Li, Yingmin; Wang, Jiaxi; Clark, Melissa L.; Kubiak, Clifford P.; Xiong, Wei
2016-04-01
We report the first fourth-order 3D SFG spectroscopy of a monolayer of the catalyst Re(diCN-bpy)(CO)3Cl on a gold surface. Besides measuring the vibrational coherences of single vibrational modes, the fourth-order 3D SFG spectrum also measures the dynamics of interstate coherences and vibrational coherences states between two vibrational modes. By comparing the 3D SFG to the corresponding 2D and third-order 3D IR spectroscopy of the same molecules in solution, we found that the interstate coherences exist in both liquid and surface systems, suggesting that the interstate coherence is not disrupted by surface interactions. However, by analyzing the 3D spectral lineshape, we found that the interstate coherences also experience non-negligible homogenous dephasing dynamics that originate from surface interactions. This unique ability of determining interstate vibrational coherence dynamics of the molecular monolayer can help in understanding of how energy flows within surface catalysts and other molecular monolayers.
Wang, Hong-Fei; Gan, Wei; Lu, Rong; Rao, Yi; Wu, Bao-Hua
Sum frequency generation vibrational spectroscopy (SFG-VS) has been proven to be a uniquely effective spectroscopic technique in the investigation of molecular structure and conformations, as well as the dynamics of molecular interfaces. However, the ability to apply SFG-VS to complex molecular interfaces has been limited by the ability to abstract quantitative information from SFG-VS experiments. In this review, we try to make assessments of the limitations, issues and techniques as well as methodologies in quantitative orientational and spectral analysis with SFG-VS. Based on these assessments, we also try to summarize recent developments in methodologies on quantitative orientational and spectral analysis in SFG-VS, and their applications to detailed analysis of SFG-VS data of various vapour/neat liquid interfaces. A rigorous formulation of the polarization null angle (PNA) method is given for accurate determination of the orientational parameter D = /, and comparison between the PNA method with the commonly used polarization intensity ratio (PIR) method is discussed. The polarization and incident angle dependencies of the SFG-VS intensity are also reviewed, in the light of how experimental arrangements can be optimized to effectively abstract crucial information from the SFG-VS experiments. The values and models of the local field factors in the molecular layers are discussed. In order to examine the validity and limitations of the bond polarizability derivative model, the general expressions for molecular hyperpolarizability tensors and their expression with the bond polarizability derivative model for C3v, C2v and C∞v molecular groups are given in the two appendixes. We show that the bond polarizability derivative model can quantitatively describe many aspects of the intensities observed in the SFG-VS spectrum of the vapour/neat liquid interfaces in different polarizations. Using the polarization analysis in SFG-VS, polarization selection rules or
Barnette, Anna L; Bradley, Laura C; Veres, Brandon D; Schreiner, Edward P; Park, Yong Bum; Park, Junyeong; Park, Sunkyu; Kim, Seong H
2011-07-11
The selective detection of crystalline cellulose in biomass was demonstrated with sum-frequency-generation (SFG) vibration spectroscopy. SFG is a second-order nonlinear optical response from a system where the optical centrosymmetry is broken. In secondary plant cell walls that contain mostly cellulose, hemicellulose, and lignin with varying concentrations, only certain vibration modes in the crystalline cellulose structure can meet the noninversion symmetry requirements. Thus, SFG can be used to detect and analyze crystalline cellulose selectively in lignocellulosic biomass without extraction of noncellulosic species from biomass or deconvolution of amorphous spectra. The selective detection of crystalline cellulose in lignocellulosic biomass is not readily achievable with other techniques such as XRD, solid-state NMR, IR, and Raman analyses. Therefore, the SFG analysis presents a unique opportunity to reveal the cellulose crystalline structure in lignocellulosic biomass.
Bulard, Emilie; Guo, Ziang; Zheng, Wanquan; Dubost, Henri; Fontaine-Aupart, Marie-Pierre; Bellon-Fontaine, Marie-Noëlle; Herry, Jean-Marie; Briandet, Romain; Bourguignon, Bernard
2011-04-19
Understanding bacterial adhesion on a surface is a crucial step to design new materials with improved properties or to control biofilm formation and eradication. Sum Frequency Generation (SFG) vibrational spectroscopy has been employed to study in situ the conformational response of a self-assembled monolayer (SAM) of octadecanethiol (ODT) on a gold film to the adhesion of hydrophilic and hydrophobic ovococcoid model bacteria. The present work highlights vibrational SFG spectroscopy as a powerful and unique non-invasive biophysical technique to probe and control bacteria interaction with ordered surfaces. Indeed, the SFG vibrational spectral changes reveal different ODT SAM conformations in air and upon exposure to aqueous solution or bacterial adhesion. Furthermore, this effect depends on the bacterial cell surface properties. The SFG spectral modeling demonstrates that hydrophobic bacteria flatten the ODT SAM alkyl chain terminal part, whereas the hydrophilic ones raise this ODT SAM terminal part. Microorganism-induced alteration of grafted chains can thus affect the desired interfacial functionality, a result that should be considered for the design of new reactive materials. © 2011 American Chemical Society
Studies on the substrate mediated vibrational excitation of CO/Si(100) by means of SFG spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Han, Xu; Lass, Kristian; Balgar, Thorsten; Hasselbrink, Eckart [Universitaet Duisburg-Essen, Fachbereich Chemie, 45117 Essen (Germany)
2009-07-01
Vibrational excitations of adsorbates play an important role in chemical reaction dynamics. In the past decade CO on solid surfaces was chosen as adequate model system for studying vibrational relaxation dynamics. Our work is focused on the energy dissipation of vibrationally excited CO adsorbed on a silicon surface by means of IR/Vis sum frequency generation (SFG) spectroscopy. Here we present studies on substrate mediated excitation of vibrational modes of CO on Si(100) induced by UV radiation. We suppose the observation of highly excited internal stretch vibrations of CO caused by hot electrons generated within the silicon substrate.
Velarde, Luis; Wang, Hong-fei
2013-08-01
While in principle the frequency-domain and time-domain spectroscopic measurements should generate identical information for a given molecular system, the inhomogeneous character of surface vibrations in sum-frequency generation vibrational spectroscopy (SFG-VS) studies has only been studied with time-domain SFG-VS by mapping the decay of the vibrational polarization using ultrafast lasers, this due to the lack of SFG vibrational spectra with high enough spectral resolution and accurate enough lineshape. Here, with the recently developed high-resolution broadband SFG-VS (HR-BB-SFG-VS) technique, we show that the inhomogeneous lineshape can be obtained in the frequency-domain for the anchoring CN stretch of the 4-n-octyl-4'-cyanobiphenyl (8CB) Langmuir monolayer at the air-water interface, and that an excellent agreement with the time-domain SFG free-induction-decay can be established. We found that the 8CB CN stretch spectrum consists of a single peak centered at 2234.00 ± 0.01 cm-1 with a total linewidth of 10.9 ± 0.3 cm-1 at half maximum. The Lorentzian contribution accounts only for 4.7 ± 0.4 cm-1 to this width and the Gaussian (inhomogeneous) broadening for as much as 8.1 ± 0.2 cm-1. Polarization analysis of the -CN spectra showed that the -CN group is tilted 57° ± 2° from the surface normal. The large heterogeneity in the -CN spectrum is tentatively attributed to the -CN group interactions with the interfacial water molecules penetrated/accommodated into the 8CB monolayer, a unique phenomenon for the nCB Langmuir monolayers reported previously.
Femtosecond time-resolved vibrational SFG spectroscopy of CO/Ru( 0 0 1 )
Hess, Ch.; Wolf, M.; Roke, S.; Bonn, M.
2002-04-01
Vibrational sum-frequency generation (SFG) employing femtosecond infrared (IR) laser pulses is used to study the dynamics of the C-O stretch vibration on Ru(0 0 1). Time-resolved measurements of the free induction decay (FID) of the IR-polarization for 0.33 ML CO/Ru(0 0 1) exhibit single exponential decays over three decades corresponding to dephasing times of T2=1.94 ps at 95 K and T2=1.16 ps at 340 K. This is consistent with pure homogeneous broadening due to anharmonic coupling with the thermally activated low-frequency dephasing mode together with a contribution from saturation of the IR transition. In pump-probe SFG experiments using a strong visible (VIS) pump pulse the perturbation of the FID leads to transient line shifts even at negative delay times, i.e. when the IR-VIS SFG probe pair precedes the pump pulse. Based on an analysis of the time-dependent polarization we discuss the influence of the perturbed FID on time-resolved SFG spectra. We investigate how coherent effects affect the SFG spectra and we examine the time resolution in these experiments, in particular in dependence of the dephasing time.
Interfacial structure of soft matter probed by SFG spectroscopy.
Ye, Shen; Tong, Yujin; Ge, Aimin; Qiao, Lin; Davies, Paul B
2014-10-01
Sum frequency generation (SFG) vibrational spectroscopy, an interface-specific technique in contrast to, for example, attenuated total reflectance spectroscopy, which is only interface sensitive, has been employed to investigate the surface and interface structure of soft matter on a molecular scale. The experimental arrangement required to carry out SFG spectroscopy, with particular reference to soft matter, and the analytical methods developed to interpret the spectra are described. The elucidation of the interfacial structure of soft matter systems is an essential prerequisite in order to understand and eventually control the surface properties of these important functional materials. Copyright © 2014 The Chemical Society of Japan and Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Barnette, Anna L; Lee, Christopher; Bradley, Laura C; Schreiner, Edward P; Park, Yong Bum; Shin, Heenae; Cosgrove, Daniel J; Park, Sunkyu; Kim, Seong H
2012-07-01
The non-centrosymmetry requirement of sum frequency generation (SFG) vibration spectroscopy allows the detection and quantification of crystalline cellulose in lignocellulose biomass without spectral interferences from hemicelluloses and lignin. This paper shows a correlation between the amount of crystalline cellulose in biomass and the SFG signal intensity. Model biomass samples were prepared by mixing commercially available cellulose, xylan, and lignin to defined concentrations. The SFG signal intensity was found sensitive to a wide range of crystallinity, but varied non-linearly with the mass fraction of cellulose in the samples. This might be due to the matrix effects such as light scattering and absorption by xylan and lignin, as well as the non-linear density dependence of the SFG process itself. Comparison with other techniques such as XRD, FT-Raman, FT-IR and NMR demonstrate that SFG can be a complementary and sensitive tool to assess crystalline cellulose in biomass. Copyright © 2012 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kweskin, Sasha Joseph [Univ. of California, Berkeley, CA (United States)
2006-01-01
Sum frequency generation (SFG) surface vibrational spectroscopy was used to characterize interfaces pertinent to current surface engineering applications, such as thin film polymers and novel catalysts. An array of advanced surface science techniques like scanning probe microscopy (SPM), x-ray photoelectron spectroscopy (XPS), gas chromatography (GC) and electron microscopy were used to obtain experimental measurements complementary to SFG data elucidating polymer and catalyst surface composition, surface structure, and surface mechanical behavior. Experiments reported in this dissertation concentrate on three fundamental questions: (1) How does the interfacial molecular structure differ from that of the bulk in real world applications? (2) How do differences in chemical environment affect interface composition or conformation? (3) How do these changes correlate to properties such as mechanical or catalytic performance? The density, surface energy and bonding at a solid interface dramatically alter the polymer configuration, physics and mechanical properties such as surface glass transition, adhesion and hardness. The enhanced sensitivity of SFG at the buried interface is applied to three systems: a series of acrylates under compression, the compositions and segregation behavior of binary polymer polyolefin blends, and the changes in surface structure of a hydrogel as a function of hydration. In addition, a catalytically active thin film of polymer coated nanoparticles is investigated to evaluate the efficacy of SFG to provide in situ information for catalytic reactions involving small mass adsorption and/or product development. Through the use of SFG, in situ total internal reflection (TIR) was used to increase the sensitivity of SFG and provide the necessary specificity to investigate interfaces of thin polymer films and nanostructures previously considered unfeasible. The dynamic nature of thin film surfaces is examined and it is found that the non
Quantitative Interpretation of Polarization SFG Vibrational Spectra of Air/Methanol Interface
Wu, Hui; Zhang, Wen-kai; Gan, Wei; Cui, Zhi-feng; Wang, Hong-fei
2006-06-01
Even though in IR and Raman spectra of liquid methanol there is always an apparent feature for the asymmetric stretching mode of the CH3 group around 2970 cm-1, this feature has not been observed in the Sum Frequency Generation Vibrational Spectroscopy (SFG-VS) in any polarizations from the air/methanol interface. Here we present a treatment based on a corrected bond additivity model to quantitatively interpret the SFG-VS of the air/methanol interface from the IR and Raman spectra of liquid methanol.
Wang, Hong-Fei
2016-12-01
Sum-frequency generation vibrational spectroscopy (SFG-VS) was first developed in the 1980s and it has been proven a uniquely sensitive and surface/interface selective spectroscopic probe for characterization of the structure, conformation and dynamics of molecular surfaces and interfaces. In recent years, there have been many progresses in the development of methodology and instrumentation in the SFG-VS toolbox that have significantly broadened the application to complex molecular surfaces and interfaces. In this review, after presenting a unified view on the theory and methodology focusing on the SFG-VS spectral lineshape, as well as the new opportunities in SFG-VS applications with such developments, some of the controversial issues that have been puzzling the community are discussed. The aim of this review is to present to the researchers and students interested in molecular surfaces and interfacial sciences up-to-date perspectives complementary to the existing textbooks and reviews on SFG-VS.
Energy Technology Data Exchange (ETDEWEB)
Ni, Yicun; Skinner, J. L. [Theoretical Chemistry Institute and Department of Chemistry, University of Wisconsin, Madison, Wisconsin 53706 (United States)
2015-07-07
Vibrational spectroscopy of the water bending mode has been investigated experimentally to study the structure of water in condensed phases. In the present work, we calculate the theoretical infrared (IR) and sum-frequency generation (SFG) spectra of the HOH bend in liquid water and at the water liquid/vapor interface using a mixed quantum/classical approach. Classical molecular dynamics simulation is performed by using a recently developed water model that explicitly includes three-body interactions and yields a better description of the water surface. Ab-initio-based transition frequency, dipole, polarizability, and intermolecular coupling maps are developed for the spectral calculations. The calculated IR and SFG spectra show good agreement with the experimental measurements. In the theoretical imaginary part of the SFG susceptibility for the water liquid/vapor interface, we find two features: a negative band centered at 1615 cm{sup −1} and a positive band centered at 1670 cm{sup −1}. We analyze this spectrum in terms of the contributions from molecules in different hydrogen-bond classes to the SFG spectral density and also compare to SFG results for the OH stretch. SFG of the water bending mode provides a complementary picture of the heterogeneous hydrogen-bond configurations at the water surface.
Ni, Yicun; Skinner, J. L.
2015-07-01
Vibrational spectroscopy of the water bending mode has been investigated experimentally to study the structure of water in condensed phases. In the present work, we calculate the theoretical infrared (IR) and sum-frequency generation (SFG) spectra of the HOH bend in liquid water and at the water liquid/vapor interface using a mixed quantum/classical approach. Classical molecular dynamics simulation is performed by using a recently developed water model that explicitly includes three-body interactions and yields a better description of the water surface. Ab-initio-based transition frequency, dipole, polarizability, and intermolecular coupling maps are developed for the spectral calculations. The calculated IR and SFG spectra show good agreement with the experimental measurements. In the theoretical imaginary part of the SFG susceptibility for the water liquid/vapor interface, we find two features: a negative band centered at 1615 cm-1 and a positive band centered at 1670 cm-1. We analyze this spectrum in terms of the contributions from molecules in different hydrogen-bond classes to the SFG spectral density and also compare to SFG results for the OH stretch. SFG of the water bending mode provides a complementary picture of the heterogeneous hydrogen-bond configurations at the water surface.
Energy Technology Data Exchange (ETDEWEB)
Hoffer, Saskia [Univ. of California, Berkeley, CA (United States)
2002-01-01
Electron based surface probing techniques can provide detailed information about surface structure or chemical composition in vacuum environments. The development of new surface techniques has made possible in situ molecular level studies of solid-gas interfaces and more recently, solid-liquid interfaces. The aim of this dissertation is two-fold. First, by using novel sample preparation, Low Energy Electron Diffraction (LEED) and other traditional ultra high vacuum (UHV) techniques are shown to provide new information on the insulator/vacuum interface. The surface structure of the classic insulator NaCl has been determined using these methods. Second, using sum frequency generation (SFG) surface specific vibrational spectroscopy studies were performed on both the biopolymer/air and electrode/electrolyte interfaces. The surface structure and composition of polyetherurethane-silicone copolymers were determined in air using SFG, atomic force microscopy (AFM), and X-ray photoelectron spectroscopy (XPS). SFG studies of the electrode (platinum, gold and copper)/electrolyte interface were performed as a function of applied potential in an electrochemical cell.
Sum frequency generation for surface vibrational spectroscopy
International Nuclear Information System (INIS)
Hunt, J.H.; Guyot-Sionnest, P.; Shen, Y.R.
1987-01-01
Surface vibrational spectroscopy is one of the best means for characterizing molecular adsorbates. For this reason, many techniques have been developed in the past. However, most of them suffer from poor sensitivity, low spectral and temporal resolution, and applications limited to vacuum solid interfaces. Recently, the second harmonic generation (SHG) technique was proved repeatedly to be a simple but versatile surface probe. It is highly sensitive and surface specific; it is also capable of achieving high temporal, spatial, and spectral resolution. Being an optical technique, it can be applied to any interface accessible by light. The only serious drawback is its lack of molecular selectivity. An obvious remedy is the extension of the technique to IR-visible sum frequency generation (SFG). Surface vibrational spectroscopy with submonolayer sensitivity is then possible using SFG with the help of a tunable IR laser. The authors report here an SFG measurement of the C-H stretch vibration of monolayers of molecules at air-solid and air-liquid interfaces
Humbert, C.; Caudano, Y.; Dreesen, Laurent; Sartenaer, Y.; Mani, A. A.; Silien, C.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.
2004-01-01
Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C60/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces...
Michalak, William D.
2013-01-31
The product selectivity during 1,3-butadiene hydrogenation on monodisperse, colloidally synthesized, Pt nanoparticles was studied under reaction conditions with kinetic measurements and in situ sum frequency generation (SFG) vibrational spectroscopy. SFG was performed with the capping ligands intact in order to maintain nanoparticle size by reduced sintering. Four products are formed at 75 C: 1-butene, cis-2-butene, trans-2-butene, and n-butane. Ensembles of Pt nanoparticles with average diameters of 0.9 and 1.8 nm exhibit a ∼30% and ∼20% increase in the full hydrogenation products, respectively, as compared to Pt nanoparticles with average diameters of 4.6 and 6.7 nm. Methyl and methylene vibrational stretches of reaction intermediates observed under working conditions using SFG were used to correlate the stable reaction intermediates with the product distribution. Kinetic and SFG results correlate with previous DFT predictions for two parallel reaction pathways of 1,3-butadiene hydrogenation. Hydrogenation of 1,3-butadiene can initiate with H-addition at internal or terminal carbons leading to the formation of 1-buten-4-yl radical (metallocycle) and 2-buten-1-yl radical intermediates, respectively. Small (0.9 and 1.8 nm) nanoparticles exhibited vibrational resonances originating from both intermediates, while the large (4.6 and 6.7 nm) particles exhibited vibrational resonances originating predominately from the 2-buten-1-yl radical. This suggests each reaction pathway competes for partial and full hydrogenation and the nanoparticle size affects the kinetic preference for the two pathways. The reaction pathway through the metallocycle intermediate on the small nanoparticles is likely due to the presence of low-coordinated sites. © 2012 American Chemical Society.
Vidal, F.; Busson, B.; Tadjeddine, A.
2005-02-01
We report the study of methanol electro-oxidation on Pt(1 1 0) using infrared-visible sum-frequency generation (SFG) vibrational spectroscopy. The use of this technique enables to probe the vibrational and electronic properties of the interface simultaneously in situ. We have investigated the vibrational properties of the interface in the CO ads internal stretch spectral region (1700-2150 cm -1) over a wide range of potentials. The analysis of the evolution of the C-O stretch line shape, which is related to the interference between the vibrational and electronic parts of the non-linear response, with the potential allows us to show that the onset of bulk methanol oxidation corresponds to the transition from a negatively to a positively charged surface.
International Nuclear Information System (INIS)
Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A.A.; Silien, C.; Lemaire, J.-J.; Thiry, P.A.; Peremans, A.
2004-01-01
Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C 60 /Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively
Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A. A.; Silien, C.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.
2004-10-01
Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[ p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C 60/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively.
Coherent optical effect on time-resolved vibrational SFG spectrum of adsorbates
Ueba, H.; Sawabu, T.; Mii, T.
2002-04-01
We present a theory to study the influence of the coherent mixing between pump-infrared and probe-visible pulse on a time-resolved sum-frequency generation (TR-SFG) spectrum for vibrations at surfaces. The general formula of the time-dependent and its Fourier transform of the SFG polarization and its Fourier transform allows us to calculate the time-resolved vibrational SFG spectrum and the transient characteristics of the SFG intensity as a function of the delay time td between the pump-infrared and probe-visible pulse. It is found the coherent optical effect manifests itself in the broadening and narrowing of the SFG spectrum with the intrinsic width of T2 at negative and positive td, respectively, being in qualitative agreement with recent experimental results. The influence of the coherent mixing on the transient behavior of the SFG intensity is also discussed in conjunction to the T2 determination.
Wu, Heng-Liang; Tong, Yujin; Peng, Qiling; Li, Na; Ye, Shen
2016-01-21
The phase transition behaviors of a supported bilayer of dipalmitoylphosphatidyl-choline (DPPC) have been systematically evaluated by in situ sum frequency generation (SFG) vibrational spectroscopy and atomic force microscopy (AFM). By using an asymmetric bilayer composed of per-deuterated and per-protonated monolayers, i.e., DPPC-d75/DPPC and a symmetric bilayer of DPPC/DPPC, we were able to probe the molecular structural changes during the phase transition process of the lipid bilayer by SFG spectroscopy. It was found that the DPPC bilayer is sequentially melted from the top (adjacent to the solution) to bottom leaflet (adjacent to the substrate) over a wide temperature range. The conformational ordering of the supported bilayer does not decrease (even slightly increases) during the phase transition process. The conformational defects in the bilayer can be removed after the complete melting process. The phase transition enthalpy for the bottom leaflet was found to be approximately three times greater than that for the top leaflet, indicating a strong interaction of the lipids with the substrate. The present SFG and AFM observations revealed similar temperature dependent profiles. Based on these results, the temperature-induced structural changes in the supported lipid bilayer during its phase transition process are discussed in comparison with previous studies.
Energy Technology Data Exchange (ETDEWEB)
Humbert, C.; Caudano, Y.; Dreesen, L.; Sartenaer, Y.; Mani, A.A.; Silien, C.; Lemaire, J.-J.; Thiry, P.A.; Peremans, A
2004-10-15
Two-colour sum-frequency generation (two-colour SFG) spectroscopy was used to probe both vibrational and electronic properties of 1-dodecanethiol/Ag(1 1 1), Au(1 1 1), and Pt(1 1 1), of 5-[p-(6-mercaptohexoxy)-phenyl]-10,15,20-triphenylporphin/Pt(1 1 1), and of C{sub 60}/Ag(1 1 1). The role of the various physical parameters determining the sum-frequency generation (SFG) intensity equation is highlighted. The enhancement of the non-linear second order susceptibility in the aforementioned interfaces is explained in terms of metal interband transition, molecular electronic transition and of electron-phonon coupling, respectively.
Ge, Aimin; Matsusaki, Michiya; Qiao, Lin; Akashi, Mitsuru; Ye, Shen
2016-04-26
Sum frequency generation (SFG) vibrational spectroscopy was employed to investigate the surface structures of polyelectrolyte multilayers (PEMs) constructed by sequentially alternating adsorption of poly(diallyldimethylammonium chloride) (PDDA) and poly(styrenesulfonate) (PSS). It was found that the surface structures and surface charge density of the as-deposited PEMs of PDDA/PSS significantly depend on the concentration of sodium chloride (NaCl) present in the polyelectrolyte solutions. Furthermore, it was found that the surface structure of the as-deposited PEMs is in a metastable state and will reach the equilibrium state by diffusion of the polyelectrolyte chain after an aging process, resulting in a polyelectrolyte mixture on the PEM surfaces.
Lee, Christopher M; Chen, Xing; Weiss, Philip A; Jensen, Lasse; Kim, Seong H
2017-01-05
Vibrational sum-frequency-generation (SFG) spectroscopy is capable of selectively detecting crystalline biopolymers interspersed in amorphous polymer matrices. However, the spectral interpretation is difficult due to the lack of knowledge on how spatial arrangements of crystalline segments influence SFG spectra features. Here we report time-dependent density functional theory (TD-DFT) calculations of cellulose crystallites in intimate contact with two different polarities: parallel versus antiparallel. TD-DFT calculations reveal that the CH/OH intensity ratio is very sensitive to the polarity of the crystallite packing. Theoretical calculations of hyperpolarizability tensors (β abc ) clearly show the dependence of SFG intensities on the polarity of crystallite packing within the SFG coherence length, which provides the basis for interpretation of the empirically observed SFG features of native cellulose in biological systems.
Kett, Peter J N; Casford, Michael T L; Davies, Paul B
2010-06-15
Sum frequency generation (SFG) spectroscopy has been used to study the structure of phosphatidylethanolamine hybrid bilayer membranes (HBMs) under water at ambient temperatures. The HBMs were formed using a modified Langmuir-Schaefer technique and consisted of a layer of dipalmitoyl phosphatidylethanolamine (DPPE) physisorbed onto an octadecanethiol (ODT) self-assembled monolayer (SAM) at a series of surface pressures from 1 to 40 mN m(-1). The DPPE and ODT were selectively deuterated so that the contributions to the SFG spectra from the two layers could be determined separately. SFG spectra in both the C-H and C-D stretching regions confirmed that a monolayer of DPPE had been adsorbed to the ODT SAM and that there were gauche defects within the alkyl chains of the phospholipid. On adsorption of a layer of DPPE, methylene modes from the ODT SAM were detected, indicating that the phospholipid had partially disordered the alkanethiol monolayer. SFG spectra recorded in air indicated that removal of water from the surface of the HBM resulted in disruption of the DPPE layer and the formation of phospholipid bilayers.
International Nuclear Information System (INIS)
Opdahl, Aric; Koffas, Telly S; Amitay-Sadovsky, Ella; Kim, Joonyeong; Somorjai, Gabor A
2004-01-01
Sum frequency generation (SFG) vibrational spectroscopy and atomic force microscopy (AFM) have been used to study polymer surface structure and surface mechanical behaviour, specifically to study the relationships between the surface properties of polymers and their bulk compositions and the environment to which the polymer is exposed. The combination of SFG surface vibrational spectroscopy and AFM has been used to study surface segregation behaviour of polyolefin blends at the polymer/air and polymer/solid interfaces. SFG surface vibrational spectroscopy and AFM experiments have also been performed to characterize the properties of polymer/liquid and polymer/polymer interfaces, focusing on hydrogel materials. A method was developed to study the surface properties of hydrogel contact lens materials at various hydration conditions. Finally, the effect of mechanical stretching on the surface composition and surface mechanical behaviour of phase-separated polyurethanes, used in biomedical implant devices, has been studied by both SFG surface vibrational spectroscopy and AFM. (topical review)
Isaienko, Oleksandr; Borguet, Eric
A non-collinear KTP-OPA to provide ultra-broadband mid-infrared pulses was designed and characterized. With proper pulse-front and phase correction, the system has a potential for high-time resolution vibrational VIS-IR-SFG spectroscopy.
International Nuclear Information System (INIS)
Cheon, Sangheon; Cho, Minhaeng
2005-01-01
Vibrational optical activity spectroscopies utilizing either circularly polarized ir or circularly polarized visible beams were theoretically investigated by considering the infrared and visible sum-frequency-generation (IV-SFG) schemes. In addition to the purely electric dipole-allowed chiral component of the IV-SFG susceptibility, the polarizability-electric quadrupole hyperpolarizability term also contributes to the vibrationally resonant IV-SFG susceptibility. The circular-intensity-difference signal is shown to be determined by the interferences between the all-electric dipole-allowed chiral component and the polarizability-electric-dipole or electric-dipole-electric-quadrupole Raman optical activity tensor components. The circularly polarized SFG methods are shown to be potentially useful coherent spectroscopic tools for determining absolute configurations of chiral molecules in condensed phases
A trough for improved SFG spectroscopy of lipid monolayers
Franz, Johannes; van Zadel, Marc-Jan; Weidner, Tobias
2017-05-01
Lipid monolayers are indispensable model systems for biological membranes. The main advantage over bilayer model systems is that the surface pressure within the layer can be directly and reliably controlled. The sensitive interplay between surface pressure and temperature determines the molecular order within a model membrane and consequently determines the membrane phase behavior. The lipid phase is of crucial importance for a range of membrane functions such as protein interactions and membrane permeability. A very reliable method to probe the structure of lipid monolayers is sum frequency generation (SFG) vibrational spectroscopy. Not only is SFG extremely surface sensitive but it can also directly access critical parameters such as lipid order and orientation, and it can provide valuable information about protein interactions along with interfacial hydration. However, recent studies have shown that temperature gradients caused by high power laser beams perturb the lipid layers and potentially obscure the spectroscopic results. Here we demonstrate how the local heating problem can be effectively reduced by spatially distributing the laser pulses on the sample surface using a translating Langmuir trough for SFG experiments at lipid monolayers. The efficiency of the trough is illustrated by the detection of enhanced molecular order due to reduced heat load.
Dynamics of Dangling Od-Stretch at the Air/water Interface by Heterodyne-Detected Sfg Spectroscopy
Stiopkin, I. V.; Weeraman, C.; Shalhout, F.; Benderskii, A. V.
2009-06-01
SFG spectra of dangling OD-stretch at the air/water interface contain information on vibrational dephasing dynamics, ultrafast reorientational molecular motion, and vibrational energy transfer. To better separate these processes we conducted heterodyne-detected SFG experiments to measure real and imaginary contributions of the SFG spectrum of the dangling OD-stretch at the air/D_2O interface for SSP, PPP, and SPS polarizations. Variations in the temporal profiles of the SFG signals for these three polarizations will be also discussed.
Hieu, Hoang Chi; Li, Hongyan; Miyauchi, Yoshihiro; Mizutani, Goro; Fujita, Naoko; Nakamura, Yasunori
2015-03-01
We report a sum frequency generation (SFG) spectroscopy study of D-glucose, D-fructose and sucrose in the Csbnd H stretching vibration regime. Wetting effect on the SFG spectra was investigated. The SFG spectrum of D-glucose changed from that of α-D-glucose into those of α-D-glucose monohydrate by wetting. The SFG spectra showed evidence of a small change of β-D-fructopyranose into other anomers by wetting. SFG spectra of sucrose did not change by wetting. Assignments of the vibrational peaks in the SFG spectra of the three sugars in the dry and wet states were performed in the Csbnd H stretching vibration region near 3000 cm-1.
Casford, Michael T L; Davies, Paul B
2009-08-01
The structure of oleamide (cis-9-octadecenamide) films on aluminum has been investigated by sum frequency generation vibrational spectroscopy (SFG) and reflection absorption infrared spectroscopy (RAIRS). Three different film deposition strategies were investigated: (i) films formed by equilibrium adsorption from oleamide solutions in oil, (ii) Langmuir-Blodgett films cast at 1 and 25 mN m(-1), (iii) thick spin-cast films. Both L-B and spin-cast films were examined in air and under oil. The adsorbate formed in the 1 mN m(-1) film in air showed little orientational order. For this film, the spectroscopic results and the ellipsometric thickness point to a relatively conformationally disordered monolayer that is oriented principally in the plane of the interface. Direct adsorption to the metal interface from oil results in SFG spectra of oleamide that are comparable to those observed for the 1 mN m(-1) L-B film in air. In contrast, SFG and RAIRS results for the 25 mN m(-1) film in air and SFG spectra of the spin-cast film in air both show strong conformational ordering and orientational alignment normal to the interface. The 25 mN m(-1) film has an ellipsometric thickness almost twice that of the 1 mN m(-1) L-B film. Taken in combination with the spectroscopic results, this is indicative of a well packed monolayer in air in which the hydrocarbon chain is in an essentially defect-free extended conformation with the methyl terminus oriented away from the surface. A similar structure is also deduced for the surface of the spin-cast film in air. Upon immersion of the 25 mN m(-1) L-B film in oil the SFG spectra show that this film rapidly adopts a relatively disordered structure similar to that seen for the 1 mN m(-1) L-B film in air. Immersion of the spin-cast film in oil results in the gradual disordering of the amide film over a period of several days until the observed spectra become essentially identical to those observed for direct adsorption of oleamide from oil.
Krier, James M.
2012-08-23
Recent work with nanoparticle catalysts shows that size and shape control on the nanometer scale influences reaction rate and selectivity. Sum frequency generation (SFG) vibrational spectroscopy is a powerful tool for studying heterogeneous catalysis because it enables the observation of surface intermediates during catalytic reactions. To control the size and shape of catalytic nanoparticles, an organic ligand was used as a capping agent to stabilize nanoparticles during synthesis. However, the presence of an organic capping agent presents two major challenges in SFG and catalytic reaction studies: it blocks a significant fraction of active surface sites and produces a strong signal that prevents the detection of reaction intermediates with SFG. Two methods for cleaning Pt nanoparticles capped with poly (vinylpyrrolidone) (PVP) are examined in this study: solvent cleaning and UV cleaning. Solvent cleaning leaves more PVP intact and relies on disordering with hydrogen gas to reduce the SFG signal of PVP. In contrast, UV cleaning depends on nearly complete removal of PVP to reduce SFG signal. Both UV and solvent cleaning enable the detection of reaction intermediates by SFG. However, solvent cleaning also yields nanoparticles that are stable under reaction conditions, whereas UV cleaning results in aggregation during reaction. The results of this study indicate that solvent cleaning is more advantageous for studying the effects of nanoparticle size and shape on catalytic selectivity by SFG vibrational spectroscopy. © 2012 American Chemical Society.
Stein, M. Jeanette; Weidner, Tobias; McCrea, Keith; Castner, David G.; Ratner, Buddy D.
2010-01-01
Sum frequency generation (SFG) vibrational spectroscopy is used to study the surface and the underlying substrate of both homogeneous and mixed self-assembled monolayers (SAMs) of 11-mercaptoundecyl-1-sulphobetainethiol (HS(CH2)11N+(CH3)2(CH2)3SO3−, SB) and 1-mercapto-11-undecyl tetra(ethylene glycol) (HS(CH2)11O(CH2CH2O)4OH, EG4) with an 11-mercapto-1-undecanol (HS(CH2)11OH, MCU) diluent. SFG results on the C–H region of the dry and hydrated SAMs gave an in situ look into the molecular orientation and suggested an approach to maximize signal-to-noise ratio on these difficult to analyze hydrophilic SAMs. Vibrational fingerprint studies in the 3000–3600 cm−1 spectral range for the SAMs exposed serially to air, water, and deuterated water revealed that a layer of tightly-bound structured water was associated with the surface of a non-fouling monolayer but was not present on a hydrophobic N-undecylmercaptan (HS(CH2)10CH3, UnD) control. The percentage of water retained upon submersion in D2O correlated well with the relative amount of protein that was previously shown to absorb onto the monolayers. These results provide evidence supporting the current theory regarding the role of a tightly-bound vicinal water layer in the protein resistance of a non-fouling group. PMID:19639981
Energy Technology Data Exchange (ETDEWEB)
Holinga IV, George Joseph [Univ. of California, Berkeley, CA (United States)
2010-09-01
Sum frequency generation (SFG) vibrational spectroscopy was used to investigate the interfacial properties of several amino acids, peptides, and proteins adsorbed at the hydrophilic polystyrene solid-liquid and the hydrophobic silica solid-liquid interfaces. The influence of experimental geometry on the sensitivity and resolution of the SFG vibrational spectroscopy technique was investigated both theoretically and experimentally. SFG was implemented to investigate the adsorption and organization of eight individual amino acids at model hydrophilic and hydrophobic surfaces under physiological conditions. Biointerface studies were conducted using a combination of SFG and quartz crystal microbalance (QCM) comparing the interfacial structure and concentration of two amino acids and their corresponding homopeptides at two model liquid-solid interfaces as a function of their concentration in aqueous solutions. The influence of temperature, concentration, equilibration time, and electrical bias on the extent of adsorption and interfacial structure of biomolecules were explored at the liquid-solid interface via QCM and SFG. QCM was utilized to quantify the biological activity of heparin functionalized surfaces. A novel optical parametric amplifier was developed and utilized in SFG experiments to investigate the secondary structure of an adsorbed model peptide at the solid-liquid interface.
Site-specific Orientation of an α-helical Peptide Ovispirin-1 from Isotope Labeled SFG Spectroscopy
Ding, Bei; Laaser, Jennifer E.; Liu, Yuwei; Wang, Pengrui; Zanni, Martin T.; Chen, Zhan
2013-01-01
Sum-frequency generation (SFG) vibrational spectroscopy is often used to probe the backbone structures and orientations of polypeptides at surfaces. Using the ovispirin-1 polypeptide at the solid/liquid interface of polystyrene, we demonstrate for the first time that SFG can probe the polarization response of a single isotope labeled residue. To interpret the spectral intensities, we simulated the spectra using an excitonic Hamiltonian approach. We show that the polarization dependence of either the label or the unlabeled amide I band alone does not provide sufficient structural constraints to obtain both the tilt and the twist of the ovispirin helix at a solid/liquid interface, but that both can be determined from the polarization dependence of the complete spectrum. For ovispirin, the detailed analysis of the polarized SFG experimental data shows that the helix axis is tilted at roughly 138 degrees from the surface normal, and the transition dipole of the isotope labeled C=O group is tilted at 23 degrees from the surface normal, with the hydrophobic region facing the polystyrene surface. We further demonstrated that the Hamiltonian approach is able to address the coupling effect and the structural disorder. For comparison, we also collected the FTIR spectrum of ovispirin under similar conditions, which reveals the enhanced sensitivity of SFG for structural studies of single monolayer peptide surfaces. Our study provides insight into how structural and environmental effects appear in SFG spectra of the amide I band and establishes that SFG of isotope labeled peptides will be a powerful technique for elucidating secondary structures with residue-by-residue resolution. PMID:24228619
Site-specific orientation of an α-helical peptide ovispirin-1 from isotope-labeled SFG spectroscopy.
Ding, Bei; Laaser, Jennifer E; Liu, Yuwei; Wang, Pengrui; Zanni, Martin T; Chen, Zhan
2013-11-27
Sum-frequency generation (SFG) vibrational spectroscopy is often used to probe the backbone structures and orientations of polypeptides at surfaces. Using the ovispirin-1 polypeptide at the solid/liquid interface of polystyrene, we demonstrate for the first time that SFG can probe the polarization response of a single-isotope-labeled residue. To interpret the spectral intensities, we simulated the spectra using an excitonic Hamiltonian approach. We show that the polarization dependence of either the label or the unlabeled amide I band alone does not provide sufficient structural constraints to obtain both the tilt and the twist of the ovispirin helix at a solid/liquid interface, but that both can be determined from the polarization dependence of the complete spectrum. For ovispirin, the detailed analysis of the polarized SFG experimental data shows that the helix axis is tilted at roughly 138° from the surface normal, and the transition dipole of the isotope-labeled C═O group is tilted at 23° from the surface normal, with the hydrophobic region facing the polystyrene surface. We further demonstrate that the Hamiltonian approach is able to address the coupling effect and the structural disorder. For comparison, we also collected the FTIR spectrum of ovispirin under similar conditions, which reveals the enhanced sensitivity of SFG for structural studies of single monolayer peptide surfaces. Our study provides insight into how structural and environmental effects appear in SFG spectra of the amide I band and establishes that SFG of isotope-labeled peptides will be a powerful technique for elucidating secondary structures with residue-by-residue resolution.
Xiong, Wei; Laaser, Jennifer E; Mehlenbacher, Randy D; Zanni, Martin T
2011-12-27
In the last ten years, two-dimensional infrared spectroscopy has become an important technique for studying molecular structures and dynamics. We report the implementation of heterodyne detected two-dimensional sum-frequency generation (HD 2D SFG) spectroscopy, which is the analog of 2D infrared (2D IR) spectroscopy, but is selective to noncentrosymmetric systems such as interfaces. We implement the technique using mid-IR pulse shaping, which enables rapid scanning, phase cycling, and automatic phasing. Absorptive spectra are obtained, that have the highest frequency resolution possible, from which we extract the rephasing and nonrephasing signals that are sometimes preferred. Using this technique, we measure the vibrational mode of CO adsorbed on a polycrystalline Pt surface. The 2D spectrum reveals a significant inhomogenous contribution to the spectral line shape, which is quantified by simulations. This observation indicates that the surface conformation and environment of CO molecules is more complicated than the simple "atop" configuration assumed in previous work. Our method can be straightforwardly incorporated into many existing SFG spectrometers. The technique enables one to quantify inhomogeneity, vibrational couplings, spectral diffusion, chemical exchange, and many other properties analogous to 2D IR spectroscopy, but specifically for interfaces.
Time-domain SFG spectroscopy using mid-IR pulse shaping: practical and intrinsic advantages.
Laaser, Jennifer E; Xiong, Wei; Zanni, Martin T
2011-03-24
Sum-frequency generation (SFG) spectroscopy is a ubiquitous tool in the surface sciences. It provides infrared transition frequencies and line shapes that probe the structure and environment of molecules at interfaces. In this article, we apply techniques learned from the multidimensional spectroscopy community to SFG spectroscopy. We implement balanced heterodyne detection to remove scatter and the local oscillator background. Heterodyning also separates the resonant and nonresonant signals by acquiring both the real and imaginary parts of the spectrum. We utilize mid-IR pulse shaping to control the phase and delay of the mid-IR pump pulse. Pulse shaping allows phase cycling for data collection in the rotating frame and additional background subtraction. We also demonstrate time-domain data collection, which is a Fourier transform technique, and has many advantages in signal throughput, frequency resolution, and line shape accuracy over existing frequency domain methods. To demonstrate time-domain SFG spectroscopy, we study an aryl isocyanide on gold, and find that the system has an inhomogeneous structural distribution, in agreement with computational results, but which was not resolved by previous frequency-domain SFG studies. The ability to rapidly and actively manipulate the mid-IR pulse in an SFG pules sequence makes possible new experiments and more accurate spectra. © 2011 American Chemical Society
Probing organic field effect transistors in situ during operation using SFG.
Ye, Hongke; Abu-Akeel, Ashraf; Huang, Jia; Katz, Howard E; Gracias, David H
2006-05-24
In this communication, we report results obtained using surface-sensitive IR+Visible Sum Frequency Generation (SFG) nonlinear optical spectroscopy on interfaces of organic field effect transistors during operation. We observe remarkable correlations between trends in the surface vibrational spectra and electrical properties of the transistor, with changes in gate voltage (VG). These results suggest that field effects on electronic conduction in thin film organic semiconductor devices are correlated to interfacial nonlinear optical characteristics and point to the possibility of using SFG spectroscopy to monitor electronic properties of OFETs.
Krier, James M.; Michalak, William D.; Baker, L. Robert; An, Kwangjin; Komvopoulos, Kyriakos; Somorjai, Gabor A.
2012-01-01
Recent work with nanoparticle catalysts shows that size and shape control on the nanometer scale influences reaction rate and selectivity. Sum frequency generation (SFG) vibrational spectroscopy is a powerful tool for studying heterogeneous
Cecchet, Francesca; Lis, Dan; Guthmuller, Julien; Champagne, Benoît; Caudano, Yves; Silien, Christophe; Mani, Alaa Addin; Thiry, Paul A; Peremans, André
2010-02-22
Polarisation-dependent sum frequency generation (SFG) spectroscopy is used to investigate the orientation of molecules on metallic surfaces. In particular, self-assembled monolayers (SAMs) of dodecanethiol (DDT) and of p-nitrothiophenol (p-NTP), grown on Pt and on Au, have been chosen as models to highlight the ability of combining ppp and ssp polarisations sets (representing the polarisation of the involved beams in the conventional order of SFG, Vis and IR beam) to infer orientational information at metallic interfaces. Indeed, using only the ppp set of data, as it is usually done for metallic surfaces, is not sufficient to determine the full molecular orientation. We show here that simply combining ppp and ssp polarisations enables both the tilt and rotation angles of methyl groups in DDT SAMs to be determined. Moreover, for p-NTP, while the SFG active vibrations detected with the ppp polarisation alone provide no orientational information, however, the combination with ssp spectra enables to retrieve the tilt angle of the p-NTP 1,4 axis. Though orientational information obtained by polarisation-dependent measurements has been extensively used at insulating interfaces, we report here their first application to metallic surfaces.
International Nuclear Information System (INIS)
Manea, A.
2011-01-01
Polarisation-dependent sum frequency generation (SFG) spectroscopy is used to investigate the orientation of molecules on metallic surfaces. In particular, self-assembled monolayers (SAMs) of dodecanethiol (DDT) and of p-nitro thiophenol (p-NTP), grown on Pt and on Au, have been chosen as models to highlight the ability of combining ppp and ssp polarizations sets (representing the polarisation of the involved beams in the conventional order of SFG, Vis and IR beam) to infer orientational information at metallic interfaces. Indeed, using only the ppp set of data, as it is usually done for metallic surfaces, is not sufficient to determine the full molecular orientation. We show here that simply combining ppp and ssp polarizations enables both the tilt and rotation angles of methyl groups in DDT SAMs to be determined. Moreover, for p-NTP, while the SFG active vibrations detected with the ppp polarisation alone provide no orientational information, however, the combination with ssp spectra enables to retrieve the tilt angle of the p-NTP 1,4 axis. Though orientational information obtained by polarisation-dependent measurements has been extensively used at insulating interfaces, we report here their first application to metallic surfaces. (author)
Detection of amide I signals of interfacial proteins in situ using SFG.
Wang, Jie; Even, Mark A; Chen, Xiaoyun; Schmaier, Alvin H; Waite, J Herbert; Chen, Zhan
2003-08-20
In this Communication, we demonstrate the novel observation that it is feasible to collect amide signals from polymer/protein solution interfaces in situ using sum frequency generation (SFG) vibrational spectroscopy. Such SFG amide signals allow for acquisition of more detailed molecular level information of entire interfacial protein structures. Proteins investigated include bovine serum albumin, mussel protein mefp-2, factor XIIa, and ubiquitin. Our studies indicate that different proteins generate different SFG amide signals at the polystyrene/protein solution interface, showing that they have different interfacial coverage, secondary structure, or orientation.
International Nuclear Information System (INIS)
Bonn, M; Ueba, H; Wolf, M
2005-01-01
A generalized theory of frequency- and time-resolved vibrational sum-frequency generation (SFG) spectroscopy of adsorbates at surfaces is presented using the density matrix formalism. Our theoretical treatment is specifically aimed at addressing issues that accompany the relatively novel SFG approach using broadband infrared pulses. The ultrashort duration of these pulses makes them ideally suited for time-resolved investigations, for which we present a complete theoretical treatment. A second key characteristic of these pulses is their large bandwidth and high intensity, which allow for highly non-linear effects, including vibrational ladder climbing of surface vibrations. We derive general expressions relating the density matrix to SFG spectra, and apply these expressions to specific experimental results by solving the coupled optical Bloch equations of the density matrix elements. Thus, we can theoretically reproduce recent experimentally demonstrated hot band SFG spectra using femtosecond broadband infrared excitation of carbon monoxide (CO) on a Ru(001) surface
Vibrational sum frequency generation (SFG) spectroscopic study of crystalline cellulose in biomass
Kim, Seong H.; Lee, Christopher M.; Kafle, Kabindra; Park, Yong Bum; Xi, Xiaoning
2013-09-01
The noncentrosymmetry requirement of sum frequency generation (SFG) spectroscopy allows selective detection of crystalline cellulose in plant cell walls and lignocellulose biomass without spectral interferences from hemicelluloses and lignin. In addition, the phase synchronization requirement of the SFG process allows noninvasive investigation of spatial arrangement of crystalline cellulose microfibrils in the sample. This paper reviews how these principles are applied to reveal structural information of crystalline cellulose in plant cell walls and biomass.
Morkel, M.; Unterhalt, H.; Klüner, T.; Rupprechter, G.; Freund, H.-J.
2005-07-01
The lineshape and intensity of SFG signals of CO adsorbed on supported Pd nanoparticles and Pd(1 1 1) are analyzed. For CO/Pd(1 1 1) nearly symmetric lorentzian lineshapes were observed. Applying two different visible wavelengths for excitation, asymmetric lineshapes observed for the CO/Pd/Al 2O 3/NiAl(1 1 0) system are explained by a lower resonant and a higher non-resonant SFG signal and a change in the phase between resonant and non-resonant signals, most likely originating from an interband transition in the NiAl substrate. The relative intensity of different CO species (hollow, bridge, on-top) was modeled by DFT calculations of IR transition moments and Raman activities. While the (experimental) sensitivity of SFG towards different CO species strongly varies, the calculated IR and Raman activities are rather similar. The inability to exactly reproduce experimental SFG intensities suggests a strong coverage dependence of Raman activities or that non-linear effects occur that can currently not be properly accounted for.
Probing alpha-helical and beta-sheet structures of peptides at solid/liquid interfaces with SFG.
Chen, Xiaoyun; Wang, Jie; Sniadecki, Jason J; Even, Mark A; Chen, Zhan
2005-03-29
We demonstrated that sum frequency generation (SFG) vibrational spectroscopy can distinguish different secondary structures of proteins or peptides adsorbed at solid/liquid interfaces. The SFG spectrum for tachyplesin I at the polystyrene (PS)/solution interface has a fingerprint peak corresponding to the B1/B3 mode of the antiparallel beta-sheet. This peak disappeared upon the addition of dithiothreitol, which can disrupt the beta-sheet structure. The SFG spectrum indicative of the MSI594 alpha-helical structure was observed at the PS/MSI594 solution interface. This research validates SFG as a powerful technique for revealing detailed secondary structures of interfacial proteins and peptides.
The molecular orientation of CO on Pd(1 1 1): a polarization-dependent SFG study
Galletto, Paolo; Unterhalt, Holger; Rupprechter, Günther
2003-01-01
The molecular orientation of carbon monoxide adsorbed on Pd(1 1 1) was examined by sum frequency generation (SFG) vibrational spectroscopy utilizing different polarization combinations of the visible and SFG light. This allows to determine the CO tilt angle with respect to the substrate, provided that a proper optical model for the interface can be defined. It is demonstrated that it is essential to invoke the βaac hyperpolarizability into the analysis and that polarization-dependent SFG of CO/Pd(1 1 1) yields information on βaac/ βccc rather than the tilt angle.
International Nuclear Information System (INIS)
Wei, Feng; Xu, Yanyan; Guo, Yuan; Liu, Shi-lin; Wang, Hongfei
2009-01-01
Here we report a novel twin polarization angle (TPA) approach in the quantitative chirality detection with the surface sum-frequency generation vibrational spectroscopy (SFG-VS). Generally, the achiral contribution dominates the surface SFG-VS signal, and the pure chiral signal is usually two or three orders of magnitude smaller. Therefore, it has been difficult to make quantitative detection and analysis of the chiral contributions to the surface SFG-VS signal. In the TPA method, by varying together the polarization angles of the incoming visible light and the sum frequency signal at fixed s or p polarization of the incoming infrared beam, the polarization dependent SFG signal can give not only direct signature of the chiral contribution in the total SFG-VS signal, but also the accurate measurement of the chiral and achiral components in the surface SFG signal. The general description of the TPA method is presented and the experiment test of the TPA approach is also presented for the SFG-VS from the S- and R-limonene chiral liquid surfaces. The most accurate degree of chiral excess values thus obtained for the 2878 cm -1 spectral peak of the S- and R-limonene liquid surfaces are (23.7±0.4)% and (25.4±1.3)%, respectively.
Holinga, George J; York, Roger L; Onorato, Robert M; Thompson, Christopher M; Webb, Nic E; Yoon, Alfred P; Somorjai, Gabor A
2011-04-27
Sum frequency generation (SFG) vibrational spectroscopy was employed to characterize the interfacial structure of eight individual amino acids--L-phenylalanine, L-leucine, glycine, L-lysine, L-arginine, L-cysteine, L-alanine, and L-proline--in aqueous solution adsorbed at model hydrophilic and hydrophobic surfaces. Specifically, SFG vibrational spectra were obtained for the amino acids at the solid-liquid interface between both hydrophobic d(8)-polystyrene (d(8)-PS) and SiO(2) model surfaces and phosphate buffered saline (PBS) at pH 7.4. At the hydrophobic d(8)-PS surface, seven of the amino acids solutions investigated showed clear and identifiable C-H vibrational modes, with the exception being l-alanine. In the SFG spectra obtained at the hydrophilic SiO(2) surface, no C-H vibrational modes were observed from any of the amino acids studied. However, it was confirmed by quartz crystal microbalance that amino acids do adsorb to the SiO(2) interface, and the amino acid solutions were found to have a detectable and widely varying influence on the magnitude of SFG signal from water at the SiO(2)/PBS interface. This study provides the first known SFG spectra of several individual amino acids in aqueous solution at the solid-liquid interface and under physiological conditions.
SFG studies on interactions between antimicrobial peptides and supported lipid bilayers.
Chen, Xiaoyun; Chen, Zhan
2006-09-01
The mode of action of antimicrobial peptides (AMPs) in disrupting cell membrane bilayers is of fundamental importance in understanding the efficiency of different AMPs, which is crucial to design antibiotics with improved properties. Recent developments in the field of sum frequency generation (SFG) vibrational spectroscopy have made it a powerful and unique biophysical technique in investigating the interactions between AMPs and a single substrate supported planar lipid bilayer. We will review some of the recent progress in applying SFG to study membrane lipid bilayers and discuss how SFG can provide novel information such as real-time bilayer structure change and AMP orientation during AMP-lipid bilayer interactions in a very biologically relevant manner. Several examples of applying SFG to monitor such interactions between AMPs and a dipalmitoyl phosphatidylglycerol (DPPG) bilayer are presented. Different modes of actions are observed for melittin, tachyplesin I, d-magainin 2, MSI-843, and a synthetic antibacterial oligomer, demonstrating that SFG is very effective in the study of AMPs and AMP-lipid bilayer interactions.
Combined IR-Raman vs vibrational sum-frequency heterospectral correlation spectroscopy
Roy, Sandra; Beutier, Clémentine; Hore, Dennis K.
2018-06-01
Vibrational sum-frequency generation spectroscopy is a valuable probe of surface structure, particularly when the same molecules are present in one of the adjacent bulk solid or solution phases. As a result of the non-centrosymmetric requirement of SFG, the signal generated is a marker of the extent to which the molecules are ordered in an arrangement that breaks the up-down symmetry at the surface. In cases where the accompanying changes in the bulk are of interest in understanding and interpreting the surface structure, simultaneous analysis of the bulk IR absorption or bulk Raman scattering is helpful, and may be used in heterospectral surface-bulk two-dimensional correlation. We demonstrate that, in such cases, generating a new type of bulk spectrum that combines the IR and Raman amplitudes is a better candidate than the individual IR and Raman spectra for the purpose of correlation with the SFG signal.
Energy Technology Data Exchange (ETDEWEB)
Fu, Li; Zhang, Yun; Wei, Zhehao; Wang, Hongfei
2014-06-04
We report in this work detailed measurements on the chiral and achiral sum-frequency vibrational spectra in the C-H stretching vibration region (2800-3050cm-1) of the air/liquid interfaces of R-limonene and S-limonene, using the recently developed high-resolution broadband sum-frequency generation vibrational spectroscopy (HR-BB-SFG-VS). The achiral SFG spectra of R-limonene and S-limonene, as well as the equal amount (50/50) racemic mixture show that the enantiomers are with the same interfacial orientations. The interference chiral SFG spectra of the limonene enantiomers exhibit spectral signature from chiral response of the Cα-H stretching mode, and spectral signature from prochiral response of the CH2 asymmetric stretching mode, respectively. The chiral spectral feature of the Cα-H stretching mode changes sign from R-limonene to S-limonene, and disappears for the 50/50 racemic mixture. While the prochiral spectral feature of the CH2 asymmetric stretching mode is the same for R-limonene and S-limonene, and also surprisingly remains the same for the 50/50 racemic mixture. These results provided detail information in understanding the structure and chirality of molecular interfaces, and demonstrated the sensitivity and potential of SFG-VS as unique spectroscopic tool for chirality characterization and chiral recognition at the molecular interface.
Energy Technology Data Exchange (ETDEWEB)
York, Roger L. [Univ. of California, Berkeley, CA (United States)
2007-01-01
Sum frequency generation (SFG) vibrational spectroscopy has been used to study the interfacial structure of several polypeptides and amino acids adsorbed to hydrophobic and hydrophilic surfaces under a variety of experimental conditions. Peptide sequence, peptide chain length, peptide hydrophobicity, peptide side-chain type, surface hydrophobicity, and solution ionic strength all affect an adsorbed peptide's interfacial structure. Herein, it is demonstrated that with the choice of simple, model peptides and amino acids, surface specific SFG vibrational spectroscopy can be a powerful tool to elucidate the interfacial structure of these adsorbates. Herein, four experiments are described. In one, a series of isosequential amphiphilic peptides are synthesized and studied when adsorbed to both hydrophobic and hydrophilic surfaces. On hydrophobic surfaces of deuterated polystyrene, it was determined that the hydrophobic part of the peptide is ordered at the solid-liquid interface, while the hydrophilic part of the peptide appears to have a random orientation at this interface. On a hydrophilic surface of silica, it was determined that an ordered peptide was only observed if a peptide had stable secondary structure in solution. In another experiment, the interfacial structure of a model amphiphilic peptide was studied as a function of the ionic strength of the solution, a parameter that could change the peptide's secondary structure in solution. It was determined that on a hydrophobic surface, the peptide's interfacial structure was independent of its structure in solution. This was in contrast to the adsorbed structure on a hydrophilic surface, where the peptide's interfacial structure showed a strong dependence on its solution secondary structure. In a third experiment, the SFG spectra of lysine and proline amino acids on both hydrophobic and hydrophilic surfaces were obtained by using a different experimental geometry that increases the SFG signal
Energy Technology Data Exchange (ETDEWEB)
Baldelli, S.; Markovic, N.; Ross, P.; Shen, Y.R.; Somorjai, G.
1999-10-21
The vibrational spectroscopy sum frequency generation (SFG) is used to investigate the adsorption of carbon monoxide on the single crystal (111) and polycrystalline platinum surfaces. By varying the frequency and polarization of the light beams, different surface species of CO species are probed. SFG signal intensities for different polarization indicate that adsorbed CO polarizability is significantly perturbed from the gas-phase molecule. The SFG signal of CO disappears well below the main oxidation potential of CO to CO{sub 2}. The disappearance of the CO signal is interpreted as a transformation in the CO layer to a state which is invisible to SFG. The invisible state is suggested to be CO with the bond axis nearly parallel to the platinum surface.
Energy Technology Data Exchange (ETDEWEB)
Thompson, Christopher [Univ. of California, Berkeley, CA (United States)
2014-05-15
Compared to many branches of chemistry, the molecular level study of catalytically active surfaces is young. Only with the invention of ultrahigh vacuum technology in the past half century has it been possible to carry out experiments that yield useful molecular information about the reactive occurrences at a surface. The reason is two-fold: low pressure is necessary to keep a surface clean for an amount of time long enough to perform an experiment, and most atomic scale techniques that are surface speci c (x-ray photoelectron spectroscopy, electron energy loss spectroscopy, Auger electron spectroscopy, etc.) cannot be used at ambient pressures, because electrons, which act as chemical probes in these techniques, are easily scattered by molecules. Sum-frequency generation (SFG) vibrational spectroscopy is one technique that can provide molecular level information from the surface without the necessity for high vacuum. Since the advent of SFG as a surface spectroscopic tool it has proved its worth in the studies of surface catalyzed reactions in the gas phase, with numerous reactions in the gas phase having been investigated on a multitude of surfaces. However, in situ SFG characterization of catalysis at the solid-liquid interface has yet to be thoroughly pursued despite the broad interest in the use of heterogeneous catalysts in the liquid phase as replacements for homogeneous counterparts. This work describes an attempt to move in that direction, applying SFG to study the solid-liquid interface under conditions of catalytic alcohol oxidation on platinum.
McClelland, Arthur A; Ahn, Seokhoon; Matzger, Adam J; Chen, Zhan
2009-11-17
Sum frequency generation vibrational spectroscopy (SFG) has been applied to study two-dimensional (2D) crystals formed by an isophthalic acid diester on the surface of highly oriented pyrolytic graphite, providing complementary measurements to scanning tunneling microscopy (STM) and computational modeling. SFG results indicate that both aromatic and C=O groups in the 2D crystal tilt from the surface. This study demonstrates that a combination of SFG and STM techniques can be used to gain a more complete picture of 2D crystal structure, and it is necessary to consider solvent-2D crystal interactions and dynamics in the computer models to achieve an accurate representation of interfacial structure.
Krier, James M.; Michalak, William D.; Cai, Xiaojun; Carl, Lindsay; Komvopoulos, Kyriakos; Somorjai, Gabor A.
2015-01-01
NPs (Stöber encapsulation) prepared by colloidal synthesis. Sum frequency generation (SFG) vibrational spectroscopy was performed to correlate surface intermediates observed in situ with reaction selectivity. It is shown that calcination is effective
Bulard, Emilie; Dubost, Henri; Fontaine-Aupart, Marie-Pierre; Zheng, Wanquan; Herry, Jean-Marie; Bellon-Fontaine, Marie-No"lle; Briandet, Romain; Bourguignon, Bernard
2011-07-01
In many fields such as biomedical or food industry, surface colonization by micro-organisms leads to biofilms formation that are tridimentional biostructures highly resistant to the action of antimicrobials, by mechanisms still unclear. In order to deepen our understanding of the initial interaction of bacteria cells with a solid surface, we analyze by in situ vibrational Sum Frequency Generation (SFG) spectroscopy the effect of the adhesion of hydrophilic Lactoccocus lactis bacteria and its hydrophobic mutants in distilled water on a self-assembled monolayer (SAM) of octadecanethiol (ODT) on a gold film. When a homogeneous bacterial monolayer is deposited on this ordered surface, SFG spectrum of the ODT SAM shows significant intensity changes from that in air or in water. Its modelling as a function of conformation allows to distinguish optical effects due to the water solution surrounding bacteria from conformational changes of the ODT SAM due to the presence of the bacteria cells. Futhermore, bacterial adhesion induces different measurable effects on the ODT SAM conformation, depending on the hydrophobic / hydrophilic character of the bacterial surface. Such a result deserves to be taken into account for the design of new materials with improved properties or to control biofilm formation.
Energy Technology Data Exchange (ETDEWEB)
Westerberg, Staffan Per Gustav [Univ. of California, Berkeley, CA (United States)
2004-01-01
High-pressure catalytic reactions and associated processes, such as adsorption have been studied on a molecular level on single crystal surfaces. Sum Frequency Generation (SFG) vibrational spectroscopy together with Auger Electron Spectroscopy (AES), Temperature Programmed Desorption (TPD) and Gas Chromatography (GC) were used to investigate the nature of species on catalytic surfaces and to measure the catalytic reaction rates. Special attention has been directed at studying high-pressure reactions and in particular, ammonia synthesis in order to identify reaction intermediates and the influence of adsorbates on the surface during reaction conditions. The adsorption of gases N2, H2, O2 and NH3 that play a role in ammonia synthesis have been studied on the Fe(111) crystal surface by sum frequency generation vibrational spectroscopy using an integrated Ultra-High Vacuum (UHV)/high-pressure system. SFG spectra are presented for the dissociation intermediates, NH2 (~3325 cm-1) and NH (~3235 cm-1) under high pressure of ammonia (200 Torr) on the clean Fe(111) surface. Addition of 0.5 Torr of oxygen to 200 Torr of ammonia does not significantly change the bonding of dissociation intermediates to the surface. However, it leads to a phase change of nearly 180° between the resonant and non-resonant second order non-linear susceptibility of the surface, demonstrated by the reversal of the SFG spectral features. Heating the surface in the presence of 200 Torr ammonia and 0.5 Torr oxygen reduces the oxygen coverage, which can be seen from the SFG spectra as another relative phase change of 180°. The reduction of the oxide is also supported by Auger electron spectroscopy. The result suggests that the phase change of the spectral features could serve as a sensitive indicator of the chemical environment of the adsorbates.
Ye, Shuji; Wei, Feng; Li, Hongchun; Tian, Kangzhen; Luo, Yi
2013-01-01
In situ and real-time characterization of molecular structures and orientation of proteins at interfaces is essential to understand the nature of interfacial protein interaction. Such work will undoubtedly provide important clues to control biointerface in a desired manner. Sum frequency generation vibrational spectroscopy (SFG-VS) has been demonstrated to be a powerful technique to study the interfacial structures and interactions at the molecular level. This paper first systematically introduced the methods for the calculation of the Raman polarizability tensor, infrared transition dipole moment, and SFG molecular hyperpolarizability tensor elements of proteins/peptides with the secondary structures of α-helix, 310-helix, antiparallel β-sheet, and parallel β-sheet, as well as the methodology to determine the orientation of interfacial protein secondary structures using SFG amide I spectra. After that, recent progresses on the determination of protein structure and orientation at different interfaces by SFG-VS were then reviewed, which provides a molecular-level understanding of the structures and interactions of interfacial proteins, specially understanding the nature of driving force behind such interactions. Although this review has focused on analysis of amide I spectra, it will be expected to offer a basic idea for the spectral analysis of amide III SFG signals and other complicated molecular systems such as RNA and DNA. Copyright © 2013 Elsevier Inc. All rights reserved.
Krier, James M.
2015-01-14
© 2014 American Chemical Society. 1,3-Butadiene (1,3-BD) hydrogenation was performed on 4 nm Pt, Pd, and Rh nanoparticles (NPs) encapsulated in SiO2 shells at 20, 60, and 100 °C. The core-shells were grown around polyvinylpyrrolidone (PVP) coated NPs (Stöber encapsulation) prepared by colloidal synthesis. Sum frequency generation (SFG) vibrational spectroscopy was performed to correlate surface intermediates observed in situ with reaction selectivity. It is shown that calcination is effective in removing PVP, and the SFG signal can be generated from the metal surface. Using SFG, it is possible to compare the surface vibrational spectrum of Pt@SiO2 (1,3-BD is hydrogenated through multiple paths and produces butane, 1-butene, and cis/trans-2-butene) to Pd@SiO2 (1,3-BD favors one path and produces 1-butene and cis/trans-2-butene). In contrast to Pt@SiO2 and Pd@SiO2, SFG and kinetic experiments of Rh@SiO2 show a permanent accumulation of organic material.
International Nuclear Information System (INIS)
Phillips, D.C.
