57%, 98.07%, 99.03% and 84.44%, respectively. A two-stage algorithm using Premier EIA for C. difficile GDH/Illumigene assay yielded superior results compared with other testing algorithms (91.57%, 98.07%, 99.03% and 84.44%, respectively), mirroring the Illumigene performance. However, Illumigene is approximately half the cost of current polymerase chain reaction (PCR) methods, has a rapid turnaround time and requires no specialised skill base, making it an attractive alternative to assays such as the Xpert C. difficile assay (Cepheid, Sunnyvale, CA). A three-stage algorithm offered no improvement and would hamper workflow.
Vehicle/Guideway Interaction in Maglev Systems
1992-03-01
Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1
Indian Academy of Sciences (India)
20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.
2010-02-19
... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...
Directory of Open Access Journals (Sweden)
Dikshit Rajesh
2008-09-01
Full Text Available Abstract The distinction between metastasis from a colorectal adenocarcinoma into the ovary and an ovarian adenocarcinoma is vital, but challenging at times, due to overlapping morphological features. Similarly, a distinction between an ovarian metastasis into the colorectum and a colorectal adenocarcinoma, although rare; is important and can be daunting. We report an analysis of 20 cases of ovarian involvement by metastatic colorectal adenocarcinomas and colorectal involvement by metastatic ovarian adenocarcinomas, including the value of differential expression of cytokeratins 7 & 20 by immunohistochemistry (IHC, in these cases. Nine cases (45% were identified as colorectal adenocarcinomas metastatic to the ovary. On biopsy, all these cases showed a 'garland-like' tumor necrosis, with desmoplasia and predominantly exhibited a tubuloalveolar pattern (67% cases. On IHC, all 8 of 9 such cases, where staining for cytokeratin 20 was performed, displayed strong positivity and 7 cases, where staining for carcinoembryogenic antigen (CEA was performed, revealed positivity for this marker (100%. Other 11 cases (55% were ovarian adenocarcinomas, metastatic to the colorectum. These showed metachronous presentations, with the ovarian tumor preceding the colorectal tumor deposits. Morphologically, psammomatous calcification was noted in 73% of these cases, whereas 'garland-like' necrosis was absent in all. The chief morphological subtype was serous papillary cystadenocarcinoma (55% cases. On IHC, CK7 and CA 125 were positive in all 6 of 11 such cases, whereas CK 20 was negative in all these cases. In cases of complex presentations like an ovarian involvement by a metastatic colorectal adenocarcinoma and vice-versa, certain clinicopathological features are useful. Differential expression of CK 7 and CK20 is vital in resolving these dilemmas. CK20 positivity and CK7 negativity is associated with a colorectal adenocarcinoma. Markers like CEA and CA-125 have an
ASPIRING VICE-CHANCELLORS' RHETORIC AND THE ...
African Journals Online (AJOL)
problems militating against the effective management of the university system in Nigeria .... political awareness in view of the historical turn at the end of one millennium and ... into account the contingencies of a given place and time and considers the opportunities ..... This view resonates with contemporary thinking about ...
Postface : La gestion des risques naturels est une dynamique
Jaboyedoff, M.; Charriere, M.K.M.; Derron, M.H.; Nicolet, P.; Sudmeier-Rieux, K.
2013-01-01
Les risques sont contrôlés par de nombreux facteurs dont, en premier lieu, les dangers, exprimés par leur fréquence (aléa) à une intensité donnée, mais aussi relativement à un fonctionnement de la société. La gestion des risques, liés aux dangers naturels, implique de les évaluer, en premier lieu,
On the Unsteady-Motion Theory of Magnetic Forces for Maglev
1993-11-01
DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work supported...vi On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S
On integral equation methods for electromagnetic scattering by biperiodic structures
Bugert, Beatrice
2014-01-01
In der vorliegenden Arbeit verwenden wir Integralgleichungsmethoden, um die Streuung von zeitharmonischen elektromagnetischen ebenen Wellen an biperiodischen mehrschichtigen Strukturen zu untersuchen. Solche Strukturen modellieren wir durch die vertikale Anordnung einer endlichen Anzahl an sich nicht schneidenden, polyedrisch Lipschitz regulären Grenzflächen. Wir unterscheiden Streuobjekte bestehend aus einer Oberfläche und solche bestehend aus mindestens zwei Oberflächen. Das elektromagnetis...
Ühinemise ja iseolemise vastuseis. Ideaalid ja reaalsus / Rein Tootmaa
Tootmaa, Rein
2001-01-01
Mängufilmid "Keiser ja palgamõrtsukas" ("Jing ke ci qin wang") : režissöör Chen Kaige : Jaapan-Hiina-Prantsusmaa 1999 ja "Tiiger ja draakon" ("Wo hu chang long") : režissöör Ang Lee : Hiina-Hongkong-Ameerika Ühendriigid 2000. Lisa : Aare Ermeli koostatud Chen Kaige ja Ang Lee loomingu lühikokkuvõtted. Kokkuvõte inglise keeles lk. 128
DEFF Research Database (Denmark)
Henriksen, Knud; Sporring, Jon; Hornbæk, Kasper
2004-01-01
reviews and provides a mathematical foundation for virtual trackballs. The first, but still popular, virtual trackball was described by Chen et al. [CHECK END OF SENTENCE]. We show that the virtual trackball by Chen et al. does not rotate the object along the intended great circular arc on the virtual...... trackball and we give a correction. Another popular virtual trackball is Shoemake's quaternion implementation [CHECK END OF SENTENCE], which we show to be a special case of the virtual trackball by Chen et al.. Shoemake extends the scope of the virtual trackball to the full screen. Unfortunately, Shoemake......'s virtual trackball is inhomogeneous and discontinuous with consequences for usability. Finally, we review Bell's virtual trackball [CHECK END OF SENTENCE] and discuss studies of the usability of virtual trackballs....
