WorldWideScience

Sample records for viarum dunal solanaceae

  1. Fruit removal of a wild tomato, Solanum granulosoleprosum Dunal (Solanaceae, by birds, bats and non-flying mammals in an urban Brazilian environment

    Directory of Open Access Journals (Sweden)

    Cáceres Nilton Carlos

    2003-01-01

    Full Text Available A study of removal of fruits of the wild tomato, Solanum granulosoleprosum Dunal (N = 5 plants, by vertebrates was carried out in an urban environment of southern Brazil from January to May 1997 and February 1998. To verify diurnal and nocturnal removals, fruits were counted in several fruit bunches, being classified by size and color. Diurnal observations were made on plants to verify bird removal. A mist net was placed among the plants from the evening to 23:00 h to verify bat consumption. Live traps baited with S. granulosoleprosum fruits were placed on the ground among plants to verify terrestrial removers. On average it was found two ripe fruits available per bunch/day, but unripe, small, fruits were dominant (70%. Nocturnal mammals and birds-diurnal mammals partitioned fruits similarly. Bats removing fruits were Artibeus lituratus (Olfers, 1818, Pygoderma bilabiatum (Wagner, 1843 and Sturnira lilium (E. Geoffroy, 1810. Birds were Saltator similis Lafresnaye & d'Orbigny, 1837 and Thraupis sayaca (Linnaeus, 1766. Terrestrial mammals were a marsupial and three rodent species. Except for rodents, these vertebrates must be promoting the seed dispersal of S. granulosoleprosum seeds in disturbed mixed forests of southern Brazil.

  2. Estudo farmacobotânico comparativo de folhas de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St.-Hil., Solanaceae

    Directory of Open Access Journals (Sweden)

    Nathalia Diniz Araújo

    2010-09-01

    Full Text Available Neste trabalho realizou-se um estudo farmacobotânico de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St-Hil, espécies pertencentes à Solanum sect. Crinitum Child, com o objetivo de efetuar morfodiagnoses macroscópicas e microscópicas que possibilitem suas caracterizações. As três espécies são conhecidas popularmente como "jurubeba", fruta-de-lobo" e "lobeira" e usadas na medicina popular contra o diabetes e também para outros fins. Essas espécies compartilham vários caracteres morfológicos, dentre os quais se destacam o hábito arbustivo a arbóreo, o indumento velutino às vezes cerdoso, a corola é pentagonal-estrelada, roxa a púrpura, e o fruto globoso acima de 5 cm de diâmetro. Entretanto, apesar da grande semelhança morfológica entre as espécies estudadas, destacaram-se como parâmetros distintivos: a morfologia do pecíolo, a base do limbo, o indumento da face adaxial, a anatomia do mesofilo, os tipos de estômatos e a morfologia do bordo foliar.

  3. Estudo farmacobotânico comparativo de folhas de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St.-Hil., Solanaceae The pharmacobotanical comparative study of leaves of Solanum crinitum Lam., Solanum gomphodes Dunal and Solanum lycocarpum A. St-Hil, (Solanaceae

    Directory of Open Access Journals (Sweden)

    Nathalia Diniz Araújo

    2010-11-01

    Full Text Available Neste trabalho realizou-se um estudo farmacobotânico de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St-Hil, espécies pertencentes à Solanum sect. Crinitum Child, com o objetivo de efetuar morfodiagnoses macroscópicas e microscópicas que possibilitem suas caracterizações. As três espécies são conhecidas popularmente como "jurubeba", fruta-de-lobo" e "lobeira" e usadas na medicina popular contra o diabetes e também para outros fins. Essas espécies compartilham vários caracteres morfológicos, dentre os quais se destacam o hábito arbustivo a arbóreo, o indumento velutino às vezes cerdoso, a corola é pentagonal-estrelada, roxa a púrpura, e o fruto globoso acima de 5 cm de diâmetro. Entretanto, apesar da grande semelhança morfológica entre as espécies estudadas, destacaram-se como parâmetros distintivos: a morfologia do pecíolo, a base do limbo, o indumento da face adaxial, a anatomia do mesofilo, os tipos de estômatos e a morfologia do bordo foliar.In this work, a pharmacobotanical study of Solanum crinitum Lam., S. gomphodes Dunal and S. lycocarpum A. St-Hil., all belonging to the Solanum sect. Crinitum Child. has been realized with the objective of providing a macroscopical and microscopical morphodiagnosis for their characterizations. The three species are commonly named "jurubeba", "fruta-de-lobo" and "lobeira", and they are used in the folk medicine for the treatment of diabetes and others diseases. The three species studied share various morphological characters, like shrub and tree forms, the velutinous abaxial indument, the presence of bristles, the flower with stellate-pentagonal corollas ranging from violet to purple, and the fruit reaching up to 5 cm in diameter. The principal parameters to distinct the three species studied were the morphology of petiole and base of the blade leaf, the indument of adaxial surface, the anatomy of mesophyll, the types of stomata and the leaf margin.

  4. 158. Solanaceae

    DEFF Research Database (Denmark)

    Friis, Ib

    2007-01-01

    A taxonomic revision and a floristic account of all species in the plant family Solanaceae (nightshade family) recorded from Ethiopia and Eritrea.......A taxonomic revision and a floristic account of all species in the plant family Solanaceae (nightshade family) recorded from Ethiopia and Eritrea....

  5. Efeito da época sobre a emergência de Sida rhombifolia e Solanum viarum em diferentes profundidades de semeadura

    Directory of Open Access Journals (Sweden)

    Marcelo Claro Souza

    2011-12-01

    Full Text Available O conhecimento da profundidade ideal de germinação de sementes de plantas daninhas é importante para o desenvolvimento de estratégias de manejo eficientes, seguras e econômicas. Com o objetivo de estudar a emergência de plântulas de Sida rhombifolia L. e Solanum viarum Dunal, em resposta à época (setembro de 2008 e janeiro de 2009 e às profundidades de semeadura (0, 1, 2, 3, 4 e 5 cm, foram realizados dois experimentos em casa de vegetação. Sida rhombifolia mostrou-se sensível às variações de temperatura, em decorrência das épocas de semeadura, e os maiores percentuais de emergência ocorreram nas profundidades entre 1 e 4 cm. Para S. viarum, observou-se forte influência da temperatura sobre a sua emergência, sendo, observado o máximo de emergência, nas profundidades de 1 a 5 cm e sua redução para as sementes locadas na superfície do solo.

  6. DETERMINACIÓN DE ALGUNOS METABOLITOS SECUNDARIOS EN TRES MORFOTIPOS DE COCONA (Solanum sessiliflorum Dunal

    Directory of Open Access Journals (Sweden)

    Juliana E. Cardona J.

    2011-12-01

    Full Text Available Se determinó la presencia y la estructura(mediante el uso de técnicas espectroscópicasy cromatográficas de algunos metabolitossecundarios en tres morfotiposdel fruto de cocona (Solanum sessiliflorumDunal; Solanaceae cultivados en eldepartamento del Guaviare. Se destacóla presencia de ácido p-cumárico, ácidop-hidroxidihidrocumárico, naringenina,salicilato de metilo, hidrocarburos decadena larga, ácidos grasos y sus ésteresmetílicos y etílicos. Algunos de estoscompuestos se acumulan únicamente enel epicarpio de la fruta. La comparaciónde metabolitos volátiles permitió establecerdiferencias químicas entre los tresmorfotipos de la fruta.

  7. Open-field host specificity test of Gratiana boliviana (Coleoptera: Chrysomelidae), a biological control agent of tropical soda apple (Solanaceae) in the United States

    International Nuclear Information System (INIS)

    Gandolfo, D.; McKay, F.; Medal, J.C.; Cuda, J.P.

    2007-01-01

    An open-field experiment was conducted to assess the suitability of the South American leaf feeding beetle Gratiana boliviana Spaeth for biological control of Solanum viarum Dunal in the USA. An open-field test with eggplant, Solanum melongena L., was conducted on the campus of the University of Buenos Aires, Argentina, and a S. viarum control plot was established 40 km from the campus. One hundred adult beetles were released in each plot at the beginning of the experiment during the vegetative stage of the plants, and forty additional beetles were released in the S. melongena plot at the flowering stage. All the plants in each plot were checked twice a week and the number of adults, immatures, and eggs recorded. Results showed almost a complete rejection of eggplant by G. boliviana. No noticeable feeding damage was ever recorded on eggplant. The experiment was ended when the eggplants started to senesce or were severely damaged by whiteflies and spider mites. The results of this open-field experiment corroborate previous quarantine/laboratory host-specificity tests indicating that a host range expansion of G. boliviana to include eggplant is highly unlikely. Gratiana boliviana was approved for field release in May 2003 in the USA. To date, no non-target effects have been observed either on eggplant or native species of Solanum. (author) [es

  8. Androgenesis in Solanaceae.

    Science.gov (United States)

    Seguí-Simarro, Jose M

    2016-01-01

    The Solanaceae is one of the most important families for global agriculture. Among the different solanaceous species, tobacco (Nicotiana tabacum), potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum) are five crops of outstanding importance worldwide. In these crops, maximum yields are produced by hybrid plants created by crossing pure (homozygous) lines with the desired traits. Pure lines may be produced by conventional breeding methods, which is time consuming and costly. Alternatively, it is possible to accelerate the production of pure lines by creating doubled haploid (DH) plants derived from (haploid) male gametophytes or their precursors (androgenesis). In this way, the different steps for the production of pure lines can be reduced to only one generation, which implies important time and cost savings. This and other advantages make androgenic DHs the choice in a number of important crops where any of the different experimental in vitro techniques (anther culture or isolated microspore culture) is well set up. The Solanaceae family is an excellent example of heterogeneity in terms of response to these techniques, including highly responding species such as tobacco, considered a model system, and tomato, one of the most recalcitrant species, where no reliable and reproducible methods are yet available. Interestingly, the first evidence of androgenesis, particularly through in vitro anther culture, was demonstrated in a solanaceous species, Datura innoxia. In this chapter, we report the state of the art of the research about androgenic DHs in Solanaceae, paying special attention to datura, tobacco, potato, tomato, eggplant, and pepper.

  9. Taxonomic synopsis and analytical key for the genera of Solanaceae from Rio Grande do Sul, Brazil Sinopse taxonômica e chave ilustrada dos gêneros de Solanaceae ocorrentes no Rio Grande do Sul, Brasil

    Directory of Open Access Journals (Sweden)

    Edson Luís de Carvalho Soares

    2011-06-01

    Full Text Available This work consists of a taxonomic synopsis of the genera of Solanaceae in Rio Grande do Sul state, Brazil. Solanaceae is represented by 28 genera in this state: Acnistus Schott, Athenaea Sendtn., Aureliana Sendtn., Bouchetia Dunal, Browalia L., Brugmansia Pers., Brunfelsia L., Calibrachoa La Llave & Lex., Capsicum L., Cestrum L., Datura L., Dyssochroma Miers, Grabowskia Schltdl., Jaborosa Juss., Lycianthes (Dunal Hassl., Melananthus Walp., Nicandra Adans., Nicotiana L., Nierembergia Ruiz & Pav., Petunia Juss., Physalis L., Salpichroa Miers, Schwenckia L., Sessea Ruiz & Pav., Solandra Sw., Solanum L. (including Cyphomandra Sendtn. and Lycopersicon Mill., Streptosolen Miers and Vassobia Rusby. Of these, 23 consist of native species , while five are represented exclusively by introduced species. The total number of species is 149, of which 118 are native and 31 are introduced (adventitious or cultivated. An identification key for genera, and also comments on the most relevant taxonomic characters of each one are presented, plus comments on the species that occur in Rio Grande do Sul state.Este trabalho consiste em uma sinopse taxonômica dos gêneros de Solanaceae no Estado do Rio Grande do Sul, Brasil. Constatou-se a ocorrência de 28 gêneros: Acnistus Schott, Athenaea Sendtn., Aureliana Sendtn., Bouchetia Dunal, Browalia L., Brugmansia Pers., Brunfelsia L., Calibrachoa La Llave & Lex., Capsicum L., Cestrum L., Datura L., Dyssochroma Miers, Grabowskia Schltdl., Jaborosa Juss., Lycianthes (Dunal Hassl., Melananthus Walp., Nicandra Adans., Nicotiana L., Nierembergia Ruiz & Pav., Petunia Juss., Physalis L., Salpichroa Miers, Schwenckia L., Sessea Ruiz & Pav., Solandra Sw., Solanum L. (incluindo Cyphomandra Sendtn. e Lycopersicon Mill., Streptosolen Miers e Vassobia Rusby. Destes, 23 apresentam espécies nativas, enquanto cinco estão representados exclusivamente por espécies introduzidas. O número total de espécies é de 149, sendo que 118 s

  10. Recombinant lines for less-spininess in steroid-bearing Solanum viarum using induced mutants as parents

    International Nuclear Information System (INIS)

    Krishnan, R.; Nanda Kumar, D.; Subhas Chander, M.

    1988-01-01

    In the domestication of the wild, spinous and steroid-bearing Solanum viarum (syn. S. khasianum var. chatterjeeanum) induced mutations play a major role. The development of Glaxo and BARC mutants catalysed commercial cultivation of this species for its berries containing solasodine, used in steroid industries. The commercially more popular Glaxo mutant population consists predominantly of plants that are totally free of spines in aerial parts except lamina where few straight spines develop. The BARC mutant still possesses spines on aerial parts including the persistent calyx. However, the laminary spines of the BARC mutant are curved and vestigial. Comparative studies on morphology, growth behaviour and agronomic characters of the two mutants, their wild progenitor and their hybrid progenies showed that the three types differ only for spine character. In F 2 generation of a cross involving the Glaxo and BARC mutants, a double mutant recombinant was recovered. The recombinant is devoid of spines in aerial parts like its Glaxo mutant parent, but possesses laminary curved vestigial spines like the BARC parent. The spine characters of the recombinant are inherited double recessive. Three advanced lines of this recombinant type (IIHR 2n - 1,2 and 3) were tested in replicated trials 1985 and 1986. They showed parity in berry yield and solasodine content with the Glaxo mutant and three promising lines evolved elsewhere viz. 'RRL (Bhuhaneswar) Y-14', 'RRL (Jorhat)' and 'Pusa'. The results indicate gainful use of induced mutants in hybridization leading to development of superior less-spiny lines of steroid bearing Solanum viarum

  11. Exploring plant tissue culture in Withania somnifera (L.) Dunal: in vitro propagation and secondary metabolite production.

    Science.gov (United States)

    Shasmita; Rai, Manoj K; Naik, Soumendra K

    2017-12-26

    Withania somnifera (L.) Dunal (family: Solanaceae), commonly known as "Indian Ginseng", is a medicinally and industrially important plant of the Indian subcontinent and other warmer parts of the world. The plant has multi-use medicinal potential and has been listed among 36 important cultivated medicinal plants of India that are in high demand for trade due to its pharmaceutical uses. The medicinal importance of this plant is mainly due to the presence of different types of steroidal lactones- withanolides in the roots and leaves. Owing to low seed viability and poor germination, the conventional propagation of W. somnifera falls short to cater its commercial demands particularly for secondary metabolite production. Therefore, there is a great need to develop different biotechnological approaches through tissue and organ culture for seasonal independent production of plants in large scale which will provide sufficient raw materials of uniform quality for pharmaceutical purposes. During past years, a number of in vitro plant regeneration protocols via organogenesis and somatic embryogenesis and in vitro conservation through synthetic seed based encapsulation technology have been developed for W. somnifera. Several attempts have also been made to standardize the protocol of secondary metabolite production via tissue/organ cultures, cell suspension cultures, and Agrobacterium rhizogenes-mediated transformed hairy root cultures. Employment of plant tissue culture based techniques would provide means for rapid propagation and conservation of this plant species and also provide scope for enhanced production of different bioactive secondary metabolites. The present review provides a comprehensive report on research activities conducted in the area of tissue culture and secondary metabolite production in W. somnifera during the past years. It also discusses the unexplored areas which might be taken into consideration for future research so that the medicinal properties and

  12. Solanaceae

    African Journals Online (AJOL)

    GRACE

    2006-05-02

    May 2, 2006 ... centromeric positions and arm lengths. Meiotic behaviour of the chromosomes involved a combination of bivalent and multivalent associations especially at the polyploid levels. The significance of this work in the understanding of cytogenetic behaviour of plants and crop improvement efforts are discussed.

  13. Preferência alimentar de adultos de Metriona elatior Klug (Coleoptera: Chrysomelidae, Cassidinae por diferentes híbridos de Solanum melogena Linnaeus (Solanaceae = Feeding preference of adults of Metriona elatior Klug (Coleoptera: Chrysomelidae, Cassidinae for different hybrids of Solanum melogena Linnaeus (Solanaceae

    Directory of Open Access Journals (Sweden)

    Daniel Gandolfo

    2008-10-01

    Full Text Available Metriona elatior Klug é potencial candidato para o controle biológico de Solanum viarum Dunal (joá-bravo, pois as larvas e adultos se alimentam de suas folhas e têm baixa taxa de dispersão. A especificidade é um forte requisito para a adequabilidade de umorganismo como agente de controle biológico, especialmente pela estratégia inundativa. Desse modo, a preferência alimentar do adulto desse inseto em laboratório foi avaliada em 14 híbridos de Solanum melogena Linnaeus (berinjela. A criação estoque foi mantida emlaboratório, com os indivíduos se alimentando de folhas do joá-bravo. O estudo foi realizado utilizando-se testes de dupla e múltipla escolha, em períodos de alimentação de 24 e 48h, oferecendo-se discos de tecido foliar, em condições de placas de Petri. As avaliaçõesda sobrevivência e consumo foliar dos insetos adultos recém-emergidos foram realizadas em folhas de joá-bravo e dos híbridos de berinjela, mantidas túrgidas pela imersão do pecíolo em água. A área foliar foi medida antes e após quatro dias de exposição ao inseto. M. elatiorapresentou preferência para alimentação, sobrevivência e consumo na planta daninha. A preferência do crisomelídeo foi maior para o híbrido ‘Minikuro Kowishiki’ de berinjela.Metriona elatior Klug is a potential biocontrol agent for Solanum viarum Dunal (tropical soda apple, because larvae and adults feed on its leaves and this species shows a low dispersion rate. Specificity plays a major role in the feasibility of an organism as abiological control agent, especially in the inundative strategy. The feeding preference of M. elatior adults was evaluated to 14 eggplant (Solanum melogena Linnaeus hybrids. Mass rearing was carried out under lab conditions, with the insect feeding directly on S. viarum leaves. The study started with dual and multiple choice tests in 24 and 48 hour feeding times, by offering leaf disks in Petri dish conditions. Survival and leaf

  14. Ultrastructure of Withania Somnifera (L.) Dunal pollen grains

    International Nuclear Information System (INIS)

    Alwadie, H.M.

    2002-01-01

    Light, scanning and transmission electron microscopy were used to study the morphology and ultrastructure of Withania Somnifera (L.) Dunall pollen grains. Light microscopic examination revealed that the pollen grains are tri- or tetrazonocoplate grains, approximately as long as broad, measuring 29-um. Scanning electron microscopic observation showed that surface sculpturing of the pollen is scarbate-granulate. Ultrathin sections as examined by transmission electron microscope showed that the pollen contained numerous starch grains, lipid droplets, endoplasmic reticulum and vesicles of dictyosomes. Two layers of the pollen wall were also distinguished, the outer wall (exine) divided into ektexine and endexine as well as the inner layer (intine). The nutritive values of Withania pollen are discussed. The importance of studying the ultrastructure of pollen grains as a new tool in palynology is also discussed. (author)

  15. In Vitro Propagation of Withania somnifera (L.) Dunal.

    Science.gov (United States)

    Singh, Pritika; Guleri, Rupam; Pati, Pratap Kumar

    2016-01-01

    Withania somnifera (L.) Dunal known as Ashwagandha is commonly used in traditional Indian medicine system. It possesses immense therapeutic value against a large number of ailments such as mental diseases, asthma, inflammation, arthritis, rheumatism, tuberculosis, and a variety of other diseases including cancer. The therapeutic potential of W. somnifera is due to the presence of secondary metabolites mainly, tropane alkaloids and withanolides (steroidal lactones). The growing realization of commercial value of the plant has initiated a new demand for in vitro propagation of elite chemotypes of Withania. Micropropagation which is an important tool for rapid multiplication requires optimization of number of factors such as nutrient medium, status of medium (solid and liquid), type of explant, and plant growth regulators. Similarly, an efficient and reproducible in vitro regeneration system which is a prerequisite for the development of genetic transformation protocol requires precise manipulation of various intrinsic and extrinsic factors.

  16. Preferência alimentar de adultos de Metriona elatior Klug (Coleoptera: Chrysomelidae, Cassidinae por diferentes híbridos de Solanum melogena Linnaeus (Solanaceae - DOI: 10.4025/actascibiolsci.v30i4.5874 Feeding preference of adults of Metriona elatior Klug (Coleoptera: Chrysomelidae, Cassidinae for different hybrids of Solanum melogena Linnaeus (Solanaceae - DOI: 10.4025/actascibiolsci.v30i4.5874

    Directory of Open Access Journals (Sweden)

    Robinson Antonio Pitelli

    2008-11-01

    Full Text Available Metriona elatior Klug é potencial candidato para o controle biológico de Solanum viarum Dunal (joá-bravo, pois as larvas e adultos se alimentam de suas folhas e têm baixa taxa de dispersão. A especificidade é um forte requisito para a adequabilidade de um organismo como agente de controle biológico, especialmente pela estratégia inundativa. Desse modo, a preferência alimentar do adulto desse inseto em laboratório foi avaliada em 14 híbridos de Solanum melogena Linnaeus (berinjela. A criação estoque foi mantida em laboratório, com os indivíduos se alimentando de folhas do joá-bravo. O estudo foi realizado utilizando-se testes de dupla e múltipla escolha, em períodos de alimentação de 24 e 48h, oferecendo-se discos de tecido foliar, em condições de placas de Petri. As avaliações da sobrevivência e consumo foliar dos insetos adultos recém-emergidos foram realizadas em folhas de joá-bravo e dos híbridos de berinjela, mantidas túrgidas pela imersão do pecíolo em água. A área foliar foi medida antes e após quatro dias de exposição ao inseto. M. elatior apresentou preferência para alimentação, sobrevivência e consumo na planta daninha. A preferência do crisomelídeo foi maior para o híbrido Minikuro Kowishiki de berinjela.Metriona elatior Klug is a potential biocontrol agent for Solanum viarum Dunal (tropical soda apple, because larvae and adults feed on its leaves and this species shows a low dispersion rate. Specificity plays a major role in the feasibility of an organism as a biological control agent, especially in the inundative strategy. The feeding preference of M. elatior adults was evaluated to 14 eggplant (Solanum melogena Linnaeus hybrids. Mass rearing was carried out under lab conditions, with the insect feeding directly on S. viarum leaves. The study started with dual and multiple choice tests in 24 and 48 hour feeding times, by offering leaf disks in Petri dish conditions. Survival and leaf

  17. In vitro protective effects of Withania somnifera (L.) dunal root extract against hydrogen peroxide and β-amyloid(1-42)-induced cytotoxicity in differentiated PC12 cells.

    Science.gov (United States)

    Kumar, S; Seal, C J; Howes, M J R; Kite, G C; Okello, E J

    2010-10-01

    Withania somnifera L. Dunal (Solanaceae), also known as 'ashwagandha' in Sanskrit and as 'Indian ginseng', is used widely in Ayurvedic medicine as a nerve tonic and memory enhancer, with antiaging, antistress, immunomodulatory and antioxidant properties. There is a paucity of data on the potential neuroprotective effects of W. somnifera root, as traditionally used, against H(2)O(2)- and Aβ((1-42))-induced cytotoxicity which are current targets for novel approaches to treat dementia, especially dementia of the Alzheimer's type (AD). In this study, an aqueous extract prepared from the dried roots of W. somnifera was assessed for potential protective effects against H(2)O(2)- and Aβ((1-42))-aggregated fibril cytotoxicity by an MTT assay using a differentiated rat pheochromocytoma PC12 cell line. The results suggest that pretreatments of differentiated PC12 cells with aqueous extracts of W. somnifera root significantly protect differentiated PC12 cells against both H(2)O(2)- and Aβ((1-42))-induced cytotoxicity, in a concentration dependent manner. To investigate the compounds that could explain the observed effects, the W. somnifera extract was analysed by liquid chromatography-serial mass spectrometry and numerous withanolide derivatives, including withaferin A, were detected. These results demonstrate the neuroprotective properties of an aqueous extract of W. somnifera root and may provide some explanation for the putative ethnopharmacological uses of W. somnifera for cognitive and other neurodegenerative disorders that are associated with oxidative stress. Copyright © 2010 John Wiley & Sons, Ltd.

  18. Mechanitis polymnia casabranca and Ithomia lichyi lichyi (Lepidoptera: Nymphalidae damaging tree of Solanum granuloso-leprosum (Solanaceae

    Directory of Open Access Journals (Sweden)

    Wagner de Souza Tavares

    2014-03-01

    Full Text Available The Zona da Mata region is located in southeastern Minas Gerais State, Brazil with fauna and flora diversified, including herbivorous insects and Solanaceae plants. Ithomiinae caterpillars were observed damaging tree of Solanum granuloso-leprosum Dunal (Solanaceae, used for different purposes and abundant in secondary forest. The objective of this study was to identify defoliating caterpillars of S. granuloso-leprosum at the campus of Universidade Federal de Viçosa (UFV in Viçosa, Minas Gerais State, Brazil and review host plants of Mechanitis polymnia L., 1758 (Lepidoptera: Nymphalidae. Thirteen caterpillars found damaging a tree of S. granuloso-leprosum at the campus of UFV were collected and maintained in the Laboratório de Controle Biológico de Insetos (LCBI from UFV until adult emergence. These caterpillars were of two species, being ten of the first and three of the second species. Adult specimens of the latter species were identified as Ithomia lichyi lichyi D'Almeida, 1939 (Lepidoptera: Nymphalidae in the Departamento de Zoologia of Universidade Federal do Paraná (UFPR in Curitiba, Paraná State, Brazil and of the group of ten caterpillars as Mechanitis polymnia casabranca Haensch, 1905 (Lepidoptera: Nymphalidae in the Museu de Zoologia of Universidade de São Paulo (USP in São Paulo State, Brazil. This is the first report of M. polymnia casabranca and I. lichyi lichyi together damaging plant of S. granuloso-leprosum in the Zona da Mata region of Minas Gerais State, Brazil and 57 plants are recorded as host of M. polymnia.