2006-01-01
Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and quartz crystal microbalance (QCM) have been used to study the molecular surface structure, surface topography and mechanical properties, and quantitative adsorbed amount of biological molecules at the solid-liquid interface. The molecular-level behavior of designed peptides adsorbed on hydrophobic polystyrene and hydrophilic silica substrates has been examined as a model of protein adsorption on polymeric biomaterial surfaces. Proteins are such large and complex molecules that it is difficult to identify the features in their structure that lead to adsorption and interaction with solid surfaces. Designed peptides which possess secondary structure provide simple model systems for understanding protein adsorption. Depending on the amino acid sequence of a peptide, different secondary structures (α-helix and β-sheet) can be induced at apolar (air/liquid or air/solid) interfaces. Having a well-defined secondary structure allows experiments to be carried out under controlled conditions, where it is possible to investigate the affects of peptide amino acid sequence and chain length, concentration, buffering effects, etc. on adsorbed peptide structure. The experiments presented in this dissertation demonstrate that SFG vibrational spectroscopy can be used to directly probe the interaction of adsorbing biomolecules with a surface or interface. The use of well designed model systems aided in isolation of the SFG signal of the adsorbing species, and showed that surface functional groups of the substrate are sensitive to surface adsorbates. The complementary techniques of AFM and QCM allowed for deconvolution of the effects of surface topography and coverage from the observed SFG spectra. Initial studies of biologically relevant surfaces are also presented: SFG spectroscopy was used to study the surface composition of common soil bacteria for use in bioremediation of nuclear waste
Energy Technology Data Exchange (ETDEWEB)
Phillips, Diana Christine [Univ. of California, Berkeley, CA (United States)
2006-01-01
Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and quartz crystal microbalance (QCM) have been used to study the molecular surface structure, surface topography and mechanical properties, and quantitative adsorbed amount of biological molecules at the solid-liquid interface. The molecular-level behavior of designed peptides adsorbed on hydrophobic polystyrene and hydrophilic silica substrates has been examined as a model of protein adsorption on polymeric biomaterial surfaces. Proteins are such large and complex molecules that it is difficult to identify the features in their structure that lead to adsorption and interaction with solid surfaces. Designed peptides which possess secondary structure provide simple model systems for understanding protein adsorption. Depending on the amino acid sequence of a peptide, different secondary structures (α-helix and β-sheet) can be induced at apolar (air/liquid or air/solid) interfaces. Having a well-defined secondary structure allows experiments to be carried out under controlled conditions, where it is possible to investigate the affects of peptide amino acid sequence and chain length, concentration, buffering effects, etc. on adsorbed peptide structure. The experiments presented in this dissertation demonstrate that SFG vibrational spectroscopy can be used to directly probe the interaction of adsorbing biomolecules with a surface or interface. The use of well designed model systems aided in isolation of the SFG signal of the adsorbing species, and showed that surface functional groups of the substrate are sensitive to surface adsorbates. The complementary techniques of AFM and QCM allowed for deconvolution of the effects of surface topography and coverage from the observed SFG spectra. Initial studies of biologically relevant surfaces are also presented: SFG spectroscopy was used to study the surface composition of common soil bacteria for use in bioremediation of nuclear waste.
Fonder, G.; Cecchet, F.; Peremans, A.; Thiry, P. A.; Delhalle, J.; Mekhalif, Z.
2009-08-01
Self-assembled monolayers (SAMs) of n-dodecanethiol (C 12H 25SH) and n-dodecaneselenol (C 12H 25SeH) on polycrystalline copper have been elaborated with the purpose of achieving densely packed and crystalline-like assemblies. By combining the surface sensitivity of polarization modulation infrared reflection absorption spectroscopy (PM-IRRAS) and sum-frequency generation spectroscopy (SFG), the effect of the self-assembly time (15 min, 30 min, 1 h, 2 h and 24 h) on the formation of n-dodecanethiol and n-dodecaneselenol monolayers on untreated and electrochemically reduced polycrystalline copper has been investigated. On electrochemically reduced copper, PM-IRRAS spectroscopy shows that both molecules are able to form well organized layers. SFG spectroscopy indicates that the C 12H 25SeH SAMs are slightly better ordered than those achieved with C 12H 25SH. On untreated copper, the two molecules lead to different film organizations. Both PM-IRRAS and SFG indicate that C 12H 25SH SAMs are of the same film quality as those obtained on electrochemically reduced copper. On the contrary, C 12H 25SeH monolayers are invariably poorly organized at the molecular level.
SFG and SPR Study of Sodium Dodecyl Sulfate Film Assembly on Positively Charged Surfaces
Song, Sanghun; Weidner, Tobias; Wagner, Matthew; Castner, David
2012-02-01
This study uses sum frequency generation (SFG) vibrational spectroscopy and surface plasmon resonance (SPR) sensing to investigate the structure of sodium dodecyl sulfate (SDS) films formed on positively charged and hydrophilic surfaces. The SPR signals show a good surface coverage suggesting that full monolayer coverage is reached at 1 mM. SFG spectra of SDS adsorbed exhibits well resolved CH3 peaks and OH peaks. At both 0.2 mM and 1 mM SDS concentration the intensity of both the CH3 and OH peaks decreased close to background levels. We found that the loss of SFG signal at 0.2 mM occurs at this concentration independent of surface charge density. It is more likely that the loss of signal is related to structural inhomogeneity induced by a striped phase - stand-up phase transition. This is supported by a distinct change of the relative SFG phase between CH3/OH near 0.2 mM. The second intensity minimum might be related to charge compensation effects. We observed a substrate dependence for the high concentration transition. We also observed distinct SFG signal phase changes for water molecules associated with SDS layers at different SDS solution concentrations indicating that the orientation of bound water changed with SDS surface structure.
Energy Technology Data Exchange (ETDEWEB)
Chase, Hilary M.; Chen, Shunli; Fu, Li; Upshur, Mary Alice; Rudshteyn, Benjamin; Thomson, Regan J.; Wang, Hong-Fei; Batista, Victor S.; Geiger, Franz M.
2017-09-01
Inferring molecular orientations from vibrational sum frequency generation (SFG) spectra is challenging in polarization combinations that result in low signal intensities, or when the local point group symmetry approximation fails. While combining experiments with density functional theory (DFT) could overcome this problem, the scope of the combined method has yet to be established. Here, we assess its feasibility of determining the distributions of molecular orientations for one monobasic ester, two epoxides and three alcohols at the vapor/fused silica interface. We find that molecular orientations of nonlocal vibrational modes cannot be determined using polarization-resolved SFG measurements alone.
Chen, Chunyan; Wang, Jie; Loch, Cheryl L; Ahn, Dongchan; Chen, Zhan
2004-02-04
In this paper, the feasibility of monitoring molecular structures at a moving polymer/liquid interface by sum frequency generation (SFG) vibrational spectroscopy has been demonstrated. N-(2-Aminoethyl)-3-aminopropyltrimethoxysilane (AATM, NH2(CH2)2NH(CH2)3Si(OCH3)3) has been brought into contact with a deuterated poly(methyl methacrylate) (d-PMMA) film, and the interfacial silane structure has been monitored using SFG. Upon initial contact, the SFG spectra can be detected, but as time progresses, the spectral intensity changes and finally disappears. Additional experiments indicate that these silane molecules can diffuse into the polymer film and the detected SFG signals are actually from the moving polymer/silane interface. Our results show that the molecular order of the polymer/silane interface exists during the entire diffusion process and is lost when the silane molecules traverse through the thickness of the d-PMMA film. The loss of the SFG signal is due to the formation of a new disordered substrate/silane interface, which contributes no detectable SFG signal. The kinetics of the diffusion of the silane into the polymer have been deduced from the time-dependent SFG signals detected from the AATM molecules as they diffuse through polymer films of different thickness.
Casford, Michael T L; Davies, Paul B
2012-07-24
The structure of thin films of 1- and 2-butylimidazoles adsorbed on copper and steel surfaces under air was examined using sum frequency generation (SFG) vibrational spectroscopy in the ppp and ssp polarizations. Additionally, the SFG spectra of both isomers were recorded at 55 °C at the liquid imidazole/air interface for reference. Complementary bulk infrared, reflection-absorption infrared spectroscopy (RAIRS), and Raman spectra of both imidazoles were recorded for assignment purposes. The SFG spectra in the C-H stretching region at the liquid/air interface are dominated by resonances from the methyl end group of the butyl side chain of the imidazoles, indicating that they are aligned parallel or closely parallel to the surface normal. These are also the most prominent features in the SFG spectra on copper and steel. In addition, both the ppp and ssp spectra on copper show resonances from the C-H stretching modes of the imidazole ring for both isomers. The ring C-H resonances are completely absent from the spectra on steel and at the liquid/air interface. The relative intensities of the SFG spectra can be interpreted as showing that, on copper, under air, both butylimidazoles are adsorbed with their butyl side chains perpendicular to the interface and with the ring significantly inclined away from the surface plane and toward the surface normal. The SFG spectra of both imidazoles on steel indicate an orientation where the imidazole rings are parallel or nearly parallel to the surface. The weak C-H resonances from the ring at the liquid/air interface suggest that the tilt angle of the ring from the surface normal at this interface is significantly greater than it is on copper.
SFG experiment and ab initio study of the chemisorption of CN - on low-index platinum surfaces
Tadjeddine, M.; Flament, J.-P.; Le Rille, A.; Tadjeddine, A.
2006-05-01
A dual analysis is proposed in order to have a better understanding of the adsorption of the cyanide ions on a platinum electrode. The SFG (Sum Frequency Generation) spectroscopy allows the in situ vibrational study and the SFG spectra of the CN - species adsorbed on single crystal Pt electrode allow a systematic study of the low-index platinum surfaces. This experimental work is supported by ab initio calculations using density functional theory and cluster models. For each surface orientation and each geometry, a cluster model of 20-30 Pt atoms has been built in order to interpret the chemisorption of the CN - ions through four kinds of adsorption geometry: on-top or bridge site, bonding via C or N atoms. Geometries have been optimized and adsorption energies, electronic properties and vibrational frequencies have been computed. From the electronic properties, we can propose an analysis of the bonding mechanism for each studied kind of adsorption. The SFG spectra of the CN -/Pt(1 1 1) system present an unique resonance owing to the top C adsorption. It is mainly the same for the CN -/Pt(1 0 0) system. It is also the case for the SFG spectra of the CN -/Pt(1 1 0) system recorded at negative electrochemical voltage; at more positive voltage, a second resonance appears at a lower frequency, owing to the top N adsorption. Experimental and theoretical values of the C-N stretching frequencies are in excellent agreement.
Fu, Li; Zhang, Yun; Wei, Zhe-Hao; Wang, Hong-Fei
2014-09-01
We report in this work detailed measurements of the chiral and achiral sum-frequency vibrational spectra in the C-H stretching vibration region (2800-3050 cm(-1)) of the air/liquid interfaces of R-(+)-limonene and S-(-)-limonene, using the recently developed high-resolution broadband sum-frequency generation vibrational spectroscopy (HR-BB-SFG-VS). The achiral SFG spectra of R-limonene and S-limonene, as well as the RS racemic mixture (50/50 equal amount mixture), show that the corresponding molecular groups of the R and S enantiomers are with the same interfacial orientations. The interference chiral SFG spectra of the limonene enantiomers exhibit a spectral signature from the chiral response of the Cα-H stretching mode, and a spectral signature from the prochiral response of the CH(2) asymmetric stretching mode, respectively. The chiral spectral feature of the Cα-H stretching mode changes sign from R-(+)-limonene to S-(-)-limonene surfaces, and disappears for the RS racemic mixture surface. While the prochiral spectral feature of the CH(2) asymmetric stretching mode is the same for R-(+)-limonene and S-(-)-limonene surfaces, and also surprisingly remains the same for the RS racemic mixture surface. Therefore, the structures of the R-(+)-limonene and the S-(-)-limonene at the liquid interfaces are nevertheless not mirror images to each other, even though the corresponding groups have the same tilt angle from the interfacial normal, i.e., the R-(+)-limonene and the S-(-)-limonene at the surface are diastereomeric instead of enantiomeric. These results provide detailed information in understanding the structure and chirality of molecular interfaces and demonstrate the sensitivity and potential of SFG-VS as a unique spectroscopic tool for chirality characterization and chiral recognition at the molecular interface. © 2014 Wiley Periodicals, Inc.
Ghosh, Ayanjeet; Ho, Jia-Jung; Serrano, Arnaldo L; Skoff, David R; Zhang, Tianqi; Zanni, Martin T
2015-01-01
By adding a mid-infrared pulse shaper to a sum-frequency generation (SFG) spectrometer, we have built a 2D SFG spectrometer capable of measuring spectra analogous to 2D IR spectra but with monolayer sensitivity and SFG selection rules. In this paper, we describe the experimental apparatus and provide an introduction to 2D SFG spectroscopy to help the reader interpret 2D SFG spectra. The main aim of this manuscript is to report 2D SFG spectra of the amyloid forming peptide FGAIL. FGAIL is a critical segment of the human islet amyloid polypeptide (hIAPP or amylin) that aggregates in people with type 2 diabetes. FGAIL is catalyzed into amyloid fibers by many types of surfaces. Here, we study the structure of FGAIL upon deposition onto a gold surface covered with a self-assembled monolayer of methyl-4-mercaptobenzoate (MMB) that produces an ester coating. FGAIL deposited on bare gold does not form ordered layers. The measured 2D SFG spectrum is consistent with amyloid fiber formation, exhibiting both the parallel (a+) and perpendicular (a-) symmetry modes associated with amyloid β-sheets. Cross peaks are observed between the ester stretches of the coating and the FGAIL peptides. Simulations are presented for two possible structures of FGAIL amyloid β-sheets that illustrate the sensitivity of the 2D SFG spectra to structure and orientation. These results provide some of the first molecular insights into surface catalyzed amyloid fiber structure.
Multimodal Broadband Vibrational Sum Frequency Generation (MM-BB-V-SFG) Spectrometer and Microscope.
Lee, Christopher M; Kafle, Kabindra; Huang, Shixin; Kim, Seong H
2016-01-14
A broadband sum frequency generation (BB-SFG) spectrometer with multimodal (MM) capabilities was constructed, which could be routinely reconfigured for tabletop experiments in reflection, transmission, and total internal reflection (TIR) geometries, as well as microscopic imaging. The system was constructed using a Ti:sapphire amplifier (800 nm, pulse width = 85 fs, repetition rate = 2 kHz), an optical parameter amplification (OPA) system for production of broadband IR pulses tunable between 1000 and 4000 cm(-1), and two Fabry-Pérot etalons arranged in series for production of narrowband 800 nm pulses. The key feature allowing the MM operation was the nearly collinear alignment of the visible (fixed, 800 nm) and infrared (tunable, 1000-4000 cm(-1)) pulses which were spatially separated. Physical insights discussed in this paper include the comparison of spectral bandwidth produced with 40 and 85 fs pump beams, the improvement of spectral resolution using etalons, the SFG probe volume in bulk analysis, the normalization of SFG signals, the stitching of multiple spectral segments, and the operation in different modes for air/liquid and adsorbate/solid interfaces, bulk samples, as well as spectral imaging combined with principle component analysis (PCA). The SFG spectral features obtained with the MM-BB-SFG system were compared with those obtained with picosecond-scanning-SFG system and high-resolution BB-SFG system (HR-BB-SFG) for dimethyl sulfoxide, α-pinene, and various samples containing cellulose (purified commercial products, Cladophora cell wall, cotton and flax fibers, and onion epidermis cell wall).
Energy Technology Data Exchange (ETDEWEB)
Kliewer, C.J.; Somorjai, G.A.
2008-11-26
Sum-frequency generation vibrational spectroscopy (SFG-VS) and kinetic measurements using gas chromatography have been used to study the surface reaction intermediates during the hydrogenation of three {alpha},{beta}-unsaturated aldehydes, acrolein, crotonaldehyde, and prenal, over Pt(111) at Torr pressures (1 Torr aldehyde, 100 Torr hydrogen) in the temperature range of 295K to 415K. SFG-VS data showed that acrolein has mixed adsorption species of {eta}{sub 2}-di-{sigma}(CC)-trans, {eta}{sub 2}-di-{sigma}(CC)-cis as well as highly coordinated {eta}{sub 3} or {eta}{sub 4} species. Crotonaldehyde adsorbed to Pt(111) as {eta}{sub 2} surface intermediates. SFG-VS during prenal hydrogenation also suggested the presence of the {eta}{sub 2} adsorption species, and became more highly coordinated as the temperature was raised to 415K, in agreement with its enhanced C=O hydrogenation. The effect of catalyst surface structure was clarified by carrying out the hydrogenation of crotonaldehyde over both Pt(111) and Pt(100) single crystals while acquiring the SFG-VS spectra in situ. Both the kinetics and SFG-VS showed little structure sensitivity. Pt(100) generated more decarbonylation 'cracking' product while Pt(111) had a higher selectivity for the formation of the desired unsaturated alcohol, crotylalcohol.
Roiaz, Matteo; Pramhaas, Verena; Li, Xia; Rameshan, Christoph; Rupprechter, Günther
2018-04-01
A new custom-designed ultrahigh vacuum (UHV) chamber coupled to a UHV and atmospheric-pressure-compatible spectroscopic and catalytic reaction cell is described, which allows us to perform IR-vis sum frequency generation (SFG) vibrational spectroscopy during catalytic (kinetic) measurements. SFG spectroscopy is an exceptional tool to study vibrational properties of surface adsorbates under operando conditions, close to those of technical catalysis. This versatile setup allows performing surface science, SFG spectroscopy, catalysis, and electrochemical investigations on model systems, including single crystals, thin films, and deposited metal nanoparticles, under well-controlled conditions of gas composition, pressure, temperature, and potential. The UHV chamber enables us to prepare the model catalysts and to analyze their surface structure and composition by low energy electron diffraction and Auger electron spectroscopy, respectively. Thereafter, a sample transfer mechanism moves samples under UHV to the spectroscopic cell, avoiding air exposure. In the catalytic cell, SFG spectroscopy and catalytic tests (reactant/product analysis by mass spectrometry or gas chromatography) are performed simultaneously. A dedicated sample manipulation stage allows the model catalysts to be examined from LN2 temperature to 1273 K, with gaseous reactants in a pressure range from UHV to atmospheric. For post-reaction analysis, the SFG cell is rapidly evacuated and samples are transferred back to the UHV chamber. The capabilities of this new setup are demonstrated by benchmark results of CO adsorption on Pt and Pd(111) single crystal surfaces and of CO adsorption and oxidation on a ZrO2 supported Pt nanoparticle model catalyst grown by atomic layer deposition.
Zanni, Martin
2012-02-01
Sum-frequency generation spectroscopy provides an infrared spectrum of interfaces and thus has widespread use in the materials and chemical sciences. In this presentation, I will present our recent work in developing a 2D pulse sequence to generate 2D SFG spectra of interfaces, in analogy to 2D infrared spectra used to measure bulk species. To develop this spectroscopy, we have utilized many of the tricks-of-the-trade developed in the 2D IR and 2D Vis communities in the last decade, including mid-IR pulse shaping. With mid-IR pulse shaping, the 2D pulse sequence is manipulated by computer programming in the desired frequency resolution, rotating frame, and signal pathway. We believe that 2D SFG will become an important tool in the interfacial sciences in an analogous way that 2D IR is now being used in many disciplines.
McClelland, Arthur; Ahn, Seokhoon; Matzger, Adam J.; Chen, Zhan
2009-03-01
Supplemented by computed models, Scanning Tunneling Microscopy (STM) can provide detailed structure of 2D crystals formed at the liquid/solid interface with atomic resolution. However, some structural information such as functional group orientations in such 2D crystals needs to be tested experimentally to ensure the accuracy of the deduced structures. Due to the limited sensitivity, many other experimental techniques such as Raman and infrared spectroscopy have not been allowed to provide such structural information of 2D crystals. Here we showed that Sum Frequency Generation Vibrational Spectroscopy (SFG) can measure average orientation of functional groups in such 2D crystals, or physisorbed monolayers, providing key experimental data to aid in the modeling and interpretation of the STM images. The usefulness of combining these two techniques is demonstrated with a phthalate diesters monolayer formed at the 1-phenyloctane/ highly oriented pyrolytic graphite (HOPG) interface. The spatial orientation of the ester C=O of the monolayer was successfully determined using SFG.
Boulesbaa, Abdelaziz; Borguet, Eric
2014-02-06
The dephasing dynamics of a vibrational coherence may reveal the interactions of chemical functional groups with their environment. To investigate this process at a surface, we employ free induction decay sum frequency generation (FID-SFG) to measure the time that it takes for free OH stretch oscillators at the charged (pH ≈ 13, KOH) interface of alumina/water (Al2O3/H2O) to lose their collective coherence. By employing noncollinear optical parametric amplification (NOPA) technology and nonlinear vibrational spectroscopy, we showed that the single free OH peak actually corresponds to two distinct oscillators oriented opposite to each other and measured the total dephasing time, T2, of the free OH stretch modes at the Al2O3/H2O interface with a sub-40 fs temporal resolution. Our results suggested that the free OH oscillators associated with interfacial water dephase on the time scale of 89.4 ± 6.9 fs, whereas the homogeneous dephasing of interfacial alumina hydroxyls is an order of magnitude slower.
Umesh P. Agarwal; Rajai Atalla
2010-01-01
Vibrational spectroscopy is an important tool in modern chemistry. In the past two decades, thanks to significant improvements in instrumentation and the development of new interpretive tools, it has become increasingly important for studies of lignin. This chapter presents the three important instrumental methods-Raman spectroscopy, infrared (IR) spectroscopy, and...
International Nuclear Information System (INIS)
Bozzini, Benedetto; Busson, Bertrand; De Gaudenzi, Gian Pietro; D'Urzo, Lucia; Mele, Claudio; Tadjeddine, Abderrahmane
2007-01-01
In order to increase the knowledge of the corrosion mechanism, in situ spectroelectrochemical methodologies were employed in the investigation of the electrochemical interface of WC-Co hardmetals. Together with standard cyclic voltammetries (CV), ElectroReflectance Spectroscopy (ERS) and Sum Frequency Generation (SFG) spectroscopy measurements were performed both on a Co-base alloy, simulating the metallic binder of hardmetal composites, and on a model WC-Co system. A cyanide solution, encountered in the gold extraction industry, was employed as electrolyte. Electrochemical cells and experimental apparatuses were designed to allow in situ experiments. CV measurements showed corrosion attack to run at potentials more anodic than -500 mV vs. Ag/AgCl, both for the alloy and the composite. The high reactivity of the alloy in cyanide environment was witnessed by the time-dependence of the surface vibrational (SFG) and electronic (SFG and ERS) properties under cathodic polarisation. Furthermore, SFG measurements highlighted two different adsorbation sites for cyanide ion, probably α- and ε-Co. The WC-Co system showed a pseudo-passivation peak, typical of the corrosion behaviour of this material, due to precipitation of corrosion products. ERS data at 532 nm showed an ennobling of the potential at which the reflectivity increase was recorded
Coherent Raman Imaging of Live Muscle Sarcomeres Assisted by SFG Microscopy.
Kim, Hyunmin; Kim, Do-Young; Joo, Kyung-Il; Kim, Jung-Hye; Jeong, Soon Moon; Lee, Eun Seong; Hahm, Jeong-Hoon; Kim, Kyuhyung; Moon, Dae Woon
2017-08-23
In this study, we used spectrally focused coherent anti-Stokes Raman scattering (spCARS) microscopy assisted by sum-frequency generation (SFG) to monitor the variations in the structural morphology and molecular vibrations of a live muscle of Caenorhabditis elegans. The subunits of the muscle sarcomeres, such as the M-line, myosin, dense body, and α-actinin, were alternatively observed using spCARS microscopy for different sample orientations, with the guidance of a myosin positional marker captured by SFG microscopy. Interestingly enough, the beam polarization dependence of the spCARS contrasts for two parallel subunits (dense body and myosin) showed a ~90° phase difference. The chemically sensitive spCARS spectra induced by the time-varying overlap of two pulses allowed (after a robust subtraction of the non-resonant background using a modified Kramers-Krönig transformation method) high-fidelity detection of various genetically modified muscle sarcomeres tuned to the C-H vibration (2800-3100 cm -1 ). Conversely, SFG image mapping assisted by phase-retrieved spCARS spectra also facilitated label-free monitoring of the changes in the muscle content of C. elegans that are associated with aging, based on the hypothesis that the C-H vibrational modes could serve as qualitative chemical markers sensitive to the amount and/or structural modulation of the muscle.
Pan, Xuecong; Yang, Fangyuan; Chen, Shunli; Zhu, Xuefeng; Wang, Chuanyi
2018-05-08
Cooperative effects of a series of equimolar binary zwitterionic-ionic surfactant mixtures on the interfacial water structure at the air-water interfaces have been studied by sum frequency generation vibrational spectroscopy (SFG-VS). For zwitterionic surfactant palmityl sulfobetaine (SNC 16 ), anionic surfactant sodium hexadecyl sulfate (SHS), and cationic surfactant cetyltrimethylammonium bromide (CTAB) with the same length of alkyl chain, significantly enhanced ordering of interfacial water molecules was observed for the zwitterionic-anionic surfactant mixtures SNC 16 -SHS, indicating that SNC 16 interacts more strongly with SHS than with CTAB because of the strong headgroup-headgroup electrostatic attraction for SNC 16 -SHS. Meanwhile, the SFG amplitude ratio of methyl and methylene symmetric stretching modes was used to verify the stronger interaction between SNC 16 and SHS. The conformational order indicator increased from 0.64 for SNC 16 to 7.17 for SNC 16 -SHS but only 0.94 for SNC 16 -CTAB. In addition, another anionic surfactant sodium dodecyl sulfate (SDS) was introduced to study the influence of chain-chain interaction. Decreased SFG amplitude of interfacial water molecules for SNC 16 -SDS was observed. Therefore, both the headgroup-headgroup electrostatic interaction and chain-chain van der Waals attractive interaction of the surfactants play an important role in enhancing the ordering of interfacial water molecules. The results provided experimental and theoretical bases for practical applications of the surfactants.
Ho, Jia-Jung; Ghosh, Ayanjeet; Zhang, Tianqi O; Zanni, Martin T
2018-02-08
Two-dimensional sum-frequency generation spectroscopy (2D SFG) is used to study the structures of the pentapeptide FGAIL on hydrogen bond promoting surfaces. FGAIL is the most amyloidogenic portion of the human islet amyloid polypeptide (hIAPP or amylin). In the presence of a pure gold surface, FGAIL does not form ordered structures. When the gold is coated with a self-assembled monolayer of mercaptobenzoic acid (MBA), 2D SFG spectra reveal features associated with β-sheets. Also observed are cross peaks between the FGAIL peptides and the carboxylic acid groups of the MBA monolayer, indicating that the peptides are in close contact with the surface headgroups. In the second set of samples, FGAIL peptides chemically ligated to the MBA monolayer also exhibited β-sheet features but with a much simpler spectrum. From simulations of the experiments, we conclude that the hydrogen bond promoting surface catalyzes the formation of both parallel and antiparallel β-sheet structures with several different orientations. When ligated, parallel sheets with only a single orientation are the primary structure. Thus, this hydrogen bond promoting surface creates a heterogeneous distribution of polymorph structures, consistent with a concentration effect that allows nucleation of many different amyloid seeding structures. A single well-defined seed favors one polymorph over the others, showing that the concentrating influence of a membrane can be counterbalanced by factors that favor directed fiber growth. These experiments lay the foundation for the measurement and interpretation of β-sheet structures with heterodyne-detected 2D SFG spectroscopy. The results of this model system suggest that a heterogeneous distribution of polymorphs found in nature are an indication of nonselective amyloid aggregation whereas a narrow distribution of polymorph structures is consistent with a specific protein or lipid interaction that directs fiber growth.
Energy Technology Data Exchange (ETDEWEB)
Bozzini, Benedetto [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy)]. E-mail: benedetto.bozzini@unile.it; Busson, Bertrand [CLIO-LCP, Batiment 201P2, Universitaire Paris Sud 11, 91420 Orsay Cedex (France); De Gaudenzi, Gian Pietro [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); D' Urzo, Lucia [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Mele, Claudio [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Tadjeddine, Abderrahmane [UDIL-CNRS, Batiment 201P1, BP34, 91898 Orsay, Cedex (France)
2007-05-15
In order to increase the knowledge of the corrosion mechanism, in situ spectroelectrochemical methodologies were employed in the investigation of the electrochemical interface of WC-Co hardmetals. Together with standard cyclic voltammetries (CV), ElectroReflectance Spectroscopy (ERS) and Sum Frequency Generation (SFG) spectroscopy measurements were performed both on a Co-base alloy, simulating the metallic binder of hardmetal composites, and on a model WC-Co system. A cyanide solution, encountered in the gold extraction industry, was employed as electrolyte. Electrochemical cells and experimental apparatuses were designed to allow in situ experiments. CV measurements showed corrosion attack to run at potentials more anodic than -500 mV vs. Ag/AgCl, both for the alloy and the composite. The high reactivity of the alloy in cyanide environment was witnessed by the time-dependence of the surface vibrational (SFG) and electronic (SFG and ERS) properties under cathodic polarisation. Furthermore, SFG measurements highlighted two different adsorbation sites for cyanide ion, probably {alpha}- and {epsilon}-Co. The WC-Co system showed a pseudo-passivation peak, typical of the corrosion behaviour of this material, due to precipitation of corrosion products. ERS data at 532 nm showed an ennobling of the potential at which the reflectivity increase was recorded.
Two-dimensional vibrational-electronic spectroscopy
Courtney, Trevor L.; Fox, Zachary W.; Slenkamp, Karla M.; Khalil, Munira
2015-10-01
Two-dimensional vibrational-electronic (2D VE) spectroscopy is a femtosecond Fourier transform (FT) third-order nonlinear technique that creates a link between existing 2D FT spectroscopies in the vibrational and electronic regions of the spectrum. 2D VE spectroscopy enables a direct measurement of infrared (IR) and electronic dipole moment cross terms by utilizing mid-IR pump and optical probe fields that are resonant with vibrational and electronic transitions, respectively, in a sample of interest. We detail this newly developed 2D VE spectroscopy experiment and outline the information contained in a 2D VE spectrum. We then use this technique and its single-pump counterpart (1D VE) to probe the vibrational-electronic couplings between high frequency cyanide stretching vibrations (νCN) and either a ligand-to-metal charge transfer transition ([FeIII(CN)6]3- dissolved in formamide) or a metal-to-metal charge transfer (MMCT) transition ([(CN)5FeIICNRuIII(NH3)5]- dissolved in formamide). The 2D VE spectra of both molecules reveal peaks resulting from coupled high- and low-frequency vibrational modes to the charge transfer transition. The time-evolving amplitudes and positions of the peaks in the 2D VE spectra report on coherent and incoherent vibrational energy transfer dynamics among the coupled vibrational modes and the charge transfer transition. The selectivity of 2D VE spectroscopy to vibronic processes is evidenced from the selective coupling of specific νCN modes to the MMCT transition in the mixed valence complex. The lineshapes in 2D VE spectra report on the correlation of the frequency fluctuations between the coupled vibrational and electronic frequencies in the mixed valence complex which has a time scale of 1 ps. The details and results of this study confirm the versatility of 2D VE spectroscopy and its applicability to probe how vibrations modulate charge and energy transfer in a wide range of complex molecular, material, and biological systems.
Two-dimensional vibrational-electronic spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Courtney, Trevor L.; Fox, Zachary W.; Slenkamp, Karla M.; Khalil, Munira, E-mail: mkhalil@uw.edu [Department of Chemistry, University of Washington, Box 351700, Seattle, Washington 98195 (United States)
2015-10-21
Two-dimensional vibrational-electronic (2D VE) spectroscopy is a femtosecond Fourier transform (FT) third-order nonlinear technique that creates a link between existing 2D FT spectroscopies in the vibrational and electronic regions of the spectrum. 2D VE spectroscopy enables a direct measurement of infrared (IR) and electronic dipole moment cross terms by utilizing mid-IR pump and optical probe fields that are resonant with vibrational and electronic transitions, respectively, in a sample of interest. We detail this newly developed 2D VE spectroscopy experiment and outline the information contained in a 2D VE spectrum. We then use this technique and its single-pump counterpart (1D VE) to probe the vibrational-electronic couplings between high frequency cyanide stretching vibrations (ν{sub CN}) and either a ligand-to-metal charge transfer transition ([Fe{sup III}(CN){sub 6}]{sup 3−} dissolved in formamide) or a metal-to-metal charge transfer (MMCT) transition ([(CN){sub 5}Fe{sup II}CNRu{sup III}(NH{sub 3}){sub 5}]{sup −} dissolved in formamide). The 2D VE spectra of both molecules reveal peaks resulting from coupled high- and low-frequency vibrational modes to the charge transfer transition. The time-evolving amplitudes and positions of the peaks in the 2D VE spectra report on coherent and incoherent vibrational energy transfer dynamics among the coupled vibrational modes and the charge transfer transition. The selectivity of 2D VE spectroscopy to vibronic processes is evidenced from the selective coupling of specific ν{sub CN} modes to the MMCT transition in the mixed valence complex. The lineshapes in 2D VE spectra report on the correlation of the frequency fluctuations between the coupled vibrational and electronic frequencies in the mixed valence complex which has a time scale of 1 ps. The details and results of this study confirm the versatility of 2D VE spectroscopy and its applicability to probe how vibrations modulate charge and energy transfer in a
Weidner, Tobias; Breen, Nicholas F.; Drobny, Gary P.; Castner, David G.
2009-01-01
Sum frequency generation (SFG) vibrational spectroscopy has been employed in biomaterials research and protein adsorption studies with growing success in recent years. A number of studies focusing on understanding SFG spectra of proteins and peptides at different interfaces have laid the foundation for future, more complex studies. In many cases a strong NH mode near 3300 cm−1 is observed in the SFG spectra, but the relationship of this mode to the peptide structure is uncertain since it has been assigned to either a backbone amide mode or a side chain related amine resonance. A thorough understanding of the SFG spectra of these first model systems is an important first step for future experiments. To clarify the origin of the NH SFG mode we studied 15N isotopically labeled 14-amino acid amphiphilic model peptides composed of lysine (K) and leucine (L) in an α-helical secondary structure (LKα14) that were adsorbed onto charged surfaces in situ at the solid-liquid interface. 15N substitution at the terminal amine group of the lysine side chains resulted in a red-shift of the NH mode of 9 cm−1 on SiO2 and 13 cm−1 on CaF2. This clearly shows the 3300 cm−1 NH feature is associated with side chain NH stretches and not with backbone amide modes. PMID:19873996
Weidner, Tobias; Breen, Nicholas F; Drobny, Gary P; Castner, David G
2009-11-26
Sum frequency generation (SFG) vibrational spectroscopy has been employed in biomaterials research and protein adsorption studies with growing success in recent years. A number of studies focusing on understanding SFG spectra of proteins and peptides at different interfaces have laid the foundation for future, more complex studies. In many cases, a strong NH mode near 3300 cm(-1) is observed in the SFG spectra, but the relationship of this mode to the peptide structure is uncertain, since it has been assigned to either a backbone amide mode or a side chain related amine resonance. A thorough understanding of the SFG spectra of these first model systems is an important first step for future experiments. To clarify the origin of the NH SFG mode, we studied (15)N isotopically labeled 14-amino acid amphiphilic model peptides composed of lysine (K) and leucine (L) in an alpha-helical secondary structure (LKalpha14) that were adsorbed onto charged surfaces in situ at the solid-liquid interface. (15)N substitution at the terminal amine group of the lysine side chains resulted in a red-shift of the NH mode of 9 cm(-1) on SiO(2) and 13 cm(-1) on CaF(2). This clearly shows the 3300 cm(-1) NH feature is associated with side chain NH stretches and not with backbone amide modes.
Zhang, Xiaoxian; Myers, John N.; Huang, Huai; Shobha, Hosadurga; Chen, Zhan; Grill, Alfred
2016-02-01
PECVD deposited porous SiCOH with ultralow dielectric constant has been successfully integrated as the insulator in advanced interconnects to decrease the RC delay. The effects of NH3 plasma treatment and the effectiveness of the dielectric repair on molecular structures at the surface and buried interface of a pSiCOH film deposited on top of a SiCNH film on a Si wafer were fully characterized using sum frequency generation vibrational spectroscopy (SFG), supplemented by X-ray photoelectron spectroscopy. After exposure to NH3 plasma for 18 s, about 40% of the methyl groups were removed from the pSiCOH surface, and the average orientation of surface methyl groups tilted more towards the surface. The repair method used here effectively repaired the molecular structures at the pSiCOH surface but did not totally recover the entire plasma-damaged layer. Additionally, simulated SFG spectra with various average orientations of methyl groups at the SiCNH/pSiCOH buried interface were compared with the experimental SFG spectra collected using three different laser input angles to determine the molecular structural information at the SiCNH/pSiCOH buried interface after NH3 plasma treatment and repair. The molecular structures including the coverage and the average orientation of methyl groups at the buried interface were found to be unchanged by NH3 plasma treatment and repair.
Surface vibrational spectroscopy
International Nuclear Information System (INIS)
Erskine, J.L.
1984-01-01
A brief review of recent studies which combine measurements of surface vibrational energies with lattice dynamical calculations is presented. These results suggest that surface vibrational spectroscopy offers interesting prospects for use as a molecular-level probe of surface geometry, adsorbate bond distances and molecular orientations
Chemical imaging of structured SAMs with a novel SFG microscope
Hoffmann, Dominik M. P.; Kuhnke, Klaus; Kern, Klaus
2002-11-01
We present a newly developed microscope for sum frequency generation (SFG) imaging of opaque and reflecting interfaces. The sample is viewed at an angle of 60° with respect to the surface normal in order to increase the collected SFG intensity. Our setup is designed to keep the whole field of view (FOV) in focus and to compensate for the distortion usually related to oblique imaging by means of a blazed grating. The separation of the SFG intensity and the reflected visible beam is accomplished by a suitable combination of spectral filters. The sum frequency microscope (SFM) is capable of in-situ chemically selective imaging by tuning the IR-beam to vibrational transitions of the respective molecules. The SFM is applied to imaging of structured self-assembled monolayers (SAM) of thiol molecules on a gold surface.
SFG characterization of a cationic ONLO dye in biological thin films
Johnson, Lewis E.; Casford, Michael T.; Elder, Delwin L.; Davies, Paul B.; Johal, Malkiat S.
2013-10-01
Biopolymer-based thin films, such as those composed of CTMA-DNA, can be used as a host material for NLOactive dyes for applications such as electro-optic (EO) switching and second harmonic generation. Previous work by Heckman et al. (Proc. SPIE 6401, 640108-2) has demonstrated functioning DNA-based EO modulators. Improved performance requires optimization of both the first hyperpolarizabilities (β) and degree of acentric ordering exhibited by the chromophores. The cationic dye DANPY-1 (Proc. SPIE 8464, 846409-D) has a high affinity for DNA and a substantial hyperpolarizability; however, its macroscopic ordering has not been previously characterized. We have characterized the acentric ordering of the dye using sum-frequency generation (SFG) vibrational spectroscopy in surface-immobilized DNA and on planar metal and dielectric surfaces.
Morkel, Matthias; Rupprechter, Günther; Freund, Hans-Joachim
2003-11-01
Sum frequency generation (SFG) vibrational spectroscopy was carried out in conjunction with thermal desorption spectroscopy, low-energy electron diffraction, and Auger electron spectroscopy to examine the coadsorption of CO and H2 on Pd(111). Sequential dosing as well as various CO/H2 mixtures was utilized to study intermolecular interactions between CO and H2. Preadsorbed CO effectively prevented the dissociative adsorption of hydrogen for CO coverages ⩾0.33 ML. While preadsorbed hydrogen was able to hinder CO adsorption at low temperature (100 K), hydrogen was replaced from the surface by CO at 150 K. When 1:1 mixtures of CO/H2 were used at 100 K, hydrogen selectively hindered CO adsorption on on-top sites, while above ˜125 K no blocking of CO adsorption was observed. The observations are explained in terms of mutual site blocking, of a CO-H phase separation, and of a CO-assisted hydrogen dissolution in the Pd bulk. The temperature-dependent site blocking effect of hydrogen is attributed to the ability (inability) of surface hydrogen to diffuse into the Pd bulk above (below) ˜125 K. Nonlinear optical SFG spectroscopy allowed us to study these effects not only in ultrahigh vacuum but also in a high-pressure environment. Using an SFG-compatible ultrahigh vacuum-high-pressure cell, spectra of 1:10 CO/H2 mixtures were acquired up to 55 mbar and 550 K, with simultaneous gas chromatographic and mass spectrometric gas phase analysis. Under reaction conditions, CO coverages ⩾0.5 ML were observed which strongly limit H2 adsorption and thus may be partly responsible for the low CO hydrogenation rate. The high-pressure and high-temperature SFG spectra also showed indications of a reversible surface roughening or a highly dynamic (not perfectly ordered) CO adsorbate phase. Implications of the observed adsorbate structures on catalytic CO hydrogenation on supported Pd nanoparticles are discussed.
International Nuclear Information System (INIS)
Morkel, Matthias; Rupprechter, Guenther; Freund, Hans-Joachim
2003-01-01
Sum frequency generation (SFG) vibrational spectroscopy was carried out in conjunction with thermal desorption spectroscopy, low-energy electron diffraction, and Auger electron spectroscopy to examine the coadsorption of CO and H 2 on Pd(111). Sequential dosing as well as various CO/H 2 mixtures was utilized to study intermolecular interactions between CO and H 2 . Preadsorbed CO effectively prevented the dissociative adsorption of hydrogen for CO coverages ≥0.33 ML. While preadsorbed hydrogen was able to hinder CO adsorption at low temperature (100 K), hydrogen was replaced from the surface by CO at 150 K. When 1:1 mixtures of CO/H 2 were used at 100 K, hydrogen selectively hindered CO adsorption on on-top sites, while above ∼125 K no blocking of CO adsorption was observed. The observations are explained in terms of mutual site blocking, of a CO-H phase separation, and of a CO-assisted hydrogen dissolution in the Pd bulk. The temperature-dependent site blocking effect of hydrogen is attributed to the ability (inability) of surface hydrogen to diffuse into the Pd bulk above (below) ∼125 K. Nonlinear optical SFG spectroscopy allowed us to study these effects not only in ultrahigh vacuum but also in a high-pressure environment. Using an SFG-compatible ultrahigh vacuum-high-pressure cell, spectra of 1:10 CO/H 2 mixtures were acquired up to 55 mbar and 550 K, with simultaneous gas chromatographic and mass spectrometric gas phase analysis. Under reaction conditions, CO coverages ≥0.5 ML were observed which strongly limit H 2 adsorption and thus may be partly responsible for the low CO hydrogenation rate. The high-pressure and high-temperature SFG spectra also showed indications of a reversible surface roughening or a highly dynamic (not perfectly ordered) CO adsorbate phase. Implications of the observed adsorbate structures on catalytic CO hydrogenation on supported Pd nanoparticles are discussed
SFG investigation of adsorbed CO and NO on NiO(111) surface
Energy Technology Data Exchange (ETDEWEB)
Bandara, Athula; Dobashi, Shinsaku; Kubota, Jun; Onda, Ken; Wada, Akihide; Domen, Kazunari; Hirose, Chiaki [Tokyo Inst. of Tech., Yokohama (Japan). Research Lab. of Resources Utilization; Kano, S.S.
1997-07-01
Adsorption structures of CO and NO on the NiO(111) film grown on Ni(111) crystal have been investigated by sum frequency generation (SFG) spectroscopy and infrared reflection absorption spectroscopy (IRAS). The CO stretching band of adsorbed CO on NiO(111) was observed at 2144 cm{sup -1} on the SFG spectra for both p- and s-polarized visible light. However, adsorbed NO on NiO(111) was observed at 1805 cm{sup -1} on the SFG spectra only for the p-polarized visible light. The results suggest that the adsorbed CO molecule was tilted from the surface normal but the NO molecule was perpendicular to the surface. These orientations of CO and NO reflect the surface structure of NiO(111) which has (2 x 2)-reconstructed microfacets. Adsorption of CO on Ni(111) instead of NiO(111) was also examined by SFG and IRAS. Absorption bands due to linear and bridged CO were observed at 2076 and 1918 cm{sup -1}, respectively, by IRAS. On the other hand, the linear CO molecules on Ni(111) gave an SFG peak at 2076 cm{sup -1} only for the p-polarized visible light indicating the CO molecules are perpendicular to the surface, and bridged CO molecules did not give any SFG signal. The absence of the bridged CO signal is believed to be due to the smaller Raman tensor of bridged CO. (author)
SFG investigation of adsorbed CO and NO on NiO(111) surface
International Nuclear Information System (INIS)
Bandara, Athula; Dobashi, Shinsaku; Kubota, Jun; Onda, Ken; Wada, Akihide; Domen, Kazunari; Hirose, Chiaki; Kano, S.S.
1997-01-01
Adsorption structures of CO and NO on the NiO(111) film grown on Ni(111) crystal have been investigated by sum frequency generation (SFG) spectroscopy and infrared reflection absorption spectroscopy (IRAS). The CO stretching band of adsorbed CO on NiO(111) was observed at 2144 cm -1 on the SFG spectra for both p- and s-polarized visible light. However, adsorbed NO on NiO(111) was observed at 1805 cm -1 on the SFG spectra only for the p-polarized visible light. The results suggest that the adsorbed CO molecule was tilted from the surface normal but the NO molecule was perpendicular to the surface. These orientations of CO and NO reflect the surface structure of NiO(111) which has (2 x 2)-reconstructed microfacets. Adsorption of CO on Ni(111) instead of NiO(111) was also examined by SFG and IRAS. Absorption bands due to linear and bridged CO were observed at 2076 and 1918 cm -1 , respectively, by IRAS. On the other hand, the linear CO molecules on Ni(111) gave an SFG peak at 2076 cm -1 only for the p-polarized visible light indicating the CO molecules are perpendicular to the surface, and bridged CO molecules did not give any SFG signal. The absence of the bridged CO signal is believed to be due to the smaller Raman tensor of bridged CO. (author)
Benderskii, Alexander; Bordenyuk, Andrey; Weeraman, Champika
2006-03-01
The recently developed spectrally- and time-resolved Sum Frequency Generation (STiR-SFG) is a surface-selective 3-wave mixing (IR+visible) spectroscopic technique capable of measuring ultrafast spectral evolution of vibrational coherences. A detailed description of this measurement will be presented, and a noniterative method or deconvolving the laser pulses will be introduced to obtain the molecular response function. STiR-SFG, combined with the frequency-domain SFG spectroscopy, was applied to study hydrogen bonding dynamics at aqueous interfaces (D2O/CaF2). Spectral dynamics of the OD-stretch on the 50-150 fs time scale provides real-time observation of ultrafast H-bond rearrangement. Tuning the IR wavelength to the blue or red side of the OD-stretch transition, we selectively monitor the dynamics of different sub-ensembles in the distribution of the H-bond structures. The blue-side excitation (weaker H-bonding) shows monotonic red-shift of the OD-frequency. In contrast, the red-side excitation (stronger H-bonding structures) produces a blue-shift and a recursion, which may indicate the presence of an underdamped intermolecular mode of interfacial water. Effect of electrolyte concentration on the H-bond dynamics will be discussed.
Rupprechter, G.; Kaichev, V. V.; Unterhalt, H.; Morkel, M.; Bukhtiyarov, V. I.
2004-07-01
The CO dissociation probability on transition metals is often invoked to explain the product distribution (selectivity) of catalytic CO hydrogenation. Along these lines, we have investigated CO adsorption and dissociation on smooth and ion-bombarded Pd(1 1 1) at pressures up to 1 mbar using vibrational sum frequency generation (SFG) and X-ray photoelectron spectroscopy (XPS). Under high pressure, CO adsorbate structures were observed that were identical to high-coverage structures in UHV. On ion-bombarded surfaces an additional species was detected which was attributed to CO bridge bonded to defect (low-coordinated) sites. On both surfaces, no indications of CO dissociation were found even after hours of 0.1 mbar CO exposure. However, exposing CO/H 2 mixtures to ion-bombarded Pd(1 1 1) produced carbonaceous deposits suggesting CH xO species as precursors for CO bond cleavage and that the formation of CH xO is facilitated by surface defects. The relevance of the observations for CO hydrogenation on Pd catalysts is discussed.
Energy Technology Data Exchange (ETDEWEB)
Rupprechter, G.; Kaichev, V.V.; Unterhalt, H.; Morkel, M.; Bukhtiyarov, V.I
2004-07-31
The CO dissociation probability on transition metals is often invoked to explain the product distribution (selectivity) of catalytic CO hydrogenation. Along these lines, we have investigated CO adsorption and dissociation on smooth and ion-bombarded Pd(1 1 1) at pressures up to 1 mbar using vibrational sum frequency generation (SFG) and X-ray photoelectron spectroscopy (XPS). Under high pressure, CO adsorbate structures were observed that were identical to high-coverage structures in UHV. On ion-bombarded surfaces an additional species was detected which was attributed to CO bridge bonded to defect (low-coordinated) sites. On both surfaces, no indications of CO dissociation were found even after hours of 0.1 mbar CO exposure. However, exposing CO/H{sub 2} mixtures to ion-bombarded Pd(1 1 1) produced carbonaceous deposits suggesting CH{sub x}O species as precursors for C---O bond cleavage and that the formation of CH{sub x}O is facilitated by surface defects. The relevance of the observations for CO hydrogenation on Pd catalysts is discussed.
Vibrational Spectroscopy of Ionic Liquids.
Paschoal, Vitor H; Faria, Luiz F O; Ribeiro, Mauro C C
2017-05-24
Vibrational spectroscopy has continued use as a powerful tool to characterize ionic liquids since the literature on room temperature molten salts experienced the rapid increase in number of publications in the 1990's. In the past years, infrared (IR) and Raman spectroscopies have provided insights on ionic interactions and the resulting liquid structure in ionic liquids. A large body of information is now available concerning vibrational spectra of ionic liquids made of many different combinations of anions and cations, but reviews on this literature are scarce. This review is an attempt at filling this gap. Some basic care needed while recording IR or Raman spectra of ionic liquids is explained. We have reviewed the conceptual basis of theoretical frameworks which have been used to interpret vibrational spectra of ionic liquids, helping the reader to distinguish the scope of application of different methods of calculation. Vibrational frequencies observed in IR and Raman spectra of ionic liquids based on different anions and cations are discussed and eventual disagreements between different sources are critically reviewed. The aim is that the reader can use this information while assigning vibrational spectra of an ionic liquid containing another particular combination of anions and cations. Different applications of IR and Raman spectroscopies are given for both pure ionic liquids and solutions. Further issues addressed in this review are the intermolecular vibrations that are more directly probed by the low-frequency range of IR and Raman spectra and the applications of vibrational spectroscopy in studying phase transitions of ionic liquids.
Vibrational spectroscopy in the electron microscope.
Krivanek, Ondrej L; Lovejoy, Tracy C; Dellby, Niklas; Aoki, Toshihiro; Carpenter, R W; Rez, Peter; Soignard, Emmanuel; Zhu, Jiangtao; Batson, Philip E; Lagos, Maureen J; Egerton, Ray F; Crozier, Peter A
2014-10-09
Vibrational spectroscopies using infrared radiation, Raman scattering, neutrons, low-energy electrons and inelastic electron tunnelling are powerful techniques that can analyse bonding arrangements, identify chemical compounds and probe many other important properties of materials. The spatial resolution of these spectroscopies is typically one micrometre or more, although it can reach a few tens of nanometres or even a few ångströms when enhanced by the presence of a sharp metallic tip. If vibrational spectroscopy could be combined with the spatial resolution and flexibility of the transmission electron microscope, it would open up the study of vibrational modes in many different types of nanostructures. Unfortunately, the energy resolution of electron energy loss spectroscopy performed in the electron microscope has until now been too poor to allow such a combination. Recent developments that have improved the attainable energy resolution of electron energy loss spectroscopy in a scanning transmission electron microscope to around ten millielectronvolts now allow vibrational spectroscopy to be carried out in the electron microscope. Here we describe the innovations responsible for the progress, and present examples of applications in inorganic and organic materials, including the detection of hydrogen. We also demonstrate that the vibrational signal has both high- and low-spatial-resolution components, that the first component can be used to map vibrational features at nanometre-level resolution, and that the second component can be used for analysis carried out with the beam positioned just outside the sample--that is, for 'aloof' spectroscopy that largely avoids radiation damage.
Non-linear optical studies of adsorbates: Spectroscopy and dynamics
Energy Technology Data Exchange (ETDEWEB)
Zhu, Xiangdong.
1989-08-01
In the first part of this thesis, we have established a systematic procedure to apply the surface optical second-harmonic generation (SHG) technique to study surface dynamics of adsorbates. In particular, we have developed a novel technique for studies of molecular surface diffusions. In this technique, the laser-induced desorption with two interfering laser beams is used to produce a monolayer grating of adsorbates. The monolayer grating is detected with diffractions of optical SHG. By monitoring the first-order second-harmonic diffraction, we can follow the time evolution of the grating modulation from which we are able to deduce the diffusion constant of the adsorbates on the surface. We have successfully applied this technique to investigate the surface diffusion of CO on Ni(111). The unique advantages of this novel technique will enable us to readily study anisotropy of a surface diffusion with variable grating orientation, and to investigate diffusion processes of a large dynamic range with variable grating spacings. In the second part of this work, we demonstrate that optical infrared-visible sum-frequency generation (SFG) from surfaces can be used as a viable surface vibrational spectroscopic technique. We have successfully recorded the first vibrational spectrum of a monolayer of adsorbates using optical infrared-visible SFG. The qualitative and quantitative correlation of optical SFG with infrared absorption and Raman scattering spectroscopies are examined and experimentally demonstrated. We have further investigated the possibility to use transient infrared-visible SFG to probe vibrational transients and ultrafast relaxations on surfaces. 146 refs.
Non-linear optical studies of adsorbates: Spectroscopy and dynamics
International Nuclear Information System (INIS)
Zhu, Xiangdong.
1989-08-01
In the first part of this thesis, we have established a systematic procedure to apply the surface optical second-harmonic generation (SHG) technique to study surface dynamics of adsorbates. In particular, we have developed a novel technique for studies of molecular surface diffusions. In this technique, the laser-induced desorption with two interfering laser beams is used to produce a monolayer grating of adsorbates. The monolayer grating is detected with diffractions of optical SHG. By monitoring the first-order second-harmonic diffraction, we can follow the time evolution of the grating modulation from which we are able to deduce the diffusion constant of the adsorbates on the surface. We have successfully applied this technique to investigate the surface diffusion of CO on Ni(111). The unique advantages of this novel technique will enable us to readily study anisotropy of a surface diffusion with variable grating orientation, and to investigate diffusion processes of a large dynamic range with variable grating spacings. In the second part of this work, we demonstrate that optical infrared-visible sum-frequency generation (SFG) from surfaces can be used as a viable surface vibrational spectroscopic technique. We have successfully recorded the first vibrational spectrum of a monolayer of adsorbates using optical infrared-visible SFG. The qualitative and quantitative correlation of optical SFG with infrared absorption and Raman scattering spectroscopies are examined and experimentally demonstrated. We have further investigated the possibility to use transient infrared-visible SFG to probe vibrational transients and ultrafast relaxations on surfaces. 146 refs
Vibrational Spectroscopy and Astrobiology
Chaban, Galina M.; Kwak, D. (Technical Monitor)
2001-01-01
Role of vibrational spectroscopy in solving problems related to astrobiology will be discussed. Vibrational (infrared) spectroscopy is a very sensitive tool for identifying molecules. Theoretical approach used in this work is based on direct computation of anharmonic vibrational frequencies and intensities from electronic structure codes. One of the applications of this computational technique is possible identification of biological building blocks (amino acids, small peptides, DNA bases) in the interstellar medium (ISM). Identifying small biological molecules in the ISM is very important from the point of view of origin of life. Hybrid (quantum mechanics/molecular mechanics) theoretical techniques will be discussed that may allow to obtain accurate vibrational spectra of biomolecular building blocks and to create a database of spectroscopic signatures that can assist observations of these molecules in space. Another application of the direct computational spectroscopy technique is to help to design and analyze experimental observations of ice surfaces of one of the Jupiter's moons, Europa, that possibly contains hydrated salts. The presence of hydrated salts on the surface can be an indication of a subsurface ocean and the possible existence of life forms inhabiting such an ocean.
International Nuclear Information System (INIS)
Humbert, C.; Busson, B.; Abid, J.-P.; Six, C.; Girault, H.H.; Tadjeddine, A.
2005-01-01
We use sum-frequency generation spectroscopy (SFG) in the infrared 2800-3000 cm -1 spectral range and UV-vis spectroscopy (transmission) in the 450-650 nm spectral range in order to characterize vibrational and electronic properties of various interfaces composed of organic monolayers adsorbed on gold nanoparticles (AuNPs) with 19 nm average diameter. SFG signal is observed for AuNPs films deposited on glass substrates using the following silane intermediates: 3-(aminopropyl) triethoxysilane and 3-(mercaptopropyl) trimethoxysilane. The density of AuNPs and their aggregates are measured with a scanning electron microscope. For the samples showing a strong well-defined surface plasmon resonance (SPR), we also observe an enhancement of their non-linear optical properties. Furthermore, the SFG measurements show that 1-dodecanethiol films are rather well ordered on specific AuNPs substrates. In this way, the presence of the SFG signal, which comes from both the bulk electronic s-d interband transition and the vibrational states of the adsorbed molecules, depends on a SPR process. This phenomenon is evidenced on the AuNPs by the incident visible beam located at 532 nm, i.e. near the SPR energy maximum of these interfaces. These results open the door to experiments involving macromolecular and biological materials networks deposited on ultrathin metal electrodes in a controlled electrochemical environment
Energy Technology Data Exchange (ETDEWEB)
Humbert, C. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France) and Laboratoire de Spectroscopie Moleculaire de Surface, University of Namur, 61 Rue de Bruxelles, B-5000 Namur (Belgium)]. E-mail: christophe.humbert@fundp.ac.be; Busson, B. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France); Abid, J.-P. [Ecole Polytechnique Federale de Lausanne, Laboratoire d' Electrochimie Physique et Analytique, CH-1015 Lausanne (Switzerland); Six, C. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France); Girault, H.H. [Ecole Polytechnique Federale de Lausanne, Laboratoire d' Electrochimie Physique et Analytique, CH-1015 Lausanne (Switzerland); Tadjeddine, A. [LURE, CNRS-UMR 130, Centre Universitaire Paris-Sud, Ba-hat t. 209D, B.P. 34, 91898 Orsay Cedex (France)
2005-05-20
We use sum-frequency generation spectroscopy (SFG) in the infrared 2800-3000 cm{sup -1} spectral range and UV-vis spectroscopy (transmission) in the 450-650 nm spectral range in order to characterize vibrational and electronic properties of various interfaces composed of organic monolayers adsorbed on gold nanoparticles (AuNPs) with 19 nm average diameter. SFG signal is observed for AuNPs films deposited on glass substrates using the following silane intermediates: 3-(aminopropyl) triethoxysilane and 3-(mercaptopropyl) trimethoxysilane. The density of AuNPs and their aggregates are measured with a scanning electron microscope. For the samples showing a strong well-defined surface plasmon resonance (SPR), we also observe an enhancement of their non-linear optical properties. Furthermore, the SFG measurements show that 1-dodecanethiol films are rather well ordered on specific AuNPs substrates. In this way, the presence of the SFG signal, which comes from both the bulk electronic s-d interband transition and the vibrational states of the adsorbed molecules, depends on a SPR process. This phenomenon is evidenced on the AuNPs by the incident visible beam located at 532 nm, i.e. near the SPR energy maximum of these interfaces. These results open the door to experiments involving macromolecular and biological materials networks deposited on ultrathin metal electrodes in a controlled electrochemical environment.
Energy Technology Data Exchange (ETDEWEB)
Philip J. Reid
2009-09-21
The conference focuses on using vibrational spectroscopy to probe structure and dynamics of molecules in gases, liquids, and interfaces. The goal is to bring together a collection of researchers who share common interests and who will gain from discussing work at the forefront of several connected areas. The intent is to emphasize the insights and understanding that studies of vibrations provide about a variety of systems.
Myers, John N.; Zhang, Xiaoxian; Huang, Huai; Shobha, Hosadurga; Grill, Alfred; Chen, Zhan
2017-05-01
Molecular structures at the surface and buried interface of an amorphous ultralow-k pSiCOH dielectric film were quantitatively characterized before and after reactive ion etching (RIE) and subsequent dielectric repair using sum frequency generation (SFG) vibrational spectroscopy and Auger electron spectroscopy. SFG results indicated that RIE treatment of the pSiCOH film resulted in a depletion of ˜66% of the surface methyl groups and changed the orientation of surface methyl groups from ˜47° to ˜40°. After a dielectric recovery process that followed the RIE treatment, the surface molecular structure was dominated by methyl groups with an orientation of ˜55° and the methyl surface coverage at the repaired surface was 271% relative to the pristine surface. Auger depth profiling indicated that the RIE treatment altered the top ˜25 nm of the film and that the dielectric recovery treatment repaired the top ˜9 nm of the film. Both SFG and Auger profiling results indicated that the buried SiCNH/pSiCOH interface was not affected by the RIE or the dielectric recovery process. Beyond characterizing low-k materials, the developed methodology is general and can be used to distinguish and characterize different molecular structures and elemental compositions at the surface, in the bulk, and at the buried interface of many different polymer or organic thin films.
Nonlinear vibrational spectroscopy of surfactants at liquid interfaces
Energy Technology Data Exchange (ETDEWEB)
Miranda, Paulo B. [Univ. of California, Berkeley, CA (United States)
1998-12-14
Surfactants are widely used to modify physical and chemical properties of interfaces. They play an important role in many technological problems. Surfactant monolayer are also of great scientific interest because they are two-dimensional systems that may exhibit a very rich phase transition behavior and can also be considered as a model system for biological interfaces. In this Thesis, we use a second-order nonlinear optical technique (Sum-Frequency Generation - SFG) to obtain vibrational spectra of surfactant monolayer at Iiquidhapor and solid/liquid interfaces. The technique has several advantages: it is intrinsically surface-specific, can be applied to buried interfaces, has submonolayer sensitivity and is remarkably sensitive to the confirmational order of surfactant monolayers.
International Nuclear Information System (INIS)
Wang, Hongfei
2012-01-01
Developments in quantitative measurement and analysis in nonlinear surface spectroscopy, namely, second harmonic generation linear dichroism (SHG-LD) and sum frequency generation vibrational spectroscopy linear dichroism (SFG-VS-LD), provide new opportunities for probing the surface chirality of monolayers and thin films. In this book chapter, the up-to-date theoretical background and experimental methodology, as well as examples and future perspectives on the developments with surface nonlinear spectroscopy in surface chirality studies are to be summarized and outlined for general readers.
SFG study of platinum electrodes in perchloric acid solutions
Zheng, W. Q.; Pluchery, O.; Tadjeddine, A.
2002-04-01
Infrared-visible sum-frequency generation (SFG) spectroscopy has been used to study the structure of water molecules (and/or its derivatives OH -, H 3O + etc.) at aqueous electrolyte/electrode interfaces. For Pt(1 1 0) and Pt(1 0 0) electrodes in 0.1 M perchloric acid solution, we did not observe any significant O-H stretching resonance. In striking contrast to the resonant SFG signal, the nonresonant SFG (NRSFG) signal varies sensitively with the applied electrochemical potential, indicating that the interaction of water molecules with platinum electrodes is relatively weak as compared to that of H + and ClO 4- ions. From changes in the NRSFG signal and on the basis of an ionic adsorption model, we can also deduce that the potential of zero charge of Pt(1 1 0) in 0.1 M HClO 4 should be located at about 0.22 V (vs. NHE). This value is in good agreement with that measured recently by electrochemical method.
Kim, Seong Han; Opdahl, Aric; Marmo, Chris; Somorjai, Gabor A
2002-04-01
The surfaces of two types of soft contact lenses neutral and ionic hydrogels--were characterized by atomic force microscopy (AFM) and sum-frequency-generation (SFG) vibrational spectroscopy. AFM measurements in saline solution showed that the presence of ionic functional groups at the surface lowered the friction and adhesion to a hydrophobic polystyrene tip. This was attributed to the specific interactions of water and the molecular orientation of hydrogel chains at the surface. Friction and adhesion behavior also revealed the presence of domains of non-crosslinked polymer chains at the lens surface. SFG showed that the lens surface became partially dehydrated upon exposure to air. On this partially dehydrated lens surface, the non-crosslinked domains exhibited low friction and adhesion in AFM. Fully hydrated in saline solution, the non-crosslinked domains extended more than tens of nanometers into solution and were mobile.
International Nuclear Information System (INIS)
Dreesen, L.; Sartenaer, Y.; Peremans, A.; Thiry, P.A.; Humbert, C.; Grugier, J.; Marchand-Brynaert, J.
2006-01-01
We use infrared-visible sum-frequency generation (SFG) spectroscopy in order to investigate the adsorption properties on Pt(111) of molecules having CH 3 -C 6 H 4 -(O-CH 2 -CH 2 ) n -O-(CH 2 ) m -SH as general chemical formula. We synthesized three molecules defined by the values m = 5 n = 4, m = 11 n = 4, m = 11 n = 8 and characterized them by Nuclear Magnetic Resonance spectroscopy. Thanks to spectroscopic measurements, we show that these molecules build self-assembled monolayers on Pt(111). First, the weak SFG signals arising from the ad-layer indicate low order and surface coverage of the substrate by these molecules. Next, the vibrational fingerprints of the aforementioned molecules are determined between 2825 and 3125 cm - 1 and the observed SFG spectral features are ascribed on the basis of the analysis of shorter and simpler molecules (1-dodecanethiol, 4-methylbenzenethiol and CH 3 -C 6 H 4 -O-(CH 2 ) 11 -SH) also adsorbed on Pt(111). The occurrence of methylene vibration modes indicates a significant amount of chain defects whatever the n and m numbers are. Finally, the identification of a particular vibration mode, characteristic of the aromatic ring, enables us to qualitatively discuss the effect of the number of methylene and ethylene glycol entities on its orientation. More precisely, higher these numbers, more tilted (with respect to the substrate normal) the aromatic ring plane is
Sum-Frequency Generation from Chiral Media and Interfaces
Energy Technology Data Exchange (ETDEWEB)
Ji, Na [Univ. of California, Berkeley, CA (United States)
2006-02-13
Sum frequency generation (SFG), a second-order nonlinear optical process, is electric-dipole forbidden in systems with inversion symmetry. As a result, it has been used to study chiral media and interfaces, systems intrinsically lacking inversion symmetry. This thesis describes recent progresses in the applications of and new insights into SFG from chiral media and interfaces. SFG from solutions of chiral amino acids is investigated, and a theoretical model explaining the origin and the strength of the chiral signal in electronic-resonance SFG spectroscopy is discussed. An interference scheme that allows us to distinguish enantiomers by measuring both the magnitude and the phase of the chiral SFG response is described, as well as a chiral SFG microscope producing chirality-sensitive images with sub-micron resolution. Exploiting atomic and molecular parity nonconservation, the SFG process is also used to solve the Ozma problems. Sum frequency vibrational spectroscopy is used to obtain the adsorption behavior of leucine molecules at air-water interfaces. With poly(tetrafluoroethylene) as a model system, we extend the application of this surface-sensitive vibrational spectroscopy to fluorine-containing polymers.