2018-02-01
Retracted Review article: Nucleophagy in Human Disease: Beyond the Physiological Role. [Tohoku J. Exp. Med., 2018, 244 (1), 75-81. doi: 10.1620/tjem.244.75.] The above Review article was published online on January 27, 2018. Soon after its publication (on February 1, 2018), Dr. Nian Fu and Prof. Linxi Chen informed the Editor-in-Chief, The Tohoku Journal of Experimental Medicine (TJEM), about serious violation of publication ethics. Indeed, Dr. Nian Fu and Prof. Linxi Chen were astonished to find their names as coauthors of this Review article, because they were not involved in the submission process of this Review article and they do not know any of other coauthors. In addition, the Review article is similar to their unpublished manuscript. After a thorough investigation in accordance with the recommendations of the Committee on Publication Ethics (COPE), the Editor-in-Chief of TJEM decided to retract this Review article. The reasons for Retraction are summarized below: forged authors and an unexpected case of plagiarism. Forged authors: Dr. Nian Fu and Prof. Linxi Chen were added as co-authors of the Review article without their knowledge. In fact, the signature provided by Prof. Linxi Chen is apparently different from the signature of a coauthor, named Linxi Chen, on the AUTHORS’ RESPONSIBILITY FORM, provided by the corresponding author of the Review article. More critically, the signature provided by Dr. Nian Fu is completely different from the signature of Nian Fu, because the Chinese characters are different between the two signatures. In addition, the replies from three authors (Ming Zhou, Hongwen Ji and Yong Xia) clearly indicate that they misunderstand the identity of Dr. Nina Fu. We also attempted to contact two authors, named Nian Fu and Linxi Chen, via e-mail. As expected, the forged authors did not respond to our inquiries, despite that their e-mail addresses appear to be active. An unexpected case of plagiarism: This Review article is similar to the
Directory of Open Access Journals (Sweden)
Alma N. Bamero
2006-12-01
Full Text Available This research entitled “Opium: The Evolution of Policies, the Tolerance of the Vice, and the Proliferation of Contraband Trade in the Philippines, 1843-1908” presents a discussion of the opium trade in Asia, the commercial networks it created, the political ties it strengthened, and the social relations itfostered. It also aims to reconstruct an aspect of Philippine social history in the nineteenth century through the use of archival materials that bear witness to the distribution and exploitation of a substance which some people stillclassify as taboo. The poppy was not endemic to the Philippines but opium, its derivative substance, was known to numb pain and could induce a “natural high” that left one with feelings of ease and contentment. A more complete introduction to the drug necessitates a discussion of the way it was extractedand processed. It is a cash crop that does not require complex devices and is, therefore, within the reach of farmers and common folk. From the eighteenth to the nineteenth centuries opium became very popular among the Chinese who discovered that their markets were being flooded with it by the British sothat the latter could pay for the tea that they craved.The Spanish Bourbons, in an effort to boost Philippine economy, allowed the trading of this substance. Initially this was supervised by the officials of the Alcaiceria de San Fernando but in 1843 the meticulous examination of the country’s finances merited the creation of an opium revenuefarm through municipal franchising. Opium could only be used by the Chinese who were migrating in big groups. This paper presents the details of the monopoly contract, identifies some of the wealthier contratistas of the period, and discusses the consequences of such a commercial venture. Smuggling orcontraband trade proliferated and by way of illustration the events namely, the Scandal of 1843 and the Gunga Incident, have been narrated. The creation of an over
Bahhou, J.; Alaoui Mhamdi, M.