  19. Chemical Constituents from Solanum glabratum Dunal var. sepicula

    Directory of Open Access Journals (Sweden)

    Essam Abdel-Sattar

    2015-01-01

    Full Text Available In the course of screening program of Saudi plants for their potential biological activity, the methanolic extract of Solanum glabratum Dunal var. sepicula as well as its different fractions were tested for its possible cytoxicity in prostate cancer (PC3 and colon cancer (HT29 cell lines using the MTT assay. In the present study, three spirostan saponins and one flavonoid glycoside were isolated from the active n-butanol fraction through a bio-guided fractionation approach. Two new saponin glycosides were identified as 23-β-D-glucopyranosyl (23S, 25R-spirost-5-en-3, 23 diol 3-O-α-L-rhamnopyranosyl-(1→2-O-[α-L-rhamnopyranosyl-(1→4]-β-D-glucopyranoside (2 and (25R-spirost-5-en-3-ol 3-O-α-L-rhamnopyranosyl-(1→2-O-[β-D-glucopyranosyl-(1→3]-β-D-galactopyranoside (3. In addition, two known compounds were also isolated and identified as isorhamnetin-3-O-α-L-rhamnopyranosyl (1→6 β-D-glucopyranoside (1 and (23S, 25R-spirost-5-en-3, 23 diol 3-O-α-L-rhamnopyranosyl-(1→2-O-[α-L-rhamnopyranosyl-(1→4]-β-D-glucopyranoside (4. The structures of the isolated compounds were elucidated based on their MS, one dimensional and extensive two dimensional NMR spectral data. Among the isolated metabolites, compound 3 showed the highest cytotoxic activity in both PC3 and HT29 cell lines with an IC 50 values of 14.8 and 19.5 m g/mL, respectively.

  20. Stability indicating studies on NMITLI 118RT+ (standardized extract of withania somnifera dunal)

    OpenAIRE

    Ahmad, Hafsa; Khandelwal, Kiran; Pachauri, Shakti Deep; Sanghwan, Rajender Singh; Dwivedi, Anil Kumar

    2014-01-01

    Background: Withania somnifera Dunal (Ashwagandha) is an Indian medicinal plant of great medicinal value; used in many clinically proven conditions. NMITLI-118RT+ is a candidate drug under a Council of Scientific and Industrial Research (CSIR) networking project. It is a chemotype of W. somnifera's root extract, which has been used for the present study. Objectives: The present investigation aims to develop and validate a simple isocratic reverse phase-high performance liquid chromatography (...

  1. THE CULTURE OF ASIMINA TRILOBA (L. DUNAL SEEDLINGS WITH A VIEW TOWARD THEIR DEVELOPMENT AS PLANTING MATERIAL

    Directory of Open Access Journals (Sweden)

    Beatrice Agneta Szilagyi

    2015-07-01

    Full Text Available Asimina triloba (L. Dunal, an exotic North American temperate-climate species, is little known or appreciated in Europe, especially in Romania. This work, with its goal of remodeling green spaces in Baia Mare by introducing the decorative species Asimina triloba (L. Dunal, proposes to test seedlings of the species in forced cultivation for producing vigorous dendrological material in a reduced time frame. Thus, in the course of experiments that took place from January to May 2014, the ecological valences of Asimina triloba were measured. The pedoclimatic conditions experienced were favorable to the growth and development of the plant in question.

  2. Production of Pharmaceutical Proteins in Solanaceae Food Crops

    Directory of Open Access Journals (Sweden)

    Giorgio De Guzman

    2013-01-01

    Full Text Available The benefits of increased safety and cost-effectiveness make vegetable crops appropriate systems for the production and delivery of pharmaceutical proteins. In particular, Solanaceae edible crops could be inexpensive biofactories for oral vaccines and other pharmaceutical proteins that can be ingested as minimally processed extracts or as partially purified products. The field of crop plant biotechnology is advancing rapidly due to novel developments in genetic and genomic tools being made available today for the scientific community. In this review, we briefly summarize data now available regarding genomic resources for the Solanaceae family. In addition, we describe novel strategies developed for the expression of foreign proteins in vegetable crops and the utilization of these techniques to manufacture pharmaceutical proteins.

  3. Highly Oxygenated Flavonoids from the Leaves of Nicotiana plumbaginifolia (Solanaceae)

    OpenAIRE

    Md. Shafiullah Shajib; Bidyut Kanti Datta; Md. Hossain Sohrab; Mohammad Abdur Rashid; Lutfun Nahar; Satyajit Dey Sarker

    2017-01-01

    Nicotiana plumbaginifolia Viv. is an annual herb of the family Solanaceae, which grows abundantly in the weedy lands of Bangladesh . This plant possesses analgesic, antibacterial, anti-anxiety and hepatoprotective properties, and produces various phenolic compounds including flavonoids. The present study afforded determination of total phenolic and flavonoid contents, and for the first time, the isolation and characterization of highly oxygenated flavonoids, e.g., 3,3' ,5,6,7,8-hexamethoxy- 4...

  4. Lectotypifications, synonymy, and a new name in Capsicum (Solanoideae, Solanaceae)

    Science.gov (United States)

    Barboza, Gloria E.

    2011-01-01

    Abstract Considerable confusion exists within Capsicum (Solanaceae) regarding the status and typification of several names, in part due to misidentifications. Some types were destroyed in Berlin during the Second World War, some have not been found by modern systematics, while others exhibit uncertain locality data or contain material from more than one species. Fourteen lectotypes, synonyms, and a new name, Capsicum eshbaughii Barboza nom. nov.,are proposed here. PMID:22171173

  5. In vivo and in vitro production of some genotypes of cherry tomato Solanum lycopersicum var. cerasiforme (Dunal)

    OpenAIRE

    Koleva Gudeva, Liljana; Dedejski, George

    2012-01-01

    Cherry tomato is a variety that is poorly present at Macedonian fields, mainly due to the traditional habits of the consumers and the commercial tomato producers to grow tomato varieties with large fruit. Cherry tomato - Lycopersicon esculentum Mill. var. cerasiforme (Dunal) is a tomato variety with small fruit, while having different shapes and colors, and it is used mainly for fresh consumption. The features of this variety are portrayed its sweetness and aroma, which further enriche the ta...

  6. STUDY THE MORPHOLOGY OF ASIMINA TRILOBA (L. DUNAL FRUITS AND SEEDS OBTAINED IN THE TRANSYLVANIA REGION OF ROMANIA

    Directory of Open Access Journals (Sweden)

    Beatrice Agneta Szilagyi

    2016-07-01

    Full Text Available The fruit tree Asimina triloba (L. Dunal originates in the temperate zones of North America. Its fruits are edible and have great nutritional value. The fruits' commercial potential contributes to a growing demand for information about this plant in Romania. A series of morphological observations were performed on the fruits and seeds of Asimina plants adapted to the temperate climate of the Transylvania zone of Romania.

  7. Solanaceae endémicas del Perú

    Directory of Open Access Journals (Sweden)

    Sandra Knapp

    2013-10-01

    Full Text Available La familia Solanaceae es una de las más ricas en especies en la flora peruana, siendo reconocida con alrededor de 42 géneros y 600 especies (Brako & Zarucchi, 1993; Ulloa Ulloa et al., 2004, principalmente hierbas y arbustos. En este trabajo reconocemos 208 especies y seis variedades como endémicos, en 16 géneros. Esta familia ocupa el sexto lugar por su diversidad en especies endémicas, siendo Solanum, Nolana y Jaltomata los géneros más ricos en especies. Los taxones endémicos se encuentran en la mayoría de las regiones, principalmente en Mesoandina, Desierto Semicálido Tropical y Bosques Muy Húmedos Montanos, desde el nivel del mar hasta los 3800 m de altitud. Treinta y seis taxones se encuentran representados dentro del Sistema Nacional de Áreas Naturales Protegidas por el Estado.

  8. Unilateral incompatibility in Capsicum (Solanaceae): occurrence and taxonomic distribution.

    Science.gov (United States)

    Onus, A Naci; Pickersgill, Barbara

    2004-08-01

    Unilateral incompatibility (UI) occurs when pollinations between species are successful in one direction but not in the other. Self-incompatible (SI) species frequently show UI with genetically related, self-compatible (SC) species, as pollen of SI species is compatible on the SC pistil, but not vice versa. Many examples of unilateral incompatibility, and all those which have been studied most intensively, are found in the Solanaceae, particularly Lycopersicon, Solanum, Nicotiana and Petunia. The genus Capsicum is evolutionarily somewhat distant from Lycopersicon and Solanum and even further removed from Nicotiana and Petunia. Unilateral incompatibility has also been reported in Capsicum; however, this is the first comprehensive study of crosses between all readily available species in the genus. All readily available (wild and domesticated) species in the genus are used as plant material, including the three genera from the Capsicum pubescens complex plus eight other species. Pollinations were made on pot-grown plants in a glasshouse. The number of pistils pollinated per cross varied (from five to 40 pistils per plant), depending on the numbers of flowers available. Pistils were collected 24 h after pollination and fixed for 3-24 h. After staining, pistils were mounted in a drop of stain, squashed gently under a cover slip and examined microscopically under ultra-violet light for pollen tube growth. Unilateral incompatibility is confirmed in the C. pubescens complex. Its direction conforms to that predominant in the Solanaceae and other families, i.e. pistils of self-incompatible species, or self-compatible taxa closely related to self-incompatible species, inhibit pollen tubes of self-compatible species. Unilateral incompatibility in Capsicum does not seem to have arisen to prevent introgression of self-compatibility into self-incompatible taxa, but as a by-product of divergence of the C. pubescens complex from the remainder of the genus.

  9. Prolonged Adaptive Evolution of a Defensive Gene in the Solanaceae.

    Science.gov (United States)

    Rausher, Mark D; Huang, Jie

    2016-01-01

    Although plants and their natural enemies may coevolve for prolonged periods, little is known about how long individual plant defensive genes are involved in the coevolutionary process. We address this issue by examining patterns of selection on the defensive gene threonine deaminase (TD). Tomato (Solanum lycopersicum) has two copies of this gene. One performs the canonical housekeeping function in amino acid metabolism of catalyzing the first reaction in the conversion of threonine to isoleucine. The second copy functions as an antinutritive defense against lepidopteran herbivores by depleting threonine in the insect gut. Wild tobacco (Nicotiana attenuata) also contains a defensive copy. We show that a single copy of TD underwent two or three duplications near the base of the Solanaceae. One copy retains the housekeeping function, whereas a second copy evolved defensive functions. Positive selection occurred on the branch of the TD2 gene tree subtending the common ancestor of the Nicotianoideae and Solanoideae. It also occurred within the Solanoideae clade but not within the Nicotianoideae clade. Finally, it occurred on most branches leading from the common ancestor to S. lycopersicum. Based on recent calibrations of the Solanaceae phylogeny, TD2 experienced adaptive substitutions for a period of 30-50 My. We suggest that the most likely explanation for this result is fluctuating herbivore abundances: When herbivores are rare, relaxed selection increases the likelihood that slightly disadvantageous mutations will be fixed by drift; when herbivores are common, increased selection causes the evolution of compensatory adaptive mutations. Alternative explanations are also discussed. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Efficacy of Ashwagandha (Withania somnifera [L.] Dunal) in improving cardiorespiratory endurance in healthy athletic adults.

    Science.gov (United States)

    Choudhary, Bakhtiar; Shetty, A; Langade, Deepak G

    2015-01-01

    Ashwagandha (Withania somnifera [L.] Dunal) has been traditionally used for various actions ranging from vitalizer, improve endurance and stamina, promote longevity, improve immunity, and male and female fertility. However, clinical studies are needed to prove the clinical efficacy of this herb, especially in cardiovascular endurance and physical performance. This prospective, double-blind, randomized, and placebo-controlled study evaluated the efficacy of Ashwagandha roots extract in enhancing cardiorespiratory endurance and improving the quality of life (QOL) in 50 healthy male/female athletic adults. Cardiorespiratory endurance was assessed by measuring the oxygen consumption at peak physical exertion (VO2 max) levels during a 20 m shuttle run test. The World Health Organization self-reported QOL questionnaire (physical health, psychological health, social relationships, and environmental factors) was used to assess the QOL. Student's t-test was used to compare the differences in a mean and change from baseline VO2 max levels, whereas Wilcoxon signed-rank test was used to assess changes in QOL scores from baseline in the two groups. There was a greater increase from baseline (P < 0.0001) in the mean VO2 max with KSM-66 Ashwagandha (n = 24) compared to placebo (n = 25) at 8 weeks (4.91 and 1.42, respectively) and at 12 weeks (5.67 and 1.86 respectively). The QOL scores for all subdomains significantly improved to a greater extent in the Ashwagandha group at 12 weeks compared to placebo (P < 0.05). The findings suggest that Ashwagandha root extract enhances the cardiorespiratory endurance and improves QOL in healthy athletic adults.

  11. A new commelinid monocot seed fossil from the early Eocene previously identified as Solanaceae.

    Science.gov (United States)

    Särkinen, Tiina; Kottner, Sören; Stuppy, Wolfgang; Ahmed, Farah; Knapp, Sandra

    2018-01-01

    Fossils provide minimum age estimates for extant lineages. Here we critically evaluate Cantisolanum daturoides Reid & Chandler and two other early putative seed fossils of Solanaceae, an economically important plant family in the Asteridae. Three earliest seed fossil taxa of Solanaceae from the London Clay Formation (Cantisolanum daturoides) and the Poole and Branksome Sand Formations (Solanum arnense Chandler and Solanispermum reniforme Chandler) were studied using x-ray microcomputed tomography (MCT) and scanning electron microscopy (SEM). The MCT scans of Cantisolanum daturoides revealed a high level of pyrite preservation at the cellular level. Cantisolanum daturoides can be clearly excluded from Solanaceae and has more affinities to the commelinid monocots based on a straight longitudinal axis, a prominent single layer of relatively thin-walled cells in the testa, and a clearly differentiated micropyle surrounded by radially elongated and inwardly curved testal cells. While the MCT scans show no internal preservation in Solanum arnense and Solanispermum reniforme, SEM images show the presence of several characteristics that allow the placement of these taxa at the stem node of Solanaceae. Cantisolanum daturoides is likely a member of commelinid monocots and not Solanaceae as previously suggested. The earliest fossil record of Solanaceae is revised to consist of fruit fossil with inflated calyces from the early Eocene of Patagonia (52 Ma) and fossilized seeds from the early to mid-Eocene of Europe (48-46 Ma). The new identity for Cantisolanum daturoides does not alter a late Cretaceous minimum age for commelinids. © 2018 Botanical Society of America.

  12. Highly Oxygenated Flavonoids from the Leaves of Nicotiana plumbaginifolia (Solanaceae

    Directory of Open Access Journals (Sweden)

    Md. Shafiullah Shajib

    2017-11-01

    Full Text Available Nicotiana plumbaginifolia Viv. is an annual herb of the family Solanaceae, which grows abundantly in the weedy lands of Bangladesh . This plant possesses analgesic, antibacterial, anti-anxiety and hepatoprotective properties, and produces various phenolic compounds including flavonoids. The present study afforded determination of total phenolic and flavonoid contents, and for the first time, the isolation and characterization of highly oxygenated flavonoids, e.g., 3,3' ,5,6,7,8-hexamethoxy- 4',5'-methylenedioxyflavone (1, 3,3' ,4' ,5',5,6,7,8-octamethoxyflavone (2, exoticin, 6,7,4',5'-dimethylenedioxy-3,5,3'-trimethoxyflavone (3 and ( 3,3' ,4',5,5',8-hexamethoxy-6,7-methylenedioxyflavone (4 from the leaves of N. plumbaginifolia . All these flavonoids are rather rare natural products, and only found in a few genera, e.g.,Polygonum and Murraya. The structures of the isolated flavonoids were elucidated by comprehensive spectroscopic analyses, e.g., UV, 1H, 13C NMR, DEPT, HSQC, HMBC and MS.

  13. Leaf Structure and Taxonomy of Petunia and Calibrachoa (Solanaceae

    Directory of Open Access Journals (Sweden)

    Claudia dos Reis

    2002-03-01

    Full Text Available We studied the leaf anatomy of sixteen species of Calibrachoa and eight species of Petunia. In Calibrachoa leaves, the vascular bundles sheath (endodermis was formed by parenchymatous developed cells, different from those of the mesophyll. In Petunia, this sheath did not show a marked morphological differentiation. The Calibrachoa leaves could be separated according to the type of leaf margins, the distribution of the stomata on leaf surfaces, the organization of the mesophyll and the morphology of the trichomes. Based on these results, an indented dichotomous identification key was elaborated for the species of the genus Calibrachoa.Foram estudados, sob o ponto de vista anatômico, os limbos foliares de dezesseis espécies de Calibrachoa Llav. & Lex. e de oito espécies de Petunia Juss. (Solanaceae. Em Calibrachoa, a bainha que envolve os feixes vasculares (endoderme é formada por células desenvolvidas e distintas das do mesofilo. Em Petunia, esta bainha não apresenta diferenciação morfológica marcante. As folhas das espécies de Calibrachoa foram separadas entre si levando-se em conta a distribuição dos estômatos nas faces foliares, a organização do mesofilo, o tipo de bordo e a morfologia dos tricomas. Com base nesses resultados, foi elaborada uma chave dicotômica indentada de identificação para as espécies do gênero Calibrachoa.

  14. Isolation barriers between petunia axillaris and Petunia integrifolia (Solanaceae).

    Science.gov (United States)

    Dell'olivo, Alexandre; Hoballah, Maria Elena; Gübitz, Thomas; Kuhlemeier, Cris

    2011-07-01

    The isolation barriers restricting gene flow between populations or species are of crucial interest for understanding how biological species arise and how they are maintained. Few studies have examined the entire range of possible isolation barriers from geographic isolation to next generation hybrid viability. Here, we present a detailed analysis of isolation barriers between two flowering plant species of the genus Petunia (Solanaceae). Petunia integrifolia and P. axillaris feature divergent pollination syndromes but can produce fertile hybrids when crossed in the laboratory. Both Petunia species are primarily isolated in space but appear not to hybridize in sympatry. Our experiments demonstrate that pollinator isolation is very high but not strong enough to explain the absence of hybrids in nature. However, pollinator isolation in conjunction with male gametic isolation (i.e., pollen-pistil interaction) can explain the lack of natural hybridization, while postzygotic isolation barriers are low or nonexistent. Our study supports the notion that reproductive isolation in flowering plants is mainly caused by pre- rather than postzygotic isolation mechanisms. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  15. Efficacy and Safety of Ashwagandha (Withania somnifera (L.) Dunal) Root Extract in Improving Memory and Cognitive Functions.

    Science.gov (United States)

    Choudhary, Dnyanraj; Bhattacharyya, Sauvik; Bose, Sekhar

    2017-11-02

    Cognitive decline is often associated with the aging process. Ashwagandha (Withania somnifera (L.) Dunal) has long been used in the traditional Ayurvedic system of medicine to enhance memory and improve cognition. This pilot study was designed to evaluate the efficacy and safety of ashwagandha (Withania somnifera (L.) Dunal) in improving memory and cognitive functioning in adults with mild cognitive impairment (MCI). A prospective, randomized, double-blind, placebo-controlled study was conducted in 50 adults. Subjects were treated with either ashwagandha-root extract (300 mg twice daily) or placebo for eight weeks. After eight weeks of study, the ashwagandha treatment group demonstrated significant improvements compared with the placebo group in both immediate and general memory, as evidenced by Wechsler Memory Scale III subtest scores for logical memory I (p = 0.007), verbal paired associates I (p = 0.042), faces I (p = 0.020), family pictures I (p = 0.006), logical memory II (p = 0.006), verbal paired associates II (p = 0.031), faces II (p = 0.014), and family pictures II (p = 0.006). The treatment group also demonstrated significantly greater improvement in executive function, sustained attention, and information-processing speed as indicated by scores on the Eriksen Flanker task (p = 0.002), Wisconsin Card Sort test (p = 0.014), Trail-Making test part A (p = 0.006), and the Mackworth Clock test (p = 0.009). Ashwagandha may be effective in enhancing both immediate and general memory in people with MCI as well as improving executive function, attention, and information processing speed.

  16. Palinologia de espécies de Solanum L. (Solanaceae A. Juss. ocorrentes nas restingas do Estado do Rio de Janeiro, Brasil Palynology of species of Solanum L. (Solanaceae A. Juss. from the restingas of Rio de Janeiro State, Brazil

    Directory of Open Access Journals (Sweden)

    Carla Patrícia Rodrigues Batista-Franklim

    2008-09-01

    Full Text Available Foram estudados 21 táxons de Solanum L., com o objetivo de caracterizá-los palinologicamente e, assim, contribuir para a elaboração de um catálogo polínico da flora das restingas do Estado do Rio de Janeiro. Os táxons examinados foram Solanum affine Sendtn., Solanum americanum Mill. var. americanum,Solanum argenteum Dunal ex Poir., Solanum aturense Dunal, Solanum caavurana Vell., Solanum capsicoides All., Solanum carautae Carv., Solanum cordifolium Dunal, Solanum curvispinum Dunal, Solanum echidnaeforme Dunal, Solanum gardneri Sendtn.,Solanum indigoferum A. St.-Hil., Solanum insidiosum Mart., Solanum mauritianum Scop., Solanum paludosum Moric., Solanum paniculatum L., Solanum paratyense Vell., Solanum pseudoquina A.St.-Hil., Solanum sisymbriifolium Lam., Solanum torvum Sw., Solanum velleum Sw. Os grãos de pólen foram acetolisados, mensurados, descritos e fotomicrografados. A análise sob microscopia eletrônica de varredura foi utilizada, em grãos de pólen não acetolisados, para confirmar as descrições feitas sob microscopia de luz e, em alguns casos para confirmar as descrições de abertura e ornamentação. Constatou-se que os grãos de pólen são pequenos ou médios, isopolares, subprolatos a oblato-esferoidais, 3-colporados, sexina granulada, rugulado-granulada ou escabrada. Pela análise dos resultados obtidos pôde-se concluir que os táxons analisados apresentam certa heterogeneidade polínica, quanto à forma, aos atributos das aberturas e à ornamentação da sexina, podendo-se usar estes caracteres na taxonomia do gênero.In this study 21 taxa of Solanum L. were investigated for palynological characterization and to contribute to the Pollen Catalog of the Flora of the Rio de Janeiro restingas. The taxa analysed were Solanum affine Sendtn., Solanum americanum Mill. var. americanum,Solanum argenteum Dunal ex Poir., Solanum aturense Dunal, Solanum caavurana Vell., Solanum capsicoides All., Solanum carautae Carv., Solanum

  17. EVALUATION OF MORPHOLOGICAL PARAMETERS OF FLOWERING BUDS AND FLOWERING ON ASIMINA TRILOBA (L. DUNAL IN THE CONTEXT OF CLIMATE CHANGE IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Beatrice Agneta Szilagyi

    2017-07-01

    Full Text Available In the context of climate change in Romania, we proposed to study the improvement of the country's flora by introducing an ornamental and beneficial species of temperate climate. Studies undertaken in spring 2017 indicate that Asimina triloba (L. Dunal flowers under conditions in Romania similar to those in the area of origin. Thus, we found that the beginning of vegetation in flowering buds took place in the first tenth of April and continued in stages until the start of the third trimester of April, when the flowering bud dimensions were over 15 mm in diameter, while the entire period of flowing took place from 24.04-20.05. One influence on the start of vegetation in flowing buds was the average daytime temperature recorded in the planting zone of Asimina triloba (L. Dunal studied, which compared with historical averages was twice as high.

  18. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

    2016-01-01

    Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

  19. Characterization and evaluation of some lines from cherry tomatoes lycopersicon esculentum mill. Var. Cerasiforme (dunal) and their ability for micropropagation in in vitro conditions

    OpenAIRE

    Dedejski, George

    2012-01-01

    Tomato production in the Republic of Macedonia is present on more than 5700 hectares, being the leading vegetable crop in the region of Strumica. Cherry tomato however, is poorly present at our fields, mainly due to the traditional habits of the consumers and the commercial tomato producers to grow tomato varieties with large fruit. Cherry tomato - Lycopersicon esculentum Mill. var. cerasiforme (Dunal) is a tomato variety with small fruit, with different shapes and colors and it is used ma...

  20. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  1. ?ndices f?sico-qu?micos e toxicol?gicos de frutos de c?bio (solanum sessiliflorum dunal) em diferentes est?dios de matura??o.

    OpenAIRE

    Andrade J?nior, Moacir Couto de

    2006-01-01

    O c?bio (Solanum sessiliflorum Dunal) ? um fruto com elevado potencial agroindustrial devido ? sua alta produtividade anual e caracter?sticas nutricionais (alto teor em fibras diet?ticas). Al?m disso, as fibras est?o contidas nos alimentos vegetais e t?m fun??es preventivas de doen?as cr?nico-degenerativas, a exemplo do diabetes mellitus e (ou) das dislipidemias, o que as situa na categoria de alimentos funcionais ou nutrac?uticos. N?o obstante, se, por um lado, algum conhecimento acerca do ...

  2. Quantificação de macro e micro nutrientes em algumas etnovariedades de cubiu (Solanum sessiliflorum Dunal Macro and micro nutrients quantification of some cubiu ethnovarieties (Solanum sessiliflorum Dunal

    Directory of Open Access Journals (Sweden)

    Lúcia K. O. Yuyama

    2007-01-01

    Full Text Available Considerando a ampla variabilidade genética de cubiu (Solanum sessiliflorum Dunal, quantificaram-se os macro e micro-nutrientes, objetivando a ampliação da tabela de composição química de alimentos típicos da região amazônica. Os frutos provenientes da Estação Experimental de Hortaliças Alejo von der Pahlen (EEH do Instituto Nacional de Pesquisas da Amazônia (INPA, localizados no km 14 da Rodovia AM 010 em Manaus, AM, foram processados no Laboratório de Alimentos e Nutrição do INPA. Avaliaram-se oito etnovariedades de cubiu identificados como: 2 I, 3 I, 6, 7, 12, 14, 17, 29 I e III em estádio de maturação comercial. Os teores de elementos minerais foram quantificados pela técnica de Ativação por Nêutrons Instrumental e a fibra alimentar pelo método enzímico-gravimétrico. Os resultados demonstram ser o cubiu um fruto com baixo conteúdo energético (média de 33 kcal, com conteúdo de fibra alimentar total na ordem de 1,6%. Em relação aos macros elementos minerais, a etnovariedade 6, apresentou a maior concentração em potássio (513,5±3,1mg, cálcio (18,9±0,6mg e a etnovariedade 2 I em Fe (564,4±58,1µg e Cr (99,3±8,3µg. A menor concentração foi constatada na etnovariedade 12 para os elementos K (229,0±4,5mg, Na (53,7±5,5µg e Zn (89,3±4,7µg. Apesar das variações em relação as diferentes etno variedades e conseqüentemente concentrações em elementos minerais, o cubiu, pode estar contribuindo para atingir as recomendações desses nutrientes.Considering the wide genetic variability of cubiu (Solanum sessiliflorum Dunal, its chemical composition was quantified in order to contribute to the chemical composition table of typical Amazonian foods. The cubiu fruit was collected at Alejo von der Pahlen (EEH experimental station from National Research Institute of Amazonia (INPA. Eight ethno varieties of cubiu identified as 2 I, 3 I, 6, 7, 12, 14, 17, 29 I and III were analyzed. All samples used were ripe

  3. In silico analysis of Simple Sequence Repeats from chloroplast genomes of Solanaceae species

    Directory of Open Access Journals (Sweden)

    Evandro Vagner Tambarussi

    2009-01-01

    Full Text Available The availability of chloroplast genome (cpDNA sequences of Atropa belladonna, Nicotiana sylvestris, N.tabacum, N. tomentosiformis, Solanum bulbocastanum, S. lycopersicum and S. tuberosum, which are Solanaceae species,allowed us to analyze the organization of cpSSRs in their genic and intergenic regions. In general, the number of cpSSRs incpDNA ranged from 161 in S. tuberosum to 226 in N. tabacum, and the number of intergenic cpSSRs was higher than geniccpSSRs. The mononucleotide repeats were the most frequent in studied species, but we also identified di-, tri-, tetra-, pentaandhexanucleotide repeats. Multiple alignments of all cpSSRs sequences from Solanaceae species made the identification ofnucleotide variability possible and the phylogeny was estimated by maximum parsimony. Our study showed that the plastomedatabase can be exploited for phylogenetic analysis and biotechnological approaches.