Sum-Frequency Generation from Chiral Media and Interfaces
International Nuclear Information System (INIS)
Ji, Na
2006-01-01
Sum frequency generation (SFG), a second-order nonlinear optical process, is electric-dipole forbidden in systems with inversion symmetry. As a result, it has been used to study chiral media and interfaces, systems intrinsically lacking inversion symmetry. This thesis describes recent progresses in the applications of and new insights into SFG from chiral media and interfaces. SFG from solutions of chiral amino acids is investigated, and a theoretical model explaining the origin and the strength of the chiral signal in electronic-resonance SFG spectroscopy is discussed. An interference scheme that allows us to distinguish enantiomers by measuring both the magnitude and the phase of the chiral SFG response is described, as well as a chiral SFG microscope producing chirality-sensitive images with sub-micron resolution. Exploiting atomic and molecular parity nonconservation, the SFG process is also used to solve the Ozma problems. Sum frequency vibrational spectroscopy is used to obtain the adsorption behavior of leucine molecules at air-water interfaces. With poly(tetrafluoroethylene) as a model system, we extend the application of this surface-sensitive vibrational spectroscopy to fluorine-containing polymers
Laser-heating-induced displacement of surfactants on the water surface
Backus, E.H.G.; Bonn, D.; Cantin, S.; Roke, S.; Bonn, M.
2012-01-01
We report a combined vibrational sum-frequency generation (SFG) spectroscopy, Brewster angle microscopy (BAM), and ellipsometry study of different surfactants on water as a function of surfactant density. Vibrational SFG spectra of surfactants on the water surface in a Langmuir trough have been
Chemische Reaktionen auf Oberflächen - eine SFG Studie
Kirsch, Harald
2014-01-01
This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...
Time-resolved vibrational spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Tokmakoff, Andrei [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Champion, Paul [Northeastern Univ., Boston, MA (United States); Heilweil, Edwin J. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Nelson, Keith A. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Ziegler, Larry [Boston Univ., MA (United States)
2009-05-14
This document contains the Proceedings from the 14th International Conference on Time-Resolved Vibrational Spectroscopy, which was held in Meredith, NH from May 9-14, 2009. The study of molecular dynamics in chemical reaction and biological processes using time-resolved spectroscopy plays an important role in our understanding of energy conversion, storage, and utilization problems. Fundamental studies of chemical reactivity, molecular rearrangements, and charge transport are broadly supported by the DOE's Office of Science because of their role in the development of alternative energy sources, the understanding of biological energy conversion processes, the efficient utilization of existing energy resources, and the mitigation of reactive intermediates in radiation chemistry. In addition, time-resolved spectroscopy is central to all fiveof DOE's grand challenges for fundamental energy science. The Time-Resolved Vibrational Spectroscopy conference is organized biennially to bring the leaders in this field from around the globe together with young scientists to discuss the most recent scientific and technological advances. The latest technology in ultrafast infrared, Raman, and terahertz spectroscopy and the scientific advances that these methods enable were covered. Particular emphasis was placed on new experimental methods used to probe molecular dynamics in liquids, solids, interfaces, nanostructured materials, and biomolecules.
Ding, Bei; Soblosky, Lauren; Nguyen, Khoi; Geng, Junqing; Yu, Xinglong; Ramamoorthy, Ayyalusamy; Chen, Zhan
2013-05-01
Antimicrobial peptides (AMPs) could become the next generation antibiotic compounds which can overcome bacterial resistance by disrupting cell membranes and it is essential to determine the factors underlying its mechanism of action. Although high-resolution NMR and other biological studies have provided valuable insights, it has been a major challenge to follow the AMP-membrane interactions at physiologically-relevant low peptide concentrations. In this study, we demonstrate a novel approach to overcome this major limitation by performing Sum Frequency Generation (SFG) vibrational spectroscopic experiments on lipid bilayers containing an AMP, LL-37. Our results demonstrate the power of SFG to study non-linear helical peptides and also infer that lipid-peptide interaction and the peptide orientation depend on the lipid membrane composition. The observed SFG signal changes capture the aggregating process of LL-37 on membrane. In addition, our SFG results on cholesterol-containing lipid bilayers indicate the inhibition effect of cholesterol on peptide-induced membrane permeation process.
International Nuclear Information System (INIS)
McGuire, John Andrew
2004-01-01
The high temporal resolution and broad bandwidth of a femtosecond laser system are exploited in a pair of nonlinear optical studies of surfaces. The dephasing dynamics of resonances associated with the adatom dangling bonds of the Si(111)7 x 7 surface are explored by transient second-harmonic hole burning, a process that can be described as a fourth-order nonlinear optical process. Spectral holes produced by a 100 fs pump pulse at about 800 nm are probed by the second harmonic signal of a 100 fs pulse tunable around 800 nm. The measured spectral holes yield homogeneous dephasing times of a few tens of femtoseconds. Fits with a Lorentzian spectral hole centered at zero probe detuning show a linear dependence of the hole width on pump fluence, which suggests that charge carrier-carrier scattering dominates the dephasing dynamics at the measured excitation densities. Extrapolation of the deduced homogeneous dephasing times to zero excitation density yields an intrinsic dephasing time of ∼ 70 fs. The presence of a secondary spectral hole indicates that scattering of the surface electrons with surface optical phonons at 570 cm -1 occurs within the first 200 fs after excitation. The broad bandwidth of femtosecond IR pulses is used to perform IR-visible sum frequency vibrational spectroscopy. By implementing a Fourier-transform technique, we demonstrate the ability to obtain sub-laser-bandwidth spectral resolution. FT-SFG yields a greater signal when implemented with a stretched visible pulse than with a femtosecond visible pulse. However, when compared with multichannel spectroscopy using a femtosecond IR pulse but a narrowband visible pulse, Fourier-transform SFG is found to have an inferior signal-to-noise ratio. A mathematical analysis of the signal-to-noise ratio illustrates the constraints on the Fourier-transform approach
Energy Technology Data Exchange (ETDEWEB)
McGuire, John Andrew [Univ. of California, Berkeley, CA (United States)
2004-11-24
The high temporal resolution and broad bandwidth of a femtosecond laser system are exploited in a pair of nonlinear optical studies of surfaces. The dephasing dynamics of resonances associated with the adatom dangling bonds of the Si(111)7 x 7 surface are explored by transient second-harmonic hole burning, a process that can be described as a fourth-order nonlinear optical process. Spectral holes produced by a 100 fs pump pulse at about 800 nm are probed by the second harmonic signal of a 100 fs pulse tunable around 800 nm. The measured spectral holes yield homogeneous dephasing times of a few tens of femtoseconds. Fits with a Lorentzian spectral hole centered at zero probe detuning show a linear dependence of the hole width on pump fluence, which suggests that charge carrier-carrier scattering dominates the dephasing dynamics at the measured excitation densities. Extrapolation of the deduced homogeneous dephasing times to zero excitation density yields an intrinsic dephasing time of {approx} 70 fs. The presence of a secondary spectral hole indicates that scattering of the surface electrons with surface optical phonons at 570 cm-1 occurs within the first 200 fs after excitation. The broad bandwidth of femtosecond IR pulses is used to perform IR-visible sum frequency vibrational spectroscopy. By implementing a Fourier-transform technique, we demonstrate the ability to obtain sub-laser-bandwidth spectral resolution. FT-SFG yields a greater signal when implemented with a stretched visible pulse than with a femtosecond visible pulse. However, when compared with multichannel spectroscopy using a femtosecond IR pulse but a narrowband visible pulse, Fourier-transform SFG is found to have an inferior signal-to-noise ratio. A mathematical analysis of the signal-to-noise ratio illustrates the constraints on the Fourier-transform approach.
SFG study on potential-dependent structure of water at Pt electrode/electrolyte solution interface
Energy Technology Data Exchange (ETDEWEB)
Noguchi, Hidenori; Okada, Tsubasa; Uosaki, Kohei [Physical Chemistry Laboratory, Division of Chemistry, Graduate School of Science, Hokkaido University, Sapporo 060-0810 (Japan)
2008-10-01
Structure of water at Pt/electrolyte solution interface was investigated by sum frequency generation (SFG) spectroscopy. Two broad peaks were observed in OH stretching region at ca. 3200 cm{sup -1} and ca. 3400 cm{sup -1}, which are known to be due to the symmetric OH stretching (U{sub 1}) of tetrahedrally coordinated, i.e., strongly hydrogen bonded 'ice-like' water, and the asymmetric OH stretching (U{sub 3}) of water molecules in a more random arrangement, i.e., weakly hydrogen bonded 'liquid-like' water, respectively. The SFG intensity strongly depended on electrode potential. Several possibilities are suggested for the potential dependence of the SFG intensity. (author)
International Nuclear Information System (INIS)
Gu Anna; Liang Xianting
2011-01-01
In this paper, we investigate a two electronic level system with vibrational modes coupled to a Brownian oscillator bath. The difference frequency generation (DFG) signals and sum frequency generation (SFG) signals are calculated. It is shown that, for the same model, the SFG signals are more sensitive than the DFG signals to the changes of the vibrational modes of the electronic two-level system. Because the SFG conversion efficiency can be improved by using the time-delay method, the findings in this paper predict that the SFG spectrum may probe the changes of the microstructure more effectively. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)
Spectroscopy and reactions of vibrationally excited transient molecules
Energy Technology Data Exchange (ETDEWEB)
Dai, H.L. [Univ. of Pennsylvania, Philadelphia (United States)
1993-12-01
Spectroscopy, energy transfer and reactions of vibrationally excited transient molecules are studied through a combination of laser-based excitation techniques and efficient detection of emission from the energized molecules with frequency and time resolution. Specifically, a Time-resolved Fourier Transform Emission Spectroscopy technique has been developed for detecting dispersed laser-induced fluorescence in the IR, visible and UV regions. The structure and spectroscopy of the excited vibrational levels in the electronic ground state, as well as energy relaxation and reactions induced by specific vibronic excitations of a transient molecule can be characterized from time-resolved dispersed fluorescence in the visible and UV region. IR emissions from highly vibrational excited levels, on the other hand, reveal the pathways and rates of collision induced vibrational energy transfer.
Vibrational Micro-Spectroscopy of Human Tissues Analysis: Review.
Bunaciu, Andrei A; Hoang, Vu Dang; Aboul-Enein, Hassan Y
2017-05-04
Vibrational spectroscopy (Infrared (IR) and Raman) and, in particular, micro-spectroscopy and micro-spectroscopic imaging have been used to characterize developmental changes in tissues, to monitor these changes in cell cultures and to detect disease and drug-induced modifications. The conventional methods for biochemical and histophatological tissue characterization necessitate complex and "time-consuming" sample manipulations and the results are rarely quantifiable. The spectroscopy of molecular vibrations using mid-IR or Raman techniques has been applied to samples of human tissue. This article reviews the application of these vibrational spectroscopic techniques for analysis of biological tissue published between 2005 and 2015.
International Nuclear Information System (INIS)
Bozzini, Benedetto; Busson, Bertrand; De Gaudenzi, Gian Pietro; Mele, Claudio; Tadjeddine, Abderrahmane
2007-01-01
In this paper, the behaviour of polycrystalline Au, Au-Cu (Cu 25%) and Au-Ag-Cu (Ag 10%, Cu 15%) electrodes in contact with neutral aqueous solutions of KCN has been studied as a function of potential by means of in situ sum frequency generation (SFG) and difference frequency generation (DFG) spectroscopies. The potential-dependent spectra have been analysed quantitatively with a model for the second-order non-linear susceptibility accounting for vibrational and electronic effects. The potential-dependence of the CN - stretching band position and of the free-electron contribution to the real part of the non-resonant component of the second-order susceptibility have been accounted for. Spectroelectrochemical results were complemented by cyclic voltammetric measurements. The chief stress in this work has been placed on systematising and quantifying the interaction between the vibrational and electronic structures of the electrodic interfaces studied. The effects of adsorbates on the electronic structure of the adsorbing electrode, as a function of electrode alloy composition and applied potential are particularly critical for the understanding of Au-alloy electrochemistry in the presence of cyanide and cyanocomplexes. The systematic comparison of SFG and DFG spectra measured under the same electrochemical conditions for Au, Au-Cu and Au-Ag-Cu electrodes discloses a rich phenomenology related to the electronic structure of the interface
Energy Technology Data Exchange (ETDEWEB)
Bozzini, Benedetto [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy)]. E-mail: benedetto.bozzini@unile.it; Busson, Bertrand [CLIO-LCP, Universite Paris-Sud, 91405 Orsay Cedex (France); De Gaudenzi, Gian Pietro [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Mele, Claudio [Dipartimento di Ingegneria dell' Innovazione, Universita di Lecce, v. Monteroni, I-73100 Lecce (Italy); Tadjeddine, Abderrahmane [UDIL-CNRS, Bat. 201, Centre Universitaire Paris-Sud, BP 34, 91898 Orsay Cedex (France)
2007-01-16
In this paper, the behaviour of polycrystalline Au, Au-Cu (Cu 25%) and Au-Ag-Cu (Ag 10%, Cu 15%) electrodes in contact with neutral aqueous solutions of KCN has been studied as a function of potential by means of in situ sum frequency generation (SFG) and difference frequency generation (DFG) spectroscopies. The potential-dependent spectra have been analysed quantitatively with a model for the second-order non-linear susceptibility accounting for vibrational and electronic effects. The potential-dependence of the CN{sup -} stretching band position and of the free-electron contribution to the real part of the non-resonant component of the second-order susceptibility have been accounted for. Spectroelectrochemical results were complemented by cyclic voltammetric measurements. The chief stress in this work has been placed on systematising and quantifying the interaction between the vibrational and electronic structures of the electrodic interfaces studied. The effects of adsorbates on the electronic structure of the adsorbing electrode, as a function of electrode alloy composition and applied potential are particularly critical for the understanding of Au-alloy electrochemistry in the presence of cyanide and cyanocomplexes. The systematic comparison of SFG and DFG spectra measured under the same electrochemical conditions for Au, Au-Cu and Au-Ag-Cu electrodes discloses a rich phenomenology related to the electronic structure of the interface.
Soblosky, Lauren; Ramamoorthy, Ayyalusamy; Chen, Zhan
2015-04-01
Supported lipid bilayers are used as a convenient model cell membrane system to study biologically important molecule-lipid interactions in situ. However, the lipid bilayer models are often simple and the acquired results with these models may not provide all pertinent information related to a real cell membrane. In this work, we use sum frequency generation (SFG) vibrational spectroscopy to study molecular-level interactions between the antimicrobial peptides (AMPs) MSI-594, ovispirin-1 G18, magainin 2 and a simple 1,2-dipalmitoyl-d62-sn-glycero-3-phosphoglycerol (dDPPG)/1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) bilayer. We compared such interactions to those between the AMPs and a more complex dDPPG/Escherichia coli (E. coli) polar lipid extract bilayer. We show that to fully understand more complex aspects of peptide-bilayer interaction, such as interaction kinetics, a heterogeneous lipid composition is required, such as the E. coli polar lipid extract. The discrepancy in peptide-bilayer interaction is likely due in part to the difference in bilayer charge between the two systems since highly negative charged lipids can promote more favorable electrostatic interactions between the peptide and lipid bilayer. Results presented in this paper indicate that more complex model bilayers are needed to accurately analyze peptide-cell membrane interactions and demonstrates the importance of using an appropriate lipid composition to study AMP interaction properties. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Seventh international conference on time-resolved vibrational spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Dyer, R.B.; Martinez, M.A.D.; Shreve, A.; Woodruff, W.H. [comps.
1997-04-01
The International Conference on Time-Resolved Vibrational Spectroscopy (TRVS) is widely recognized as the major international forum for the discussion of advances in this rapidly growing field. The 1995 conference was the seventh in a series that began at Lake Placid, New York, 1982. Santa Fe, New Mexico, was the site of the Seventh International Conference on Time-Resolved Vibrational Spectroscopy, held from June 11 to 16, 1995. TRVS-7 was attended by 157 participants from 16 countries and 85 institutions, and research ranging across the full breadth of the field of time-resolved vibrational spectroscopy was presented. Advances in both experimental capabilities for time-resolved vibrational measurements and in theoretical descriptions of time-resolved vibrational methods continue to occur, and several sessions of the conference were devoted to discussion of these advances and the associated new directions in TRVS. Continuing the interdisciplinary tradition of the TRVS meetings, applications of time-resolved vibrational methods to problems in physics, biology, materials science, and chemistry comprised a large portion of the papers presented at the conference.
International Nuclear Information System (INIS)
McCrea, Keith R.
2001-01-01
In the results discussed above, it is clear that Sum Frequency Generation (SFG) is a unique tool that allows the detection of vibrational spectra of adsorbed molecules present on single crystal surfaces under catalytic reaction conditions. Not only is it possible to detect active surface intermediates, it is also possible to detect spectator species which are not responsible for the measured turnover rates. By correlating high-pressure SFG spectra under reaction conditions and gas chromatography (GC) kinetic data, it is possible to determine which species are important under reaction intermediates. Because of the flexibility of this technique for studying surface intermediates, it is possible to determine how the structures of single crystal surfaces affect the observed rates of catalytic reactions. As an example of a structure insensitive reaction, ethylene hydrogenation was explored on both Pt(111) and Pt(100). The rates were determined to be essentially the same. It was observed that both ethylidyne and di-(sigma) bonded ethylene were present on the surface under reaction conditions on both crystals, although in different concentrations. This result shows that these two species are not responsible for the measured turnover rate, as it would be expected that one of the two crystals would be more active than the other, since the concentration of the surface intermediate would be different on the two crystals. The most likely active intermediates are weakly adsorbed molecules such as(pi)-bonded ethylene and ethyl. These species are not easily detected because their concentration lies at the detection limit of SFG. The SFG spectra and GC data essentially show that ethylene hydrogenation is structure insensitive for Pt(111) and Pt(100). SFG has proven to be a unique and excellent technique for studying adsorbed species on single crystal surfaces under high-pressure catalytic reactions. Coupled with kinetic data obtained from gas chromatography measurements, it can
Energy Technology Data Exchange (ETDEWEB)
Dong, Hui; Lewis, Nicholas H. C.; Oliver, Thomas A. A.; Fleming, Graham R., E-mail: grfleming@lbl.gov [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, Californial 94720 (United States); Kavli Energy NanoSciences Institute at Berkeley, Berkeley, California 94720 (United States)
2015-05-07
Changes in the electronic structure of pigments in protein environments and of polar molecules in solution inevitably induce a re-adaption of molecular nuclear structure. Both changes of electronic and vibrational energies can be probed with visible or infrared lasers, such as two-dimensional electronic spectroscopy or vibrational spectroscopy. The extent to which the two changes are correlated remains elusive. The recent demonstration of two-dimensional electronic-vibrational (2DEV) spectroscopy potentially enables a direct measurement of this correlation experimentally. However, it has hitherto been unclear how to characterize the correlation from the spectra. In this paper, we present a theoretical formalism to demonstrate the slope of the nodal line between the excited state absorption and ground state bleach peaks in the spectra as a characterization of the correlation between electronic and vibrational transition energies. We also show the dynamics of the nodal line slope is correlated to the vibrational spectral dynamics. Additionally, we demonstrate the fundamental 2DEV spectral line-shape of a monomer with newly developed response functions.
Energy Technology Data Exchange (ETDEWEB)
Ferguson, Michael James [Univ. of California, Berkeley, CA (United States)
2005-01-01
The ammonia synthesis reaction has been studied using single crystal model catalysis combined with sum frequency generation (SFG) vibrational spectroscopy. The adsorption of gases N2, H2, O2 and NH3 that play a role in ammonia synthesis have been studied on the Fe(111) crystal surface by sum frequency generation vibrational spectroscopy using an integrated Ultra-High Vacuum (UHV)/high-pressure system. SFG spectra are presented for the dissociation intermediates, NH2 (~3325 cm-1) and NH (~3235 cm-1) under high pressure of ammonia or equilibrium concentrations of reactants and products on Fe(111) surfaces. Special attention was paid to understand how potassium promotion of the iron catalyst affects the intermediates of ammonia synthesis. An Fe(111) surface promoted with 0.2 monolayers of potassium red shifts the vibrational frequencies of the reactive surface intermediates, NH and NH2, providing evidence for weakened the nitrogen-hydrogen bonds relative to clean Fe(111). Spectral features of these surface intermediates persisted to higher temperatures for promoted iron surfaces than for clean Fe(111) surfaces implying that nitrogen-iron bonds are stronger for the promoted surface. The ratio of the NH to NH2 signal changed for promoted surfaces in the presence of equilibrium concentrations of reactants and products. The order of adding oxygen and potassium to promoted surfaces does not alter the spectra indicating that ammonia induces surface reconstruction of the catalyst to produce the same surface morphology. When oxygen is co-adsorbed with nitrogen, hydrogen, ammonia or potassium on Fe(111), a relative phase shift of the spectra occurs as compared to the presence of adsorbates on clean iron surfaces. Water adsorption on iron was also probed using SFG vibrational spectroscopy. For both H2O and D2O, the only spectral feature was in the range of
Vibrational spectroscopy: a clinical tool for cancer diagnostics.
Kendall, Catherine; Isabelle, Martin; Bazant-Hegemark, Florian; Hutchings, Joanne; Orr, Linda; Babrah, Jaspreet; Baker, Rebecca; Stone, Nicholas
2009-06-01
Vibrational spectroscopy techniques have demonstrated potential to provide non-destructive, rapid, clinically relevant diagnostic information. Early detection is the most important factor in the prevention of cancer. Raman and infrared spectroscopy enable the biochemical signatures from biological tissues to be extracted and analysed. In conjunction with advanced chemometrics such measurements can contribute to the diagnostic assessment of biological material. This paper also illustrates the complementary advantage of using Raman and FTIR spectroscopy technologies together. Clinical requirements are increasingly met by technological developments which show promise to become a clinical reality. This review summarises recent advances in vibrational spectroscopy and their impact on the diagnosis of cancer.
Laaser, Jennifer E.; Skoff, David R.; Ho, Jia-Jung; Joo, Yongho; Serrano, Arnaldo L.; Steinkruger, Jay D.; Gopalan, Padma; Gellman, Samuel H.; Zanni, Martin T.
2014-01-01
Surface-bound polypeptides and proteins are increasingly used to functionalize inorganic interfaces such as electrodes, but their structural characterization is exceedingly difficult with standard technologies. In this paper, we report the first two-dimensional sum-frequency generation (2D SFG) spectra of a peptide monolayer, which is collected by adding a mid-IR pulse shaper to a standard femtosecond SFG spectrometer. On a gold surface, standard FTIR spectroscopy is inconclusive about the peptide structure because of solvation-induced frequency shifts, but the 2D lineshapes, anharmonic shifts, and lifetimes obtained from 2D SFG reveal that the peptide is largely α-helical and upright. Random coil residues are also observed, which do not themselves appear in SFG spectra due to their isotropic structural distribution, but which still absorb infrared light and so can be detected by cross-peaks in 2D SFG spectra. We discuss these results in the context of peptide design. Because of the similar way in which the spectra are collected, these 2D SFG spectra can be directly compared to 2D IR spectra, thereby enabling structural interpretations of surface-bound peptides and biomolecules based on the well-studied structure/2D IR spectra relationships established from soluble proteins. PMID:24372101
Mah, Pei T; Novakovic, Dunja; Saarinen, Jukka; Van Landeghem, Stijn; Peltonen, Leena; Laaksonen, Timo; Isomäki, Antti; Strachan, Clare J
2017-05-01
To investigate the effect of compression on the crystallization behavior in amorphous tablets using sum frequency generation (SFG) microscopy imaging and more established analytical methods. Tablets containing neat amorphous griseofulvin with/without excipients (silica, hydroxypropyl methylcellulose acetate succinate (HPMCAS), microcrystalline cellulose (MCC) and polyethylene glycol (PEG)) were prepared. They were analyzed upon preparation and storage using attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy, scanning electron microscopy (SEM) and SFG microscopy. Compression-induced crystallization occurred predominantly on the surface of the neat amorphous griseofulvin tablets, with minimal crystallinity being detected in the core of the tablets. The presence of various types of excipients was not able to mitigate the compression-induced surface crystallization of the amorphous griseofulvin tablets. However, the excipients affected the crystallization rate of amorphous griseofulvin in the core of the tablet upon compression and storage. SFG microscopy can be used in combination with ATR-FTIR spectroscopy and SEM to understand the crystallization behaviour of amorphous tablets upon compression and storage. When selecting excipients for amorphous formulations, it is important to consider the effect of the excipients on the physical stability of the amorphous formulations.
Energy Technology Data Exchange (ETDEWEB)
Kliewer, Christopher J. [Univ. of California, Berkeley, CA (United States)
2009-06-30
Sum frequency generation surface vibrational spectroscopy (SFG-VS) in combination with gas chromatography (GC) was used in-situ to monitor surface bound reaction intermediates and reaction selectivities for the hydrogenation reactions of pyrrole, furan, pyridine, acrolein, crotonaldehyde, and prenal over Pt(111), Pt(100), Rh(111), and platinum nanoparticles under Torr reactant pressures and temperatures of 300K to 450K. The focus of this work is the correlation between the SFG-VS observed surface bound reaction intermediates and adsorption modes with the reaction selectivity, and how this is affected by catalyst structure and temperature. Pyrrole hydrogenation was investigated over Pt(111) and Rh(111) single crystals at Torr pressures. It was found that pyrrole adsorbs to Pt(111) perpendicularly by cleaving the N-H bond and binding through the nitrogen. However, over Rh(111) pyrrole adsorbs in a tilted geometry binding through the {pi}-aromatic orbitals. A surface-bound pyrroline reaction intermediate was detected over both surfaces with SFG-VS. It was found that the ring-cracking product butylamine is a reaction poison over both surfaces studied. Furan hydrogenation was studied over Pt(111), Pt(100), 10 nm cubic platinum nanoparticles and 1 nm platinum nanoparticles. The product distribution was observed to be highly structure sensitive and the acquired SFG-VS spectra reflected this sensitivity. Pt(100) exhibited more ring-cracking to form butanol than Pt(111), while the nanoparticles yielded higher selectivities for the partially saturated ring dihydrofuran. Pyridine hydrogenation was investigated over Pt(111) and Pt(100). The α-pyridyl surface adsorption mode was observed with SFG-VS over both surfaces. 1,4-dihydropyridine was seen as a surface intermediate over Pt(100) but not Pt(111). Upon heating the surfaces to 350K, the adsorbed pyridine changes to a flat-lying adsorption mode. No evidence was found for the pyridinium cation. The hydrogenation of the
Surface restructuring behavior of various types of poly(dimethylsiloxane) in water detected by SFG.
Chen, Chunyan; Wang, Jie; Chen, Zhan
2004-11-09
Surface structures of several different poly(dimethylsiloxane) (PDMS) materials, tetraethoxysilane-cured hydroxy-terminated PDMS (TEOS-PDMS), platinum-cured vinyl-terminated PDMS (Pt-PDMS), platinum-cured vinyl-terminated poly(diphenylsiloxane)-co-poly(dimethylsiloxane) (PDPS-co-PDMS), and PDMS-co-polystyrene (PDMS-co-PS) copolymer in air and water have been investigated by sum frequency generation (SFG) vibrational spectroscopy. The SFG spectra collected from all PDMS surfaces in both air and water are dominated by methyl group stretches, indicating that all the surfaces are mainly covered by methyl groups. Other than surface-dominating methyl groups, some -Si-CH2-CH2- moieties on the Pt-PDMS surface have also been detected in air, which are present at cross-linking points. Information about the average orientation angle and angle distribution of the methyl groups on the PDMS surface has been evaluated. Surface restructuring of the methyl groups has been observed for all PDMS surfaces in water. Upon contacting water, the methyl groups on all PDMS surfaces tilt more toward the surface. The detailed restructuring behaviors of several PDMS surfaces in water and the effects of molecular weight on restructuring behaviors have been investigated. For comparison, in addition to air and water, surface structures of PDMS materials mentioned above in a nonpolar solvent, FC-75, have also been studied. By comparing the different response of phenyl groups to water on both PDPS-co-PDMS and PS-co-PDMS surfaces, we have demonstrated how the restructuring behaviors of surface phenyl groups are affected by the structural flexibility of the molecular chains where they are attached.
Experimental and theoretical evidence for bilayer-by-bilayer surface melting of crystalline ice
DEFF Research Database (Denmark)
Sánchez, M. Alejandra; Kling, Tanja; Ishiyama, Tatsuya
2017-01-01
, and its nature, we investigate the surface melting of hexagonal ice by combining noncontact, surfacespecific vibrational sum frequency generation (SFG) spectroscopy and spectra calculated from molecular dynamics simulations. Using SFG, we probe the outermost water layers of distinct single crystalline ice...
Vázquez, Anne V; Holden, Brad; Kristalyn, Cornelius; Fuller, Mike; Wilkerson, Brett; Chen, Zhan
2011-05-01
Flip chip technology has greatly improved the performance of semiconductor devices, but relies heavily on the performance of epoxy underfill adhesives. Because epoxy underfills are cured in situ in flip chip semiconductor devices, understanding their surface and interfacial structures is critical for understanding their adhesion to various substrates. Here, sum frequency generation (SFG) vibrational spectroscopy was used to study surface and buried interfacial structures of two model epoxy resins used as underfills in flip chip devices, bisphenol A digylcidyl ether (BADGE) and 1,4-butanediol diglycidyl ether (BDDGE). The surface structures of these epoxies were compared before and after cure, and the orientations of their surface functional groups were deduced to understand how surface structural changes during cure may affect adhesion properties. Further, the effect of moisture exposure, a known cause of adhesion failure, on surface structures was studied. It was found that the BADGE surface significantly restructured upon moisture exposure while the BDDGE surface did not, showing that BADGE adhesives may be more prone to moisture-induced delamination. Lastly, although surface structure can give some insight into adhesion, buried interfacial structures more directly correspond to adhesion properties of polymers. SFG was used to study buried interfaces between deuterated polystyrene (d-PS) and the epoxies before and after moisture exposure. It was shown that moisture exposure acted to disorder the buried interfaces, most likely due to swelling. These results correlated with lap shear adhesion testing showing a decrease in adhesion strength after moisture exposure. The presented work showed that surface and interfacial structures can be correlated to adhesive strength and may be helpful in understanding and designing optimized epoxy underfill adhesives.
Peñalber-Johnstone, Chariz; Adamová, Gabriela; Plechkova, Natalia V.; Bahrami, Maryam; Ghaed-Sharaf, Tahereh; Ghatee, Mohammad Hadi; Seddon, Kenneth R.; Baldelli, Steven
2018-05-01
Sum frequency generation (SFG) spectroscopy is a nonlinear vibrational spectroscopic technique used in the study of interfaces, due to its unique ability to distinguish surface molecules that have preferential ordering compared to the isotropic bulk. Here, a series of alkyltrioctylphosphonium chloride ionic liquids, systematically varied by cation structure, were characterized at the air-liquid interface by SFG. The effect on surface structure resulting from molecular variation (i.e., addition of cyano- and methoxy-functional groups) of the cation alkyl chain was investigated. SFG spectra in the C—H stretching region (2750-3100 cm-1) for [P8 8 8 n][Cl], where n = 4, 5, 8, 10, 12, or 14, showed characteristic changes as the alkyl chain length was increased. Spectral profiles for n = 4, 5, 8, or 10 appeared similar; however, when the fourth alkyl chain was sufficiently long (as in the case of n = 12 or n = 14), abrupt changes occurred in the spectra. Molecular dynamics (MD) simulation of a slab of each ionic liquid (with n = 8, 10, or 12) confirmed gauche defects, with enhancement for the long alkyl chain and an abrupt increase of gauche occurrence from n = 8 to n = 10. A comparison of the tilt angle distribution from the simulation and the SFG analysis show a broad distribution of angles. Using experimental SFG spectra in conjunction with MD simulations, a comprehensive molecular picture at the surface of this unique class of liquids is presented.
Kennedy, Griffin John
Kinetic measurements are paired with in-situ spectroscopic characterization tools to investigate colloidally based, supported Pt catalytic model systems in order to elucidate the mechanisms by which metal and support work in tandem to dictate activity and selectivity. The results demonstrate oxide support materials, while inactive in absence of Pt nanoparticles, possess unique active sites for the selective conversion of gas phase molecules when paired with an active metal catalyst. In order to establish a paradigm for metal-support interactions using colloidally synthesized Pt nanoparticles the ability of the organic capping agent to inhibit reactivity and interaction with the support must first be assessed. Pt nanoparticles capped by poly(vinylpyrrolidone) (PVP), and those from which the PVP is removed by UV light exposure, are investigated for two reactions, the hydrogenation of ethylene and the oxidation of methanol. It is shown that prior to PVP removal the particles are moderately active for both reactions. Following removal, the activity for the two reactions diverges, the ethylene hydrogenation rate increases 10-fold, while the methanol oxidation rate decreases 3-fold. To better understand this effect the capping agent prior to, and the residual carbon remaining after UV treatment are probed by sum frequency generation vibrational spectroscopy. Prior to removal no major differences are observed when the particles are exposed to alternating H2 and O2 environments. When the PVP is removed, carbonaceous fragments remain on the surface that dynamically restructure in H2 and O2. These fragments create a tightly bound shell in an oxygen environment and a porous coating of hydrogenated carbon in the hydrogen environment. Reaction rate measurements of thermally cleaned PVP and oleic acid capped particles show this effect to be independent of cleaning method or capping agent. In all this demonstrates the ability of the capping agent to mediate nanoparticle catalysis
Two-dimensional infrared spectroscopy of vibrational polaritons.
Xiang, Bo; Ribeiro, Raphael F; Dunkelberger, Adam D; Wang, Jiaxi; Li, Yingmin; Simpkins, Blake S; Owrutsky, Jeffrey C; Yuen-Zhou, Joel; Xiong, Wei
2018-04-19
We report experimental 2D infrared (2D IR) spectra of coherent light-matter excitations--molecular vibrational polaritons. The application of advanced 2D IR spectroscopy to vibrational polaritons challenges and advances our understanding in both fields. First, the 2D IR spectra of polaritons differ drastically from free uncoupled excitations and a new interpretation is needed. Second, 2D IR uniquely resolves excitation of hybrid light-matter polaritons and unexpected dark states in a state-selective manner, revealing otherwise hidden interactions between them. Moreover, 2D IR signals highlight the impact of molecular anharmonicities which are applicable to virtually all molecular systems. A quantum-mechanical model is developed which incorporates both nuclear and electrical anharmonicities and provides the basis for interpreting this class of 2D IR spectra. This work lays the foundation for investigating phenomena of nonlinear photonics and chemistry of molecular vibrational polaritons which cannot be probed with traditional linear spectroscopy.
Ma, Sulan; Li, Hongchun; Tian, Kangzhen; Ye, Shuji; Luo, Yi
2014-02-06
Cholesterol organization and transport within a cell membrane are essential for human health and many cellular functions yet remain elusive so far. Using cholesterol analogue 6-ketocholestanol (6-KC) as a model, we have successfully exploited sum frequency generation vibrational spectroscopy (SFG-VS) to track the organization and transport of cholesterol in a membrane by combining achiral-sensitive ssp (ppp) and chiral-sensitive psp polarization measurements. It is found that 6-KC molecules are aligned at the outer leaflet of the DMPC lipid bilayer with a tilt angle of about 10°. 6-KC organizes itself by forming an α-β structure at low 6-KC concentration and most likely a β-β structure at high 6-KC concentration. Among all proposed models, our results favor the so-called umbrella model with formation of a 6-KC cluster. Moreover, we have found that the long anticipated flip-flop motion of 6-KC in the membrane takes time to occur, at least much longer than previously thought. All of these interesting findings indicate that it is critical to explore in situ, real-time, and label-free methodologies to obtain a precise molecular description of cholesterol's behavior in membranes. This study represents the first application of SFG to reveal the cholesterol-lipid interaction mechanism at the molecular level.
Toward a simple molecular understanding of sum frequency generation at air-water interfaces
Energy Technology Data Exchange (ETDEWEB)
Noah-Vanhoucke, Joyce; Smith, Jared D.; Geissler, Phillip L.
2009-01-13
Second-order vibrational spectroscopies successfully isolate signals from interfaces, but they report on intermolecular structure in a complicated and indirect way. Here we adapt a perspective on vibrational response developed for bulk spectroscopies to explore the microscopic fluctuations to which sum frequency generation (SFG), a popular surface-specific measurement, is most sensitive. We focus exclusively on inhomogeneous broadening of spectral susceptibilities for OH stretching of HOD as a dilute solute in D{sub 2}O. Exploiting a simple connection between vibrational frequency shifts and an electric field variable, we identify several functions of molecular orientation whose averages govern SFG. The frequency-dependence of these quantities is well captured by a pair of averages, involving alignment of OH and OD bonds with the surface normal at corresponding values of the electric field. The approximate form we obtain for SFG susceptibility highlights a dramatic sensitivity to the way a simulated liquid slab is partitioned for calculating second-order response.
2016-07-01
HIGHLY RESOLVED SUB-TERAHERTZ VIBRATIONAL SPECTROSCOPY OF BIOLOGICAL MACROMOLECULES AND BACTERIA CELLS ECBC...SUBTITLE Highly Resolved Sub-Terahertz Vibrational Spectroscopy of Biological Macromolecules and Bacteria Cells 5a. CONTRACT NUMBER W911SR-14-P...22 4.3 Bacteria THz Study
Electronic and vibrational spectroscopy and vibrationally mediated photodissociation of V+(OCO).
Citir, Murat; Altinay, Gokhan; Metz, Ricardo B
2006-04-20
Electronic spectra of gas-phase V+(OCO) are measured in the near-infrared from 6050 to 7420 cm(-1) and in the visible from 15,500 to 16,560 cm(-1), using photofragment spectroscopy. The near-IR band is complex, with a 107 cm(-1) progression in the metal-ligand stretch. The visible band shows clearly resolved vibrational progressions in the metal-ligand stretch and rock, and in the OCO bend, as observed by Brucat and co-workers. A vibrational hot band gives the metal-ligand stretch frequency in the ground electronic state nu3'' = 210 cm(-1). The OCO antisymmetric stretch frequency in the ground electronic state (nu1'') is measured by using vibrationally mediated photodissociation. An IR laser vibrationally excites ions to nu1'' = 1. Vibrationally excited ions selectively dissociate following absorption of a second, visible photon at the nu1' = 1 CO2, due to interaction with the metal. Larger blue shifts observed for complexes with fewer ligands agree with trends seen for larger V+(OCO)n clusters.
International Nuclear Information System (INIS)
Yang, Shuo; Noguchi, Hidenori; Uosaki, Kohei
2017-01-01
Highlights: • Electrochemical SFG spectroscopy is an efficient in situ probe of electronic structure at electrochemical interface. • Electrooxidation performances of CO adsorbed on polycrystalline Pt and Pt(111) electrodes were compared. • The enhanced SFG signal of CO on Pt electrodes was observed due to a vibrational-electronic double resonance effect. • The broader energy distribution of 5sa state of CO on polycrystalline Pt than on Pt(111) is proved by SFG results. - Abstract: Electrochemical cyclic voltammetry and potential dependent double resonance sum frequency generation (DR-SFG) spectroscopy were performed on CO adsorbed on polycrystalline Pt and Pt(111) electrodes in H_2SO_4 solution to examine the effect of substrate on the electronic structure of CO. The dependence of SFG intensity on potential and visible energy for atop CO band was observed on both polycrystalline and single crystalline Pt electrodes. Enhancement of the SFG intensity was determined to be a direct result of a surface electronic resonance of the visible/SF light with the electronic transition from Fermi level of Pt to the 5σ_a anti-bonding state of adsorbed CO, in agreement with previous results. Interestingly, when compared to the Pt(111) electrode, the distribution width of the intensity enhancement region on polycrystalline Pt is broader than on Pt(111). This suggests that the energy distribution of the 5σ_a state of CO on polycrystalline Pt surface is broader than that on Pt(111) due to the complex surface structure of the polycrystalline Pt electrode.
Sum Frequency Generation Studies of Hydrogenation Reactions on Platinum Nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Krier, James M. [Univ. of California, Berkeley, CA (United States)
2013-08-31
Sum Frequency Generation (SFG) vibrational spectroscopy is used to characterize intermediate species of hydrogenation reactions on the surface of platinum nanoparticle catalysts. In contrast to other spectroscopy techniques which operate in ultra-high vacuum or probe surface species after reaction, SFG collects information under normal conditions as the reaction is taking place. Several systems have been studied previously using SFG on single crystals, notably alkene hydrogenation on Pt(111). In this thesis, many aspects of SFG experiments on colloidal nanoparticles are explored for the first time. To address spectral interference by the capping agent (PVP), three procedures are proposed: UV cleaning, H2 induced disordering and calcination (core-shell nanoparticles). UV cleaning and calcination physically destroy organic capping while disordering reduces SFG signal through a reversible structural change by PVP.
Vibrations of bioionic liquids by ab initio molecular dynamics and vibrational spectroscopy.
Tanzi, Luana; Benassi, Paola; Nardone, Michele; Ramondo, Fabio
2014-12-26
Density functional theory and vibrational spectroscopy are used to investigate a class of bioionic liquids consisting of a choline cation and carboxylate anions. Through quantum mechanical studies of motionless ion pairs and molecular dynamics of small portions of the liquid, we have characterized important structural features of the ionic liquid. Hydrogen bonding produces stable ion pairs in the liquid and induces vibrational features of the carboxylate groups comparable with experimental results. Infrared and Raman spectra of liquids have been measured, and main bands have been assigned on the basis of theoretical spectra.
Energy Technology Data Exchange (ETDEWEB)
Koffas, Telly Stelianos [Univ. of California, Berkeley, CA (United States)
2004-01-01
Sum frequency generation (SFG) vibrational spectroscopy, atomic force microscopy (AFM), and other complementary surface-sensitive techniques have been used to study the surface molecular structure and surface mechanical behavior of biologically-relevant polymer systems. SFG and AFM have emerged as powerful analytical tools to deduce structure/property relationships, in situ, for polymers at air, liquid and solid interfaces. The experiments described in this dissertation have been performed to understand how polymer surface properties are linked to polymer bulk composition, substrate hydrophobicity, changes in the ambient environment (e.g., humidity and temperature), or the adsorption of macromolecules. The correlation of spectroscopic and mechanical data by SFG and AFM can become a powerful methodology to study and engineer materials with tailored surface properties. The overarching theme of this research is the interrogation of systems of increasing structural complexity, which allows us to extend conclusions made on simpler model systems. We begin by systematically describing the surface molecular composition and mechanical properties of polymers, copolymers, and blends having simple linear architectures. Subsequent chapters focus on networked hydrogel materials used as soft contact lenses and the adsorption of protein and surfactant at the polymer/liquid interface. The power of SFG is immediately demonstrated in experiments which identify the chemical parameters that influence the molecular composition and ordering of a polymer chain's side groups at the polymer/air and polymer/liquid interfaces. In general, side groups with increasingly greater hydrophobic character will be more surface active in air. Larger side groups impose steric restrictions, thus they will tend to be more randomly ordered than smaller hydrophobic groups. If exposed to a hydrophilic environment, such as water, the polymer chain will attempt to orient more of its hydrophilic groups to
Anharmonic Vibrational Spectroscopy on Metal Transition Complexes
Latouche, Camille; Bloino, Julien; Barone, Vincenzo
2014-06-01
Advances in hardware performance and the availability of efficient and reliable computational models have made possible the application of computational spectroscopy to ever larger molecular systems. The systematic interpretation of experimental data and the full characterization of complex molecules can then be facilitated. Focusing on vibrational spectroscopy, several approaches have been proposed to simulate spectra beyond the double harmonic approximation, so that more details become available. However, a routine use of such tools requires the preliminary definition of a valid protocol with the most appropriate combination of electronic structure and nuclear calculation models. Several benchmark of anharmonic calculations frequency have been realized on organic molecules. Nevertheless, benchmarks of organometallics or inorganic metal complexes at this level are strongly lacking despite the interest of these systems due to their strong emission and vibrational properties. Herein we report the benchmark study realized with anharmonic calculations on simple metal complexes, along with some pilot applications on systems of direct technological or biological interest.
Energy Technology Data Exchange (ETDEWEB)
Bratlie, Kaitlin [Univ. of California, Berkeley, CA (United States)
2007-01-01
Catalytic reactions of cyclohexene, benzene, n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene on platinum catalysts were monitored in situ via sum frequency generation (SFG) vibrational spectroscopy and gas chromatography (GC). SFG is a surface specific vibrational spectroscopic tool capable of monitoring submonolayer coverages under reaction conditions without gas-phase interference. SFG was used to identify the surface intermediates present during catalytic processes on Pt(111) and Pt(100) single-crystals and on cubic and cuboctahedra Pt nanoparticles in the Torr pressure regime and at high temperatures (300K-450K). At low pressures (<10-6 Torr), cyclohexene hydrogenated and dehydrogenates to form cyclohexyl (C6H11) and π-allyl C6H9, respectively, on Pt(100). Increasing pressures to 1.5 Torr form cyclohexyl, π-allyl C6H9, and 1,4-cyclohexadiene, illustrating the necessity to investigate catalytic reactions at high-pressures. Simultaneously, GC was used to acquire turnover rates that were correlated to reactive intermediates observed spectroscopically. Benzene hydrogenation on Pt(111) and Pt(100) illustrated structure sensitivity via both vibrational spectroscopy and kinetics. Both cyclohexane and cyclohexene were produced on Pt(111), while only cyclohexane was formed on Pt(100). Additionally, π-allyl c-C6H9 was found only on Pt(100), indicating that cyclohexene rapidly dehydrogenates on the (100) surface. The structure insensitive production of cyclohexane was found to exhibit a compensation effect and was analyzed using the selective energy transfer (SET) model. The SET model suggests that the Pt-H system donates energy to the E2u mode of free benzene, which leads to catalysis. Linear C6 (n-hexane, 2-methylpentane, 3-methylpentane, and 1-hexene) hydrocarbons were also investigated in the presence and absence of excess hydrogen on Pt
Two-Photon Vibrational Spectroscopy using local optical fields of gold and silver nanostructures
Kneipp, Katrin; Kneipp, Janina; Kneipp, Harald
2007-03-01
Spectroscopic effects can be strongly affected when they take place in the immediate vicinity of metal nanostructures due to coupling to surface plasmons. We introduce a new approach that suggests highly efficient two-photon labels as well as two-photon vibrational spectroscopy for non-destructive chemical probing. The underlying spectroscopic effect is the incoherent inelastic scattering of two photons on the vibrational quantum states performed in the enhanced local optical fields of gold nanoparticles, surface enhanced hyper Raman scattering (SEHRS). We infer effective two-photon cross sections for SEHRS on the order of 10^5 GM, similar or higher than the best known cross sections for two-photon fluorescence. SEHRS combines the advantages of two-photon spectroscopy with the structural information of vibrational spectroscopy, and the high sensitivity and nanometer-scale local confinement of plasmonics-based spectroscopy.
Toward yrast spectroscopy in soft vibrational nuclei
International Nuclear Information System (INIS)
Marumori, Toshio; Kuriyama, Atsushi; Sakata, Fumihiko.
1979-10-01
In a formally parallel way with that exciting progress has been recently achieved in understanding the yrast spectra of the rotational nuclei in terms of the quasi-particle motion in the rotating frame, an attempt to understand the yrast spectra of the vibrational nuclei in terms of the quasi-particle motion is proposed. The essential idea is to introduce the quasi-particle motion in a generalized vibrating frame, which can be regarded as a rotating frame in the gauge space of ''physical'' phonons where the number of the physical phonons plays the role of the angular momentum. On the basis of a simple fundamental principle called as the ''invariance principle of the Schroedinger equation'', which leads us to the ''maximal decoupling'' between the physical phonon and the intrinsic modes, it is shown that the vibrational frame as well as the physical-phonon-number operator represented by the quasi-particles can be self-consistently determined. A new scope toward the yrast spectroscopy of the vibrational nuclei in terms of the quasi-particle motion is discussed. (author)
A novel SFG structure for C-T high-pass filters
DEFF Research Database (Denmark)
Nielsen, Ivan Riis
1993-01-01
A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed. The increme......A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed....... The incremental integration structure is compared to the leapfrog and direct SFG simulation structures. Leapfrog high-pass filters are relatively simple and show good noise properties, but they are based on differentiators and thus stability problems exist. The direct SFG simulation method is based on integrators...... and has good stability properties, but it leads to a relatively high circuit complexity and a high noise level. However, the incremental integration structure inherits the low-noise properties of the leapfrog structure and the good stability of the direct SFG simulation method. A sixth-order elliptic high...
Resonance tunneling electron-vibrational spectroscopy of polyoxometalates.
Dalidchik, F I; Kovalevskii, S A; Balashov, E M
2017-05-21
The tunneling spectra of the ordered monolayer films of decamolybdodicobaltate (DMDC) compounds deposited from aqueous solutions on HOPG were measured by scanning tunnel microscopy in air. The DMDC spectra, as well as the tunneling spectra of other polyoxometalates (POMs), exhibit well-defined negative differential resistances (NDRs). The mechanism of formation of these spectral features was established from the collection of revealed NDR dependences on the external varying parameters and found to be common to all systems exhibiting Wannier-Stark localization. A model of biresonance tunneling was developed to provide an explanation for the totality of experimental data, both the literature and original, on the tunneling POM probing. A variant of the tunneling electron-vibrational POM spectroscopy was proposed allowing the determination of the three basic energy parameters-energy gaps between the occupied and unoccupied states, frequencies of the vibrational transitions accompanying biresonance electron-tunneling processes, and electron-vibrational interaction constants on the monomolecular level.
Ultrafast spectroscopy of model biological membranes
Ghosh, Avishek
2009-01-01
In this PhD thesis, I have described the novel time-resolved sum-frequency generation (TR-SFG) spectroscopic technique that I developed during the course of my PhD research and used it study the ultrafast vibrational, structural and orientational dynamics of water molecules at model biological
A Novel SFG Structure for C-T Highpass Filters
DEFF Research Database (Denmark)
Nielsen, Ivan Riis
1992-01-01
This paper presents the design of a sixth order elliptic highpass filter having a passband frequency of 3.0KHz, a passband ripple of 1.0dB and a stopband attenuation of 50dB. The filter is based on a novel integrator based SFG describing a passive prototype filter; this SFG is simulated using...
International Nuclear Information System (INIS)
2011-01-01
Spectroscopy has played and is playing a very important role as it is one of the most efficient methods of molecular structure studies with the help of which direct information about the chemical compounds can be obtained. Spectroscopy has its contribution in a number of branches in areas such as medicine, industry, environment, agriculture, power, construction, forensic analysis (both criminal and civil cases), etc., where it has revolutionized the very face of these sectors. Vibrational spectroscopic (Infrared and Raman) techniques have demonstrated potential to provide non-destructive, rapid clinically relevant diagnostic information. Raman and infrared spectroscopy enable the biochemical signatures from biological tissues to be extracted and analyzed there by advancing the treatment of cancer. Advancement in instrumentation has allowed the development of numerous infrared and Raman spectroscopic methods. Infrared spectroscopy is tremendously used in the fields of pharmaceuticals. medical diagnostics food and agrochemical quality control, and combustion research. Raman spectroscopy is used in condensed matter physics, biomedicinal fields for tissue analysis and chemistry to study vibrational, rotational, and other low-frequency modes in a system. Keeping in mind the fast development: in the Spectroscopy, we have planned to organize a national level conference for 2 days on 'Exploring the Frontiers of Vibrational Spectroscopy' to bring out the tremendous potential of various Spectroscopic techniques available at the global level. Papers relevant to INIS are indexed separately
Theory for Nonlinear Spectroscopy of Vibrational Polaritons
Ribeiro, RF; Dunkelberger, AD; Xiang, B; Xiong, W; Simpkins, BS; Owrutsky, JC; Yuen-Zhou, J
2017-01-01
Molecular polaritons have gained considerable attention due to their potential to control nanoscale molecular processes by harnessing electromagnetic coherence. Although recent experiments with liquid-phase vibrational polaritons have shown great promise for exploiting these effects, significant challenges remain in interpreting their spectroscopic signatures. In this letter, we develop a quantum-mechanical theory of pump-probe spectroscopy for this class of polaritons based on the quantum La...
Gaynor, James D.; Wetterer, Anna M.; Cochran, Rea M.; Valente, Edward J.; Mayer, Steven G.
2015-01-01
Raman spectroscopy is a powerful experimental technique, yet it is often missing from the undergraduate physical chemistry laboratory curriculum. Tetrachloromethane (CCl[subscript 4]) is the ideal molecule for an introductory vibrational spectroscopy experiment and the symmetric stretch vibration contains fine structure due to isotopic variations…
Vibrational spectroscopy in diagnosis and screening
Severcan, F
2012-01-01
In recent years there has been a tremendous growth in the use of vibrational spectroscopic methods for diagnosis and screening. These applications range from diagnosis of disease states in humans, such as cancer, to rapid identification and screening of microorganisms. The growth in such types of studies has been possible thanks to advances in instrumentation and associated computational and mathematical tools for data processing and analysis. This volume of Advances in Biomedical Spectroscopy contains chapters from leading experts who discuss the latest advances in the application of Fourier
Scenario Focus Group Workshop Report (2nd SFG Meeting)
Water Futures and Solution Initiative, (WFaS)
2016-01-01
The Scenario Focus Group (SFG) is comprised of water policy and planning decision makers at the national and international level who collaborate within the Water Futures and Solutions Initiative, primarily by identifying key water management challenges, priorities, trends, options, and trade-offs within their regions and advising on where further systems analysis and investigation would be most helpful for understanding externalities and guiding planning decisions. The SFG guides the developm...
On selection rules in vibrational and rotational molecular spectroscopy
International Nuclear Information System (INIS)
Guichardet, A.
1986-01-01
The aim of this work is a rigorous proof of the Selection Rules in Molecular Spectroscopy (Vibration and Rotation). To get this we give mathematically rigorous definitions of the (tensor) transition operators, in this case the electric dipole moment; this is done, firstly by considering the molecule as a set of point atomic kernels performing arbitrary motions, secondly by limiting ourselves either to infinitesimal vibration motions, or to arbitrary rotation motions. Then the selection rules follow from an abstract formulation of the Wigner-Eckart theorem. In a last paragraph we discuss the problem of separating vibration and rotation motions; very simple ideas from Differential Geometry, linked with the ''slice theorem'', allow us to define the relative speeds, the solid motions speeds, the Coriolis energies and the moving Eckart frames [fr
Sum frequency and second harmonic generation from the surface of a liquid microjet
International Nuclear Information System (INIS)
Smolentsev, Nikolay; Chen, Yixing; Roke, Sylvie; Jena, Kailash C.; Brown, Matthew A.
2014-01-01
The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena
Sum frequency and second harmonic generation from the surface of a liquid microjet
Energy Technology Data Exchange (ETDEWEB)
Smolentsev, Nikolay; Chen, Yixing; Roke, Sylvie, E-mail: sylvie.roke@epfl.ch [Laboratory for Fundamental Biophotonics (LBP), Institute of Bioengineering (IBI), School of Engineering STI, École Polytechnique Fédérale de Lausanne EPFL, 1015 Lausanne (Switzerland); Jena, Kailash C. [Laboratory for Fundamental Biophotonics (LBP), Institute of Bioengineering (IBI), School of Engineering STI, École Polytechnique Fédérale de Lausanne EPFL, 1015 Lausanne (Switzerland); Department of Physics, Indian Institute of Technology Ropar, Rupnagar, 140001 (India); Brown, Matthew A. [Laboratory for Surface Science and Technology, Department of Materials, ETH Zürich, CH-8093 Zurich (Switzerland)
2014-11-14
The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena.
Sum frequency and second harmonic generation from the surface of a liquid microjet
Smolentsev, Nikolay; Chen, Yixing; Jena, Kailash C.; Brown, Matthew A.; Roke, Sylvie
2014-11-01
The use of a liquid microjet as a possible source of interest for Second Harmonic Generation (SHG) and Sum Frequency Generation (SFG) spectroscopy is examined. We measured non-resonant SHG scattering patterns from the air/water interface of a microjet of pure water and observe a strong enhancement of the SHG signal for certain scattering angles. These enhancements can be explained by the optical properties and the shape of the liquid microjet. SFG experiments at the surface of a liquid microjet of ethanol in air show that it is also possible to measure the coherent vibrational SFG spectrum of the ethanol/air interface in this way. Our findings are useful for future far-UV or X-ray based nonlinear optical surface experiments on liquid jets. In addition, combined X-ray photoelectron spectroscopy and SHG/SFG measurements are feasible, which will be very useful in improving our understanding of the molecular foundations of electrostatic and chemical surface properties and phenomena.
Spectroscopie de vibration infrarouge du silicium amorphe ...
African Journals Online (AJOL)
... évaporé (a-Si:H) préparées dans un bâti ultra-vide (UHV). L'hydrogène atomique est obtenu à l'aide d'un plasma dans un tube à décharge dirigé vers le porte-substrat. Les fréquences de vibrations et la nature des liaisons Si-H ont été analysées à partir des mesures de spectroscopie infrarouge à transformée de Fourier.
Nonlinear spectroscopic studies of chiral media
International Nuclear Information System (INIS)
Belkin, Mikhail Alexandrovich
2004-01-01
Molecular chirality plays an important role in chemistry, biology, and medicine. Traditional optical techniques for probing chirality, such as circular dichroism and Raman optical activity rely on electric-dipole forbidden transitions. As a result, their intrinsic low sensitivity limits their use to probe bulk chirality rather than chiral surfaces, monolayers or thin films often important for chemical or biological systems. Contrary to the traditional chirality probes, chiral signal in sum-frequency generation (SFG) is electric-dipole allowed both on chiral surface and in chiral bulk making it a much more promising tool for probing molecular chirality. SFG from a chiral medium was first proposed in 1965, but had never been experimentally confirmed until this thesis work was performed. This thesis describes a set of experiments successfully demonstrating that chiral SFG responses from chiral monolayers and liquids are observable. It shows that, with tunable inputs, SFG can be used as a sensitive spectroscopic tool to probe chirality in both electronic and vibrational resonances of chiral molecules. The monolayer sensitivity is feasible in both cases. It also discusses the relevant theoretical models explaining the origin and the strength of the chiral signal in vibrational and electronic SFG spectroscopies
Lifescience Database Archive (English)
Full Text Available TAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAAXXXXXXXXXXAATGTCCANATTTCCATANATGTGT...>SFG168Z.Seq ----------AATGTCCANATTTCCATANATGTGTTNAAANACGTGGTGGTATNTTAAGN TGTGAATTTNANCCNCCAAGACAACCAAGATCCC...GTAAAATCAATTTGTAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAA----------AATGTCCANATTTCCATANATGTGTTNAA ANACGTGG
Vibrational dynamics of aqueous hydroxide solutions probed using broadband 2DIR spectroscopy
International Nuclear Information System (INIS)
Mandal, Aritra; Tokmakoff, Andrei
2015-01-01
We employed ultrafast transient absorption and broadband 2DIR spectroscopy to study the vibrational dynamics of aqueous hydroxide solutions by exciting the O–H stretch vibrations of the strongly hydrogen-bonded hydroxide solvation shell water and probing the continuum absorption of the solvated ion between 1500 and 3800 cm −1 . We observe rapid vibrational relaxation processes on 150–250 fs time scales across the entire probed spectral region as well as slower vibrational dynamics on 1–2 ps time scales. Furthermore, the O–H stretch excitation loses its frequency memory in 180 fs, and vibrational energy exchange between bulk-like water vibrations and hydroxide-associated water vibrations occurs in ∼200 fs. The fast dynamics in this system originate in strong nonlinear coupling between intra- and intermolecular vibrations and are explained in terms of non-adiabatic vibrational relaxation. These measurements indicate that the vibrational dynamics of the aqueous hydroxide complex are faster than the time scales reported for long-range transport of protons in aqueous hydroxide solutions
Vibrational spectroscopy at high external pressures the diamond anvil cell
Ferraro, John R
1984-01-01
Vibrational Spectroscopy at High External Pressures: The Diamond Anvil Cell presents the effects of high pressure on the vibrational properties of materials as accomplished in a diamond anvil cell (DAC). The DAC serves the dual purpose of generating the pressures and being transparent to infrared radiation, allowing the observation of changes caused by pressure. The optical probes highlighted will deal principally with infrared and Raman scattering, although some observations in the visible region will also be presented. The book begins with a discussion of the effects of pressure and pres
Vibrational spectroscopy on intermolecular interactions in solutions and at interfaces
Nissink, Johannes Wilhelmus Maria
1999-01-01
In recent years, considerable progress has been made in the areas of molecular recognition and surface analysis. These fields meet in the field of sensor development, where the interaction between molecules and a suitably modified surface is of utmost importance. Vibrational spectroscopy is quite
A Novel SFG Structure for C-T Highpass Filters
Nielsen, Ivan Riis
1992-01-01
This paper presents the design of a sixth order elliptic highpass filter having a passband frequency of 3.0KHz, a passband ripple of 1.0dB and a stopband attenuation of 50dB. The filter is based on a novel integrator based SFG describing a passive prototype filter; this SFG is simulated using MOSFET-C building blocks. The noise performance is considerably enhanced when compared to other highpass filter structures. Well within the stopband the output noise is dominated by amplifier noise, but ...
Vibrational spectroscopy of the borate mineral kotoite Mg₃(BO₃)₂.
Frost, Ray L; Xi, Yunfei
2013-02-15
Vibrational spectroscopy has been used to assess the structure of kotoite a borate mineral of magnesium which is isostructural with jimboite. The mineral is orthorhombic with point group: 2/m 2/m 2/m. The mineral has the potential as a new memory insulator material. The mineral has been characterised by a combination of Raman and infrared spectroscopy. The Raman spectrum is dominated by a very intense band at 835 cm(-1), assigned to the symmetric stretching mode of tetrahedral boron. Raman bands at 919, 985 and 1015 cm(-1) are attributed to the antisymmetric stretching modes of tetrahedral boron. Kotoite is strictly an hydrous borate mineral. An intense Raman band observed at 3559 cm(-1) is attributed to the stretching vibration of hydroxyl units, more likely to be associated with the borate mineral hydroxyborate. The lack of observation of water bending modes proves the absence of water in the kotoite structure. Copyright © 2012 Elsevier B.V. All rights reserved.
A novel SFG structure for C-T high-pass filters
Nielsen, Ivan Riis
1993-01-01
A signal flow graph (SFG) structure for simulating passive high-pass ladder filters, called the incremental integration structure, is proposed. The structure requires the use of integrators with nonintegrating inputs, and an implementation based on the MOSFET-C technique is discussed. The incremental integration structure is compared to the leapfrog and direct SFG simulation structures. Leapfrog high-pass filters are relatively simple and show good noise properties, but they are based on diff...
Competition between SFG and two SHGs in broadband type-I QPM
Dang, Weirui; Chen, Yuping; Gong, Mingjun; Chen, Xianfeng
2013-03-01
In this paper, we have studied the characteristics of second-order nonlinear interactions with band-overlapped type-I quasi-phase-matching (QPM) second harmonic generation (SHG) and sum-frequency generation (SFG), and predicted a blue-shift with a band-narrowing of their bands and a sunken response in the SFG curve, which are due to the phase-matching-dependent competition between band-overlapped SHG and SFG processes. This prediction is then verified by the experiment in an 18-mm-long bulk MgO-doped periodically poled lithium niobate crystal (MgO:PPLN) and may provide the candidate solution to output controlling for flexible broadcast wavelength conversion, channel-selective wavelength conversion and all-optical logic gates by cascaded QPM second-order nonlinear processes.
Lee, Christopher M; Kubicki, James D; Fan, Bingxin; Zhong, Linghao; Jarvis, Michael C; Kim, Seong H
2015-12-10
Hydrogen bonds play critical roles in noncovalent directional interactions determining the crystal structure of cellulose. Although diffraction studies accurately determined the coordinates of carbon and oxygen atoms in crystalline cellulose, the structural information on hydrogen atoms involved in hydrogen-bonding is still elusive. This could be complemented by vibrational spectroscopy; but the assignment of the OH stretch peaks has been controversial. In this study, we performed calculations using density functional theory with dispersion corrections (DFT-D2) for the cellulose Iβ crystal lattices with the experimentally determined carbon and oxygen coordinates. DFT-D2 calculations revealed that the OH stretch vibrations of cellulose are highly coupled and delocalized through intra- and interchain hydrogen bonds involving all OH groups in the crystal. Additionally, molecular dynamics (MD) simulations of a single cellulose microfibril showed that the conformations of OH groups exposed at the microfibril surface are not well-defined. Comparison of the computation results with the experimentally determined IR dichroism of uniaxially aligned cellulose microfibrils and the peak positions of various cellulose crystals allowed unambiguous identification of OH stretch modes observed in the vibrational spectra of cellulose.
[Structure analysis of disease-related proteins using vibrational spectroscopy].
Hiramatsu, Hirotsugu
2014-01-01
Analyses of the structure and properties of identified pathogenic proteins are important for elucidating the molecular basis of diseases and in drug discovery research. Vibrational spectroscopy has advantages over other techniques in terms of sensitivity of detection of structural changes. Spectral analysis, however, is complicated because the spectrum involves a substantial amount of information. This article includes examples of structural analysis of disease-related proteins using vibrational spectroscopy in combination with additional techniques that facilitate data acquisition and analysis. Residue-specific conformation analysis of an amyloid fibril was conducted using IR absorption spectroscopy in combination with (13)C-isotope labeling, linear dichroism measurement, and analysis of amide I band features. We reveal a pH-dependent property of the interacting segment of an amyloidogenic protein, β2-microglobulin, which causes dialysis-related amyloidosis. We also reveal the molecular mechanisms underlying pH-dependent sugar-binding activity of human galectin-1, which is involved in cell adhesion, using spectroscopic techniques including UV resonance Raman spectroscopy. The decreased activity at acidic pH was attributed to a conformational change in the sugar-binding pocket caused by protonation of His52 (pKa 6.3) and the cation-π interaction between Trp68 and the protonated His44 (pKa 5.7). In addition, we show that the peak positions of the Raman bands of the C4=C5 stretching mode at approximately 1600 cm(-1) and the Nπ-C2-Nτ bending mode at approximately 1405 cm(-1) serve as markers of the His side-chain structure. The Raman signal was enhanced 12 fold using a vertical flow apparatus.