1999-03-01
The diel changes of the biochemical composition of the phytoplankton were studied in the Idriss first reservoir (located on the Inaouen river at thirty Km from the city of Fes, Morrocco) during September 1994. Several biomass and metabolic indicators (proteins, carbohydrates, lipids, chlorophyll a and primary production) were assessed every fourth hour over tow days (7, 8 and 9 September). Since the Protein/Carbohydrates ratio (P/C) is largely recognised as a good integrator of the metabolic functions of the cells, we examined its distribution pattern concomitantly with aforementioned parameters. The results demonstrated enhanced P/C ratios clearly indicating that nutrients were sufficiently available for growth. In addition, this index showed a diel significant variation with levels higher in the night than in the day. Moreover, these results suggest that phytoplankton species during the night used the day-synthesised carbohydrates to insure the cell metabolic functioning. The P/C presents relatively high values in proposition to the ones that have been recorded in temperate regions, and seems to be related to azotic inputs of the Inaouen river. Dans le but de parfaire nos connaissances sur le fonctionnement du sous écosystème phytoplancton, nous nous sommes intéressés à étudier son cycle nycthéméral et son métabolisme cellulaire dans la retenue du barrage Idriss premier. Cette dernière, construite sur l'Oued Inaouène, est située à une trentaine de Km de la ville de Fès. Au cours de ce cycle, les prélèvements ont été effectués selon une séquence temporelle de 4 heures pendant 48 heures, les 7, 8 et 9 septembre 1994. L'étude de l'évolution des composantes biochimiques des cellules phytoplanctoniques à savoir les protéines, les glucides et les lipides a permis de mettre en évidence des variations nycthémérales importantes. Ces variations sont d'autant plus importantes que les variations spatiales observées entre les profondeurs. De plus
Military Culture and Counterinsurgency in the Twenty First Century: Defeating Boko Haram in Nigeria
2013-04-01
Leone and Una Osili, War and Stature: Growing Up During the Nigerian Civil War, The Centre for Market and Public Organization, http...Mercia." Early Medieval Europe 15, no. 1 (February 2007): 53-85. Academic Search Premier, EBSCOhost (accessed December 16, 2012) Binding Prometheus: How...Sailors and the Impressment Paradox." Journal Of Early Modern History 14, no. 1/2 (March 2010): 9-44. Academic Search Premier, EBSCOhost (accessed
Précis de télédétection, v.4 méthodes de photointerprétation et d'interprétation d'image
Provencher, Léo
2007-01-01
Le premier manuel publié en français sur l'interprétation d'image ainsi que le premier manuel universitaire de photointerprétation en français depuis plus de 30 ans. Cet ouvrage novateur met l'accent sur la démarche intellectuelle d'interprétation ainsi que sur les techniques et méthodes d'identification des composantes de la surface terrestre.
1989-05-17
brand , which symbolizes feudal autocracy, in that the new form has been posited in the hopes that reform can forcefully be implemented so as to...ucts; name- brand and high-quality products; products of energy, communications, transportation, and raw mate- rial industries; aid agriculture...1986 election. Chen Weiye fought a skillful battle although he had been seen as an underdog . The smashing victory of Chen Weiye and Huang Wentai plus
Viets, Carmen
2001-01-01
Faseroptische SERS-Sensoren wurden durch die Beschichtung der Endflächen von optischen Fasern mit rauhen Metallfilmen erzeugt. Zu den verschiedenen Präparationstechniken, die angewendet und verglichen wurden, gehörten das langsame Aufdampfen von Metall-Inselfilmen und das Bedampfen von Nanopartikeln, aufgerauhten oder elektronenlithographisch strukturierten Oberflächen mit Metallfilmen. Der Einfluß der Laserleistung auf die Messungen mit SERS-Sensoren wurde untersucht, und es wurden maximale ...
Unconventional Density Wave and Superfluidity in Cold Atom Systems
2014-06-01
Tsai, Chairperson Professor Kirill Shtengel Professor Vivek Aji 3 Copyright by Chen-Yen Lai 2014 4 The Dissertation of Chen-Yen Lai is approved...thank my dissertation committee members, Professor Vivek Aji and Pro- fessor Kirill Shtengel, for their help, kindness, insightful comments and...near balance to a stripe-CDW ( red ) as the imbalance increases. The insert shows the strong imbalance region, where single species p-wave majority
Quasi-Static Evolution, Catastrophe, and Failed Eruption of Solar Flux Ropes
2016-12-30
Ropes James Chen Beam Physics Branch Plasma Physics Division December 30, 2016 Approved for public release; distribution is unlimited. i REPORT...pressure gradient force combine to balance the major radial hoop force. The macroscopic forces on the flux ropes and onset conditions are quantified...Solar physics theory 67-4989-07 Quasi-Static Evolution, Catastrophe, and “Failed” Eruption of Solar Flux Ropes James Chen1 Plasma Physics Division
Aerial Logistics Management for Carrier Onboard Delivery
2016-09-01
NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY by Samuel L. Chen September 2016...AND SUBTITLE AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY 5. FUNDING NUMBERS 6. AUTHOR(S) Samuel L. Chen 7. PERFORMING ORGANIZATION NAME(S...delivery (COD) is the use of aircraft to transport people and cargo from a forward logistics site (FLS) to a carrier strike group (CSG). The goal of
The Role of Protein Elongation Factor eEF1A2 in Breast Cancer
2006-09-01
apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al
L’espace domestique au Bronze final et au premier âge du Fer dans le sud de la Corse
Directory of Open Access Journals (Sweden)
Peche-Quilichini, Kewin
2015-12-01
organización general como a nivel del espacio interno y de la arquitectura de las viviendas. [fr] L’objectif de cet article est de fournir une approche synthétique sur les formes de l’habitat en Corse au Bronze final (BF et au premier âge du Fer (F1, à l’échelle de la microrégion montagneuse de l’Alta Rocca, située dans le sud de la Corse, au coeur du bassin occidental de la Méditerranée. La problématique d’étude des sites protohistoriques non fortifiés est jeune sur l’île, mais les travaux se sont récemment multipliés et rendent compte de la complexité structurelle et évolutive des espaces habités, permettant ainsi une premiére analyse comparative. Le raisonnement s’appuie essentiellement sur l’apport des fouilles du grand habitat de Cuciurpula, initiées en 2008 et toujours en cours, ainsi que sur l’exploitation des villages de Puzzonu et de Nuciaresa, sondés en 2012. La chronologie des secteurs étudiés permet d’embrasser un arc chronologique complet entre le XIIe et le VIe siécle av. J.-C., et donc d’appréhender les phénoménes évolutifs, tant en termes d’organisation générale qu’au niveau de l’espace interne et de l’architecture des habitations.