  4. ANÁLISIS CARIOTÍPICO DE CAPSICUM PUBESCENS (SOLANACEAE "ROCOTO"

    Directory of Open Access Journals (Sweden)

    Misael Guevara

    2014-06-01

    Full Text Available Análisis cariotípico de Capsicum pubescens R&P (Solanaceae. Los cromosomas han sido descritos, comparados y dibujados, usando una técnica de coloración modificada, C. pubescens tiene un número cromosómico diploide 2n = 24, de los cuales 11 pares son metacéntricos y 1 par submetacéntrico.

  5. Content of atropine and scopolamine in poisonous solanaceae plants from Slovenia

    OpenAIRE

    Javor Kac; Uroš Klančar; Aleš Mlinarič; Aleš Krbavčič

    2006-01-01

    Background: Some species from the Solanaceae family are still the cause of serious poisoning among youth in Slovenia. Usually intoxication is due to abuse of these plants to provoke hallucinations. There is still not enough data about the alkaloid content of these plants growing in Slovenia.Methods: Different plant samples were analyzed for the content of atropine and scopolamine with capillary electrophoresis after solid phase extraction of alkaloids. Plants were gathered from different area...

  6. The historical role of species from the Solanaceae plant family in genetic research

    OpenAIRE

    Gebhardt, Christiane

    2016-01-01

    Key message This article evaluates the main contributions of tomato, tobacco, petunia, potato, pepper and eggplant to classical and molecular plant genetics and genomics since the beginning of the twentieth century. Abstract Species from the Solanaceae family form integral parts of human civilizations as food sources and drugs since thousands of years, and, more recently, as ornamentals. Some Solanaceous species were subjects of classical and molecular genetic research over the last 100?years...

  7. Intoxicação por Cestrum laevigatum (Solanaceae em bubalinos Poisoning by Cestrum laevigatum (Solanaceae in buffaloes

    Directory of Open Access Journals (Sweden)

    José Diomedes Barbosa

    2010-12-01

    ões necrosadas observou-se um halo de hepatócitos com vacuolização.Based on the history and clinical and pathological data, as well as on inspection of the pastures, a mortality of buffaloes in the county of Itaguaí/RJ, Brazil, was diagnosed as poisoning by Cestrum laevigatum Schlecht., a plant of the Solanaceae family. The poisoning was reproduced in two buffaloes. Dried leaves of the shrub were administered by hand, in single doses corresponding to 20g/kg and 40g/kg of the fresh leaves, to four buffaloes of the Murrah breed. The dose corresponding to 40g/kg of the fresh leaves caused signs of poisoning, as apathy, anorexia, absence of rumen movements, dysmetria, excitement and aggressiveness, followed by death of the two buffaloes within 65 hours after administration. From the two buffaloes that received the corresponding dose of 20g/kg of the fresh plant, one presented clinical signs characterized mainly by decrease of the rumen movements, but recovered 97h22min after the administration; the other buffalo did not show symptoms of poisoning. Laboratory analyses for biochemical evaluation accused hepatic alterations. In one buffalo that died, the main macroscopic finding was an orange liver with a clear nutmeg appearance; in the second buffalo, the orange liver had no nutmeg appearance. Other alterations found in these two buffaloes were slight edema of the gall bladder wall, a slightly reddish mucous membrane of the abomasum, extensive echymoses in the endocard of the left ventricle and few petechiae in the endocard of the right ventricle; the abomasum content was slightly dry, and the large intestine had little and slightly dry contents wrapped by mucus. Histopatological examination revealed severe coagulative necrosis of the liver parenchyma in the centrolobular and intermediate lobular areas, with a halo of vacuolated hepatocytes at the periphery of the necrotic areas.

  8. Algunos aspectos técnicos sobre la liofilización de pulpa de cocona (Solanum sessiliflorum Dunal

    Directory of Open Access Journals (Sweden)

    Leynard Natividad Marín

    2013-12-01

    Full Text Available La cocona (Solanum sessiliflorum Dunal es una fruta ampliamente distribuida en la Amazonia Sudamericana, con buenas características nutricionales y antioxidantes. El objetivo de este trabajo fue deshidratar la pulpa de cocona mediante liofilización para evaluar algunos aspectos técnicos de un nuevo tipo de producto que permita su mejor comercialización y mayores usos en la industria alimentaria. Los frutos fueron adquiridos en el Mercado Central de Frutas de Lima (Perú y procesados en el Centro Experimental Tecnológico de la Universidad Nacional del Callao (Callao, Perú. Fue realizado un acondicionamiento y liofilización de la materia prima; en el primero la muestra fue cortada, escaldada, pelada, despulpada, refinada y concentrada al vacío a temperatura de baño de 60 ºC durante 15 minutos y presión de -800 mbar; mientras que en la segunda, se congelaron previamente las muestras durante 12 horas a -20 ºC para su sublimación durante 24 horas a una presión inferior a 200 μHg. Asimismo, se determinaron los rendimientos y contenidos de humedad en el proceso. Se realizaron caracterizaciones en la pulpa refinada, muestra liofilizada y en la pulpa liofilizada reconstituida: contenido de humedad, proteína, extracto etéreo, cenizas, carbohidratos incluido el contenido de fibra, densidad, viscosidad, sólidos solubles, azúcares reductores, acidez titulable, pH y solubilidad, según fue el caso. Se obtuvo un polvo higroscópico, con solubilidad en agua de 84,33 % y con ligeras variaciones en sus características con respecto al producto inicial.

  9. Caavuranamide, a novel steroidal alkaloid from the ripe fruits of Solanum caavurana Vell. (Solanaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Vaz, Nelissa Pacheco; Santos, Erica L.; Marques, Francisco A.; Maia, Beatriz H.L.N. Sales, E-mail: noronha@ufpr.br [Departamento de Quimica, Universidade Federal do Parana, Centro Politecnico, Curitiba, PR (Brazil); Costa, Emmanoel V. [Departamento de Quimica, Universidade Federal de Sergipe, Sao Cristovao, SE (Brazil); Mikich, Sandra Bos [Laboratorio de Ecologia, Embrapa Florestas, Colombo, PR (Brazil); Braga, Raquel M. [Instituto de Quimica, Universidade Estadual de Campinas, SP (Brazil); Delarmelina, Camila; Duarte, Marta C.T. [Divisao de Microbiologia, Centro Pluridisciplinar de Pesquisas Quimicas Biologicas e Agricolas (CPQBA), Universidade Estadual de Campinas, SP (Brazil); Duarte, Marta C.T.; Ruiz, Ana Lucia T.G.; Souza, Vanessa H.S.; Carvalho, Joao E. de [Divisa de Farmacologia e Toxicologia, Centro Pluridisciplinar de Pesquisas Quimicas Biologicas e Agricolas (CPQBA), Universidade Estadual de Campinas, SP (Brazil)

    2012-07-01

    Phytochemical investigation of the ripe fruits of Solanum caavurana Vell. (Solanaceae) afforded a novel steroidal alkaloid with spirosolane-type skeleton, named as caavuranamide, together with the alkaloids 4-tomatiden-3-one and 5{alpha}-tomatidan-3-one. Their structures were elucidated on the basis of spectroscopic methods. The antiproliferative and antimicrobial activities for the ethanolic extract, sub-fractions obtained from partition and acid-base treatment were also evaluated. Caavuranamide showed antibacterial activity similar to the chloramphenicol positive control against Rhodococcus equi. (author)

  10. Caavuranamide, a novel steroidal alkaloid from the ripe fruits of Solanum caavurana Vell. (Solanaceae)

    International Nuclear Information System (INIS)

    Vaz, Nelissa Pacheco; Santos, Erica L.; Marques, Francisco A.; Maia, Beatriz H.L.N. Sales; Costa, Emmanoel V.; Mikich, Sandra Bos; Braga, Raquel M.; Delarmelina, Camila; Duarte, Marta C.T.; Duarte, Marta C.T.; Ruiz, Ana Lucia T.G.; Souza, Vanessa H.S.; Carvalho, Joao E. de

    2012-01-01

    Phytochemical investigation of the ripe fruits of Solanum caavurana Vell. (Solanaceae) afforded a novel steroidal alkaloid with spirosolane-type skeleton, named as caavuranamide, together with the alkaloids 4-tomatiden-3-one and 5α-tomatidan-3-one. Their structures were elucidated on the basis of spectroscopic methods. The antiproliferative and antimicrobial activities for the ethanolic extract, sub-fractions obtained from partition and acid-base treatment were also evaluated. Caavuranamide showed antibacterial activity similar to the chloramphenicol positive control against Rhodococcus equi. (author)

  11. Solanaceae plant malformation in Chongqing City, China, reveals a pollution threat to the Yangtze River.

    Science.gov (United States)

    Zhang, Hongbo; Liu, Guanshan; Timko, Michael P; Li, Jiana; Wang, Wenjing; Ma, Haoran

    2014-10-21

    Water quality is under increasing threat from industrial and natural sources of pollutants. Here, we present our findings about a pollution incident involving the tap water of Chongqing City in China. In recent years, Solanaceae plants grown in greenhouses in this city have displayed symptoms of cupped, strappy leaves. These symptoms resembled those caused by chlorinated auxinic herbicides. We have determined that these symptoms were caused by the tap water used for irrigation. Using a bioactivity-guided fractionation method, we isolated a substance with corresponding auxinic activity from the tap water. The substance was named "solanicide" because of its strong bioactivity against Solanaceae plants. Further investigation revealed that the solanicide in the water system of Chongqing City is derived from the Jialing River, a major tributary of the Yangtze River. Therefore, it is also present in the Yangtze River downstream of Chongqing after the inflow of the Jialing River. Biological analyses indicated that solanicide is functionally similar to, but distinct from, other known chlorinated auxinic herbicides. Chemical assays further showed that solanicide structurally differs from those compounds. This study has highlighted a water pollution threat to the Yangtze River and its floodplain ecosystem.

  12. Estudios en Solanaceae – XXIII sobre dos especies nuevas de cuatresia Estudios en Solanaceae – XXIII sobre dos especies nuevas de Cuatresia

    Directory of Open Access Journals (Sweden)

    Hunziker Armando T.

    1986-12-01

    Full Text Available Two new Colombian species of Cuatre sia (Solanaceae, are clescribed and illustrated. Con motivo de la preparación de una sinopsis preliminar sobre Cuatresia A. T. Hunz., ha quedado en evidencia una serie de especies indescritas, 2 de las cuales presento seguidamente.  Es esta una buena oportunidad para llamar la atención de los colegas sobre este difícil y olvidado género de Solanáceas.  En su gran mayoría, las dificultades se originan en los materiales disponibles, que son escasos y fragmentarios; varias especies se conocen por una única colección (a veces con apenas 1 o 2 flores, en la mayoría se ignora cómo son el fruto, la semilla y el embrión, y en otros casos, las observaciones sobre el color de la corola son contradictorias, o imprecisas, o faltan por completo. Por todo ello, quisiera incitar a quienes tienen el privilegio de acceder a las regiones donde crecen estas plantas, a que extremen los recaudos para que las colecciones de Cuatresia mejoren en calidad y cantidad.

  13. A GIS model of habitat suitability for Solanum conocarpum (Solanaceae) in St. John, US Virgin Islands

    Science.gov (United States)

    Palumbo, Matthew D.; Fleming, Jonathan P.; Monsegur, Omar A.; Vilella, Francisco

    2016-01-01

    Solanum conocarpum (Solanaceae) (Marron Bacora) is a rare, dry-forest shrub endemic to the island of St. John, US Virgin Islands, considered for listing under the Endangered Species Act. Given its status as a species of conservation concern, we incorporated environmental characteristics of 3 observed populations and 5 additional known locations into a geographic information system (GIS) analysis to create a habitat-suitability model for the species on the island of St. John. Our model identified 1929.87 ha of highly suitable and moderately suitable habitat. Of these, 1161.20 ha (60.2%) occurred within the boundaries of Virgin Islands National Park. Our model provides spatial information on potential locations for future surveys and restoration sites for this endemic species of the US Virgin Islands.

  14. Antifungal glycoalkaloids, flavonoids and other chemical constituents of Solanum asperum Rich (Solanaceae)

    International Nuclear Information System (INIS)

    Pinto, Francisco das Chagas L.; Uchoa, Daniel Esdras de A.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo; Silva, Fernanda M. e; Theodoro, Phellipe N.E.T.; Espindola, Laila S.

    2011-01-01

    Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-alpha-L-ramnopyranosyl-kaempferol and 3-O-[beta-D-glucopyranosyl-(1->6)-alpha-L-ramnopyranosyl ]-7-O-alpha-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae). The structures of all compounds were determined by interpretation of their spectra (IR, MS, 1 H and 13 C NMR) and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 mug/mL) against four filamentous fungi species of the genera Microsporum and Trichophyton. (author)

  15. In vitro regeneration of cocona (Solanum sessiliflorum, Solanaceae) cultivars for commercial production.

    Science.gov (United States)

    Schuelter, A R; Grunvald, A K; Amaral, A T; da Luz, C L; Luz, C L; Gonçalves, L M; Stefanello, S; Scapim, C A

    2009-08-11

    Cocona (Solanum sessiliflorum Dunal) is a solanaceous shrub native to the Amazon region that produces an edible fruit. This species has numerous advantages, particularly a high nutritional value and productivity. However, due to irregular germination and rapid loss of seed viability, there are few plantations for production on a large scale. Development of alternative propagation strategies is essential for the production of homogeneous seedlings of genotypes with superior agronomic performance. We developed techniques for in vitro regeneration of the cocona varieties Santa Luzia and Thaís for large-scale production of healthy plantlets. Twenty days after seeding, seedling segments germinated in vitro were used as explant sources. Three successive experiments were performed: one to test the effect of the explant source and combinations of two growth regulators, auxin (indole acetic acid, IAA) and kinetin (KIN), on the morphogenetic response; another to investigate the effect of the combination of growth regulators on the morphogenetic response of hypocotyl segments, and another to evaluate how sucrose concentration affects the development of adventitious shoots. The best shoot induction was obtained using hypocotyl segments and stem apices, while rhizogenesis was greatest in leaves with a petiole. The number of adventitious shoots per explant on hypocotyl segments increased with 10 and 20 mg/L KIN, combined with 0.02 mg/L IAA in the variety Santa Luzia. Sucrose combined with these growth regulator levels increased the average number of calli; these were optimally produced when 45 g/L sucrose and 0.01 mg/L IAA + 20 mg/L KIN were applied. Only sucrose concentration influenced shoot proliferation in the two S. sessiliflorum varieties, with a maximum at 17.5 g/L.

  16. Morphological and physiological features of the species Asimina triloba (L. dunal, introduced as an ornamental plant in Baia Mare (Maramureş county, Romania

    Directory of Open Access Journals (Sweden)

    Beatrice SZILAGYI

    2011-11-01

    Full Text Available Tree species Asimina triloba (L. Dunal, is native to North America. In the area of origin is cultivated, both as food species because the edible fruit, and as ornamental species. Ornamental value derives both from decorative flowers, that open in early spring, and because habitus species. The species is demanding from slightly acidic soils (pH 5.5 to 7.0 and well drained. Seedlings are susceptible to heatstroke and need areas of the sun, but since the second year, vegetate well in bright light conditions [27]. Optimum climate is temperate to subtropical one. The species exhibits unique quality traits for a temperate fruit that are similar to other fruit in the Annonaceae family, including cherimoya (Annona cherimola Mill., sugar apple or sweetsop, (A. squamosa L., soursop (A. muricata L., custard apple (A. reticulata L., and atemoya (A. squamosa X A. cherimola, all of which are tropical [2].This study follows the behavior of the species, in particular conditions of the Baia Mare and its surroundings. In this area a fewindividuals were introduced, in order to diversigy the range of species of ornamental plants. In Baia Mare, topoclimate is specifically depression, sheltered by mountains, more atenuated as temperature and winds, than in surrounding areas. As a result ofclimatic conditions, chestnut Castanea sativa, grows in good conditions in Baia Mare. Instead, the area is heavily polluted,especially at ground level. Pollution by heavy metals is a historical being generated by the mining industry.The introduction and use of a new plant species into a new area involves: 1. easy to obtain seed; 2.- maintaining the crown shape habitus and and leaf shape and size, respectively; 3 – determination of optimal physiological parameters. Therefore have been performed, the following experimental determinations: 1. - germination of seed obtained in the particular conditions of the Baia Mare; 2. - some morphomtric characteristics of leaves, in the juveniles

  17. Pollen morphology and study of the visitors (Hymenoptera, Apidae) of Solanum stramoniifolium Jacq. (Solanaceae) in Central Amazon

    OpenAIRE

    Silva,Alexandre Coletto da; Kinupp,Valdely Ferreira; Absy,Maria Lucia; Kerr,Warwick Estevam

    2004-01-01

    The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The poll...

  18. Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII) markers

    OpenAIRE

    Enciso-Rodríguez, Felix; Martínez, Rodrigo; Lobo, Mario; Barrero, Luz Stella

    2010-01-01

    The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae...

  19. Phytoremediation Potential of Maná-Cubiu (Solanum sessiliflorum Dunal for the Deleterious Effects of Methylmercury on the Reproductive System of Rats

    Directory of Open Access Journals (Sweden)

    Raquel Frenedoso da Silva

    2014-01-01

    Full Text Available Methylmercury, organic form of mercury, can increase the number of abnormal sperm and decrease sperm concentration and testosterone levels possibly due to the damage caused by reactive species to germ and Leydig cells. Maná-cubiu (Solanum sessiliflorum Dunal is a native fruit from Amazon rich in iron, zinc, niacin, pectin, and citric acid, used in foods, beverages, and medicinal purposes, since it has been useful for treatment of various diseases caused by oxidative stress or nutritional deficiency. Therefore, this study evaluated the phytoremediation potential of this fruit on damages caused by exposure to MeHg on sperm quantity and quality and the histological aspect of the testis and epididymis. Wistar male rats (n=20 were randomly allocated into four groups: Control group (received distilled water, MeHg group (140 μg/Kg, Solanum group (1% of fruit Maná-cubiu on chow, and Solanum plus MeHg group (same treatment as MeHg and Solanum group. The organs were weighted, histopathology; sperm morphology and counts were obtained. The results showed reduction in body weight gain, testis weights, reduced sperm production, and increased histopathological abnormalities in the MeHg-treated group. However, treatment with Solanum plus MeHg revealed a protective effect of this fruit on damages caused by MeHg.

  20. Content of atropine and scopolamine in poisonous solanaceae plants from Slovenia

    Directory of Open Access Journals (Sweden)

    Javor Kac

    2006-03-01

    Full Text Available Background: Some species from the Solanaceae family are still the cause of serious poisoning among youth in Slovenia. Usually intoxication is due to abuse of these plants to provoke hallucinations. There is still not enough data about the alkaloid content of these plants growing in Slovenia.Methods: Different plant samples were analyzed for the content of atropine and scopolamine with capillary electrophoresis after solid phase extraction of alkaloids. Plants were gathered from different areas of Slovenia between April and September 2004.Results: Results were compared and possible correlations between the alkaloid content and species, plant parts, growth conditions, and time of harvest were suggested. Atropine and scopolamine contents were assessed in deadly nightshade (Atropa belladonna L., thorn apple (Datura stramonium L., scopolia (Scopolia carniolica Jacq. and angel trumpet. The common name angel trumpet is used for Datura inoxia Mill. as well as for different Brugmansia Pers. species. The most intriguing results were the variable alkaloid content in various Brugmansia species and generally great differences in alkaloid content among various plants and their plant parts.Conclusions: All investigated plants have noticeable atropine and/or scopolamine content. The content is variable between various plants and their plant parts and therefore special care should be taken in cases of possible intoxication. It was shown that smaller or greater amounts of ingested drug can cause the same level of intoxication due to the variability in alkaloid content.

  1. Callogenesis in root explants of four species of the family Solanaceae after inducing by Agrobacterium rhizogenes

    Directory of Open Access Journals (Sweden)

    Zahra Shakeran

    2015-09-01

    Full Text Available Studying explants affected by Agrobacterium rhizogenes shows that in addition to possible formation of hairy roots, it is likely that callogenesis can be induced in these tissues. The T-DNA region of A. rhizogenes codes enzymes that participate in biosynthesis of plants growth hormones. These hormones also affect callogenesis, hence, the formation of various calluses with different morphological properties are possible. It is very likely that the level of biosynthetic growth hormone, the plasmid carried by each bacteria strain, the position of T-DNA, and the level of gene expression contribute to this morphologic variation. In this study, the root explants of four species of the family Solanaceae namely Atropa belladonna, Datura metel, D. stramonium and Hyoscyamus niger were induced by using different strains of A. rhizogenes (A4, A7, AR15834, AR318, AR9402 and AR9543. Some of these explants entered callus phase and formed various calluses with different colors and shapes. Moreover, in some callus samples hairy roots were also appeared. These variations were probably caused by variations in the levels and ratios of auxin and cytokinine hormons after the induction. As shown in previous studies, the amount of secondary metabolites is reduced due to undifferentiated tissue produced in the callogenesis process.

  2. Natural Medium for Growing of Endophytic Bacteria from Solanaceae in Malang-Indonesia

    Directory of Open Access Journals (Sweden)

    Purnawati Arika

    2016-01-01

    Full Text Available Endophytic bacteria are important microorganisms having potential as biocontrol agents for many pathogens. Until now, the growth of it always uses semi-synthetic or synthetic medium so it was difficult to be used by farmers in the field and it was expensive to have its propagation as biocontrol agents. Based on the problem, this research will study the natural medium as propagation medium of Endophytic bacteria. It had natural ingredients such as soybean, chicken broth, egg, worms, snail, sorghum and they were easy to get by farmers. This study used endophytic bacteria from Solanaceae in Malang- Indonesia. Four isolates of endophytic bacteria were grown in agar and liquid medium with ingredients of corn flour, soybean flour, sorghum flour, snail flour, and worm flour. There is no difference in the incubation period, color, shape, and surface colony. The population in medium with snail flour ingredients at a concentration of 107 cfu/ml is the highest and snail flour is the best medium for growing endophytic bacteria.

  3. Insight into the evolution of the Solanaceae from the parental genomes of Petunia hybrida.

    Science.gov (United States)

    Bombarely, Aureliano; Moser, Michel; Amrad, Avichai; Bao, Manzhu; Bapaume, Laure; Barry, Cornelius S; Bliek, Mattijs; Boersma, Maaike R; Borghi, Lorenzo; Bruggmann, Rémy; Bucher, Marcel; D'Agostino, Nunzio; Davies, Kevin; Druege, Uwe; Dudareva, Natalia; Egea-Cortines, Marcos; Delledonne, Massimo; Fernandez-Pozo, Noe; Franken, Philipp; Grandont, Laurie; Heslop-Harrison, J S; Hintzsche, Jennifer; Johns, Mitrick; Koes, Ronald; Lv, Xiaodan; Lyons, Eric; Malla, Diwa; Martinoia, Enrico; Mattson, Neil S; Morel, Patrice; Mueller, Lukas A; Muhlemann, Joëlle; Nouri, Eva; Passeri, Valentina; Pezzotti, Mario; Qi, Qinzhou; Reinhardt, Didier; Rich, Melanie; Richert-Pöggeler, Katja R; Robbins, Tim P; Schatz, Michael C; Schranz, M Eric; Schuurink, Robert C; Schwarzacher, Trude; Spelt, Kees; Tang, Haibao; Urbanus, Susan L; Vandenbussche, Michiel; Vijverberg, Kitty; Villarino, Gonzalo H; Warner, Ryan M; Weiss, Julia; Yue, Zhen; Zethof, Jan; Quattrocchio, Francesca; Sims, Thomas L; Kuhlemeier, Cris

    2016-05-27

    Petunia hybrida is a popular bedding plant that has a long history as a genetic model system. We report the whole-genome sequencing and assembly of inbred derivatives of its two wild parents, P. axillaris N and P. inflata S6. The assemblies include 91.3% and 90.2% coverage of their diploid genomes (1.4 Gb; 2n = 14) containing 32,928 and 36,697 protein-coding genes, respectively. The genomes reveal that the Petunia lineage has experienced at least two rounds of hexaploidization: the older gamma event, which is shared with most Eudicots, and a more recent Solanaceae event that is shared with tomato and other solanaceous species. Transcription factors involved in the shift from bee to moth pollination reside in particularly dynamic regions of the genome, which may have been key to the remarkable diversity of floral colour patterns and pollination systems. The high-quality genome sequences will enhance the value of Petunia as a model system for research on unique biological phenomena such as small RNAs, symbiosis, self-incompatibility and circadian rhythms.

  4. EVALUACIÓN DE DENSIDADES DE SIEMBRA EN Solanum sessiliflorum dunal “COCONA” Y SU EFECTO EN EL RENDIMIENTO DE FRUTO

    Directory of Open Access Journals (Sweden)

    Rodrigo Gonzales Vega

    2012-12-01

    Full Text Available La cocona es una especie vegetal nativa de América Tropical, cuyos frutos maduros son ricos en hierro, vitamina B5 (Niacina, se utilizan en la preparación de jugos, refrescos, jarabes y ensaladas. El estudio se realizó en el Campo Experimental “El Dorado” de Estación Experimental San Roque, del INIA Loreto con el objetivo principal de determinar el mejor distanciamiento para establecer plantaciones comerciales de Solanum sessiliflorum dunal “Cocona”, en condiciones de suelos no inundables o de altura. Se evaluaron cuatro densidades de siembra 2,0m x 2,0m; 1,5m x 1,5m, 2,0m x 1,0 y 1,5m x 1,0m. Las variables evaluadas fueron el número de frutos, peso de frutos y rendimiento de frutos por cada tratamiento en estudio, el diseño experimental utilizado fue Bloques Completos al Azar (DBCA, con cuatro repeticiones, los datos fueron analizados mediante el Análisis de Variancia y Prueba Estadística de Tukey, usando el software SPSS, versión 10. De los resultados Obtenidos se determinó que la densidad 1,5m x 1,0m (6 666 plantas/ha, produjo el mejor rendimiento con 14 600 kg/ha de fruto, superando significativamente a los tratamientos 2m x 1,0, 1,5m x 1,5m y 2,0 x 2,0m, que alcanzaron rendimientos de fruto de 12020, 11 330 y 10 570 kg/ha, respectivamente. Se concluye que la densidad de siembra influye en el rendimiento de fruto, así a menor número de plantas, mayor número y peso de fruto por planta se obtiene un menor rendimiento de fruto/ha.