Nonlinear vibrational spectroscopy of surfactants at liquid interfaces
Miranda, Paulo Barbeitas
Surfactants are widely used to modify physical and chemical properties of interfaces. They play an important role in many technological problems. Surfactant monolayers are also of great scientific interest because they are two-dimensional systems that may exhibit a very rich phase transition behavior and can also be considered as a model system for biological interfaces. In this Thesis, we use a second-order nonlinear optical technique (Sum-Frequency Generation - SFG) to obtain vibrational spectra of surfactant monolayers at liquid/vapor and solid/liquid interfaces. The technique has several advantages: it is intrinsically surface-specific, can be applied to buried interfaces, has submonolayer sensitivity and is remarkably sensitive to the conformational order of surfactant monolayers. The first part of the Thesis is concerned with surfactant monolayers at the air/water interface (Langmuir films). Surface crystallization of an alcohol Langmuir film and of liquid alkanes are studied and their phase transition behaviors are found to be of different nature, although driven by similar intermolecular interactions. The effect of crystalline order of Langmuir monolayers on the interfacial water structure is also investigated. It is shown that water forms a well-ordered hydrogen-bonded network underneath an alcohol monolayer, in contrast to a fatty acid monolayer which induces a more disordered structure. In the latter case, ionization of the monolayer becomes more significant with increase of the water pH value, leading to an electric-field-induced ordering of interfacial water molecules. We also show that the orientation and conformation of fairly complicated molecules in a Langmuir monolayer can be completely mapped out using a combination of SFG and second harmonic generation (SHG). For a quantitative analysis of molecular orientation at an interface, local-field corrections must be included. The second part is a study of self-assembled surfactant monolayers at the
Eisawi, Nagwa M; Hassan, Dina A; Hussien, Mohammed O; Musa, Azza B; El Hussein, Abdel Rahim M
2017-05-01
Spotted fever group (SFG) rickettsiosis is caused by obligatory intracellular Gram-negative bacteria that belong to the genus Rickettsia . Ticks belonging to the family Ixodidae can act as vectors, reservoirs or amplifiers of SFG rickettsiae. This study was conducted to estimate the seroprevalence of SFG rickettsioses in cattle, sheep and goats from Khartoum State, Sudan. Blood samples were collected from a total of 600 animals (sheep, goats and cattle) from 32 different farms distributed in three locations in Khartoum State during the period January to December 2012. Sera were tested for antibodies against SFG rickettsiae using IFAT. The prevalence of seropositivity was 59.3% in sheep, 60.1% in goats and 64.4% in cattle. Season was significantly ( P < 0.05) associated with seroprevalence of SFG rickettsiae in cattle during winter. The SFG rickettsiae antibodies prevalence was significantly higher in female compared with male in sheep, but there were no significant differences between male and female in either cattle or goats. The prevalence was significantly higher in adult animals compared with young in both sheep and goats. With regard to management system, there was a significant difference in the prevalence in cattle raised in closed system compared with those raised in semi-intensive system. In contrast, there was significant difference in the seroprevalence of SFG in sheep where the prevalence was higher in the sheep raised in semi-intensive system compared with those raised in close system. There was no significant difference in the seroprevalence in goats with regard to management systems. The unexpected high prevalence of SFG rickettsia antibodies in domestic ruminants sera suggest that the veterinary and public health impact of these agents in Sudan need further evaluation especially in humans.
Bandshapes in vibrational spectroscopy
International Nuclear Information System (INIS)
Dijkman, F.G.
1978-01-01
A detailed account is given of the development of modern bandshape theories since 1965. An investigation into the relative contributions of statistical irreversible relaxation processes is described, for a series of molecules in which gradually the length of one molecular axis is increased. An investigation into the theoretical and experimental investigation of the broadening brought about by the effect of fluctuating intermolecular potentials on the vibrational frequency is also described. The effect of an intermolecular perturbative potential on anharmonic and Morse oscillators is discussed and the results are presented of a computation on the broadening of the vibrational band of some diatomic molecules in a rigid lattice type solvent. The broadening of the OH-stretching vibration in a number of aliphatic alcohols, the vibrational bandshapes of the acetylenic C-H stretching vibration and of the symmetric methyl stretching vibration are investigated. (Auth./ C.F.)
Vibrational Spectroscopy of Intramolecular Hydrogen Bonds in the Infrared and Near-Infrared Regions
DEFF Research Database (Denmark)
Schrøder, Sidsel Dahl
and 1,4-diaminobutane). Experimentally, the hydrogen bonds have been studied with vibrational spectroscopy in the infrared and near-infrared regions. The focus is primarily on spectra recorded in the near-infrared regions, which in these studies are dominated by O-H and N-H stretching overtones....... Overtone spectra have been recorded with intracavity laser photoacoustic laser spectroscopy and conventional long path absorption spectroscopy. Theoretically, a combination of electronic structure calculations and local mode models have been employed to guide the assignment of bands in the vibrational......,4-diaminobutane, no sign of intramolecular N-H···N hydrogen bonds were identified in the overtone spectra. However, theoretical analyzes indicate that intramolecular N-H···N hydrogen bonds are present in all three diamines if two hydrogen atoms on one of the methylene groups are substituted with triuoromethyl...
SFG spectroscopy from 10 -8 to 1000 mbar: less-ordered CO structures and coadsorption on Pd (1 1 1)
Morkel, Matthias; Unterhalt, Holger; Salmeron, Miquel; Rupprechter, Günther; Freund, Hans-Joachim
2003-06-01
Vibrational sum frequency generation spectroscopy was employed to study "less-ordered" phases resulting from low-temperature CO exposure on Pd(1 1 1). Such imperfect structures may also occur under catalytic reaction conditions up to 1000 mbar and originate from the superposition of ordered structures when the CO mobility and flux were insufficient. The effect of coadsorbed hydrogen and water was also examined.
Vibrational Spectroscopy on Photoexcited Dye-Sensitized Films via Pump-Degenerate Four-Wave Mixing.
Abraham, Baxter; Fan, Hao; Galoppini, Elena; Gundlach, Lars
2018-03-01
Molecular sensitization of semiconductor films is an important technology for energy and environmental applications including solar energy conversion, photocatalytic hydrogen production, and water purification. Dye-sensitized films are also scientifically complex and interesting systems with a long history of research. In most applications, photoinduced heterogeneous electron transfer (HET) at the molecule/semiconductor interface is of critical importance, and while great progress has been made in understanding HET, many open questions remain. Of particular interest is the role of combined electronic and vibrational effects and coherence of the dye during HET. The ultrafast nature of the process, the rapid intramolecular vibrational energy redistribution, and vibrational cooling present complications in the study of vibronic coupling in HET. We present the application of a time domain vibrational spectroscopy-pump-degenerate four-wave mixing (pump-DFWM)-to dye-sensitized solid-state semiconductor films. Pump-DFWM can measure Raman-active vibrational modes that are triggered by excitation of the sample with an actinic pump pulse. Modifications to the instrument for solid-state samples and its application to an anatase TiO 2 film sensitized by a Zn-porphyrin dye are discussed. We show an effective combination of experimental techniques to overcome typical challenges in measuring solid-state samples with laser spectroscopy and observe molecular vibrations following HET in a picosecond time window. The cation spectrum of the dye shows modes that can be assigned to the linker group and a mode that is localized on the Zn-phorphyrin chromophore and that is connected to photoexcitation.
Damage-free vibrational spectroscopy of biological materials in the electron microscope.
Rez, Peter; Aoki, Toshihiro; March, Katia; Gur, Dvir; Krivanek, Ondrej L; Dellby, Niklas; Lovejoy, Tracy C; Wolf, Sharon G; Cohen, Hagai
2016-03-10
Vibrational spectroscopy in the electron microscope would be transformative in the study of biological samples, provided that radiation damage could be prevented. However, electron beams typically create high-energy excitations that severely accelerate sample degradation. Here this major difficulty is overcome using an 'aloof' electron beam, positioned tens of nanometres away from the sample: high-energy excitations are suppressed, while vibrational modes of energies electron energy loss spectra from biogenic guanine crystals in their native state, resolving their characteristic C-H, N-H and C=O vibrational signatures with no observable radiation damage. The technique opens up the possibility of non-damaging compositional analyses of organic functional groups, including non-crystalline biological materials, at a spatial resolution of ∼10 nm, simultaneously combined with imaging in the electron microscope.
Energy Technology Data Exchange (ETDEWEB)
Cahoon, James Francis [Univ. of California, Berkeley, CA (United States)
2008-12-01
One and two dimensional time-resolved vibrational spectroscopy has been used to investigate the elementary reactions of several prototypical organometallic complexes in room temperature solution. The electron transfer and ligand substitution reactions of photogenerated 17-electron organometallic radicals CpW(CO)3 and CpFe(CO)2 have been examined with one dimensional spectroscopy on the picosecond through microsecond time-scales, revealing the importance of caging effects and odd-electron intermediates in these reactions. Similarly, an investigation of the photophysics of the simple Fischer carbene complex Cr(CO)5[CMe(OMe)] showed that this class of molecule undergoes an unusual molecular rearrangement on the picosecond time-scale, briefly forming a metal-ketene complex. Although time-resolved spectroscopy has long been used for these types of photoinitiated reactions, the advent of two dimensional vibrational spectroscopy (2D-IR) opens the possibility to examine the ultrafast dynamics of molecules under thermal equilibrium conditions. Using this method, the picosecond fluxional rearrangements of the model metal carbonyl Fe(CO)5 have been examined, revealing the mechanism, time-scale, and transition state of the fluxional reaction. The success of this experiment demonstrates that 2D-IR is a powerful technique to examine the thermally-driven, ultrafast rearrangements of organometallic molecules in solution.
Zyubin, A.; Konstantinova, E.; Slezhkin, V.; Matveeva, K.; Samusev, I.; Bryukhanov, V.
2017-12-01
In this paper we perform results of conformational analysis of septic human serum albumin (HSA) carried out by Raman spectroscopy (RS), infrared (IR) spectroscopy and fluorescent spectroscopy. The main vibrational groups were identified and analyzed for septic HSA and its health control. Comparison between Raman and IR results were done. Fluorescent spectral changes of Trp-214 group were analyzed. Application of Raman, IR spectroscopy, fluorescent spectroscopy for conformational changes study of HSA during pathology were shown.
Edler, J.; Hamm, P.
2003-08-01
Two-dimensional infrared (2D-IR) spectroscopy is applied to investigate acetanilide, a molecular crystal consisting of quasi-one-dimensional hydrogen bonded peptide units. The amide-I band exhibits a double peak structure, which has been attributed to different mechanisms including vibrational self-trapping, a Fermi resonance, or the existence of two conformational substates. The 2D-IR spectrum of crystalline acetanilide is compared with that of two different molecular systems: (i) benzoylchloride, which exhibits a strong symmetric Fermi resonance and (ii) N-methylacetamide dissolved in methanol which occurs in two spectroscopically distinguishable conformations. Both 2D-IR spectra differ significantly from that of crystalline acetanilide, proving that these two alternative mechanisms cannot account for the anomalous spectroscopy of crystalline acetanilide. On the other hand, vibrational self-trapping of the amide-I band can naturally explain the 2D-IR response.
Wang, Jian; Sun, Junqiang
2005-11-01
A novel all-optical format conversion scheme from NRZ to RZ based on sum-frequency generation (SFG) in a periodically poled LiNbO 3 (PPLN) waveguide is proposed, using a nonlinear optical loop mirror (NOLM). The conversion mechanism relies on the combination of attenuation and nonlinear phase shift induced on the clockwise signal field during the SFG process. The SFG between pump, and co- and counter- propagating signals in the PPLN waveguide are numerically studied, showing that counter-propagating SFG can be ignored when quasi-phase matching (QPM) for SFG during co-propagating interaction. The nonlinear phase shift induced on the clockwise signal field is analyzed in detail, showing that it is more effective to yield large values for nonlinear phase shift when appropriately phase mismatched for the SFG process. Two tuning schemes are proposed depend on whether the sum-frequency wavelength is variable or fixed. It is found that the latter has a rather wide 3dB signal conversion bandwidth approximately 154nm. Finally, the influence of reversible process of SFG is discussed and the optimum arrangement of pump and signal peak powers is theoretically demonstrated. The result shows that proper power arrangement, pump width, and waveguide length are necessary for achieving a good conversion effect.
Coadsorption and reaction of H2 and CO on Raney nickel: Neutron vibrational spectroscopy
International Nuclear Information System (INIS)
Kelley, R.D.; Kernforschungsanlage Juelich G.m.b.H.
1983-01-01
Neutron vibration spectroscopy is used to study the adsorption and reaction of H 2 and Co on a catalytic nickel surface. The sample was first exposed to H 2 and than to CO. At low temperatures there is no change of vibrational modes of H in the three-fold site; at a higher temperature changes occur. Some conclusions are drawn on the reaction product. (G.Q.)
Baio, Joseph E.
There are many techniques that allow surface scientists to study interfaces. However, few are routinely applied to probe biological surfaces. The work presented here demonstrates how detailed information about the conformation, orientation, chemical state, and molecular structure of biological molecules immobilized onto a surface can be assessed by electron spectroscopy, mass spectrometry, and nonlinear vibrational spectroscopy techniques. This investigation began with the development of simple model systems (small proteins, and peptides) and evolved into a study of more complex --- real world systems. Initially, two model systems based on the chemical and electrostatic immobilization of a small rigid protein (Protein G B1 domain, 6kDa) were built to develop the capabilities of time-of-flight secondary ion mass spectrometry (ToFSIMS), near edge X-ray absorption fine structure spectroscopy (NEXAFS) and sum frequency generation (SFG) spectroscopy as tools to probe the structure of surface immobilized proteins. X-ray photoelectron spectroscopy (XPS) was used to measure the amount of immobilized protein and ToF-SIMS sampled the amino acid composition of the exposed surface of the protein film. Within the ToF-SIMS spectra, an enrichment of secondary ions from amino acids located at opposite ends of the proteins were used to describe protein orientation. SFG spectral peaks characteristic of ordered alpha-helix and beta-sheet elements were observed for both systems and the phase of the peaks indicated a predominantly upright orientation for both the covalent and electrostatic configurations. Polarization dependence of the NEXAFS signal from the N 1s to pi* transition of the peptide bonds that make up the beta-sheets also indicated protein ordering at the surface. Building upon the Protein G B1 studies, the orientation and structure of a surface immobilized antibody (HuLys Fv: variant of humanized anti-lysozyme variable fragment, 26kDa) was characterized across two
International Nuclear Information System (INIS)
Tourillon, Gerard; Dreesen, Laurent; Volcke, Cedric; Sartenaer, Yannick; Thiry, Paul A; Peremans, Andre
2007-01-01
We show that sum-frequency generation spectroscopy performed in the total internal reflection configuration (TIR-SFG) combined with a dense gold nanoparticles monolayer allows us to study, with an excellent signal to noise ratio and high signal to background ratio, the conformation of adsorbed molecules. Dodecanethiol (DDT) was used as probe molecules in order to assess the potentialities of the approach. An enhancement of more than one order of magnitude of the SFG signals arising from the adsorbed species is observed with the TIR geometry compared to the external reflection one while the SFG non-resonant contribution remains the same for both configurations. Although further work is required to fully understand the origin of the SFG process on nanoparticles, our work opens new possibilities for studying nanostructures
Directory of Open Access Journals (Sweden)
Serena Carlesi
2017-01-01
Full Text Available A comprehensive dataset of vibrational spectra of different natural organic binding media is presented and discussed. The binding media were applied on a glass substrate and analyzed after three months of natural ageing. The combination of Raman and FT-NIR spectroscopies allows for an improved identification of these materials as Raman technique is more informative about the skeletal vibrations, while FT-NIR spectroscopy is more sensitive to the substituents and polar groups. The experimental results are initially discussed in the framework of current spectral assignment. Then, multivariate analysis (PCA is applied leading to differentiation among the samples. The two major principal components allow for a complete separation of the different classes of organic materials. Further differentiation within the same class is possible thanks to the secondary components. The loadings obtained from PCA are discussed on the basis of the spectral assignment leading to clear understanding of the physical basis of this differentiation process.
Vibrational spectroscopy of proteins
International Nuclear Information System (INIS)
Schwaighofer, A.
2013-01-01
Two important steps for the development of a biosensor are the immobilization of the biological component (e.g. protein) on a surface and the enhancement of the signal to improve the sensitivity of detection. To address these subjects, the present work describes Fourier transform infrared (FTIR) investigations of several proteins bound to the surface of an attenuated total reflection (ATR) crystal. Furthermore, new nanostructured surfaces for signal enhancement were developed for use in FTIR microscopy. The mitochondrial redox-protein cytochrome c oxidase (CcO) was incorporated into a protein-tethered bilayer lipid membrane (ptBLM) on an ATR crystal featuring a roughened two-layer gold surface for signal enhancement. Electrochemical excitation by periodic potential pulses at different modulation frequencies was followed by time-resolved FTIR spectroscopy. Phase sensitive detection was used for deconvolution of the IR spectra into vibrational components. A model based on protonation-dependent chemical reaction kinetics could be fitted to the time evolution of IR bands attributed to several different redox centers of the CcO. Further investigations involved the odorant binding protein 14 (OBP14) of the honey bee (Apis mellifera), which was studied using ATR-FTIR spectroscopy and circular dichroism. OBP14 was found to be thermally stable up to 45 °C, thus permitting the potential application of this protein for the fabrication of biosensors. Thermal denaturation measurements showed that odorant binding increases the thermal stability of the OBP-odorant complex. In another project, plasmonic nanostructures were fabricated that enhance the absorbance in FTIR microscopy measurements. The nanostructures are composed of an array of round-shaped insulator and gold discs on top of a continuous gold layer. Enhancement factors of up to ⁓125 could be observed with self-assembled monolayers of dodecanethiol molecules immobilized on the gold surface (author) [de
Directory of Open Access Journals (Sweden)
Liangdong Zhu
2015-04-01
Full Text Available Femtosecond stimulated Raman spectroscopy (FSRS is an emerging molecular structural dynamics technique for functional materials characterization typically in the visible to near-IR range. To expand its applications we have developed a versatile FSRS setup in the ultraviolet region. We use the combination of a narrowband, ~400 nm Raman pump from a home-built second harmonic bandwidth compressor and a tunable broadband probe pulse from sum-frequency-generation-based cascaded four-wave mixing (SFG-CFWM laser sidebands in a thin BBO crystal. The ground state Raman spectrum of a laser dye Quinolon 390 in methanol that strongly absorbs at ~355 nm is systematically studied as a standard sample to provide previously unavailable spectroscopic characterization in the vibrational domain. Both the Stokes and anti-Stokes Raman spectra can be collected by selecting different orders of SFG-CFWM sidebands as the probe pulse. The stimulated Raman gain with the 402 nm Raman pump is >21 times larger than that with the 550 nm Raman pump when measured at the 1317 cm−1 peak for the aromatic ring deformation and ring-H rocking mode of the dye molecule, demonstrating that pre-resonance enhancement is effectively achieved in the unique UV-FSRS setup. This added tunability in the versatile and compact optical setup enables FSRS to better capture transient conformational snapshots of photosensitive molecules that absorb in the UV range.
General principles of vibrational spectroscopies
Weckhuysen, B.M.; Schoonheydt, R.A.
2000-01-01
Atoms in molecules and solids do not remain in fixed relative positions, but vibrate about some mean position. This vibrational motion is quantized and at room temperature, most of the molecules in a given sample are in their lowest vibrational state. Absorption of electromagnetic radiation with
Vibrational spectroscopy: a tool being developed for the noninvasive monitoring of wound healing
Crane, Nicole J.; Elster, Eric A.
2012-01-01
Wound care and management accounted for over 1.8 million hospital discharges in 2009. The complex nature of wound physiology involves hundreds of overlapping processes that we have only begun to understand over the past three decades. The management of wounds remains a significant challenge for inexperienced clinicians. The ensuing inflammatory response ultimately dictates the pace of wound healing and tissue regeneration. Consequently, the eventual timing of wound closure or definitive coverage is often subjective. Some wounds fail to close, or dehisce, despite the use and application of novel wound-specific treatment modalities. An understanding of the molecular environment of acute and chronic wounds throughout the wound-healing process can provide valuable insight into the mechanisms associated with the patient's outcome. Pathologic alterations of wounds are accompanied by fundamental changes in the molecular environment that can be analyzed by vibrational spectroscopy. Vibrational spectroscopy, specifically Raman and Fourier transform infrared spectroscopy, offers the capability to accurately detect and identify the various molecules that compose the extracellular matrix during wound healing in their native state. The identified changes might provide the objective markers of wound healing, which can then be integrated with clinical characteristics to guide the management of wounds.
A compact OPO/SFG laser for ultraviolet biological sensing
Tiihonen, Mikael; Pasiskevicius, Valdas; Laurell, Fredrik; Jonsson, Per; Lindgren, Mikael
2004-07-01
A compact parametric oscillator (OPO) with intracavity sum-frequency generation (SFG) to generate 293 nm UV laser irradiation, was developed. The OPO/SFG device was pumped by a 100 Hz Nd:YAG laser (1064 nm) of own design, including subsequent second harmonic generation (SHG) in an external periodically poled KTiOPO4 (KTP) crystal. The whole system could be used to deliver more than 30 μJ laser irradiation per pulse (100 Hz) at 293 nm. The UV laser light was introduced in an optical fiber attached to a sample compartment allowing detection of fluorescence emission using a commercial spectrometer. Aqueous samples containing biomolecules (ovalbumin) or bacteria spores (Bacillus subtilis) were excited by the UV-light at 293 nm resulting in strong fluorescence emission in the range 325 - 600 nm.
Cozzolino, Daniel
2015-03-30
Vibrational spectroscopy encompasses a number of techniques and methods including ultra-violet, visible, Fourier transform infrared or mid infrared, near infrared and Raman spectroscopy. The use and application of spectroscopy generates spectra containing hundreds of variables (absorbances at each wavenumbers or wavelengths), resulting in the production of large data sets representing the chemical and biochemical wine fingerprint. Multivariate data analysis techniques are then required to handle the large amount of data generated in order to interpret the spectra in a meaningful way in order to develop a specific application. This paper focuses on the developments of sample presentation and main sources of error when vibrational spectroscopy methods are applied in wine analysis. Recent and novel applications will be discussed as examples of these developments. © 2014 Society of Chemical Industry.
Vibrational Spectroscopy of Chemical Species in Silicon and Silicon-Rich Nitride Thin Films
Directory of Open Access Journals (Sweden)
Kirill O. Bugaev
2012-01-01
Full Text Available Vibrational properties of hydrogenated silicon-rich nitride (SiN:H of various stoichiometry (0.6≤≤1.3 and hydrogenated amorphous silicon (a-Si:H films were studied using Raman spectroscopy and Fourier transform infrared spectroscopy. Furnace annealing during 5 hours in Ar ambient at 1130∘C and pulse laser annealing were applied to modify the structure of films. Surprisingly, after annealing with such high-thermal budget, according to the FTIR data, the nearly stoichiometric silicon nitride film contains hydrogen in the form of Si–H bonds. From analysis of the FTIR data of the Si–N bond vibrations, one can conclude that silicon nitride is partly crystallized. According to the Raman data a-Si:H films with hydrogen concentration 15% and lower contain mainly Si–H chemical species, and films with hydrogen concentration 30–35% contain mainly Si–H2 chemical species. Nanosecond pulse laser treatments lead to crystallization of the films and its dehydrogenization.
Collective vibrational spectra of α- and γ-glycine studied by terahertz and Raman spectroscopy
International Nuclear Information System (INIS)
Shi Yulei; Wang Li
2005-01-01
Terahertz time-domain spectroscopy is used to investigate the absorption and dispersion of polycrystalline α- and γ-glycine in the spectral region 0.5-3.0 THz. The spectra exhibit distinct features in these two crystalline phases. The observed far-infrared responses are attributed to intermolecular vibrational modes mediated by hydrogen bonds. We also measure the Raman spectra of the polycrystalline and dissolved glycine in the frequency range 28-3900 cm -1 . The results show that all the vibrational modes below 200 cm -1 are nonlocalized but are of a collective (phonon-like) nature. Furthermore, the temperature dependence of the Raman spectra of α-glycine agrees with the anharmonicity mechanism of the vibrational potentials
International Nuclear Information System (INIS)
Vieira, M.M.F.
1985-01-01
Vibrational-rotational overtones absorption solid hydrogens (H 2 , D 2 , HD) is studied using pulsed laser piezoeletric transducer (PULPIT) optoacoustic spectroscopy is studied. A general downward shift in energy from isolated molecular energies is observed. Studying normal-hydrogen it was observed that the phonon excitations associated with double-molecular transitions are predominantly transverse-optical phonons, whereas the excitations associated with single-molecular transitions are predominantly longitudinal - optical phonons. Multiplet structures were observed for certain double transitions in parahydrogen and orthodeuterium. The HD spectrum, besides presenting the sharp zero-phonon lines and the associated phonon side bands, like H 2 and D 2 , showed also two different features. This observation was common to all the transitions involving pure rotational excitation in H 2 and D 2 , which showed broad linewidths. This, together with some other facts (fluorescence lifetime *approx*10 5 sec; weak internal vibration and lattice coupling), led to the proposition of a mechanism for the fast nonradiative relaxation in solid hydrogens, implied from some observed experimental evidences. This relaxation, due to strong coupling, would happen in two steps: the internal vibration modes would relax to the rotational modes of the molecules, and then this rotational modes would relax to the lattice vibration modes. (Author) [pt
International Nuclear Information System (INIS)
Myo Myat Thet; Win Kyaw; Yin Maung Maung; Ko Ko Kyaw Soe
2008-03-01
The Zn0.72Li0.28O/Si (x = 0.28mol%) thin layers were fabricated on p-Si(100) substrate with five different process temperature. Vibrational characterizations of those thin films were investigated by FT- Raman spectroscopy. The resulted spectral line characters have been compared with that of Zn0.72Li0.28O/Glass thin films. Some vibrational motions of starting materials and final(candidate) thin films molecules were found in two substrates of glass and Si and vibrational frequencies were assigned by using molecular spectroscopy. Most of the frequencies of starting and final materials were found to be shifted in each of the films of two different substrates.
Santos, Cherry S; Baldelli, Steven
2009-01-29
The gas-liquid interface of halide-free 1,3-dialkylimidazolium alkyl sulfates [RMIM][R-OSO(3)] with R chain length from C(1)-C(4) and C(8) has been studied systematically using the surface-specific sum frequency generation (SFG) vibrational spectroscopy and surface tension measurements. From the SFG spectra, vibrational modes from the methyl group of both cation and anion are observed for all ionic liquid samples considered in the present study. These results suggest the presence of both ions at the gas-liquid interface, which is further supported by surface tension measurements. Surface tension data show a decreasing trend as the alkyl chain in the imidazolium cation is varied from methyl to butyl chain, with a specific anion. A similar trend is observed when the alkyl chain of the anion is modified and the cation is fixed.
International Nuclear Information System (INIS)
Schröter, M.; Ivanov, S.D.; Schulze, J.; Polyutov, S.P.; Yan, Y.; Pullerits, T.; Kühn, O.
2015-01-01
The influence of exciton–vibrational coupling on the optical and transport properties of molecular aggregates is an old problem that gained renewed interest in recent years. On the experimental side, various nonlinear spectroscopic techniques gave insight into the dynamics of systems as complex as photosynthetic antennae. Striking evidence was gathered that in these protein–pigment complexes quantum coherence is operative even at room temperature conditions. Investigations were triggered to understand the role of vibrational degrees of freedom, beyond that of a heat bath characterized by thermal fluctuations. This development was paralleled by theory, where efficient methods emerged, which could provide the proper frame to perform non-Markovian and non-perturbative simulations of exciton–vibrational dynamics and spectroscopy. This review summarizes the state of affairs of the theory of exciton–vibrational interaction in molecular aggregates and photosynthetic antenna complexes. The focus is put on the discussion of basic effects of exciton–vibrational interaction from the stationary and dynamics points of view. Here, the molecular dimer plays a prominent role as it permits a systematic investigation of absorption and emission spectra by numerical diagonalization of the exciton–vibrational Hamiltonian in a truncated Hilbert space. An extension to larger aggregates, having many coupled nuclear degrees of freedom, becomes possible with the Multi-Layer Multi-Configuration Time-Dependent Hartree (ML-MCTDH) method for wave packet propagation. In fact it will be shown that this method allows one to approach the limit of almost continuous spectral densities, which is usually the realm of density matrix theory. Real system–bath situations are introduced for two models, which differ in the way strongly coupled nuclear coordinates are treated, as a part of the relevant system or the bath. A rather detailed exposition of the Hierarchy Equations Of Motion (HEOM
Kubota, Jun; Wada, Akihide; Domen, Kazunari; Kano, Satoru S.
2002-08-01
The behavior of D 2O ice on CO/Pt(1 1 1) and Pt(1 1 1) under the irradiation of near-IR pulses (NIR) was studied by sum-frequency generation (SFG) spectroscopy. The peaks assigned to the O-D stretching modes of ice were obtained for the first 30 molecular layers on Pt(1 1 1). When the D2O/ CO/ Pt(1 1 1) was irradiated, the signal of D 2O was weakened after 500 ps, but that of CO was weakened immediately after the pumping. A similar time response was observed for the D 2O peak in D2O/ Pt(1 1 1) . The weakening of SFG is attributed to the broadening of bands due to thermal excitation. This indicates that the energy of the pump pulse is deposited on the Pt(1 1 1) surface and diffused into the layers of D 2O ice in the 500 ps timescale.
DEFF Research Database (Denmark)
Uceda Otero, E. P.; Eliel, G. S. N.; Fonseca, E. J. S.
2013-01-01
In this work we have used Fourier transform infrared (FTIR) / vibrational absorption (VA) spectroscopy to study two cancer cell lines: the Henrietta Lacks (HeLa) human cervix carcinoma and 5637 human bladder carcinoma cell lines. Our goal is to experimentally investigate biochemical changes...
Developing and understanding biofluid vibrational spectroscopy: a critical review.
Baker, Matthew J; Hussain, Shawn R; Lovergne, Lila; Untereiner, Valérie; Hughes, Caryn; Lukaszewski, Roman A; Thiéfin, Gérard; Sockalingum, Ganesh D
2016-04-07
Vibrational spectroscopy can provide rapid, label-free, and objective analysis for the clinical domain. Spectroscopic analysis of biofluids such as blood components (e.g. serum and plasma) and others in the proximity of the diseased tissue or cell (e.g. bile, urine, and sputum) offers non-invasive diagnostic/monitoring possibilities for future healthcare that are capable of rapid diagnosis of diseases via specific spectral markers or signatures. Biofluids offer an ideal diagnostic medium due to their ease and low cost of collection and daily use in clinical biology. Due to the low risk and invasiveness of their collection they are widely welcomed by patients as a diagnostic medium. This review underscores recent research within the field of biofluid spectroscopy and its use in myriad pathologies such as cancer and infectious diseases. It highlights current progresses, advents, and pitfalls within the field and discusses future spectroscopic clinical potentials for diagnostics. The requirements and issues surrounding clinical translation are also considered.
Energy Technology Data Exchange (ETDEWEB)
Leyssner, Felix
2011-10-24
The goal of this work is to optimize the efficiency of photoinduced molecular switching processes on surfaces via controlled variations of the adsorption and electronic properties of the switch. We investigated the influence of external stimuli, i.e. photons and thermal activation, on surface bound molecular switches undergoing trans/cis-isomerizations and ring-opening/closing-reactions, respectively. High resolution electron energy loss spectroscopy (HREELS) and sum-frequency generation (SFG) spectroscopy have been used as the main tools to investigate the adsorption behavior and the molecular switching properties. Two basic concepts of coupling the molecular switch to the surface have been studied: (i) physisorbed or weakly chemisorbed systems deposited on noble metal surfaces under UHV conditions and (ii) molecular switches bound covalently via anchor groups. In the HREELS study following concept (i), we investigated the adsorption geometry and isomerization behavior of various molecular switches on metal substrates which are able to undergo a photoinduced trans/cis-isomerization in solution. We investigated three isoelectronic molecules on Au where we systematically changed the photochemically active group from the diazo-group in an azobenzene-derivative (on Cu(111)) to the imine-group, and the vinylene-group, respectively. Finding the photoisomerization quenched for all systems we observed considerable differences in their thermal isomerization behavior. Comparable we find the photoinduced ring-opening/closing-reaction of spiropyran quenched on Au(111) but a thermally induced ring-opening reaction resulting in the open form being strongly stabilized by the metal. SFG spectroscopy is employed to investigate the reversible, photoinduced trans/cis-isomerization of an azobenzene-functionalized self-assembled monolayer (SAM) on gold using a tripodal linker system. In consequence of the decoupling provided by the tripodal linker, the switching behavior of the
Baribeault, David
2011-08-01
Parenteral sodium ferric gluconate in complex (Ferrlecit [branded SFG]) is used to treat patients with iron deficiency anemia undergoing chronic hemodialysis and receiving supplemental epoetin. This comparative pharmacokinetic study (GeneraMedix, Inc., Study 17909) evaluates whether the recently approved generic product Nulecit (generic SFG) and the branded product Ferrlecit (branded SFG) are bioequivalent. In this open-label study, 240 healthy volunteers in a fasting state were assigned randomly to a single 10-min intravenous (IV) infusion of 125 mg of generic or branded SFG. Total and transferrin-bound iron concentrations were determined for the 36-h period after infusion and corrected for pretreatment levels. Maximum concentration (Cmax) and area under the concentration-time curve of 0 to 36 h (AUC[0-36]) were compared between the two products. Demonstration of bioequivalence required that the 90% confidence intervals of each parameter evaluated for generic SFG were within 80% to 125% of the corresponding values for branded SFG. Uncorrected and baseline-corrected mean serum concentrations of total serum iron during the 36-h assessment period were similar for generic and branded SFG. For total serum iron, the geometric mean ratios of corrected Cmax and AUC[0-36] were 100%. For transferrin-bound iron, the geometric mean ratios were 87% for corrected Cmax and 92% for corrected AUC[0-36]. All associated 90% confidence intervals were within the range of 80% to 125%. A new generic SFG in complex for IV infusion is bioequivalent to the branded SFG in complex for IV infusion. The generic SFG is AB rated by the FDA and considered therapeutically equivalent to the branded product.
First-Principles Vibrational Electron Energy Loss Spectroscopy of β -Guanine
Radtke, G.; Taverna, D.; Lazzeri, M.; Balan, E.
2017-07-01
A general approach to model vibrational electron energy loss spectra obtained using an electron beam positioned away from the specimen is presented. The energy-loss probability of the fast electron is evaluated using first-principles quantum mechanical calculations (density functional theory) of the dielectric response of the specimen. The validity of the method is assessed using recently measured anhydrous β -guanine, an important molecular solid used by animals to produce structural colors. The good agreement between theory and experiments lays the basis for a quantitative interpretation of this spectroscopy in complex systems.
The Fourteenth International Meeting on Time-Resolved Vibrational Spectroscopy (TRVS XIV)
2010-02-03
conferences covering the use of advanced vibrational spectroscopy for the use of studying time-dependent molecular processes in chemistry, physics ...Netherlands a.huertaviga@uva.nl Neil Hunt Dept of Physics , University of Strathclyde United Kingdom nhunt@phys.strath.ac Koichi Iwata Gakushuin University...Dasgupta Mark Creelman Sangdeok Shim Biochemical Reaction Dynamics, , , UC B k ler e ey 11:50 AM C W. Zinth, W. J. Schreier, J. Kubon, N. Regner, K
Márquez, F J; Rojas, A; Ibarra, V; Cantero, A; Rojas, J; Oteo, J A; Muniain, M A
2006-10-01
In southern Spain, Dermacentor marginatus ticks can be infected with several genospecies of spotted fever Group (SFG) Rickettsia. We developed a nested polymerase chain reaction assay by using a species-specific probe targeting the ompA gene to detect and differentiate between the two groups of rickettsiae previously described in D. marginatus. SFG rickettsia has been detected in 85.15% of ticks studied (26.7% of positives have been to R. slovaca, the causative agent of TIBOLA-DEBONEL, and 73.3% to SFG rickettsia closely related to strains RpA4-JL-02-DnS14-DnS28).
A Novel (DDCC-SFG-Based Systematic Design Technique of Active Filters
Directory of Open Access Journals (Sweden)
M. Fakhfakh
2013-09-01
Full Text Available This paper proposes a novel idea for the synthesis of active filters that is based on the use of signal-flow graph (SFG stamps of differential difference current conveyors (DDCCs. On the basis of an RLC passive network or a filter symbolic transfer function, an equivalent SFG is constructed. DDCCs’ SFGs are identified inside the constructed ‘active’ graph, and thus the equivalent circuit can be easily synthesized. We show that the DDCC and its ‘derivatives’, i.e. differential voltage current conveyors and the conventional current conveyors, are the main basic building blocks in such design. The practicability of the proposed technique is showcased via three application examples. Spice simulations are given to show the viability of the proposed technique.
Atomic Origins of the Self-Healing Function in Cement–Polymer Composites
Energy Technology Data Exchange (ETDEWEB)
Nguyen, Manh Thuong; Wang, Zheming; Rod, Kenton A.; Childers, Matthew I.; Fernandez, Carlos A.; Koech, Phillip K.; Bennett, Wendy D.; Rousseau, Roger J.; Glezakou, Vassiliki-Alexandra
2018-01-09
Motivated by recent advances in self-healing cement and epoxy polymer composites, we present a combined ab initio molecular dynamics and sum frequency generation (SFG) spectroscopy study of a calcium-silicate-hydrate/polymer interface. On stable, low-defect surfaces, the polymer only weakly adheres through coordination and hydrogen bonding interactions and can be easily mobilized towards defected surfaces. Conversely, on fractured surfaces, the polymer strongly anchors through ionic Ca-O bonds resulting from the deprotonation of polymer hydroxyl groups. In addition, polymer S-S groups are turned away from the cement/polymer interface, allowing for the self-healing function within the polymer. The overall elasticity and healing properties of these composites stem from a flexible hydrogen bonding network that can readily adapt to surface morphology. The theoretical vibrational signals associated with the proposed cement-polymer interfacial chemistry were confirmed experimentally by SFG spectroscopy.
International Nuclear Information System (INIS)
Arnold, G.W.
1978-01-01
Defects produced by implantation of various atomic species in fused and crystalline SiO 2 were studied using infrared reflection spectroscopy (IRS) with UV-visible spectroscopy. We observe a new vibrational band at 830 cm -1 which is tentatively associated with the creation of two nonbridging O atoms in SiO 4 units. Numerous chemical effects were also observed, including evidence for chemical incorporation of Li and anomalously large O-vacancy production for Al + , B + and Si + implantation
Probing a molecular electronic transition by two-colour sum-frequency generation spectroscopy
International Nuclear Information System (INIS)
Humbert, C.; Dreesen, L.; Nihonyanagi, S.; Masuda, T.; Kondo, T.; Mani, A.A.; Uosaki, K.; Thiry, P.A.; Peremans, A.
2003-01-01
We demonstrate that a new emerging technique, two-colour sum-frequency generation (SFG) spectroscopy, can be used to probe the molecular electronic properties of self-assembled monolayers (SAMs). In the CH spectral range (2800-3200 cm -1 ), we show that the sum-frequency generation signal of a porphyrin alkanethiol derivative adsorbed on Pt(1 1 1) reaches a maximum intensity at ∼435 nm SFG wavelength. This wavelength corresponds to the porphyrin moiety specific π-π* molecular electronic transition which is called the Soret or B band. This resonant behaviour is not observed for 1-dodecanethiol SAMs, which are devoid of molecular electronic transition in the investigated visible spectral range
Vibrational Spectroscopy as a Promising Toolbox for Analyzing Functionalized Ceramic Membranes.
Kiefer, Johannes; Bartels, Julia; Kroll, Stephen; Rezwan, Kurosch
2018-01-01
Ceramic materials find use in many fields including the life sciences and environmental engineering. For example, ceramic membranes have shown to be promising filters for water treatment and virus retention. The analysis of such materials, however, remains challenging. In the present study, the potential of three vibrational spectroscopic methods for characterizing functionalized ceramic membranes for water treatment is evaluated. For this purpose, Raman scattering, infrared (IR) absorption, and solvent infrared spectroscopy (SIRS) were employed. The data were analyzed with respect to spectral changes as well as using principal component analysis (PCA). The Raman spectra allow an unambiguous discrimination of the sample types. The IR spectra do not change systematically with functionalization state of the material. Solvent infrared spectroscopy allows a systematic distinction and enables studying the molecular interactions between the membrane surface and the solvent.
Far-infrared vibrational modes of DNA components studied by terahertz time-domain spectroscopy
International Nuclear Information System (INIS)
Fischer, B M; Walther, M; Jepsen, P Uhd
2002-01-01
The far-infrared dielectric function of a wide range of organic molecules is dominated by vibrations involving a substantial fraction of the atoms forming the molecule and motion associated with intermolecular hydrogen bond vibrations. Due to their collective nature such modes are highly sensitive to the intra- and intermolecular structure and thus provide a unique fingerprint of the conformational state of the molecule and effects of its environment. We demonstrate the use of terahertz time-domain spectroscopy (THz-TDS) for recording the far-infrared (0.5-4.0 THz) dielectric function of the four nucleobases and corresponding nucleosides forming the building blocks of deoxyribose nucleic acid (DNA). We observe numerous distinct spectral features with large differences between the molecules in both frequency-dependent absorption coefficient and index of refraction. Assisted by results from density-functional calculations we interpret the origin of the observed resonances as vibrations of hydrogen bonds between the molecules
Xu, Ningning; Liu, Jianxin; Yu, Peiqiang
2018-04-01
Advanced vibrational molecular spectroscopy has been developed as a rapid and non-destructive tool to reveal intrinsic molecular structure conformation of biological tissues. However, this technique has not been used to systematically study flaking induced structure changes at a molecular level. The objective of this study was to use vibrational molecular spectroscopy to reveal association between steam flaking induced CHO molecular structural changes in relation to grain CHO fractionation, predicted CHO biodegradation and biodigestion in ruminant system. The Attenuate Total Reflectance Fourier-transform Vibrational Molecular Spectroscopy (ATR-Ft/VMS) at SRP Key Lab of Molecular Structure and Molecular Nutrition, Ministry of Agriculture Strategic Research Chair Program (SRP, University of Saskatchewan) was applied in this study. The fractionation, predicted biodegradation and biodigestion were evaluated using the Cornell Net Carbohydrate Protein System. The results show that: (1) The steam flaking induced significant changes in CHO subfractions, CHO biodegradation and biodigestion in ruminant system. There were significant differences between non-processed (raw) and steam flaked grain corn (P R2 = 0.87, RSD = 0.74, P R2 = 0.87, RSD = 0.24, P < .01). In summary, the processing induced molecular CHO structure changes in grain corn could be revealed by the ATR-Ft/VMS vibrational molecular spectroscopy. These molecular structure changes in grain were potentially associated with CHO biodegradation and biodigestion.
Recent Advances in the Characterization of Gaseous and Liquid Fuels by Vibrational Spectroscopy
Directory of Open Access Journals (Sweden)
Johannes Kiefer
2015-04-01
Full Text Available Most commercial gaseous and liquid fuels are mixtures of multiple chemical compounds. In recent years, these mixtures became even more complicated when the suppliers started to admix biofuels into the petrochemical basic fuels. As the properties of such mixtures can vary with composition, there is a need for reliable analytical technologies in order to ensure stable operation of devices such as internal combustion engines and gas turbines. Vibrational spectroscopic methods have proved their suitability for fuel characterization. Moreover, they have the potential to overcome existing limitations of established technologies, because they are fast and accurate, and they do not require sampling; hence they can be deployed as inline sensors. This article reviews the recent advances of vibrational spectroscopy in terms of infrared absorption (IR and Raman spectroscopy in the context of fuel characterization. The focus of the paper lies on gaseous and liquid fuels, which are dominant in the transportation sector and in the distributed generation of power. On top of an introduction to the physical principles and review of the literature, the techniques are critically discussed and compared with each other.
Geographic variation in risk factors for SFG rickettsial and leptospiral exposure in Colombia.
Padmanabha, Harish; Hidalgo, Marylin; Valbuena, Gustavo; Castaneda, Elizabeth; Galeano, Armando; Puerta, Henry; Cantillo, Cesar; Mantilla, Gilma
2009-10-01
In order to characterize the patterns of human exposure to spotted fever group (SFG) rickettsial and leptospiral infection, IgG surveys were conducted on 642 residents of ten different areas of the rural district of Necoclí, Colombia. Areas were selected based on forest cover and human settlement pattern, and individual risk factors were elucidated through multivariate logistic models, controlling for variance clustering within communities. Overall, prevalence of high antibody titers indicating previous exposure to SFG rickettsia and leptospira was 29.2% and 35.6%, respectively, and both were most prevalent in the same peri-urban neighborhood. Forest cover .10% demonstrated the strongest independent association with leptospiral exposure, followed by homes with outdoor storage sheds. Isolated rural housing was the only variable independently associated with SFG rickettsia exposure. Community-level variables significantly modified the effects of individual risk factors. For both pathogens the eldest quartile was less exposed in periurban areas although there was no age effect overall for either. Females living in population settlements were more exposed to SFG rickettsiae but there was no sex association in isolated rural houses. Similarly, in sites with forest cover .10%, individuals working at home had higher leptospira seroprevalence, but place of work was not a risk factor in areas of forest cover ,10%. These data suggest that the patterns of maintenance and/or exposure to leptospira and rickettsia vary across different human created landscapes and settlement patterns. While contrasting risk factors may reflect the unique transmission cycles of each pathogen, the observed patterns of geographic variation suggest that both diseases may respond similarly larger scale human-ecological dynamics.
Albentosa, Marina; Sánchez-Hernández, Miriam; Campillo, Juan Antonio; Moyano, Francisco Javier
2012-11-01
The present study was aimed to establish the relationship between the functionality of the digestive gland and physiological rates including SFG (scope for growth) in wild mussels, Mytilus galloprovincilis. The experimental set-up consisted in the evaluation of changes in the morphology of the gland, as well as in the activity of some key digestive enzymes (amylase, laminarinase, cellulase and protease) within a broad range of SFG obtained through manipulation of food ration. The higher SFG values were correlated to an increase in both the size of the digestive gland and the activities of enzymes when expressed in relation to individual. In contrast, no clear relations were observed when the activity of enzymes was expressed in relation to soluble protein, with the exception to amylase. The higher protease activities measured in mussels showing lower SFG may reflect an initial stage of catabolic processes intended to compensate the energy deficit produced by food restriction. The potential use of parameters measured in digestive glands in studies of marine pollution was discussed. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
A. Card
2016-02-01
Full Text Available We show resolution of fine spectral features within several Raman active vibrational modes in potassium titanyl phosphate (KTP crystal. Measurements are performed using a femtosecond time-domain coherent anti-Stokes Raman scattering spectroscopy technique that is capable of delivering equivalent spectral resolution of 0.1 cm−1. The Raman spectra retrieved from our measurements show several spectral components corresponding to vibrations of different symmetry with distinctly different damping rates. In particular, linewidths for unassigned optical phonon mode triplet centered at around 820 cm−1 are found to be 7.5 ± 0.2 cm−1, 9.1 ± 0.3 cm−1, and 11.2 ± 0.3 cm−1. Results of our experiments will ultimately help to design an all-solid-state source for sub-optical-wavelength waveform generation that is based on stimulated Raman scattering.
Lanzani, Guglielmo; De Silvestri, Sandro
2007-01-01
Vibrational spectroscopy is a powerful investigation tool for a wide class of materials covering diverse areas in physics, chemistry and biology. The continuous development in the laser field regarding ultrashort pulse generation has led to the possibility of producing light pulses that can follow vibrational motion coupled to the electronic transitions in molecules and solids in real time. Aimed at researchers and graduate students using vibrational spectroscopy, this book provides both introductory chapters as well as more advanced contents reporting on recent progress. It also provides a good starting point for scientists seeking a sound introduction to ultrafast optics and spectroscopic techniques.
Communication: atomic force detection of single-molecule nonlinear optical vibrational spectroscopy.
Saurabh, Prasoon; Mukamel, Shaul
2014-04-28
Atomic Force Microscopy (AFM) allows for a highly sensitive detection of spectroscopic signals. This has been first demonstrated for NMR of a single molecule and recently extended to stimulated Raman in the optical regime. We theoretically investigate the use of optical forces to detect time and frequency domain nonlinear optical signals. We show that, with proper phase matching, the AFM-detected signals closely resemble coherent heterodyne-detected signals. Applications are made to AFM-detected and heterodyne-detected vibrational resonances in Coherent Anti-Stokes Raman Spectroscopy (χ((3))) and sum or difference frequency generation (χ((2))).
Huang, Dao-Ling; Zhu, Guo-Zhu; Wang, Lai-Sheng
2016-06-01
Deprotonated thymine can exist in two different forms, depending on which of its two N sites is deprotonated: N1[T-H]^- or N3[T-H]^-. Here we report a photodetachment study of the N1[T-H]^- isomer cooled in a cryogenic ion trap and the observation of an excited dipole-bound state. Eighteen vibrational levels of the dipole-bound state are observed, and its vibrational ground state is found to be 238 ± 5 wn below the detachment threshold of N1[T-H]^-. The electron affinity of the deprotonated thymine radical (N1[T-H]^.) is measured accruately to be 26 322 ± 5 wn (3.2635 ± 0.0006 eV). By tuning the detachment laser to the sixteen vibrational levels of the dipole-bound state that are above the detachment threshold, highly non-Franck-Condon resonant-enhanced photoelectron spectra are obtained due to state- and mode-selective vibrational autodetachment. Much richer vibrational information is obtained for the deprotonated thymine radical from the photodetachment and resonant-enhanced photoelectron spectroscopy. Eleven fundamental vibrational frequencies in the low-frequency regime are obtained for the N1[T-H]^. radical, including the two lowest-frequency internal rotational modes of the methyl group at 70 ± 8 wn and 92 ± 5 wn. D. L. Huang, H. T. Liu, C. G. Ning, G. Z. Zhu and L. S. Wang, Chem. Sci., 6, 3129-3138 (2015)
Energy Technology Data Exchange (ETDEWEB)
Dimitrievska, Mirjana; White, James L.; Zhou, Wei; Stavila, Vitalie; Klebanoff, Leonard E.; Udovic, Terrence J.
2016-01-01
The structure-dependent vibrational properties of different Mg(BH4)2 polymorphs (..alpha.., ..beta.., ..gamma.., and ..delta.. phases) were investigated with a combination of neutron vibrational spectroscopy (NVS) measurements and density functional theory (DFT) calculations, with emphasis placed on the effects of the local structure and orientation of the BH4- anions. DFT simulations closely match the neutron vibrational spectra. The main bands in the low-energy region (20-80 meV) are associated with the BH4- librational modes. The features in the intermediate energy region (80-120 meV) are attributed to overtones and combination bands arising from the lower-energy modes. The features in the high-energy region (120-200 meV) correspond to the BH4- symmetric and asymmetric bending vibrations, of which four peaks located at 140, 142, 160, and 172 meV are especially intense. There are noticeable intensity distribution variations in the vibrational bands for different polymorphs. This is explained by the differences in the spatial distribution of BH4- anions within various structures. An example of the possible identification of products after the hydrogenation of MgB2, using NVS measurements, is presented. These results provide fundamental insights of benefit to researchers currently studying these promising hydrogen-storage materials.
Vibrational spectroscopy and structural analysis of complex uranium compounds (review)
International Nuclear Information System (INIS)
Umreiko, D.S.; Nikanovich, M.V.
1985-01-01
The paper reports on the combined application of experimental and theoretical methods of vibrational spectroscopy together with low-temperature luminescence data to determine the characteristic features of the formation and structure of complex systems, not only containing ligands directly coordinated to the CA uranium, but also associated with the extraspherical polyatomic electrically charged particles: organic cations. These include uranyl complexes and heterocyclical amines. Studied here were compounds of tetra-halouranylates with pyridine and its derivates, as well as dipyridyl, quinoline and phenanthroline. Structural schemes are also proposed for other uranyl complexes with protonated heterocyclical amines with a more complicated composition, which correctly reflect their spectroscopic properties
Wei, Qingshuo; Tajima, Keisuke; Tong, Yujin; Ye, Shen; Hashimoto, Kazuhito
2009-12-09
We report a new type of ordered monolayer for the surface modification of organic semiconductors. Fullerene derivatives with fluorocarbon chains ([6,6]-phenyl-C(61)-buryric acid 1H,1H-perfluoro-1-alkyl ester or FC(n)) spontaneously segregated as a monolayer on the surface of a [6,6]-phenyl-C(61)-butyric acid methyl ester (PCBM) film during a spin-coating process from the mixture solutions, as confirmed by X-ray photoelectron spectroscopy (XPS). Ultraviolet photoelectron spectroscopy (UPS) showed the shift of ionization potentials (IPs) depending on the fluorocarbon chain length, indicating the formation of surface dipole moments. Surface-sensitive vibrational spectroscopy, sum frequency generation (SFG) revealed the ordered molecular orientations of the C(60) moiety in the surface FC(n) layers. The intensity of the SFG signals from FC(n) on the surface showed a clear odd-even effect when the length of the fluorocarbon chain was changed. This new concept of the surface-segregated monolayer provides a facile and versatile approach to modifying the surface of organic semiconductors and is applicable to various organic optoelectronic devices.
International Nuclear Information System (INIS)
Schmidt, J.R.; Roberts, S.T.; Loparo, J.J.; Tokmakoff, A.; Fayer, M.D.; Skinner, J.L.
2007-01-01
Vibrational spectroscopy can provide important information about structure and dynamics in liquids. In the case of liquid water, this is particularly true for isotopically dilute HOD/D 2 O and HOD/H 2 O systems. Infrared and Raman line shapes for these systems were measured some time ago. Very recently, ultrafast three-pulse vibrational echo experiments have been performed on these systems, which provide new, exciting, and important dynamical benchmarks for liquid water. There has been tremendous theoretical effort expended on the development of classical simulation models for liquid water. These models have been parameterized from experimental structural and thermodynamic measurements. The goal of this paper is to determine if representative simulation models are consistent with steady-state, and especially with these new ultrafast, experiments. Such a comparison provides information about the accuracy of the dynamics of these simulation models. We perform this comparison using theoretical methods developed in previous papers, and calculate the experimental observables directly, without making the Condon and cumulant approximations, and taking into account molecular rotation, vibrational relaxation, and finite excitation pulses. On the whole, the simulation models do remarkably well; perhaps the best overall agreement with experiment comes from the SPC/E model
Directory of Open Access Journals (Sweden)
Diethelm Johannsmann
2016-12-01
Full Text Available Colloidal spheres attached to a quartz crystal microbalance (QCM produce the so-called “coupled resonances”. They are resonators of their own, characterized by a particle resonance frequency, a resonance bandwidth, and a modal mass. When the frequency of the main resonator comes close to the frequency of the coupled resonance, the bandwidth goes through a maximum. A coupled resonance can be viewed as an absorption line in acoustic shear-wave spectroscopy. The known concepts from spectroscopy apply. This includes the mode assignment problem, selection rules, and the oscillator strength. In this work, the mode assignment problem was addressed with Finite Element calculations. These reveal that a rigid sphere in contact with a QCM displays two modes of vibration, termed “slipping” and “rocking”. In the slipping mode, the sphere rotates about its center; it exerts a tangential force onto the resonator surface at the point of contact. In the rocking mode, the sphere rotates about the point of contact; it exerts a torque onto the substrate. In liquids, both axes of rotation are slightly displaced from their ideal positions. Characteristic for spectroscopy, the two modes do not couple to the mechanical excitation equally well. The degree of coupling is quantified by an oscillator strength. Because the rocking mode mostly exerts a torque (rather than a tangential force, its coupling to the resonator's tangential motion is weak; the oscillator strength consequently is small. Recent experiments on surface-adsorbed colloidal spheres can be explained by the mode of vibration being of the rocking type. Keywords: Quartz crystal microbalance, Coupled resonance, Biocolloids, Adsorption
Heavy atom vibrational modes and low-energy vibrational autodetachment in nitromethane anions
International Nuclear Information System (INIS)
Thompson, Michael C.; Weber, J. Mathias; Baraban, Joshua H.; Matthews, Devin A.; Stanton, John F.
2015-01-01
We report infrared spectra of nitromethane anion, CH 3 NO 2 − , in the region 700–2150 cm −1 , obtained by Ar predissociation spectroscopy and electron detachment spectroscopy. The data are interpreted in the framework of second-order vibrational perturbation theory based on coupled-cluster electronic structure calculations. The modes in the spectroscopic region studied here are mainly based on vibrations involving the heavier atoms; this work complements earlier studies on nitromethane anion that focused on the CH stretching region of the spectrum. Electron detachment begins at photon energies far below the adiabatic electron affinity due to thermal population of excited vibrational states
Larsen, Poul S.; Filgueira, Ramón; Riisgård, Hans Ulrik
2014-04-01
Prediction of somatic growth of blue mussels, Mytilus edulis, based on the data from 2 field-growth studies of mussels in suspended net-bags in Danish waters was made by 3 models: the bioenergetic growth (BEG), the dynamic energy budget (DEB), and the scope for growth (SFG). Here, the standard BEG model has been expanded to include the temperature dependence of filtration rate and respiration and an ad hoc modification to ensure a smooth transition to zero ingestion as chlorophyll a (chl a) concentration approaches zero, both guided by published data. The first 21-day field study was conducted at nearly constant environmental conditions with a mean chl a concentration of C = 2.7 μg L- 1, and the observed monotonous growth in the dry weight of soft parts was best predicted by DEB while BEG and SFG models produced lower growth. The second 165-day field study was affected by large variations in chl a and temperature, and the observed growth varied accordingly, but nevertheless, DEB and SFG predicted monotonous growth in good agreement with the mean pattern while BEG mimicked the field data in response to observed changes in chl a concentration and temperature. The general features of the models were that DEB produced the best average predictions, SFG mostly underestimated growth, whereas only BEG was sensitive to variations in chl a concentration and temperature. DEB and SFG models rely on the calibration of the half-saturation coefficient to optimize the food ingestion function term to that of observed growth, and BEG is independent of observed actual growth as its predictions solely rely on the time history of the local chl a concentration and temperature.
Conformation, orientation and interaction in molecular monolayers
International Nuclear Information System (INIS)
Superfine, R.; Huang, J.Y.; Shen, Y.R.
1989-01-01
Knowledge of the conformation and ordering of molecular monolayers is essential for a detailed understanding of a wide variety of surface and interfacial phenomena. Over the past several years, surface second harmonic generation (SHG) has proven to be a valuable and versatile probe of monolayer systems. Our group has recently extended the technique to infrared-visible sum frequency generation (SFG) which has unique capabilities for surface vibrational spectroscopy. Like second harmonic generation, SFG is highly surface specific with submonolayer sensitivity at all interfaces accessible by light. The orientation of individual groups within an adsorbate molecule can be deduced by a polarization analysis of the SFG signal from the vibrational modes of the groups. The authors have used SHG and SFG to study orientations and conformations of surfactant and liquid crystal (LC) monolayers and their interaction on a substrate. The interfacial properties of LC are of great interest to many researchers for both basic science understanding and practical application to LC devices. It is well known that the bulk alignment of a liquid crystal in a cell is strongly affected by the surface treatment of the cell walls. The reason behind it is not yet clear. The theoretical background and experimental arrangement of SHG and SFG have been described elsewhere. In the setup, a 30 psec. Nd:YAG mode-locked laser system together with nonlinear accessories generates a visible beam at .532μm and an infrared beam tunable about 3.4μm. Both beams are focused to a common spot of 300μm dia. The typical signal off the surface from a compact ordered alkyl chain monolayer is ∼500 photons per pulse, easily detected with a photomultiplier tube
DEFF Research Database (Denmark)
Berg, Rolf W.
This introductory booklet covers the basics of molecular spectroscopy, infrared and Raman methods, instrumental considerations, symmetry analysis of molecules, group theory and selection rules, as well as assignments of fundamental vibrational modes in molecules.......This introductory booklet covers the basics of molecular spectroscopy, infrared and Raman methods, instrumental considerations, symmetry analysis of molecules, group theory and selection rules, as well as assignments of fundamental vibrational modes in molecules....
Evangelisti, Luca; Holdren, Martin S.; Mayer, Kevin J.; Smart, Taylor; West, Channing; Pate, Brooks
2017-06-01
The absolute configuration of 3-methylcyclohexanone was established by chiral tag rotational spectroscopy measurements using 3-butyn-2-ol as the tag partner. This molecule was chosen because it is a benchmark measurement for vibrational circular dichroism (VCD). A comparison of the analysis approaches of chiral tag rotational spectroscopy and VCD will be presented. One important issue in chiral analysis by both methods is the conformational flexibility of the molecule being analyzed. The analysis of conformational composition of samples will be illustrated. In this case, the high spectral resolution of molecular rotational spectroscopy and potential for spectral simplification by conformational cooling in the pulsed jet expansion are advantages for chiral tag spectroscopy. The computational chemistry requirements for the two methods will also be discussed. In this case, the need to perform conformer searches for weakly bound complexes and to perform reasonably high level quantum chemistry geometry optimizations on these complexes makes the computational time requirements less favorable for chiral tag rotational spectroscopy. Finally, the issue of reliability of the determination of the absolute configuration will be considered. In this case, rotational spectroscopy offers a "gold standard" analysis method through the determination of the ^{13}C-subsitution structure of the complex between 3-methylcyclohexanone and an enantiopure sample of the 3-butyn-2-ol tag.
Theoretical study of sum-frequency vibrational spectroscopy on limonene surface
International Nuclear Information System (INIS)
Zheng, Ren-Hui; Liu, Hao; Jing, Yuan-Yuan; Wang, Bo-Yang; Shi, Qiang; Wei, Wen-Mei
2014-01-01
By combining molecule dynamics (MD) simulation and quantum chemistry computation, we calculate the surface sum-frequency vibrational spectroscopy (SFVS) of R-limonene molecules at the gas-liquid interface for SSP, PPP, and SPS polarization combinations. The distributions of the Euler angles are obtained using MD simulation, the ψ-distribution is between isotropic and Gaussian. Instead of the MD distributions, different analytical distributions such as the δ-function, Gaussian and isotropic distributions are applied to simulate surface SFVS. We find that different distributions significantly affect the absolute SFVS intensity and also influence on relative SFVS intensity, and the δ-function distribution should be used with caution when the orientation distribution is broad. Furthermore, the reason that the SPS signal is weak in reflected arrangement is discussed
Theoretical study of sum-frequency vibrational spectroscopy on limonene surface
Energy Technology Data Exchange (ETDEWEB)
Zheng, Ren-Hui, E-mail: zrh@iccas.ac.cn; Liu, Hao; Jing, Yuan-Yuan; Wang, Bo-Yang; Shi, Qiang [Beijing National Laboratory for Molecular Sciences, State Key Laboratory for Structural Chemistry of Unstable and Stable Species, Institute of Chemistry, Chinese Academy of Sciences, Zhongguancun, Beijing 100190 (China); Wei, Wen-Mei [Department of Chemistry, College of Basic Medicine, Anhui Medical University, Hefei, Anhui 230032 (China)
2014-03-14
By combining molecule dynamics (MD) simulation and quantum chemistry computation, we calculate the surface sum-frequency vibrational spectroscopy (SFVS) of R-limonene molecules at the gas-liquid interface for SSP, PPP, and SPS polarization combinations. The distributions of the Euler angles are obtained using MD simulation, the ψ-distribution is between isotropic and Gaussian. Instead of the MD distributions, different analytical distributions such as the δ-function, Gaussian and isotropic distributions are applied to simulate surface SFVS. We find that different distributions significantly affect the absolute SFVS intensity and also influence on relative SFVS intensity, and the δ-function distribution should be used with caution when the orientation distribution is broad. Furthermore, the reason that the SPS signal is weak in reflected arrangement is discussed.
International Nuclear Information System (INIS)
Lauhon, L. J.; Ho, W.
2001-01-01
Inelastic electron tunneling spectroscopy (IETS) was performed on single molecules with a variable temperature scanning tunneling microscope. The peak intensity, width, position, and line shape of single molecule vibrational spectra were studied as a function of temperature, modulation bias, bias polarity, and tip position for the (C--H,C--D) stretching vibration of acetylene (C 2 H 2 ,C 2 D 2 ) on Cu(001). The temperature broadening of vibrational peaks was found to be a consequence of Fermi smearing as in macroscopic IETS. The modulation broadening of vibrational peaks assumed the expected form for IETS. Extrapolation of the peak width to zero temperature and modulation suggested an intrinsic width of ∼4 meV due primarily to instrumental broadening. The inelastic tunneling cross section at negative bias was reduced by a factor of 1.7 for the C--H stretch mode. Low energy modes of other molecules did not show such a reduction. There was no evidence of a tip-induced Stark shift in the peak positions. The spatial variation of the inelastic signal was measured to determine the junction stability necessary for the acquisition of single molecule vibrational spectra
Energy Technology Data Exchange (ETDEWEB)
Somorjai, G.A.; Frei, H.; Park, J.Y.
2009-07-23
The challenge of chemistry in the 21st century is to achieve 100% selectivity of the desired product molecule in multipath reactions ('green chemistry') and develop renewable energy based processes. Surface chemistry and catalysis play key roles in this enterprise. Development of in situ surface techniques such as high-pressure scanning tunneling microscopy, sum frequency generation (SFG) vibrational spectroscopy, time-resolved Fourier transform infrared methods, and ambient pressure X-ray photoelectron spectroscopy enabled the rapid advancement of three fields: nanocatalysts, biointerfaces, and renewable energy conversion chemistry. In materials nanoscience, synthetic methods have been developed to produce monodisperse metal and oxide nanoparticles (NPs) in the 0.8-10 nm range with controlled shape, oxidation states, and composition; these NPs can be used as selective catalysts since chemical selectivity appears to be dependent on all of these experimental parameters. New spectroscopic and microscopic techniques have been developed that operate under reaction conditions and reveal the dynamic change of molecular structure of catalysts and adsorbed molecules as the reactions proceed with changes in reaction intermediates, catalyst composition, and oxidation states. SFG vibrational spectroscopy detects amino acids, peptides, and proteins adsorbed at hydrophobic and hydrophilic interfaces and monitors the change of surface structure and interactions with coadsorbed water. Exothermic reactions and photons generate hot electrons in metal NPs that may be utilized in chemical energy conversion. The photosplitting of water and carbon dioxide, an important research direction in renewable energy conversion, is discussed.
DEFF Research Database (Denmark)
Larsen, Poul Scheel; Filgueira, Ramón; Riisgård, Hans Ulrik
2014-01-01
Prediction of somatic growth of blue mussels, Mytilus edulis, based on the data from 2 field-growth studies of mussels in suspended net-bags in Danish waters was made by 3 models: the bioenergetic growth (BEG), the dynamic energy budget (DEB), and the scope for growth (SFG). Here, the standard BEG...... at nearly constant environmental conditions with a mean chl a concentration of C=2.7μgL−1, and the observed monotonous growth in the dry weight of soft parts was best predicted by DEB while BEG and SFG models produced lower growth. The second 165-day field study was affected by large variations in chl...... a and temperature, and the observed growth varied accordingly, but nevertheless, DEB and SFG predicted monotonous growth in good agreement with the mean pattern while BEG mimicked the field data in response to observed changes in chl a concentration and temperature. The general features of the models were that DEB...
Laser-induced breakdown spectroscopy with laser irradiation resonant with vibrational transitions
International Nuclear Information System (INIS)
Khachatrian, Ani; Dagdigian, Paul J.
2010-01-01
An investigation of laser-induced breakdown spectroscopy (LIBS) of polymers, both in bulk form and spin coated on Si wafers, with laser irradiation in the mid-infrared spectral region is presented. Of particular interest is whether the LIBS signals are enhanced when the laser wavelength is resonant with a fundamental vibrational transition of the polymer. Significant increases in the LIBS signals were observed for irradiation on hydride stretch fundamental transitions, and the magnitude of the enhancement showed a strong dependence on the mode excited. The role of the substrate was investigated by comparison of results for bulk and spin-coated samples. The polymers investigated were Nylon 12 and poly(vinyl alcohol-co-ethylene).