Film Premiere: Arrows of time at exploratorium
2007-01-01
"Join award-wimming artist and filmmaker Ken McMullen for a uniqude presentation of films engaging ideas at the forefront of science and culture on Sunday, Apri 29 at 2pm at the Exploratorium." (1/3 page)
Rosneftegazstroy - Russia's premier oil and gas contractor
International Nuclear Information System (INIS)
Anon.
1996-01-01
This special Petroleum Economist Sponsored Supplement looks at the present condition and future prospects of the Russian oil and gas industry. Russia's chief oil and gas contractor, Rosneftegazstroy, a joint stock company formed in 1991, took over from the former Soviet Union's Ministry of Oil and Gas Construction and from Neftegazstroy, the State concern. Responsible for the exploration and exploitation of the country's huge oil and gas reserves, Rosneftegazstroy has a mammoth task ahead to modernize and create an adequate infrastructure for its new commercial basis. Its foreign investment projects are described and plans for rebuilding and new developments are discussed. Russia's fuel and energy industries now show clear signs of increasing activity, amid a backdrop of falling production overall. (UK)
Premier appel à notes conceptuelles 2014-2015*
International Development Research Centre (IDRC) Digital Library (Canada)
IDRC CRDI
18 mars 2014 ... Les demandes dûment remplies, accompagnées de tous les .... en résultent contribuent à l'amélioration des conditions de vie dans les ... dialogues sur les politiques, ateliers, activités au Canada; formation d' ... les associations professionnelles ou les organismes publics ..... continuer à financer le projet.
ewec 2007 - Europe's premier wind energy event
International Nuclear Information System (INIS)
Chaviaropoulos, T.
2007-01-01
This online collection of papers - the ewec 2007 proceedings - reflects the various sessions and lectures presented at the ewec wind-energy convention held in Milan in 2007. The first day's sessions looked at the following topics: Renewable Energy Roadmap, the changing structure of the wind industry, politics and programmes, aerodynamics and innovation in turbine design, wind resources and site characterisation (2 sessions), energy scenarios, harmonisation of incentive schemes, structural design and materials, forecasting, integration studies, integrating wind into electricity markets, wind-turbine electrical systems and components, as well as loads, noise and wakes. The second day included sessions on offshore: developments and prospects, extreme wind conditions and forecasting techniques, small wind turbines, distributed generation and autonomous systems cost effectiveness, cost effectiveness of wind energy, financing wind energy concepts, wind and turbulence, wind power plants and grid integration, offshore technology, global challenges and opportunities, aero-elasticity, loads and control, operations and maintenance, carbon trading and the emission trading schemes, investment strategies of power producers, wind power plants and grid integration, wind turbine electrical systems and components, and wakes. The third day offered sessions on environmental issues, condition monitoring, operation and maintenance, structural design and materials, the Up-Wind workshop, winning hearts and minds, offshore technology, advances in measuring methods and advancing drive-train reliability. In a closing session the conference was summarised, awards for poster contributions were made and the Poul la Cour Prize was presented
Arthroscopy Techniques: The Premier Arthroscopic Video Library.
Leland, J Martin; Lubowitz, James H; Provencher, Matthew T
2016-12-01
Arthroscopy has always been focused on its roots-providing practical, clinically relevant information for the practicing arthroscopist. In the digital age, there is a need for publication platforms dedicated to multimedia presentations, hence the birth of Arthroscopy Techniques, Arthroscopy's online video companion. With over 700 videos, our library is filled with an exceptional collection of arthroscopic educational material, with topics ranging from the basics of arthroscopy to the most complex surgical procedures. One series, published this month, explores elbow arthroscopy with specific attention to describing various elbow portals, patient positioning, and tricks of elbow arthroscopy known only to the masters. If you have yet to view Arthroscopy Techniques, experience the future of arthroscopy today at www.ArthroscopyTechniques.org! Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.
Massive Star Formation: Accreting from Companion X. Chen1 ...
Indian Academy of Sciences (India)
Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...
Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...
African Journals Online (AJOL)
The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...
Food Fortification to Prevent and Control Iron Deficiency | Chen ...
African Journals Online (AJOL)
It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...
Chemische Reaktionen auf Oberflächen - eine SFG Studie
Kirsch, Harald
2014-01-01
This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...
Existence of positive periodic solution of mutualism system with several delays
International Nuclear Information System (INIS)
Wu Haihui; Xia Yonghui; Lin Muren
2008-01-01
In this paper, by using Mawhin coincidence degree, some sufficient conditions are obtained for the global existence of positive periodic solutions of a mutualism systems with bounded and unbounded delays. Our results generalize significantly improve those of Gopalsamy and He [Gopalsamy K, He XZ. Persistence, attractivity, and delay in facultative mutualism. J Math Anal Appl 1997;215:154-73], Yang et al. [Yang F, Jiang D, Ying A. Existence of positive solution of multidelays facultative mutualism system. J Eng Math 2002;3:64-8], Chen et al. [Chen FD, Shi JL, Chen XX. Periodicity in Lotka-Volterra facultative mutualism system with several delays. J Eng Math 2004;21(3)] and Xia and Lin [Xia YH, Lin M, Existence of positive periodic solution of mutualism system with infinite delays. Ann Diff Eqs 2005;21(3):448-53
Robust anonymous authentication scheme for telecare medical information systems.