  5. Separation of four flavonol glycosides from Solanum rostratum Dunal using aqueous two-phase flotation followed by preparative high-performance liquid chromatography.

    Science.gov (United States)

    Chang, Lin; Shao, Qian; Xi, Xingjun; Chu, Qiao; Wei, Yun

    2017-02-01

    Aqueous two-phase flotation followed by preparative high-performance liquid chromatography was used to separate four flavonol glycosides from Solanum rostratum Dunal. In the aqueous two-phase flotation section, the effects of sublation solvent, solution pH, (NH 4 ) 2 SO 4 concentration in aqueous solution, cosolvent, N 2 flow rate, flotation time, and volumes of the polyethylene glycol phase on the recovery were investigated in detail, and the optimal conditions were selected: 50 wt% polyethylene glycol 1000 ethanol solvent as the flotation solvent, pH 4, 350 g/L of (NH 4 ) 2 SO 4 concentration in aqueous phase, 40 mL/min of N 2 flow rate, 30 min of flotation time, 10.0 mL of flotation solvent volume, and two times. After aqueous two-phase flotation concentration, the flotation products were purified by preparative high-performance liquid chromatography. The purities of the final products A and B were 98.1 and 99.0%. Product B was the mixture of three compounds based on the analysis of high-performance liquid chromatography at the temperature of 10°C, while product A was hyperoside after the identification by nuclear magnetic resonance. Astragalin, 3'-O-methylquercetin 3-O-β-d-galactopyranoside, and 3'-O-methylquercetin 3-O-β-d-glucopyranoside were obtained with the purity of 93.8, 97.1, and 99.2%, respectively, after the further separation of product B using preparative high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The historical role of species from the Solanaceae plant family in genetic research.

    Science.gov (United States)

    Gebhardt, Christiane

    2016-12-01

    This article evaluates the main contributions of tomato, tobacco, petunia, potato, pepper and eggplant to classical and molecular plant genetics and genomics since the beginning of the twentieth century. Species from the Solanaceae family form integral parts of human civilizations as food sources and drugs since thousands of years, and, more recently, as ornamentals. Some Solanaceous species were subjects of classical and molecular genetic research over the last 100 years. The tomato was one of the principal models in twentieth century classical genetics and a pacemaker of genome analysis in plants including molecular linkage maps, positional cloning of disease resistance genes and quantitative trait loci (QTL). Besides that, tomato is the model for the genetics of fruit development and composition. Tobacco was the major model used to establish the principals and methods of plant somatic cell genetics including in vitro propagation of cells and tissues, totipotency of somatic cells, doubled haploid production and genetic transformation. Petunia was a model for elucidating the biochemical and genetic basis of flower color and development. The cultivated potato is the economically most important Solanaceous plant and ranks third after wheat and rice as one of the world's great food crops. Potato is the model for studying the genetic basis of tuber development. Molecular genetics and genomics of potato, in particular association genetics, made valuable contributions to the genetic dissection of complex agronomic traits and the development of diagnostic markers for breeding applications. Pepper and eggplant are horticultural crops of worldwide relevance. Genetic and genomic research in pepper and eggplant mostly followed the tomato model. Comparative genome analysis of tomato, potato, pepper and eggplant contributed to the understanding of plant genome evolution.

  7. Estudo Farmacognóstico e Screening Biológico de Solanum lycocarpum St. Hill (Solanaceae)

    OpenAIRE

    Martins, Gilmarcio Zimmermann [UNESP

    2013-01-01

    Devido ao negligenciamento e ao aumento de números de casos das doenças microbianas e parasitárias no Brasil, o aprimoramento da investigação científica e tecnológica na área de plantas medicinais faz-se indispensável para à busca de novos produtos antimicrobianos e antiparasitários. A Solanum lycocarpum St. Hill. (Solanaceae) é uma planta medicinal tradicionalmente utilizada na forma de polvilho de lobeira como terapia complementar para o tratamento do Diabetes Mellitus, hipocolesterolêmico ...

  8. Differential strengths of selection on S-RNases from Physalis and Solanum (Solanaceae

    Directory of Open Access Journals (Sweden)

    Kohn Joshua R

    2011-08-01

    Full Text Available Abstract Background The S-RNases of the Solanaceae are highly polymorphic self-incompatibility (S- alleles subject to strong balancing selection. Relatively recent diversification of S-alleles has occurred in the genus Physalis following a historical restriction of S-allele diversity. In contrast, the genus Solanum did not undergo a restriction of S-locus diversity and its S-alleles are generally much older. Because recovery from reduced S-locus diversity should involve increased selection, we employ a statistical framework to ask whether S-locus selection intensities are higher in Physalis than Solanum. Because different S-RNase lineages diversify in Physalis and Solanum, we also ask whether different sites are under selection in different lineages. Results Maximum-likelihood and Bayesian coalescent methods found higher intensities of selection and more sites under significant positive selection in the 48 Physalis S-RNase alleles than the 49 from Solanum. Highest posterior densities of dN/dS (ω estimates show that the strength of selection is greater for Physalis at 36 codons. A nested maximum likelihood method was more conservative, but still found 16 sites with greater selection in Physalis. Neither method found any codons under significantly greater selection in Solanum. A random effects likelihood method that examines data from both taxa jointly confirmed higher selection intensities in Physalis, but did not find different proportions of sites under selection in the two datasets. The greatest differences in strengths of selection were found in the most variable regions of the S-RNases, as expected if these regions encode self-recognition specificities. Clade-specific likelihood models indicated some codons were under greater selection in background Solanum lineages than in specific lineages of Physalis implying that selection on sites may differ among lineages. Conclusions Likelihood and Bayesian methods provide a statistical approach to

  9. Tuber resistance and slow rotting characteristics of potato clones associated with the Solanaceae Coordinated Agricultural Project to the US-24 clonal lineage of Phytophthora infestans

    Science.gov (United States)

    Late blight, caused by Phytophthora infestans, is a devastating disease on potato worldwide and new lineages of the pathogen continue to develop in the U.S. Breeding for resistance is important for economic and environmental purposes. The Solanaceae Coordinated Agricultural Project (SolCAP) focuses ...

  10. Screening of non-tuber bearing Solanaceae for resistance to and induction of juvenile hatch of potato cyst nematodes and their potential for trap cropping

    NARCIS (Netherlands)

    Scholte, K.

    2000-01-01

    Ninety accessions of non-tuber bearing Solanaceae were screened for (i) resistance to and (ii) stimulatory effect on juvenile hatch of potato cyst nematodes, and (iii) their growth under temperate climatic conditions. All plant species belonging to the genus Solanum tested induced hatching but this

  11. Pollen morphology and study of the visitors (Hymenoptera, Apidae of Solanum stramoniifolium Jacq. (Solanaceae in Central Amazon Morfologia polínica e estudo dos visitantes (Hymenoptera, Apidae de Solanum stramoniifolium Jacq. (Solanaceae na Amazônia Central

    Directory of Open Access Journals (Sweden)

    Alexandre Coletto da Silva

    2004-09-01

    Full Text Available The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The pollen of S. stramoniifolium is tricolporate and psilate or without ornamentation. In a word, S. stramoniifolium constitutes a potential source of pollen for different species of bees with and without sting, providing an interesting field for germination studies, insect-plant interactions and floral biology that are already under way.A família Solanaceae tem ampla distribuição, principalmente nas áreas tropicais e subtropicais da América do Sul. Solanum L. é um dos mais importantes gêneros desta família com aproximadamente 1.200 espécies. O objetivo deste trabalho foi o de estudar a biologia floral com enfoque na morfologia polínica e no registro de algumas abelhas visitantes de S. stramoniifolium. Dados preliminares indicam a presença de uma espécie de abelha com ferrão e quatro espécies sem ferrão como visitantes de S. stramoniifolium. O pólen de S. stramoniifolium é tricolporado e psilado, ou seja, sem ornamentação. Conclui-se, após o estudo da biologia floral, que S. stramoniifolium constitui fonte potencial de pólen para diferentes espécies de abelhas com e sem ferrão, representando interessante campo para estudos de germinação, interações inseto-planta e biologia floral.

  12. Intoxicação natural e experimental por Metternichia princeps (Solanaceae em caprinos

    Directory of Open Access Journals (Sweden)

    Juliana da Silva Prado

    2012-09-01

    Full Text Available Entre os anos de 2007 e 2009 ocorreu uma doença nefrotóxica de evolução subaguda com alta mortandade em caprinos em uma propriedade no município de Itaguaí, estado do Rio de Janeiro. Levantou-se a suspeita de que Metternichia princeps, planta pertencente à família Solanaceae, seria a causa. Através de experimentação em caprinos o quadro clínico-patológico de intoxicação por esta planta e a dose letal foram estabelecidos. Na experimentação foram utilizados 12 caprinos de diferentes raças, de ambos os sexos, jovens a adultos, com pesos acima de 15 kg. Os animais que receberam as doses de 30g/kg em 5 dias, 15g/kg em 3 dias, doses únicas de 10g/kg e de 5g/kg, morreram. Dos três animais que receberam as doses únicas de 2,5g/kg, dois morreram e um não apresentou sinais clínicos e o animal que recebeu a dose única de 1,25g/kg, também não apresentou sinais clínicos. O início dos sinais clínicos após a administração da planta variou entre 7h e 46h45min. A evolução variou entre 3h6min e 126h40min. Os primeiros sinais clínicos apresentados foram inapetência, adipsia, apatia e relutância ao movimento. Em seguida os animais entravam em decúbito esternal e ao serem colocados em estação, mantinham os membros anteriores flexionados, apoiavam apenas os posteriores no chão até evoluírem para flexão dos quatro membros e seguia-se o decúbito lateral. À necropsia destacaram-se o edema de tecido adiposo perirrenal, rins pálidos e, ao corte, com estriação esbranquiçada desde o córtex até a região medular. À histopatologia foi verificada acentuada necrose coagulativa das células epiteliais dos túbulos uriníferos. Comparativamente aos casos naturais, os caprinos intoxicados experimentalmente por M. princeps apresentaram quadro clínico-patológico semelhante. Desta maneira foi comprovado que Metternichia princeps é responsável pela doença nefrotóxica em caprinos no Rio de Janeiro; a menor dose que causou a

  13. Test for Local Insect Traps against some Solanacea Insects Plant under Green House Conditions in Riyadh, Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Ayedh, Hassan Ibn Yahiya

    2005-01-01

    Trapping efficiency of seven different colored sticky traps (Green, Fluorescent yellow, Orange, Pink, red, White and Yellow) was evaluated in some solanacea plants, tomatoes (Lycopersicon esculentum), eggplant (Solanum Magellan) and sweet pepper (Capsicum spp.) crops, for whitefly (Bemis ia airlifting), leaf miners (Liriomyza trifolii), thrips (Thrips tabaci) in Riyadh, Saudi Arabia. The traps were placed at four different heights (0.5, 1.0, 1.5 and 2.0 m above the ground). The experiment was laid out in a Completely Randomized Block Design (CRBD) with four replications during autumn 2001, spring and autumn 2002. Significantly high insect populations were trapped on Fluorescent yellow, yellow and green colored sticky traps. No significant differences were witnessed between mean numbers of various insects caught on sticky traps placed at different heights but more insects were trapped at 0.5 - 1.5m. (author)

  14. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  15. Parasitoids (Hymenoptera: Braconidae: Aphidiinae) attacking aphids feeding on solanaceae and cucurbitaceae crops in Southeastern Europe: Aphidiine-aphid-plant associations and key

    Czech Academy of Sciences Publication Activity Database

    Kavallieratos, N. G.; Tomanović, Ž.; Starý, Petr; Žikić, V.; Petrović-Obradović, O.

    2010-01-01

    Roč. 103, č. 2 (2010), s. 153-164 ISSN 0013-8746 R&D Projects: GA AV ČR IBS5007102 Grant - others:The Ministry of Science and Environment Protection(CS) 143006B Institutional research plan: CEZ:AV0Z50070508 Keywords : Aphidiinae * aphids * Solanaceae Subject RIV: EH - Ecology, Behaviour Impact factor: 1.031, year: 2010

  16. Effects of seco-steroids purified from Physalis angulata L., Solanaceae, on the viability of Leishmania sp Efeitos de seco-esteróides purificados de Physalis angulata L., Solanaceae na viabilidade de Leishmania sp

    Directory of Open Access Journals (Sweden)

    Elisalva T. Guimarães

    2010-12-01

    Full Text Available Physalis angulata L., Solanaceae, is an annual herb commonly used in popular medicine in many tropical and subtropical countries. P. angulata extracts contain a variety of substances, but little is known about their pharmacological activities. In this work we investigated the in vitro antileishmanial activity of seco-steroids (physalins purified from P. angulata. Addition of physalins B, F, and G caused a concentration-dependent inhibition in the growth of L. amazonensis promastigotes, being the IC50 values were 6.8, 1.4, and 9.2 μM, respectively. Physalin D was less active and had an IC50 value of 30.5 μM. Physalins were also active in cultures of other Leishmania species (L. major, L. braziliensis, and L. chagasi. Our results demonstrate the potent antileishmanial activity of physalins in cultures of Leishmania species of the New and Old Worlds and suggest the therapeutic potential of these seco-steroids in leishmaniasis.Physalis angulata L., Solanaceae, é uma erva anual utilizada na medicina popular em muitos países tropicais e subtropicais. Apesar dos extratos da P. angulata apresentarem uma grande variedade de substâncias, pouco é conhecido sobre a sua atividade farmacológica. Neste trabalho foi investigado a atividade antileishmania in vitro de seco-esteroides (fisalinas purificados da P. angulata. O tratamento com as fisalinas B, F e G causou uma inibição concentração-dependente do crescimento de promastigotas de Leishmania amazonensis em cultura axênica, com valores de IC50 de 6,8, 1,4, e 9,2 μM respectivamente. A fisalina D foi menos ativa, com valores de IC50 de 30,5 μM. Foi também observada uma atividade leishmanicida em culturas de outras espécies de Leishmania (L. major, L. braziliensis e L. chagasi. Nossos resultados demonstram que as fisalinas inibem o crescimento dos promastigotas com o tratamento de espécies de Leishmania do Velho e do Novo Mundos e sugerem o potencial terapêutico destas moléculas na

  17. Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.

    Science.gov (United States)

    Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas

    2016-05-01

    Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  18. Genome-wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Directory of Open Access Journals (Sweden)

    Eunyoung Seo

    2016-08-01

    Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.

  19. Mapeo de genes ribosómicos y heterocromatina en seis especies de Lycium de sudamérica (solanaceae

    Directory of Open Access Journals (Sweden)

    Soledad Blanco

    2012-12-01

    Full Text Available El clado Lycieae (Solanaceae reune 92 especies, actualmente agrupadas en un único género, Lycium. Se realizó un estudio citogenético en seis especies sudamericanas de este género, usándose por primera vez en el grupo la técnica de FISH, además de la técnica de bandeo CMA/DAPI. Se emplearon ápices radicales de las siguientes especies: L. boerhaviifolium (previamente Grabowskia, L. bridgesii (previamente Phrodus, el tetraploide L. chilense y los diploides L. cestroides, L. ciliatum y L. tenuispinosum. Se confirmó el número básico x=12. La técnica de bandeo reveló la presencia de una banda CMA+/DAPI- asociada a NORs en el primer par metacéntrico en las especies diploides, y en los dos primeros pares m en la tetraploide. Además, L. tenuispinosum mostró una banda intercalar CMA+/DAPI- en uno de sus cromosomas, en tanto que en L. bridgesii se encontraron bandas terminales e intercalares en todos los cromosomas. Con la técnica de FISH se observó que los loci 18-5,8-26S fueron consistentes con los bloques CMA+/DAPI-/NORs. Las especies diploides presentaron siempre un par cromosómico m portador de genes ADNr 5S, mientras que la especie tetraploide presentó dos pares, concordando con su nivel de ploidía. En las especies estudiadas, la diversificación no fue acompañada por rearreglos cromosómicos estructurales significativos, excepto L. bridgesii, que se destaca por poseer una fórmula cariotípica distinta y un mayor porcentaje de heterocromatina.Mapping of ribosomal genes and heterochromatin in Lycium of South America (Solanaceae. The clade Lycieae (Solanaceae embraces 92 species, currently gathered in a single genus, Lycium. A study was conducted in six South American species of this genus, using the FISH technique for the first time in the group, in addition to the CMA/DAPI banding technique. Root tips of the following species were employed: L. boerhaviifolium (previously Grabowskia, L. bridgesii (previously Phrodus, the

  20. No evidence for Fabaceae Gametophytic self-incompatibility being determined by Rosaceae, Solanaceae, and Plantaginaceae S-RNase lineage genes.

    Science.gov (United States)

    Aguiar, Bruno; Vieira, Jorge; Cunha, Ana E; Vieira, Cristina P

    2015-06-02

    Fabaceae species are important in agronomy and livestock nourishment. They have a long breeding history, and most cultivars have lost self-incompatibility (SI), a genetic barrier to self-fertilization. Nevertheless, to improve legume crop breeding, crosses with wild SI relatives of the cultivated varieties are often performed. Therefore, it is fundamental to characterize Fabaceae SI system(s). We address the hypothesis of Fabaceae gametophytic (G)SI being RNase based, by recruiting the same S-RNase lineage gene of Rosaceae, Solanaceae or Plantaginaceae SI species. We first identify SSK1 like genes (described only in species having RNase based GSI), in the Trifolium pratense, Medicago truncatula, Cicer arietinum, Glycine max, and Lupinus angustifolius genomes. Then, we characterize the S-lineage T2-RNase genes in these genomes. In T. pratense, M. truncatula, and C. arietinum we identify S-RNase lineage genes that in phylogenetic analyses cluster with Pyrinae S-RNases. In M. truncatula and C. arietinum genomes, where large scaffolds are available, these sequences are surrounded by F-box genes that in phylogenetic analyses also cluster with S-pollen genes. In T. pratense the S-RNase lineage genes show, however, expression in tissues not involved in GSI. Moreover, levels of diversity are lower than those observed for other S-RNase genes. The M. truncatula and C. arietinum S-RNase and S-pollen like genes phylogenetically related to Pyrinae S-genes, are also expressed in tissues other than those involved in GSI. To address if other T2-RNases could be determining Fabaceae GSI, here we obtained a style with stigma transcriptome of Cytisus striatus, a species that shows significant difference on the percentage of pollen growth in self and cross-pollinations. Expression and polymorphism analyses of the C. striatus S-RNase like genes revealed that none of these genes, is the S-pistil gene. We find no evidence for Fabaceae GSI being determined by Rosaceae, Solanaceae, and

  1. Plant population structure and insect herbivory on Solanum mauritianum Scopoli (Solanaceae in southern Brazil: a support to biological control

    Directory of Open Access Journals (Sweden)

    Deise Mari Barboza

    2009-04-01

    Full Text Available Solanum mauritianum Scopoli (Solanaceae, a native Brazilian shrub, has become naturalized and invasive in several countries. In South Africa, where invasions are severe, herbivorous insects that attack S. mauritianum in its native area have been considered for introduction as biological control agents. To assess the action of such herbivores on the plant, studies were carried out on a population of S. mauritianum in an area undergoing regeneration in southern Brazil. An analysis of the structure of that population was performed, as well as of herbivory by insects, in particular of Anthonomus (Curculionidae. The population structure showed an "inverted J" pattern in diameter classes, but not in height classes. Individual plants showed an aggregate distribution. The damage caused by Anthonomus did not amount to the loss of a large leaf area, but since it was inflicted on young leaves and in a large proportion, could lead to the survival decrease.Solanum mauritianum Scopoli (Solanaceae, um arbusto endêmico do sul do Brasil, naturalizou-se e tornou-se invasor em vários países do mundo. Na África do Sul, onde as invasões são severas, insetos fitófagos associados à planta no país de origem têm sido considerados para introdução como agentes de controle biológico. Para avaliar a ação de tais insetos no ambiente natural, foram conduzidos estudos em uma população de S. mauritianum em uma área em regeneração no sul do Brasil. Foi realizada análise da estrutura populacional, bem como da herbivoria causada por insetos, em particular para uma espécie do gênero Anthonomus (Curculionidae, para subsidiar o trabalho sobre controle biológico. A estrutura da população mostrou um padrão "J invertido" nas classes de diâmetro, mas não nas classes de altura; a distribuição espacial dos indivíduos era agregada. O dano causado por Anthonomus sp. não refletiu na perda real de grande área foliar. No entanto, uma vez que foi detectada uma

  2. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  3. Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII) markers

    Science.gov (United States)

    2010-01-01

    The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae (Asterid) species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested) and tree tomatoes (26 out of 41) for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with FST > 0.90), which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species. PMID:21637482

  4. Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII) markers.

    Science.gov (United States)

    Enciso-Rodríguez, Felix; Martínez, Rodrigo; Lobo, Mario; Barrero, Luz Stella

    2010-04-01

    The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae (Asterid) species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested) and tree tomatoes (26 out of 41) for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with F(ST) > 0.90), which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species.

  5. Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII markers

    Directory of Open Access Journals (Sweden)

    Felix Enciso-Rodríguez

    2010-01-01

    Full Text Available The Lulo or naranjilla (Solanum quitoense Lam. and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt. are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32 and tree tomatoes (n = 30 through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII in other Solanaceae (Asterid species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested and tree tomatoes (26 out of 41 for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with F ST > 0.90, which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species.

  6. Estudo fitoquímico de folhas de Solanum lycocarpum A. St.-Hil (Solanaceae e sua aplicação na alelopatia Phytochemistry of Solanum lycocarpum A.St.-Hil (Solanaceae leaves and their application in allelopathy

    Directory of Open Access Journals (Sweden)

    Sarah Christina Caldas Oliveira

    2012-09-01

    Full Text Available Solanum lycocarpum A.St.-Hil (Solanaceae é um arbusto típico da região central do Brasil (Cerrado. A atividade alelopática do extrato aquoso de folhas e frutos dessa espécie já foi verificada em estudos anteriores. O objetivo desse trabalho foi avaliar a atividade alelopática de diferentes extratos de S. lycocarpum na germinação e crescimento de quatro espécies-alvo. As folhas foram coletadas, secas e trituradas e submetidas a dois métodos distintos de extração: 1- líquido-líquido (acetato de etila e diclorometano do extrato aquoso das folhas e 2- com solventes em polaridade crescente (hexano, diclorometano, acetato de etila, acetona, metanol e água diretamente das folhas. Cada extração foi realizada com equipamento de ultrassom durante uma hora, filtrado e evaporado. Desses extratos, soluções de 800, 400 e 200 ppm foram preparadas, e água e Logran® foram usados como controle positivo e negativo, respectivamente. Cada solução, bem como os controles, foi dissolvida em DMSO para os bioensaios. As espécies alvo usadas foram: alface, agrião, tomate e cebola. Cada placa era composta de 20 sementes e foi adicionado 1 mL de solução teste com 4 repetições. As placas foram incubadas a 25 ºC no escuro. Posteriormente, as plântulas tiveram suas partes aéreas e raízes medidas e a porcentagem de germinação e inibição calculada para cada extrato. Tomate foi a espécie que mostrou maior sensibilidade para todos os extratos, seguido de agrião, cebola e alface. Os extratos que tiveram maior atividade foram o acetato de etila, acetona e as extrações líquido-líquido, indicando as frações que devem conter os princípios ativos da folha dessa espécie.Solanum lycocarpum A.St.-Hil (Solanaceae is a typical shrub in the Cerrado of central Brazil. The allelopathic activity of aqueous extracts of the leaves and fruits of this species has already been proven in previous studies. The goal of this work was to verify the

  7. Characterization of Trichome-Expressed BAHD Acyltransferases in Petunia axillaris Reveals Distinct Acylsugar Assembly Mechanisms within the Solanaceae1[OPEN

    Science.gov (United States)

    Uebler, Joseph B.; Liu, Xiaoxiao

    2017-01-01

    Acylsugars are synthesized in the glandular trichomes of the Solanaceae family and are implicated in protection against abiotic and biotic stress. Acylsugars are composed of either sucrose or glucose esterified with varying numbers of acyl chains of differing length. In tomato (Solanum lycopersicum), acylsugar assembly requires four acylsugar acyltransferases (ASATs) of the BAHD superfamily. Tomato ASATs catalyze the sequential esterification of acyl-coenzyme A thioesters to the R4, R3, R3ʹ, and R2 positions of sucrose, yielding a tetra-acylsucrose. Petunia spp. synthesize acylsugars that are structurally distinct from those of tomato. To explore the mechanisms underlying this chemical diversity, a Petunia axillaris transcriptome was mined for trichome preferentially expressed BAHDs. A combination of phylogenetic analyses, gene silencing, and biochemical analyses coupled with structural elucidation of metabolites revealed that acylsugar assembly is not conserved between tomato and petunia. In P. axillaris, tetra-acylsucrose assembly occurs through the action of four ASATs, which catalyze sequential addition of acyl groups to the R2, R4, R3, and R6 positions. Notably, in P. axillaris, PaxASAT1 and PaxASAT4 catalyze the acylation of the R2 and R6 positions of sucrose, respectively, and no clear orthologs exist in tomato. Similarly, petunia acylsugars lack an acyl group at the R3ʹ position, and congruently, an ortholog of SlASAT3, which catalyzes acylation at the R3ʹ position in tomato, is absent in P. axillaris. Furthermore, where putative orthologous relationships of ASATs are predicted between tomato and petunia, these are not supported by biochemical assays. Overall, these data demonstrate the considerable evolutionary plasticity of acylsugar biosynthesis. PMID:28701351

  8. Characterization of Trichome-Expressed BAHD Acyltransferases in Petunia axillaris Reveals Distinct Acylsugar Assembly Mechanisms within the Solanaceae.