Jang, Sung Ho; Yeo, Sang Seok; Lee, Seung Hyun; Jin, Sang Hyun; Lee, Mi Young
2017-08-01
To date, the cortical effect of exercise has not been fully elucidated. Using the functional near infrared spectroscopy, we attempted to compare the cortical effect between shoulder vibration exercise and shoulder simple exercise. Eight healthy subjects were recruited for this study. Two different exercise tasks (shoulder vibration exercise using the flexible pole and shoulder simple exercise) were performed using a block paradigm. We measured the values of oxygenated hemoglobin in the four regions of interest: the primary sensory-motor cortex (SM1 total, arm somatotopy, and leg and trunk somatotopy), the premotor cortex, the supplementary motor area, and the prefrontal cortex. During shoulder vibration exercise and shoulder simple exercise, cortical activation was observed in SM1 (total, arm somatotopy, and leg and trunk somatotopy), premotor cortex, supplementary motor area, and prefrontal cortex. Higher oxygenated hemoglobin values were also observed in the areas of arm somatotopy of SM1 compared with those of other regions of interest. However, no significant difference in the arm somatotopy of SM1 was observed between the two exercises. By contrast, in the leg and trunk somatotopy of SM1, shoulder vibration exercise led to a significantly higher oxy-hemoglobin value than shoulder simple exercise. These two exercises may result in cortical activation effects for the motor areas relevant to the shoulder exercise, especially in the arm somatotopy of SM1. However, shoulder vibration exercise has an additional cortical activation effect for the leg and trunk somatotopy of SM1.
Directory of Open Access Journals (Sweden)
Sung Ho Jang
2017-01-01
Full Text Available To date, the cortical effect of exercise has not been fully elucidated. Using the functional near infrared spectroscopy, we attempted to compare the cortical effect between shoulder vibration exercise and shoulder simple exercise. Eight healthy subjects were recruited for this study. Two different exercise tasks (shoulder vibration exercise using the flexible pole and shoulder simple exercise were performed using a block paradigm. We measured the values of oxygenated hemoglobin in the four regions of interest: the primary sensory-motor cortex (SM1 total, arm somatotopy, and leg and trunk somatotopy, the premotor cortex, the supplementary motor area, and the prefrontal cortex. During shoulder vibration exercise and shoulder simple exercise, cortical activation was observed in SM1 (total, arm somatotopy, and leg and trunk somatotopy, premotor cortex, supplementary motor area, and prefrontal cortex. Higher oxygenated hemoglobin values were also observed in the areas of arm somatotopy of SM1 compared with those of other regions of interest. However, no significant difference in the arm somatotopy of SM1 was observed between the two exercises. By contrast, in the leg and trunk somatotopy of SM1, shoulder vibration exercise led to a significantly higher oxy-hemoglobin value than shoulder simple exercise. These two exercises may result in cortical activation effects for the motor areas relevant to the shoulder exercise, especially in the arm somatotopy of SM1. However, shoulder vibration exercise has an additional cortical activation effect for the leg and trunk somatotopy of SM1.
Shock compression and flash-heating of molecular adsorbates on the picosecond time scale
Berg, Christopher Michael
An ultrafast nonlinear coherent laser spectroscopy termed broadband multiplex vibrational sum-frequency generation (SFG) with nonresonant suppression was employed to monitor vibrational transitions of molecular adsorbates on metallic substrates during laser-driven shock compression and flash-heating. Adsorbates were in the form of well-ordered self-assembled monolayers (SAMs) and included molecular explosive simulants, such as nitroaromatics, and long chain-length alkanethiols. Based on reflectance measurements of the metallic substrates, femtosecond flash-heating pulses were capable of producing large-amplitude temperature jumps with DeltaT = 500 K. Laser-driven shock compression of SAMs produced pressures up to 2 GPa, where 1 GPa ≈ 1 x 104 atm. Shock pressures were estimated via comparison with frequency shifts observed in the monolayer vibrational transitions during hydrostatic pressure measurements in a SiC anvil cell. Molecular dynamics during flash-heating and shock loading were probed with vibrational SFG spectroscopy with picosecond temporal resolution and sub-nanometer spatial resolution. Flash-heating studies of 4-nitrobenzenethiolate (NBT) on Au provided insight into effects from hot-electron excitation of the molecular adsorbates at early pump-probe delay times. At longer delay times, effects from the excitation of SAM lattice modes and lower-energy NBT vibrations were shown. In addition, flash-heating studies of alkanethiolates demonstrated chain disordering behaviors as well as interface thermal conductances across the Au-SAM junction, which was of specific interest within the context of molecular electronics. Shock compression studies of molecular explosive simulants, such as 4-nitrobenzoate (NBA), demonstrated the proficiency of this technique to observe shock-induced molecular dynamics, in this case orientational dynamics, on the picosecond time scale. Results validated the utilization of these refined shock loading techniques to probe the shock
Yesudas, Freeda; Mero, Mark; Kneipp, Janina; Heiner, Zsuzsanna
2018-03-01
Broadband vibrational sum-frequency generation (BB-VSFG) spectroscopy has become a well-established surface analytical tool capable of identifying the orientation and structure of molecular layers. A straightforward way to boost the sensitivity of the technique could be to increase the laser repetition rate beyond that of standard BB-VSFG spectrometers, which rely on Ti:sapphire lasers operating at repetition rates of 1-5 kHz. Nevertheless, possible thermally induced artifacts in the vibrational spectra due to higher laser average powers are unexplored. Here, we discuss laser power induced temperature accumulation effects that distort the BB-VSFG spectra of 1,2-diacyl-sn-glycero-3-phosphocholine at an interface between two transparent phases at repetition rates of 5, 10, 50, and 100 kHz at constant pulse energy. No heat-induced distortions were found in the spectra, suggesting that the increase in the laser repetition rate provides a feasible route to an improved signal-to-noise ratio or shorter data acquisition times in BB-VSFG spectroscopy for thin films on transparent substrates. The results have implications for future BB-VSFG spectrometers pushing the detection limit for molecular layers with low surface coverage.
Heterogeneous Dynamics of Coupled Vibrations
Cringus, Dan; Jansen, Thomas I. C.; Pshenichnikov, Maxim S.; Schoenlein, RW; Corkum, P; DeSilvestri, S; Nelson, KA; Riedle, E
2009-01-01
Frequency-dependent dynamics of coupled stretch vibrations of a water molecule are revealed by 2D IR correlation spectroscopy. These are caused by non-Gaussian fluctuations of the environment around the individual OH stretch vibrations.
International Nuclear Information System (INIS)
Zorba, T.; Paraskevopoulos, K.M.; Pavlidou, E.; Andrikopoulos, K.S.; Daniilia, S.; Popkonstantinov, K.; Kostova, R.; Platnyov, V.
2007-01-01
Vibrational spectroscopy is applied on samples obtained from the excavation area of the medieval Monastery (10 th century) of Karaach-Teke in Bulgaria. The results of the corresponding study, reveal the type of materials used for the creation of the wall-paintings and give evidence of Byzantine influence, a fact that further supports the well known impact of Byzantium on the technology and thematic-aesthetic features of iconography in Bulgaria during this era. In addition, the complementarity of FTIR and -Raman spectroscopies in the identification of pigments is indicated
Thz Spectroscopy and DFT Modeling of Intermolecular Vibrations in Hydrophobic Amino Acids
Williams, michael R. C.; Aschaffenburg, Daniel J.; Schmuttenmaer, Charles A.
2013-06-01
Vibrations that involve intermolecular displacements occur in molecular crystals at frequencies in the 0.5-5 THz range (˜15-165 cm^{-1}), and these motions are direct indicators of the interaction potential between the molecules. The intermolecular potential energy surface of crystalline hydrophobic amino acids is inherently interesting simply because of the wide variety of forces (electrostatic, dipole-dipole, hydrogen-bonding, van der Waals) that are present. Furthermore, an understanding of these particular interactions is immediately relevant to important topics like protein conformation and pharmaceutical polymorphism. We measured the low-frequency absorption spectra of several polycrystalline hydrophobic amino acids using THz time-domain spectroscopy, and in addition we carried out DFT calculations using periodic boundary conditions and an exchange-correlation functional that accounts for van der Waals dispersion forces. We chose to investigate a series of similar amino acids with closely analogous unit cells (leucine, isoleucine, and allo-isoleucine, in racemic or pseudo-racemic mixtures). This allows us to consider trends in the vibrational spectra as a function of small changes in molecular arrangement and/or crystal geometry. In this way, we gain confidence that peak assignments are not based on serendipitous similarities between calculated and observed features.
Ultrafast infrared vibrational spectroscopy
Fayer, Michael D
2013-01-01
The past ten years or so have seen the introduction of multidimensional methods into infrared and optical spectroscopy. The technology of multidimensional spectroscopy is developing rapidly and its applications are spreading to biology and materials science. Edited by a recognized leader in the field and with contributions from top researchers, including experimentalists and theoreticians, this book presents the latest research methods and results and will serve as an excellent resource for other researchers.
Energy Technology Data Exchange (ETDEWEB)
Lewis, Nicholas H. C.; Dong, Hui; Oliver, Thomas A. A.; Fleming, Graham R., E-mail: grfleming@lbl.gov [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Kavli Energy Nanosciences Institute at Berkeley, Berkeley, California 94720 (United States)
2015-09-28
Two dimensional electronic spectroscopy has proved to be a valuable experimental technique to reveal electronic excitation dynamics in photosynthetic pigment-protein complexes, nanoscale semiconductors, organic photovoltaic materials, and many other types of systems. It does not, however, provide direct information concerning the spatial structure and dynamics of excitons. 2D infrared spectroscopy has become a widely used tool for studying structural dynamics but is incapable of directly providing information concerning electronic excited states. 2D electronic-vibrational (2DEV) spectroscopy provides a link between these domains, directly connecting the electronic excitation with the vibrational structure of the system under study. In this work, we derive response functions for the 2DEV spectrum of a molecular dimer and propose a method by which 2DEV spectra could be used to directly measure the electronic site populations as a function of time following the initial electronic excitation. We present results from the response function simulations which show that our proposed approach is substantially valid. This method provides, to our knowledge, the first direct experimental method for measuring the electronic excited state dynamics in the spatial domain, on the molecular scale.
Hertrampf, A; Sousa, R M; Menezes, J C; Herdling, T
2016-05-30
Quality control (QC) in the pharmaceutical industry is a key activity in ensuring medicines have the required quality, safety and efficacy for their intended use. QC departments at pharmaceutical companies are responsible for all release testing of final products but also all incoming raw materials. Near-infrared spectroscopy (NIRS) and Raman spectroscopy are important techniques for fast and accurate identification and qualification of pharmaceutical samples. Tablets containing two different active pharmaceutical ingredients (API) [bisoprolol, hydrochlorothiazide] in different commercially available dosages were analysed using Raman- and NIR Spectroscopy. The goal was to define multivariate models based on each vibrational spectroscopy to discriminate between different dosages (identity) and predict their dosage (semi-quantitative). Furthermore the combination of spectroscopic techniques was investigated. Therefore, two different multiblock techniques based on PLS have been applied: multiblock PLS (MB-PLS) and sequential-orthogonalised PLS (SO-PLS). NIRS showed better results compared to Raman spectroscopy for both identification and quantitation. The multiblock techniques investigated showed that each spectroscopy contains information not present or captured with the other spectroscopic technique, thus demonstrating that there is a potential benefit in their combined use for both identification and quantitation purposes. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Eriksen, Troels K; Karlsen, Eva; Spanget-Larsen, Jens
2015-01-01
The title compounds were investigated by means of Linear Dichroism (LD) IR spectroscopy on samples partially aligned in uniaxially stretched low-density polyethylene and by density functional theory calculations. Satisfactory overall agreement between observed and calculated vibrational wavenumbers...
DEFF Research Database (Denmark)
Hansen, Anders Kragh; Jensen, Ole Bjarlin; Andersen, Peter Eskil
2015-01-01
Diode-based high power visible lasers are perfect pump sources for, e.g., titaniumsapphire lasers. The combination of favorable scaling laws in both SFG and cascading of nonlinear crystals allows access to unprecedented powers in diode-based systems.......Diode-based high power visible lasers are perfect pump sources for, e.g., titaniumsapphire lasers. The combination of favorable scaling laws in both SFG and cascading of nonlinear crystals allows access to unprecedented powers in diode-based systems....
On Surface Order and Disorder of α-Pinene-Derived Secondary Organic Material
Energy Technology Data Exchange (ETDEWEB)
Shrestha, Mona; Zhang, Yue; Upshur, Mary Alice; Liu, Pengfei; Blair, Sandra L.; Wang, Hongfei; Nizkorodov, Sergey; Thomson, Regan; Martin, Scot T.; Geiger, Franz M.
2015-05-14
The surfaces of secondary organic aerosol particles are notoriously difficult to access experimentally, even though they are the key location where exchange between the aerosol particle phase and its gas phase occurs. Here, we overcome this difficulty by applying standard and sub 1-cm-1 resolution vibrational sum frequency generation (SFG) spectroscopy to detect C–H oscillators at the surfaces of secondary organic material (SOM) prepared from the ozonolysis of α-pinene at Harvard University and at the University of California, Irvine that were subsequently collected on Teflon filters as well as CaF2 windows using electrostatic deposition. We find both samples yield comparable SFG spectra featuring an intense peak at 2940 cm-1 that are independent of spectral resolution and location or method of preparation. We hypothesize that the SFG spectra are due to surface-active C–H oscillators associated with the four-membered ring motif of α-pinene, which produces an unresolvable spectral continuum of approximately 50 cm-1 width reminiscent of the similar, albeit much broader, O–H stretching continuum observed in the SFG spectra of aqueous surfaces. Upon subjecting the SOM samples to cycles in relative humidity (RH) between <2% RH and 95% RH, we observe reversible changes in the SFG signal intensity across the entire spectral range surveyed for a polarization combination probing components of the vibrational transition dipole moments that are oriented parallel to the plane of incidence, but no signal intensity changes for any other polarization combination investigated. These results support the notion that the C–H oscillators at the surfaces of α-pinene-derived SOM deposited on CaF2 windows shift back and forth between two different molecular orientation distributions as the RH is lowered (more ordered) or raised (less ordered). The findings thus point towards the presence of a reversible surface switch for hindering (more ordered, <2%RH) and promoting (less
International Nuclear Information System (INIS)
Morini, Filippo; Deleuze, Michael S.; Watanabe, Noboru; Takahashi, Masahiko
2015-01-01
The influence of thermally induced nuclear dynamics (molecular vibrations) in the initial electronic ground state on the valence orbital momentum profiles of furan has been theoretically investigated using two different approaches. The first of these approaches employs the principles of Born-Oppenheimer molecular dynamics, whereas the so-called harmonic analytical quantum mechanical approach resorts to an analytical decomposition of contributions arising from quantized harmonic vibrational eigenstates. In spite of their intrinsic differences, the two approaches enable consistent insights into the electron momentum distributions inferred from new measurements employing electron momentum spectroscopy and an electron impact energy of 1.2 keV. Both approaches point out in particular an appreciable influence of a few specific molecular vibrations of A 1 symmetry on the 9a 1 momentum profile, which can be unravelled from considerations on the symmetry characteristics of orbitals and their energy spacing
All-optical 40Gbit/s format conversion from NRZ to RZ based on SFG in a PPLN waveguide
Wang, Jian; Sun, Junqiang
2006-01-01
A novel all-optical 40Gbit/s NRZ-to-RZ data format conversion scheme based on sum-frequency generation (SFG) interaction in a periodically poled LiNbO 3 (PPLN) waveguide is presented for the first time, using a Mach-Zehnder interferometer (MZI). The conversion mechanism relies on the combination of attenuation and nonlinear phase shift Φ NL induced on the signal field. The performance of the conversion is numerically evaluated, with the result showing that it is more effective to yield Φ NL when appropriately phase mismatched for SFG process but Φ NL~0 when quasi-phase-matching (QPM). Compared with the cascaded second-order nonlinear interactions (SHG+DFG) with the influence of walk-off effect, a high conversion efficiency and good performance are achieved with peak power 500mw and width 2ps of the pump, which can be used in super high-speed situation (40Gbit/s and above). Finally, the inverse process of SFG and corresponding walk-off effect are analyzed and the optimum arrangement of power is proposed, showing that proper power, pump width, and waveguide length are necessary for achieving a satisfied conversion effect.
International Nuclear Information System (INIS)
Marumori, Toshio; Kuriyama, Atsushi; Sakata, Fumihiko
1980-01-01
In a formally parallel way with that exciting progress has been recently achieved in understanding the yrast spectra of the rotational nuclei in terms of the quasi-particle motion in the rotating frame, an attempt to understand the yrast spectra of the vibrational nuclei in terms of the quasi-particle motion is proposed. The essential idea is to introduce the quasi-particle motion in a generalized vibrating frame, which can be regarded as a rotating frame in the gauge space of 'physical' phonons where the number of the physical phonons plays the role of the angular momentum. On the basis of a simple fundamental principle called as the 'invariance principle of the Schroedinger equation', which leads us to the 'maximal decoupling' between the physical phonon and the intrinsic modes, it is shown that the vibrational frame as well as the physical-phonon-number operator represented by the quasi-particles can be self-consistently determined. A new scope toward the yrast spectroscopy of the vibrational nuclei in terms of the quasi-particle motion is discussed
Aliaga, Cesar; Tsung, Chia-Kuang; Alayoglu, Selim; Komvopoulos, Kyriakos; Yang, Peidong; Somorjai, Gabor A.
2011-01-01
Sum frequency generation vibrational spectroscopy and kinetic measurements obtained from gas chromatography were used to study the adsorption and hydrogenation of 2-methylfuran (MF) and 2,5-dimethylfuran (DMF) over cubic Pt nanoparticles of 7 nm
Stańczak, Joanna
2006-05-01
Dermacentor reticulatus ticks from Poland were investigated by molecular methods for the presence of rickettsiae. During 2003/2004, a total of 285 adult ticks was assayed using primers RpCS.877 and RpCS.1258 derived from the citrate synthase (gltA) gene, and 116 samples (40.7%) were positive for rickettsial DNA. Ten out of these positive samples were further assayed using SLO1F and SLO1R primers derived form the rOmpA-encoding gene to confirm that detected rickettsiae belong to the spotted fever group (SFG). The obtained sequence of a fragment of the gltA gene of Rickettsia sp. isolated from Polish D. reticulatus demonstrated 96-98% similarities to Rickettsia slovaca, Rickettsia sibirica, Rickettsia honei, and other SFG rickettsiae. The nucleotide sequences of the amplified fragments of the ompA gene were 98% homologous to RpA4 Rickettsia sp. reported from ticks collected in territories of the former Soviet Union.
Energy Technology Data Exchange (ETDEWEB)
Fernández-Bravo, Ángel; Delgado, Tomás; Lucena, Patricia; Laserna, J. Javier, E-mail: laserna@uma.es
2013-11-01
Laser-induced breakdown spectroscopy (LIBS) of organic materials is based on the analysis of atomic and ionic emission lines and on a few molecular bands, the most important being the CN violet system and the C{sub 2} Swan system. This paper is focused in molecular emission of LIBS plasmas based on the CN (B{sup 2}Σ–X{sup 2}Σ) band, one of the strongest emissions appearing in all carbon materials when analyzed in air atmosphere. An analysis of this band with sufficient spectral resolution provides a great deal of information on the molecule, which has revealed that valuable information can be obtained from the plume chemistry and dynamics affecting the excitation mechanisms of the molecules. The vibrational emission of this molecular band has been investigated to establish the dependence of this emission on the molecular structure of the materials. The paper shows that excitation/emission phenomena of molecular species observed in the plume depend strongly on the time interval selected and on the irradiance deposited on the sample surface. Precise time resolved LIBS measurements are needed for the observation of distinctive CN emission. For the organic compounds studied, larger differences in the behavior of the vibrational emission occur at early stages after plasma ignition. Since molecular emission is generally more complex than that involving atomic emission, local plasma conditions as well as plume chemistry may induce changes in vibrational emission of molecules. As a consequence, alterations in the distribution of the emissions occur in terms of relative intensities, being sensitive to the molecular structure of every single material. - Highlights: • Vibrational emission of CN species in laser-induced plasmas has been investigated. • Distribution of vibrational emission of CN has been found to be time dependent. • Laser irradiance affects the vibrational distribution of the CN molecules. • Plume chemistry controls the excitation mechanisms of CN
Energy Technology Data Exchange (ETDEWEB)
Slenkamp, Karla M.; Lynch, Michael S.; Van Kuiken, Benjamin E.; Brookes, Jennifer F.; Bannan, Caitlin C.; Daifuku, Stephanie L.; Khalil, Munira, E-mail: mkhalil@chem.washington.edu [Department of Chemistry, University of Washington, Box 351700, Seattle, Washington 98195 (United States)
2014-02-28
Using polarization-selective two-dimensional infrared (2D IR) spectroscopy, we measure anharmonic couplings and angles between the transition dipole moments of the four cyanide stretching (ν{sub CN}) vibrations found in [(NH{sub 3}){sub 5}Ru{sup III}NCFe{sup II}(CN){sub 5}]{sup −} (FeRu) dissolved in D{sub 2}O and formamide and [(NC){sub 5}Fe{sup II}CNPt{sup IV}(NH{sub 3}){sub 4}NCFe{sup II}(CN){sub 5}]{sup 4−} (FePtFe) dissolved in D{sub 2}O. These cyanide-bridged transition metal complexes serve as model systems for studying the role of high frequency vibrational modes in ultrafast photoinduced charge transfer reactions. Here, we focus on the spectroscopy of the ν{sub CN} modes in the electronic ground state. The FTIR spectra of the ν{sub CN} modes of the bimetallic and trimetallic systems are strikingly different in terms of frequencies, amplitudes, and lineshapes. The experimental 2D IR spectra of FeRu and FePtFe and their fits reveal a set of weakly coupled anharmonic ν{sub CN} modes. The vibrational mode anharmonicities of the individual ν{sub CN} modes range from 14 to 28 cm{sup −1}. The mixed-mode anharmonicities range from 2 to 14 cm{sup −1}. In general, the bridging ν{sub CN} mode is most weakly coupled to the radial ν{sub CN} mode, which involves the terminal CN ligands. Measurement of the relative transition dipole moments of the four ν{sub CN} modes reveal that the FeRu molecule is almost linear in solution when dissolved in formamide, but it assumes a bent geometry when dissolved in D{sub 2}O. The ν{sub CN} modes are modelled as bilinearly coupled anharmonic oscillators with an average coupling constant of 6 cm{sup −1}. This study elucidates the role of the solvent in modulating the molecular geometry and the anharmonic vibrational couplings between the ν{sub CN} modes in cyanide-bridged transition metal mixed valence complexes.
Spectroscopy of vibrationally hot molecules: Hydrogen cyanide and acetylene
International Nuclear Information System (INIS)
Jonas, D.M.
1992-01-01
An efficient formula for calculating nuclear spin statistical weights is presented. New experimental methods to distinguish electric and magnetic multipole transitions are proposed and used to prove that the formaldehyde A - X 0-0 transition is a magnetic dipole transition. HIgh resolution vacuum ultraviolet studies of the A → X fluorescence excitation spectrum of hydrogen cyanide (HCN) have: (i) determined that only the (0,1,0) vibrational level of the HCN A-state has a sufficiently long fluorescence lifetime to be suitable for Stimulated Emission Pumping (SEP) studies; and (ii) measured the electric dipole moment of the A-state. Several transitions in the hydrogen cyanide A → X SEP spectrum are shown to be due to the axis-switching mechanism. From a Franck-Condon plot of the intensities and a comparison between sums of predicted rotational constants and sums of observed rotational constants, all of the remaining transitions in the SEP spectrum can be securly assigned. Two weak resonances; a 2:3 CH:CN stretch Fermi resonance and a 6:2 bend:CN stretch resonance appear in the SEP spectrum. Excitation of the CH stretching vibration is predicted and shown to be entirely absent, apart from resonances, in the HCN SEP spectrum. A → X SEP spectra of acetylene (HCCH) near E VIB = 7,000 cm -1 display a wealth of strong and fully assignable anharmonic resonances and forbidden rotational transitions. It is proved that Darling-Dennison resonance between the cis and trans bending vibrations is the crucial first step in a series of anharmonic resonances which can transfer nearly all the vibrational energy out of the initial CC stretch/trans-bend excitation at high vibrational energy. Secondary steps in the vibrational energy flow are vibrational-l-resonance and the '2345' Fermi resonance. For short times, the vibrational energy redistribution obeys very restrictive rules
Dissimilar Dynamics of Coupled Water Vibrations
Jansen, Thomas L. C.; Cringus, Dan; Pshenichnikov, Maxim S.
2009-01-01
Dissimilar dynamics of coupled stretch vibrations of a water molecule are revealed by two-dimensional, IR correlation spectroscopy. These are caused by essentially non-Gaussian fluctuations of the electric field exerted by the environment on the individual OH stretch vibrations. Non-Gaussian
Spectroscopy in catalysis : an introduction
Niemantsverdriet, J.W.
2000-01-01
Spectroscopy in Catalysis describes the most important modern analytical techniques used to investigate catalytic surfaces. These include electron spectroscopy (XPS, UPS, AES, EELS), ion spectroscopy (SIMS, SNMS, RBS, LEIS), vibrational spectroscopy (infrared, Raman, EELS), temperature-programmed
Leavitt, Christopher; Raston, Paul; Moody, Grant; Shirley, Caitlyne; Douberly, Gary
2014-06-01
The structure-function relationship in proteins is widely recognized, motivating numerous investigations of isolated neutral and ionic polypeptides that generally employ conformation specific, multidimensional UV and IR spectroscopies. This data taken in conjunction with computed harmonic frequencies has provided a snapshot of the underlying molecular physics at play in many polypeptides, but few experiments have been able to probe the energetics of these systems. In this study, we use vibrational spectroscopy to measure the gas-phase enthalpy change for isomerization between two conformations of the dipeptide N-acetyl glycine methyl amide (NAGMA). A two-stage oven source is implemented producing a gas-phase equilibrium distribution of NAGMA molecules that is flash frozen upon pickup by He nanodroplets. Using polarization spectroscopy, the IR spectrum is assigned to a mixture of two conformers having intramolecular hydrogen bonds made up of either five- or seven-membered rings, C5 and C7, respectively. The interconversion enthalpy, obtained from the van't Hoff relation, is 4.52{±}0.12 kJ/mol for isomerization from the C7 to the C5-conformer. This experimental measurement is compared to computations employing a broad range of theoretical methods.
Surface vibrational spectroscopy (EELS)
International Nuclear Information System (INIS)
Okuyama, Hiroshi
2006-01-01
Adsorbed states of hydrogen on metal surfaces have been studied by means of electron energy loss spectroscopy (EELS). In this article, typical spectra and analysis as well as recent development are introduced. (author)
DEFF Research Database (Denmark)
Jalkanen, Karl J.; Jürgensen, Vibeke Würtz; Claussen, Anetta
2006-01-01
and experimental approach. The systems we have studied systematically are the amino acids (L-alanine, L-tryptophan, and L-histidine), peptides (N-acetyl L-alanine N'-methyl amide, N-acetyl L-tryptophan N'-methyl amide, N-acetyl L-histidine N'-methyl amide, L-alanyl L-alanine, tri-L-serine, N-acetyl L-alanine L......+disp, RHF, MP2, and DFT methodologies for the modeling studies with the goal of interpreting the experimentally measured vibrational spectra for these molecules to the greatest extent possible and to use this combined approach to understand the structure, function, and electronic properties......We report on our work with vibrational absorption, vibrational circular dichroism, Raman scattering, Raman optical activity, and surface-enhanced Raman spectroscopy to study protein and DNA structure, hydration, and the binding of ligands, drugs, pesticides, or herbicides via a combined theoretical...
Humbert, C.; Dreesen, L.; Mani, A. A.; Caudano, Y.; Lemaire, J.-J.; Thiry, P. A.; Peremans, A.
2002-04-01
We measured IR-visible sum-frequency generation spectra of CH 3-(C 6H 4) 2-(CH 2) 3-S-H (Biphenyl-3) self-assembled monolayers on a silver and a gold substrate. For the latter substrate, we observed different interference patterns between the resonant signal of the CH vibration and the non-resonant contribution of the substrate as a function of the visible beam wavelength. The non-linear response of the gold substrate is enhanced around 480 nm corresponding to the s-d interband transition. Such effect is not observed for the silver substrate the interband transition of which is located out of the investigated visible spectral range of 450-700 nm.
Voit, E. I.; Didenko, N. A.; Gaivoronskaya, K. A.
2018-03-01
Thermal decomposition of (NH4)2ZrF6 resulting in ZrO2 formation within the temperature range of 20°-750°C has been investigated by means of thermal and X-ray diffraction analysis and IR and Raman spectroscopy. It has been established that thermolysis proceeds in six stages. The vibrational-spectroscopy data for the intermediate products of thermal decomposition have been obtained, systematized, and summarized.
Sum-frequency spectroscopic studies: I. Surface melting of ice, II. Surface alignment of polymers
Energy Technology Data Exchange (ETDEWEB)
Wei, Xing [Univ. of California, Berkeley, CA (United States)
2000-01-01
Surface vibrational spectroscopy via infrared-visible sum-frequency generation (SFG) has been established as a useful tool to study the structures of different kinds of surfaces and interfaces. This technique was used to study the (0001) face of hexagonal ice (Ih). SFG spectra in the O-H stretch frequency range were obtained at various sample temperatures. For the vapor(air)/ice interface, the degree of orientational order of the dangling OH bonds at the surface was measured as a function of temperature. Disordering sets in around 200 K and increases dramatically with temperature, which is strong evidence of surface melting of ice. For the other ice interfaces (silica/OTS/ice and silica/ice), a similar temperature dependence of the hydrogen bonded OH stretch peak was observed; the free OH stretch mode, however, appears to be different from that of the vapor (air)/ice interface due to interactions at the interfaces. The technique was also used to measure the orientational distributions of the polymer chains on a rubbed polyvinyl alcohol surface. Results show that the polymer chains at the surface appear to be well aligned by rubbing, and the adsorbed liquid crystal molecules are aligned, in turn, by the surface polymer chains. A strong correlation exists between the orientational distributions of the polymer chains and the liquid crystal molecules, indicating that the surface-induced bulk alignment of a liquid crystal film by rubbed polymer surfaces is via an orientational epitaxy-like mechanism. This thesis also contains studies on some related issues that are crucial to the above applications. An experiment was designed to measure SFG spectra in both reflection and transmission. The result confirms that SFG in reflection is generally dominated by the surface contribution. Another issue is the motional effect due to fast orientational motion of molecules at a surface or interface. Calculations show that the effect is significant if the molecular orientation varies
Mid-infrared upconversion spectroscopy
DEFF Research Database (Denmark)
Tidemand-Lichtenberg, Peter; Dam, Jeppe Seidelin; Andersen, H. V.
2016-01-01
Mid-infrared (MIR) spectroscopy is emerging as an attractive alternative to near-infrared or visible spectroscopy. MIR spectroscopy offers a unique possibility to probe the fundamental absorption bands of a large number of gases as well as the vibrational spectra of complex molecules. In this paper...
Zhang, Zhen; Feng, Rong-juan; Li, Yi-yi; Liu, Ming-hua; Guo, Yuan
2017-08-01
Sphingomyelin(SM) is specifically enriched in the plasma membrane of mammalian cells. Its molecular structure is compose by N-acyl-Derythro-sphingosylphosphorylcholine. The function of the SM related to membrane signaling and protein trafficking are relied on the interactions of the SM, cations, cholesterol and proteins. In this report, the interaction of three different nature SMs, cations and cholesterol at air/aqueous interfaces studied by high-resolution broadband sum frequency vibrational spectroscopy, respectively. Our results shed lights on understanding the relationship between SMs monolayer, cholesterol and Cations.
Gas Phase Vibrational Spectroscopy of Weakly Volatil Safe Taggants Using a Synchrotron Source
Cuisset, Arnaud; Hindle, Francis; Mouret, Gael; Gruet, Sebastien; Pirali, Olivier; Roy, Pascale
2013-06-01
The high performances of the AILES beamline of SOLEIL allow to study at medium resolution (0.5 cm^{-1}) the gas phase THz vibrational spectra of weakly volatil compounds. Between 2008 and 2010 we recorded and analyzed the THz/Far-IR spectra of phosphorous based nerve agents thanks to sufficient vapour pressures from liquid samples at room temperature. Recently, we extended these experiments towards the vibrational spectroscopy of vapour pressures from solid samples. This project is quite challenging since we target lower volatile compounds, and so requires very high sensitive spectrometers. Moreover a specially designed heated multipass-cell have been developped for the gas phase study of very weak vapor pressures. Thanks to skills acquired during initial studies and recent experiments performed on AILES with solid PAHs, we have recorded and assigned the gas phase vibrational fingerprints from the THz to the NIR spectral domain (10-4000 cm-1) of a set of targeted nitro-derivatives. The study was focused onto the para, ortho-mononitrotoluene (p-NT, o-NT), the 1,4 Dinitrobenzene (1,4 DNB), the 2,3-dimethyl-2,3-dinitrobutane (DMNB), and 2,4 and 2,6-dinitrotoluene (2,4-2,6 DNT), which are safe taggants widely used for the detection of commercial explosives. These taggants are usually added to plastic explosives in order to facilitate their vapour detection. Therefore, there is a continuous interest for their detection and identification in realistic conditions via optical methods. A first step consists in the recording of their gas phase vibrational spectra. These expected spectra focused onto molecules involved into defence and security domains are not yet available to date and will be very useful for the scientific community. This work is supported by the contract ANR-11-ASTR-035-01. A. Cuisset, G. Mouret, O. Pirali, P. Roy, F. Cazier, H. Nouali, J. Demaison, J. Phys. Chem. B, 2008, 112:, 12516-12525 I. Smirnova, A. Cuisset, R. Bocquet, F. Hindle, G. Mouret, O
Dovbeshko, G. I.; Repnytska, O. P.; Pererva, T.; Miruta, A.; Kosenkov, D.
2004-07-01
Conformation analysis of mutated DNA-bacteriophages (PLys-23, P23-2, P47- the numbers have been assigned by T. Pererva) induced by MS2 virus incorporated in Ecoli AB 259 Hfr 3000 has been done. Surface enhanced infrared absorption (SEIRA) spectroscopy and principal component analysis has been applied for solving this problem. The nucleic acids isolated from the mutated phages had a form of double stranded DNA with different modifications. The nucleic acid from phage P47 was undergone the structural rearrangement in the most degree. The shape and position ofthe fine structure of the Phosphate asymmetrical band at 1071cm-1 as well as the stretching OH vibration at 3370-3390 cm-1 has indicated to the appearance ofadditional OH-groups. The Z-form feature has been found in the base vibration region (1694 cm-1) and the sugar region (932 cm-1). A supposition about modification of structure of DNA by Z-fragments for P47 phage has been proposed. The P23-2 and PLys-23 phages have showed the numerous minor structural changes also. On the basis of SEIRA spectra we have determined the characteristic parameters of the marker bands of nucleic acid used for construction of principal components. Contribution of different spectral parameters of nucleic acids to principal components has been estimated.
Saariaho, Anna-Maija; Jääskeläinen, Anna-Stiina; Nuopponen, Mari; Vuorinen, Tapani
2003-01-01
Raman spectroscopy of wood and lignin samples is preferably carried out in the near-infrared region because lignin produces an intense laser-induced fluorescence background at visible excitation wavelengths. However, excitation of aromatic and conjugated lignin structures with deep ultra violet (UV) light gives resonance-enhanced Raman signals while the overlapping fluorescence is eliminated. In this study, ultra violet resonance Raman (UVRR) spectroscopy was used to define characteristic vibration bands of model compounds of p-hydroxyphenyl, guaiacyl, and syringyl lignin structures at three excitation wavelengths (229, 244, and 257 nm). The intensities of each band, relative to the intensity of the aromatic vibration band at 1600 cm-1, were defined and the most suitable excitation wavelength was suggested for each structure. p-Hydroxyphenyl structures showed intensive characteristic bands at 1217-1214 and 1179-1167 cm-1 with excitation at 244 nm, whereas the bands of guaiacyl structures were more intensive with 257 nm excitation. Most intensive characteristic bands of guaiacyl structures were found at 1289-1279, 1187-1185, 1158-1155, and 791-704 cm-1. Syringyl structures had almost identical spectra with 244 and 257 nm excitations with characteristic bands at 1514-1506, 1333-1330, and 981-962 cm-1. The characteristic bands of the three structural units were also found from the compression wood, softwood, and hardwood samples, indicating that UVRR spectroscopy can be applied for the determination of chemical structures of lignin.
Gorry, PA
1985-01-01
BASIC Molecular Spectroscopy discusses the utilization of the Beginner's All-purpose Symbolic Instruction Code (BASIC) programming language in molecular spectroscopy. The book is comprised of five chapters that provide an introduction to molecular spectroscopy through programs written in BASIC. The coverage of the text includes rotational spectra, vibrational spectra, and Raman and electronic spectra. The book will be of great use to students who are currently taking a course in molecular spectroscopy.
Struts, A. V.; Barmasov, A. V.; Brown, M. F.
2015-05-01
Here we review the application of modern spectral methods for the study of G-protein-coupled receptors (GPCRs) using rhodopsin as a prototype. Because X-ray analysis gives us immobile snapshots of protein conformations, it is imperative to apply spectroscopic methods for elucidating their function: vibrational (Raman, FTIR), electronic (UV-visible absorption, fluorescence) spectroscopies, and magnetic resonance (electron paramagnetic resonance, EPR), and nuclear magnetic resonance (NMR). In the first of the two companion articles, we discuss the application of optical spectroscopy for studying rhodopsin in a membrane environment. Information is obtained regarding the time-ordered sequence of events in rhodopsin activation. Isomerization of the chromophore and deprotonation of the retinal Schiff base leads to a structural change of the protein involving the motion of helices H5 and H6 in a pH-dependent process. Information is obtained that is unavailable from X-ray crystallography, which can be combined with spectroscopic studies to achieve a more complete understanding of GPCR function.
Hill, Katalin; Pénzes, Csanád Botond; Schnöller, Donát; Horváti, Kata; Bosze, Szilvia; Hudecz, Ferenc; Keszthelyi, Tamás; Kiss, Eva
2010-10-07
Tensiometry, sum-frequency vibrational spectroscopy, and atomic force microscopy were employed to assess the cell penetration ability of a peptide conjugate of the antituberculotic agent isoniazide. Isoniazide was conjugated to peptide (91)SEFAYGSFVRTVSLPV(106), a functional T-cell epitope of the immunodominant 16 kDa protein of Mycobacterium tuberculosis. As a simple but versatile model of the cell membrane a phospholipid Langmuir monolayer at the liquid/air interface was used. Changes induced in the structure of the phospholipid monolayer by injection of the peptide conjugate into the subphase were followed by tensiometry and sum-frequency vibrational spectroscopy. The drug penetrated lipid films were transferred to a solid support by the Langmuir-Blodgett technique, and their structures were characterized by atomic force microscopy. Peptide conjugation was found to strongly enhance the cell penetration ability of isoniazide.
Pelmenschikov, Vladimir; Birrell, James A; Pham, Cindy C; Mishra, Nakul; Wang, Hongxin; Sommer, Constanze; Reijerse, Edward; Richers, Casseday P; Tamasaku, Kenji; Yoda, Yoshitaka; Rauchfuss, Thomas B; Lubitz, Wolfgang; Cramer, Stephen P
2017-11-22
[FeFe]-hydrogenases are metalloenzymes that reversibly reduce protons to molecular hydrogen at exceptionally high rates. We have characterized the catalytically competent hydride state (H hyd ) in the [FeFe]-hydrogenases from both Chlamydomonas reinhardtii and Desulfovibrio desulfuricans using 57 Fe nuclear resonance vibrational spectroscopy (NRVS) and density functional theory (DFT). H/D exchange identified two Fe-H bending modes originating from the binuclear iron cofactor. DFT calculations show that these spectral features result from an iron-bound terminal hydride, and the Fe-H vibrational frequencies being highly dependent on interactions between the amine base of the catalytic cofactor with both hydride and the conserved cysteine terminating the proton transfer chain to the active site. The results indicate that H hyd is the catalytic state one step prior to H 2 formation. The observed vibrational spectrum, therefore, provides mechanistic insight into the reaction coordinate for H 2 bond formation by [FeFe]-hydrogenases.
Höbel, Frank; Bandara, Athula; Rupprechter, Günther; Freund, Hans-Joachim
2006-02-01
Structural changes that occur on Pd-Nb 2O 5/Cu 3Au(1 0 0) model catalysts upon thermal annealing were followed by sum frequency generation (SFG) and temperature-programmed desorption (TPD) using CO as probe molecule. SFG experiments were performed both under ultrahigh vacuum and mbar pressure. Heating the catalyst to temperatures above 300 K lead to an irreversible 50% decrease in the CO adsorption capacity and modified the remaining adsorption sites. Alterations of the phase between resonant and non-resonant SFG signals upon annealing indicate a change in the electronic structure of the surface, which excludes Pd sintering or migration of Nb 2O 5 over Pd particles to cause the observed effect and rather suggests the formation of "mixed Pd-NbO x" sites. The same changes in surface properties also occur during CO hydrogenation at 1 bar and high temperature, pointing to an involvement of "mixed Pd-NbO x" sites in catalytic reactions.
Exploring Solvent Shape and Function Using - and Isomer-Selective Vibrational Spectroscopy
Johnson, Mark
2010-06-01
We illustrate the new types of information than can be obtained through isomer-selective ``hole-burning'' spectroscopy carried out in the vibrational manifolds of Ar-tagged cluster ions. Three examples of increasing complexity will be presented where the changes in a solute ion are correlated with different morphologies of a surrounding solvent cage. In the first, we discuss the weak coupling limit where different hydration morphologies lead to small distortions of a covalent ion. We then introduce the more interesting case of the hydrated electron, where different shapes of the water network lead to dramatic changes in the extent of delocalization in the diffuse excess electron cloud. We then turn to the most complex case involving hydration of the nitrosonium ion, where different arrangements of the same number of water molecules span the range in behavior from simple solvation to actively causing a chemical reaction. The latter results are particularly interesting as they provide a microscopic, molecular-level picture of the ``solvent coordinate'' commonly used to describe solvent mediated processes.
Hollas, J Michael
2013-01-01
The latest edition of this highly acclaimed title introduces the reader to a wide range of spectroscopies, and includes both the background theory and applications to structure determination and chemical analysis. It covers rotational, vibrational, electronic, photoelectron and Auger spectroscopy, as well as EXAFs and the theory of lasers and laser spectroscopy. A revised and updated edition of a successful, clearly written book Includes the latest developments in modern laser techniques, such as cavity ring-down spectroscopy and femtosecond lasers Provides numerous worked examples, calculations and questions at the end of chapters.
Vibrational Spectroscopy of Chromatographic Interfaces
Energy Technology Data Exchange (ETDEWEB)
Jeanne E. Pemberton
2011-03-10
Chromatographic separations play a central role in DOE-supported fundamental research related to energy, biological systems, the environment, and nuclear science. The overall portfolio of research activities in the Separations and Analysis Program within the DOE Office of Basic Energy Sciences includes support for activities designed to develop a molecular-level understanding of the chemical processes that underlie separations for both large-scale and analytical-scale purposes. The research effort funded by this grant award was a continuation of DOE-supported research to develop vibrational spectroscopic methods to characterize the interfacial details of separations processes at a molecular level.
The photodissociation and reaction dynamics of vibrationally excited molecules
Energy Technology Data Exchange (ETDEWEB)
Crim, F.F. [Univ. of Wisconsin, Madison (United States)
1993-12-01
This research determines the nature of highly vibrationally excited molecules, their unimolecular reactions, and their photodissociation dynamics. The goal is to characterize vibrationally excited molecules and to exploit that understanding to discover and control their chemical pathways. Most recently the author has used a combination of vibrational overtone excitation and laser induced fluorescence both to characterize vibrationally excited molecules and to study their photodissociation dynamics. The author has also begun laser induced grating spectroscopy experiments designed to obtain the electronic absorption spectra of highly vibrationally excited molecules.
Probing Intermolecular Electron Delocalization in Dimer Radical Anions by Vibrational Spectroscopy
International Nuclear Information System (INIS)
Mani, Tomoyasu; Brookhaven National Laboratory; Grills, David C.
2017-01-01
Delocalization of charges is one of the factors controlling charge transport in conjugated molecules. It is considered to play an important role in the performance of a wide range of molecular technologies, including organic solar cells and organic electronics. Dimerization reactions are well-suited as a model to investigate intermolecular spatial delocalization of charges. And while dimerization reactions of radical cations are well investigated, studies on radical anions are still scarce. Upon dimerization of radical anions with neutral counterparts, an electron is considered to delocalize over the two molecules. By using time-resolved infrared (TRIR) detection coupled with pulse radiolysis, we show that radical anions of 4-n-hexyl-4'-cyanobiphenyl (6CB) undergo such dimerization reactions, with an electron equally delocalized over the two molecules. We have recently demonstrated that nitrile ν(C≡N) vibrations respond to the degree of electron localization of nitrile-substituted anions: we can quantify the changes in the electronic charges from the neutral to the anion states in the nitriles by monitoring the ν(C≡N) IR shifts. In the first part of this article, we show that the sensitivity of the ν(C≡N) IR shifts does not depend on solvent polarity. In the second part, we describe how probing the shifts of the nitrile IR vibrational band unambiguously confirms the formation of dimer radical anions, with K dim = 3 × 10 4 M –1 . IR findings are corroborated by electronic absorption spectroscopy and electronic structure calculations. We find that the presence of a hexyl chain and the formation of π–π interactions are both crucial for dimerization of radical anions of 6CB with neutral 6CB. Our study provides clear evidence of spatial delocalization of electrons over two molecular fragments.
Vibrational Surface Electron-Energy-Loss Spectroscopy Probes Confined Surface-Phonon Modes
Directory of Open Access Journals (Sweden)
Hugo Lourenço-Martins
2017-12-01
Full Text Available Recently, two reports [Krivanek et al. Nature (London 514, 209 (2014NATUAS0028-083610.1038/nature13870, Lagos et al. Nature (London 543, 529 (2017NATUAS0028-083610.1038/nature21699] have demonstrated the amazing possibility to probe vibrational excitations from nanoparticles with a spatial resolution much smaller than the corresponding free-space phonon wavelength using electron-energy-loss spectroscopy (EELS. While Lagos et al. evidenced a strong spatial and spectral modulation of the EELS signal over a nanoparticle, Krivanek et al. did not. Here, we show that discrepancies among different EELS experiments as well as their relation to optical near- and far-field optical experiments [Dai et al. Science 343, 1125 (2014SCIEAS0036-807510.1126/science.1246833] can be understood by introducing the concept of confined bright and dark surface phonon modes, whose density of states is probed by EELS. Such a concise formalism is the vibrational counterpart of the broadly used formalism for localized surface plasmons [Ouyang and Isaacson Philos. Mag. B 60, 481 (1989PMABDJ1364-281210.1080/13642818908205921, García de Abajo and Aizpurua Phys. Rev. B 56, 15873 (1997PRBMDO0163-182910.1103/PhysRevB.56.15873, García de Abajo and Kociak Phys. Rev. Lett. 100, 106804 (2008PRLTAO0031-900710.1103/PhysRevLett.100.106804, Boudarham and Kociak Phys. Rev. B 85, 245447 (2012PRBMDO1098-012110.1103/PhysRevB.85.245447]; it makes it straightforward to predict or interpret phenomena already known for localized surface plasmons such as environment-related energy shifts or the possibility of 3D mapping of the related surface charge densities [Collins et al. ACS Photonics 2, 1628 (2015APCHD52330-402210.1021/acsphotonics.5b00421].
Ohto, Tatsuhiko; Hunger, Johannes; Backus, Ellen H G; Mizukami, Wataru; Bonn, Mischa; Nagata, Yuki
2017-03-08
The osmolyte molecule trimethylamine-N-oxide (TMAO) stabilizes the structure of proteins. As functional proteins are generally found in aqueous solutions, an important aspect of this stabilization is the interaction of TMAO with water. Here, we review, using vibrational spectroscopy and molecular dynamics simulations, recent studies on the structure and dynamics of TMAO with its surrounding water molecules. This article ends with an outlook on the open questions on TMAO-protein and TMAO-urea interactions in aqueous environments.
Energy Technology Data Exchange (ETDEWEB)
Foehlisch, A.; Nilsson, A.; Martensson, N. [Uppsala Univ. (Sweden)] [and others
1997-04-01
There are various effects which determine the line shape of a core-level electron spectrum. These are due to the finite life-time of the core hole, inelastic scattering of the outgoing photoelectron, electronic shake-up and shake-off processes and vibrational excitations. For free atoms and molecules the different contributions to the observed line shapes can often be well separated. For solids, surfaces and adsorbates the line shapes are in general much broader and it has in the past been assumed that no separation of the various contributions can be made. In the present report the authors will show that this is indeed not the case. Surprisingly, the vibrational fine structure of CO adsorbed on Ni(100) can be resolved in the C 1s and O 1s electron spectra. This was achieved by the combination of highly monochromatized soft X-rays from B18.0 with a high resolution Scienta 200 mm photoelectron spectrometer. X-ray photoelectron spectroscopy (XPS) with tunable excitation energy yields as a core level spectroscopy atomic and site-specific information. The presented measurements allow for a determination of internuclear distances and potential energy curves in corehole ionized adsorbed molecules. The authors analysis of the c(2x2) phase CO/Ni(100) on {open_quotes}top{close_quotes} yielded a vibrational splitting of 217 +/- 2 meV for C 1s ionization. For O 1s ionization a splitting of 173 +/- 8 meV was found.
Structural determination of some uranyl compounds by vibrational spectroscopy
International Nuclear Information System (INIS)
Rodriguez S, A.; Martinez Q, E.
1990-07-01
The vibrational spectra of different uranyl compounds has been studied and of it spectral information has been used the fundamental asymmetric vibrational frequency, to determine the length and constant bond force U=O by means of the combination of the concept of absorbed energy and the mathematical expression of Badger modified by Jones. It is intended a factor that simplifies the mathematical treatment and the results are compared with the values obtained for other methods. (Author)
Maekawa, Hiroaki; Sul, Soohwan; Ge, Nien-Hui
2013-08-01
We have applied infrared three-pulse photon echo and single- and dual-frequency 2D IR spectroscopy to the ester Cdbnd O and diazo Ndbnd N stretching modes in ethyl diazoacetate (EDA), and investigated their vibrational frequency fluctuations and correlation. The two modes exhibit different vibrational dynamics and 2D lineshape, which are well simulated by frequency-frequency correlation functions (FFCFs) with two decaying components. Although the FT IR spectrum shows a single Cdbnd O band, absolute magnitude 2D IR nonrephasing spectrum displays spectral signatures supporting the presence of cis and trans conformations. The cross-peak inclined toward the anti-diagonal in the dual-frequency 2D IR spectrum, indicating that the frequency fluctuations of the two modes are anticorrelated. This behavior is attributed to anticorrelated change in the bond orders when solvent and structural fluctuations causes EDA to adopt a different mixture of the two dominant resonance structures. The effects of cross FFCF on the cross-peak line shape are discussed.
Mork, Steven Wayne
High resolution infrared spectroscopy was used to examine intramolecular vibrational interactions in 2 -fluoroethanol (2FE) and 1,2-difluoroethane (DFE). A high resolution infrared spectrophotometer capable of better than 10 MHz spectral resolution was designed and constructed. The excitation source consists of three lasers: an argon-ion pumped dye laser which pumps a color -center laser. The infrared beam from the color-center laser is used to excite sample molecules which are rotationally and vibrationally cooled in a supersonic molecular beam. Rovibrational excitation of the sample molecules is detected by monitoring the kinetic energy of the molecular beam with a bolometer. The high resolution infrared spectrum of 2FE was collected and analyzed over the 2977-2990 cm^ {-1}^ectral region. This region contains the asymmetric CH stretch on the fluorinated carbon. The spectrum revealed extensive perturbations in the rotational fine structure. Analysis of these perturbations has provided a quantitative measure of selective vibrational mode coupling between the C-H stretch and its many neighboring dark vibrational modes. Interestingly, excitation of the C-H stretch is known to induce a photoisomerization reaction between 2FE's Gg^' and Tt conformers. Implications of the role of mode coupling in the reaction mechanism are also addressed. Similarly, the high resolution infrared spectrum of DFE was collected and analyzed over the 2978-2996 cm ^{-1}^ectral region. This region contains the symmetric combination of asymmetric C-H stretches in DFE. Perturbations in the rotational fine structure indicate vibrational mode coupling to a single dark vibrational state. The dark state is split by approximately 19 cm^{-1} due to tunneling between two identical gauche conformers. The coupling mechanism is largely anharmonic with a minor component of B/C-plane Coriolis coupling. Effects of centrifugal distortion along the molecular A-axis are also observed. The coupled vibrational
Study of confinement and sliding friction of fluids using sum frequency generation spectroscopy
Nanjundiah, Kumar
2007-12-01
Friction and wear are important technologically. Tires on wet roads, windshield wipers and human joints are examples where nanometer-thick liquids are confined between flexible-rigid contact interfaces. Fundamental understanding of the structure of these liquids can assist in the design of products such as artificial joints and lubricants for Micro-electromechanical systems [MEMS]. Prior force measurements have suggested an increase in apparent viscosity of confined liquid and sometimes solid-like responses. But, these have not given the state of molecules under confinement. In the present study, we have used a surface sensitive, non-linear optical technique (infrared-visible sum frequency generation spectroscopy [SFG]) to investigate molecular structure at hidden interfaces. SFG can identify chemical groups, concentration and orientation of molecules at an interface. A friction cell was developed to study sliding of a smooth elastomeric lens against a sapphire surface. Experiments were done with dry sliding as well as lubricated sliding in the presence of linear alkane liquids. SFG spectra at the alkane/sapphire interface revealed ordering of the confined alkane molecules. These were more ordered than alkane liquid, but less ordered than alkane crystal. Cooling of the confined alkane below its melting temperature [TM] led to molecular orientation that was different from that of bulk crystal next to a sapphire surface. Molecules were oriented with their symmetry axis parallel to the surface normal. In addition, the melting temperature [Tconf] under confinement for a series of linear alkanes (n =15--27) showed a surprising trend. Intermediate molecular weights showed melting point depression. The T conf values suggested that melting started at the alkane/sapphire interface. In another investigation, confinement of water between an elastomeric PDMS lens and sapphire was studied. SFG spectra at the sapphire/water/PDMS interface revealed a heterogeneous morphology. The
Larkin, Peter J; Dabros, Marta; Sarsfield, Beth; Chan, Eric; Carriere, James T; Smith, Brian C
2014-01-01
Polymorph detection, identification, and quantitation in crystalline materials are of great importance to the pharmaceutical industry. Vibrational spectroscopic techniques used for this purpose include Fourier transform mid-infrared (FT-MIR) spectroscopy, Fourier transform near-infrared (FT-NIR) spectroscopy, Raman spectroscopy, and terahertz (THz) and far-infrared (FIR) spectroscopy. Typically, the fundamental molecular vibrations accessed using high-frequency Raman and MIR spectroscopy or the overtone and combination of bands in the NIR spectra are used to monitor the solid-state forms of active pharmaceutical ingredients (APIs). The local environmental sensitivity of the fundamental molecular vibrations provides an indirect probe of the long-range order in molecular crystals. However, low-frequency vibrational spectroscopy provides access to the lattice vibrations of molecular crystals and, hence, has the potential to more directly probe intermolecular interactions in the solid state. Recent advances in filter technology enable high-quality, low-frequency Raman spectra to be acquired using a single-stage spectrograph. This innovation enables the cost-effective collection of high-quality Raman spectra in the 200-10 cm(-1) region. In this study, we demonstrate the potential of low-frequency Raman spectroscopy for the polymorphic characterization of APIs. This approach provides several benefits over existing techniques, including ease of sampling and more intense, information-rich band structures that can potentially discriminate among crystalline forms. An improved understanding of the relationship between the crystalline structure and the low-frequency vibrational spectrum is needed for the more widespread use of the technique.
Energy Technology Data Exchange (ETDEWEB)
Crozier, Peter A., E-mail: crozier@asu.edu [School for the Engineering of Matter, Transport and Energy, Arizona State University, 501 E. Tyler Mall, Tempe, AZ 85287-6106 (United States); Aoki, Toshihiro [LeRoy Eyring Center for Solid State Science, Arizona State University, Tempe, AZ 85287-1704 (United States); Liu, Qianlang [School for the Engineering of Matter, Transport and Energy, Arizona State University, 501 E. Tyler Mall, Tempe, AZ 85287-6106 (United States)
2016-10-15
Understanding the role of water, hydrate and hydroxyl species on nanoparticle surfaces and interfaces is very important in both physical and life sciences. Detecting the presence of oxygen-hydrogen species with nanometer resolution is extremely challenging at present. Here we show that the recently developed vibrational electron energy-loss spectroscopy using subnanometer focused electron beams can be employed to spectroscopically identify the local presence and variation of OH species on nanoscale surfaces. The hydrogen-oxygen fingerprint can be correlated with highly localized structural and morphological information obtained from electron imaging. Moreover, the current approach exploits the aloof beam mode of spectral acquisition which does not require direct electron irradiation of the sample thus greatly reducing beam damage to the OH bond. These findings open the door for using electron microscopy to probe local hydroxyl and hydrate species on nanoscale organic and inorganic structures. - Highlights: • High spatial resolution spectroscopic detection of water related species in nanoparticles. • Detection of OH stretch modes with vibrational EELS. • Differentiation between hydrate and hydroxide species on or on nanoparticles. • Detection of hydrate on a single 60 nm oxide nanoparticle of MgO. • Use of aloof beam EELS to minimize radiation damage.
Spálovská, Dita; Králík, František; Kohout, Michal; Jurásek, Bronislav; Habartová, Lucie; Kuchař, Martin; Setnička, Vladimír
2018-05-01
Recently, there has been a worldwide substantial increase in the consumption of new psychoactive substances (NPS), compounds that mimic the structure of illicit drugs, such as amphetamines or ecstasy. The producers try to avoid the law by a slight modification of illicit structures, thereby developing dozens of temporarily legal NPS every year. The current trends in the detection and monitoring of such substances demand a fast and reliable analysis. Molecular spectroscopy represents a highly effective tool for the identification of NPS and chiroptical methods can provide further information on their 3D structure, which is the key for the determination of their biological activity. We present the first systematic study of NPS, specifically butylone, combining chiroptical and vibrational spectroscopies with ab initio calculations. According to density functional theory calculations, 6 stable lowest energy conformers of butylone were found and their molecular structure was described. For each conformer, the relative abundance based on the Boltzmann distribution was estimated, their population weighted spectra predicted and compared to the experimental results. Very good agreement between the experimental and the simulated spectra was achieved, which allowed not only the assignment of the absolute configuration, but also a precise description of the molecular structure. © 2018 Wiley Periodicals, Inc.
Nonlinear spectroscopic studies of interfacial molecular ordering
International Nuclear Information System (INIS)
Superfine, R.
1991-07-01
The second order nonlinear optical processes of second harmonic generation and sum frequency generation are powerful new probes of surfaces. They possess unusual surface sensitivity due to the symmetry properties of the nonlinear susceptibility. In particular, infrared-visible sum frequency generation (SFG) can obtain the vibrational spectrum of sub-monolayer coverages of molecules. In this thesis, we explore the unique information that can be obtained from SFG. We take advantage of the sensitivity of SFG to the conformation of alkane chains to study the interaction between adsorbed liquid crystal molecules and surfactant treated surfaces. The sign of the SFG susceptibility depends on the sign of the molecular polarizability and the orientation, up or down, of the molecule. We experimentally determine the sign of the susceptibility and use it to determine the absolute orientation to obtain the sign of the molecular polarizability and show that this quantity contains important information about the dynamics of molecular charge distributions. Finally, we study the vibrational spectra and the molecular orientation at the pure liquid/vapor interface of methanol and water and present the most detailed evidence yet obtained for the structure of the pure water surface. 32 refs., 4 figs., 2 tabs
Jung, Suyong; Park, Minkyu; Park, Jaesung; Jeong, Tae-Young; Kim, Ho-Jong; Watanabe, Kenji; Taniguchi, Takashi; Ha, Dong Han; Hwang, Chanyong; Kim, Yong-Sung
2015-11-13
Inelastic electron tunneling spectroscopy is a powerful technique for investigating lattice dynamics of nanoscale systems including graphene and small molecules, but establishing a stable tunnel junction is considered as a major hurdle in expanding the scope of tunneling experiments. Hexagonal boron nitride is a pivotal component in two-dimensional Van der Waals heterostructures as a high-quality insulating material due to its large energy gap and chemical-mechanical stability. Here we present planar graphene/h-BN-heterostructure tunneling devices utilizing thin h-BN as a tunneling insulator. With much improved h-BN-tunneling-junction stability, we are able to probe all possible phonon modes of h-BN and graphite/graphene at Γ and K high symmetry points by inelastic tunneling spectroscopy. Additionally, we observe that low-frequency out-of-plane vibrations of h-BN and graphene lattices are significantly modified at heterostructure interfaces. Equipped with an external back gate, we can also detect high-order coupling phenomena between phonons and plasmons, demonstrating that h-BN-based tunneling device is a wonderful playground for investigating electron-phonon couplings in low-dimensional systems.
Foucher, Mickaël; Marinov, Daniil; Carbone, Emile; Chabert, Pascal; Booth, Jean-Paul
2015-08-01
Inductively-coupled plasmas in pure O2 (at pressures of 5-80 mTorr and radiofrequency power up to 500 W) were studied by optical absorption spectroscopy over the spectral range 200-450 nm, showing the presence of highly vibrationally excited O2 molecules (up to vʺ = 18) by Schumann-Runge band absorption. Analysis of the relative band intensities indicates a vibrational temperature up to 10,000 K, but these hot molecules only represent a fraction of the total O2 density. By analysing the (11-0) band at higher spectral resolution the O2 rotational temperature was also determined, and was found to increase with both pressure and power, reaching 900 K at 80 mTorr 500 W. These measurements were achieved using a new high-sensitivity ultra-broad-band absorption spectroscopy setup, based on a laser-plasma light source, achromatic optics and an aberration-corrected spectrograph. This setup allows the measurement of weak broadband absorbances due to a baseline variability lower than 2 × 10-5 across a spectral range of 250 nm.
Bozzini, Benedetto; Busson, Bertrand; Gayral, Audrey; Humbert, Christophe; Mele, Claudio; Six, Catherine; Tadjeddine, Abderrahmane
2012-06-25
In this paper we report an in situ electrochemical Sum-/Difference Frequency Generation (SFG/DFG) spectroscopy investigation of the adsorption of nitrile and CN⁻ from the ionic liquid 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl) amide ([BMP][TFSA]) containing 4-{2-[1-(2-cyanoethyl)-1,2,3,4-tetrahydroquinolin-6-yl]-diazenyl}benzonitrile (CTDB) at Au electrodes in the absence and in the presence of the Au-electrodeposition process from K[Au(CN)₂]. The adsorption of nitrile and its coadsorption with CN⁻ resulting either from the cathodic decomposition of the dye or from ligand release from the Au(I) cyanocomplex yield potential-dependent single or double SFG bands in the range 2,125-2,140 cm⁻¹, exhibiting Stark tuning values of ca. 3 and 1 cm⁻¹ V⁻¹ in the absence and presence of electrodeposition, respectively. The low Stark tuning found during electrodeposition correlates with the cathodic inhibiting effect of CTDB, giving rise to its levelling properties. The essential insensitivity of the other DFG parameters to the electrodeposition process is due to the growth of smooth Au.
Advanced techniques for actinide spectroscopy (ATAS 2012). Abstract book
Energy Technology Data Exchange (ETDEWEB)
Foerstendorf, Harald; Mueller, Katharina; Steudtner, Robin [eds.
2012-07-01
The abstract book of the International workshop on advanced techniques for actinide spectroscopy (ATAS 2012) include contributions concerning the following issues: environmental applications, NMR spectroscopy, vibrational spectroscopy, X-ray spectroscopy and theory, technical application: separation processes, emission spectroscopy.
Advanced techniques for actinide spectroscopy (ATAS 2012). Abstract book
International Nuclear Information System (INIS)
Foerstendorf, Harald; Mueller, Katharina; Steudtner, Robin
2012-01-01
The abstract book of the International workshop on advanced techniques for actinide spectroscopy (ATAS 2012) include contributions concerning the following issues: environmental applications, NMR spectroscopy, vibrational spectroscopy, X-ray spectroscopy and theory, technical application: separation processes, emission spectroscopy.
PREFACE: Vibrations at surfaces Vibrations at surfaces
Rahman, Talat S.
2011-12-01
This special issue is dedicated to the phenomenon of vibrations at surfaces—a topic that was indispensible a couple of decades ago, since it was one of the few phenomena capable of revealing the nature of binding at solid surfaces. For clean surfaces, the frequencies of modes with characteristic displacement patterns revealed how surface geometry, as well as the nature of binding between atoms in the surface layers, could be different from that in the bulk solid. Dispersion of the surface phonons provided further measures of interatomic interactions. For chemisorbed molecules on surfaces, frequencies and dispersion of the vibrational modes were also critical for determining adsorption sites. In other words, vibrations at surfaces served as a reliable means of extracting information about surface structure, chemisorption and overlayer formation. Experimental techniques, such as electron energy loss spectroscopy and helium-atom-surface scattering, coupled with infra-red spectroscopy, were continually refined and their resolutions enhanced to capture subtleties in the dynamics of atoms and molecules at surfaces. Theoretical methods, whether based on empirical and semi-empirical interatomic potential or on ab initio electronic structure calculations, helped decipher experimental observations and provide deeper insights into the nature of the bond between atoms and molecules in regions of reduced symmetry, as encountered on solid surfaces. Vibrations at surfaces were thus an integral part of the set of phenomena that characterized surface science. Dedicated workshops and conferences were held to explore the variety of interesting and puzzling features revealed in experimental and theoretical investigations of surface vibrational modes and their dispersion. One such conference, Vibrations at Surfaces, first organized by Harald Ibach in Juelich in 1980, continues to this day. The 13th International Conference on Vibrations at Surfaces was held at the University of
Su, Yudan; Han, Hui-Ling; Cai, Qun; Wu, Qiong; Xie, Mingxiu; Chen, Daoyong; Geng, Baisong; Zhang, Yuanbo; Wang, Feng; Shen, Y R; Tian, Chuanshan
2015-10-14
Sum-frequency vibrational spectroscopy was employed to probe polymer contaminants on chemical vapor deposition (CVD) graphene and to study alkane and polyethylene (PE) adsorption on graphite. In comparing the spectra from the two surfaces, it was found that the contaminants on CVD graphene must be long-chain alkane or PE-like molecules. PE adsorption from solution on the honeycomb surface results in a self-assembled ordered monolayer with the C-C skeleton plane perpendicular to the surface and an adsorption free energy of ∼42 kJ/mol for PE(H(CH2CH2)nH) with n ≈ 60. Such large adsorption energy is responsible for the easy contamination of CVD graphene by impurity in the polymer during standard transfer processes. Contamination can be minimized with the use of purified polymers free of PE-like impurities.