Xie, Qi; Zhang, Jun; Dong, Na
2013-04-01
Patient can obtain sorts of health-care delivery services via Telecare Medical Information Systems (TMIS). Authentication, security, patient's privacy protection and data confidentiality are important for patient or doctor accessing to Electronic Medical Records (EMR). In 2012, Chen et al. showed that Khan et al.'s dynamic ID-based authentication scheme has some weaknesses and proposed an improved scheme, and they claimed that their scheme is more suitable for TMIS. However, we show that Chen et al.'s scheme also has some weaknesses. In particular, Chen et al.'s scheme does not provide user's privacy protection and perfect forward secrecy, is vulnerable to off-line password guessing attack and impersonation attack once user's smart card is compromised. Further, we propose a secure anonymity authentication scheme to overcome their weaknesses even an adversary can know all information stored in smart card.
Earnings management and financial reporting fraud: can external auditors spot the difference?
Kassem, Rasha
2012-01-01
The aim of this paper is to increase external auditors’ knowledge about earnings management and help them spot the difference between earnings management and financial reporting fraud. A thorough literature review was undertaken to achieve the paper’s aim. The secondary data used in this paper was obtained from different databases like Ebscohost, Business Search Premier, Academic Search Premier, Emerlad, Sciencedirect, and Jstor. The current paper suggests a new approach and way of thinking f...
Le Syndrome de Denys-Drash, une Cause Rare de Syndrome ...
African Journals Online (AJOL)
Le syndrome de Denys-Drash (DD) est une affection génétique rare due à la mutation du gène WT1, impliqué dans la morphogenèse des organes génitaux externes et du rein. Il associe un syndrome néphrotique congénital et une ambiguïté sexuelle. Les premiers signes surviennent dès les 3 premiers mois de vie sous ...
Transparent and Stretchable High-Performance Supercapacitors Based on Wrinkled Graphene Electrodes
2013-12-18
2, 870–875. 38. Chen, T.; Dai, L. Carbon Nanomaterials for High- Performance Supercapacitors . Mater. Today 2013, 16, 272–280. 39. Stoller, M. D...High-Performance Supercapacitors Based onWrinkledGraphene Electrodes Tao Chen,† Yuhua Xue,† Ajit K. Roy,‡ and Liming Dai†,* †Center of Advanced Science...electrodes and the associated supercapacitor cells cannot be both trans- parent and stretchable.1318 It is highly desirable to integrate the
Wang, Xiaolin; Wang,Qingbing; Li,Jianfeng; An,Sai; Chen,Yi; Jiang,Chen
2015-01-01
Qingbing Wang,1,2 Jianfeng Li,3 Sai An,3 Yi Chen,1 Chen Jiang,3 Xiaolin Wang1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Key Laboratory of Smart Drug Delivery, Ministry of Education, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai, People’s Republic of China Background: Gene therapy is a very promising technology for treatment of pancreatic ductal adenocarci...
2013-01-01
Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner
CLEAR: Cross-Layer Exploration for Architecting Resilience
2017-03-01
unavailable, or in an economy mode (low resilience, low power mode) when ABFT is available. However, the overheads outweigh benefits (details in [Cheng 16b...layer r Design, Automation , & Test in Europe, 2010. [Chen 05] Chen, Z. and J. Dong table real number codes based on random m Lecture Notes in...tolerate soft errors in processor c ACM/EDAC/IEEE Design Automation Conf., 2016. [Cheng 16b] Cheng, E., et al. -layer exploration for architecting
Agent Reasoning Transparency: The Influence of Information Level on Automation-Induced Complacency
2017-06-30
automation performance using working memory capacity. Ergonomics . 2014;57(3):295–318. Barber D, Davis L, Nicholson D, Finkelstein N, Chen JYC. The...ELEMENT NUMBER 6. AUTHOR(S) Julia L Wright, Jessie YC Chen, Michael J Barnes, and Peter A Hancock 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK ...Appendix C. Cube Comparisons Test 131 Appendix D. Spatial Orientation Test 135 Appendix E. National Aeronautics and Space Administration-Task Load Index
Curran, K; Drust, B; Murphy, R; Pringle, A; Richardson, D
2016-06-01
To investigate the challenges that men from hard-to-reach (HTR) populations encounter when attempting to commit to regular participation in physical activity and health behaviours, and to explore the psychological and social effects of participation in a twelve week football-led health improvement intervention. A twelve week football specific physical activity intervention targeting men from HTR populations was delivered by Everton Football Clubs' Football in the Community (FitC) scheme as part of a national programme of men's health delivered in/by English Premier League (EPL) football clubs. Men living in homeless shelters and/or recovering from substance misuse were recruited over a period of three months. The programme consisted of a two hour football session, twice weekly, alongside the dissemination of healthy living messages. Football sessions were conducted by a qualified FitC coach. This research was conducted during a twelve week period of immersed practitioner-research. Ethnographic and observational methodologies were adopted. Psychosocial issues were discussed with participants through informal client-researcher interactions and data were logged via field notes. Records of attendance were logged. Participants who failed to attend a session were contacted and their reason(s) for non-attendance were recorded. Data were analysed using deductive and inductive reasoning. Despite the apparent ambition of the participants to regularly participate in the FitC programme, adherence to the programme was poor. Economic, environmental and social barriers to engagement in the programme were apparent. Engagement in the programme resulted in positive psychosocial developments; the development of structure, social interaction and social capital. Community based football-led health improvement programmes endorsed by professional football clubs appear well positioned to connect with, and attract, men from HTR populations. The evidence suggests that such programmes can