    Science.gov (United States)

    Nadakuduti, Satya Swathi; Uebler, Joseph B; Liu, Xiaoxiao; Jones, A Daniel; Barry, Cornelius S

    2017-09-01

    Acylsugars are synthesized in the glandular trichomes of the Solanaceae family and are implicated in protection against abiotic and biotic stress. Acylsugars are composed of either sucrose or glucose esterified with varying numbers of acyl chains of differing length. In tomato ( Solanum lycopersicum ), acylsugar assembly requires four acylsugar acyltransferases (ASATs) of the BAHD superfamily. Tomato ASATs catalyze the sequential esterification of acyl-coenzyme A thioesters to the R4, R3, R3', and R2 positions of sucrose, yielding a tetra-acylsucrose. Petunia spp. synthesize acylsugars that are structurally distinct from those of tomato. To explore the mechanisms underlying this chemical diversity, a Petunia axillaris transcriptome was mined for trichome preferentially expressed BAHDs. A combination of phylogenetic analyses, gene silencing, and biochemical analyses coupled with structural elucidation of metabolites revealed that acylsugar assembly is not conserved between tomato and petunia. In P. axillaris , tetra-acylsucrose assembly occurs through the action of four ASATs, which catalyze sequential addition of acyl groups to the R2, R4, R3, and R6 positions. Notably, in P. axillaris , PaxASAT1 and PaxASAT4 catalyze the acylation of the R2 and R6 positions of sucrose, respectively, and no clear orthologs exist in tomato. Similarly, petunia acylsugars lack an acyl group at the R3' position, and congruently, an ortholog of SlASAT3, which catalyzes acylation at the R3' position in tomato, is absent in P. axillaris Furthermore, where putative orthologous relationships of ASATs are predicted between tomato and petunia, these are not supported by biochemical assays. Overall, these data demonstrate the considerable evolutionary plasticity of acylsugar biosynthesis. © 2017 American Society of Plant Biologists. All Rights Reserved.

  9. POLEN DE LAS MAGNOLIOPSIDA EN EL VOLCÁN (PAMPLONA, COLOMBIA II: FAMILIAS HYPERICACEAE, LAMIACEAE, LOBELIACEAE, POLYGONACEAE, RHAMNACEAE, ROSACEAE, RUBIACEAE, SCROPHULARIACEAE Y SOLANACEAE

    Directory of Open Access Journals (Sweden)

    JORGE D. MERCADO-GÓMEZ

    2013-12-01

    Full Text Available Se caracterizó la morfología polínica de las especies pertenecientes a las familias, Hypericaceae, Lamiaceae, Lobeliaceae, Polygonaceae, Rhamnaceae, Rosaceae, Rubiaceae, Scrophulariaceae y Solanaceae, encontradas en la zona El Volcán (Pamplona, Colombia. Las observaciones, descripciones y microfotografías de los granos de polen se realizaron con microscopio de luz, contando un mínimo de 25 granos por especie. Todas las familias presentan un carácter euripalinologico, excepto Melastomataceae la cual es estenopalinologica. Asimismo, al realizar comparaciones sobre algunas especies que fueron descritas en otras zonas del bosque altoandino y páramo en la cordillera Central y Occidental, fue posible determinar variaciones en la morfología polínica.

  10. Antifungal glycoalkaloids, flavonoids and other chemical constituents of Solanum asperum Rich (Solanaceae); Glicoalcaloides antifugincos, flavonoides e outros constituintes quimicos de Solanum asperum

    Energy Technology Data Exchange (ETDEWEB)

    Pinto, Francisco das Chagas L.; Uchoa, Daniel Esdras de A.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo, E-mail: opessoa@ufc.b [Universidade Federal do Ceara (DQOI/UFC), Fortaleza, CE (Brazil). Dept. de Quimica Organica e Inorganica; Silva, Fernanda M. e; Theodoro, Phellipe N.E.T.; Espindola, Laila S. [Universidade de Brasilia (FCS/UnB), DF (Brazil). Fac. de Ciencias da Saude

    2011-07-01

    Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-alpha-L-ramnopyranosyl-kaempferol and 3-O-[beta-D-glucopyranosyl-(1->6)-alpha-L-ramnopyranosyl ]-7-O-alpha-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae). The structures of all compounds were determined by interpretation of their spectra (IR, MS, {sup 1}H and {sup 13}C NMR) and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 mug/mL) against four filamentous fungi species of the genera Microsporum and Trichophyton. (author)

  11. Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum) cultivar Micro-Tom, a reference system for the Solanaceae genomics.

    Science.gov (United States)

    Aoki, Koh; Yano, Kentaro; Suzuki, Ayako; Kawamura, Shingo; Sakurai, Nozomu; Suda, Kunihiro; Kurabayashi, Atsushi; Suzuki, Tatsuya; Tsugane, Taneaki; Watanabe, Manabu; Ooga, Kazuhide; Torii, Maiko; Narita, Takanori; Shin-I, Tadasu; Kohara, Yuji; Yamamoto, Naoki; Takahashi, Hideki; Watanabe, Yuichiro; Egusa, Mayumi; Kodama, Motoichiro; Ichinose, Yuki; Kikuchi, Mari; Fukushima, Sumire; Okabe, Akiko; Arie, Tsutomu; Sato, Yuko; Yazawa, Katsumi; Satoh, Shinobu; Omura, Toshikazu; Ezura, Hiroshi; Shibata, Daisuke

    2010-03-30

    The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs) was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706) was estimated to be 0.061%. The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the tomato whole-genome sequence and aid in tomato functional

  12. Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum cultivar Micro-Tom, a reference system for the Solanaceae genomics

    Directory of Open Access Journals (Sweden)

    Kikuchi Mari

    2010-03-01

    Full Text Available Abstract Background The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. Results To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706 was estimated to be 0.061%. Conclusion The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the

  13. Typification of Solanum (Solanaceae species described by Martín de Sessé y Lacasta and José Mariano Mociño

    Directory of Open Access Journals (Sweden)

    Knapp, Sandra

    2008-06-01

    Full Text Available Lectotypes, neotypes or epitypes are confirmed or designated here for 16 of the 22 names coined by Martín Sessé y Lacasta and José Mariano Mociño that were described as members of the large genus Solanum (Solanaceae: Solanum bifidum, S. cordovense, S. declinatum, S. dichotomum, S. diphyllum, S. lanceifolium, S. lanceolatum, S. lineatum (both homonyms, S. longifolium, S. mexicanum, S. nutans, S. sarmentosum, S. scandens, S. tlacotalpense and S. uniflorum. A brief introduction assesses the importance of the Sessé & Mociño expedition (the Real Expedición Botánica a Nueva España to the botany of their time, and identifies difficulties in identifying and neotypifying or lectotypifying names coined by them. More than half of the names coined by Sessé and Mociño have no material associated with them. The currently accepted name for each taxon is given, and taxa of uncertain status are indicated. Each typification is accompanied by a discussion of the reasoning behind the choice of specimen, and all newly designated types are illustrated.Se confirman o designan los lectótipos, neótipos o epítipos de 16 de los 22 nombres acuñados por Martín de Sessé y Lacasta y José Mariano Mociño que o bien fueron descritos dentro del género Solanum (Solanaceae o son actualmente reconocidos como parte del mismo: Solanum bifidum, S. cordovense, S. declinatum, S. dichotomum, S. diphyllum, S. lanceifolium, S. lanceolatum, S. lineatum (ambos homónimos, S. longifolium, S. mexicanum, S. nutans, S. sarmentosum, S. scandens, S. tlacotalpense y S. uniflorum. Se incluye una breve introducción explicando la importancia de la Real Expedición Botánica a Nueva España (expedición de Sessé y Mociño para la botánica de su tiempo, así como las dificultades que entraña neotipificar o lectotipificar los nombres acuñados por éllos. Se incluye el nombre aceptado para cada taxon cuando es posible y cada tipificación se acompaña de una discusión explicando

  14. Induction of cell death on Plasmodium falciparum asexual blood stages by Solanum nudum steroids

    DEFF Research Database (Denmark)

    López, Mary Luz; Vommaro, Rossiane; Zalis, Mariano

    2010-01-01

    Solanum nudum Dunal (Solanaceae) is a plant used in traditional medicine in Colombian Pacific Coast, from which five steroids denominated SNs have been isolated. The SNs compounds have antiplasmodial activity against asexual blood stages of Plasmodium falciparum strain 7G8 with an IC50 between 20...

  15. Distribution of a Ty3/gypsy-like retroelement on the A and B-chromosomes of Cestrum strigilatum Ruiz & Pav. and Cestrum intermedium Sendtn. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Jéferson Nunes Fregonezi

    2007-01-01

    Full Text Available Retroelements are a diversified fraction of eukaryotic genomes, with the Ty1/copia and Ty3/gypsy groups being very common in a large number of plant genomes. We isolated an internal segment of the Ty3/gypsy retroelement of Cestrum strigilatum (Solanaceae using PCR amplification with degenerate primers for a conserved region of reverse transcriptase. The isolated segment (pCs12 was sequenced and showed similarity with Ty3/gypsy retroelements of monocotyledons and dicotyledons. This segment was used as probe in chromosomes of C. strigilatum and Cestrum intermedium. Diffuse hybridization signals were observed along the chromosomes and more accentuated terminal signals in some chromosome pairs, always associated with nucleolus organizer regions (NORs. The physical relationship between the hybridization sites of pCs12 and pTa71 ribosomal probes was assessed after sequential fluorescence in situ hybridization (FISH. Hybridization signals were also detected in the B chromosomes of these species, indicating an entail among the chromosomes of A complement and B-chromosomes.

  16. Phytotoxicity and cytogenotoxicity of hydroalcoholic extracts from Solanum muricatum Ait. and Solanum betaceum Cav. (Solanaceae) in the plant model Lactuca sativa.

    Science.gov (United States)

    Dos Santos, Fabio Eduardo; Carvalho, Marcos Schleiden Sousa; Silveira, Graciele Lurdes; Correa, Felipe Folgaroli; Cardoso, Maria das Graças; Andrade-Vieira, Larissa Fonseca; Vilela, Luciane Resende

    2018-03-05

    Plants are rich in biologically active compounds. They can be explored for the production of bioherbicides. In this context, the present work aimed to evaluate the allelopathic effect of hydroalcoholic extracts from two Solanaceae species: Solanum muricatum Ait. and Solanum betaceum Cav. For this end, we conducted phytochemical screening and biological assays, determining the effects of the extracts on germination, early development, cell cycle, and DNA fragmentation in plantlets and meristematic cells of the plant model Lactuca sativa L. (lettuce). The percentage of seeds germinated under effect of S. muricatum extract did not differ from the control, but plantlet growth was reduced at the highest concentrations. For S. betaceum extract, dose dependence was observed for both germination and plantlet development, with the highest concentrations inhibiting germination. The growth curves revealed the concentrations of 2.06 and 1.93 g/L for S. muricatum and S. betaceum extracts, respectively, as those reducing 50% of root growth (RG). At these concentrations, both extracts presented mitodepressive effect, besides inducing significant increase in the frequency of condensed nuclei, associated to DNA fragmentation and cytoplasmic shrinkage. The frequency of chromosome alterations was not significant. We further discuss the mechanisms of action related to the chemical composition of the extracts, which presented organic acids, reducing sugars, proteins, amino acids, and tannins, besides catechins and flavonoids, only found in the extract of S. betaceum.

  17. In vitro production of secondary metabolite using Atropa komarovii Bline&Shal (Solanaceae hairy root culture via Agrobacterium rhizogenes ATCC15834

    Directory of Open Access Journals (Sweden)

    Ofelia Banihashemi

    2017-07-01

    Full Text Available Background & Aim:A new sustainable tissue-based system is presented by plant hairy roots, preserving all of the several specialized types of cell with critical roles in allowing bioactive secondary molecules to be synthesized more consistently as usual. The system is also essential for studying the production of alkaloid in culture. Experimental: The Atropa komarovii leaves were wounded and infected with soil gram-negative bacterium Agrobacterium rhizogenes ATCC15834. After three weeks, the transformation roots and control roots without infection, appeared, and for confirming that T-DNA Ri plasmid fragments were transformed and integrated to plant genome, the rolB gene region, was amplified using PCR. HPLC method was then used for assaying how two tropane alkaloids such as atropine (hyosciamine and scopolamine (hyoscine were produced in hairy roots,control roots, leaves and roots of plantlet. Results: The data indicated that diagnostic 500bp rol B product amplification was exhibited to be present by all the transformed hairy roots. Scopolamine content in hairy roots was considerably greater than that in control roots but greatest (Hyoscyamine atropine content was observed in control roots. Analysis of DW, FW and root length showed that fresh and dry root weight increased in hairy roots compared with that in non transformed root. Recommended applications/industries: The present study demonstrated that secondary metabolite production using medicinal plants concerns many researchers worldwide today and hairy root culture is a useful method for producing tropane alkaloids in solanaceae.

  18. Reproductive biology of endemic Solanum melissarum Bohs (Solanaceae) and updating of its current geographic distribution as the basis for its conservation in the Brazilian Cerrado.

    Science.gov (United States)

    Coelho, C P; Gomes, D C; Guilherme, F A G; Souza, L F

    2017-11-01

    The genus Solanum (family Solanaceae) includes more than 1400 species and has buzz-pollinated flowers with poricidal anthers. The present study aimed to describe the distribution, breeding system and pollination mechanism of Solanum melissarum, a species endemic to Brazil. The study of breeding system was conducted in an urban forest fragment in Jataí, GO. Distribution data were gathered from floristic surveys and digital plant databases. The floral morphology and the pollination mechanism were studied on through field observations and preserved flowers. The breeding system was determined through hand pollination treatments. The species has a distribution only in the Brazilian Atlantic forest coastal, and this study provides the first records of S. melissarum for the state of Goiás. The pendulous flowers have poricidal anthers close to the stigma, with membranous thecae joined by a connective bearing osmophores that attract males of Euglossa cordata bees. As they collect fragrances, the bees press the thecae and pollen is released through a bellows mechanism. Based on the hand-pollination treatments, this species is self-incompatible. Isolated forest fragments may not include enough pollinators to ensure the pollination of plants with specialized systems. However, they are essential for the conservation of species with interesting phytogeographic patterns, such as the vicariance observed in S. melissarum, and for the conservation of regional diversity.

  19. Comparative mapping of Phytophthora resistance loci in pepper germplasm: evidence for conserved resistance loci across Solanaceae and for a large genetic diversity.

    Science.gov (United States)

    Thabuis, A; Palloix, A; Pflieger, S; Daubèze, A-M; Caranta, C; Lefebvre, V

    2003-05-01

    Phytophthora capsici Leonian, known as the causal agent of the stem, collar and root rot, is one of the most serious problems limiting the pepper crop in many areas in the world. Genetic resistance to the parasite displays complex inheritance. Quantitative trait locus (QTL) analysis was performed in three intraspecific pepper populations, each involving an unrelated resistant accession. Resistance was evaluated by artificial inoculations of roots and stems, allowing the measurement of four components involved in different steps of the plant-pathogen interaction. The three genetic maps were aligned using common markers, which enabled the detection of QTLs involved in each resistance component and the comparison of resistance factors existing among the three resistant accessions. The major resistance factor was found to be common to the three populations. Another resistance factor was found conserved between two populations, the others being specific to a single cross. This comparison across intraspecific germplasm revealed a large variability for quantitative resistance loci to P. capsici. It also provided insights both into the allelic relationships between QTLs across pepper germplasm and for the comparative mapping of resistance factors across the Solanaceae.

  20. (Apocynaceae) bark and Xylopia aethiopica (Dunal)

    African Journals Online (AJOL)

    SERVER

    African Journal of Biotechnology Vol. 7 (6), pp. 701-705, 18 March, 2008. Available online at .... and modified enzymatic procedures from Sigma Diagnostics. (Wasan et al., 2001). ..... Fundamentals of Clinical Chemistry. 2nd Edition. Tietz WN ...

  1. (L.) Dunal using RAPD and AFLP markers

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... Fragment Length Polymorphism (AFLP) markers. Eighteen ... importance due to its simplicity, efficiency, relative ease .... nation, number of polymorphic bands, percentage polymorphism .... roots, stems, leaves, flowers, pollen grains, mature fruits ... genetic changes that isolated it from the wild species.

  2. Biotechnological interventions in Withania somnifera (L.) Dunal.

    Science.gov (United States)

    Singh, Pritika; Guleri, Rupam; Singh, Varinder; Kaur, Gurpreet; Kataria, Hardeep; Singh, Baldev; Kaur, Gurcharan; Kaul, Sunil C; Wadhwa, Renu; Pati, Pratap Kumar

    2015-01-01

    Withania somnifera is one of the most valued plants and is extensively used in Indian, Unani, and African systems of traditional medicine. It possess a wide array of therapeutic properties including anti-arthritic, anti-aging, anti-cancer, anti-inflammatory, immunoregulatory, chemoprotective, cardioprotective, and recovery from neurodegenerative disorders. With the growing realization of benefits and associated challenges in the improvement of W. somnifera, studies on exploration of genetic and chemotypic variations, identification and characterization of important genes, and understanding the secondary metabolites production and their modulation has gained significant momentum. In recent years, several in vitro and in vivo preclinical studies have facilitated the validation of therapeutic potential of the phytochemicals derived from W. somnifera and have provided necessary impetus for gaining deeper insight into the mechanistic aspects involved in the mode of action of these important pharmaceutically active constituents. The present review highlights some of the current developments and future prospects of biotechnological intervention in this important medicinal plant.

  3. SCR96, a small cysteine-rich secretory protein of Phytophthora cactorum, can trigger cell death in the Solanaceae and is important for pathogenicity and oxidative stress tolerance.

    Science.gov (United States)

    Chen, Xiao-Ren; Li, Yan-Peng; Li, Qi-Yuan; Xing, Yu-Ping; Liu, Bei-Bei; Tong, Yun-Hui; Xu, Jing-You

    2016-05-01

    Peptides and small molecules produced by both the plant pathogen Phytophthora and host plants in the apoplastic space mediate the relationship between the interplaying organisms. Various Phytophthora apoplastic effectors, including small cysteine-rich (SCR) secretory proteins, have been identified, but their roles during interaction remain to be determined. Here, we identified an SCR effector encoded by scr96, one of three novel genes encoding SCR proteins in P. cactorum with similarity to the P. cactorum phytotoxic protein PcF. Together with the other two genes, scr96 was transcriptionally induced throughout the developmental and infection stages of the pathogen. These genes triggered plant cell death (PCD) in the Solanaceae, including Nicotiana benthamiana and tomato. The scr96 gene did not show single nucleotide polymorphisms in a collection of P. cactorum isolates from different countries and host plants, suggesting that its role is essential and non-redundant during infection. Homologues of SCR96 were identified only in oomycetes, but not in fungi and other organisms. A stable protoplast transformation protocol was adapted for P. cactorum using green fluorescent protein as a marker. The silencing of scr96 in P. cactorum caused gene-silenced transformants to lose their pathogenicity on host plants and these transformants were significantly more sensitive to oxidative stress. Transient expression of scr96 partially recovered the virulence of gene-silenced transformants on plants. Overall, our results indicate that the P. cactorum scr96 gene encodes an important virulence factor that not only causes PCD in host plants, but is also important for pathogenicity and oxidative stress tolerance. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  4. Dispersals of Hyoscyameae and Mandragoreae (Solanaceae) from the New World to Eurasia in the early Miocene and their biogeographic diversification within Eurasia.

    Science.gov (United States)

    Tu, Tieyao; Volis, Sergei; Dillon, Michael O; Sun, Hang; Wen, Jun

    2010-12-01

    The cosmopolitan Solanaceae contains 21 tribes and has the greatest diversity in South America. Hyoscyameae and Mandragoreae are the only tribes of this family distributed exclusively in Eurasia with two centers of diversity: the Mediterranean-Turanian (MT) region and the Tibetan Plateau (TP). In this study, we examined the origins and biogeographical diversifications of the two tribes based on the phylogenetic framework and chronogram inferred from a combined data set of six plastid DNA regions (the atpB gene, the ndhF gene, the rps16-trnK intergenic spacer, the rbcL gene, the trnC-psbM region and the psbA-trnH intergenic spacer) with two fossil calibration points. Our data suggest that Hyoscyameae and Mandragoreae each forms a monophyletic group independently derived from different New World lineages in the early Miocene. Phylogenetic relationships within both tribes are generally well resolved. All genera of Hyoscyameae are found to be monophyletic and they diversified in middle to late Miocene. At nearly the same time, Mandragoreae split into two clades, corresponding to the MT region and the TP region, respectively. Both the phylogenetic relationships and the estimated ages of Hyoscyameae and Mandragoreae support two independent dispersal events of their ancestors from the New World into Eurasia. After their arrivals in Eurasia, the two tribes diversified primarily in the MT region and in the TP region via multiple biogeographic processes including vicariance, dispersal, recolonization or being preserved as relicts, from the mid Miocene to the late Quaternary. Published by Elsevier Inc.

  5. Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Hufnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae); Impacto dos nutrientes N e K e de acucares soluveis sobre populacoes de Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) e Agrotis ipsilon (Hufnagel) (Lepidoptera, Noctuidae) na cultura da batata, Solanum tuberosum L. (Solanaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Azeredo, Edson Henrique de [Universidade Federal Fluminense (UFF), Pinheiral, RJ (Brazil). Pro-Reitoria de Extensao], e-mail: edsonhenrique.azeredo@bol.com.br; Lima, Eduardo [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Agronomia. Dept. de Solos; Cassino, Paulo Cesar Rodrigues [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Biologia. Centro Integrado de Manejo de Pragas C.R.G.

    2004-03-15

    Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Huefnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae). The occurrence of Diabrotica speciosa (Germar, 1824) and Agrotis ipsilon (Huefnagel, 1767) on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum quantity of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha{sup -1} of N + K with 27.03% at P< 0,05. It was observed that the effect of the dosage of N + K in the increment of the concentration of soluble sugars increased the damages in the tubercles and stems by A. ipsilon. The infestation by these species increased to 58.82% on the Monalisa cultivar, when the nitrogen dosage increased from zero to 150 kg.ha{sup -1}, in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensitized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing. (author)

  6. Healthscaping a medieval city: Lucca’s Curia viarum and the future of public health history

    NARCIS (Netherlands)

    Geltner, G.

    2013-01-01

    In early fourteenth-century Lucca, one government organ began expanding its activities beyond the maintenance of public works to promoting public hygiene and safety, and in ways that suggest both a concern for and an appreciation of population-level preventative healthcare. Evidence for this shift

  7. Anti-ulcer and anti-Helicobacter pylori potentials of the ethyl acetate fraction of Physalis alkekengi L. var. franchetii (Solanaceae) in rodent.

    Science.gov (United States)

    Wang, Yong; Wang, Sui Lou; Zhang, Jiong Yi; Song, Xiao Ning; Zhang, Zhi Yong; Li, Jing Feng; Li, Song

    2018-01-30

    Physalis alkekengi L. var. franchetii (Solanaceae) has been widely used in Chinese folk medicine due to its wide distribution throughout the country, for the treatment of a wide range of diseases including heat and cold, sore throat, fever, fungal infection, inflammation, toothache, rheumatism, burn, analgesic, ulcer and urinary diseases. However, the effect of P. alkekengi var. franchetii on ulcer and Helicobacter pylori infection has not been reported to date. This study was designed to investigate the anti-inflammatory, anti-ulcer, anti-Helicobacter pylori and analgesic properties of ethyl acetate fraction of the crude aqueous methanolic extract from the aerial parts of the plant P. alkekengi L. var. franchetii in rodents. Acute toxicity of the crude extract of P. alkekengi L. var. franchetii (PAF) was evaluated in rats. The petroleum ether fraction (PEF), butanol fraction (BF), ethyl acetate fraction (EAF) and aqueous fraction (AF) of crude aqueous methanolic extract from PAF were screened for anti-inflammatory and anti-ulcer potential at doses of 100, 250 and 500mg/kg (p.o.), using carrageenin-induced hind paw edema and ethanol-induced gastric lesions test in rats. In vitro anti-Helicobacter pylori activity of EAF was assayed subsequently. In addition, three doses of EAF were evaluated for analgesic activity using hot plate and writhing tests, respectively. Finally, we performed a phytochemical analysis of EAF. Four fractions of crude extract from PAF significantly reduced the paw volume in carrageenin-induced hind paw edema model at different doses (100, 250 and 500mg/kg, p.o.). The fraction EAF at a dose of 500mg/kg exhibited the highest (75.92%) (0.150 ± 0.045***, ***p < 0.001) anti-inflammatory potential, which is similar to indomethacin (***P < 0.001)(0.120 ± 0.014***, 80.74% inhibition of inflammation) at 5mg/kg. Pretreatment with EAF (500mg/kg, p.o.) significantly reduced the intensity of gastric mucosal damage and showed higher gastroprotective

  8. Development of a real-time PCR method for the differential detection and quantification of four solanaceae in GMO analysis: potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum).

    Science.gov (United States)

    Chaouachi, Maher; El Malki, Redouane; Berard, Aurélie; Romaniuk, Marcel; Laval, Valérie; Brunel, Dominique; Bertheau, Yves

    2008-03-26

    The labeling of products containing genetically modified organisms (GMO) is linked to their quantification since a threshold for the presence of fortuitous GMOs in food has been established. This threshold is calculated from a combination of two absolute quantification values: one for the specific GMO target and the second for an endogenous reference gene specific to the taxon. Thus, the development of reliable methods to quantify GMOs using endogenous reference genes in complex matrixes such as food and feed is needed. Plant identification can be difficult in the case of closely related taxa, which moreover are subject to introgression events. Based on the homology of beta-fructosidase sequences obtained from public databases, two couples of consensus primers were designed for the detection, quantification, and differentiation of four Solanaceae: potato (Solanum tuberosum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), and eggplant (Solanum melongena). Sequence variability was studied first using lines and cultivars (intraspecies sequence variability), then using taxa involved in gene introgressions, and finally, using taxonomically close taxa (interspecies sequence variability). This study allowed us to design four highly specific TaqMan-MGB probes. A duplex real time PCR assay was developed for simultaneous quantification of tomato and potato. For eggplant and pepper, only simplex real time PCR tests were developed. The results demonstrated the high specificity and sensitivity of the assays. We therefore conclude that beta-fructosidase can be used as an endogenous reference gene for GMO analysis.

  9. Contribution à l'étude de l'activité biologique d'extraits de feuilles de Cestrum parqui L'Herit.(Solanaceae sur le criquet pélerin Schistocerca gregaria (Forsk

    Directory of Open Access Journals (Sweden)

    Barbouche N.

    2001-01-01

    Full Text Available Contribution to the study of the biological activity of Cestrum parqui L'Herit. extracts against the locust Schistocerca gregaria (Forsk. The leaves of Cestrum parqui L'Herit. (Solanaceae, a common ornamental shrub in North Africa showed strong insecticide activity against the locust Schistocerca gregaria. The first part of this paper deals with a phytochemical survey of C. parqui. The second one reports on the toxicity of methanolic extracts (EB of leaves and fractions thereof. The mortality in treated insects (at the 5th instar injected with aqueous solutions of EB or fractions reached 100/ within a period of 2 to 4 days. The bioassays undertaken with two fractions F37 (recovered from EB by solid phase extraction and ESB (resulting from the diethylether precipitation from EB methanolic solution exhibited a similar toxicity. The n-hexane extracts obtained after F37 and ESB acidic hydrolysis showed the same TLC patterns. The toxicity of C. parqui is related to the occurrence of saponins.