Vibrational properties of epitaxial Bi4Te3 films as studied by Raman spectroscopy
Directory of Open Access Journals (Sweden)
Hao Xu
2015-08-01
Full Text Available Bi4Te3, as one of the phases of the binary Bi–Te system, shares many similarities with Bi2Te3, which is known as a topological insulator and thermoelectric material. We report the micro-Raman spectroscopy study of 50 nm Bi4Te3 films on Si substrates prepared by molecular beam epitaxy. Raman spectra of Bi4Te3 films completely resolve the six predicted Raman-active phonon modes for the first time. Structural features and Raman tensors of Bi4Te3 films are introduced. According to the wavenumbers and assignments of the six eigenpeaks in the Raman spectra of Bi4Te3 films, it is found that the Raman-active phonon oscillations in Bi4Te3 films exhibit the vibrational properties of those in both Bi and Bi2Te3 films.
Energy Technology Data Exchange (ETDEWEB)
Kneebone, Jared L. [Univ. of Rochester, Rochester, NY (United States); Daifuku, Stephanie L. [Univ. of Rochester, Rochester, NY (United States); Kehl, Jeffrey A. [Univ. of Rochester, Rochester, NY (United States); Wu, Gang [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Chung, Hoon T. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hu, Michael Y. [Argonne National Lab. (ANL), Argonne, IL (United States); Alp, E. Ercan [Argonne National Lab. (ANL), Argonne, IL (United States); More, Karren L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Zelenay, Piotr [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Holby, Edward F. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Neidig, Michael L. [Univ. of Rochester, Rochester, NY (United States)
2017-07-06
While non-precious metal M-N-C (M = Fe or Co) catalysts have been developed that are effective for the oxygen reduction reaction in polymer electrolyte fuel cells, no consensus has yet been reached regarding the nature of the M sites in these heterogeneous catalysts that are responsible for reaction with dioxygen (O2). While multiple studies have developed correlations between Fe distributions in as-prepared catalysts and ORR activity, the direct identification of sites reactive towards O2 or O2-analog molecules remains a significant challenge. In the present study, we demonstrate a new approach to identifying and characterizing potential Fe active sites in complex ORR catalysts that combines an effective probe molecule (NO(g)) Mössbauer spectroscopy and nuclear resonance vibrational spectroscopy (NRVS) with density functional theory (DFT) calculations. Mössbauer spectroscopic studies demonstrate that NO(g) treatment of electrochemically reduced PANI-57Fe-C leads to selective reaction with only a sub-set of the Fe species present. Nuclear resonance vibrational spectroscopic studies identified new Fe-ligand vibrations associated with the site reactive towards NO(g). DFT calculations of vibrational properties of a small selection of previously proposed active site structures suggest that graphene zig-zag edge hosted Fe-N structures may be responsible for the observed vibrational behavior with NO(g) probe molecules. Moreover, such sites are likely also reactive to O2, possibly serving as the ORR active sites in the synthesized materials.
Nonlinear optical polarization analysis in chemistry and biology
Simpson, Garth J
2017-01-01
This rigorous yet accessible guide presents a molecular-based description of nonlinear optical polarization analysis of chemical and biological assemblies. It includes discussion of the most common nonlinear optical microscopy and interfacial measurements used for quantitative analysis, specifically second harmonic generation (SHG), two-photon excited fluorescence (2PEF), vibrational sum frequency generation (SFG), and coherent anti-Stokes Raman spectroscopy/stimulated Raman spectroscopy (CARS/SRS). A linear algebra mathematical framework is developed, allowing step-wise systematic connections to be made between the observable measurements and the molecular response. Effects considered include local field corrections, the molecular orientation distribution, rotations between the molecular frame, the local frame and the laboratory frame, and simplifications from molecular and macromolecular symmetry. Specific examples are provided throughout the book, working from the common and relatively simple case studies ...
Isaac, Rohan; Goetz, Katelyn P.; Roberts, Drew; Jurchescu, Oana D.; McNeil, L. E.
2018-02-01
Charge-transfer (CT) complexes are a promising class of materials for the semiconductor industry because of their versatile properties. This class of compounds shows a variety of phase transitions, which are of interest because of their potential impact on the electronic characteristics. Here temperature-dependent vibrational spectroscopy is used to study structural phase transitions in a set of organic CT complexes. Splitting and broadening of infrared-active phonons in the complex formed between pyrene and pyromellitic dianhydride (PMDA) confirm the structural transition is of the order-disorder type and complement previous x-ray diffraction (XRD) results. We show that this technique is a powerful tool to characterize transitions, and apply it to a range of binary CT complexes composed of polyaromatic hyrdocarbons (anthracene, perylene, phenanthrene, pyrene, and stilbene) and PMDA. We extend the understanding of transitions in perylene-PMDA and pyrene-PMDA, and show that there are no order-disorder transitions present in anthracene-PMDA, stilbene-PMDA and phenanthrene-PMDA in the temperature range investigated here.
Energy Technology Data Exchange (ETDEWEB)
Gelin, Maxim F.; Domcke, Wolfgang [Department of Chemistry, Technische Universität München, D-85747 Garching (Germany); Rao, B. Jayachander [Departamento de Química and Centro de Química, Universidade de Coimbra, 3004-535 Coimbra (Portugal)
2016-05-14
We give a detailed theoretical analysis of the simplest variant of femtosecond stimulated Raman spectroscopy, where a picosecond Raman pump pulse and a femtosecond Raman probe pulse are applied resonantly to a chromophore in thermal equilibrium in the ground electronic state. We demonstrate that this technique is capable of the detection of dephasing-free Raman-like lines revealing vibrational modes not only in the electronic ground state but also in the excited electronic state of the chromophore. The analytical results obtained with simplifying assumptions for the shape of the laser pulses are substantiated by numerical simulations with realistic laser pulses, employing the equation-of-motion phase-matching approach.
Time-resolved study of formate on Ni( 1 1 1 ) by picosecond SFG spectroscopy
Kusafuka, K.; Noguchi, H.; Onda, K.; Kubota, J.; Domen, K.; Hirose, C.; Wada, A.
2002-04-01
Time-resolved vibrational measurements were carried out on formate (HCOO) adsorbed on Ni(1 1 1) surface by combining the sum-frequency generation method and picosecond laser system (time resolution of 6 ps). Rapid intensity decrease (within the time resolution) followed by intensity recovery (time constant of several tens of ps) of CH stretching signal was observed when picosecond 800 nm pulse was irradiated on the sample surface. From the results of temperature and pump fluence dependences of temporal behaviour of signal intensity, we concluded that the observed intensity change was induced by non-thermal process. Mechanism of the temporal intensity change was discussed.
Directory of Open Access Journals (Sweden)
Tsen Shaw-Wei D
2006-09-01
Full Text Available Abstract Background Recently, a technique which departs radically from conventional approaches has been proposed. This novel technique utilizes biological objects such as viruses as nano-templates for the fabrication of nanostructure elements. For example, rod-shaped viruses such as the M13 phage and tobacco mosaic virus have been successfully used as biological templates for the synthesis of semiconductor and metallic nanowires. Results and discussion Low wave number (≤ 20 cm-1 acoustic vibrations of the M13 phage have been studied using Raman spectroscopy. The experimental results are compared with theoretical calculations based on an elastic continuum model and appropriate Raman selection rules derived from a bond polarizability model. The observed Raman mode has been shown to belong to one of the Raman-active axial torsion modes of the M13 phage protein coat. Conclusion It is expected that the detection and characterization of this low frequency vibrational mode can be used for applications in nanotechnology such as for monitoring the process of virus functionalization and self-assembly. For example, the differences in Raman spectra can be used to monitor the coating of virus with some other materials and nano-assembly process, such as attaching a carbon nanotube or quantum dots.
DEFF Research Database (Denmark)
Kumpf, C.; Müller, A.; Weigand, W.
2003-01-01
The atomic structure and lattice dynamics of epitaxial BeTe(001) thin films are derived from surface x-ray diffraction and Raman spectroscopy. On the Te-rich BeTe(001) surface [1 (1) over bar0]-oriented Te dimers are identified. They cause a (2 X 1) superstructure and induce a pronounced buckling...... in the underlying Te layer. The Be-rich surface exhibits a (4 X 1) periodicity with alternating Te dimers and Te-Be-Te trimers. A vibration eigenfrequency of 165 cm(-1) is observed for the Te-rich surface, while eigenmodes at 157 and 188 cm(-1) are found for the Be-rich surface. The experimentally derived atomic...... geometry and the vibration modes are in very good agreement with the results of density functional theory calculations....
Lehnert, Nicolai; Galinato, Mary Grace I; Paulat, Florian; Richter-Addo, George B; Sturhahn, Wolfgang; Xu, Nan; Zhao, Jiyong
2010-05-03
This study presents Nuclear Resonance Vibrational Spectroscopy (NRVS) data on the five-coordinate (5C) ferrous heme-nitrosyl complex [Fe(OEP)(NO)] (1, OEP(2-) = octaethylporphyrinato dianion) and the corresponding (15)N(18)O labeled complex. The obtained spectra identify two isotope sensitive features at 522 and 388 cm(-1), which shift to 508 and 381 cm(-1), respectively, upon isotope labeling. These features are assigned to the Fe-NO stretch nu(Fe-NO) and the in-plane Fe-N-O bending mode delta(ip)(Fe-N-O), the latter has been unambiguously assigned for the first time for 1. The obtained NRVS data were simulated using our quantum chemistry centered normal coordinate analysis (QCC-NCA). Since complex 1 can potentially exist in 12 different conformations involving the FeNO and peripheral ethyl orientations, extended density functional theory (DFT) calculations and QCC-NCA simulations were performed to determine how these conformations affect the NRVS properties of [Fe(OEP)NO]. These results show that the properties and force constants of the FeNO unit are hardly affected by the conformational changes involving the ethyl substituents. On the other hand, the NRVS-active porphyrin-based vibrations around 340-360, 300-320, and 250-270 cm(-1) are sensitive to the conformational changes. The spectroscopic changes observed in these regions are due to selective mechanical couplings of one component of E(u)-type (in ideal D(4h) symmetry) porphyrin-based vibrations with the in-plane Fe-N-O bending mode. This leads to the observed variations in Fe(OEP) core mode energies and NRVS intensities without affecting the properties of the FeNO unit. The QCC-NCA simulated NRVS spectra of 1 show excellent agreement with experiment, and indicate that conformer F is likely present in the samples of this complex investigated here. The observed porphyrin-based vibrations in the NRVS spectra of 1 are also assigned based on the QCC-NCA results. The obtained force constants of the Fe-NO and N
International Nuclear Information System (INIS)
Maekawa, Hiroaki; Sul, Soohwan; Ge, Nien-Hui
2013-01-01
Highlights: ► Vibrational dynamics of conjugated C=O and N=N modes of ethyl diazoacetate was studied. ► Their frequency–frequency correlation functions are different. ► The dual-frequency 2D IR spectrum indicates anticorrelated frequency fluctuations. ► Correlation effects on dual-frequency 2D IR spectra are discussed. ► The existence of cis and trans conformers is revealed in 2D IR spectra. - Abstract: We have applied infrared three-pulse photon echo and single- and dual-frequency 2D IR spectroscopy to the ester C=O and diazo N=N stretching modes in ethyl diazoacetate (EDA), and investigated their vibrational frequency fluctuations and correlation. The two modes exhibit different vibrational dynamics and 2D lineshape, which are well simulated by frequency–frequency correlation functions (FFCFs) with two decaying components. Although the FT IR spectrum shows a single C=O band, absolute magnitude 2D IR nonrephasing spectrum displays spectral signatures supporting the presence of cis and trans conformations. The cross-peak inclined toward the anti-diagonal in the dual-frequency 2D IR spectrum, indicating that the frequency fluctuations of the two modes are anticorrelated. This behavior is attributed to anticorrelated change in the bond orders when solvent and structural fluctuations causes EDA to adopt a different mixture of the two dominant resonance structures. The effects of cross FFCF on the cross-peak line shape are discussed
Energy Technology Data Exchange (ETDEWEB)
Maekawa, Hiroaki; Sul, Soohwan [Department of Chemistry, University of California at Irvine, Irvine, CA 92697-2025 (United States); Ge, Nien-Hui, E-mail: nhge@uci.edu [Department of Chemistry, University of California at Irvine, Irvine, CA 92697-2025 (United States)
2013-08-30
Highlights: ► Vibrational dynamics of conjugated C=O and N=N modes of ethyl diazoacetate was studied. ► Their frequency–frequency correlation functions are different. ► The dual-frequency 2D IR spectrum indicates anticorrelated frequency fluctuations. ► Correlation effects on dual-frequency 2D IR spectra are discussed. ► The existence of cis and trans conformers is revealed in 2D IR spectra. - Abstract: We have applied infrared three-pulse photon echo and single- and dual-frequency 2D IR spectroscopy to the ester C=O and diazo N=N stretching modes in ethyl diazoacetate (EDA), and investigated their vibrational frequency fluctuations and correlation. The two modes exhibit different vibrational dynamics and 2D lineshape, which are well simulated by frequency–frequency correlation functions (FFCFs) with two decaying components. Although the FT IR spectrum shows a single C=O band, absolute magnitude 2D IR nonrephasing spectrum displays spectral signatures supporting the presence of cis and trans conformations. The cross-peak inclined toward the anti-diagonal in the dual-frequency 2D IR spectrum, indicating that the frequency fluctuations of the two modes are anticorrelated. This behavior is attributed to anticorrelated change in the bond orders when solvent and structural fluctuations causes EDA to adopt a different mixture of the two dominant resonance structures. The effects of cross FFCF on the cross-peak line shape are discussed.
Precise Ab-initio prediction of terahertz vibrational modes in crystalline systems
DEFF Research Database (Denmark)
Jepsen, Peter Uhd; Clark, Stewart J.
2007-01-01
We use a combination of experimental THz time-domain spectroscopy and ab-initio density functional perturbative theory to accurately predict the terahertz vibrational spectrum of molecules in the crystalline phase. Our calculations show that distinct vibrational modes found in solid-state materials...
Setiawan, D.; Kraka, E.; Cremer, D.
2014-10-01
The nature of the E⋯E‧ pnicogen bond (E = N, P, As) in dimers such as H2FP⋯PH2F (1) and H3N⋯PHNO2 (2) can be described using vibrational spectroscopy in form of the calculated infrared and depolarized Raman scattering spectra. Utilizing the six calculated intermonomer frequencies, the corresponding local mode E⋯E‧ stretching frequency and force constant are obtained, where the latter provides a unique measure of the E⋯E‧ bond strength. Pnicogen bonding in 1 is relative strong (bond strength order n = 0.151) and covalent whereas pnicogen bonding in 2 is electrostatic (n = 0.047) because of a different bonding mechanism.
SFG and AFM Studies of Polymer Surface Monolayers
Somorjai, Gabor A.
2003-03-01
Sum frequency generation vibrational spectroscopy and atomic force microscopy techniques were utilized to study the structure and composition of polymer surfaces ranging from polyethylene and polypropylene to copolymers of polyurethane and polystyrene. The surface methyl groups aligned perpendicular to the surface above the glass transition temperature of polypropylene. Large side groups such as the phenyl group on polystyrene is also near the surface normal at the polymer-air interface. At the air interface hydrophobic groups are dominant on the polymer surface while at solid-water interface hydrophilic groups segregate to the surface. Minimizing surface energy is the cause of readjusting the surface composition at polymer-water interfaces as compared to polymer-air interfaces. Upon stretching the soft component of two-component polymer systems segregates to the surface and both the surface structure and the surface composition undergo reversible or irreversible changes depending on the magnitude of the stretch. Since the heart beat forces bio-polymers to stretch over 40 million times a year the molecular behavior due to stretching has important physiological consequences.
Relationships for electron-vibrational coupling in conjugated π organic systems
O'Neill, L.; Lynch, P.; McNamara, M.; Byrne, H. J.
2005-06-01
A series of π conjugated systems were studied by absorption, photoluminescence and vibrational spectroscopy. As is common for these systems, a linear relationship between the positioning of the absorption and photoluminescence maxima plotted against inverse conjugation length is observed. The relationships are in good agreement with the simple particle in a box method, one of the earliest descriptions of the properties of one-dimensional organic molecules. In addition to the electronic transition energies, it was observed that the Stokes shift also exhibited a well-defined relationship with increasing conjugation length, implying a correlation between the electron-vibrational coupling and chain length. This correlation is further examined using Raman spectroscopy, whereby the integrated Raman scattering is seen to behave superlinearly with chain length. There is a clear indication that the vibrational activity and thus nonradiative decay processes are controllable through molecular structure. The correlations between the Stokes energies and the vibrational structure are also observed in a selection of PPV based polymers and a clear trend of increasing luminescence efficiency with decreasing vibrational activity and Stokes shift is observable. The implications of such structure property relationships in terms of materials design are discussed.
Study of calcification formation and disease diagnostics utilising advanced vibrational spectroscopy
Kerssens, Marleen Maartje
The accurate and safe diagnosis of breast cancer is a significant societal issue, with annual disease incidence of 48,000 women and around 370 men in the UK. Early diagnosis of the disease allows more conservative treatments and better patient outcomes. Microcalcifications in breast tissue are an important indicator for breast cancers, and often the only sign of their presence. Several studies have suggested that the type of calcification formed may act as a marker for malignancy and its presence may be of biological significance. In this work, breast calcifications are studied with FTIR, synchrotron FTIR, ATR FTIR, and Raman mapping to explore their disease specific composition. From a comparison between vibrational spectroscopy and routine staining procedures it becomes clear that calcium builds up prior to calcification formation. Raman and FTIR indicate the same size for calcifications and are in agreement with routine staining techniques. From the synchrotron FTIR measurements it can be proven that amide is present in the centre of the calcifications and the intensity of the bands depends on the pathology. Special attention is paid to the type of carbonate substitution in the calcifications relating to different pathology grades. In contrast to mammography, Raman spectroscopy has the capability to distinguish calcifications based on their chemical composition. The ultimate goal is to turn the acquired knowledge from the mapping studies into a clinical tool based on deep Raman spectroscopy. Deep Raman techniques have a considerable potential to reduce large numbers of normal biopsies, reduce the time delay between screening and diagnosis and therefore diminish patient anxiety. In order to achieve this, a deep Raman system is designed and after evaluation of its performance tested on buried calcification standards in porcine soft tissue and human mammary tissue. It is shown that, when the calcification is probed through tissue, the strong 960 cm-1 phosphate band
Tetsassi Feugmo, Conrard Giresse; Liégeois, Vincent; Champagne, Benoît
2017-11-15
The first vibrational sum frequency generation (SFG) spectra based on molecular properties calculated at the coupled cluster singles and doubles (CCSD) level of approximation have been simulated for interfacial model alkyl chains, providing benchmark data for comparisons with approximate methods, including density functional theory (DFT). The approach proceeds in three steps. In the first two steps, the molecular spectral properties are determined: the vibrational normal modes and frequencies and then the derivatives of the dipole moment and of the polarizability with respect to the normal coordinates. These derivatives are evaluated with a numerical differentiation approach, of which the accuracy was monitored using Romberg's procedure. Then, in the last step, a three-layer model is employed to evaluate the macroscopic second-order nonlinear optical responses and thereby the simulated SFG spectra of the alkyl interface. Results emphasize the following facts: (i) the dipole and polarizability derivatives calculated at the DFT level with the B3LYP exchange-correlation functional can differ, with respect to CCSD, by as much as ±10 to 20% and ±20 to 50% for the CH 3 and CH 2 vibrations, respectively; (ii) these differences are enhanced when considering the SFG intensities as well as their variations as a function of the experimental configuration (ppp versus ssp) and as a function of the tilt and rotation angles, defining the orientation of the alkyl chain at the interface; (iii) these differences originate from both the vibrational normal coordinates and the Cartesian derivatives of the dipole moment and polarizability; (iv) freezing the successive fragments of the alkyl chain strongly modifies the SFG spectrum and enables highlighting the delocalization effects between the terminal CH 3 group and its neighboring CH 2 units; and finally (v) going from the free chain to the free methyl model, and further to C 3v constraints on leads to large variations of two ratios
Fundamental Vibration of Molecular Hydrogen
Dickenson, G. D.; Niu, M. L.; Salumbides, E. J.; Komasa, J.; Eikema, K. S. E.; Pachucki, K.; Ubachs, W.
2013-05-01
The fundamental ground tone vibration of H2, HD, and D2 is determined to an accuracy of 2×10-4cm-1 from Doppler-free laser spectroscopy in the collisionless environment of a molecular beam. This rotationless vibrational splitting is derived from the combination difference between electronic excitation from the X1Σg+, v=0, and v=1 levels to a common EF1Σg+, v=0 level. Agreement within 1σ between the experimental result and a full ab initio calculation provides a stringent test of quantum electrodynamics in a chemically bound system.
Dynamical interactions between solute and solvent studied by nonlinear infrared spectroscopy
International Nuclear Information System (INIS)
Ohta, K.; Tominaga, K.
2006-01-01
Interactions between solute and solvent play an important role in chemical reaction dynamics and in many relaxation processes in condensed phases. Recently third-order nonlinear infrared (IR) spectroscopy has shown to be useful to investigate solute-solvent interaction and dynamics of the vibrational transition. These studies provide detailed information on the energy relaxation of the vibrationally excited state, and the time scale and the magnitude of the time correlation functions of the vibrational frequency fluctuations. In this work we have studied vibrational energy relaxation (VER) of solutions and molecular complexes by nonlinear IR spectroscopy, especially IR pump-probe method, to understand the microscopic interactions in liquids. (authors)
Directory of Open Access Journals (Sweden)
Rohan Isaac
2018-02-01
Full Text Available Charge-transfer (CT complexes are a promising class of materials for the semiconductor industry because of their versatile properties. This class of compounds shows a variety of phase transitions, which are of interest because of their potential impact on the electronic characteristics. Here temperature-dependent vibrational spectroscopy is used to study structural phase transitions in a set of organic CT complexes. Splitting and broadening of infrared-active phonons in the complex formed between pyrene and pyromellitic dianhydride (PMDA confirm the structural transition is of the order-disorder type and complement previous x-ray diffraction (XRD results. We show that this technique is a powerful tool to characterize transitions, and apply it to a range of binary CT complexes composed of polyaromatic hyrdocarbons (anthracene, perylene, phenanthrene, pyrene, and stilbene and PMDA. We extend the understanding of transitions in perylene-PMDA and pyrene-PMDA, and show that there are no order-disorder transitions present in anthracene-PMDA, stilbene-PMDA and phenanthrene-PMDA in the temperature range investigated here.
Nuclear resonance vibrational spectroscopic studies of iron-containing biomolecules
International Nuclear Information System (INIS)
Ohta, Takehiro; Seto, Makoto
2014-01-01
In this review, we report recent nuclear resonance vibrational spectroscopic (NRVS) studies of iron-containing biomolecules and their model complexes. The NRVS is synchrotron-based element-specific vibrational spectroscopic methods. Unlike Raman and infrared spectroscopy, the NRVS can investigate all iron motions without selection rules, which provide atomic level insights into the structure/reactivity correlation of biologically relevant iron complexes. (author)
Gardner, Adrian M.; Tuttle, William Duncan; Whalley, Laura E.; Claydon, Andrew; Carter, Joseph H.; Wright, Timothy G.
2017-06-01
The S_{1} electronic state and ground state of the cation of para-fluorotoluene (pFT) have been investigated using resonance-enhanced multiphoton ionization (REMPI) spectroscopy and zero-kinetic-energy (ZEKE) spectroscopy. Here we focus on the low wavenumber region where a number of "pure" torsional, fundamental vibrational and vibration-torsional levels are expected; assignments of observed transitions are discussed, which are compared to results of published work on toluene (methylbenzene) from the Lawrance group. The similarity in the activity observed in the excitation spectrum of the two molecules is striking. A. M. Gardner, W. D. Tuttle, L. Whalley, A. Claydon, J. H. Carter and T. G. Wright, J. Chem. Phys., 145, 124307 (2016). J. R. Gascooke, E. A. Virgo, and W. D. Lawrance J. Chem. Phys., 143, 044313 (2015).
Vibrations of a molecule in an external force field.
Okabayashi, Norio; Peronio, Angelo; Paulsson, Magnus; Arai, Toyoko; Giessibl, Franz J
2018-05-01
The oscillation frequencies of a molecule on a surface are determined by the mass distribution in the molecule and the restoring forces that occur when the molecule bends. The restoring force originates from the atomic-scale interaction within the molecule and with the surface, which plays an essential role in the dynamics and reactivity of the molecule. In 1998, a combination of scanning tunneling microscopy with inelastic tunneling spectroscopy revealed the vibrational frequencies of single molecules adsorbed on a surface. However, the probe tip itself exerts forces on the molecule, changing its oscillation frequencies. Here, we combine atomic force microscopy with inelastic tunneling spectroscopy and measure the influence of the forces exerted by the tip on the lateral vibrational modes of a carbon monoxide molecule on a copper surface. Comparing the experimental data to a mechanical model of the vibrating molecule shows that the bonds within the molecule and with the surface are weakened by the proximity of the tip. This combination of techniques can be applied to analyze complex molecular vibrations and the mechanics of forming and loosening chemical bonds, as well as to study the mechanics of bond breaking in chemical reactions and atomic manipulation.
Energy Technology Data Exchange (ETDEWEB)
Visser, Hendrik [Univ. of California, Berkeley, CA (United States)
2001-01-01
Manganese model complexes, relevant to the oxygen-evolving complex (OEC) in photosynthesis, were studied with Mn K-edge X-ray absorption near-edge spectroscopy (XANES), Mn Kb X-ray emission spectroscopy (XES), and vibrational spectroscopy. A more detailed understanding was obtained of the influence of nuclearity, overall structure, oxidation state, and ligand environment of the Mn atoms on the spectra from these methods. This refined understanding is necessary for improving the interpretation of spectra of the OEC. Mn XANES and Kb XES were used to study a di-(mu)-oxo and a mono-(mu)-oxo di-nuclear Mn compound in the (III,III), (III,IV), and (IV,IV) oxidation states. XANES spectra show energy shifts of 0.8 - 2.2 eV for 1-electron oxidation-state changes and 0.4 - 1.8 eV for ligand-environment changes. The shifts observed for Mn XES spectra were approximately 0.21 eV for oxidation state-changes and only approximately 0.04 eV for ligand-environment changes. This indicates that Mn Kb XES i s more sensitive to the oxidation state and less sensitive to the ligand environment of the Mn atoms than XANES. These complimentary methods provide information about the oxidation state and the ligand environment of Mn atoms in model compounds and biological systems. A versatile spectroelectrochemical apparatus was designed to aid the interpretation of IR spectra of Mn compounds in different oxidation states. The design, based on an attenuated total reflection device, permits the study of a wide spectral range: 16,700 (600 nm) - 225
Sakurai, Atsunori; Tanimura, Yoshitaka
2011-04-28
To investigate the role of quantum effects in vibrational spectroscopies, we have carried out numerically exact calculations of linear and nonlinear response functions for an anharmonic potential system nonlinearly coupled to a harmonic oscillator bath. Although one cannot carry out the quantum calculations of the response functions with full molecular dynamics (MD) simulations for a realistic system which consists of many molecules, it is possible to grasp the essence of the quantum effects on the vibrational spectra by employing a model Hamiltonian that describes an intra- or intermolecular vibrational motion in a condensed phase. The present model fully includes vibrational relaxation, while the stochastic model often used to simulate infrared spectra does not. We have employed the reduced quantum hierarchy equations of motion approach in the Wigner space representation to deal with nonperturbative, non-Markovian, and nonsecular system-bath interactions. Taking the classical limit of the hierarchy equations of motion, we have obtained the classical equations of motion that describe the classical dynamics under the same physical conditions as in the quantum case. By comparing the classical and quantum mechanically calculated linear and multidimensional spectra, we found that the profiles of spectra for a fast modulation case were similar, but different for a slow modulation case. In both the classical and quantum cases, we identified the resonant oscillation peak in the spectra, but the quantum peak shifted to the red compared with the classical one if the potential is anharmonic. The prominent quantum effect is the 1-2 transition peak, which appears only in the quantum mechanically calculated spectra as a result of anharmonicity in the potential or nonlinearity of the system-bath coupling. While the contribution of the 1-2 transition is negligible in the fast modulation case, it becomes important in the slow modulation case as long as the amplitude of the
Vibrational Energy Relaxation in Water-Acetonitrile Mixtures
Cringus, Dan; Yeremenko, Sergey; Pshenichnikov, Maxim S.; Wiersma, Douwe A.; Kobayashi, Takayoshi; Kobayashi, Tetsuro; Nelson, Keith A.; Okada, Tadashi; Silvestri, Sandro De
2004-01-01
IR pump-probe spectroscopy is used to study the effect of hydrogen bonding on the vibrational energy relaxation pathways. Hydrogen bonding accelerates the population relaxation from 12ps in diluted acetonitrile solution to 700fs in bulk water.
Millimeterwave spectroscopy of active laser plasmas; the excited vibrational states of HCN
International Nuclear Information System (INIS)
De Lucia, F.C.; Helminger, P.A.
1977-01-01
Millimeter and submillimeter microwave techniques have been used for the spectroscopic study of an HCN laser plasma. Forty-seven rotational transitions in 12 excited vibrational states have been observed. Numerous rotational, vibrational, and perturbation parameters have been calculated from these data. A discussion of experimental techniques is included
Gomes, Janaina F; Busson, Bertrand; Tadjeddine, Abderrahmane
2006-03-23
Ethanol in an acidic solution-Pt(110) interface was studied by SFG spectroscopy (between 1820 and 2325 cm(-1)) to explore primarily the effects of the alcohol concentration. Stretching bands of H-Pt (ca. 1970 or 2050 cm(-1)) and CO (ca. 1980 and 2040 cm(-1)) species, produced by the ethanol oxidation, were detected during the adsorption and oxidation of 0-1 mol L(-1) ethanol in a 0.1 mol L(-1) HClO(4) solution on the electrode surface. Hydrogen and CO coadsorb stably on Pt(110) between 0.05 and 0.15 V in ethanol-containing solutions. In this potential range, the blue shift of the hydrogen resonance (ca. 80 cm(-1)) reveals a weakening of the hydrogen bonding between adsorbed hydrogen and water molecules in the double layer. After the hydrogen desorption (0.15 V), the formation of compact CO islands, depending on the ethanol concentration, lifts the Pt(110) surface reconstruction. In ethanol-free solution, the surface remains reconstructed. The lower-frequency CO band is assigned to the CO species adsorbed on (1 x 2) reconstructed Pt(110) domains, having smaller local coverages, while the higher-frequency CO band is attributed to the close-packed CO species adsorbed on (1 x 1) patches. The reaction pathway forming CO(2) is less favored with increasing ethanol concentration.
Garcia Rey, Natalia; Dlott, Dana
2017-06-01
Imidazolium based ionic liquids (ILs) have been used as a promising system to improve the CO_{2} electroreduction at lower overpotential than other organic or aqueous electrolytes^{1}. Although the detailed mechanism of the CO_{2} electroreduction on Ag has not been elucidated yet, we have developed a methodology to study the electrified interface during the CO_{2} electroreduction using sum frequency generation (SFG) spectroscopy in combination with cyclic voltammetry^{2}. In this work, we tuned the composition of imidazolium-based ILs by exchanging the anion or the functional groups of the imidazolium. We use the nonresonant SFG (NR-SFG) to study the IL-Ag interface and resonant SFG (RES-SFG) to identify the CO adsorbed on the electrode and monitor the Stark shift as a function of cell potential. In previous studies on CO_{2} electroreduction in the IL: 1-ethyl-3-methylimidazolium tetrafluorborate (EMIM-BF_{4}) on Ag, we showed three events occurred at the same potential (-1.33 V vs. Ag/AgCl): the current associated with CO_{2} electroreduction increased, the Stark shift of the adsorbed atop CO doubled in magnitude and the EMIM-BF_{4} underwent a structural transition^{3}. In addition, we also observed how the structural transition of the EMIM-BF_{4} electrolyte shift to lower potentials when the IL is mixed with water. It is known that water enhances the CO_{2} electroreduction producing more CO^{4}. Moreover, the CO is adsorbed in multi-bonded and in atop sites when more water is present in the electrolyte. ^{1}Lau, G. P. S.; Schreier, M.; Vasilyev, D.; Scopelliti, R.; Grätzel, M.; Dyson, P. J., New Insights into the Role of Imidazolium-Based Promoters for the Electroreduction of CO_{2} on a Silver Electrode. J. Am. Chem. Soc. 2016, 138, 7820-7823. ^{2}Garcia Rey, N.; Dlott, D. D., Studies of Electrochemical Interfaces by Broadband Sum Frequency Generation. J. Electroanal. Chem. 2016. DOI:10.1016/j.jelechem.2016.12.023. ^{3}Garcia Rey, N.; Dlott, D. D
Infrared micro-spectroscopy of human tissue: principles and future promises.
Diem, Max; Ergin, Ayşegül; Remiszewski, Stan; Mu, Xinying; Akalin, Ali; Raz, Dan
2016-06-23
This article summarizes the methods employed, and the progress achieved over the past two decades in applying vibrational (Raman and IR) micro-spectroscopy to problems of medical diagnostics and cellular biology. During this time, several research groups have verified the enormous information contained in vibrational spectra; in fact, information on protein, lipid and metabolic composition of cells and tissues can be deduced by decoding the observed vibrational spectra. This decoding process is aided by the availability of computer workstations and advanced algorithms for data analysis. Furthermore, commercial instrumentation for the fast collection of both Raman and infrared micro-spectral data has enabled the collection of images of cells and tissues based solely on vibrational spectroscopic data. The progress in the field has been manifested by a steady increase in the number and quality of publications submitted by established and new research groups in vibrational spectroscopy in the biological and biomedical arenas.
Choi, Jong-Ho; Kuwata, Keith T.; Haas, Bernd-Michael; Cao, Yibin; Johnson, Matthew S.; Okumura, Mitchio
1994-01-01
Infrared spectra of mass‐selected clusters NO^+(H_2O)_n for n=1 to 5 were recorded from 2700 to 3800 cm^(−1) by vibrational predissociation spectroscopy. Vibrational frequencies and intensities were also calculated for n=1 and 2 at the second‐order Møller–Plesset (MP2) level, to aid in the interpretation of the spectra, and at the singles and doubles coupled cluster (CCSD) level energies of n=1 isomers were computed at the MP2 geometries. The smaller clusters (n=1 to 3) were complexes of H_2O...
Vibrational spectroscopy of H{sub 3}{sup +} - advancing into the visible spectral region
Energy Technology Data Exchange (ETDEWEB)
Berg, Max; Bing, Dennis; Petrignani, Annemieke; Wolf, Andreas [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany)
2010-07-01
The triatomic hydrogen ion H{sub 3}{sup +} is a highly reactive key component in many astrophysical and technological plasmas. Being the simplest polyatomic molecule, it is also an important benchmark system against which various quantum mechanical calculations are tested. While the rovibrational levels near the triangular equilibrium structure are well understood, the rovibrational spectrum of this elementary system at strongly deformed geometry, above the barrier to linearity near 10000 cm{sup -1}, represents a formidable task for theory. Its experimental exploration so far ended slightly above 13900 cm{sup -1} from the ground state E{sub 0}({lambda}{proportional_to}720 nm). We report new measurements in a cryogenic 22 pole trap in the range of very high vibrational overtones, reaching levels up to {proportional_to}16500 cm{sup -1} ({lambda}{proportional_to}600 nm) from E{sub 0}. Chemical probing spectroscopy revealed its use for ultra-sensitive detection of transitions six to seven orders of magnitude weaker than the fundamental. Aside from the transition frequencies ({+-}0.005 cm{sup -1}), we present results from a new method to derive precise transition intensities, helping theoretical assignment of the lines.
Vibrational analysis of Fourier transform spectrum of the B u )–X g ...
Indian Academy of Sciences (India)
improved by putting the wave number of band origins in Deslandre table. The vibrational analysis was supported by determining the Franck–Condon factor and r-centroid values. Keywords. Fourier transform spectroscopy; electronic spectrum of selenium dimer; vibrational analysis; Franck–Condon factor; r-centroid values.
Adhikari, Aniruddha
2016-10-10
Lipid/water interaction is essential for many biological processes. The water structure at the nonionic lipid interface remains little known, and there is no scope of a priori prediction of water orientation at nonionic interfaces, either. Here, we report our study combining advanced nonlinear spectroscopy and molecular dynamics simulation on the water orientation at the ceramide/water interface. We measured χ spectrum in the OH stretch region of ceramide/isotopically diluted water interface using heterodyne-detected vibrational sum-frequency generation spectroscopy and found that the interfacial water prefers an overall hydrogen-up orientation. Molecular dynamics simulation indicates that this preferred hydrogen-up orientation of water is determined by a delicate balance between hydrogen-up and hydrogen-down orientation induced by lipid-water and intralipid hydrogen bonds. This mechanism also suggests that water orientation at neutral lipid interfaces depends highly on the chemical structure of the lipid headgroup, in contrast to the charged lipid interfaces where the net water orientation is determined solely by the charge of the lipid headgroup.
Franck-Condon fingerprinting of vibration-tunneling spectra.
Berrios, Eduardo; Sundaradevan, Praveen; Gruebele, Martin
2013-08-15
We introduce Franck-Condon fingerprinting as a method for assigning complex vibration-tunneling spectra. The B̃ state of thiophosgene (SCCl2) serves as our prototype. Despite several attempts, assignment of its excitation spectrum has proved difficult because of near-degenerate vibrational frequencies, Fermi resonance between the C-Cl stretching mode and the Cl-C-Cl bending mode, and large tunneling splittings due to the out-of-plane umbrella mode. Hence, the spectrum has never been fitted to an effective Hamiltonian. Our assignment approach replaces precise frequency information with intensity information, eliminating the need for double resonance spectroscopy or combination differences, neither of which have yielded a full assignment thus far. The dispersed fluorescence spectrum of each unknown vibration-tunneling state images its character onto known vibrational progressions in the ground state. By using this Franck-Condon fingerprint, we were able to determine the predominant character of several vibration-tunneling states and assign them; in other cases, the fingerprinting revealed that the states are strongly mixed and cannot be characterized with a simple normal mode assignment. The assigned transitions from vibration-tunneling wave functions that were not too strongly mixed could be fitted within measurement uncertainty by an effective vibration-tunneling Hamiltonian. A fit of all observed vibration-tunneling states will require a full resonance-tunneling Hamiltonian.
Vibrational spectroscopy of shock-compressed fluid N2 and O2
International Nuclear Information System (INIS)
Schmidt, S.C.; Moore, D.S.; Shaw, M.S.; Johnson, J.D.
1987-01-01
Single-pulse multiplex coherent anti-Stokes Raman scattering (CARS) was used to observe the vibrational spectra of liquid N 2 shock-compressed to several pressures and temperatures up to 41 GPa and 5200 K and liquid O 2 shock-compressed to several pressures and temperatures up to 10 GPa and 1000 K. For N 2 , the experimental spectra were compared to synthetic spectra calculated using a semiclassical model for CARS intensities and estimated vibrational frequencies, peak Raman susceptibilities, and Raman line widths. The question of excited state populations in the shock-compressed state is addressed
Vibrational optical activity principles and applications
Nafie, Laurence A
2011-01-01
This unique book stands as the only comprehensive introduction to vibrational optical activity (VOA) and is the first single book that serves as a complete reference for this relatively new, but increasingly important area of molecular spectroscopy. Key features:A single-source reference on this topic that introduces, describes the background and foundation of this area of spectroscopy.Serves as a guide on how to use it to carry out applications with relevant problem solving.Depth and breadth of the subject is presented in a logical, complete and progressive fashion. A
The vibrational spectrum of the atoms in the grain boundaries of nanocrystalline Pd
Energy Technology Data Exchange (ETDEWEB)
Stuhr, U. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Wipf, H.; Hahn, H. [Technische Hochschule Darmstadt (Germany); Natter, H.; Hemperlmann, R. [Universitaet des Saarlandes, Saarbruecken (Germany); Andersen, K. [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)
1997-09-01
The vibrational excitations of the atoms in nanocrystalline Pd was investigated by neutron-time-of-flight spectroscopy. Hydrogen was used as a probe for the vibrations in the grain boundaries. The separation between the H and Pd vibrations was done by spin analysis. The results show that in the grain boundary the density of states of low energy excitations ({<=}5 meV) is drastically increased. (author) 3 figs., 3 refs.
Proton conducting system (ImH2)2SeO4·2H2O investigated with vibrational spectroscopy
Zięba, Sylwia; Mizera, Adam; Pogorzelec-Glaser, Katarzyna; Łapiński, Andrzej
2017-06-01
Imidazolium selenate dihydrate (ImH2)2SeO4·2H2O crystals have been investigated using Raman and IR spectroscopy. Experimental data were supported by the quantum-chemical calculations (DFT), Hirshfield surfaces and fingerprint plots analysis, and Bader theory calculations. The imidazolium selenate dihydrate crystal exhibits high proton conductivity of the order of 10- 1 S/m at T = 333 K. The spectra of this compound are dominated by bands related to the lattice modes, the internal vibrations of the protonated imidazole cation, selenate anion, water molecules, and hydrogen bonds network. For the imidazolium selenate dihydrate crystal, the formal classification of the fundamental modes has been carried out.
Aqueous heterogeneity at the air/water interface revealed by 2D-HD-SFG spectroscopy.
Hsieh, Cho-Shuen; Okuno, Masanari; Hunger, Johannes; Backus, Ellen H G; Nagata, Yuki; Bonn, Mischa
2014-07-28
Water molecules interact strongly with each other through hydrogen bonds. This efficient intermolecular coupling causes strong delocalization of molecular vibrations in bulk water. We study intermolecular coupling at the air/water interface and find intermolecular coupling 1) to be significantly reduced and 2) to vary strongly for different water molecules at the interface--whereas in bulk water the coupling is homogeneous. For strongly hydrogen-bonded OH groups, coupling is roughly half of that of bulk water, due to the lower density in the near-surface region. For weakly hydrogen-bonded OH groups that absorb around 3500 cm(-1), which are assigned to the outermost, yet hydrogen-bonded OH groups pointing towards the liquid, coupling is further reduced by an additional factor of 2. Remarkably, despite the reduced structural constraints imposed by the interfacial hydrogen-bond environment, the structural relaxation is slow and the intermolecular coupling of these water molecules is weak. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Overtone spectroscopy of the hydroxyl stretch vibration in hydroxylamine (NH2OH)
International Nuclear Information System (INIS)
Scott, J.L.; Luckhaus, D.; Brown, S.S.; Crim, F.F.
1995-01-01
We present photoacoustic spectra of the second (3ν OH ), third (4ν OH ), and fourth (5ν OH ) overtone bands of the hydroxyl stretch vibration in hydroxylamine. Asymmetric rotor simulations of the rovibrational contours provide rotational constants and an estimate of the homogeneous linewidth. The fourth overtone band appears anomalously broad relative to the two lower bands, reflecting a sharp increase in the rate of intramolecular vibrational energy redistribution (IVR). By contrast, the calculated density of states increases smoothly with energy. The homogeneous linewidth of the fourth overtone transition is similar to that measured by Luo et al. [J. Chem. Phys. 93, 9194 (1990)] for the predissociative sixth overtone band, supporting the conclusion that the broadening arises from increased (ro)vibrational coupling at an energy between the third and fourth overtone states
Dynamics of optical degradation on LiB{sub 3}O{sub 5}-crystal surfaces during SFG
Energy Technology Data Exchange (ETDEWEB)
Moeller, Stefan; Andresen, Aenne; Imlau, Mirco [Department of Physics, University of Osnabrueck (Germany)
2008-07-01
We have investigated the phenomenon of optical degradation of LiB{sub 3}O{sub 5} single crystal surfaces during sum-frequency generation (SFG) of UV-light ({lambda}=355 nm) by a focused Q-switched Nd:YAG laser (f=20 kHz, {tau}{sub 1064}=10 ns, anti P{sub 1064}=1.5 W). The investigations were performed on timescales >100 h and UV-intensities below the light induced damage threshold of the crystals. The degradations were studied with optical and analytical methods. As a result we found a steady deposition of foreign material on the output crystal surface in the illuminated area. Here, XPS uncovered several foreign elements as Na,S,Si,Ca, C beside B and O depending on the composition of the ambient atmosphere during SFG. The temporal development of the degradation could be observed by measuring the beam profile behind the crystal. The beam divergence increased as a function of the deposition height, which led to a complex intensity profile in the far-field. Further illuminating lead to a catastrophic break-down of the surface and the beam profile. This is due to thermal damage originating from the UV-absorption of the deposited material. Three models for the deposition process are discussed: a) diffusion out of the LiB{sub 3}O{sub 5}-subsurface, b) deposition of atoms of the ambient atmosphere, c) chemical reactions of LiB{sub 3}O{sub 5}, water, and boric acid.
Vibrational dynamics of ice in reverse micelles
Dokter, A.M.; Petersen, C.; Woutersen, S.; Bakker, H.J.
2008-01-01
he ultrafast vibrational dynamics of HDO:D2O ice at 180 K in anionic reverse micelles is studied by midinfrared femtosecond pump-probe spectroscopy. Solutions containing reverse micelles are cooled to low temperatures by a fast-freezing procedure. The heating dynamics of the micellar solutions is
Gao, Yan; Zhang, Liqun; Wang, Yong; Li, Haoran
2010-03-04
Attenuated total reflection infrared spectroscopy and density functional theory calculation have been employed to study the spectral properties of imidazolium-based ionic liquids (ILs) with different anions. ILs based on 1-butyl-3-methylimidazolium cation with different anions, OH(-), CF(3)CO(2)(-), HSO(4)(-), H(2)PO(4)(-), Cl(-), PF(6)(-), and BF(4)(-), are investigated in the present work. It has been shown that the C(2)-H stretching vibration of the imidazolium ring is closely related to the electron density of H-bonding between the two closest cations and anions for pure ILs. The electron density of H-bonding between cation and anion with different anions decreases in the order [OH](-) > [H(2)PO(4)](-) > [HSO(4)](-) > [CF(3)CO(2)](-) > [Cl](-) > [BF(4)](-) > [PF(6)](-). For aqueous ILs, with increasing water content, the aromatic C-H stretching vibration of the imidazolium cation showed systematic blue-shifts. Especially for BmimOH, the nu(C(2))(-H) undergoes a drastic blue-shift by 58 cm(-1), suggesting that the formation of the strong hydrogen bonds O-H...O may greatly weaken the electron density of H-bonding between the cation and anion of ILs.
Chirp effects on impulsive vibrational spectroscopy: a multimode perspective.
Wand, Amir; Kallush, Shimshon; Shoshanim, Ofir; Bismuth, Oshrat; Kosloff, Ronnie; Ruhman, Sanford
2010-03-07
The well-documented propensity of negatively-chirped pulses to enhance resonant impulsive Raman scattering has been rationalized in terms of a one pulse pump-dump sequence which "follows" the evolution of the excited molecules and dumps them back at highly displaced configurations. The aim of this study was to extend the understanding of this effect to molecules with many displaced vibrational modes in the presence of condensed surroundings. In particular, to define an optimally chirped pulse, to investigate what exactly it "follows" and to discover how this depends on the molecule under study. To this end, linear chirp effects on vibrational coherences in poly-atomics are investigated experimentally and theoretically. Chirped pump-impulsive probe experiments are reported for Sulforhodamine-B ("Kiton Red"), Betaine-30 and Oxazine-1 in ethanol solutions with <10 fs resolution. Numerical simulations, including numerous displaced modes and electronic dephasing, are conducted to reproduce experimental results. Through semi-quantitative reproduction of experimental results in all three systems we show that the effect of group velocity dispersion (GVD) on the buildup of ground state wave-packets depends on the pulse spectrum, on the displacements of vibrational modes upon excitation, on the detuning of the excitation pulses from resonance, and on electronic dephasing rates. Akin to scenarios described for frequency-domain resonance Raman, within the small-displacement regime each mode responds to excitation chirp independently and the optimal GVD is mode-specific. Highly-displaced modes entangle the dynamics of excitation in different modes, requiring a multi-dimensional description of the response. Rapid photochemistry and ultrafast electronic dephasing narrow the window of opportunity for coherent manipulations, leading to a reduced and similar optimal chirp for different modes. Finally, non-intuitive coherent aspects of chirp "following" are predicted in the small
Wang, Shaofeng; Ma, Xu; Zhang, Guoqing; Jia, Yongfeng; Hatada, Keisuke
2016-11-15
Hydrous ferric arsenate (HFA) is an important arsenic-bearing precipitate in the mining-impacted environment and hydrometallurgical tailings. However, there is no agreement on its local atomic structure. The local structure of HFA was reprobed by employing a full-potential multiple scattering (FPMS) analysis, density functional theory (DFT) calculations, and vibrational spectroscopy. The FPMS simulations indicated that the coordination number of the As-Fe, Fe-As, or both in HFA was approximately two. The DFT calculations constructed a structure of HFA with the formula of Fe(HAsO 4 ) x (H 2 AsO 4 ) 1-x (OH) y ·zH 2 O. The presence of protonated arsenate in HFA was also evidenced by vibrational spectroscopy. The As and Fe K-edge X-ray absorption near-edge structure spectra of HFA were accurately reproduced by FPMS simulations using the chain structure, which was also a reasonable model for extended X-Ray absorption fine structure fitting. The FPMS refinements indicated that the interatomic Fe-Fe distance was approximately 5.2 Å, consistent with that obtained by Mikutta et al. (Environ. Sci. Technol. 2013, 47 (7), 3122-3131) using wavelet analysis. All of the results suggested that HFA was more likely to occur as a chain with AsO 4 tetrahedra and FeO 6 octahedra connecting alternately in an isolated bidentate-type fashion. This finding is of significance for understanding the fate of arsenic and the formation of ferric arsenate minerals in an acidic environment.
HOW SFG INCREASE STUDENTS ABILITY TO PRODUCE AND ANALYSE TEXT MEDIA
Directory of Open Access Journals (Sweden)
Abd. Ghofur
2013-05-01
Full Text Available This article explores the use of Systemic Functional Grammar for students of english language teaching entitled Analysing Media Texts. This is aims at assisting students to produce their own texts and to help them develop an understanding of the linguistic choices they make. Students are introduced to the key principles of CDA and to Halliday’s SFG to provide them with tools to assist them to understand the social and constructed nature of discourses, especially those typically found in media texts. This article focuses on students’ interpretation of media texts, their ability to read with greater understanding and to apply key concepts that they had learnt to their analyses. The students demonstrated clearly that they had developed an understanding of CDA, acquired the basic metalanguage necessary for Hallidayan analysis and some of them could produce much more rigorous textual analyses than before.
Pfeifer, Marcel; Ruf, Alexander; Fischer, Peer
2013-11-04
We record vibrational spectra with two indirect schemes that depend on the real part of the index of refraction: mid-infrared refractometry and photothermal spectroscopy. In the former, a quantum cascade laser (QCL) spot is imaged to determine the angles of total internal reflection, which yields the absorption line via a beam profile analysis. In the photothermal measurements, a tunable QCL excites vibrational resonances of a molecular monolayer, which heats the surrounding medium and changes its refractive index. This is observed with a probe laser in the visible. Sub-monolayer sensitivities are demonstrated.
Vibrational properties of epitaxial Bi{sub 4}Te{sub 3} films as studied by Raman spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Xu, Hao; Pan, Wenwu; Chen, Qimiao; Wu, Xiaoyan [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); University of Chinese Academy of Sciences, No.19A Yuquan Road, Beijing 100049 (China); Song, Yuxin, E-mail: songyuxin@mail.sim.ac.cn, E-mail: shumin@chalmers.se; Gong, Qian [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Lu, Pengfei [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Wang, Shumin, E-mail: songyuxin@mail.sim.ac.cn, E-mail: shumin@chalmers.se [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Department of Microtechnology and Nanoscience, Chalmers University of Technology, 41296 Gothenburg (Sweden)
2015-08-15
Bi{sub 4}Te{sub 3}, as one of the phases of the binary Bi–Te system, shares many similarities with Bi{sub 2}Te{sub 3}, which is known as a topological insulator and thermoelectric material. We report the micro-Raman spectroscopy study of 50 nm Bi{sub 4}Te{sub 3} films on Si substrates prepared by molecular beam epitaxy. Raman spectra of Bi{sub 4}Te{sub 3} films completely resolve the six predicted Raman-active phonon modes for the first time. Structural features and Raman tensors of Bi{sub 4}Te{sub 3} films are introduced. According to the wavenumbers and assignments of the six eigenpeaks in the Raman spectra of Bi{sub 4}Te{sub 3} films, it is found that the Raman-active phonon oscillations in Bi{sub 4}Te{sub 3} films exhibit the vibrational properties of those in both Bi and Bi{sub 2}Te{sub 3} films.
Vidal, F.; Busson, B.; Six, C.; Pluchery, O.; Tadjeddine, A.
2002-04-01
The Pt( hkl)/methanol in acidic solution interface which constitutes a model of the anodic part of a fuel cell is studied by infrared-visible sum frequency generation vibrational spectroscopy. Methanol dissociative adsorption leads to CO poisoning of the Pt electrode surfaces. The structure of the CO/Pt( hkl) interface depends strongly on the orientation of the surface electrode.
Brewer, Kimberly D; Rioux, James A; Klassen, Martyn; Bowen, Chris V; Beyea, Steven D
2012-07-01
Susceptibility field gradients (SFGs) cause problems for functional magnetic resonance imaging (fMRI) in regions like the orbital frontal lobes, leading to signal loss and image artifacts (signal displacement and "pile-up"). Pulse sequences with spiral-in k-space trajectories are often used when acquiring fMRI in SFG regions such as inferior/medial temporal cortex because it is believed that they have improved signal recovery and decreased signal displacement properties. Previously postulated theories explain differing reasons why spiral-in appears to perform better than spiral-out; however it is clear that multiple mechanisms are occurring in parallel. This study explores differences in spiral-in and spiral-out images using human and phantom empirical data, as well as simulations consistent with the phantom model. Using image simulations, the displacement of signal was characterized using point spread functions (PSFs) and target maps, the latter of which are conceptually inverse PSFs describing which spatial locations contribute signal to a particular voxel. The magnitude of both PSFs and target maps was found to be identical for spiral-out and spiral-in acquisitions, with signal in target maps being displaced from distant regions in both cases. However, differences in the phase of the signal displacement patterns that consequently lead to changes in the intervoxel phase coherence were found to be a significant mechanism explaining differences between the spiral sequences. The results demonstrate that spiral-in trajectories do preserve more total signal in SFG regions than spiral-out; however, spiral-in does not in fact exhibit decreased signal displacement. Given that this signal can be displaced by significant distances, its recovery may not be preferable for all fMRI applications. Copyright © 2012 Elsevier Inc. All rights reserved.
Femtosecond Broadband Stimulated Raman Spectroscopy
International Nuclear Information System (INIS)
Lee, Soo-Y; Yoon, Sagwoon; Mathies, Richard A
2006-01-01
Femtosecond broadband stimulated Raman spectroscopy (FSRS) is a new technique where a narrow bandwidth picosecond Raman pump pulse and a red-shifted broadband femtosecond Stokes probe pulse (with or without time delay between the pulses) act on a sample to produce a high resolution Raman gain spectrum with high efficiency and speed, free from fluorescence background interference. It can reveal vibrational structural information and dynamics of stationary or transient states. Here, the quantum picture for femtosecond broadband stimulated Raman spectroscopy (FSRS) is used to develop the semiclassical coupled wave theory of the phenomenon and to derive an expression for the measurable Raman gain in FSRS. The semiclassical theory is applied to study the dependence of lineshapes in FSRS on the pump-probe time delay and to deduce vibrational dephasing times in cyclohexane in the ground state
The vibrational Jahn–Teller effect in E⊗e systems
Energy Technology Data Exchange (ETDEWEB)
Thapaliya, Bishnu P.; Dawadi, Mahesh B.; Ziegler, Christopher; Perry, David S., E-mail: dperry@uakron.edu
2015-10-16
Highlights: • The vibrational Jahn–Teller effect is documented for three E⊗e molecular systems. • The spontaneous vibrational Jahn–Teller distortion is very small. • Vibrational Jahn–Teller splittings are substantial (1–60 cm{sup −1}). • Vibrational conical intersections in CH{sub 3}OH are accessible at low energies. - Abstract: The Jahn–Teller theorem is applied in the vibrational context where degenerate high-frequency vibrational states (E) are considered as adiabatic functions of low-frequency vibrational coordinates (e). For CH{sub 3}CN and Cr(C{sub 6}H{sub 6})(CO){sub 3}, the global minimum of the non-degenerate electronic potential energy surface occurs at the C{sub 3v} geometry, but in CH{sub 3}OH, the equilibrium geometry is far from the C{sub 3v} reference geometry. In the former cases, the computed spontaneous Jahn–Teller distortion is exceptionally small. In methanol, the vibrational Jahn–Teller interaction results in the splitting of the degenerate E-type CH stretch into what have been traditionally assigned as the distinct ν{sub 2} and ν{sub 9} vibrational bands. The ab initio vibrational frequencies are fit precisely by a two-state high-order Jahn–Teller Hamiltonian (Viel and Eisfeld, 2004). The presence of vibrational conical intersections, including 7 for CH{sub 3}OH, has implications for spectroscopy, for geometric phase, and for ultrafast localized non-adiabatic energy transfer.
Fournier, Frédéric; Zheng, Wanquan; Carrez, Serge; Dubost, Henri; Bourguignon, Bernard
2004-09-01
Interaction of CO adsorbed on Pt(111) with electrons and phonons is studied experimentally by means of a pump-probe experiment where CO is probed by IR+visible sum frequency generation under a pump laser intensity that allows photodesorption. Vibrational spectra of CO internal stretch are obtained as a function of pump-probe delay. A two-temperature and anharmonic coupling model is used to extract from the spectra the real time variations of CO peak frequency and dephasing time. The main conclusions are the following: (i) The CO stretch is perturbed by two low-frequency modes, assigned to frustrated rotation and frustrated translation. (ii) The frustrated rotation is directly coupled to electrons photoexcited in Pt(111) by the pump laser. (iii) There is no evidence of Pt-CO stretch excitation in the spectra. The implications for the photodesorption dynamics are discussed.
Crystal structure, thermal behaviour, vibrational spectroscopy and ...
Indian Academy of Sciences (India)
2018-05-23
May 23, 2018 ... modes corresponding to the kröhnkite is identified by the IR and Raman spectroscopies in the frequency ranges ..... The two weak bands near 1227 and 1202 cm ... ciated with the hydroxyl groups are taken into consideration.
Noguchi, H.; Okada, T.; Onda, K.; Kano, S. S.; Wada, A.; Domen, K.
2003-03-01
Time-resolved sum-frequency generation spectroscopy was carried out on a deuterated formate (DCOO) adsorbed on Ni(1 1 1) surface to investigate the surface reaction dynamics under instantaneous surface temperature jump induced by the irradiation by picosecond laser pulses. The irradiation of pump pulse (800 nm) caused the rapid intensity decrease of both CD and OCO stretching modes of bridged formate on Ni(1 1 1). Different temporal behaviors of intensity recovery between these two vibrational modes were observed, i.e., CD stretching mode recovered faster than OCO. This is the first result to show that the dynamics of adsorbates on metals strongly depends on the observed vibrational mode. From the results of temperature and pump fluence dependence, we concluded that the observed intensity change was not due to the decomposition or desorption, but was induced by a non-thermal process.
Analysis of solid-state transformations of pharmaceutical compounds using vibrational spectroscopy
DEFF Research Database (Denmark)
Heinz, Andrea; Strachan, Clare J; Gordon, Keith C
2009-01-01
OBJECTIVES: Solid-state transformations may occur during any stage of pharmaceutical processing and upon storage of a solid dosage form. Early detection and quantification of these transformations during the manufacture of solid dosage forms is important since the physical form of an active...... pharmaceutical ingredient can significantly influence its processing behaviour, including powder flow and compressibility, and biopharmaceutical properties such as solubility, dissolution rate and bioavailability. KEY FINDINGS: Vibrational spectroscopic techniques such as infrared, near-infrared, Raman and, most...... multivariate approaches where even overlapping spectral bands can be analysed. SUMMARY: This review discusses the applications of different vibrational spectroscopic techniques to detect and monitor solid-state transformations possible for crystalline polymorphs, hydrates and amorphous forms of pharmaceutical...
Vibrational spectroscopic study of poldervaartite CaCa[SiO3(OH)(OH)
Frost, Ray L.; López, Andrés; Scholz, Ricardo; Lima, Rosa Malena Fernandes
2015-02-01
We have studied the mineral poldervaartite CaCa[SiO3(OH)(OH)] which forms a series with its manganese analogue olmiite CaMn[SiO3(OH)](OH) using a range of techniques including scanning electron microscopy, thermogravimetric analysis, Raman and infrared spectroscopy. Chemical analysis shows the mineral is reasonably pure and contains only calcium and manganese with low amounts of Al and F. Thermogravimetric analysis proves the mineral decomposes at 485 °C with a mass loss of 7.6% compared with the theoretical mass loss of 7.7%. A strong Raman band at 852 cm-1 is assigned to the SiO stretching vibration of the SiO3(OH) units. Two Raman bands at 914 and 953 cm-1 are attributed to the antisymmetric vibrations. Intense prominent peaks observed at 3487, 3502, 3509, 3521 and 3547 cm-1 are assigned to the OH stretching vibration of the SiO3(OH) units. The observation of multiple OH bands supports the concept of the non-equivalence of the OH units. Vibrational spectroscopy enables a detailed assessment of the molecular structure of poldervaartite.
Ultrafast Laser-Based Spectroscopy and Sensing: Applications in LIBS, CARS, and THz Spectroscopy
Leahy-Hoppa, Megan R.; Miragliotta, Joseph; Osiander, Robert; Burnett, Jennifer; Dikmelik, Yamac; McEnnis, Caroline; Spicer, James B.
2010-01-01
Ultrafast pulsed lasers find application in a range of spectroscopy and sensing techniques including laser induced breakdown spectroscopy (LIBS), coherent Raman spectroscopy, and terahertz (THz) spectroscopy. Whether based on absorption or emission processes, the characteristics of these techniques are heavily influenced by the use of ultrafast pulses in the signal generation process. Depending on the energy of the pulses used, the essential laser interaction process can primarily involve lattice vibrations, molecular rotations, or a combination of excited states produced by laser heating. While some of these techniques are currently confined to sensing at close ranges, others can be implemented for remote spectroscopic sensing owing principally to the laser pulse duration. We present a review of ultrafast laser-based spectroscopy techniques and discuss the use of these techniques to current and potential chemical and environmental sensing applications. PMID:22399883
Ultrafast Laser-Based Spectroscopy and Sensing: Applications in LIBS, CARS, and THz Spectroscopy
Directory of Open Access Journals (Sweden)
Megan R. Leahy-Hoppa
2010-04-01
Full Text Available Ultrafast pulsed lasers find application in a range of spectroscopy and sensing techniques including laser induced breakdown spectroscopy (LIBS, coherent Raman spectroscopy, and terahertz (THz spectroscopy. Whether based on absorption or emission processes, the characteristics of these techniques are heavily influenced by the use of ultrafast pulses in the signal generation process. Depending on the energy of the pulses used, the essential laser interaction process can primarily involve lattice vibrations, molecular rotations, or a combination of excited states produced by laser heating. While some of these techniques are currently confined to sensing at close ranges, others can be implemented for remote spectroscopic sensing owing principally to the laser pulse duration. We present a review of ultrafast laser-based spectroscopy techniques and discuss the use of these techniques to current and potential chemical and environmental sensing applications.
International Nuclear Information System (INIS)
Miyamae, Takayuki; Nozoye, Hisakazu
2004-01-01
The interface between AlO x and poly(ethylene terephthalate) has been investigated by sum-frequency generation (SFG). A considerable improvement in adhesion strength was achieved by short time Ar plasma modification. The increase of the adhesion strength shows good correlation with the increase of the SFG peak strength. By depositing AlO x , the increase of SFG intensities and appearance of a new peak are observed, indicating the formation of a C=O···Al bond at the interface. Surface-modification and interfacial adhesion property are discussed
Derro, Erika L.
The hydrogen trioxy (HOOO) radical has been implicated as an important intermediate in key processes in the atmosphere. In the present studies, HOOO is produced by the combination of O2 and photolytically generated OH radicals in the collisional region of a pulsed supersonic expansion. Rotationally cooled HOOO is probed in the effectively collision-free region of the expansion using infrared action spectroscopy, an infrared-pump, ultraviolet-probe technique, in which HOOO is vibrationally excited and the nascent OH products of vibrational predissociation are probed via laser-induced fluorescence. High resolution infrared spectra of HOOO and DOOO were observed in the fundamental and overtone OH/D stretching regions (nui and 2nu 1), which comprise a rotationally structured band attributed to the trans conformer, and an unstructured component assigned to the cis conformer. Infrared spectra of HOOO and DOOO combination bands composed of the OH stretch and a low frequency mode (nu1 + nun) were also observed. This allowed identification of vibrational frequencies for five of the six modes for trans-H/DOOO and four of the six modes for cis-HOOO and DOOO. Identification of low frequency modes provides critical information on the vibrational dynamics and thermochemical properties of the HOOO radical, and furthermore, provides a potential means for detecting HOOO in situ in the atmosphere. In addition, the nascent OH X2pi products following vibrational predissociation of HOOO have been investigated. The product state distributions reveal a distinct preference for population of pi(A ') Λ-doublets in OH that is indicative of a planar dissociation of trans-HOOO in which the symmetry of the bonding orbital is maintained. The highest observed OH quantum state allows determination of the stability of HOOO relative to the OH + O 2 asymptote using a conservation of energy approach. In conjunction with a similar investigation of DOOO, the binding energy is determined to be ≤ 5
Synchrotron radiation in the Far-Infrared: Adsorbate-substrate vibrations and resonant interactions
International Nuclear Information System (INIS)
Hoffmann, F.M.; Williams, G.P.; Hirschmugl, C.J.; Chabal, Y.J.