Directory of Open Access Journals (Sweden)
Kees van Dijk
2013-03-01
Full Text Available Some twenty years after the Sultan of Brunei had bestowed upon the Englishman James Brooke the title of Rajah of Sarawak, giving him extensive authorities over a large tract of land, an American, Joseph William Torrey, United States consul in Brunei, gained the right to call himself Rajah of Marudu and Ambong. Though Torrey’s efforts failed to establish a profitable business in Sabah, they formed the root of the British North Borneo Company. Torrey probably was one of the last of his kind. Elsewhere in the Pacific, European and American residents and adventurers did not bother much about native titles, expanding their hold over land and its inhabitants by economic and political manipulation. In Hawaii and Samoa political reform and becoming cabinet minister or prime minister of a still independent island state served their purposes better.Quelque vingt ans après que le sultan de Brunei eut accordé à l’Anglais James Brooke le titre de rajah de Sarawak, qui lui donnait d’importants pouvoirs sur une vaste région, un Américain, Joseph William Torrey, consul des Etats-Unis à Brunei, obtint le titre de rajah de Marudu et Ambong. Les efforts de Torrey, échouant à établir une affaire profitable à Sabah, constituèrent néanmoins les bases de la British North Borneo Company. Torrey fut sans doute l’un des derniers de ce type d’aventuriers. Ailleurs dans le Pacifique, des résidents et des aventuriers européens et américains, par des manœuvres économiques et politiques, consolidèrent leur contrôle sur les territoires et leurs populations, sans trop se soucier d’obtenir des titres locaux. A Hawaii et à Samoa, il leur fut plus utile d’entreprendre des réformes politiques et de se pourvoir d’un poste de ministre ou de premier ministre d’un Etat insulaire encore indépendant.
Fluorescence fluctuation spectroscopy (FFS), part A
Tetin, Sergey
2013-01-01
This new volume of Methods in Enzymology continues the legacy of this premier serial by containing quality chapters authored by leaders in the field. This volume covers Fluorescence Fluctuation SpectroscopyContains chapters on such topics as Time-integrated fluorescence cumulant analysis, Pulsed Interleaved Excitation, and raster image correlation spectroscopy and number and brightness analysis.Continues the legacy of this premier serial with quality chapters authored by leaders in the fieldCovers fluorescence fluctuation spectroscopyContains chapte
New issues in attendance demand: the case of the English football league
D Forrest; R Simmons
2005-01-01
This paper uses an attendance demand model with panel data on over 4,000 games to examine economic problems of fixture congestion in English Football League schedules. We find that televised midweek Champions League matches involving English Premier League clubs have substantial adverse impacts on lower division Football League gate attendance. This suggests that affected clubs may have a case for compensation from the Premier League for loss of gate revenue from this source. Scheduling of ho...
Chen YC; Ho HO; Chiu CC; Sheu MT
2013-01-01
Ying-Chen Chen,1,* Hsiu-O Ho,1,* Chiao-Chi Chiu,1 Ming-Thau Sheu1,2 1School of Pharmacy, College of Pharmacy, Taipei Medical University, 2Clinical Research Center and Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei, Taiwan*These authors contributed equally to this workAbstract: In this study, alendronate, the most commonly used biphosphonate for treating osteoporosis, was formulated as gastroretentive dosage form (GRDF) tablets to enhance its oral bioav...
Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu
2018-01-01
Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...
Reforming China’s Criminal Procedure Law
Winckler, Hugo
2014-01-01
Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...
Chen, Ming; Anderson, Erik; Hill, Geoffrey; Chen, John J; Patrianakos, Thomas
2015-01-01
Ming Chen,1 Erik Anderson,2 Geoffrey Hill,3 John J Chen,4 Thomas Patrianakos2 1Department of Surgery, University of Hawaii, Honolulu, HI, 2Department of Ophthalmology, John H Stroger, Jr Hospital of Cook County, Chicago, IL, 3Department of Ophthalmology, UT Southwestern Medical Center, Dallas, TX, 4Biostatistics Core, John A Burns School of Medicine, University of Hawaii, Honolulu, HI, USA Purpose: To compare cumulative dissipated energy between two phacoemulsification mac...
Chen, Ming; Sweeney, Henry W; Luke, Becky; Chen, Mindy; Brown, Mathew
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Chen, Ming
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Tung, Li-Chen; Lin, Chin-Kai; Hsieh, Ching-Lin; Chen, Ching-Chi; Huang, Chin-Tsan; Wang, Chun-Hou
2013-01-01
Li-Chen Tung,1,# Chin-Kai Lin,2,# Ching-Lin Hsieh,3,4 Ching-Chi Chen,1 Chin-Tsan Huang,1 Chun-Hou Wang5,6 1Department of Physical Medicine and Rehabilitation, Chi Mei Medical Center, Tainan, 2Program of Early Intervention, Department of Early Childhood Education, National Taichung University of Education, Taichung, 3School of Occupational Therapy, College of Medicine, National Taiwan University, Taipei, 4Department of Physical Medicine and Rehabilitation, National Taiwan University Hospital, ...