  10. Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Hufnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae)

    International Nuclear Information System (INIS)

    Azeredo, Edson Henrique de; Lima, Eduardo; Cassino, Paulo Cesar Rodrigues

    2004-01-01

    Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Huefnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae). The occurrence of Diabrotica speciosa (Germar, 1824) and Agrotis ipsilon (Huefnagel, 1767) on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum quantity of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha -1 of N + K with 27.03% at P -1 , in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensitized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing. (author)

  11. Integrating varietal resistance with Xylopia aethiopica (Dunal) A ...

    African Journals Online (AJOL)

    The different rates of X. aethiopica extract significantly interacted with maize varietal resistance and reduced fecundity of S. zeamais and maize seed weight loss due to insect's feeding. Treatment of seeds with extract at 1.0 ml/20 g seed caused significant (above 50%) mortality at 24 h post treatment in all varieties whereas ...

  12. In Vitro Propagation and Conservation of Withania somnifera (Dunal) L.

    Science.gov (United States)

    Fatima, Nigar; Ahmad, Naseem; Anis, Mohammad

    2016-01-01

    Plant tissue culture offers several techniques for rapid clonal propagation, germplasm conservation, regeneration of genetically manipulated superior clones, production of phyto-constituents, and ex vitro conservation of valuable phytodiversity. An improved and efficient micropropagation protocol for Withania somnifera (L.), a drug-producing medicinal plant, using juvenile explants (nodal explants) has been developed. Highest multiplication and subsequent elongation of shoots is observed on MS medium containing BA and NAA. The regenerated microshoots roots best on ½ MS medium containing NAA, established in earthen pots containing garden soil and are maintained in the greenhouse with 95 % survival rate. Genetic uniformity of micropropagated plants is confirmed by PCR-based DNA fingerprinting techniques, viz., RAPD and ISSR. No variation is observed in DNA fingerprinting patterns among the micropropagated plants, which are similar to that of the donor plant illustrating their genetic uniformity.

  13. Extratos metanólico e acetato de etila de Solanum megalonyx Sendtn. (Solanaceae apresentam atividade espasmolítica em íleo isolado de cobaia: um estudo comparativo

    Directory of Open Access Journals (Sweden)

    Rita de Cássia M. Oliveira

    Full Text Available Solanum megalonyx Sendtn. (Solanaceae é conhecida popularmente por "jurubeba" no Nordeste do Brasil e se apresenta na forma de arbusto. Várias espécies de Solanum apresentam efeito espasmolítico em órgãos isolados. Assim, objetivou-se investigar e comparar o efeito dos extratos metanólico (SM-MeOH e acetato de etila (SM-AcOEt, obtidos das partes aéreas de S. megalonyx, em íleo isolado de cobaia. SM-MeOH e SM-AcOEt antagonizaram (n = 5 as contrações fásicas induzidas por 1 mM de acetilcolina (logCI50 = 3,2 ± 0,1 e 1,8 ± 0,6 mg/mL, respectivamente ou de histamina (logCI50 = 2,8 ± 0,5 e 1,7 ± 0,3 mg/mL, respectivamente. SM-MeOH e SM-AcOEt também relaxaram (n = 5 o íleo pré-contraído por 40 mM de KCl (logCE50 = 1,9 ± 0,09 e 1,9 ± 0,1 mg/mL, respectivamente, por 1 mM de histamina (logCE50 = 1,9 ± 0,07 e 1,7 ± 0,08 mg/mL, respectivamente ou de acetilcolina (logCE50 = 1,9 ± 0,02 e 1,7 ± 0,09 mg/mL, respectivamente de maneira dependente de concentração e equipotente. Demonstra-se pela primeira vez que S. megalonyx apresenta efeito espasmolítico não seletivo em íleo isolado de cobaia, sugerindo que os extratos podem estar agindo em um passo comum da via de sinalização dos agentes contráteis testados.

  14. Flowerlocation in Solanum dulcamara L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Irina Zhuravlyeva

    2013-01-01

    Full Text Available The morphology of inflorescence of Solanum dulcamara is studied. Pseudolateral location of inflorescence relatively to plant body is set, the absence of bracteae and the sympodial type of growing of branches are found out. From W. Troll point of view the inflorescence of nightshade is defined as the polytelica synflorescence – complex dichasium.

  15. Is Solanum ferox var. ferox (Solanaceae) extinct?

    NARCIS (Netherlands)

    Heiser, C.B.

    2001-01-01

    In 1995 I wrote letters to over 50 people (botanists, agricultural scientists, and former students of Indiana University) in south-eastern Asia trying to obtain a few seeds of Solanumferox L. var. ferox (S. involucratum Blume). I had over 25 replies, five of which included seeds, but none of the

  16. Composición química de los aceites esenciales de las hojas de Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae y Solanum subinerme (Solanaceae, recolectadas en Sucre, Venezuela

    Directory of Open Access Journals (Sweden)

    Gabriel Ordaz

    2011-06-01

    Full Text Available Los aceites esenciales son biosintetizados por plantas aromáticas y pueden obtenerse de cualquier órgano de la misma, tienen gran aplicación en la industria farmacéutica, sanitaria, cosmética, agrícola y de alimentos. Los aceites esenciales de las hojas de las plantas Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis y Solanum subinerme fueron obtenidos mediante hidrodestilación con rendimientos de 0.004, 0.032, 0.016 y 0.005%, respectivamente. La CG/EM permitió identificar la mayoría de los constituyentes de estos aceites esenciales (88.00, 89.80, 87.50 y 89.47%, respectivamente, encontrándose en mayor proporción metabolitos no volátiles de estructura no terpenoidal en H. guazumifolia (30.28%, sesquiterpenoides oxigenados en P. tuberculatum (52.19%, sesquiterpenos en S. dulcis (26.09% y derivados oxigenados de diterpenos en S. subinerme (39.67%. Los constituyentes mayoritarios fueron el diisobutilftalato (13.11% en H. guazumifolia, (--espatulenol (11.37% en P. tuberculatum y el trans-fitol (8.29 y 36.00% para S. dulcis y S. subinerme, respectivamente. El diisooctilftalato fue el constituyente común en los aceites esenciales de todas las especies y los compuestos volátiles trans-pinano, L-linalool, β-ionona, isofitol, neofitadieno, trans-fitol, dibutilftalato y hexadecanoato de metilo, fueron detectados en tres de estas esencias. Esto sugiere que dichas plantas pueden requerir metabolitos secundarios similares para su interacción ecológica, posiblemente debido a factores ambientales comunes.Chemical composition of essential oils from leaves of Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae and Solanum subinerme (Solanaceae from Sucre, Venezuela. Essential oils, biosynthesized and accumulated in aromatic plants, have a wide range of applications in the pharmaceutical health, cosmetics, food and agricultural industry. This study aimed to analyze the secondary

  17. Breeding systems in some representatives of the genus Lycium (Solanaceae

    Directory of Open Access Journals (Sweden)

    L. Minne

    1994-10-01

    Full Text Available The development of the ovule and the embryo sac of five of the 17 species of Lycium and of one hybrid, recorded for southern Africa, was investigated. All specimens of four of the species and the hybrid (between a hermaphroditic and a functionally dioecious species were found to be functionally dioecious: they express only one sex, although both male and female organs are present in the same tlower. One species was hermaphroditic. The embryo sacs of all species, and of the hybrid, were of the normal eight-nucleate Polygonum type. The structure of the ovary and the development of the embryo sac are similar to those of L europaeum L. The absence of unreduced embryo sacs indicates that apomixis does not occur at any ploidy level in the species studied.

  18. Two new South American species of Solanum section Crinitum (Solanaceae

    Directory of Open Access Journals (Sweden)

    Frank Farruggia

    2010-11-01

    Full Text Available Two new species of Solanum section Crinitum are described here. Solanum falciforme Farruggia, sp. nov., closely resembles S. crinitum and S. lycocarpum, but differs by the presence of falcate trichomes on the young growth. It is endemic to the cerrado and adjacent woodlands of Distrito Federal, Bahia, Goiás and Minas Gerais, Brazil. The other species, Solanum pseudosycophanta Farruggia, sp.nov., has close affinities to S. sycophanta but differs from the latter inprominent long-stalked stellate hairs along the stem, calyx, petiole and the adaxial surface of the leaf, in contrast to S. sycophanta which is glabrous or pubescent with sessile to short-stalked multangulate hairs. This species is narrowly distributed in tropical montane forests of northern Peru and southern Ecuador.

  19. Six cultivars of Solanum macrocarpon (Solanaceae in Ghana

    Directory of Open Access Journals (Sweden)

    Z. R. Bukenya

    1987-10-01

    Full Text Available The  Solanum macrocarpon complex (the cultivated egg plant has been studied in Ghana using morphological and experimental methods. Six cultivars belonging to the S.  macrocarpon complex have been recognized and described. The cultivars are  S. macrocarpon ‘Gboma’,  S. macrocarpon ‘Mankessim’,  S. macrocarpon ‘Akwaseho’,  S. macrocarpon ‘Kade’,  S. macrocarpon ‘Sarpeiman’ and  S. macrocarpon ‘Bui’. The very spiny, hairy plant traditionally called S. dasyphyllum is regarded as the wild ancestor from which the cultivars have been derived through a process of crop evolution. The variation within S. macrocarpon complex is attributable to genotypic differences and environmental factors.

  20. Numerical taxonomic study of some solanum l. Species (solanaceae ...

    African Journals Online (AJOL)

    ) were employed to elucidate the relationship among the taxa of the genus, while similarity matrix and dendrogram were constructed. PCA factor loading of the characters showed that characters such as plant height, leaf margin and leaf base ...

  1. Annotated checklist of Solanum L. (Solanaceae for Peru

    Directory of Open Access Journals (Sweden)

    Tiina Särkinen

    2015-04-01

    Full Text Available The genus Solanum is among the most species-rich genera both of the Peruvian flora and of the tropical Andes in general. The present revised checklist treats 276 species of Solanum L., of which 253 are native, while 23 are introduced and/or cultivated. A total of 74 Solanum species (29% of native species are endemic to Peru. Additional 58 species occur only in small number of populations outside Peru, and these species are here labelled as near-endemics to highlight the role Peru playes in their future protection. Species diversity is observed to peak between 2500 – 3000 m elevation, but endemic species diversity is highest between 3000 – 3500 m elevation. Cajamarca has the highest number of endemic (29 spp. and total species (130 spp., even when considering the effect of area. Centers of endemic species diversity are observed in provinces of Cajamarca (Cajamarca, Huaraz and Carhuaz (Ancash, and Canta and Huarochirí (Lima. Secondary centres of endemism with high concentrations of both endemics and near-endemics are found in San Ignacio and Cutervo (Cajamarca, Santiago de Chuco (La Libertad, Oxapampa (Pasco, and Cusco (Cusco. Current diversity patterns are highly correlated with collection densities, and further collecting is needed across all areas, especially from Arequipa, Ayacucho, Puno, Ancash, Huánuco, Amazonas and Cajamarca, where high levels of species diversity and endemism are indicated but only a few collections of many species are known.

  2. Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant' Anna, Carlos M.R., E-mail: mgeraldo@ufrrj.b [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Dept. de Quimica; Benassi Neto, Mario; Eberlin, Marcos N. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacases, RJ (Brazil). Setor de Quimica de Produtos Naturais. Lab. de Ciencias Quimicas

    2010-07-01

    The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-{beta}-D-apiofuranosyl-(1->5)-{beta}-D-apiofuranosyl-(1->6)-{beta}-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete {sup 1}H and {sup 13}C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)

  3. Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)

    International Nuclear Information System (INIS)

    Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant'Anna, Carlos M.R.; Benassi Neto, Mario; Eberlin, Marcos N.; Braz-Filho, Raimundo

    2010-01-01

    The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-β-D-apiofuranosyl-(1->5)-β-D-apiofuranosyl-(1->6)-β-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete 1 H and 13 C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)

  4. Datura inoxia Mill. (Solanaceae, a new alien species in Serbia

    Directory of Open Access Journals (Sweden)

    Lakušić, D.

    2017-09-01

    Full Text Available As ornamental plant originated from Central America, Datura inoxia Mill. has been introduced to many areas beyond its natural range. However, in many places, mainly in the Mediterranean region D. inoxia has escaped from cultivation and is being established as an alien. In relevant botanical literature its occurrence on the Balkan Peninsula has not been reported for Albania, Bosnia & Herzegovina, Macedonia (FYROM and Serbia. Based on our field and herbarium studies, we have found that D. inoxia is also present in Serbia, both as cultivated ornamental plant, but as well as an escape, with established populations. We have registered this species in 23 localities in Srem, Bačka, Banat, Šumadija and NE Serbia regions, which are situated in 16 UTM 10 km x 10 km squares. Most of the findings (16 localities refer to a small group of individuals which are cultivated, while the remaining seven relate to plants that have escaped from cultivation and have established small wild populations in the surrounding ruderal habitats, edges of natural or planted forest, waste and arable fields. Although we have registered only seven small groups of individuals that have escaped from cultivation, due to its capacity to invade natural habitats D. inoxia can be considered as potential threat for natural biodiversity in Serbia.

  5. Solanaceae III: henbane, hags and Hawley Harvey Crippen.

    Science.gov (United States)

    Lee, M R

    2006-12-01

    Hyoscyamus, the henbane, is one of the drugs of the ancients. Initially used both as a poison and narcotic, it was widely adopted by witches, wizards and soothsayers as a component of their hallucinatory and flying ointments. It was also used by notorious poisoners such as Madame Voisin in France. Eventually, in the nineteenth century its active principle was isolated by Ladenburg and called l-hyoscine. It proved to be a tropane alkaloid very similar to atropine. These two alkaloids proved to be very important in the study of the parasympathetic component of the autonomic nervous system, and together with physostigmine, allowed the major neurotransmitter acetylcholine to be isolated and its mechanisms of action to be characterised. The Crippen murder case in 1910 gave hyoscine further fame, indeed, notoriety. The unassuming homeopathic doctor murdered his wife with the alkaloid and then decamped for Canada with his mistress Ethel Le Neve. The case became a worldwide sensation for several reasons: the arrest of the fugitive couple by wireless telegraphy (Marconigram) and the extensive chemical and histological evidence presented by Willcox and Spilsbury. Some authorities claim that this was the beginning of the science of forensic medicine in Britain. Hyoscine is now hardly ever used in modern therapeutics but its history from antiquity to the witches and on to Dr Crippen is both bizarre and fascinating.

  6. Effects of ionizing radiation on Capsicum baccatum var. pendulum (Solanaceae)

    International Nuclear Information System (INIS)

    Scaldaferro, M.A.; Prina, A.R.; Moscone, E.A.; Kwasniewska, J.

    2013-01-01

    Cytogenetic and somatic effects of various x-ray treatments were evaluated in pepper, Capsicum baccatum var. pendulum cv. “Cayenne”, with the aim to assess optimal conditions for obtaining viable lines. The cytogenetic effects were quantified by counting chromosome aberrations. The level of DNA fragmentation was estimated with TUNEL test (terminal transferase mediated dUTP-fluorescein nick end labeling). Irradiation to 20 Gy with 16-h presoaking can be a suitable treatment of the selected pepper cultivar for a mutagenesis program. - Highlights: • Cytogenetic and somatic effects of x-rays treatments in Capsicum were evaluated. • Frequencies of chromosome aberrations correlated with radiation doses. • Highest frequency of chromosome aberrations occurred with 20 Gy+soaking seeds. • In TUNEL test, the nuclei with DNA fragmentation were higher than in the control. • The strongest effects were observed with doses of 300 Gy or 20 Gy after soaking

  7. Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)

    OpenAIRE

    Cornelius, Marli T. F.; Carvalho, Mário G. de; Silva, Tania M. S. da; Alves, Cassia C. F.; Siston, Ana P. N.; Alves, Kelly Z.; Sant'Anna, Carlos M. R.; Neto, Mario B.; Eberlin, Marcos N.; Braz-Filho, Raimundo

    2010-01-01

    The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-β-D-apiofuranosyl-(1→5)-β-D-apiofuranosyl-(1→6)-β-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans- coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solama...

  8. New records of Petunia (Solanaceae) for the Argentinean flora

    OpenAIRE

    Ando, Toshio; Soto, Silvina; Suárez, Enrique

    2005-01-01

    Petunia interior and P. guarapuavensis are reported for the first time for the Argentinean flora, and their geographical distributions are updated. Petunia interior y P. guarapuavensis son citadas por pimera vez para la Flora Argentina, con una actualización de su distribución geográfica.

  9. Influence of lunar cycles on growth of Ashwagandha (Withania somnifera [L.] Dunal).

    Science.gov (United States)

    Tavhare, Swagata D; Nishteswar, K; Shukla, Vinay J

    2015-01-01

    Ayurvedic classics have advocated to collect the medicinal plants according to part used and seasons in order to get desired pharmacological action and therapeutic benefits. The logic behind this principle is being validated by recent researches. To analyze the influence of lunar cycles on growth of Ashwagandha in Shishira and Greeshma Ritu (winter and summer season). Fourteen small crops of Ashwagandha of average size 10 cm were collected on October 7, 2013, from institute campus and then replantation was done at Charaka Herbal Garden, Gujarat Ayurved University, Jamnagar in an area of 60 cm × 60 cm (l × b). No fertilizers or pesticides were used. The plants were watered daily and plants were uprooted as per lunar cycles for analysis. Eight samples were collected and observed during Shishira and Greeshma season on Pournima (full moon) and Amavasya (new moon) days. The measurements were taken thrice and average values were taken into consideration for study purpose. The variations in morphological characteristics such as length, breadth, weight, and number of roots and twigs were studied through statistical procedure of principle component analysis, which makes interpretation of all possible related variables. Root weight (RW), pith diameter (PD) and internodal distance (ID) were found to be increased on full moon days as compared to new moon days. The maximum RW was observed during Greeshma Aashadha Pournima. The study has shown a definite influence of lunar cycles on the growth of the plant parts assessed by RW, PD, and ID that have found to be increased on full moon days as compared to new moon days.

  10. An efficient hairy root culture system for Withania somnifera (L.) Dunal

    African Journals Online (AJOL)

    ... the presence of acetosyringone (100 µM) attained a higher frequency (88%) of hairy root induction. By adopting this protocol, we could utilize the hairy root culture for industrial scale production of withanolides. Keywords: Leaf explant, Agrobacterium rhizogenes, Withania somnifera, co-cultivation period, acetosyringone.

  11. Sonication, Vacuum Infiltration and Thiol Compounds Enhance the Agrobacterium-Mediated Transformation Frequency of Withania somnifera (L.) Dunal

    Science.gov (United States)

    Sivanandhan, Ganeshan; Kapil Dev, Gnajothi; Theboral, Jeevaraj; Selvaraj, Natesan; Ganapathi, Andy; Manickavasagam, Markandan

    2015-01-01

    In the present study, we have established a stable transformation protocol via Agrobacterium tumafacines for the pharmaceutically important Withania somnifera. Six day-old nodal explants were used for 3 day co-cultivation with Agrobacterium tumefaciens strain LBA4404 harbouring the vector pCAMIBA2301. Among the different injury treatments, sonication, vacuum infiltration and their combination treatments tested, a vacuum infiltration for 10 min followed by sonication for 10 sec with A. tumefaciens led to a higher transient GUS expression (84% explants expressing GUS at regenerating sites). In order to improve gene integration, thiol compounds were added to co-cultivation medium. A combined treatment of L-Cys at 100 mg/l, STS at 125 mg/l, DTT at 75 mg/l resulted in a higher GUS expression (90%) in the nodal explants. After 3 days of co-cultivation, the explants were subjected to three selection cycles with increasing concentrations of kanamycin [100 to 115 mg/l]. The integration and expression of gusA gene in T0 and T1 transgenic plants were confirmed by polymerase chain reaction (PCR), and Southern blott analysis. These transformed plants (T0 and T1) were fertile and morphologically normal. From the present investigation, we have achieved a higher transformation efficiency of (10%). Withanolides (withanolide A, withanolide B, withanone and withaferin A) contents of transformed plants (T0 and T1) were marginally higher than control plants. PMID:25927703

  12. Effect of Withania somnifera Dunal Root Extract on Behavioral Despair Model in Mice: a Possible Role for Nitric Oxide

    Directory of Open Access Journals (Sweden)

    Mahshid Attari

    2016-04-01

    Full Text Available Withania somnifera (WS possess anti-inflammatory and antioxidant properties. WS preparations have a potential therapeutic role in the central nervous system (CNS related disorders in animal models. In this study, the possible protective effect of acute aqueous WS root extract on behavioral despair was explored and compared with fluoxetine, an antidepressant with selective serotonin (5-HT reuptake inhibitor activity (SSRI. Further, the probable involvement of nitric oxide (NO determined to measure immobility time in forced swimming test (FST and tail suspension test (TST in male mice. Immediately after assessment of locomotor activity, the immobility time was evaluated. WS was administered intraperitoneally (200, 400 mg/kg; i.p. 60 min before the behavioral tests. To assess the involvement of NO in the possible protective effect of WS, a non-specific NO synthase inhibitor, NG-L-arginine methyl ester (L-NAME, 10 mg/kg, i.p. was administered 30 min before the extract administration (400 mg/kg, i.p., 90 min before the tests. Acute WS extract (200, 400 mg/kg, i.p. dose-dependently decreased the immobility time in FST, P<0.05, P<0.001, respectively and 400 mg/kg proved the most effective dose and this dose was comparable to fluoxetine (20 mg/kg, i.p. WS (400 mg/kg, i.p. also lowered the immobility measure in TST (P<0.05. However, these effects were not related to change in locomotor activity. Moreover, L-NAME (10 mg/kg, i.p. did not influence the effect of the extract on the behavioral tests. As a consequence, the immobility time was virtually constant between the group received the extract (400 mg/kg alone, and the group received L-NAME (10 mg/kg before the extract. It is probable that NO does not mediate this beneficial effect, and WS may affect other neurochemical systems and pathways.

  13. Effect of combination of Withania somnifera Dunal and Tribulus terrestris Linn on letrozole induced polycystic ovarian syndrome in rats

    Directory of Open Access Journals (Sweden)

    Amrin Saiyed

    2016-12-01

    Conclusion: The above findings indicate the effectiveness of the combination of hydroalcoholic extract of WS and TT against letrozole induced polycystic ovarian syndrome in rat. This validates the usefulness of combination in PCOS and other related disorders as mentioned by Unani physicians.

  14. Validation of dbEST-SSRs and transferability of some other solanaceous species SSR in ashwagandha [Withania Somnifera (L.) Dunal].

    Science.gov (United States)

    Parmar, Eva K; Fougat, Ranbir S; Patel, Chandni B; Zala, Harshvardhan N; Patel, Mahesh A; Patel, Swati K; Kumar, Sushil

    2015-12-01

    Cross-species transferability and expressed sequence tags (ESTs) in public databases are cost-effective means for developing simple sequence repeats (SSRs) for less-studied species like medicinal plants. In this study, 11 EST-SSR markers developed from 742 available ESTs of Withania Somnifera EST sequences and 95 SSR primer pairs derived from other solanaceous crops (tomato, eggplant, chili, and tobacco) were utilized for their amplification and validation. Out of 11, 10 EST-SSRs showed good amplification quality and produced 13 loci with a product size ranging between 167 and 291 bp. Similarly, of the 95 cross-genera SSR loci assayed, 20 (21 %) markers showed the transferability of 5, 27, 32, and 14.2 % from eggplant, chili, tomato, and tobacco, respectively, to ashwagandha. In toto, these 30 SSR markers reported here will be valuable resources and may be applicable for the analysis of intra- and inter-specific genetic diversity in ashwagandha for which till date no information about SSR is available.

  15. Fruit anatomy of species of Solanum sect. Torva (Solanaceae Anatomía del fruto en especies de Solanum sect. Torva (Solanaceae

    Directory of Open Access Journals (Sweden)

    Franco E. Chiarini

    2010-12-01

    Full Text Available The mature fruits of 10 South American species of Solanum sect. Torva were studied. Cross and longitudinal microtome sections, stained with astra blue/basic fuchsin, were made for microscopic examination. All species present an epidermis formed by a unistrate layer of small, isodiametric cells, with dense content and cellulosic walls. Immediately below, a hypodermis is always found, consisting of a well-defined layer of lignified cells with a single calcium oxalate crystal occupying the whole lumen of each cell. This is followed by one layer of cellulosic, isodiametric cells with dense cytoplasm and then several collenchymatous layers, sometimes with sclerified cell walls. The mesocarp comprises two zones histologically differentiated: an external one (formed by regular, vacuolated, medium-sized cells with small intercellular spaces, and an internal one, commonly juicy, and developing proliferations among the seeds. The fruits analyzed are alike, and despite some particularities, they can be classified as berries in the conventional sense. All the traits examined agree with the ornithochorous dispersal syndrome. The homogeneity in fruit traits may be due to shared habit, habitat and sexual system.Se estudiaron los frutos maduros de 10 especies sudamericanas de Solanum sect. Torva. Se examinaron en microscopio cortes microtómicos transversales y longitudinales teñidos con azul astral/fucsina básica. Todas las especies presentaron una epidermis unistrata de células pequeñas, isodiamétricas, de contenido denso y paredes celulósicas. Inmediatamente por debajo se encontró siempre una hipodermis, formada por una capa bien definida de células lignificadas con un cristal de oxalato de calcio en el lúmen de cada célula. A continuación se halló otra capa de celulas isodiamétricas, celulósicas, de contenido denso, y luego varias capas de colénquima, en ocasiones con paredes esclerificadas. El mesocarpo presentó dos zonas histologicamente diferenciadas: una externa (formada por células regulares, vacuoladas, de tamaño medio y espacios intercelulares pequeños y una interna, comúnmente jugosa y que prolifera entre las semillas. No obstante algunas particularidades, los frutos analizados son similares entre sí, y se clasificaron como bayas en sentido convencional. Todos los rasgos analizados concuerdan con el síndrome de dispersión ornitócoro. La homogeneidad en los caracteres puede deberse al hábito, hábitat y sistema sexual compartidos.