1991-01-01
Synchrotron radiation in the Far Infrared offers the potential for a broadband source of high brightness and intensity. Recent development of a Far-Infrared Beamline at the NSLS in Brookhaven provides an unique high intensity source in the FIR spectral range (800-10 cm -1 ). This talk reviews its application to surface vibrational spectroscopy of low frequency adsorbate-substrate vibrations and resonant interactions on metal surfaces
Sub-THz spectroscopic characterization of vibrational modes in artificially designed DNA monocrystal
International Nuclear Information System (INIS)
Sizov, Igor; Rahman, Masudur; Gelmont, Boris; Norton, Michael L.; Globus, Tatiana
2013-01-01
Highlights: • Sub-THz spectroscopy is used to characterize artificially designed DNA monocrystal. • Results are obtained using a novel near field, RT, frequency domain spectrometer. • Narrow resonances of 0.1 cm −1 width in absorption spectra of crystal are observed. • Signature measured between 310 and 490 GHz is reproducible and well resolved. • Absorption pattern is explained in part by simulation results from dsDNA fragment. - Abstract: Sub-terahertz (sub-THz) vibrational spectroscopy is a new spectroscopic branch for characterizing biological macromolecules. In this work, highly resolved sub-THz resonance spectroscopy is used for characterizing engineered molecular structures, an artificially designed DNA monocrystal, built from a short DNA sequence. Using a recently developed frequency domain spectroscopic instrument operating at room temperature with high spectral and spatial resolution, we demonstrated very intense and specific spectral lines from a DNA crystal in general agreement with a computational molecular dynamics (MD) simulation of a short double stranded DNA fragment. The spectroscopic signature measured in the frequency range between 310 and 490 GHz is rich in well resolved and reproducible spectral features thus demonstrating the capability of THz resonance spectroscopy to be used for characterizing custom macromolecules and structures designed and implemented via nanotechnology for a wide variety of application domains. Analysis of MD simulation indicates that intense and narrow vibrational modes with atomic movements perpendicular (transverse) and parallel (longitudinal) to the long DNA axis coexist in dsDNA, with much higher contribution from longitudinal vibrations
Chain, Fernando E; Leyton, Patricio; Paipa, Carolina; Fortuna, Mario; Brandán, Silvia A
2015-03-05
In this work, FT-IR, FT-Raman, UV-Visible and NMR spectroscopies and density functional theory (DFT) calculations were employed to study the structural and vibrational properties of the labdane-type diterpene 13-epi-sclareol using the hybrid B3LYP method together with the 6-31G(∗) basis set. Three stable structures with minimum energy found on the potential energy curves (PES) were optimized, and the corresponding molecular electrostatic potentials, atomic charges, bond orders, stabilization energies and topological properties were computed at the same approximation level. The complete assignment of the bands observed in the vibrational spectrum of 13-epi-sclareol was performed taking into account the internal symmetry coordinates for the three structures using the scaled quantum mechanical force field (SQMFF) methodology at the same level of theory. In addition, the force constants were calculated and compared with those reported in the literature for similar compounds. The predicted vibrational spectrum and the calculated (1)H NMR and (13)C NMR chemical shifts are in good agreement with the corresponding experimental results. The theoretical UV-Vis spectra for the most stable structure of 13-epi-sclareol demonstrate a better correlation with the corresponding experimental spectrum. The study of the three conformers by means of the theory of atoms in molecules (AIM) revealed different H bond interactions and a strong dependence of the interactions on the distance between the involved atoms. Furthermore, the natural bond orbital (NBO) calculations showed the characteristics of the electronic delocalization for the two six-membered rings with chair conformations. Copyright © 2014 Elsevier B.V. All rights reserved.
National Research Council Canada - National Science Library
Dlott, Dana D
2005-01-01
... with 1.5 Angstrom resolution. With 3D spectroscopy we have studied vibrational energy transfer in water and for the first time we have been able to watch vibrational energy flow across the interface between a molecular nanostructure and its surroundings.
International Nuclear Information System (INIS)
Clouthier, D.J.; Huang, G.; Adam, A.G.; Merer, A.J.
1994-01-01
High-resolution intracavity dye laser spectroscopy has been used to obtain sub-Doppler spectra of transitions to 350 rotational levels in the 4 1 0 band of the A 1 A 2 --X 1 A 1 electronic transition of thioformaldehyde. Ground state combination differences from the sub-Doppler spectra, combined with microwave and infrared data, have been used to improve the ground state rotational and centrifugal distortion constants of H 2 CS. The upper state shows a remarkable number of perturbations. The largest of these are caused by nearby triplet levels, with matrix elements of 0.05--0.15 cm -1 . A particularly clear singlet--triplet avoided crossing in K a ' = 7 has been shown to be caused by interaction with the F 1 component of the 3 1 6 2 vibrational level of the a 3 A 2 state. At least 53% of the S 1 levels show evidence of very small perturbations by high rovibronic levels of the ground state. The number of such perturbations is small at low J, but increases rapidly beyond J=5 such that 40%--80% of the observed S 1 levels of any given J are perturbed by ground state levels. Model calculations show that the density and J dependence of the number of perturbed levels can be explained if there is extensive rotation-induced mixing of the vibrational levels in the ground state
Vibrational spectroscopy and intramolecular energy transfer in isocyanic acid (HNCO)
International Nuclear Information System (INIS)
Coffey, M.J.; Berghout, H.L.; Woods, E. III; Crim, F.F.
1999-01-01
Room temperature photoacoustic spectra in the region of the first through the fourth overtones (2ν 1 to 5ν 1 ) and free-jet action spectra of the second through the fourth overtones (3ν 1 to 5ν 1 ) of the N - H stretching vibration permit analysis of the vibrational and rotational structure of HNCO. The analysis identifies the strong intramolecular couplings that control the early stages of intramolecular vibrational energy redistribution (IVR) and gives the interaction matrix elements between the zero-order N - H stretching states and the other zero-order states with which they interact. The experimentally determined couplings and zero-order state separations are consistent with ab initio calculations of East, Johnson, and Allen [J. Chem. Phys. 98, 1299 (1993)], and comparison with the calculation identifies the coupled states and likely interactions. The states most strongly coupled to the pure N - H stretching zero-order states are ones with a quantum of N - H stretching excitation (ν 1 ) replaced by different combinations of N - C - O asymmetric or symmetric stretching excitation (ν 2 or ν 3 ) and trans-bending excitation (ν 4 ). The two strongest couplings of the nν 1 state are to the states (n-1)ν 1 +ν 2 +ν 4 and (n-1)ν 1 +ν 3 +2ν 4 , and sequential couplings through a series of low order resonances potentially play a role. The analysis shows that if the pure N - H stretch zero-order state were excited, energy would initially flow out of that mode into the strongly coupled mode in 100 fs to 700 fs, depending on the level of initial excitation. copyright 1999 American Institute of Physics
Vibrational spectroscopic investigation of polymorphs and cocrystals of indomethacin.
Ali, Hassan Refat H; Alhalaweh, Amjad; Velaga, Sitaram P
2013-05-01
Identification of optimal solid form of an active pharmaceutical ingredient and form control are very important in drug development. Thus, the structural information of these forms and in-depth insight on the modes of molecular interactions are necessary, and vibrational spectroscopic methods are well suited for this purpose. In-depth structural analysis of different solid forms of indomethacin (IND) using Raman and infrared (IR) spectroscopy is the objective. We have investigated the modes of molecular interactions in polymorphs (α and γ), amorphous and discovered cocrystals of IND with nicotinamide (NIC) and trans-cinnamic acid (CIN) coformers. The solid forms of IND have been prepared; their purity has been verified by differential scanning calorimetry and powder X-ray diffractometry and then studied in the solid-state by Raman and IR spectroscopy. The modes of the interactions were closely investigated from the vibrational data. The key vibrational features of IND solid forms have been specified. The IR (C=O) band at 1713 cm(-1) attributed to cyclic acid dimer of γ IND has disappeared in IND-NIC/CIN whilst retained in IND-SAC cocrystal. IND cocrystallizes in different conformations and crystal lattices with different coformers. The cyclic acid dimer of IND has been kept on its cocrystallization with saccharin and it could have been broken with NIC and CIN. The complementary nature of Raman and IR spectroscopy allowed unambiguous investigation of the chemical composition of pharmaceutical materials which is of particular importance in the absence of detailed structural information, as in the case of IND-NIC and IND-CIN.
Vibrational excitations in molecular layers probed by ballistic electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Kajen, Rasanayagam Sivasayan; Chandrasekhar, Natarajan [Institute of Materials Research and Engineering, 3 Research Link, 117602 (Singapore); Feng Xinliang; Muellen, Klaus [Max-Planck-Institut fuer Polymerforschung, Postfach 3148, D-55021 Mainz (Germany); Su Haibin, E-mail: n-chandra@imre.a-star.edu.sg, E-mail: muellen@mpip-mainz.mpg.de, E-mail: hbsu@ntu.edu.sg [Division of Materials Science, Nanyang Technological University, 50 Nanyang Avenue, 639798 (Singapore)
2011-10-28
We demonstrate the information on molecular vibrational modes via the second derivative (d{sup 2}I{sub B}/dV{sup 2}) of the ballistic electron emission spectroscopy (BEES) current. The proposed method does not create huge fields as in the case of conventional derivative spectroscopy and maintains a zero bias across the device. BEES studies carried out on three different types of large polycyclic aromatic hydrocarbon (PAH) molecular layers show that the d{sup 2}I{sub B}/dV{sup 2} spectra consist of uniformly spaced peaks corresponding to vibronic excitations. The peak spacing is found to be identical for molecules within the same PAH family though the BEES onset voltage varies for different molecules. In addition, injection into a particular orbital appears to correspond to a specific vibrational mode as the manifestation of the symmetry principle.
Ritchie, Andrew W; Webb, Lauren J
2015-11-05
Biological function emerges in large part from the interactions of biomacromolecules in the complex and dynamic environment of the living cell. For this reason, macromolecular interactions in biological systems are now a major focus of interest throughout the biochemical and biophysical communities. The affinity and specificity of macromolecular interactions are the result of both structural and electrostatic factors. Significant advances have been made in characterizing structural features of stable protein-protein interfaces through the techniques of modern structural biology, but much less is understood about how electrostatic factors promote and stabilize specific functional macromolecular interactions over all possible choices presented to a given molecule in a crowded environment. In this Feature Article, we describe how vibrational Stark effect (VSE) spectroscopy is being applied to measure electrostatic fields at protein-protein interfaces, focusing on measurements of guanosine triphosphate (GTP)-binding proteins of the Ras superfamily binding with structurally related but functionally distinct downstream effector proteins. In VSE spectroscopy, spectral shifts of a probe oscillator's energy are related directly to that probe's local electrostatic environment. By performing this experiment repeatedly throughout a protein-protein interface, an experimental map of measured electrostatic fields generated at that interface is determined. These data can be used to rationalize selective binding of similarly structured proteins in both in vitro and in vivo environments. Furthermore, these data can be used to compare to computational predictions of electrostatic fields to explore the level of simulation detail that is necessary to accurately predict our experimental findings.
International Nuclear Information System (INIS)
Van der Ham, E.W.M.; Vrehen, Q.H.F.; Eliel, E.R.
1995-01-01
Sum-frequency generation (SFG) has developed into a widely applied tool for study of surfaces and interfaces where molecules are present. It combines the surface specificity of a second-order nonlinear optical technique with the power of a spectroscopic method, and it can be used under widely varying experimental conditions ranging from UHV to electrochemical cells. The important characteristic of SFG is that it allows one to study the average spatial orientation of a molecular bond in a monolayer of molecules at an interface. Until recently SFG measurements were confined to the frequency interval Y μ > 1700 cm -1 because of a lack of suitable laser sources at wave-lengths λ > 6 μm. So for most molecules only a few vibrational modes and thus intramolecular bonds can be studied. We have developed a universal sum-frequency spectrometer around the FELIX free-electron law that covers the complete molecular fingerprint since we can generate any IR wavelength between 2.75 and 110 fμ at the FELIX facility. We have used this setup for a series of exploratory SFG experiments in a frequency range that was hitherto unexplored in the study of molecular monolayers. We have studied thiol monolayers chemisorbed on a variety of noble metals (Au, Ag, Pt) where we focussed on the C-S stretch vibration at ν = 702 cm -1 (λ = 14.3 μm). We have found spectroscopic features revealing the presence of both the trane and gauche conformers of the adsorbed molecules. The present measurements open a whole new wavelength range for nonlinear optical studies of interfaces
Directory of Open Access Journals (Sweden)
Benedetto Bozzini
2012-06-01
Full Text Available In this paper we report an in situ electrochemical Sum-/Difference Frequency Generation (SFG/DFG spectroscopy investigation of the adsorption of nitrile and CN− from the ionic liquid 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl amide ([BMP][TFSA] containing 4-{2-[1-(2-cyanoethyl-1,2,3,4-tetrahydroquinolin-6-yl]- diazenyl}benzonitrile (CTDB at Au electrodes in the absence and in the presence of the Au-electrodeposition process from K[Au(CN2]. The adsorption of nitrile and its coadsorption with CN− resulting either from the cathodic decomposition of the dye or from ligand release from the Au(I cyanocomplex yield potential-dependent single or double SFG bands in the range 2,125–2,140 cm−1, exhibiting Stark tuning values of ca. 3 and 1 cm−1 V−1 in the absence and presence of electrodeposition, respectively. The low Stark tuning found during electrodeposition correlates with the cathodic inhibiting effect of CTDB, giving rise to its levelling properties. The essential insensitivity of the other DFG parameters to the electrodeposition process is due to the growth of smooth Au.
Energy Technology Data Exchange (ETDEWEB)
Roy, S.; Gruenbaum, S. M.; Skinner, J. L. [Theoretical Chemistry Institute and Department of Chemistry, 1101 University Ave., University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States)
2014-11-14
Understanding the structure of water near cell membranes is crucial for characterizing water-mediated events such as molecular transport. To obtain structural information of water near a membrane, it is useful to have a surface-selective technique that can probe only interfacial water molecules. One such technique is vibrational sum-frequency generation (VSFG) spectroscopy. As model systems for studying membrane headgroup/water interactions, in this paper we consider lipid and surfactant monolayers on water. We adopt a theoretical approach combining molecular dynamics simulations and phase-sensitive VSFG to investigate water structure near these interfaces. Our simulated spectra are in qualitative agreement with experiments and reveal orientational ordering of interfacial water molecules near cationic, anionic, and zwitterionic interfaces. OH bonds of water molecules point toward an anionic interface leading to a positive VSFG peak, whereas the water hydrogen atoms point away from a cationic interface leading to a negative VSFG peak. Coexistence of these two interfacial water species is observed near interfaces between water and mixtures of cationic and anionic lipids, as indicated by the presence of both negative and positive peaks in their VSFG spectra. In the case of a zwitterionic interface, OH orientation is toward the interface on the average, resulting in a positive VSFG peak.
Vibration-rotation spectrum of BH X1Σ+ by Fourier transform emission spectroscopy
Pianalto, F. S.; O'Brien, L. C.; Keller, P. C.; Bernath, P. F.
1988-06-01
The vibration-rotation emission spectrum of the BH X1Σ+ state was observed with the McMath Fourier transform spectrometer at Kitt Peak. The 1-0, 2-1, and 3-2 bands were observed in a microwave discharge of B2H6 in He. Spectroscopic constants of the individual vibrational levels and equilibrium molecular constants were determined. An RKR potential curve was calculated from the equilibrium constants. Alfred P. Sloan Fellow; Camille and Henry Dreyfus Teacher-Scholar.
Çakar, Halil Ibrahim; Doğan, Serfiraz; Kara, Sadık; Rittweger, Jörn; Rawer, Rainer; Zange, Jochen
2017-06-01
In this study, we investigated the effects of vibration of the whole lower leg on the content and the oxygenation of hemoglobin in the unloaded relaxed lateral gastrocnemius muscle. Vibration was applied orthogonal to and in parallel with leg axis to examine whether the extrusion of blood depends on an alignment of main vessel direction, axis of vibration and gravity. The blood volume in the muscles was altered by horizontal and 30° upright body posture. Fifteen male subjects were exposed to 4 sets of experiments with both vibration directions and both tilt angles applied in permutated order. The absence of voluntary muscular activity and the potential occurrence of compound action potentials by stretch reflexes were monitored using electromyography. Total hemoglobin and tissue saturation index were measured with near infrared spectroscopy. Changes of lower leg circumference were measured with strain gauge system placed around the calf. Vibration caused decrease in tHb and increase in TSI indicating extrusion of predominantly venous blood from the muscle. In 30° tilted position, muscles contained more blood at baseline and vibration ejected more blood from the muscle compared with horizontal posture (p < 0.01). At 30° tilting deeper drop in tHb and steeper increase in TSI (p < 0.01) were observed when vibration was applied in parallel with the length axis of muscle. It is concluded that the vibration extrudes more blood in 30° head up posture and the vibration applied in parallel with the length axis of the muscle is more effective than orthogonal vibration.
Kortyna, A.; Lesko, D. M. B.; Nesbitt, D. J.
2018-05-01
The combination of a pulsed supersonic slit-discharge source and single-mode difference frequency direct absorption infrared spectroscopy permit first high resolution infrared study of the iodomethyl (CH2I) radical, with the CH2I radical species generated in a slit jet Ne/He discharge and cooled to 16 K in the supersonic expansion. Dual laser beam detection and collisional collimation in the slit expansion yield sub-Doppler linewidths (60 MHz), an absolute frequency calibration of 13 MHz, and absorbance sensitivities within a factor of two of the shot-noise limit. Fully rovibrationally resolved direct absorption spectra of the CH2 symmetric stretch mode (ν2) are obtained and fitted to a Watson asymmetric top Hamiltonian with electron spin-rotation coupling, providing precision rotational constants and spin-rotation tensor elements for the vibrationally excited state. Analysis of the asymmetric top rotational constants confirms a vibrationally averaged planar geometry in both the ground- and first-excited vibrational levels. Sub-Doppler resolution permits additional nuclear spin hyperfine structures to be observed, with splittings in excellent agreement with microwave measurements on the ground state. Spectroscopic data on CH2I facilitate systematic comparison with previous studies of halogen-substituted methyl radicals, with the periodic trends strongly correlated with the electronegativity of the halogen atom. Interestingly, we do not observe any asymmetric CH2 stretch transitions, despite S/N ≈ 25:1 on strongest lines in the corresponding symmetric CH2 stretch manifold. This dramatic reversal of the more typical 3:1 antisymmetric/symmetric CH2 stretch intensity ratio signals a vibrational transition moment poorly described by simple "bond-dipole" models. Instead, the data suggest that this anomalous intensity ratio arises from "charge sloshing" dynamics in the highly polar carbon-iodine bond, as supported by ab initio electron differential density plots and
Quantum vibrational polarons: Crystalline acetanilide revisited
Hamm, Peter; Edler, Julian
2006-03-01
We discuss a refined theoretical description of the peculiar spectroscopy of crystalline acetanilide (ACN). Acetanilide is a molecular crystal with quasi-one-dimensional chains of hydrogen-bonded units, which is often regarded as a model system for the vibrational spectroscopy of proteins. In linear spectroscopy, the CO stretching (amide I) band of ACN features a double-peak structure, the lower of which shows a pronounced temperature dependence which has been discussed in the context of polaron theory. In nonlinear spectroscopy, both of these peaks respond distinctly differently. The lower-frequency band exhibits the anharmonicity expected from polaron theory, while the higher-frequency band responds as if it were quasiharmonic. We have recently related the response of the higher-frequency band to that of a free exciton [J. Edler and P. Hamm, J. Chem. Phys. 117, 2415 (2002)]. However, as discussed in the present paper, the free exciton is not an eigenstate of the full quantum version of the Holstein polaron Hamiltonian, which is commonly used to describe these phenomena. In order to resolve this issue, we present a numerically exact solution of the Holstein polaron Hamiltonian in one dimension (1D) and 3D. In 1D, we find that the commonly used displaced oscillator picture remains qualitatively correct, even for relatively large exciton coupling. However, the result is not in agreement with the experiment, as it fails to explain the free-exciton band. In contrast, when taking into account the 3D nature of crystalline acetanilide, certain parameter regimes exist where the displaced oscillator picture breaks down and states appear in the spectrum that indeed exhibit the characteristics of a free exciton. The appearance of these states is a speciality of vibrational polarons, whose source of exciton coupling is transition dipole coupling which is expected to have opposite signs of interchain and intrachain coupling.
Energy Technology Data Exchange (ETDEWEB)
Eisenthal, Kenneth B [Columbia Univ., New York, NY (United States)
2015-02-24
We have advanced our capabilities to investigate ultrafast excited state dynamics at a liquid interface using a pump to excite molecules to higher electronic states and then probe the subsequent time evolution of the interfacial molecules with femtosecond time delayed vibrational SFG.
Boughton, Andrew P; Yang, Pei; Tesmer, Valerie M; Ding, Bei; Tesmer, John J G; Chen, Zhan
2011-09-13
Few experimental techniques can assess the orientation of peripheral membrane proteins in their native environment. Sum Frequency Generation (SFG) vibrational spectroscopy was applied to study the formation of the complex between G protein-coupled receptor (GPCR) kinase 2 (GRK2) and heterotrimeric G protein β(1)γ(2) subunits (Gβγ) at a lipid bilayer, without any exogenous labels. The most likely membrane orientation of the GRK2-Gβγ complex differs from that predicted from the known protein crystal structure, and positions the predicted receptor docking site of GRK2 such that it would more optimally interact with GPCRs. Gβγ also appears to change its orientation after binding to GRK2. The developed methodology is widely applicable for the study of other membrane proteins in situ.
Acoustic resonance spectroscopy for the advanced undergraduate laboratory
International Nuclear Information System (INIS)
Franco-Villafañe, J A; Méndez-Sánchez, R A; Flores-Olmedo, E; Báez, G; Gandarilla-Carrillo, O
2012-01-01
We present a simple experiment that allows advanced undergraduates to learn the principles and applications of spectroscopy. The technique, known as acoustic resonance spectroscopy, is applied to study a vibrating rod. The setup includes electromagnetic-acoustic transducers, an audio amplifier and a vector network analyzer. Typical results of compressional, torsional and bending waves are analyzed and compared with analytical results. (paper)
Castillo, María V; Pergomet, Jorgelina L; Carnavale, Gustavo A; Davies, Lilian; Zinczuk, Juan; Brandán, Silvia A
2015-01-05
In this study 3,3',4,4'-tetrachloroazobenzene (TCAB) was prepared and then characterized by infrared, Raman, multidimensional nuclear magnetic resonance (NMR) and ultraviolet-visible spectroscopies. The density functional theory (DFT) together with the 6-31G(*) and 6-311++G(**) basis sets were used to study the structures and vibrational properties of the two cis and trans isomers of TCAB. The harmonic vibrational wavenumbers for the optimized geometries were calculated at the same theory levels. A complete assignment of all the observed bands in the vibrational spectra of TCAB was performed combining the DFT calculations with the scaled quantum mechanical force field (SQMFF) methodology. The molecular electrostatic potentials, atomic charges, bond orders and frontier orbitals for the two isomers of TCAB were compared and analyzed. The comparison of the theoretical ultraviolet-visible spectrum with the corresponding experimental demonstrates a good concordance while the calculated (1)H and (13)C chemicals shifts are in good conformity with the corresponding experimental NMR spectra of TCAB in solution. The npp(*) transitions for both forms were studied by natural bond orbital (NBO) while the topological properties were calculated by employing Bader's Atoms in the Molecules (AIM) theory. This study shows that the cis and trans isomers exhibit different structural and vibrational properties and absorption bands. Copyright © 2014. Published by Elsevier B.V.
Advancements of two dimensional correlation spectroscopy in protein researches
Tao, Yanchun; Wu, Yuqing; Zhang, Liping
2018-05-01
The developments of two-dimensional correlation spectroscopy (2DCOS) applications in protein studies are discussed, especially for the past two decades. The powerful utilities of 2DCOS combined with various analytical techniques in protein studies are summarized. The emphasis is on the vibration spectroscopic techniques including IR, NIR, Raman and optical activity (ROA), as well as vibration circular dichroism (VCD) and fluorescence spectroscopy. In addition, some new developments, such as hetero-spectral 2DCOS, moving-window correlation, and model based correlation, are also reviewed for their utility in the investigation of the secondary structure, denaturation, folding and unfolding changes of protein. Finally, the new possibility and challenges of 2DCOS in protein research are highlighted as well.
Energy Technology Data Exchange (ETDEWEB)
Arjmand, F. [Aligarh Muslim Univ., Aligarh (India). Dept. of Chemistry; Sharma, S. [Aligarh Muslim Univ., Aligarh (India). Dept. of Chemistry; Usman, M. [Aligarh Muslim Univ., Aligarh (India). Dept. of Chemistry; Leu, B. M. [Argonne National Lab. (ANL), Argonne, IL (United States). Advanced Photon Source (APS); Hu, M. Y. [Argonne National Lab. (ANL), Argonne, IL (United States). Advanced Photon Source (APS); Toupet, L. [Univ. de Rennes, Rennes (France). Inst. de Physique de Rennes; Gosztola, David J. [Argonne National Lab. (ANL), Argonne, IL (United States). Center for Nanoscale Materials; Tabassum, S. [Aligarh Muslim Univ., Aligarh (India). Dept. of Chemistry
2016-06-21
The vibrational dynamics of a newly synthesized tetrastannoxane was characterized with a combination of experimental (Raman, IR and tin-based nuclear resonance vibrational spectroscopy) and computational (DFT/B3LYP) methods, with an emphasis on the vibrations of the tin sites. The cytotoxic activity revealed a significant regression selectively against the human pancreatic cell lines.
Determining the Authenticity of Gemstones Using Raman Spectroscopy
Aponick, Aaron; Marchozzi, Emedio; Johnston, Cynthia R.; Wigal, Carl T.
1998-04-01
The benefits of laser spectroscopy in the undergraduate curriculum have been the focus of several recent articles in this journal. Raman spectroscopy has been of particular interest since the similarities of Raman to conventional infrared spectroscopy make the interpretation of spectral data well within undergraduate comprehension. In addition, the accessibility to this technology is now within the reach of most undergraduate institutions. This paper reports the development of an experiment using Raman spectroscopy which determines the authenticity of both diamonds and pearls. The resulting spectra provide an introduction to vibrational spectroscopy and can be used in a variety of laboratory courses ranging from introductory chemistry to instrumental analysis.
Time-resolved spectroscopy defines perturbation in molecules
International Nuclear Information System (INIS)
Ahmed, K.
1998-01-01
Time-resolved LIF spectroscopy is employed in order to investigate perturbations in different excited electronic state of alkali molecules. Dunham Coefficients are used to search the selected excited ro-vibrational level, which is overlap with the other nearby excited states. Lifetime measurement has been performed of more than 50 ro-vibrational levels. Out of these 25 levels were observed drastically different lifetimes from the other unperturbed levels. In this report, influence of different perturbations on this anomalous behavior is investigated and discussed. (author)
Two-dimensional electronic femtosecond stimulated Raman spectroscopy
Directory of Open Access Journals (Sweden)
Ogilvie J.P.
2013-03-01
Full Text Available We report two-dimensional electronic spectroscopy with a femtosecond stimulated Raman scattering probe. The method reveals correlations between excitation energy and excited state vibrational structure following photoexcitation. We demonstrate the method in rhodamine 6G.
Pathak, Anshuma; Bora, Achyut; Braunschweig, Björn; Meltzer, Christian; Yan, Hongdan; Lemmens, Peter; Daum, Winfried; Schwartz, Jeffrey; Tornow, Marc
2017-05-18
We report the impact of geometrical constraint on intramolecular interactions in self-assembled monolayers (SAMs) of alkylphosphonates grown on anodically oxidized aluminum (AAO). Molecular order in these films was determined by sum frequency generation (SFG) spectroscopy, a more sensitive measure of order than infrared absorption spectroscopy. Using SFG we show that films grown on AAO are, within detection limits, nearly perfectly ordered in an all-trans alkyl chain configuration. In marked contrast, films formed on planar, plasma-oxidized aluminum oxide or α-Al 2 O 3 (0001) are replete with gauche defects. We attribute these differences to the nanocylindrical structure of AAO, which enforces molecular confinement.
Ultrafast Vibrational Spectrometer for Engineered Nanometric Energetic Materials
National Research Council Canada - National Science Library
Dlott, Dana
2002-01-01
.... The needed equipment was ordered and installed, and assembled into a working SFG set up that has been tested on a model system consisting of a self assembled monolayer of alkane on gold. The next step will be to finish integrating the carbon dioxide laser system and to begin looking at aluminum based energetic materials.
2018-01-01
The structural heterogeneity of water at various interfaces can be revealed by time-resolved sum-frequency generation spectroscopy. The vibrational dynamics of the O–H stretch vibration of interfacial water can reflect structural variations. Specifically, the vibrational lifetime is typically found to increase with increasing frequency of the O–H stretch vibration, which can report on the hydrogen-bonding heterogeneity of water. We compare and contrast vibrational dynamics of water in contact with various surfaces, including vapor, biomolecules, and solid interfaces. The results reveal that variations in the vibrational lifetime with vibrational frequency are very typical, and can frequently be accounted for by the bulk-like heterogeneous response of interfacial water. Specific interfaces exist, however, for which the behavior is less straightforward. These insights into the heterogeneity of interfacial water thus obtained contribute to a better understanding of complex phenomena taking place at aqueous interfaces, such as photocatalytic reactions and protein folding. PMID:29490138
Energy Technology Data Exchange (ETDEWEB)
Aumer, Andreas
2010-06-21
This thesis focuses on 4 different model systems of surface science. The experimental techniques used for the measurements include sum frequency generation (SFG), thermal desorption spectroscopy (TDS), low energy electron diffraction (LEED), Auger electron spectroscopy (AES), infrared adsorption spectrosocopy (IRAS) and scanning tunneling microscopy (STM). By using SFG, measurements could be performed up to a pressure of 50 mbar. The systems under investigation were: CO on Pt(111), water on Ag(001) and on MgO/Ag(001), CO on Au/MgO/Ag(001), and CO on Au-Pd/MgO/Ag(001). The system of CO on Pt(111) exhibits a two peak-pattern under certain pressure and temperature conditions which has not been studied so far. Various experiments helped to elucidate the origin of this distinct behaviour. The measurements of water on Ag(001) and MgO/Ag(001) show that on MgO, water first adsorbs as a monolayer with a following multilayer, whereas on Ag(001) it adsorbs as a multilayer from the beginning. The monolayer can be studied below the multilayer and some resonances can be identified. For the case of Au/MgO/Ag(001), STM shows that the growth mode of Au depends on the thickness of the supporting MgO film, which can not be seen with spectroscopic methods. For mixed Au-Pd particles on MgO/Ag(001) a clear difference in the adsorption behaviour between pure metal particles and mixed particles can be seen, which is explained by an interaction between these metals. Annealing the mixed particles to 600 K leads to a segregation of the metals, where the Au atoms diffuse to the shell and the Pd atoms make up the core. The results of all these measurements are discussed in the light of recent publications. (orig.)
Proceedings of the DAE-BRNS theme meeting on recent trends in spectroscopy: book of abstracts
International Nuclear Information System (INIS)
2014-01-01
The meeting aimed at providing the latest developments in various spectroscopic techniques to the research students and practicing scientists. The proceedings of the symposium covered a wide range of topics of infrared and Raman spectroscopy, time resolved spectroscopy, mass spectrometry, nuclear magnetic resonance spectroscopy, electron spin resonance spectroscopy, rotational and vibrational spectroscopy, fluorescence spectroscopy, cavity ring down spectroscopy, laser based spectroscopic techniques and electrochemical spectroscopy. Papers relevant to INIS are indexed separately
International Nuclear Information System (INIS)
Thomason, M.D.
1982-07-01
Rates for resonant vibrational and rotational energy transfer from the 001 state by CO 2 + CO 2 collisions have been measured. All data were obtained by double resonance spectroscopy with CO 2 lasers in a 2.5 meter absorption cell at 700 0 K. Results for rotation transfer include pumped-level relaxation and the response of other 001 levels with ΔJ up to 18. These data are compared to four relevant collision models via a 35-level rate equation analysis. Sequence-band (002 → 101) and hot-band (011 → 110) lasting have been used to observe resonant nu 3 -transfer relaxation involving 001 + 001 reversible 002 + 000, 001 + 100 reversible 101 + 000, and 001 + 010 reversible 011 + 000. A multilevel rate analysis has been utilized to determine the rate coefficients for 001 going to the 002, the 101, and the 011 levels. Part of the hot-band data has been interpreted as due to 110 + 000 reversible 100 + 010, and the associated rate constant has been estimated. The results of the study are compared to the theory and to other experiments
High resolution spectroscopy in the quasi continuum. Final report
International Nuclear Information System (INIS)
Janda, K.C.
1986-01-01
Studies of the spectroscopy of vibrationally metastable molecules are briefly described. The research concentrates on two types of molecules, complexes involving ethylene and rare gas atoms bonded to halogen molecules
International Nuclear Information System (INIS)
Ali, Hassan Refat H.; Edwards, Howell G.M.; Hargreaves, Michael D.; Munshi, Tasnim; Scowen, Ian J.; Telford, Richard J.
2008-01-01
Knowledge and control of the polymorphic phases of chemical compounds are important aspects of drug development in the pharmaceutical industry. Salmeterol xinafoate, a long acting β-adrenergic receptor agonist, exists in two polymorphic Forms, I and II. Raman and near infrared spectra were obtained of these polymorphs at selected wavelengths in the range of 488-1064 nm; significant differences in the Raman and near-infrared spectra were apparent and key spectral marker bands have been identified for the vibrational spectroscopic characterisation of the individual polymorphs which were also characterised with X ray diffractometry. The solid-state transition of salmeterol xinafoate polymorphs was studied using simultaneous in situ portable Raman spectroscopy and differential scanning calorimetry isothermally between transitions. This method assisted in the unambiguous characterisation of the two polymorphic forms by providing a simultaneous probe of both the thermal and vibrational data. The study demonstrates the value of a rapid in situ analysis of a drug polymorph which can be of potential value for at-line in-process control
Energy Technology Data Exchange (ETDEWEB)
Ali, Hassan Refat H. [Chemical and Forensic Sciences/University Analytical Centre, School of Life Sciences, University of Bradford, Richmond Road, Bradford BD7 1DP (United Kingdom); Edwards, Howell G.M. [Chemical and Forensic Sciences/University Analytical Centre, School of Life Sciences, University of Bradford, Richmond Road, Bradford BD7 1DP (United Kingdom)], E-mail: H.G.M.Edwards@bradford.ac.uk; Hargreaves, Michael D.; Munshi, Tasnim; Scowen, Ian J.; Telford, Richard J. [Chemical and Forensic Sciences/University Analytical Centre, School of Life Sciences, University of Bradford, Richmond Road, Bradford BD7 1DP (United Kingdom)
2008-07-14
Knowledge and control of the polymorphic phases of chemical compounds are important aspects of drug development in the pharmaceutical industry. Salmeterol xinafoate, a long acting {beta}-adrenergic receptor agonist, exists in two polymorphic Forms, I and II. Raman and near infrared spectra were obtained of these polymorphs at selected wavelengths in the range of 488-1064 nm; significant differences in the Raman and near-infrared spectra were apparent and key spectral marker bands have been identified for the vibrational spectroscopic characterisation of the individual polymorphs which were also characterised with X ray diffractometry. The solid-state transition of salmeterol xinafoate polymorphs was studied using simultaneous in situ portable Raman spectroscopy and differential scanning calorimetry isothermally between transitions. This method assisted in the unambiguous characterisation of the two polymorphic forms by providing a simultaneous probe of both the thermal and vibrational data. The study demonstrates the value of a rapid in situ analysis of a drug polymorph which can be of potential value for at-line in-process control.
Carr, J. K.; Buchanan, L. E.; Schmidt, J. R.; Zanni, M. T.; Skinner, J. L.
2013-01-01
Urea/water is an archetypical “biological” mixture, and is especially well known for its relevance to protein thermodynamics, as urea acts as a protein denaturant at high concentration. This behavior has given rise to an extended debate concerning urea’s influence on water structure. Based on a variety of methods and of definitions of water structure, urea has been variously described as a structure-breaker, a structure-maker, or as remarkably neutral towards water. Because of its sensitivity to microscopic structure and dynamics, vibrational spectroscopy can help resolve these debates. We report experimental and theoretical spectroscopic results for the OD stretch of HOD/H2O/urea mixtures (linear IR, 2DIR, and pump-probe anisotropy decay) and for the CO stretch of urea-D4/D2O mixtures (linear IR only). Theoretical results are obtained using existing approaches for water, and a modification of a frequency map developed for acetamide. All absorption spectra are remarkably insensitive to urea concentration, consistent with the idea that urea only very weakly perturbs water structure. Both this work and experiments by Rezus and Bakker, however, show that water’s rotational dynamics are slowed down by urea. Analysis of the simulations casts doubt on the suggestion that urea immobilizes particular doubly hydrogen bonded water molecules. PMID:23841646
Yang, Deheng; Li, Yadong; Liu, Xinyi; Cao, Yue; Gao, Yi; Shen, Y Ron; Liu, Wei-Tao
2018-04-24
The facet-specific interaction between molecules and crystalline catalysts, such as titanium dioxides (TiO 2 ), has attracted much attention due to possible facet-dependent reactivity. Using surface-sensitive sum-frequency vibrational spectroscopy, we have studied how methanol interacts with different common facets of crystalline TiO 2 , including rutile(110), (001), (100), and anatase(101), under ambient temperature and pressure. We found that methanol adsorbs predominantly in the molecular form on all of the four surfaces, while spontaneous dissociation into methoxy occurs preferentially when these surfaces become defective. Extraction of Fermi resonance coupling between stretch and bending modes of the methyl group in analyzing adsorbed methanol spectra allows determination of the methanol adsorption isotherm. The isotherms obtained for the four surfaces are nearly the same, yielding two adsorbed Gibbs free energies associated with two different adsorption configurations singled out by ab initio calculations. They are ( i ) ∼-20 kJ/mol for methanol with its oxygen attached to a low-coordinated surface titanium, and ( ii ) ∼-5 kJ/mol for methanol hydrogen-bonded to a surface oxygen and a neighboring methanol molecule. Despite similar adsorption energetics, the Fermi resonance coupling strength for adsorbed methanol appears to depend sensitively on the surface facet and coverage.
International Nuclear Information System (INIS)
Yau, Waifan.
1988-04-01
Substitutional carbon on an arsenic lattice site is the shallowest and one of the most dominant acceptors in semi-insulating Liquid Encapsulated Czochralski (LEC) GaAs. However, the role of this acceptor in determining the well known ''W'' shape spatial variation of neutral EL2 concentration along the diameter of a LEC wafer is not known. In this thesis, we attempt to clarify the issue of the carbon acceptor's effect on this ''W'' shaped variation by measuring spatial profiles of this acceptor along the radius of three different as-grown LEC GaAs wafers. With localized vibrational mode absorption spectroscopy, we find that the profile of the carbon acceptor is relatively constant along the radius of each wafer. Average values of concentration are 8 x 10E15 cm -3 , 1.1 x 10E15 cm -3 , and 2.2 x 10E15 cm -3 , respectively. In addition, these carbon acceptor LVM measurements indicate that a residual donor with concentration comparable to carbon exists in these wafers and it is a good candidate for the observed neutral EL2 concentration variation. 22 refs., 39 figs
Wang, Hongxin; Yoda, Yoshitaka; Dong, Weibing; Huang, Songping D
2013-09-01
The conventional energy calibration for nuclear resonant vibrational spectroscopy (NRVS) is usually long. Meanwhile, taking NRVS samples out of the cryostat increases the chance of sample damage, which makes it impossible to carry out an energy calibration during one NRVS measurement. In this study, by manipulating the 14.4 keV beam through the main measurement chamber without moving out the NRVS sample, two alternative calibration procedures have been proposed and established: (i) an in situ calibration procedure, which measures the main NRVS sample at stage A and the calibration sample at stage B simultaneously, and calibrates the energies for observing extremely small spectral shifts; for example, the 0.3 meV energy shift between the 100%-(57)Fe-enriched [Fe4S4Cl4](=) and 10%-(57)Fe and 90%-(54)Fe labeled [Fe4S4Cl4](=) has been well resolved; (ii) a quick-switching energy calibration procedure, which reduces each calibration time from 3-4 h to about 30 min. Although the quick-switching calibration is not in situ, it is suitable for normal NRVS measurements.
Ultrasensitive Broadband Probing of Molecular Vibrational Modes with Multifrequency Optical Antennas
Czech Academy of Sciences Publication Activity Database
Aouani, H.; Šípová, Hana; Rahmani, M.; Navarro-Cia, M.; Hegnerová, Kateřina; Homola, Jiří; Hong, M.; Maier, S. A.
2013-01-01
Roč. 7, č. 1 (2013), s. 669-675 ISSN 1936-0851 R&D Projects: GA MŠk(CZ) LH11102 Institutional support: RVO:67985882 Keywords : plasmonic * nanoantenna * vibrational spectroscopy Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 12.033, year: 2013
Vibrational spectroscopy of SnBr4 and CCl4 using Lie algebraic ...
Indian Academy of Sciences (India)
experimentalists because of the development of new laser spectroscopic techniques. Wulfman played a ... used Lie algebraic methods to study the spectra of molecules (vibron model) using. U(4) algebra. ..... to vibrations of gas molecules.
International Nuclear Information System (INIS)
Volkmer, Andreas
2005-01-01
For noninvasive characterization of chemical species or biological components within a complex heterogeneous system, their intrinsic molecular vibrational properties can be used in contrast mechanisms in optical microscopy. A series of recent advances have made coherent anti-Stokes Raman scattering (CARS) microscopy a powerful technique that allows vibrational imaging with high sensitivity, high spectral resolution and three-dimensional sectioning capability. In this review, we discuss theoretical and experimental aspects of CARS microscopy in a collinear excitation beam geometry. Particular attention is given to the underlying physical principles behind the new features of CARS signal generation under tight focusing conditions. We provide a brief overview of the instrumentation of CARS microscopy and its experimental characterization by means of imaging of model systems and live unstained cells. CARS microscopy offers the possibility of spatially resolved vibrational spectroscopy, providing chemical and physical structure information of molecular specimens on the sub-micrometre length scale. We review multiplex CARS microspectroscopy allowing fast acquisition of frequency-resolved CARS spectra, time-resolved CARS microspectroscopy recording ultrafast Raman free induction decays and CARS correlation spectroscopy probing dynamical processes with chemical selectivity. (topical review)
Microresonator soliton dual-comb spectroscopy
Suh, Myoung-Gyun; Yang, Qi-Fan; Yang, Ki Youl; Yi, Xu; Vahala, Kerry J.
2016-11-01
Measurement of optical and vibrational spectra with high resolution provides a way to identify chemical species in cluttered environments and is of general importance in many fields. Dual-comb spectroscopy has emerged as a powerful approach for acquiring nearly instantaneous Raman and optical spectra with unprecedented resolution. Spectra are generated directly in the electrical domain, without the need for bulky mechanical spectrometers. We demonstrate a miniature soliton-based dual-comb system that can potentially transfer the approach to a chip platform. These devices achieve high-coherence pulsed mode locking. They also feature broad, reproducible spectral envelopes, an essential feature for dual-comb spectroscopy. Our work shows the potential for integrated spectroscopy with high signal-to-noise ratios and fast acquisition rates.
Wavelength tunable CW red laser generated based on an intracavity-SFG composite cavity
Zhang, Z. N.; Bai, Y.; Lei, G. Z.; Bai, B.; Sun, Y. X.; Hu, M. X.; Wang, C.; Bai, J. T.
2016-12-01
We report a wavelength-tunable watt-level continuous wave (CW) red laser that uses a composite cavity based on an intracavity sum-frequency generation (SFG). The composite cavity is composed of a LD side-pumped Nd: GdVO4 p-polarized 1062.9 nm resonant cavity and a resonant optical parametric oscillator (SRO) of s-polarized signal light using a periodically poled crystal MgO: PPLN. Based on the temperature tuning from 30 °C to 200 °C, the CW red laser beams are obtained in a tunable waveband from 634.4 nm to 649.1 nm, corresponding to a tunable output waveband from 3278.0 nm to 2940.2 nm of the mid-infrared idler lights. The maximum CW output power of the red laser at 634.4 nm and the idler light at 3278.0 nm reach 3.03 W and 4.13 W under 30 °C, respectively.
Photoelectron spectroscopy of supersonic molecular beams
International Nuclear Information System (INIS)
Pollard, J.E.
1982-05-01
A new technique for performing high resolution molecular photoelectron spectroscopy is described, beginning with its conceptual development, through the construction of a prototypal apparatus, to the initial applications on a particularly favorable molecular system. The distinguishing features of this technique are: (1) the introduction of the sample in the form of a collimated supersonic molecular beam; and (2) the use of an electrostatic deflection energy analyzer which is carefully optimized in terms of sensitivity and resolution. This combination makes it possible to obtain photoelectron spectra at a new level of detail for many small molecules. Three experiments are described which rely on the capability to perform rotationally-resolved photoelectron spectroscopy on the hydrogen molecule and its isotopes. The first is a measurement of the ionic vibrational and rotational spectroscopic constants and the vibrationally-selected photoionization cross sections. The second is a determination of the photoelectron asymmetry parameter, β, for selected rotational transitions. The third is an investigation of the rotational relaxation in a free jet expansion, using photoelectron spectroscopy as a probe of the rotational state population distributions. In the closing chapter an assessment is made of the successes and limitations of the technique, and an indication is given of areas for further improvement in future spectrometers
International Nuclear Information System (INIS)
Takahashi, Hiroaki; Watanabe, Ryosuke; Miyauchi, Yoshihiro; Mizutani, Goro
2011-01-01
In this report, local electronic structures of steps and terraces on rutile TiO 2 single crystal faces were studied by second harmonic and sum frequency generation (SHG/SFG) spectroscopy. We attained selective measurement of the local electronic states of the step bunches formed on the vicinal (17 18 1) and (15 13 0) surfaces using a recently developed step-selective probing technique. The electronic structures of the flat (110)-(1x1) (the terrace face of the vicinal surfaces) and (011)-(2x1) surfaces were also discussed. The SHG/SFG spectra showed that step structures are mainly responsible for the formation of trap states, since significant resonances from the trap states were observed only from the vicinal surfaces. We detected deep hole trap (DHT) states and shallow electron trap (SET) states selectively from the step bunches on the vicinal surfaces. Detailed analysis of the SHG/SFG spectra showed that the DHT and SET states are more likely to be induced at the top edges of the step bunches than on their hillsides. Unlike the SET states, the DHT states were observed only at the step bunches parallel to [1 1 1][equivalent to the step bunches formed on the (17 18 1) surface]. Photocatalytic activity for each TiO 2 sample was also measured through methylene blue photodegradation reactions and was found to follow the sequence: (110) < (17 18 1) < (15 13 0) < (011), indicating that steps along [0 0 1] are more reactive than steps along [1 1 1]. This result implies that the presence of the DHT states observed from the step bunches parallel to [1 1 1] did not effectively contribute to the methylene blue photodegradation reactions.
Katano, Satoshi; Toma, Koji; Toma, Mana; Tamada, Kaoru; Uehara, Yoichi
2010-11-28
Scanning tunneling microscope light emission (STM-LE) spectroscopy has been utilized to elucidate the luminescence phenomena of Ag nanoparticles capped with myristate (myristate-capped AgNP) and 2-methyl-1-propanethiolate (C(4)S-capped AgNP) on the dodecanethiol-precovered Au substrate. The STM imaging revealed that myristate-capped AgNPs form an ordered hexagonal array whereas C(4)S-capped AgNPs show imperfect ordering, indicating that a shorter alkyl chain of C(4)S-capped AgNP is not sufficient to form rigid interdigitation. It should be noted that such a nanoparticle ordering affects the luminescence properties of the Ag nanoparticle. We found that the STM-LE is only detected from the Ag nanoparticles forming the two-dimensional superlattice. This indicates that the STM-LE of the Ag nanoparticle is radiated via the collective excitation of the local surface plasmon resonance (LSPR) spread over the Ag nanoparticles. Note that the STM-LE spectra of the Ag nanoparticles exhibit spike-like peaks superimposed on the broad light emission peak. Using Raman spectroscopy, we concluded that the spike-like structure appearing in the STM-LE spectra is associated with the vibrational excitation of the molecule embedded between Ag nanoparticles.
Enhanced vibration diagnostics using vibration signature analysis
International Nuclear Information System (INIS)
Ahmed, S.; Shehzad, K.; Zahoor, Y.; Mahmood, A.; Bibi, A.
2001-01-01
Symptoms will appear in equipment, as well as in human beings. when 'suffering from sickness. Symptoms of abnormality in equipment are vibration, noise, deformation, temperature, pressure, electric current, crack, wearing, leakage etc. these are called modes of failure. If the mode of failure is vibration then the vibration signature analysis can be effectively used in order to diagnose the machinery problems. Much valuable information is contained within these vibration 'Spectra' or 'Signatures' but is only of use if the analyst can unlock its 'Secrets'. This paper documents a vibration problem in the motor of a centrifugal pump (Type ETA). It focuses mainly on the roll of modern vibration monitoring system in problem analysis. The problem experienced was the motor unstability and noise due to high vibration. Using enhanced vibration signature data, the problem was analyzed. which suggested that the rotor eccentricity was the cause of excessive noise and vibration in the motor. In conclusion, advanced electronic monitoring and diagnostic systems provide powerful information for machine's condition assessment and problem analysis. Appropriate interpretation and use of this information is important for accurate and effective vibration analysis. (author)
Sen, Ananya; Bouchet, Aude; Lepère, Valeria; Le Barbu-Debus, Katia; Scuderi, D; Piuzzi, F; Zehnacker-Rentien, A
2012-08-16
Laser-desorbed quinine and quinidine have been studied in the gas phase by combining supersonic expansion with laser spectroscopy, namely, laser-induced fluorescence (LIF), resonance-enhanced multiphoton ionization (REMPI), and IR-UV double resonance experiments. Density funtional theory (DFT) calculations have been done in conjunction with the experimental work. The first electronic transition of quinine and quinidine is of π-π* nature, and the studied molecules weakly fluoresce in the gas phase, in contrast to what was observed in solution (Qin, W. W.; et al. J. Phys. Chem. C2009, 113, 11790). The two pseudo enantiomers quinine and quinidine show limited differences in the gas phase; their main conformation is of open type as it is in solution. However, vibrational circular dichroism (VCD) experiments in solution show that additional conformers exist in condensed phase for quinidine, which are not observed for quinine. This difference in behavior between the two pseudo enantiomers is discussed.
Orientation determination of interfacial beta-sheet structures in situ.
Nguyen, Khoi Tan; King, John Thomas; Chen, Zhan
2010-07-01
Structural information such as orientations of interfacial proteins and peptides is important for understanding properties and functions of such biological molecules, which play crucial roles in biological applications and processes such as antimicrobial selectivity, membrane protein activity, biocompatibility, and biosensing performance. The alpha-helical and beta-sheet structures are the most widely encountered secondary structures in peptides and proteins. In this paper, for the first time, a method to quantify the orientation of the interfacial beta-sheet structure using a combined attenuated total reflectance Fourier transformation infrared spectroscopic (ATR-FTIR) and sum frequency generation (SFG) vibrational spectroscopic study was developed. As an illustration of the methodology, the orientation of tachyplesin I, a 17 amino acid peptide with an antiparallel beta-sheet, adsorbed to polymer surfaces as well as associated with a lipid bilayer was determined using the regular and chiral SFG spectra, together with polarized ATR-FTIR amide I signals. Both the tilt angle (theta) and the twist angle (psi) of the beta-sheet at interfaces are determined. The developed method in this paper can be used to obtain in situ structural information of beta-sheet components in complex molecules. The combination of this method and the existing methodology that is currently used to investigate alpha-helical structures will greatly broaden the application of optical spectroscopy in physical chemistry, biochemistry, biophysics, and structural biology.
SFG synthesis of general high-order all-pass and all-pole current transfer functions using CFTAs.
Tangsrirat, Worapong
2014-01-01
An approach of using the signal flow graph (SFG) technique to synthesize general high-order all-pass and all-pole current transfer functions with current follower transconductance amplifiers (CFTAs) and grounded capacitors has been presented. For general nth-order systems, the realized all-pass structure contains at most n + 1 CFTAs and n grounded capacitors, while the all-pole lowpass circuit requires only n CFTAs and n grounded capacitors. The resulting circuits obtained from the synthesis procedure are resistor-less structures and especially suitable for integration. They also exhibit low-input and high-output impedances and also convenient electronic controllability through the g m-value of the CFTA. Simulation results using real transistor model parameters ALA400 are also included to confirm the theory.
SFG Synthesis of General High-Order All-Pass and All-Pole Current Transfer Functions Using CFTAs
Directory of Open Access Journals (Sweden)
Worapong Tangsrirat
2014-01-01
Full Text Available An approach of using the signal flow graph (SFG technique to synthesize general high-order all-pass and all-pole current transfer functions with current follower transconductance amplifiers (CFTAs and grounded capacitors has been presented. For general nth-order systems, the realized all-pass structure contains at most n + 1 CFTAs and n grounded capacitors, while the all-pole lowpass circuit requires only n CFTAs and n grounded capacitors. The resulting circuits obtained from the synthesis procedure are resistor-less structures and especially suitable for integration. They also exhibit low-input and high-output impedances and also convenient electronic controllability through the gm-value of the CFTA. Simulation results using real transistor model parameters ALA400 are also included to confirm the theory.
Pfeiffer, Tobias; Weber, Stefan; Klier, Jens; Bachtler, Sebastian; Molter, Daniel; Jonuscheit, Joachim; Von Freymann, Georg
2018-05-14
In many industrial fields, like automotive and painting industry, the thickness of thin layers is a crucial parameter for quality control. Hence, the demand for thickness measurement techniques continuously grows. In particular, non-destructive and contact-free terahertz techniques access a wide range of thickness determination applications. However, terahertz time-domain spectroscopy based systems perform the measurement in a sampling manner, requiring fixed distances between measurement head and sample. In harsh industrial environments vibrations of sample and measurement head distort the time-base and decrease measurement accuracy. We present an interferometer-based vibration correction for terahertz time-domain measurements, able to reduce thickness distortion by one order of magnitude for vibrations with frequencies up to 100 Hz and amplitudes up to 100 µm. We further verify the experimental results by numerical calculations and find very good agreement.
International Nuclear Information System (INIS)
Nakagawa, Hideyuki
2000-01-01
Synchrotron radiation is expected to be the sharp infrared light source for the advanced experiments on IR and FIR spectroscopy in wide research fields. Especially, synchronized use of SR with VIS and/or UV laser light is to be a promising technique for the research on the dynamical properties of the photo-excited states in condensed materials. Some proposals are attempted for high resolution IR spectroscopy to elucidate fine interaction of molecular ions in crystalline solids with their environmental field and for time-resolved IR spectroscopic studies on the electronic and vibrational energy relaxation by using laser pulses synchronized with IR-SR pulses. Several experimental results are presented in relevance to the subjects; on high-resolution FTIR spectra of cyanide ions and metal cyanide complexes in cadmium halide crystals, on the energy up-conversion process among the vibrational levels of cyanide ions in alkali halide crystals, and on the electronic-to-vibrational energy conversion process in metal cyanide complexes. (author)
International Nuclear Information System (INIS)
Kroeger, J
2008-01-01
Three aspects of electron-phonon coupling at metal surfaces are reviewed. One aspect is the Kohn effect, which describes an anomalous dispersion relation of surface phonons due to quasi-one-dimensional nesting of Fermi surface contours. The combination of electron energy loss spectroscopy and angle-resolved photoelectron spectroscopy allows us to unambiguously characterize Kohn anomaly systems. A second aspect is the nonadiabatic damping of adsorbate vibrations. Characteristic spectroscopic line shapes of vibrational modes allow us to estimate the amount of energy transfer between the vibrational mode and electron-hole pairs. Case studies of a Kohn anomaly and nonadiabatic damping are provided by the hydrogen- and deuterium-covered Mo(110) surface. As a third aspect of interaction between electrons and phonons, local heating of a C 60 molecule adsorbed on Cu(100) and in contact with the tip of a scanning tunnelling microscope is covered
International Nuclear Information System (INIS)
Yencha, Andrew J; Malins, Andrew E R; Siggel-King, Michele R F; Eypper, Marie; King, George C
2009-01-01
We have initiated a research program to investigate the ionization behavior of some simple organic molecules containing the carboxyl group (R 2 C=O), where R could be H, OH, NH 2 , or CH 3 or other aliphatic or aromatic carbon groups, using threshold photoelectron spectroscopy and photoionization total ion yield spectroscopy. We report here on the simplest organic acid, formic acid, and two simple aldehydes: acetaldehyde and the simplest unsaturated aldehyde, 2-propenal (acrolein). The objective of this study was to characterize the valence cationic states of these molecules with vibrational structural resolution.
The pink pigment prodigiosin: Vibrational spectroscopy and DFT calculations
Czech Academy of Sciences Publication Activity Database
Jehlička, J.; Němec, I.; Varnali, T.; Culka, A.; Svatoš, A.; Frank, Otakar; Oren, A.; Edwards, G.M.
2016-01-01
Roč. 134, NOV 2016 (2016), s. 234-243 ISSN 0143-7208 Institutional support: RVO:61388955 Keywords : prodigiosin * serratia marcescens * raman spectroscopy Subject RIV: CG - Electrochemistry Impact factor: 3.473, year: 2016
Vibrational spectroscopy on protons and deuterons in proton conducting perovskites
DEFF Research Database (Denmark)
Glerup, M.; Poulsen, F.W.; Berg, R.W.
2002-01-01
A short review of IR-spectroscopy on protons in perovskite structure oxides is given. The nature of possible proton sites, libration and combination tones and degree of hydrogen bonding is emphasised. Three new spectroscopic experiments and/or interpretations are presented. An IR-microscopy exper......A short review of IR-spectroscopy on protons in perovskite structure oxides is given. The nature of possible proton sites, libration and combination tones and degree of hydrogen bonding is emphasised. Three new spectroscopic experiments and/or interpretations are presented. An IR...
International Nuclear Information System (INIS)
Pirali, O.; Gruet, S.; Kisiel, Z.; Goubet, M.; Martin-Drumel, M. A.; Cuisset, A.; Hindle, F.; Mouret, G.
2015-01-01
Polycyclic aromatic hydrocarbons (PAHs) are highly relevant for astrophysics as possible, though controversial, carriers of the unidentified infrared emission bands that are observed in a number of different astronomical objects. In support of radio-astronomical observations, high resolution laboratory spectroscopy has already provided the rotational spectra in the vibrational ground state of several molecules of this type, although the rotational study of their dense infrared (IR) bands has only recently become possible using a limited number of experimental set-ups. To date, all of the rotationally resolved data have concerned unperturbed spectra. We presently report the results of a high resolution study of the three lowest vibrational states of quinoline C 9 H 7 N, an N-bearing naphthalene derivative. While the pure rotational ground state spectrum of quinoline is unperturbed, severe complications appear in the spectra of the ν 45 and ν 44 vibrational modes (located at about 168 cm −1 and 178 cm −1 , respectively). In order to study these effects in detail, we employed three different and complementary experimental techniques: Fourier-transform microwave spectroscopy, millimeter-wave spectroscopy, and Fourier-transform far-infrared spectroscopy with a synchrotron radiation source. Due to the high density of states in the IR spectra of molecules as large as PAHs, perturbations in the rotational spectra of excited states should be ubiquitous. Our study identifies for the first time this effect and provides some insights into an appropriate treatment of such perturbations
Pirali, O.; Kisiel, Z.; Goubet, M.; Gruet, S.; Martin-Drumel, M. A.; Cuisset, A.; Hindle, F.; Mouret, G.
2015-03-01
Polycyclic aromatic hydrocarbons (PAHs) are highly relevant for astrophysics as possible, though controversial, carriers of the unidentified infrared emission bands that are observed in a number of different astronomical objects. In support of radio-astronomical observations, high resolution laboratory spectroscopy has already provided the rotational spectra in the vibrational ground state of several molecules of this type, although the rotational study of their dense infrared (IR) bands has only recently become possible using a limited number of experimental set-ups. To date, all of the rotationally resolved data have concerned unperturbed spectra. We presently report the results of a high resolution study of the three lowest vibrational states of quinoline C9H7N, an N-bearing naphthalene derivative. While the pure rotational ground state spectrum of quinoline is unperturbed, severe complications appear in the spectra of the ν45 and ν44 vibrational modes (located at about 168 cm-1 and 178 cm-1, respectively). In order to study these effects in detail, we employed three different and complementary experimental techniques: Fourier-transform microwave spectroscopy, millimeter-wave spectroscopy, and Fourier-transform far-infrared spectroscopy with a synchrotron radiation source. Due to the high density of states in the IR spectra of molecules as large as PAHs, perturbations in the rotational spectra of excited states should be ubiquitous. Our study identifies for the first time this effect and provides some insights into an appropriate treatment of such perturbations.
Energy Technology Data Exchange (ETDEWEB)
Pirali, O.; Gruet, S. [AILES Beamline, Synchrotron SOLEIL, l’Orme des Merisiers, Saint-Aubin, 91192 Gif-sur-Yvette cedex (France); Institut des Sciences Moléculaires d’Orsay, UMR8214 CNRS – Université Paris-Sud, Bât. 210, 91405 Orsay cedex (France); Kisiel, Z. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warsaw (Poland); Goubet, M. [Laboratoire de Physique des Lasers, Atomes et Molécules, UMR 8523 CNRS - Université Lille 1, Bâtiment P5, F-59655 Villeneuve d’Ascq Cedex (France); Martin-Drumel, M. A.; Cuisset, A.; Hindle, F.; Mouret, G. [Laboratoire de Physico-Chimie de l’Atmosphère, EA-4493, Université du Littoral – Côte d’Opale, 59140 Dunkerque (France)
2015-03-14
Polycyclic aromatic hydrocarbons (PAHs) are highly relevant for astrophysics as possible, though controversial, carriers of the unidentified infrared emission bands that are observed in a number of different astronomical objects. In support of radio-astronomical observations, high resolution laboratory spectroscopy has already provided the rotational spectra in the vibrational ground state of several molecules of this type, although the rotational study of their dense infrared (IR) bands has only recently become possible using a limited number of experimental set-ups. To date, all of the rotationally resolved data have concerned unperturbed spectra. We presently report the results of a high resolution study of the three lowest vibrational states of quinoline C{sub 9}H{sub 7}N, an N-bearing naphthalene derivative. While the pure rotational ground state spectrum of quinoline is unperturbed, severe complications appear in the spectra of the ν{sub 45} and ν{sub 44} vibrational modes (located at about 168 cm{sup −1} and 178 cm{sup −1}, respectively). In order to study these effects in detail, we employed three different and complementary experimental techniques: Fourier-transform microwave spectroscopy, millimeter-wave spectroscopy, and Fourier-transform far-infrared spectroscopy with a synchrotron radiation source. Due to the high density of states in the IR spectra of molecules as large as PAHs, perturbations in the rotational spectra of excited states should be ubiquitous. Our study identifies for the first time this effect and provides some insights into an appropriate treatment of such perturbations.
Energy Technology Data Exchange (ETDEWEB)
Olynick, D.L.; Cord, B.; Schipotinin, A.; Ogletree, D.F.; Schuck, P.J.
2009-11-13
Hydrogen Silsesquioxane (HSQ) is used as a high-resolution resist with resolution down below 10nm half-pitch. This material or materials with related functionalities could have widespread impact in nanolithography and nanoscience applications if the exposure mechanism was understood and instabilities controlled. Here we have directly investigated the exposure mechanism using vibrational spectroscopy (both Raman and Fourier transform Infrared) and electron beam desorption spectrocscopy (EBDS). In the non-networked HSQ system, silicon atoms sit at the corners of a cubic structure. Each silicon is bonded to a hydrogen atom and bridges 3 oxygen atoms (formula: HSiO3/2). For the first time, we have shown, via changes in the Si-H2 peak at ~;;2200 cm -1 in the Raman spectra and the release of SiHx products in EBID, that electron-bam exposed materials crosslinks via a redistribution reaction. In addition, we observe the release of significantly more H2 than SiH2 during EBID, which is indicative of additional reaction mechanisms. Additionally, we compare the behavior of HSQ in response to both thermal and electron-beam induced reactions.
Shalit, Andrey; Perakis, Fivos; Hamm, Peter
2014-04-01
We apply two-dimensional infrared spectroscopy to differentiate between the two polyamorphous forms of glassy water, low-density (LDA) and high-density (HDA) amorphous ices, that were obtained by slow vapor deposition at 80 and 11 K, respectively. Both the vibrational lifetime and the bandwidth of the 1-2 transition of the isolated OD stretch vibration of HDO in H2O exhibit characteristic differences when comparing hexagonal (Ih), LDA, and HDA ices, which we attribute to the different local structures - in particular the presence of interstitial waters in HDA ice - that cause different delocalization lengths of intermolecular phonon degrees of freedom. Moreover, temperature dependent measurements show that the vibrational lifetime closely follows the structural transition between HDA and LDA phases.
Nilsson, Zach N; Mandella, Brian L; Sen, Kakali; Kekilli, Demet; Hough, Michael A; Moënne-Loccoz, Pierre; Strange, Richard W; Andrew, Colin R
2017-11-06
Nitrite coordination to heme cofactors is a key step in the anaerobic production of the signaling molecule nitric oxide (NO). An ambidentate ligand, nitrite has the potential to coordinate via the N- (nitro) or O- (nitrito) atoms in a manner that can direct its reactivity. Distinguishing nitro vs nitrito coordination, along with the influence of the surrounding protein, is therefore of particular interest. In this study, we probed Fe(III) heme-nitrite coordination in Alcaligenes xylosoxidans cytochrome c' (AXCP), an NO carrier that excludes anions in its native state but that readily binds nitrite (K d ∼ 0.5 mM) following a distal Leu16 → Gly mutation to remove distal steric constraints. Room-temperature resonance Raman spectra (407 nm excitation) identify ν(Fe-NO 2 ), δ(ONO), and ν s (NO 2 ) nitrite ligand vibrations in solution. Illumination with 351 nm UV light results in photoconversion to {FeNO} 6 and {FeNO} 7 states, enabling FTIR measurements to distinguish ν s (NO 2 ) and ν as (NO 2 ) vibrations from differential spectra. Density functional theory calculations highlight the connections between heme environment, nitrite coordination mode, and vibrational properties and confirm that nitrite binds to L16G AXCP exclusively through the N atom. Efforts to obtain the nitrite complex crystal structure were hampered by photochemistry in the X-ray beam. Although low dose crystal structures could be modeled with a mixed nitrite (nitro)/H 2 O distal population, their photosensitivity and partial occupancy underscores the value of the vibrational approach. Overall, this study sheds light on steric determinants of heme-nitrite binding and provides vibrational benchmarks for future studies of heme protein nitrite reactions.
Aliaga, Cesar
2011-04-28
Sum frequency generation vibrational spectroscopy and kinetic measurements obtained from gas chromatography were used to study the adsorption and hydrogenation of 2-methylfuran (MF) and 2,5-dimethylfuran (DMF) over cubic Pt nanoparticles of 7 nm average size, synthesized by colloidal methods and cleaned by ultraviolet light and ozone treatment. Reactions carried out at atmospheric pressure in the temperature range of 20-120 °C produced dihydro and tetrahydro species, as well as ring-opening products (alcohols) and ring-cracking products, showing high selectivity toward ring opening throughout the entire temperature range. The aromatic rings (MF and DMF) adsorbed parallel to the nanoparticle surface. Results yield insight into various surface reaction intermediates and the reason for the significantly lower selectivity for ring cracking in DMF hydrogenation compared to MF hydrogenation. © 2011 American Chemical Society.
TERAHERTZ SPECTROSCOPY AND GLOBAL ANALYSIS OF THE BENDING VIBRATIONS OF ACETYLENE 12C2D2
International Nuclear Information System (INIS)
Yu Shanshan; Drouin, Brian J.; Pearson, John C.; Pickett, Herbert M.; Lattanzi, Valerio; Walters, Adam
2009-01-01
Two hundred and fifty-one 12 C 2 D 2 transitions have been measured in the 0.2-1.6 THz region of its ν 5 -ν 4 difference band and 202 of them were observed for the first time. The accuracy of these measurements is estimated to be ranging from 50 kHz to 100 kHz. The 12 C 2 D 2 molecules were generated under room temperature by passing 120-150 mTorr D 2 O vapor through calcium carbide (CaC 2 ) powder. A multistate analysis was carried out for the bending vibrational modes ν 4 and ν 5 of 12 C 2 D 2 , which includes the lines observed in this work and prior microwave, far-infrared and infrared data on the pure bending levels. Significantly improved molecular parameters were obtained for 12 C 2 D 2 by adding the new measurements to the old data set, which had only 10 lines with microwave measurement precision. New frequency and intensity predictions have been made based on the obtained molecular parameters. The more precise measurements and new predictions reported here will support the analyses of astronomical observations by the future high-resolution spectroscopy telescopes such as Herschel, SOFIA, and ALMA, which will work in the terahertz spectral region.