Lanthanide metal-organic frameworks
International Nuclear Information System (INIS)
Cheng, Peng
2015-01-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Lanthanide metal-organic frameworks
Energy Technology Data Exchange (ETDEWEB)
Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry
2015-03-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Directory of Open Access Journals (Sweden)
Geneviève Baril-Gingras
2010-11-01
Full Text Available Le travail des cadres de premier niveau a connu, ces dernières années, de nombreux changements. Dans le réseau de la santé au Québec, on a observé réduction importante de leur nombre de cadre de premier niveau. Or, ceux-ci jouent un rôle important quant à la santé (physique et psychologique et à la sécurité des membres des équipes de travail, puisqu’ils définissent certaines des conditions de réalisation de leur travail et certains aspects de leur environnement psychosocial de travail. L’étude, visant à mieux comprendre le travail de ces cadres et l’influence des conditions dans lesquelles il est réalisé, a procédé par des observations auprès de 12 cadres de premier niveau, sous forme de chroniques de travail et par des entretiens sur la base de ces observations. L’article présente et discute trois types de résultats : des exemples de la manière dont la tâche prescrite est convertie en tâche effective et de sa traduction dans leur activité ; une synthèse de la manière dont ils perçoivent leur rôle ou « tâche effective » ; des constats quant à l’écart entre celle-ci et les conditions de réalisation de leur travail, en particulier du fait d’une surcharge quantitative de travail, d’une autonomie réelle limitée et d’obstacles à la planification et au développement à long terme de leurs services, Ces conditions n’apparaissent donc pas favorables au rôle positif qu’ils souhaitent jouer et qui est attendu d’eux, par rapport à leurs équipes de travail.First-level managers’ work has undergone many changes in recent years. In Québec’s public health network, the number of these managers has decreased significantly. However, they play an important role in the health (physical and mental and safety of work team members, since they define some of their working conditions and some aspects of the psycho-social work environment. The aim of the study was to better understand first
The Imitation Game: Alan Turings enigmatiske imitationsspil
DEFF Research Database (Denmark)
Bentzen, Martin Mose
2015-01-01
Alan Turing revolutionerede computervidenskaben og modtog først verdens anerkendelse længe efter sin død. Nu sætter filmen 'The Imitation Game', der har premiere i Danmark 29. januar 2015, fokus på det oversete geni.......Alan Turing revolutionerede computervidenskaben og modtog først verdens anerkendelse længe efter sin død. Nu sætter filmen 'The Imitation Game', der har premiere i Danmark 29. januar 2015, fokus på det oversete geni....
Scattering of plane waves by rough surfaces in the sense of Born approximation
Arnold, Thomas
2014-01-01
Das Thema dieser Arbeit ist die Streuung elektromagnetischer ebener Wellen an rauen Oberflächen, also an ebenen Oberflächen mit glatten und beschränkten Störungen. Darüber hinaus wird ein kleiner Kontrast der Materialkonstanten zwischen dem Deckmaterial und dem Material unter der rauen Oberfläche angenommen. Unter diesen Voraussetzungen wird ein Fernfeld-Formel für das gestreute Feld mit Hilfe von Born-Approximation und Fourier-Techniken hergeleitet. Dieser Ansatz basiert auf einer Modifikati...
Distributed mechatronics controller for modular wall climbing robot
CSIR Research Space (South Africa)
Tlale, NS
2006-07-01
Full Text Available - climbing robot for inspection in nuclear power plants.”, Proc. IEEE Int. Conf. on Robotics and Automation, pp. 409-1414. (Chen 2001) Chen, D-. J., 2001, “Architecture for Systematic Development of Mechatronics Software Systems”, Licentiate Thesis... provide a more cost effective solution to the problem (Luk et al 1991). Such robots are termed service robots by the International Service Robot Association (ISRA) (Pransky 1996). They are defined as machines that sense, think, and act to benefit (or...
Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan
2018-01-01
Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...
Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning
2016-01-01
Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...
Directory of Open Access Journals (Sweden)
Haoyu Liu
2017-03-01
Full Text Available A second species of Qingryllus Chen & Zheng is described and illustrated, Q. jiguanshanensis sp. n., from Sichuan, China. This new species is similar to Q. striofemorus Chen & Zheng, 1995, but differs from the latter by the posterior margin of pronotum being distinctly widened, the veins of tegmina yellowish-white only on lateral side of dorsal area, and the epiphallus distinctly widened posteriorly. A distribution map of the species of this genus and habitus photographs of the new species are presented.
2012-08-06
K2-2 COMPUTATIONAL STUDY OF EXTERNAL FIXATION DEVICES SURFACE HEATING IN 1.5T AND 3T MRI SYSTEMS Yan Liu*1, Jianxiang Shen1, Ji Chen1, Wolfgang...communications have been ex- panding rapidly with the proliferation of consumer wireless devices such as smart phones, tablet PCs, handheld gaming devices, and...Computational Study of External Fixation Devices Surface Heating in 1.5T and 3T MRI Systems Yan Liu* (1) , Jianxiang Shen (1) , Ji Chen (1) , and
Is the Chinese Army the Real Winner in PLA Reforms
2016-10-01
44 Commentary / The Chinese Army and PLA Reforms JFQ 83, 4th Quarter 2016 Is the Chinese Army the Real Winner in PLA Reforms? By Phillip C. Saunders...and John Chen G round force officers run China’s military, the People’s Liberation Army ( PLA ). About 70 percent of PLA soldiers serve in the PLA ...Saunders and Chen 45 services and arms of the PLA ” has meant reductions in “technologically backward” PLAA units and personnel increases for the other
Kramer, D.A.