  16. What can we learn from tobacco and other Solanaceae about horizontal DNA transfer?

    Czech Academy of Sciences Publication Activity Database

    Talianová, Martina; Janoušek, Bohuslav

    2011-01-01

    Roč. 98, č. 8 (2011), s. 1231-1242 ISSN 0002-9122 R&D Projects: GA ČR(CZ) GA521/08/0932; GA ČR(CZ) GD204/09/H002 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : Agrobacterium * grafting * horizontal gene transfer Subject RIV: BO - Biophysics Impact factor: 2.664, year: 2011

  17. Inbreeding depression in Solanum carolinense (Solanaceae, a species with a plastic self-incompatibility response

    Directory of Open Access Journals (Sweden)

    Keser Lidewij H

    2008-01-01

    Full Text Available Abstract Background Solanum carolinense (horsenettle is a highly successful weed with a gametophytic self-incompatibility (SI system. Previous studies reveal that the strength of SI in S. carolinense is a plastic trait, associated with particular S-alleles. The importance of this variation in self-fertility on the ability of horsenettle to found and establish new populations will depend, to a large extent, on the magnitude of inbreeding depression. We performed a series of greenhouse and field experiments to determine the magnitude of inbreeding depression in S. carolinense, whether inbreeding depression varies by family, and whether the estimates of inbreeding depression vary under field and greenhouse conditions. We performed a series of controlled self- and cross-pollinations on 16 genets collected from a large population in Pennsylvania to obtain progeny with different levels of inbreeding. We grew the selfed and outcrossed progeny in the greenhouse and under field conditions and recorded various measures of growth and reproductive output. Results In the greenhouse study we found (1 a reduction in flower, fruit and seed production per fruit in inbred (selfed progeny when compared to outbred (outcrossed progeny; (2 a reduction in growth of resprouts obtained from rhizome cuttings of selfed progeny; and (3 an increase in the ability to self-fertilize in the selfed progeny. In the field, we found that (1 outcrossed progeny produced more leaves than their selfed siblings; (2 herbivory seems to add little to inbreeding depression; and (3 outcrossed plants grew faster and were able to set more fruits than selfed plants. Conclusion Solanum carolinense experiences low levels of inbreeding depression under greenhouse conditions and slightly more inbreeding depression under our field conditions. The combined effects of low levels of inbreeding depression and plasticity in the strength of SI suggest that the production of selfed progeny may play an important role in the establishment of new populations of S. carolinense.

  18. The ups and downs of genome size evolution in polyploid species of Nicotiana (Solanaceae)

    Czech Academy of Sciences Publication Activity Database

    Leitch, I.J.; Hanson, L.; Lim, K.Y.; Kovařík, Aleš; Chase, M.W.; Clarkson, J.J.; Leitch, A.R.

    2008-01-01

    Roč. 101, č. 6 (2008), s. 805-814 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : genome size * allopolyploidy * evolution-Nicotiana Subject RIV: BO - Biophysics Impact factor: 2.755, year: 2008

  19. Genetic diversity and structure in semiwild and domesticated chiles (Capsicum annuum; Solanaceae) from Mexico.

    Science.gov (United States)

    Aguilar-Meléndez, Araceli; Morrell, Peter L; Roose, Mikeal L; Kim, Seung-Chul

    2009-06-01

    The chile of Mesoamerica, Capsicum annuum, is one of five domesticated chiles in the Americas. Among the chiles, it varies the most in size, form, and color of its fruits. Together with maize, C. annuum is one of the principal elements of the neotropical diets of Mesoamerican civilizations. Despite the great economic and cultural importance of C. annuum both worldwide and in Mexico, however, very little is known about its geographic origin and number of domestications. Here we sampled a total of 80 accessions from Mexico (58 semiwild and 22 domesticated) and examined nucleotide sequence diversity at three single- or low-copy nuclear loci, Dhn, G3pdh, and Waxy. Across the three loci, we found an average reduction of ca. 10% in the diversity of domesticates relative to semiwild chiles and geographic structure within Mexican populations. The Yucatan Peninsula contained a large number of haplotypes, many of which were unique, suggesting an important region of chile domestication and center of diversity. The present sampling of loci did not conclusively resolve the number and location of domestications, but several lines of evidence suggest multiple independent domestications from widely distributed progenitor populations.

  20. Anatomical structure and surface micromorphology of tomatillo leaf and flower (Physalis ixocarpa Brot., Solanaceae

    Directory of Open Access Journals (Sweden)

    Barbara Dyki

    2014-01-01

    Full Text Available Tomatillo (Physalis ixocarpa Brot. is a newly introduced cultivated plant in Poland. Its anatomy was investigated in light and scanning electron microscopes. Tomatillo adult leaf had one layer of palisade parenchyma. The 1-2 cell layers of spongy parenchyma situated just below the palisade parenchyma showed large, tightly packed cells with great druses. The remaining spongy parenchyma was built of cells showing several extensions. Peculiarity of the sepals were the stomata situated on columns or hills formed of many cells. The petals had a very loose mesophyl. Their adaxial epidermis was composed of papillate cells. Such structure of the petal epidermis probably contributes to light dispersion and prevents glittering. There were several types of trichomes on the leaves, sepals and petals, some of them glandular and some simple. The large, very ramified, dendritic trichomes situated on the petals at the entry to the ovary might eventually protect it against excessive drying. The pollen grain was spherical, three-colpate. The style had a hollow channel inside. The stigma was of a wet, pa-pillate type. Sometimes thorny trichomes were found among papillae.

  1. A clarified position for solanum lycopersicum var. cerasiforme in the evolutionary history of tomatoes (solanaceae

    Directory of Open Access Journals (Sweden)

    Causse Mathilde

    2008-12-01

    Full Text Available Abstract Background The natural phenotypic variability present in the germplasm of cultivated plants can be linked to molecular polymorphisms using association genetics. However it is necessary to consider the genetic structure of the germplasm used to avoid false association. The knowledge of genetic structure of plant populations can help in inferring plant evolutionary history. In this context, we genotyped 360 wild, feral and cultivated accessions with 20 simple sequence repeat markers and investigated the extent and structure of the genetic variation. The study focused on the red fruited tomato clade involved in the domestication of tomato and confirmed the admixture status of cherry tomatoes (Solanum lycopersicum var. cerasiforme. We used a nested sample strategy to set-up core collection maximizing the genetic diversity with a minimum of individuals. Results Molecular diversity was considerably lower in S. lycopersicum i.e. the domesticated form. Model-based analysis showed that the 144 S. lycopersicum var. cerasiforme accessions were structured into two groups: one close to the domesticated group and one resulting from the admixture of the S. lycopersicum and S. pimpinellifolium genomes. SSR genotyping also indicates that domesticated and wild tomatoes have evolved as a species complex with intensive level of hybridization. We compiled genotypic and phenotypic data to identify sub-samples of 8, 24, 32 and 64 cherry tomato accessions that captured most of the genetic and morphological diversity present in the entire S. lycopersicum var. cerasiforme collection. Conclusion The extent and structure of allelic variation is discussed in relation to historical events like domestication and modern selection. The potential use of the admixed group of S. lycopersicum var. cerasiforme for association genetics studies is also discussed. Nested core collections sampled to represent tomato diversity will be useful in diversity studies. Molecular and phenotypic variability of these core collections is defined. These collections are available for the scientific community and can be used as standardized panels for coordinating efforts on identifying novel interesting genes and on examining the domestication process in more detail.

  2. UNA NUEVA ESPECIE DE SOLANUM SECCIÓN GEMINATA (SOLANACEAE DE COLOMBIA

    Directory of Open Access Journals (Sweden)

    GRANADOS-TOCHOY JUAN CARLOS

    2006-06-01

    Full Text Available Se describe Solanum sagittantherum Granados-Tochoy & C.I. Orozco, una nuevaespecie de Solanum sección Geminata encontrada en la Cordillera Oriental de losAndes de Colombia. Se presenta información sobre su distribución, hábitat y taxonomía.

  3. Estudio citogenético en Physalis peruviana l. “Uchuva” (Solanaceae

    Directory of Open Access Journals (Sweden)

    Nohra Cecilia Rodríguez Castillo

    2004-07-01

    los datos citogenéticos. Sé evalúo la acción de la colchicina, para inducir la poliploidización en esta especie, para ello se eligieron frutos del ecotipo “Colombia” con un alto contenido de azúcares y sus semillas se cultivaron in vitro con el inhibidor mitótico, obteniéndose un diploide directo de este ecotipo. Se recomendó hacer un seguimiento de este material, para evaluar esta técnica dentro del programa de fitomejoramiento.

  4. Population structure and genetic diversity of native and invasive populations of Solanum rostratum (Solanaceae.

    Directory of Open Access Journals (Sweden)

    Jiali Zhao

    Full Text Available We investigate native and introduced populations of Solanum rostratum, an annual, self-compatible plant that has been introduced around the globe. This study is the first to compare the genetic diversity of Solanum rostratum between native and introduced populations. We aim to (1 determine the level of genetic diversity across the studied regions; (2 explore the likely origins of invasive populations in China; and (3 investigate whether there is the evidence of multiple introductions into China.We genotyped 329 individuals at 10 microsatellite loci to determine the levels of genetic diversity and to investigate population structure of native and introduced populations of S. rostratum. We studied five populations in each of three regions across two continents: Mexico, the U.S.A. and China.We found the highest genetic diversity among Mexican populations of S. rostratum. Genetic diversity was significantly lower in Chinese and U.S.A. populations, but we found no regional difference in inbreeding coefficients (F IS or population differentiation (F ST. Population structure analyses indicate that Chinese and U.S.A. populations are more closely related to each other than to sampled Mexican populations, revealing that introduced populations in China share an origin with the sampled U.S.A. populations. The distinctiveness between some introduced populations indicates multiple introductions of S. rostratum into China.

  5. Genetic diversity of the African hexaploid species Solanum scabrum Mill. and S. nigrum L. (Solanaceae)

    NARCIS (Netherlands)

    Manoko, M.L.K.; Berg, van den R.G.; Feron, R.M.C.; Weerden, van der G.M.; Mariani, C.

    2008-01-01

    Two hexaploid species of Solanum sect. Solanum are present in Africa: Solanum scabrum and S. nigrum. Solanum scabrum is a widely cultivated species and is used as a leafy vegetable, as a source of medicine and as a source of ink dye. In previous studies a wide range of morphological diversity has

  6. Keanekaragaman, aktivitas kunjungan, dan keefektifan lebah penyerbuk pada tanaman tomat (Solanum lycopersicum L: Solanaceae

    Directory of Open Access Journals (Sweden)

    Andi Gita Maulidyah Indraswari

    2016-12-01

    Full Text Available Tomato (Solanum lycopersicum L. is a hermaphrodite plant and capable of auto pollination. However it still need pollinators to maximize pollination success. This research was aimed to determine the diversity, foraging activity of pollinator bees and its effectiveness on seeds and fruits formation of tomato. Scan sampling method was used to determine the diversity of pollinators and focal sampling method was used to observe visiting behavior of the bees. We conducted two experiments i.e., screen caged plants and open plants to compare the effect of the bee pollinators on fruits and seeds set formation. Results showed that eleven species of bees were found, i.e., Megachile conjuncta Smith, Megachile fulfifrons Smith, Megachile unbripennis Smith, Xylocopa confusa Latreille, Xylocopa latipes Drury, Xylocopa caerulea Fabricius, Ceratina cognata Latreille, Nomia quadridentata Bingham, Amegilla cyrtandrae Lieftinck, Amegilla burneensis Friese, and Apis cerana Fabricius. Three species of bees were dominant, i.e., X. confusa, A. cyrtandrae, and C. cognata. Bee, X. confusa visited more flowers per minute, followed by A. cyrtandrae and C. cognata. The longest species visiting in plants were C. cognata, followed by X. confusa and A. cyrtandrae. Bee pollinators increase 8.92% of fruiting, 43% of fruit size, 189% of number of seeds per fruit, and 355% of weight of seeds of tomato plants.

  7. Biosynthesis of steroidal alkaloids in Solanaceae plants: involvement of an aldehyde intermediate during C-26 amination.

    Science.gov (United States)

    Ohyama, Kiyoshi; Okawa, Akiko; Moriuchi, Yuka; Fujimoto, Yoshinori

    2013-05-01

    The C-26 amino group of steroidal alkaloids, such as tomatine, is introduced during an early step of their biosynthesis from cholesterol. In the present study, the mechanism of C-26 amination was reinvestigated by administering stable isotope labeled compounds, such as (26,26,26,27,27,27-(2)H6)cholesterol during biosynthesis of tomatine, solanine and solasonine. The chemical compositions of tomatine and solanine so obtained were analyzed by LC-MS after administering the d6-cholesterol to a tomato seedling and a potato shoot, respectively. The resulting spectra indicated that two deuterium atoms were eliminated from C-26 of cholesterol during biosynthesis. Furthermore, administration of (6-(13)C(2)H3)mevalonate in combination with lovastatin to an eggplant seedling, followed by GC-MS analysis of solasodine after TMS derivatization established that two deuterium atoms were eliminated from C-26 of cholesterol during solasonine biosynthesis. These findings are in contrast to an earlier observation that one hydrogen atom was lost from C-26 during tomatidine biosynthesis, and suggest that C-26 nitrogen atom addition involves an aldehyde intermediate. Thus, it is proposed that the C-26 amination reaction that occurs during steroidal alkaloid biosynthesis proceeds by way of a transamination mechanism. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Two new records of Fabiana stephanii Hunz. & Barboza (Solanaceae from Arequipa and Ayacucho (Peru

    Directory of Open Access Journals (Sweden)

    Eliana Linares Perea

    2016-08-01

    Full Text Available In this work, two new records of Fabiana stephanii Hunz. & Barboza for the flora of Southern Peru are reported, including taxonomical, biogeographical and phytosociological data on this species.

  9. Polymethoxyflavones from Nicotiana plumbaginifolia (Solanaceae Exert Antinociceptive and Neuropharmacological Effects in Mice

    Directory of Open Access Journals (Sweden)

    Md. Shafiullah Shajib

    2018-02-01

    Full Text Available Polymethoxylavones (PMFs are known to exhibit significant anti-inflammatory and neuroprotective properties. Nicotiana plumbaginifolia, an annual Bangladeshi herb, is rich in polymethoxyflavones that possess significant analgesic and anxiolytic activities. The present study aimed to determine the antinociceptive and neuropharmacological activities of polyoxygenated flavonoids namely- 3,3′,5,6,7,8-hexamethoxy-4′,5′-methylenedioxyflavone (1, 3,3′,4′,5′,5,6,7,8-octamethoxyflavone (exoticin (2, 6,7,4′,5′-dimethylenedioxy-3,5,3′-trimethoxyflavone (3, and 3,3′,4′,5,5′,8-hexamethoxy-6,7-methylenedioxyflavone (4, isolated and identified from N. plumbaginifolia. Antinociceptive activity was assessed using the acetic-acid induced writhing, hot plate, tail immersion, formalin and carrageenan-induced paw edema tests, whereas neuropharmacological effects were evaluated in the hole cross, open field and elevated plus maze test. Oral treatment of compounds 1, 3, and 4 (12.5–25 mg/kg b.w. exhibited dose-dependent and significant (p < 0.01 antinociceptive activity in the acetic-acid, formalin, carrageenan, and thermal (hot plate-induced pain models. The association of ATP-sensitive K+ channel and opioid systems in their antinociceptive effect was obvious from the antagonist effect of glibenclamide and naloxone, respectively. These findings suggested central and peripheral antinociceptive activities of the compounds. Compound 1, 3, and 4 (12.5 mg/kg b.w. demonstrated significant (p < 0.05 anxiolytic-like activity in the elevated plus-maze test, while the involvement of GABAA receptor in the action of compound 3 and 4 was evident from the reversal effects of flumazenil. In addition, compounds 1 and 4 (12.5–25 mg/kg b.w exhibited anxiolytic activity without altering the locomotor responses. The present study suggested that the polymethoxyflavones (1–4 from N. Plumbaginifolia could be considered as suitable candidates for the development of analgesic and anxiolytic agents.

  10. Polymethoxyflavones from Nicotiana plumbaginifolia (Solanaceae) Exert Antinociceptive and Neuropharmacological Effects in Mice.

    Science.gov (United States)

    Shajib, Md Shafiullah; Rashid, Ridwan B; Ming, Long C; Islam, Shanta; Sarker, Md Moklesur R; Nahar, Lutfun; Sarker, Satyajit D; Datta, Bidyut K; Rashid, Mohammad A

    2018-01-01

    Polymethoxylavones (PMFs) are known to exhibit significant anti-inflammatory and neuroprotective properties. Nicotiana plumbaginifolia , an annual Bangladeshi herb, is rich in polymethoxyflavones that possess significant analgesic and anxiolytic activities. The present study aimed to determine the antinociceptive and neuropharmacological activities of polyoxygenated flavonoids namely- 3,3',5,6,7,8-hexamethoxy-4',5'-methylenedioxyflavone ( 1 ), 3,3',4',5',5,6,7,8-octamethoxyflavone (exoticin) ( 2 ), 6,7,4',5'-dimethylenedioxy-3,5,3'-trimethoxyflavone ( 3 ), and 3,3',4',5,5',8-hexamethoxy-6,7-methylenedioxyflavone ( 4 ), isolated and identified from N. plumbaginifolia . Antinociceptive activity was assessed using the acetic-acid induced writhing, hot plate, tail immersion, formalin and carrageenan-induced paw edema tests, whereas neuropharmacological effects were evaluated in the hole cross, open field and elevated plus maze test. Oral treatment of compounds 1 , 3 , and 4 (12.5-25 mg/kg b.w.) exhibited dose-dependent and significant ( p Plumbaginifolia could be considered as suitable candidates for the development of analgesic and anxiolytic agents.

  11. Effect of different substrates for organic agriculture in seedling development of traditional species of Solanaceae

    Energy Technology Data Exchange (ETDEWEB)

    Olaria, M.; Nebot, J.F.; Molina, H.; Troncho, P.; Lapeña, P.; Llorens, E.

    2016-11-01

    Sowing of seedlings is one of the most critical processes on the establishment of a crop, since the future development of the plant depends largely on its health when is planted on the field. Moreover, organic agriculture has to deal with the low application of fertilizers and pesticides, which hinder the growth of seedlings. In this work, we studied the big influence of different mixtures of substrates suitable for organic agriculture based on peat, coconut husk and vermicompost in traditional varieties of tomato, pepper and eggplant. Our results indicate that the use of coconut husk based substrates in organic agriculture can reduce the growth of seedlings between 20 and 30% compared with peat-based substrates. Moreover, the plants growth in this substrate showed lower levels of chlorophyll and lower weight, but the results are strongly dependent on the species tested. Comparison between traditional plants demonstrates that traditional varieties are strongly influenced by the substrate, whereas the growth of a commercial variety of tomato barely differs when different substrates are used. The election of the substrate in organic agriculture is critical to the correct development of the plant, especially when traditional plant varieties are used. (Author)

  12. Effect of different substrates for organic agriculture in seedling development of traditional species of Solanaceae

    Directory of Open Access Journals (Sweden)

    Hector Molina

    2016-03-01

    Full Text Available Sowing of seedlings is one of the most critical processes on the establishment of a crop, since the future development of the plant depends largely on its health when is planted on the field. Moreover, organic agriculture has to deal with the low application of fertilizers and pesticides, which hinder the growth of seedlings. In this work, we studied the big influence of different mixtures of substrates suitable for organic agriculture based on peat, coconut husk and vermicompost in traditional varieties of tomato, pepper and eggplant. Our results indicate that the use of coconut husk based substrates in organic agriculture can reduce the growth of seedlings between 20 and 30% compared with peat-based substrates. Moreover, the plants growth in this substrate showed lower levels of chlorophyll and lower weight, but the results are strongly dependent on the species tested. Comparison between traditional plants demonstrates that traditional varieties are strongly influenced by the substrate, whereas the growth of a commercial variety of tomato barely differs when different substrates are used. The election of the substrate in organic agriculture is critical to the correct development of the plant, especially when traditional plant varieties are used.

  13. Natural Medium for Growing of Endophytic Bacteria from Solanaceae in Malang-Indonesia

    OpenAIRE

    Purnawati Arika; Harijani Wiwik Sri; Windriyanti Wiwin

    2016-01-01

    Endophytic bacteria are important microorganisms having potential as biocontrol agents for many pathogens. Until now, the growth of it always uses semi-synthetic or synthetic medium so it was difficult to be used by farmers in the field and it was expensive to have its propagation as biocontrol agents. Based on the problem, this research will study the natural medium as propagation medium of Endophytic bacteria. It had natural ingredients such as soybean, chicken broth, egg, worms, snail, sor...

  14. The evolution of chili peppers (Capsicum-Solanaceae): a cytogenetic perspective

    Science.gov (United States)

    Capsicum (chili peppers) is a New World genus with five crop species of great economic importance for food and spices. An up-to-date summary of the karyotypic knowledge is presented, including data on classical staining (chromosome number, size and morphology), silver impregnation (number and positi...

  15. Alkaloids in Solanum torvum Sw (Solanaceae): (With 2 Tables & 1 Figure)

    OpenAIRE

    Pérez-Amador, MC; Muñoz Ocotero, V; García Castañeda, JM; González Esquinca, AR

    2007-01-01

    A comparison was made between plants of Solanum torvum Sw that grow in Chiapas, Mexico, and plants of the same species originating from India. This was effected to establish either similarities or differences between these plants in total alkaloid contents and presence of solasodine, an important alkaloid for the partial synthesis of steroids. The total alkaloid content (0.12%) of the plants coming from Chiapas and India was the same. However, solasodine was found only in the plants of Chiapa...

  16. Fruit Morphology as Taxonomic Features in Five Varieties of Capsicum annuum L. Solanaceae

    Directory of Open Access Journals (Sweden)

    Daniel Andrawus Zhigila

    2014-01-01

    Full Text Available Variations in the fruit morphological features of Capsicum annuum varieties were studied. Varieties studied include var. abbreviatum, var. annuum, var. accuminatum, var. grossum, and var. glabriusculum. The fruit morphology revealed attenuated fruit shape with rounded surfaces in var. glabriusculum, and cordate fruit shape with flexuous surface in var. annuum, abbreviatum and accuminatum. The fruit is a berry and may be green, yellow, or red when ripe. The fruit epidermal cell-wall patterns are polygonal in shape with straight and curved anticlinal walls in all the five varieties. The fruit of var. abbreviatum and var. grossum is trilocular, while that of var. accuminatum and annuum is bilocular, and that of var. glabriusculum is tetralocular. Capsicum annuum var. glabriusculum had the highest mean number of seeds (108.4 and var. annuum had the lowest number of seeds (41.3 per fruit. The fruit is conspicuously hollowed in var. glabriusculum, accuminatum, and annuum but inconspicuously hollowed in var. abbreviatum and var. grossum. These features are shown to be good taxonomic characters for delimiting the five varieties of Capsicum annuum.

  17. Insight into the evolution of the Solanaceae from the parental genomes of Petunia hybrida

    NARCIS (Netherlands)

    Bombarely, Aureliano; Moser, Michel; Amrad, Avichai; Bao, Manzhu; Bapaume, Laure; Barry, Cornelius S.; Bliek, Mattijs; Boersma, Maaike R.; Borghi, Lorenzo; Bruggmann, Rémy; Bucher, Marcel; Agostino, D' Nunzio; Davies, Kevin; Druege, Uwe; Dudareva, Natalia; Egea-Cortines, Marcos; Delledonne, Massimo; Fernandez-Pozo, Noe; Franken, Philipp; Grandont, Laurie; Heslop-Harrison, J.S.; Hintzsche, Jennifer; Johns, Mitrick; Koes, Ronald; Lv, Xiaodan; Lyons, Eric; Malla, Diwa; Martinoia, Enrico; Mattson, Neil S.; Morel, Patrice; Mueller, Lukas A.; Muhlemann, Joëlle; Nouri, Eva; Passeri, Valentina; Pezzotti, Mario; Qi, Qinzhou; Reinhardt, Didier; Rich, Melanie; Richert-Pöggeler, Katja R.; Robbins, Tim P.; Schatz, Michael C.; Schranz, Eric; Schuurink, Robert C.; Schwarzacher, Trude; Spelt, Kees; Tang, Haibao; Urbanus, Susan L.; Vandenbussche, Michiel; Vijverberg, Kitty; Villarino, Gonzalo H.; Warner, Ryan M.; Weiss, Julia; Yue, Zhen; Zethof, Jan; Quattrocchio, Francesca; Sims, Thomas L.; Kuhlemeier, Cris

    2016-01-01

    Petunia hybrida is a popular bedding plant that has a long history as a genetic model system. We report the whole-genome sequencing and assembly of inbred derivatives of its two wild parents, P. axillaris N and P. inflata S6. The assemblies include 91.3% and 90.2% coverage of their diploid

  18. Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP

    OpenAIRE

    ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.

    2005-01-01

    • Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.

  19. A revision of the Solanum elaeagnifolium clade (Elaeagnifolium clade; subgenus Leptostemonum, Solanaceae

    Directory of Open Access Journals (Sweden)

    Sandra Knapp

    2017-08-01

    Full Text Available The Solanum elaeagnifolium clade (Elaeagnifolium clade contains five species of small, often rhizomatous, shrubs from deserts and dry forests in North and South America. Members of the clade were previously classified in sections Leprophora, Nycterium and Lathyrocarpum, and were not thought to be closely related. The group is sister to the species-rich monophyletic Old World clade of spiny solanums. The species of the group have an amphitropical distribution, with three species in Mexico and the southwestern United States and three species in Argentina. Solanum elaeagnifolium occurs in both North and South America, and is a noxious invasive weed in dry areas worldwide. Members of the group are highly variable morphologically, and this variability has led to much synonymy, particularly in the widespread S. elaeagnifolium. We here review the taxonomic history, morphology, relationships and ecology of these species and provide keys for their identification, descriptions, full synonymy (including designations of lectotypes and nomenclatural notes. Illustrations, distribution maps and preliminary conservation assessments are provided for all species.

  20. The effect of polyploidy and hybridization on the evolution of floral colour in Nicotiana (Solanaceae)

    Czech Academy of Sciences Publication Activity Database

    McCarthy, E.W.; Arnold, S.E.J.; Chittka, L.; Le Comber, S. C.; Verity, R.; Dodsworth, S.; Knapp, S.; Kelly, L.J.; Chase, M. W.; Baldwin, I.T.; Kovařík, Aleš

    2015-01-01

    Roč. 115, č. 7 (2015), s. 1117-1131 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA13-10057S Institutional support: RVO:68081707 Keywords : GENE-EXPRESSION * HUMMINGBIRD POLLINATION * SPECTRAL SENSITIVITY Subject RIV: BO - Biophysics Impact factor: 3.982, year: 2015

  1. Anatomic Aspects of Formation and Growth of the Cape Gooseberry Fruit Physalis peruviana (Solanaceae

    Directory of Open Access Journals (Sweden)

    Manuel Fernando Mazorra

    2006-01-01

    confirmed that anatomically the Cape gooseberry fruits, ecotipo Colombia, and ruderal type are similar, which demonstrates the absence of appreciable anatomical changes that explain the greater size of the fruits of ecotipo Colombia.