Gaigeot, Marie-Pierre; Sulpizi, Marialore
2012-03-01
/computational communities. On the experimental side, surface specific techniques, such as non-linear optical spectroscopy (sum frequency generation spectroscopy (SFG) and second harmonic generation (SHG)), surface sensitive x-ray scattering, in situ scanning tunneling microscopy (STM) and infrared reflection absorption spectroscopy provide information on layers of nanometric thickness at the interface. On the other hand, it is quite clear that the experiments require theoretical modelling in order to dissect the experimental results and to rationalize the different factors that contribute to the interfacial properties. In this respect molecular dynamics simulations are a major tool. While many successes have already been achieved with molecular dynamics simulations based on empirical force fields, first principles molecular dynamics simulations are now emerging as the other major approach where structure and reactivity are treated in a consistent way. Recent progress within the past 3-5 years on efficient treatments of basis sets and long range interactions in density functional theory (DFT) indeed extend such simulation capabilities to hundreds and thousands of atoms, thus allowing realistic models for interfaces to be tackled, maintaining first principles quality. Most of these simulations bring information on the structural organization of the solvent in the interfacial region between the solid and the liquid, but very few investigate the supplementary challenge of extracting vibrational spectroscopic fingerprints of the interface and, in particular, the direct modeling of the vibrational sum frequency generation (VSFG) non-linear spectra. The present special section reports an interesting contribution from the group of R Y Shen who pioneered VSFG optical experiments. They show how VSFG measurements can be used to unravel the behavior of interfacial water on alumina Al2O3 as a function of pH. The groups of A Hodgson and C Busse respectively provide complementary experiments based on low
Vibrational energy on surfaces: Ultrafast flash-thermal conductance of molecular monolayers
Dlott, Dana
2008-03-01
Vibrational energy flow through molecules remains a perennial problem in chemical physics. Usually vibrational energy dynamics are viewed through the lens of time-dependent level populations. This is natural because lasers naturally pump and probe vibrational transitions, but it is also useful to think of vibrational energy as being conducted from one location in a molecule to another. We have developed a new technique where energy is driven into a specific part of molecules adsorbed on a metal surface, and ultrafast nonlinear coherent vibrational spectroscopy is used to watch the energy arrive at another part. This technique is the analog of a flash thermal conductance apparatus, except it probes energy flow with angstrom spatial and femtosecond temporal resolution. Specific examples to be presented include energy flow along alkane chains, and energy flow into substituted benzenes. Ref: Z. Wang, J. A. Carter, A. Lagutchev, Y. K. Koh, N.-H. Seong, D. G. Cahill, and D. D. Dlott, Ultrafast flash thermal conductance of molecular chains, Science 317, 787-790 (2007). This material is based upon work supported by the National Science Foundation under award DMR 0504038 and the Air Force Office of Scientific Research under award FA9550-06-1-0235.
How exciton-vibrational coherences control charge separation in the photosystem II reaction center
Novoderezhkin, V.I.; Romero Mesa, E.; van Grondelle, R.
2015-01-01
In photosynthesis absorbed sun light produces collective excitations (excitons) that form a coherent superposition of electronic and vibrational states of the individual pigments. Two-dimensional (2D) electronic spectroscopy allows a visualization of how these coherences are involved in the primary
Benedek, Giorgio; Vattuone, Luca
2008-06-01
The 12th International Conference on Vibrations at Surfaces (VAS 12) took place from 20 26 July 2007 as an event of the International School of Solid State Physics at the Ettore Majorana Foundation and Centre for Scientific Culture, Erice (Italy). The format and special environment of the conference have contributed to its transition from a traditional, medium-size conference into a more effective workshop, with a series of lectures reporting the most recent developments in the field, two poster sessions presenting recent results and even works in progress being discussed. The papers collected in this issue cover the highlights of the conference very thoroughly. Quite a few novel aspects concerning vibrations at surfaces are represented here, for example: new aspects in surface phonon spectroscopy, such as the very recent progress in inelastic x-ray scattering, the first observation of the boson peak in disordered surfaces, progress in the theory of atom scattering inelastic resonances, the action spectroscopy, the study of polycrystalline surfaces with electron energy-loss spectroscopy etc; parallel developments in experimental vibrational studies of adsorbed phases, either inorganic or organic, with those in ab initio theoretical simulations; the theory of enhanced electron--phonon interaction in low dimensions (2D and 1D); the extension from the traditional realm of surface vibrations and spectroscopy to other aspects of surface dynamics, like friction and various nonlinear effects, and to relevant dynamical phenomena occurring at interfaces. Other novelties presented at the conference, but already published in recent issues of the Journal of Physics: Condensed Matter, are also worth mentioning: the spin-echo spectroscopy with 3He allowing for slow-dynamics spectroscopy at very high, unprecedented resolutions (2007 J. Phys.: Cond. Matter 19 300301 and 305010; the first demonstration of dissociative surface trapping of molecules (2007 J. Phys.: Cond. Matter 19
Energy Technology Data Exchange (ETDEWEB)
Hajlaoui, Sondes, E-mail: hajlaouisondes@yahoo.fr [Unité de recherche de la matière condensée, Faculté des Sciences de Sfax, Université de Sfax, BP 1171, 3000, Sfax (Tunisia); Chaabane, Iskandar [Unité de recherche de la matière condensée, Faculté des Sciences de Sfax, Université de Sfax, BP 1171, 3000, Sfax (Tunisia); Lhoste, Jérôme; Bulou, Alain [LUNAM Université, Université du Maine, CNRS UMR 6283, Institut des Molécules et Matériaux du Mans (IMMM), Avenue Olivier Messiaen, 72085, Le Mans, Cedex 9 (France); Guidara, Kamel [Unité de recherche de la matière condensée, Faculté des Sciences de Sfax, Université de Sfax, BP 1171, 3000, Sfax (Tunisia)
2016-09-15
In this work a novel compound tertrapropylammonium aquapentachlorostannate dihydrate was synthesized and characterized by; single crystal X-ray diffraction, vibrational spectroscopy, differential scanning calorimetric and dielectric measurement. The crystal structure refinement at room temperature reveled that this later belongs to the monoclinic compound with P121/c1 space group with the following unit cell parameters a = 8.2699(3) Å, b = 12.4665(4) Å, c = 22.3341(7) Å and β = 92.94(0)°. The crystal arrangement can be described by stacked organic-inorganic layers in the c direction with two independent water molecules placed between each two layers. The detailed interpretations of the vibrational properties of the studied compound were performed using density functional theory (DFT) with the B3LYP/LanL2DZ basis set, and has enabled us to make the detailed assignments by comparative study of the experimental and calculated Raman and IR spectra. The differential scanning calorimetry (DSC) measurement disclosed two anomalies in the temperature range 356–376 (T{sub 1}) K and at 393 K (T{sub 2}) characterized by the dehydration of the sample and probably a reconstruction of a new structure after T{sub 2} transition. The temperature dependences of dielectric permittivity show a relaxation process around T{sub 2} anomaly indicating the occurrence of the disorder at high temperature. The dependence of the exponent m(T) on temperature, extracted from the straight lines of log(ε″) with log (ω), suggests that the correlated barrier hopping is the appropriate model for the conduction mechanism. - Highlights: • The single-crystal X-ray diffraction has been performed. • The assignments of the vibration modes based on DFT were reported and discussed. • Differential scanning calorimetric reveals the presence of two endothermic peaks. • The electric permittivity was studied using the impedance measurements. • The CBH is the appropriate model for the conduction
Ziemkiewicz, Michael P; Pluetzer, Christian; Nesbitt, David J; Scribano, Yohann; Faure, Alexandre; van der Avoird, Ad
2012-08-28
First results are reported on overtone (v(OH) = 2 ← 0) spectroscopy of weakly bound H(2)-H(2)O complexes in a slit supersonic jet, based on a novel combination of (i) vibrationally mediated predissociation of H(2)-H(2)O, followed by (ii) UV photodissociation of the resulting H(2)O, and (iii) UV laser induced fluorescence on the nascent OH radical. In addition, intermolecular dynamical calculations are performed in full 5D on the recent ab initio intermolecular potential of Valiron et al. [J. Chem. Phys. 129, 134306 (2008)] in order to further elucidate the identity of the infrared transitions detected. Excellent agreement is achieved between experimental and theoretical spectral predictions for the most strongly bound van der Waals complex consisting of ortho (I = 1) H(2) and ortho (I = 1) H(2)O (oH(2)-oH(2)O). Specifically, two distinct bands are seen in the oH(2)-oH(2)O spectrum, corresponding to internal rotor states in the upper vibrational manifold of Σ and Π rotational character. However, none of the three other possible nuclear spin modifications (pH(2)-oH(2)O, pH(2)-pH(2)O, or oH(2)-pH(2)O) are observed above current signal to noise level, which for the pH(2) complexes is argued to arise from displacement by oH(2) in the expansion mixture to preferentially form the more strongly bound species. Direct measurement of oH(2)-oH(2)O vibrational predissociation in the time domain reveals lifetimes of 15(2) ns and <5(2) ns for the Σ and Π states, respectively. Theoretical calculations permit the results to be interpreted in terms of near resonant energy levels and intermolecular alignment of the H(2) and H(2)O wavefunctions, providing insight into predissociation dynamical pathways from these metastable levels.
Laser spectroscopy and dynamics of transient species
Energy Technology Data Exchange (ETDEWEB)
Clouthier, D.J. [Univ. of Kentucky, Lexington (United States)
1993-12-01
The goal of this program is to study the vibrational and electronic spectra and excited state dynamics of a number of transient sulfur and oxygen species. A variety of supersonic jet techniques, as well as high resolution FT-IR and intracavity dye laser spectroscopy, have been applied to these studies.
Center Line Slope Analysis in Two-Dimensional Electronic Spectroscopy
?anda, Franti?ek; Perl?k, V?clav; Lincoln, Craig N.; Hauer, J?rgen
2015-01-01
Center line slope (CLS) analysis in 2D infrared spectroscopy has been extensively used to extract frequency?frequency correlation functions of vibrational transitions. We apply this concept to 2D electronic spectroscopy, where CLS is a measure of electronic gap fluctuations. The two domains, infrared and electronic, possess differences: In the infrared, the frequency fluctuations are classical, often slow and Gaussian. In contrast, electronic spectra are subject to fast spectral diffusion and...
Frost, Ray L; Xi, Yunfei; Beganovic, Martina; Belotti, Fernanda Maria; Scholz, Ricardo
2013-04-15
This research was done on lazulite samples from the Gentil mine, a lithium bearing pegmatite located in the municipality of Mendes Pimentel, Minas Gerais, Brazil. Chemical analysis was carried out by electron microprobe analysis and indicated a magnesium rich phase with partial substitution of iron. Traces of Ca and Mn, (which partially replaced Mg) were found. The calculated chemical formula of the studied sample is: (Mg0.88, Fe0.11)Al1.87(PO4)2.08(OH)2.02. The Raman spectrum of lazulite is dominated by an intense sharp band at 1060 cm(-1) assigned to PO stretching vibrations of of tetrahedral [PO4] clusters presents into the HPO4(2-) units. Two Raman bands at 1102 and 1137 cm(-1) are attributed to both the HOP and PO antisymmetric stretching vibrations. The two infrared bands at 997 and 1007 cm(-1) are attributed to the ν1PO4(3-) symmetric stretching modes. The intense bands at 1035, 1054, 1081, 1118 and 1154 cm(-1) are assigned to the ν3PO4(3-) antisymmetric stretching modes from both the HOP and tetrahedral [PO4] clusters. A set of Raman bands at 605, 613, 633 and 648 cm(-1) are assigned to the ν4 out of plane bending modes of the PO4, HPO4 and H2PO4 units. Raman bands observed at 414, 425, 460, and 479 cm(-1) are attributed to the ν2 tetrahedral PO4 clusters, HPO4 and H2PO4 bending modes. The intense Raman band at 3402 and the infrared band at 3403 cm(-1) are assigned to the stretching vibration of the OH units. A combination of Raman and infrared spectroscopy enabled aspects of the molecular structure of the mineral lazulite to be understood. Copyright © 2013 Elsevier B.V. All rights reserved.
Acoustic resonance spectroscopy (ARS): ARS300 operations manual, software version 2.01
Energy Technology Data Exchange (ETDEWEB)
NONE
1996-07-25
Acoustic Resonance Spectroscopy (ARS) is a nondestructive evaluation technology developed at the Los Alamos National Laboratory. The ARS technique is a fast, safe, and nonintrusive technique that is particularly useful when a large number of objects need to be tested. Any physical object, whether solid, hollow, or fluid filled, has many modes of vibration. These modes of vibration, commonly referred to as the natural resonant modes or resonant frequencies, are determined by the object`s shape, size, and physical properties, such as elastic moduli, speed of sound, and density. If the object is mechanically excited at frequencies corresponding to its characteristic natural vibrational modes, a resonance effect can be observed when small excitation energies produce large amplitude vibrations in the object. At other excitation frequencies, i.e., vibrational response of the object is minimal.
Breen, Nicholas F.; Weidner, Tobias; Li, Kun; Castner, David G.; Drobny, Gary P.
2011-01-01
The artificial amphiphilic peptide LKα14 adopts a helical structure at interfaces, with opposite orientation of its leucine (L, hydrophobic) and lysine (K, hydrophilic) side chains. When adsorbed onto surfaces, different residue side chains necessarily have different proximities to the surface, depending on both their position in the helix and the composition of the surface itself. Deuterating the individual leucine residues (isopropyl-d7) permits the use of solid-state deuterium NMR as a site-specific probe of side chain dynamics. In conjunction with SFG as a probe of the peptide binding face, we demonstrate that the mobility of specific leucine side chains at the interface is quantifiable in terms of their surface proximity. PMID:19764755
International Nuclear Information System (INIS)
Janda, K.C.
1986-01-01
The goal of my project is to understand how intramolecular vibrational relaxation effects the high resolution spectroscopy of vibrationally excited molecules. Their first results indicated that for molecular complexes of ethylene, vibrationally excited in the nu 7 out-of-plane bending mode, IVR is so fast that high resolution spectroscopy is vitiated by lifetime broadening. Only for rare gas-ethylene complexes was rotational resolution achieved. These results led them to postulate that IVR in ethylene complexes occurs by a V-T,R mechanism where the rate is limited by angular momentum constraints
Energy Technology Data Exchange (ETDEWEB)
Andrejeva, Anna; Tuttle, William D.; Harris, Joe P.; Wright, Timothy G., E-mail: Tim.Wright@nottingham.ac.uk [School of Chemistry, University of Nottingham, University Park, Nottingham NG7 2RD (United Kingdom)
2015-12-28
We report vibrationally resolved spectra of the S{sub 1}←S{sub 0} transition of bromobenzene using resonance-enhanced multiphoton ionization spectroscopy. We study bromobenzene-h{sub 5} as well as its perdeuterated isotopologue, bromobenzene-d{sub 5}. The form of the vibrational modes between the isotopologues and also between the S{sub 0} and S{sub 1} electronic states is discussed for each species, allowing assignment of the bands to be achieved and the activity between states and isotopologues to be established. Vibrational bands are assigned utilizing quantum chemical calculations, previous experimental results, and isotopic shifts. Previous work and assignments of the S{sub 1} spectra are discussed. Additionally, the vibrations in the ground state cation, D{sub 0}{sup +}, are considered, since these have also been used by previous workers in assigning the excited neutral state spectra. We also examine the vibrations of iodobenzene in the S{sub 0} and D{sub 0}{sup +} states and comment on the previous assignments of these. In summary, we have been able to assign the corresponding vibrations across the whole monohalobenzene series of molecules, in the S{sub 0}, S{sub 1}, and D{sub 0}{sup +} states, gaining insight into vibrational activity and vibrational couplings.
Acute effects of a vibration-like stimulus during knee extension exercise.
Mileva, Katya N; Naleem, Asif A; Biswas, Santonu K; Marwood, Simon; Bowtell, Joanna L
2006-07-01
This study was conducted to test whether a low-frequency vibration-like stimulus (rapid variable resistance) applied during a single session of knee extension exercise would alter muscle performance. Torque, knee joint angle, EMG activity of rectus femoris (RF) and vastus lateralis (VL) muscles, and VL muscle oxygenation status (near-infrared spectroscopy) were recorded during metronome-guided knee extension exercise. Nine healthy adults completed four trials exercising at contraction intensities of 35% (L) or 70% (H) of one-repetition maximum (1RM) in control (no vibration, Vb-) or vibrated condition (superimposed 10-Hz vibration-like stimulus, Vb+). Maximum voluntary contraction and 1RM were tested pre- and postexercise. During 1RM tests, muscle dynamic strength (P=0.02) and power (P=0.05) were significantly higher during vibrated rather than nonvibrated trials, and strength was significantly higher post- than preexercise (P=0.002), except during LVb- trial. Median spectral frequency of VL and RF EMG activity was significantly higher during postexercise than preexercise 1RM test in the vibration trials but unchanged in the control trials (Pvibration superimposition tended to speed muscle deoxygenation rate (P=0.065, 36% effect size) particularly during L trials. Vibration superimposition during knee extension exercise at low contraction intensity enhanced muscle performance. This effect appears to result from adaptation of neural factors such as motor unit excitability (recruitment and firing frequency, conduction velocity of excitation) in response to sensory receptor stimulation. Muscle vibration may increase the training effects derived from light-to-moderate exercise.
The effects of vibration-reducing gloves on finger vibration
Welcome, Daniel E.; Dong, Ren G.; Xu, Xueyan S.; Warren, Christopher; McDowell, Thomas W.
2015-01-01
Vibration-reducing (VR) gloves have been used to reduce the hand-transmitted vibration exposures from machines and powered hand tools but their effectiveness remains unclear, especially for finger protection. The objectives of this study are to determine whether VR gloves can attenuate the vibration transmitted to the fingers and to enhance the understanding of the mechanisms of how these gloves work. Seven adult male subjects participated in the experiment. The fixed factors evaluated include hand force (four levels), glove condition (gel-filled, air bladder, no gloves), and location of the finger vibration measurement. A 3-D laser vibrometer was used to measure the vibrations on the fingers with and without wearing a glove on a 3-D hand-arm vibration test system. This study finds that the effect of VR gloves on the finger vibration depends on not only the gloves but also their influence on the distribution of the finger contact stiffness and the grip effort. As a result, the gloves increase the vibration in the fingertip area but marginally reduce the vibration in the proximal area at some frequencies below 100 Hz. On average, the gloves reduce the vibration of the entire fingers by less than 3% at frequencies below 80 Hz but increase at frequencies from 80 to 400 Hz. At higher frequencies, the gel-filled glove is more effective at reducing the finger vibration than the air bladder-filled glove. The implications of these findings are discussed. Relevance to industry Prolonged, intensive exposure to hand-transmitted vibration can cause hand-arm vibration syndrome. Vibration-reducing gloves have been used as an alternative approach to reduce the vibration exposure. However, their effectiveness for reducing finger-transmitted vibrations remains unclear. This study enhanced the understanding of the glove effects on finger vibration and provided useful information on the effectiveness of typical VR gloves at reducing the vibration transmitted to the fingers. The new
Difference frequency generation spectroscopy as a vibrational optical activity measurement tool.
Cheon, Sangheon; Cho, Minhaeng
2009-03-19
Vibrational optical activity (VOA) of chiral molecules in condensed phases can be studied by using vibrational circular dichroism and Raman optical activity measurement techniques. Recently, IR-vis sum frequency generation has shown to be an alternative VOA measurement method. Such a three-wave-mixing method employing a polarization modulation technique can be a potentially useful VOA measurement tool. Here, a theoretical description of difference frequency generation (DFG) employing circularly polarized visible radiations is presented. Frequency scanning to obtain a VOA-DFG spectrum is achieved by controlling the difference between the two electronically nonresonant incident radiation frequencies. If the two incident beams are linearly polarized and their polarization directions are perpendicular to each other, one can selectively measure the all-electric-dipole-allowed chiral component of the DFG susceptibility. In addition, by using circularly polarized beams and taking the DFG difference intensity signal, which is defined as the difference between left and right circularly polarized DFG signals, additional chiral susceptibility components originating from the electric quadrupole transition can be measured. The DFG as a novel VOA measurement technique for solution samples containing chiral molecules will therefore be a useful coherent spectroscopic tool for determining absolute configuration of chiral molecules in condensed phases.
National Aeronautics and Space Administration — Structural damage to ball grid array interconnects incurred during vibration testing has been monitored in the prefailure space using resistance spectroscopy-based...
Molecular structure and vibrational spectroscopy of isoproturon
Vrielynck, L.; Dupuy, N.; Kister, J.; Nowogrocki, G.
2006-05-01
The crystal structure of isoproturon [ N-(4-isopropylphenyl)- N', N'-dimethylurea] has been determined: the compound crystallizes in the space group Pbca with unit cell parameters a=10.186(2) Å, b=11.030(2) Å, c=20.981(4) Å. The structure was solved and refined down to R1=0.0508 and ωR2=0.12470 for 3056 reflections. The crystalline molecular network of this pesticide is stabilized, as for many molecules of the same family, by π-π interactions but especially by a medium-strong N-H⋯C dbnd6 O intermolecular hydrogen bond (2.14 Å). The X-ray parameters were then compared with the results of DFT quantum chemical calculation computed with the GAUSSIAN 94 package. A tentative assignment of the ATR-FT-IR and Raman spectra was proposed supported by vibrational mode calculation and spectroscopic data on benzenic and urea derivatives available in the literature. The presence of a tight band around 3300 cm -1, which can be assigned to the NH bond stretching mode as well as the low frequency position of the amide I band at 1640 cm -1, sensitive to solvent polarity, confirms the existence of a quite strong intermolecular hydrogen bond between neighboring molecules in the crystal of isoproturon.
Ji, Cuiying; Zhang, Xuewei; Yan, Xiaogang; Mostafizar Rahman, M; Prates, Luciana L; Yu, Peiqiang
2017-08-05
The objectives of this study were to: 1) investigate forage carbohydrate molecular structure profiles; 2) bio-functions in terms of CHO rumen degradation characteristics and hourly effective degradation ratio of N to OM (HED N/OM ), and 3) quantify interactive association between molecular structures, bio-functions and nutrient availability. The vibrational molecular spectroscopy was applied to investigate the structure feature on a molecular basis. Two sourced-origin alfalfa forages were used as modeled forages. The results showed that the carbohydrate molecular structure profiles were highly linked to the bio-functions in terms of rumen degradation characteristics and hourly effective degradation ratio. The molecular spectroscopic technique can be used to detect forage carbohydrate structure features on a molecular basis and can be used to study interactive association between forage molecular structure and bio-functions. Copyright © 2017 Elsevier B.V. All rights reserved.
Electronic resonances in broadband stimulated Raman spectroscopy
Batignani, G.; Pontecorvo, E.; Giovannetti, G.; Ferrante, C.; Fumero, G.; Scopigno, T.
2016-01-01
Spontaneous Raman spectroscopy is a formidable tool to probe molecular vibrations. Under electronic resonance conditions, the cross section can be selectively enhanced enabling structural sensitivity to specific chromophores and reaction centers. The addition of an ultrashort, broadband femtosecond pulse to the excitation field allows for coherent stimulation of diverse molecular vibrations. Within such a scheme, vibrational spectra are engraved onto a highly directional field, and can be heterodyne detected overwhelming fluorescence and other incoherent signals. At variance with spontaneous resonance Raman, however, interpreting the spectral information is not straightforward, due to the manifold of field interactions concurring to the third order nonlinear response. Taking as an example vibrational spectra of heme proteins excited in the Soret band, we introduce a general approach to extract the stimulated Raman excitation profiles from complex spectral lineshapes. Specifically, by a quantum treatment of the matter through density matrix description of the third order nonlinear polarization, we identify the contributions which generate the Raman bands, by taking into account for the cross section of each process.
Structure, vibrations, and hydrogen bond parameters of dibenzotetraaza[14]annulene
Gawinkowski, S.; Eilmes, J.; Waluk, J.
2010-07-01
Geometry and vibrational structure of dibenzo[ b, i][1,4,8,11]tetraaza[14]annulene (TAA) have been studied using infrared and Raman spectroscopy combined with quantum-chemical calculations. The assignments were proposed for 106 out of the total of 108 TAA vibrations, based on comparison of the theoretical predictions with the experimental data obtained for the parent molecule and its isotopomer in which the NH protons were replaced by deuterons. Reassignments were suggesteded for the NH stretching and out-of-plane vibrations. The values of the parameters of the intramolecular NH⋯N hydrogen bonds were analysed in comparison with the corresponding data for porphyrin and porphycene, molecules with the same structural motif, a cavity composed of four nitrogen atoms and two inner protons. Both experiment and calculations suggest that the molecule of TAA is not planar and is present in a trans tautomeric form, with the protons located on the opposite nitrogen atoms.
DEFF Research Database (Denmark)
Castillo, John J.; Rindzevicius, Tomas; Rozo, Ciro E.
2015-01-01
on the nanopillars within the high electromagnetic field areas. The adsorption behaviour of folic acid and the band assignment of the main vibrations together with the optimized geometry of folic acid and folic acid in the presence of a cluster of 10 gold atoms were assessed using the density functional theory (B3......LYP(6-31G(d))) and the scalar relativistic effective core potential with a double-zeta basis set (LANL2DZ). The vibrations obtained from the solid-state folic acid and the folic acid on a gold cluster were in accordance with those observed experimentally. The analysis of the main vibrations indicated...
Infrared-emission spectroscopy of CO on Ni
International Nuclear Information System (INIS)
Chiang, S.; Tobin, R.G.; Richards, P.L.
1982-09-01
We report the first observation of thermally emitted infrared radiation from vibrational modes of molecules adsorbed on clean, single-crystal metal surfaces. The observation of emission from CO adsorbed on Ni demonstrates the surface sensitivity of a novel apparatus for infrared vibrational spectroscopy, with a resolution of 1 to 15 cm -1 over the frequency range from 330 to 3000 cm -1 . A liquid-helium-cooled grating spectrometer measures the thermal radiation from a room-temperature, single-crystal sample, which is mounted in an ultrahigh-vacuum system. Measurements of frequencies and linewidths of CO on a single-crystal Ni sample, as a function of coverage, are discussed
Czech Academy of Sciences Publication Activity Database
Hopmann, K. H.; Šebestík, Jaroslav; Novotná, J.; Stensen, W.; Urbanová, M.; Svenson, J.; Svendsen, J. S.; Bouř, Petr; Ruud, K.
2012-01-01
Roč. 77, č. 2 (2012), s. 858-869 ISSN 0022-3263 R&D Projects: GA ČR GAP208/11/0105; GA MŠk(CZ) LH11033 Institutional research plan: CEZ:AV0Z40550506 Keywords : vibrational circular dichroism * Raman optical activity * absolute configuration * bioprospecting Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.564, year: 2012
Highly sensitive high resolution Raman spectroscopy using resonant ionization methods
International Nuclear Information System (INIS)
Owyoung, A.; Esherick, P.
1984-05-01
In recent years, the introduction of stimulated Raman methods has offered orders of magnitude improvement in spectral resolving power for gas phase Raman studies. Nevertheless, the inherent weakness of the Raman process suggests the need for significantly more sensitive techniques in Raman spectroscopy. In this we describe a new approach to this problem. Our new technique, which we call ionization-detected stimulated Raman spectroscopy (IDSRS), combines high-resolution SRS with highly-sensitive resonant laser ionization to achieve an increase in sensitivity of over three orders of magnitude. The excitation/detection process involves three sequential steps: (1) population of a vibrationally excited state via stimulated Raman pumping; (2) selective ionization of the vibrationally excited molecule with a tunable uv source; and (3) collection of the ionized species at biased electrodes where they are detected as current in an external circuit
Hirano, Tsuneo; Nagashima, Umpei; Jensen, Per
2018-04-01
For NCS in the X ˜ 2 Π electronic ground state, three-dimensional potential energy surfaces (3D PESs) have been calculated ab initio at the core-valence, full-valence MR-SDCI+Q/[aug-cc-pCVQZ (N, C, S)] level of theory. The ab initio 3D PESs are employed in second-order-perturbation-theory and DVR3D calculations to obtain various molecular constants and ro-vibrationally averaged structures. The 3D PESs show that the X ˜ 2 Π NCS has its potential minimum at a linear configuration, and hence it is a "linear molecule." The equilibrium structure has re (N-C) = 1.1778 Å, re (C-S) = 1.6335 Å, and ∠e (N-C-S) = 180°. The ro-vibrationally averaged structure, determined as expectation values over DVR3D wavefunctions, has 〈 r (N-C)〉0 = 1.1836 Å, 〈 r (C-S)〉0 = 1.6356 Å, and 〈 ∠ (N-C-S)〉0 = 172.5°. Using these expectation values as the initial guess, a bent r0 structure having an 〈 ∠ (N-C-S)〉0 of 172.2° is deduced from the experimentally reported B0 values for NC32S and NC34S. Our previous prediction that a linear molecule, in any ro-vibrational state including the ro-vibrational ground state, is to be "observed" as being bent on ro-vibrational average, has been confirmed here theoretically through the expectation value for the bond-angle deviation from linearity, 〈 ρ bar 〉 , and experimentally through the interpretation of the experimentally derived rotational-constant values.
Matsumura, Hirotoshi; Moënne-Loccoz, Pierre
2014-01-01
The combination of rapid freeze quenching (RFQ) with resonance Raman (RR) spectroscopy represents a unique tool with which to investigate the nature of short-lived intermediates formed during the enzymatic reactions of metalloproteins. Commercially available equipment allows trapping of intermediates within a millisecond to second time scale for low-temperature RR analysis resulting in the direct detection of metal-ligand vibrations and porphyrin skeletal vibrations in hemoproteins. This chapter briefly discusses RFQ-RR studies carried out previously in our laboratory and presents, as a practical example, protocols for the preparation of RFQ samples of the reaction of metmyoglobin with nitric oxide (NO) under anaerobic conditions. Also described are important controls and practical procedures for the analysis of these samples by low-temperature RR spectroscopy.
Changes in the vibrational properties of graphene and other related nanostructures under strain
International Nuclear Information System (INIS)
Codorniu Pujals, D.
2015-01-01
It is well known that the presence of strain in solids modifies their vibrational properties due to the variation of the atomic position and the changes of the interatomic distances. Monolayer graphene is especially sensible to the effects of strain, for example, to that produced by the curvature of some region of the graphene plane. These changes in the vibrational properties of graphene modifies in different way its Raman spectrum. In the case of other graphene-related materials as fullerenes, nano-onions and nano tubes, the curvature is always present, consequently, there is a modification of the vibrational properties in relation with those in graphene, due to the strain provoked by curvature. In this paper, the overall picture of the effect of strain on the vibrational properties of graphene and other carbon nanostructures is presented from a theoretical point of view and the main considerations are correlated with experimental results from Raman spectroscopy (Author)
How exciton-vibrational coherences control charge separation in the photosystem II reaction center.
Novoderezhkin, Vladimir I; Romero, Elisabet; van Grondelle, Rienk
2015-12-14
In photosynthesis absorbed sun light produces collective excitations (excitons) that form a coherent superposition of electronic and vibrational states of the individual pigments. Two-dimensional (2D) electronic spectroscopy allows a visualization of how these coherences are involved in the primary processes of energy and charge transfer. Based on quantitative modeling we identify the exciton-vibrational coherences observed in 2D photon echo of the photosystem II reaction center (PSII-RC). We find that the vibrations resonant with the exciton splittings can modify the delocalization of the exciton states and produce additional states, thus promoting directed energy transfer and allowing a switch between the two charge separation pathways. We conclude that the coincidence of the frequencies of the most intense vibrations with the splittings within the manifold of exciton and charge-transfer states in the PSII-RC is not occurring by chance, but reflects a fundamental principle of how energy conversion in photosynthesis was optimized.
Novelli, Fabio; Giovannetti, Gianluca; Avella, Adolfo; Cilento, Federico; Patthey, Luc; Radovic, Milan; Capone, Massimo; Parmigiani, Fulvio; Fausti, Daniele
2017-05-01
The interaction between phonons and high-energy excitations of electronic origin in cuprates and their role in the superconducting mechanisms is still controversial. Here we use coherent vibrational time-domain spectroscopy together with density functional and dynamical mean-field theory calculations to establish a direct link between the c -axis phonon modes and the in-plane electronic charge excitations in optimally doped YB a2C u3O7 . The nonequilibrium Raman tensor is measured by means of the broadband "coherent-phonon" response in pump-probe experiments and is qualitatively described by our model using density functional theory in the frozen-phonon approximation plus single-band dynamical mean-field theory to account for the electronic correlations. The major outcome of our experimental and theoretical study is to establish the link between out-of-plane copper ion displacements and the in-plane electronic correlations, and to estimate at a few unit cells the correlation length of the associated phonon mode. The approach introduced here could help in revealing the complex interplay between fluctuations of different nature and spatial correlation in several strongly correlated materials.
Gorlova, Olga; Colvin, Sean M.; Brathwaite, Antonio; Menges, Fabian S.; Craig, Stephanie M.; Miller, Scott J.; Johnson, Mark A.
2017-08-01
Recent advances in the coupling of vibrational spectroscopy with mass spectrometry create new opportunities for the structural characterization of metabolites with great sensitivity. Previous studies have demonstrated this scheme on 300 K ions using very high power free electron lasers in the fingerprint region of the infrared. Here we extend the scope of this approach to a single investigator scale as well as extend the spectral range to include the OH stretching fundamentals. This is accomplished by detecting the IR absorptions in a linear action regime by photodissociation of weakly bound N2 molecules, which are attached to the target ions in a cryogenically cooled, rf ion trap. We consider the specific case of the widely used drug Valsartan and two isomeric forms of its metabolite. Advantages and challenges of the cold ion approach are discussed, including disentangling the role of conformers and the strategic choices involved in the selection of the charging mechanism that optimize spectral differentiation among candidate structural isomers. In this case, the Na+ complexes are observed to yield sharp resonances in the high frequency NH and OH stretching regions, which can be used to easily differentiate between two isomers of the metabolite. [Figure not available: see fulltext.
Raman spectroscopy in high temperature chemistry
International Nuclear Information System (INIS)
Drake, M.C.; Rosenblatt, G.M.
1979-01-01
Raman spectroscopy (largely because of advances in laser and detector technology) is assuming a rapidly expanding role in many areas of research. This paper reviews the contribution of Raman spectroscopy in high temperature chemistry including molecular spectroscopy on static systems and gas diagnostic measurements on reactive systems. An important aspect of high temperature chemistry has been the identification and study of the new, and often unusual, gaseous molecules which form at high temperatures. Particularly important is the investigation of vibrational-rotational energy levels and electronic states which determine thermodynamic properties and describe chemical bonding. Some advantages and disadvantages of high temperature Raman spectrosocpy for molecular studies on static systems are compared: (1) Raman vs infrared; (2) gas-phase vs condensed in matries; and (3) atmospheric pressure Raman vs low pressure techniques, including mass spectroscopy, matrix isolation, and molecular beams. Raman studies on molecular properties of gases, melts, and surfaces are presented with emphasis on work not covered in previous reviews of high temperature and matrix isolation Raman spectroscopy
Raman spectroscopy in high temperature chemistry
International Nuclear Information System (INIS)
Drake, M.C.; Rosenblatt, G.M.
1979-01-01
Raman spectroscopy (largely because of advances in laser and detector technology) is assuming a rapidly expanding role in many areas of research. This paper reviews the contribution of Raman spectroscopy in high temperature chemistry including molecular spectroscopy on static systems and gas diagnostic measurements on reactive systems. An important aspect of high temperature chemistry has been the identification and study of the new, and often unusual, gaseous molecules which form at high temperatures. Particularly important is the investigation of vibrational-rotational energy levels and electronic states which determine thermodynamic properties and describe chemical bonding. Some advantages and disadvantages of high temperature Raman spectrosocpy for molecular studies on static systems are compared: (1) Raman vs infrared; (2) gas-phase vs condensed in matrices; and (3) atmospheric pressure Raman vs low pressure techniques, including mass spectroscopy, matrix isolation, and molecular beams. Raman studies on molecular properties of gases, melts, and surfaces are presented with emphasis on work not covered in previous reviews of high temperature and matrix isolation Raman spectroscopy
International Nuclear Information System (INIS)
Yin Jun; Yu Ling-Yao; Liu Xing; Wan Hui; Lin Zi-Yang; Niu Han-Ben
2011-01-01
In broadband coherent anti-Stokes Raman scattering (CARS) spectroscopy with supercontinuum (SC), the simultaneously detectable spectral coverage is limited by the spectral continuity and the simultaneity of various spectral components of SC in an enough bandwidth. By numerical simulations, the optimal experimental conditions for improving the SC are obtained. The broadband time-resolved CARS spectrography based on the SC with required temporal and spectral distributions is realised. The global molecular vibrational spectrum with well suppressed nonresonant background noise can be obtained in a single measurement. At the same time, the measurements of dephasing times of various molecular vibrational modes can be conveniently achieved from intensities of a sequence of time-resolved CARS signals. It will be more helpful to provide a complete picture of molecular vibrations, and to exhibit a potential to understand not only both the solvent dynamics and the solute-solvent interactions, but also the mechanisms of chemical reactions in the fields of biology, chemistry and material science. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)
Schmitz, Andrew J; Hogle, David G; Gai, Xin Sonia; Fenlon, Edward E; Brewer, Scott H; Tucker, Matthew J
2016-09-08
The vibrations in the azide, N3, asymmetric stretching region and nitrile, CN, symmetric stretching region of 2'-azido-5-cyano-2'-deoxyuridine (N3CNdU) are examined by two-dimensional infrared (2D IR) spectroscopy. At earlier waiting times, the 2D IR spectrum shows the presence of both vibrational transitions along the diagonal and off-diagonal cross peaks indicating vibrational coupling. The coupling strength is determined from the off-diagonal anharmonicity to be 66 cm(-1) for the intramolecular distance of ∼7.9 Å, based on a structural map generated for this model system. In addition, the frequency-frequency correlation decay is detected, monitoring the solvent dynamics around each individual probe position. Overall, these vibrational reporters can be utilized in tandem to simultaneously track global structural information and fast structural fluctuations.
Relationship of the vibrational frequency of the uranyl ion with the uranium electronegativity
International Nuclear Information System (INIS)
Rodriguez S, A.; Martinez Q, E.
1990-07-01
It has been demonstrated that the vibrational asymmetric frequency of the uranyl ion, it experiences a consistent spectrochemical displacement with the variations of electronegativity of the uranium in their complexes. The values of the electronegativity of the uranium they were dear by means of calculations that it involves measures of those lengths of the connection uranium-oxygen, obtained by vibrational spectroscopy, effective nuclear charges and the Allred and Rochow equation. The results show the evidence of a natural order that relates to the vibrational frequency with the electronegativity of the uranium atom; settling down that if the electronegativity is graph against it bond length to the oxygen or to it frequency value, a simple relationship is obtained as a form to obtain clear responses in absence of complementary information. (Author)
Mohammed, Omar F.
2014-05-01
We combine ultrafast electronic and vibrational spectroscopy and computational modeling to investigate the photoinduced excited-state intramolecular hydrogen-transfer dynamics in 1,8-dihydroxy-9,10-anthraquinone (DHAQ) in tetrachloroethene, acetonitrile, dimethyl sulfoxide, and methanol. We analyze the electronic excited states of DHAQ with various possible hydrogen-bonding schemes and provide a general description of the electronic excited-state dynamics based on a systematic analysis of femtosecond UV/vis and UV/IR pump-probe spectroscopic data. Upon photoabsorption at 400 nm, the S 2 electronic excited state is initially populated, followed by a rapid equilibration within 150 fs through population transfer to the S 1 state where DHAQ exhibits ESIHT dynamics. In this equilibration process, the excited-state population is distributed between the 9,10-quinone (S2) and 1,10-quinone (S1) states while undergoing vibrational energy redistribution, vibrational cooling, and solvation dynamics on the 0.1-50 ps time scale. Transient UV/vis pump-probe data in methanol also suggest additional relaxation dynamics on the subnanosecond time scale, which we tentatively ascribe to hydrogen bond dynamics of DHAQ with the protic solvent, affecting the equilibrium population dynamics within the S2 and S1 electronic excited states. Ultimately, the two excited singlet states decay with a solvent-dependent time constant ranging from 139 to 210 ps. The concomitant electronic ground-state recovery is, however, only partial because a large fraction of the population relaxes to the first triplet state. From the similarity of the time scales involved, we conjecture that the solvent plays a crucial role in breaking the intramolecular hydrogen bond of DHAQ during the S2/S1 relaxation to either the ground or triplet state. © 2014 American Chemical Society.
Ruger, R.; Niehaus, T.; van Lenthe, E.; Heine, T.; Visscher, L.
2016-01-01
We report a time-dependent density functional based tight-binding (TD-DFTB) scheme for the calculation of UV/Vis spectra, explicitly taking into account the excitation of nuclear vibrations via the adiabatic Hessian Franck-Condon method with a harmonic approximation for the nu- clear wavefunction.
Visualizing Infrared (IR) Spectroscopy with Computer Animation
Abrams, Charles B.; Fine, Leonard W.
1996-01-01
IR Tutor, an interactive, animated infrared (IR) spectroscopy tutorial has been developed for Macintosh and IBM-compatible computers. Using unique color animation, complicated vibrational modes can be introduced to beginning students. Rules governing the appearance of IR absorption bands become obvious because the vibrational modes can be visualized. Each peak in the IR spectrum is highlighted, and the animation of the corresponding normal mode can be shown. Students can study each spectrum stepwise, or click on any individual peak to see its assignment. Important regions of each spectrum can be expanded and spectra can be overlaid for comparison. An introduction to the theory of IR spectroscopy is included, making the program a complete instructional package. Our own success in using this software for teaching and research in both academic and industrial environments will be described. IR Tutor consists of three sections: (1) The 'Introduction' is a review of basic principles of spectroscopy. (2) 'Theory' begins with the classical model of a simple diatomic molecule and is expanded to include larger molecules by introducing normal modes and group frequencies. (3) 'Interpretation' is the heart of the tutorial. Thirteen IR spectra are analyzed in detail, covering the most important functional groups. This section features color animation of each normal mode, full interactivity, overlay of related spectra, and expansion of important regions. This section can also be used as a reference.
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Infrared Spectroscopy of Noh Suspended in Solid Parahydrogen: Part Two
Balabanoff, Morgan E.; Mutunga, Fredrick M.; Anderson, David T.
2015-06-01
The only report in the literature on the infrared spectroscopy of the parent oxynitrene NOH was performed using Ar matrix isolation spectroscopy at 10 K. In this previous study, they performed detailed isotopic studies to make definitive vibrational assignments. NOH is predicted by high-level calculations to be in a triplet ground electronic state, but the Ar matrix isolation spectra cannot be used to verify this triplet assignment. In our 2013 preliminary report, we showed that 193 nm in situ photolysis of NO trapped in solid parahydrogen can also be used to prepare the NOH molecule. Over the ensuing two years we have been studying the infrared spectroscopy of this species in more detail. The spectra reveal that NOH can undergo hindered rotation in solid parahydrogen such that we can observe both a-type and b-type rovibrational transitions for the O-H stretch vibrational mode, but only a-type for the mode assigned to the bend. In addition, both observed a-type infrared absorption features (bend and OH stretch) display fine structure; an intense central peak with weaker peaks spaced symmetrically to both lower and higher wavenumbers. The spacing between the peaks is nearly identical for both vibrational modes. We now believe this fine structure is due to spin-rotation interactions and we will present a detailed analysis of this fine structure. Currently, we are performing additional experiments aimed at making 15NOH to test these preliminary assignments. The most recent data and up-to-date analysis will be presented in this talk. G. Maier, H. P. Reisenauer, M. De Marco, Angew. Chem. Int. Ed. 38, 108-110 (1999). U. Bozkaya, J. M. Turney, Y. Yamaguchi, and H. F. Schaefer III, J. Chem. Phys. 136, 164303 (2012). David T. Anderson and Mahmut Ruzi, 68th Ohio State University International Symposium on Molecular Spectroscopy, talk TE01 (2013).
[Occupational standing vibration rate and vibrational diseases].
Karnaukh, N G; Vyshchipan, V F; Haumenko, B S
2003-12-01
Occupational standing vibration rate is proposed in evaluating a degree of impairment of an organism activity. It will allow more widely to introduce specification of quality and quantity in assessment of the development of vibrational disease. According out-patient and inpatient obtained data we have established criterial values of functional changes in accordance with accumulated occupational standing vibration rate. The nomogram was worked out for defining a risk of the development of vibrational disease in mine workers. This nomogram more objectively can help in diagnostics of the disease.
Three-body interactions in liquid and solid hydrogen: Evidence from vibrational spectroscopy
Hinde, Robert
2008-03-01
In the cryogenic low-density liquid and solid phases of H2 and D2, the H2 and D2 molecules retain good rotational and vibrational quantum numbers that characterize their internal degrees of freedom. High-resolution infrared and Raman spectroscopic experiments provide extremely sensitive probes of these degrees of freedom. We present here fully-first-principles calculations of the infrared and Raman spectra of liquid and solid H2 and D2, calculations that employ a high-quality six-dimensional coupled-cluster H2-H2 potential energy surface and quantum Monte Carlo treatments of the single-molecule translational degrees of freedom. The computed spectra agree very well with experimental results once we include three-body interactions among the molecules, interactions which we also compute using coupled-cluster quantum chemical methods. We predict the vibrational spectra of liquid and solid H2 at several temperatures and densities to provide a framework for interpreting recent experiments designed to search for superfluid behavior in small H2 droplets. We also present preliminary calculations of the spectra of mixed H2/D2 solids that show how positional disorder affects the spectral line shapes in these systems.
International Nuclear Information System (INIS)
Bratescu, Maria Antoneta; Hieda, Junko; Umemura, Tomonari; Saito, Nagahiro; Takai, Osamu
2011-01-01
The degradation of p-benzoquinone (p-BQ) in water was investigated by the coherent anti-Stokes Raman spectroscopy (CARS) method, in which the change of the anti-Stokes signal intensity corresponding to the vibrational transitions of the molecule is monitored during and after solution plasma processing (SPP). In the beginning of SPP treatment, the CARS signal intensity of the ring vibrational molecular transitions at 1233 and 1660 cm -1 increases under the influence of the electric field of the plasma, depending on the delay time between the plasma pulse and the laser firing pulse. At the same time, the plasma contributes to the degradation of p-BQ molecules by generating hydrogen and hydroxyl radicals, which decompose p-BQ into different carboxylic acids. After SPP, the CARS signal intensity of the vibrational bands of p-BQ ceased and the degradation of p-BQ was confirmed by UV-visible absorption spectroscopy and liquid chromatography analysis.
Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.
Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan
2018-05-07
Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.
DEFF Research Database (Denmark)
Barsberg, Soren
2015-01-01
Lignin is the most abundant aromatic plant polymer on earth. Useful information on its structure and interactions is gained by vibrational spectroscopy and relies on the quality of band assignments. B3LYP predictions were recently shown to support band assignments. Further progress calls...
Identifying highly conducting Au–C links through inelastic electron tunneling spectroscopy
Czech Academy of Sciences Publication Activity Database
Foti, G.; Vázquez, Héctor; Sanchez-Portal, D.; Arnau, A.; Frederiksen, T.
2014-01-01
Roč. 118, OCT (2014), s. 27106-27112 ISSN 1932-7447 Institutional support: RVO:68378271 Keywords : molecular electronics * alkanes * tin-functionalization * anchoring groups * vibrational spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.772, year: 2014
McWilliams, L.; Wren, S. N.; Valley, N. A.; Richmond, G.
2014-12-01
Small organic bases have been measured in atmospheric samples, with their sources ranging from industrial processing to animal husbandry. These small organic amines are often highly soluble, being found in atmospheric condensed phases such as fogwater and rainwater. Additionally, they display acid-neutralization ability often greater than ammonia, yet little is known regarding their kinetic and thermodynamic properties. This presentation will describe the molecular level details of a model amine system at the vapor/liquid interface in the presence of acidic gas. We find that this amine system shows very unique properties in terms of its bonding, structure, and orientation at aqueous surfaces. The results of our studies using a combination of computation, vibrational sum frequency spectroscopy, and surface tension will report the properties inherent to these atmospherically relevant species at aqueous surfaces.
Recovering Intrinsic Fragmental Vibrations Using the Generalized Subsystem Vibrational Analysis.
Tao, Yunwen; Tian, Chuan; Verma, Niraj; Zou, Wenli; Wang, Chao; Cremer, Dieter; Kraka, Elfi
2018-05-08
Normal vibrational modes are generally delocalized over the molecular system, which makes it difficult to assign certain vibrations to specific fragments or functional groups. We introduce a new approach, the Generalized Subsystem Vibrational Analysis (GSVA), to extract the intrinsic fragmental vibrations of any fragment/subsystem from the whole system via the evaluation of the corresponding effective Hessian matrix. The retention of the curvature information with regard to the potential energy surface for the effective Hessian matrix endows our approach with a concrete physical basis and enables the normal vibrational modes of different molecular systems to be legitimately comparable. Furthermore, the intrinsic fragmental vibrations act as a new link between the Konkoli-Cremer local vibrational modes and the normal vibrational modes.
Abral, Hairul; Putra, Genda J; Asrofi, Mohammad; Park, Ji-Won; Kim, Hyun-Joong
2018-01-01
This article reports effect of vibration duration of high ultrasound applied to bio-composite while gelatinized on its properties. The bio-composite consists of mixing of both the tapioca starch based bioplastic and oil palm empty fruit bunch (OPEFB) fibers with high volume fraction. Gelatinization of the bio-composite sample was poured into a rectangular glass mold placed then in an ultrasonic bath with 40kHz, and 250watt in different duration for 0, 15, 30, 60min respectively. The results show that vibration during gelatinization has changed the characterisation of the bio-composite. SEM photograph displayed different fracture surface of tensile sample. For vibration duration of 60min, tensile strength (TM), and tensile modulus (TM) was improved to 64.4, 277.4%, respectively, meanwhile strain was decreased to 35.1% in comparison without vibration. Fourier Transform Infrared Spectroscopy (FTIR), and XRD diffraction of the bio-composite has changed due to various vibration duration. Moisture absorption of the vibrated bio-composite was lower than that of the untreated one. Copyright © 2017 Elsevier B.V. All rights reserved.
Femtosecond laser spectroscopy
Hannaford, Peter
2005-01-01
As concepts and methodologies have evolved over the past two decades, the realm of ultrafast science has become vast and exciting and has impacted many areas of chemistry, biology and physics, and other fields such as materials science, electrical engineering, and optical communication. The field has recently exploded with the announcement of a series of remarkable new developments and advances. This volume surveys this recent growth in eleven chapters written by leading international researchers in the field. It includes sections on femtosecond optical frequency combs, soft x-ray femtosecond laser sources, and attosecond laser sources. In addition, the contributors address real-time spectroscopy of molecular vibrations with sub-5-fs pulses and multidimensional femtosecond coherent spectroscopies for studying molecular and electron dynamics. Novel methods for measuring and characterizing ultrashort laser pulses and ultrashort pulses of light are also described. The topics covered are revolutionizing the field...
Monitoring of blood oxygenation in brain by resonance Raman spectroscopy
DEFF Research Database (Denmark)
Brazhe, Nadezda A; Thomsen, Kirsten; Lønstrup, Micael
2018-01-01
Blood oxygenation in cerebral vessels is an essential parameter to evaluate brain function and to investigate the coupling between local blood flow and neuronal activity. We apply resonance Raman spectroscopy in vivo to study hemoglobin oxygenation in cortex vessels of anesthetized ventilated mice....... We demonstrate that the pairs of Raman peaks at 1355 and1375 cm-1(symmetric vibrations of pyrrol half-rings in the heme molecule), 1552 and 1585 cm-1and 1602 and 1638 cm-1(vibrations of methine bridges in heme molecule) are reliable markers for quantitative estimation of the relative amount...
IRMPD Spectroscopy Sheds New (Infrared) Light on the Sulfate Pattern of Carbohydrates.
Schindler, B; Barnes, L; Gray, C J; Chambert, S; Flitsch, S L; Oomens, J; Daniel, R; Allouche, A R; Compagnon, I
2017-03-16
IR spectroscopy of gas-phase ions is proposed to resolve positional isomers of sulfated carbohydrates. Mass spectrometric fingerprints and gas-phase vibrational spectra in the near and mid-IR regions were obtained for sulfated monosaccharides, yielding unambiguous signatures of sulfated isomers. We report the first systematic exploration of the biologically relevant but notoriously challenging deprotonated state in the near IR region. Remarkably, anions displayed very atypical vibrational profiles, which challenge the well-established DFT (Density Functionnal Theory) modeling. The proposed approach was used to elucidate the sulfate patterns in glycosaminoglycans, a ubiquitous class of mammalian carbohydrates, which is regarded as a major challenge in carbohydrate structural analysis. Isomeric glycosaminoglycan disaccharides from heparin and chondroitin sources were resolved, highlighting the potential of infrared multiple photon dissociation spectroscopy as a novel structural tool for carbohydrates.
Vibrational and electronic spectra of 2-nitrobenzanthrone: An experimental and computational study
Onchoke, Kefa K.; Chaudhry, Saad N.; Ojeda, Jorge J.
2016-01-01
The environmental pollutant 2-nitrobenzanthrone (2-NBA) poses human health hazards, and is formed by atmospheric reactions of NOX gases with atmospheric particulates. Though its mutagenic effects have been studied in biological systems, its comprehensive spectroscopic experimental data are scarce. Thus, vibrational and optical spectroscopic analysis (UV-Vis, and fluorescence) of 2-NBA was studied using both experimental and density functional theory employing B3LYP method with 6-311 + G(d,p) basis set. The scaled theoretical vibrational frequencies show good agreement to experiment to within 5 cm- 1 and NBA, respectively. On the basis of normal coordinate analysis complete assignments of harmonic experimental infrared and Raman bands are made. The influence of the nitro group substitution upon the benzanthrone structure and symmetric CH vibrations, and electronic spectra is noted. This study is useful for the development of spectroscopy-mutagenicity relationships in nitrated polycyclic aromatic hydrocarbons.
Role of Raman spectroscopy and surface enhanced Raman spectroscopy in colorectal cancer
Jenkins, Cerys A; Lewis, Paul D; Dunstan, Peter R; Harris, Dean A
2016-01-01
Colorectal cancer (CRC) is the fourth most common cancer in the United Kingdom and is the second largest cause of cancer related death in the United Kingdom after lung cancer. Currently in the United Kingdom there is not a diagnostic test that has sufficient differentiation between patients with cancer and those without cancer so the current referral system relies on symptomatic presentation in a primary care setting. Raman spectroscopy and surface enhanced Raman spectroscopy (SERS) are forms of vibrational spectroscopy that offer a non-destructive method to gain molecular information about biological samples. The techniques offer a wide range of applications from in vivo or in vitro diagnostics using endoscopic probes, to the use of micro-spectrometers for analysis of biofluids. The techniques have the potential to detect molecular changes prior to any morphological changes occurring in the tissue and therefore could offer many possibilities to aid the detection of CRC. The purpose of this review is to look at the current state of diagnostic technology in the United Kingdom. The development of Raman spectroscopy and SERS in clinical applications relation for CRC will then be discussed. Finally, future areas of research of Raman/SERS as a clinical tool for the diagnosis of CRC are also discussed. PMID:27190582
Effect of shelf aging on vibration transmissibility of anti-vibration gloves
SHIBATA, Nobuyuki
2017-01-01
Anti-vibration gloves have been used in real workplaces to reduce vibration transmitted through hand-held power tools to the hand. Generally materials used for vibration attenuation in gloves are resilient materials composed of certain synthetic and/or composite polymers. The mechanical characteristics of the resilient materials used in anti-vibration gloves are prone to be influenced by environmental conditions such as temperature, humidity, and photo-irradiation, which cause material degradation and aging. This study focused on the influence of shelf aging on the vibration attenuation performance of air-packaged anti-vibration gloves following 2 yr of shelf aging. Effects of shelf aging on the vibration attenuation performance of anti-vibration gloves were examined according to the Japan industrial standard JIS T8114 test protocol. The findings indicate that shelf aging induces the reduction of vibration attenuation performance in air-packaged anti-vibration gloves. PMID:28978817
Vibrational and orientational dynamics of water in aqueous hydroxide solutions.
Hunger, Johannes; Liu, Liyuan; Tielrooij, Klaas-Jan; Bonn, Mischa; Bakker, Huib
2011-09-28
We report the vibrational and orientational dynamics of water molecules in isotopically diluted NaOH and NaOD solutions using polarization-resolved femtosecond vibrational spectroscopy and terahertz time-domain dielectric relaxation measurements. We observe a speed-up of the vibrational relaxation of the O-D stretching vibration of HDO molecules outside the first hydration shell of OH(-) from 1.7 ± 0.2 ps for neat water to 1.0 ± 0.2 ps for a solution of 5 M NaOH in HDO:H(2)O. For the O-H vibration of HDO molecules outside the first hydration shell of OD(-), we observe a similar speed-up from 750 ± 50 fs to 600 ± 50 fs for a solution of 6 M NaOD in HDO:D(2)O. The acceleration of the decay is assigned to fluctuations in the energy levels of the HDO molecules due to charge transfer events and charge fluctuations. The reorientation dynamics of water molecules outside the first hydration shell are observed to show the same time constant of 2.5 ± 0.2 ps as in bulk liquid water, indicating that there is no long range effect of the hydroxide ion on the hydrogen-bond structure of liquid water. The terahertz dielectric relaxation experiments show that the transfer of the hydroxide ion through liquid water involves the simultaneous motion of ~7 surrounding water molecules, considerably less than previously reported for the proton. © 2011 American Institute of Physics
Amine terminated SAMs: Investigating why oxygen is present in these films
International Nuclear Information System (INIS)
Baio, J.E.; Weidner, T.; Brison, J.; Graham, D.J.; Gamble, Lara J.; Castner, David G.
2009-01-01
Self-assembled monolayers (SAMs) on gold prepared from amine-terminated alkanethiols have long been employed as model positively charged surfaces. Yet in previous studies significant amounts of unexpected oxygen containing species are always detected in amine terminated SAMs. Thus, the goal of this investigation was to determine the source of these oxygen species and minimize their presence in the SAM. The surface composition, structure, and order of amine-terminated SAMs on Au were characterized by X-ray photoelectron spectroscopy (XPS), time-of-flight secondary ion mass spectroscopy (ToF-SIMS), sum frequency generation (SFG) and near edge X-ray absorption fine structure (NEXAFS) spectroscopy. XPS determined compositions of amine-terminated SAMs in the current study exhibited oxygen concentrations of 2.4 ± 0.4 atomic %, a substantially lower amount of oxygen than reported in previously published studies. High-resolution XPS results from the S 2p , C 1s and N 1s regions did not detect any oxidized species. Angle-resolved XPS indicated that the small amount of oxygen detected was located at or near the amine head group. Small amounts of oxidized nitrogen, carbon and sulfur secondary ions, as well as ions attributed to water, were detected in the ToF-SIMS data due to the higher sensitivity of ToF-SIMS. The lack of N-O, S-O, and C-O stretches in the SFG spectra are consistent with the XPS and ToF-SIMS results and together show that oxidation of the amine-terminated thiols alone can only account for, at most, a small fraction of the oxygen detected by XPS. Both the SFG and angle-dependent NEXAFS indicated the presence of gauche defects in the amine SAMs. However, the SFG spectral features near 2865 cm -1 , assigned to the stretch of the methylene group next to the terminal amine unit, demonstrate the SAM is reasonably ordered. The SFG results also show another broad feature near 3200 cm -1 related to hydrogen-bonded water. From this multi-technique investigation it is
Single-molecule electronics: Cooling individual vibrational modes by the tunneling current.
Lykkebo, Jacob; Romano, Giuseppe; Gagliardi, Alessio; Pecchia, Alessandro; Solomon, Gemma C
2016-03-21
Electronic devices composed of single molecules constitute the ultimate limit in the continued downscaling of electronic components. A key challenge for single-molecule electronics is to control the temperature of these junctions. Controlling heating and cooling effects in individual vibrational modes can, in principle, be utilized to increase stability of single-molecule junctions under bias, to pump energy into particular vibrational modes to perform current-induced reactions, or to increase the resolution in inelastic electron tunneling spectroscopy by controlling the life-times of phonons in a molecule by suppressing absorption and external dissipation processes. Under bias the current and the molecule exchange energy, which typically results in heating of the molecule. However, the opposite process is also possible, where energy is extracted from the molecule by the tunneling current. Designing a molecular "heat sink" where a particular vibrational mode funnels heat out of the molecule and into the leads would be very desirable. It is even possible to imagine how the vibrational energy of the other vibrational modes could be funneled into the "cooling mode," given the right molecular design. Previous efforts to understand heating and cooling mechanisms in single molecule junctions have primarily been concerned with small models, where it is unclear which molecular systems they correspond to. In this paper, our focus is on suppressing heating and obtaining current-induced cooling in certain vibrational modes. Strategies for cooling vibrational modes in single-molecule junctions are presented, together with atomistic calculations based on those strategies. Cooling and reduced heating are observed for two different cooling schemes in calculations of atomistic single-molecule junctions.
International Nuclear Information System (INIS)
Sedlacek, A.J.; Weston, R.E. Jr.; Flynn, G.W.
1991-01-01
The vibrational relaxation of highly excited ground state benzene, benzene d 6 , and hexafluorobenzene by CO 2 has been investigated with high resolution diode laser spectroscopy. The vibrationally hot polyatomics are formed by single photon 248 nm excitation to the S 1 state followed by rapid radiationless transitions. It has been found that in all cases less than 1% of the energy initially present in the polyatomics is deposited into the high frequency mode of CO 2 (ν 3 ). An investigation of the CO 2 (00 0 1) nascent rotational distribution under single collision conditions reveals that very little rotational excitation accompanies vibrational energy transfer to the ν 3 mode. The CO 2 (ν 3 ) rotational states can be described by temperatures, T rot , as follows: C 6 H 6 , T rot =360±30 K; C 6 D 6 , T rot =350±35 K and C 6 F 6 , T rot =340±23 K. An estimate of left-angle ΔE right-angle ν3 , the mean energy transferred to the CO 2 ν 3 mode per collision, suggests that as the availability of low frequency modes in the excited molecule increases, less energy is deposited into the high frequency mode of CO 2 . Finally, evidence is presented suggesting that even at moderate laser fluences, the two-photon ionization of benzene can lead to substantial CO 2 ν 3 excitation via electron+CO 2 inelastic collisions
Tao, Yunwen; Zou, Wenli; Cremer, Dieter; Kraka, Elfi
2017-10-26
A novel approach is presented to assess chemical similarity based the local vibrational mode analysis developed by Konkoli and Cremer. The local mode frequency shifts are introduced as similarity descriptors that are sensitive to any electronic structure change. In this work, 59 different monosubstituted benzenes are compared. For a subset of 43 compounds, for which experimental data was available, the ortho-/para- and meta-directing effect in electrophilic aromatic substitution reactions could be correctly reproduced, proving the robustness of the new similarity index. For the remaining 16 compounds, the directing effect was predicted. The new approach is broadly applicable to all compounds for which either experimental or calculated vibrational frequency information is available.
Ro-vibrational laser spectroscopy of ESD neutrals from chemisorbed species
International Nuclear Information System (INIS)
Burns, A.R.; Stechel, E.B.; Jennison, D.R.
1987-01-01
Ever since the introduction of intense tunable laser radiation, the fields of molecular spectroscopy and dynamics have expanded tremendously. Indeed, with each technical improvement in laser resolution and output power, new applications have emerged with correspondingly increased levels of sophistication and information. In the field of electron-stimulated desorption (ESD), not only has the utilization of lasers resulted in the detection of neutral species, which were previously difficult to observe without specially-designed analyzers, but also the quantum-specific nature of the resonant laser interaction with the neutrals has yielded valuable information concerning internal energies. In this article, we will discuss some of the experimental methods in the application of laser resonance-ionization spectroscopy (RIS) to the study of the ESD of neutrals, in particular, chemisorbed NO and CO desorption from Pt(111). We will also show how the detailed information obtained in these experiments has identified a new desorption mechanism
Fielicke, André; von Helden, Gert; Meijer, Gerard; Pedersen, David B; Simard, Benoit; Rayner, David M
2005-06-15
We report on the interaction of carbon monoxide with cationic gold clusters in the gas phase. Successive adsorption of CO molecules on the Au(n)(+) clusters proceeds until a cluster size specific saturation coverage is reached. Structural information for the bare gold clusters is obtained by comparing the saturation stoichiometry with the number of available equivalent sites presented by candidate structures of Au(n)(+). Our findings are in agreement with the planar structures of the Au(n)(+) cluster cations with n < or = 7 that are suggested by ion mobility experiments [Gilb, S.; Weis, P.; Furche, F.; Ahlrichs, R.; Kappes, M. M. J. Chem. Phys. 2001, 116, 4094]. By inference we also establish the structure of the saturated Au(n)(CO)(m)(+) complexes. In certain cases we find evidence suggesting that successive adsorption of CO can distort the metal cluster framework. In addition, the vibrational spectra of the Au(n)(CO)(m)(+) complexes in both the CO stretching region and in the region of the Au-C stretch and the Au-C-O bend are measured using infrared photodepletion spectroscopy. The spectra further aid in the structure determination of Au(n)(+), provide information on the structure of the Au(n)(+)-CO complexes, and can be compared with spectra of CO adsorbates on deposited clusters or surfaces.
Raman Spectroscopy for Homeland Security Applications
Directory of Open Access Journals (Sweden)
Gregory Mogilevsky
2012-01-01
Full Text Available Raman spectroscopy is an analytical technique with vast applications in the homeland security and defense arenas. The Raman effect is defined by the inelastic interaction of the incident laser with the analyte molecule’s vibrational modes, which can be exploited to detect and identify chemicals in various environments and for the detection of hazards in the field, at checkpoints, or in a forensic laboratory with no contact with the substance. A major source of error that overwhelms the Raman signal is fluorescence caused by the background and the sample matrix. Novel methods are being developed to enhance the Raman signal’s sensitivity and to reduce the effects of fluorescence by altering how the hazard material interacts with its environment and the incident laser. Basic Raman techniques applicable to homeland security applications include conventional (off-resonance Raman spectroscopy, surface-enhanced Raman spectroscopy (SERS, resonance Raman spectroscopy, and spatially or temporally offset Raman spectroscopy (SORS and TORS. Additional emerging Raman techniques, including remote Raman detection, Raman imaging, and Heterodyne imaging, are being developed to further enhance the Raman signal, mitigate fluorescence effects, and monitor hazards at a distance for use in homeland security and defense applications.