2007-01-01
Seawater and natural brines accounted for about 52 percent of U.S. magnesium compounds production in 2006. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties from well brines in Michigan. Caustic-calcined magnesia was recovered from sea-water by Premier Chemicals in Florida; from well brines in Michigan by Martin Marietta and Rohm and Haas; and from magnesite in Nevada by Premier Chemicals. Intrepid Potash-Wendover and Great Salt Lake Minerals recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from brucite by Applied Chemical Magnesias in Texas, from seawater by SPI Pharma in Delaware and Premier Chemicals in Florida, and by Martin Marietta and Rohm and Haas from their operations mentioned above. About 59 percent of the magnesium compounds consumed in the United States was used for refractories that are used mainly to line steelmaking furnaces. The remaining 41 percent was consumed in agricultural, chemical, construction, environmental and industrial applications.
International Nuclear Information System (INIS)
Taherkhani, Farid; Akbarzadeh, Hamed; Feyzi, Mostafa; Rafiee, Hamid Reza
2015-01-01
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models
Energy Technology Data Exchange (ETDEWEB)
Taherkhani, Farid, E-mail: faridtaherkhani@gmail.com, E-mail: f.taherkhani@razi.ac.ir [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of); Akbarzadeh, Hamed [Hakim Sabzevari University, Department of Chemistry (Iran, Islamic Republic of); Feyzi, Mostafa; Rafiee, Hamid Reza [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of)
2015-01-15
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models.
Sociology as Moral Philosophy (and Vice Versa).
Vandenberghe, Frédéric
2017-11-01
In this article, I want to make an attempt to reconnect sociology to moral philosophy and moral philosophy to sociology. The thesis I want to defend is that sociology continues by other means the venerable tradition of practical and moral philosophy. Like its forebears, it stands and falls with a defense of "practical wisdom" (Aristotle) and "practical reason" (Kant). The development of a moral sociology presupposes, however, that one recognizes and rejects Max Weber's theory of axiological neutrality as an extremist position and that one carefully articulates prescriptive and descriptive, internal and external, as well as observer and actor positions. © 2017 Canadian Sociological Association/La Société canadienne de sociologie.
Bureaucratic Corruption: Efficiency Virtue or Distributive Vice?
Kulshreshtha Pravin
2003-01-01
Governments frequently allocate resources at low prices and on a first-come-first-served basis because of reasons of equity and a concern for the poor. However, bureaucrats who distribute these resources often take bribes. This paper develops a rigorous model to analyze the distributional, efficiency and public policy implications of bribery in such situations. It is shown that at low prices, the poor would choose to wait while the rich would pay the bribe to obtain the rationed commodity. If...
Executive Assistant - Vice-President, Programs and Partnerships ...
International Development Research Centre (IDRC) Digital Library (Canada)
The Executive Assistant also performs a variety of office management related tasks, offers ... Operational and administrative activities of the VP's Office ... PPB staff at Head Quarter and reports any excess leave issues to the attention of the VP.
Analytical Method Details (MS): SE52_MS01 [Metabolonote[Archive
Lifescience Database Archive (English)
Full Text Available stem and Waters Q-Tof Premier UPLC-QTOF-MS ESI Negative The eluates (3 μl) were subsequently subjected to metabolome...DS column (LC-ESI-Q-Tof/MS, HPLC: Waters Acquity UPLC system; MS: Waters Q-Tof Premier). The metabolome...d (Matsuda et al., 2009c, 2010a). Briefly, the metabolome data were obtained in the negative ion mode (m/z 1... the complex nature of the metabolome data. To construct MS2T libraries, the extracts of five ecotypes were
Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong
2017-01-01
Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...
International Nuclear Information System (INIS)
Hu Manfeng; Xu Zhenyuan; Zhang Rong; Hu Aihua
2007-01-01
Based on the active control idea and the invariance principle of differential equations, a general scheme of adaptive full state hybrid projective synchronization (FSHPS) and parameters identification of a class of chaotic (hyper-chaotic) systems with linearly dependent uncertain parameters is proposed in this Letter. With this effective scheme parameters identification and FSHPS of chaotic and hyper-chaotic systems can be realized simultaneously. Numerical simulations on the chaotic Chen system and the hyper-chaotic Chen system are presented to verify the effectiveness of the proposed scheme
2013-10-01
Wu K, Wang L, Jiao X, Ju X, Li Z, Ertel A, Addya S, McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. Androgen therapy resistant...Li Z, Hu J, Chen K, Wu J, Pestell RG. DACH1 inhibited prostate cancer cellular proliferation and Interleukon-6 signaling. AACR 103rd Annual Meeting...March 31 – April 4, 2012, Chicago, IL. Wang J, Cai S, Chen K, Sun Y, Li S, Pestell RG, Wu K. Regulation of AR transcriptional activity and
Directory of Open Access Journals (Sweden)
Martha C. Martínez Quintanilla
2017-04-01
Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.