  2. Estudio de la diversidad citogenética de Physalis peruviana L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Nohra Cecilia Rodríguez Castillo

    2006-07-01

    Full Text Available municipios de Villa de Leyva (Boyacá, Colombia, La Calera y Choachí (Cundinamarca, Colombia y dos cultivados, uno de ellos nativo, el ecotipo Colombia distribuido en el municipio de Subachoque (Cundinamarca y uno foráneo, procedente de Kenia, cultivado en el municipio de Paipa (Cundinamarca. Ápices radicales obtenidos a partir de semillas y de hojas en medios de cultivo in vitro enriquecidos con auxinas se emplearon para estandarizar el protocolo de obtención de cromosomas, con las diferentes técnicas de pretratamiento, fijación, hidrólisis y montaje de las muestras. Adicionalmente se evaluó la duración del ciclo celular para establecer la hora mitótica. Se encontró variabilidad genética entre los ecotipos evaluados. Los ecotipos silvestres presentaron una dotación cromosómica 2n=24, el ecotipo Colombia 2n=32 y el ecotipo Kenia 2n=48. Los ecotipos exhibieron también variación en las características morfológicas y anatómicas, que de acuerdo a la literatura, son un reflejo del nivel de ploidía, como altura, área foliar, número de estomas/mm', número de cloroplastos en las células guarda de los estomas, diámetro de frutos, semillas y contenido de masa seca.

  3. Listado anotado de Solanum L. (Solanaceae) en el Perú

    DEFF Research Database (Denmark)

    Särkinen, Tiina; Baden, Maria; Gonzáles, Paúl

    2015-01-01

    ), and Canta and Huarochirí (Lima). Secondary centres of endemism with high concentrations of both endemics and near-endemics are found in San Ignacio and Cutervo (Cajamarca), Santiago de Chuco (La Libertad), Oxapampa (Pasco), and Cusco (Cusco). Current diversity patterns are highly correlated with collection...

  4. Induced mutagenesis as a breeding strategy for improvement of Solanaceous vegetables

    International Nuclear Information System (INIS)

    Masuda, Masaharu; Ojiewo, Christopher O.

    2008-01-01

    The Solanaceae are a cosmopolitan family containing many essential vegetables and fruits such as potato (Solanum tuberosum L.), tomato (Lycopersicon esculentum L.), eggplant (Solanum melongena L.), paprika, chillies, green and red peppers (Capsicum annuum L.), jasmine nightshade (Solanum jasminoides Paxt.), winter cherry (Solanum pseudocapsicum L.), and Cape gooseberry, ornamentals such as Petunia, Schizanthus, and Lycium species, and medicinal plants such as bittersweet (Solanum dulcamara L.) and Solanum viarum Dun., both used as sources of corticosteroids. It also contains tobacco (Nicotiana spp.) - one of the most harmful yet economically important plants in the world - together with many other plants of both poisonous and medicinal value such as belladonna (Atropa belladona L.), stramonium (Datura stramonium L.), black henbane (Hyoscyamus niger L.), and African nightshade (Solanum villosum). Composed of approximately 90 genera and between 2000 and 3000 species, the family is widely distributed throughout the tropical and temperate regions of the world, with centers of diversity occurring in Central and South America, Australia, and Africa (EDMONDS 1978; SYMON 1981; D'ARCY 1991). Work to develop new varieties of improved solanaceous crops started more than 2 centuries ago. This paper reviews some of the recent developments in various aspects of varietal improvement of solanaceous vegetables through mutation breeding. Mutational work reported here includes the alteration of plant reproductive or vegetative growth and the development of locally adapted cultivars and popular breeding lines, or the induction of novel alleles. The potential for direct application of the mutants as new improved cultivars, their use in cross-breeding schemes, and their application in, for example, marker technology in genetic research are discussed. Specific examples of novel mutants developed in our laboratory that have the potential for application in improving solanaceous fruits

  5. Evaluación in vivo de la actividad antimalárica de 25 plantas provenientes de una Reserva de Conservación Biológica de Costa Rica In vivo evaluation of the antimalarial activity of 25 plants from a Biological Conservation Reserve of Costa Rica

    Directory of Open Access Journals (Sweden)

    MISAEL CHINCHILLA-CARMONA

    2011-03-01

    Full Text Available Se realizó una evaluación in vivo de la actividad antimalárica de las hojas, flores, frutos, corteza y raíz de 25 plantas de la Reserva Biológica Alberto Manuel Brenes (REBAMB, situada en San Ramón, Alajuela, Costa Rica. Las plantas estudiadas fueron Aphelandra aurantiaca (Scheidw. Lindl., Aphelandra tridentata Hemsl. (Acanthaceae, Xanthosoma undipes (K. Koch & C.D. Bouché K. Koch. (Araceae, Iriartea deltoidea Ruiz & Pav. (Arecaceae, Neurolaena lobata (L. Cass. (Asteraceae, Lonchocarpus pentaphyllus (Poir. Kunth ex DC., Pterocarpus hayesii Hemsl., Senna papillosa (Britton & Rose H.S. Irwin & Barneby., Cinnamomum chavarrianum (Hammel Kosterm. (Fabaceae, Nectandra membranacea (Sw. Griseb., Persea povedae W.C. Burger. (Lauraceae, Hampea appendiculata (Donn. Sm. Standl. (Malvaceae, Guarea glabra Vahl., Ruagea glabra Triana & Planch. (Meliaceae, Psidium guajava L. (Myrtaceae, Bocconia frutescens L. (Papaveraceae, Piper friedrichsthalii C. DC. (Piperaceae, Clematis dioica L. (Ranunculaceae, Prunus annularis Koehne. (Rosaceae, Siparuna thecaphora (Poepp. & Endl. A. DC. (Siparunaceae, Solanum arboreum Dunal., Witheringia solanacea L'Hér. (Solanaceae, Ticodendron incognitum Gómez-Laur. & L.D. Gómez. (Ticodendraceae, Heliocarpus appendiculatus Turcz. (Tiliaceae y Myriocarpa longipes Liebm. (Urticaceae. Los extractos alcohólicos frescos y secos, fueron evaluados por su actividad inhibitoria de la parasitemia causada por Plasmodium berghei en ratones Swiss. Al realizar las prueba de CI50 las plantas en que esa actividad fue muy relevante fueron (en mg kg-1 de peso: 12 para la corteza de B. frutescens, 18 para la raíz de H. appendiculata, 14 para la raíz de I. deltoidea, 4 para el fruto inmaduro de M. longipes, 21 para la raíz de N. membranacea, 19 para las hojas tiernas de P. povedae y 16 para el fruto inmaduro de S. tecaphora. Los extractos frescos presentaron una mayor actividad antimalárica que los sometidos a desecación. Este estudio es

  6. Effect of Withania Somnifera Root Powder on the Levels of Circulatory Lipid Peroxidation and Liver Marker Enzymes in Chronic Hyperammonemia

    Directory of Open Access Journals (Sweden)

    B. Harikrishnan

    2008-01-01

    Full Text Available Withania somnifera (L Dunal (Solanaceae, commonly called Ashwagandha (Sanskrit is an Ayurvedic Indian medicinal plant, which has been widely used as a home remedy for several ailments. We have investigated the influence of W.somnifera root powder on the levels of circulatory ammonia, urea, lipid peroxidation products such as TBARS (thiobarbituric acid and reactive substances, HP (hydroperoxides and liver marker enzymes such as AST (aspartate transaminase, ALT (alanine transaminase and ALP (alkaline phosphatase, for its hepatoprotective effect in ammonium chloride induced hyperammonemia. Ammonium chloride treated rats showed a significant increase in the levels of circulatory ammonia, urea, AST, ALT, ALP, TBARS and HP. These changes were significantly decreased in rats treated with W.somnifera root powder and ammonium chloride. Our results indicate that W.somnifera offers hepatoprotection by influencing the levels of lipid peroxidation products and liver markers in experimental hyperammonemia and this could be due to (i the presence of alkaloids, withanolids and flavonoids, (ii normalizing the levels of urea and urea related compounds, (iii its free radical scavenging property and (iv its antioxidant property. The exact underlying mechanism is still unclear and further research needed.

  7. Analgesic effects of an ethanol extract of the fruits of Xylopia aethiopica (Dunal A. Rich (Annonaceae and the major constituent, xylopic acid in murine models

    Directory of Open Access Journals (Sweden)

    Eric Woode

    2012-01-01

    Full Text Available Background: Fruit extracts of Xylopia aethiopica are used traditionally in the management of pain disorders including rheumatism, headache, colic pain, and neuralgia. Little pharmacological data exists in scientific literature of the effect of the fruit extract and its major diterpene, xylopic acid, on pain. The present study evaluated the analgesic properties of the ethanol extract of X. aethiopica (XAE and xylopic acid (XA, in murine models. Materials and Methods: XAE and XA were assessed in chemical (acetic acid-induced abdominal writhing and formalin tests, thermal (Tail-flick and Hargreaves thermal hyperalgesia tests, and mechanical (Randall-Selitto paw pressure test pain models. Results: XAE and XA exhibited significant analgesic activity in all the pain models used. XAE (30-300 mg kg -1 , p.o. and XA (10-100 mg kg -1 , p.o. inhibited acetic acid-induced visceral nociception, formalin- induced paw pain (both neurogenic and inflammatory, thermal pain as well as carrageenan-induced mechanical and thermal hyperalgesia in animals. Morphine (1-10 mg kg -1 , i.p. and diclofenac (1-10 mg kg -1 , i.p., used as controls, exhibited similar anti-nociceptive activities. XAE and XA did not induce tolerance to their respective anti-nociceptive effects in the formalin test after chronic administration. Morphine tolerance did not also cross-generalize to the analgesic effects of XAE or XA. Conclusions: These findings establish the analgesic properties of the ethanol fruit extract of X. aethiopica and its major diterpene, xylopic acid.

  8. CARACTERIZACIÓN DE LA MORFOLOGÍA FLORAL DE DOS CULTIVARES DE BERENJENA (Solanum melongena L. (Solanaceae FLORAL MORPHOLOGY CHARACTERIZATION OF TWO CULTIVARS OF EGGPLANT (Solanum melongena L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Hermes Araméndiz Tatis

    2009-12-01

    Full Text Available La berenjena es una especie perteneciente al género Solanum, de gran importancia en la horticultura del Caribe colombiano. El estudio tuvo como objetivo describir la morfología floral de dos cultivares de berenjena “Long Purple” y “Criolla Lila”, que tienen origen geográfico diferente, utilizando para ello, una muestra aleatoria de 100 cojines florales por cultivar. Se estimaron la media, rango, varianza, desviación estándar, coeficiente de variación y se aplicó la prueba t, para determinar diferencias entre los dos cultivares. Los resultados indicaron que el cultivar “Long Purple”, presenta flores distílicas, en tanto que en el “Criollo Lila” se observó la presencia de tristilia. El potencial de producción de frutos, fue del 76,5% y 57,52%, para el “Criollo Lila” y “Long Purple”, respectivamente. Las flores brevistílicas en ambos cultivares, incrementan la aptitud masculina y por ende un desbalance entre las flores con funcionamiento masculino y hermafrodita.The eggplant is a specie of genus Solanum, of great importance in horticulture of colombian Caribbean region. The objective of study was to describe the floral morphology of two cultivars of eggplant “Long Purple” and “Lilac land race”, which have different geographic origin. We used a random sample of 100 floral cushions for cultivar. The mean, range, variance, standard deviation, variation coefficient were estimated. The t-test was applied to determine differences between two cultivars. The results indicated that genotype ‘Long Purple’, showed distylics flowers, while in the “Lilac land race” was observed the presence of tristylics flowers. The potential for production of fruit was 76.50% and 57.52% for the “Lilac land race” and “Long Purple”, respectively. Brevistylics flowers in the two cultivars, increased male fitness and thus produced a nonbalance on functioning between male and hermaphrodite flowers.

  9. Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae in the Linhares Forest, Espírito Santo state, Brazil Dispersão de sementes de Solanum thomasiifolium Sendtner (Solanaceae na Floresta de Linhares, Espírito Santo, Brasil

    Directory of Open Access Journals (Sweden)

    João Vasconcellos-Neto

    2009-12-01

    Full Text Available The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of "nativo" vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous, and one species of lizard (Tropidurus torquatus fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds, 19% (crab-eating fox and 4% (lizards. Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control, bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.O propósito deste estudo foi analisar a dispersão de sementes e o estabelecimento de Solanum thomasiifolium em uma área de vegetação de "nativo" no Estado do Espírito Santo, na costa do sudeste do Brasil. Dez espécies de aves, o cachorro-do-mato (Cerdocyon thous e uma espécie de lagarto (Tropidurus torquatus alimentaram-se de frutos de S. thomasiifolium e dispersaram sementes viáveis em suas fezes. A contribuição proporcional de cada um destes grupos na dispersão de sementes foi de 77% para aves, 19% para o cachorro-do-mato e 4% para o lagarto. Formigas também contribuíram com a dispersão de sementes. Mais sementes foram depositadas nas ilhas de vegetação do que nas áreas abertas vizinhas. As taxas de germinação de sementes oriundas de frutos (controle, fezes de aves, fezes do cachorro do mato e do lagarto foram, respectivamente, 64 %, 64 %, 53% e 80%. As diferenças entre estas taxas foram todas significativas, exceto entre o controle e fezes de aves. Lagartos foram importantes como transportadores de sementes entre ilhas de vegetação próximas e defecaram uma grande proporção de sementes viáveis. As aves e o cachorro-do-mato não aumentaram a germinação de sementes, mas promoveram a dispersão sobre uma área maior. A arquitetura da planta, a produtividade de frutos, as características do fruto e a diversidade de frugívoros são importante no sucesso de S. thomasiifolium para colonização do habitat.

  10. Atividade moluscicida de princípios ativos de folhas de Lycopersicon esculentum (Solanales, Solanaceae em Biomphalaria glabrata (Gastropoda, Planorbidae Moluscicide activity of active principles in the leaves of Lycopersicon esculentum (Solanales, Solanaceae on Biomphalaria glabrata (Gastropoda, Planorbidae

    Directory of Open Access Journals (Sweden)

    Vilma Leyton

    Full Text Available Foram obtidos extratos aquosos e alcoólicos a partir de pó de folhas secas de tomateiro (Lycopersicon esculentum, Mill. c.v. Cereja. Por extração metanólica e precipitação alcalina, foi obtido um produto que denominamos "glicoalcalóide esteroidal bruto" (GEb, no qual foi caracterizada a presença de tomatina. Em ensaios laboratoriais, os extratos aquosos, alcoólicos e o GEb apresentaram atividade moluscicida em Biomphalaria glabrata (Say, 1818. O "glicoalcalóide esteroidal bruto" apresentou alta atividade moluscicida (CL50 = 8,01 ppm e CL90 = 13,17 ppm, comparável à atividade da tomatina. Desovas de B. glabrata mostraram-se resistentes aos extratos testados. Os níveis de atividade moluscicida apresentados pelos diversos extratos e o GEb, apontam apenas o GEb como candidato para a continuação dos estudos visando a sua possível utilização em campo.Aqueous and alcoholic extracts were obtained from crushed dried leaves of tomato plant (Lycopersicon esculentum, Mill. c.v. Cherry. By the use of a methanolic extraction and alkaline precipitation, a product named crude steroidal glycoalkaloid (GEb, was obtained. The presence of tomatidine was characterized in this product. In laboratory, the aqueous and alcoholic extracts and GEb have shown molluscicidal activity against Biomphalaria glabrata (Say, 1818. The crude steroidal glycoalkaloid presented a high molluscicidal activity (LC50 = 8.01 ppm and LC90 = 13.17 ppm, similar to that of tomatine. None of the compounds tested affected B. glabrata egg masses. The level of activity showed by the different extracts and by the GEb, pointed out the GEb as the only candidate able to be considered for further tests toward field trials as molluscicidal agent.

  11. Phytogeographic analysis of the genus Datura (Solanaceae in continental Mexico Análisis fitogeográfico del género Datura (Solanaceae en México continental

    Directory of Open Access Journals (Sweden)

    Mario Luna-Cavazos

    2011-09-01

    Full Text Available The geographic distribution of the species of Datura in Mexico was analyzed using numerical analysis of natural populations documented by herbarium specimens. A map of Mexico was divided into 239, 1° x 1° squares (latitude and longitude which were used as sampling geographical units and in which the presence or absence of each species of Datura was recorded. Multivariate procedures were applied: a, TWINSPAN classification to define Datura´s main distribution areas; b, Detrended Correspondence Analysis (DCA to define Datura´s main distribution gradients, and c, Canonical Correspondence Analysis (CCA to relate distribution patterns with geographical and climatic factors. Species of Datura were found in 69% (165 of the squares. TWINSPAN defined 14 groups which, when associated with Mexico’s biogeographic provinces, were concentrated in the northwestern Mexican provinces as well as in the Altiplano Norte and Altiplano Sur and the Sierra Madre Occidental. DCA indicated that Datura’s main distribution patterns are explained by 3 principal gradients: altitude, humidity, and latitude. The CCA identified longitude, precipitation of the driest quarter, altitude, and average temperature of the warmest quarter as the most important variables affecting Datura´s distribution patterns. The Depresión del Balsas region of central Mexico is the area with greatest species richness of Datura.Se analizó la distribución geográfica de las especies de Datura en México mediante análisis numérico de poblaciones naturales documentadas con ejemplares de herbario. Un mapa de México fue dividido en 239 cuadros de 1° x 1° (latitud y longitud, los cuales se usaron como unidades geográficas de muestreo, y en ellos se registró la presencia o ausencia de cada especie de Datura. Se aplicaron procedimientos estadísticos multivariados: a, clasificación por TWINSPAN para definir las principales áreas de distribución de Datura; b, análisis de correspondencia rectificado (ACR para definir los principales gradientes en la distribución de Datura y c, análisis de correspondencia canónica (ACC para relacionar los patrones de distribución con factores geográficos y climáticos. Las especies de Datura se localizaron en el 69 % (165 de los cuadros. TWINSPAN definió 14 grupos, los cuales, cuando se relacionaron con las provincias biogeográficas mexicanas, estuvieron concentrados en provincias del noroeste de México así como en el Altiplano Norte, Altiplano Sur y la sierra Madre Occidental. El ACR indicó que los patrones de distribución de Datura son explicados por 3 gradientes principales: altitud, humedad y latitud. El ACC definió a la longitud, precipitación del trimestre más seco, altitud y temperatura media del trimestre más cálido como las variables más importantes relacionadas con los patrones de distribución de Datura. La región de la depresión del Balsas es el área con la mayor riqueza de especies de Datura.

  12. Efeitos de extratos de Nierembergia veitchii (Hook Solanaceae sobre a fertilidade de ratas e morfologia óssea dos fetos The effects of Nierembergia veitchii (Hook Solanaceae extracts in rat fertility and fetal skeleton morphology

    Directory of Open Access Journals (Sweden)

    João Roberto Braga de Mello

    2000-06-01

    Full Text Available Os efeitos da administração oral dos extratos aquoso (NvH2O, metanólico (NvmeOH, butanólico (Nvbut e hexano (Nvhex, obtidos, seqüencialmente, de 500g de Nierembergia veitchii (planta seca, foram comparados aos obtidos com vitamina D3 (2,5mg.kg-1 e aos de um grupo controle (solução fisiológica - SF, quando administrados, durante todo o período de gestação (21 dias, a ratas albinas Wistar. A redução do ganho de peso foi evidente nas fêmeas tratadas com Nvhex, Nvbut e vitamina D3. Nesses grupos, houve redução do número de implantes uterinos (9,3 ± 1,4; 9,6 + 1,4 e 8,4 ± 1,4, quando comparados com o controle (SF (11,2 ± 0,4. Essa redução também foi observada no número de filhotes por ninhada (8,1 ± 1,3; 9,0 ± 1,5; 5,1 ± 1,7 e 10,3 ± 0,6, e na massa corporal dos filhotes ao nascer (2,1g ± 0,5; 2,9g ± 0,4; 1,9g ± 0,1 e 3,3g ± 0,1. Os resultados obtidos com NvH2O e NvmeOH não diferiram dos obtidos com o grupo controle. Anomalias macroscópicas foram observadas em fetos de ratas tratadas com Nvhex e Nvbut, 0,1 e 0,2% respectivamente. Os resultados da análise da morfologia óssea dos fetos mostraram a ocorrência de 33,3%; 45%; 9,8% e 11,1% de anomalias para os grupos NvH2O, NvmeOH, Nvbut e SF, respectivamente. As anomalias ósseas mais freqüentemente observadas ocorreram no crânio e constaram de ossificação incompleta de supraoccipital, interparietais, parietais, frontal e temporal.The effects of oral administration of aqueous (NvH2O, methanolic (NvmeOH, buthanolic (Nvbut and hexan (Nvhex extracts, sequentialy obtained from 500g Nierembergia veitchii (dried plant were compared with a vitamin D3 treated group and with a control group (saline, when administered during the pregnancy to Wistar rats (21 days. Weigth gain was reduced in dams treated with Nvhex, Nvbut and vitamin D3. In these groups it was observed a reduction in uterine implantations (9.3 ± 1.4, 9.6 ± 1.4 and 8.4 ± 1.4 when compared with the control (11.2 ± 0.4. The reduction could also be observed in the number of pups per litter (8.1 ± 1.3, 9.0 ± 1.5, 5.1 ± 1.7 and 10.3 ± 0.6, and in the weigth of pups at birth (2.1g ± 0.5, 2.9g ± 0.4, 1.9g ± 0.1 and 3.3g ± 0.1. We didn’t observe any difference betwen NvH2O, NvmeOH and control group. Macroscopicaly abnormalities were observed in some pups of Nvhex and Nvbut groups (0.1% and 0.2% respectively. The results of the skeleton avaliation showed 33.3%, 45%, 9.8% e 11.1% of abnormalities for NvH2O, NvmeOH, Nvbut and control group respectively. The most frequently observed abnormalities were found in the skull, and were: incomplete ossification of supraocciopital, interparietal, parietal, frontal and temporal.

  13. Alteraciones morfo-histológicas en hojas de Solanum chenopodioides (Solanaceae), producidas por ácaros y dípteros minadores Morpho-histological alterations in leaves of Solanum chenopodioides (Solanaceae) produced by mites and leaf miner diptera

    OpenAIRE

    Silvana D Del V. Figueroa; Nilda Dottori; María Teresa Cosa

    2011-01-01

    Solanum chenopodioides Lam., conocida como "hierba mora", es una hierba o subarbusto ampliamente distribuido en Argentina y otras zonas de Sudamérica y es una maleza sumamente tóxica para el ganado. Sus hojas tienen propiedades medicinales y son utilizadas como sedante y en oftalmología. Es frecuente el ataque de sus hojas por ácaros fitófagos y por insectos minadores. El objetivo del presente trabajo fue analizar la morfología y la anatomía de las hojas en plantas sanas e infestadas por ácar...

  14. Alteraciones morfo-histológicas en hojas de Solanum chenopodioides (Solanaceae, producidas por ácaros y dípteros minadores Morpho-histological alterations in leaves of Solanum chenopodioides (Solanaceae produced by mites and leaf miner diptera

    Directory of Open Access Journals (Sweden)

    Silvana D Del V. Figueroa

    2011-12-01

    Full Text Available Solanum chenopodioides Lam., conocida como "hierba mora", es una hierba o subarbusto ampliamente distribuido en Argentina y otras zonas de Sudamérica y es una maleza sumamente tóxica para el ganado. Sus hojas tienen propiedades medicinales y son utilizadas como sedante y en oftalmología. Es frecuente el ataque de sus hojas por ácaros fitófagos y por insectos minadores. El objetivo del presente trabajo fue analizar la morfología y la anatomía de las hojas en plantas sanas e infestadas por ácaros (Tetranychidae, Tetranychus sp. y dípteros minadores de la hoja (Agromyzidae. Los resultados muestran que el ataque de ambos agentes reduce significativamente el volumen del tejido fotosintético por excelencia. Así, se compromete el crecimiento, y por lo tanto la supervivencia de la especie. Aún más, en caso de ser utilizada como especie medicinal se afecta la calidad del principio activo.Solanum chenopodioides Lam., known as "nightshade", is a herb or subshrub widely distributed in Argentina and another zones of South America, and is a weed highly toxic to livestock. Its leaves have medicinal properties and are used as a sedative and in ophthalmology. The attack of its leaves by phytophagous mites and leafminer insects is frequent. The aim of this study was to analyze the morphology and the anatomy of the leaves of both healthy and infested plants by Tetranychidae, Tetranychus sp. mites and Agromyzidae leafminer diptera. The results show that the attack of both agents significantly reduces the amount of photosynthetic tissue par excellence. Thus, growth is compromised, and therefore the survival of the species. Moreover, when used as medicinal species, the quality the active principle is affected.

  15. Natural and experimental poisoning by Cestrum laevigatum (Solanaceae among cattle in the Agreste region of Paraíba, Brazil

    Directory of Open Access Journals (Sweden)

    Temístocles Soares de Oliveira Neto

    2017-10-01

    Full Text Available An outbreak of natural poisoning by Cestrum laevigatum was reported among cattle in the Agreste region of Paraíba, which affected six out of 20 animals. Four animals were found dead and two presented clinical signs, including, dyspnea, drooling, jugular vein engorgement, muscle tremors and ataxia, which subsequently progressed to recumbence and death. An experimental poisoning was performed in two bovines who were administered single doses of 35 g kg-1 and 50 g kg-1 body weight (BW, respectively, of fresh leaves and fruits. The animal that received 35 g kg-1 BW had mild clinical signs, consisting of apathy, salivation and reduced ruminal movements with recovery 30 hours after the onset of initial signs. The animal that received 50 g kg-1 BW showed apathy, dry stool, drooling, hyperexcitability, head pressing, opisthotonos, nystagmus, miosis, jugular and episcleral vessel engorgement, ruminal atony, muscle tremors, ataxia, falling, seizures, and sternal recumbence, followed by lateral recumbence, with death occurring 21 hours and 37 minutes after ingestion. The enzyme activities of aspartate aminotransferase and gamma-glutamyltransferase in the serum increased significantly 18 hours after the administration of the plant. The primary gross lesions in the natural and experimental cases were enlarged livers, with rounded edges and accentuation of the lobular pattern on the capsular and cut surfaces. Histopathology revealed diffuse centrilobular coagulative necrosis with hemorrhages and congestion, and the presence of degenerated hepatocytes in the midzonal regions. Based on the epidemiological and clinicopathological data, we concluded that C. laevigatum was responsible for an acute hepatotoxic disease among cattle in the Agreste region of Paraíba.

  16. Response of Bemisia tabaci Genn. (Hemiptera: Aleyrodidae) biotype B to genotypes of pepper Capsicum annuum (Solanales: Solanaceae).

    Science.gov (United States)

    Ballina-Gomez, H; Ruiz-Sanchez, E; Chan-Cupul, W; Latournerie-Moreno, L; Hernández-Alvarado, L; Islas-Flores, I; Zuñiga-Aguilar, J J

    2013-04-01

    Bemisia tabaci Genn. biotype B is a widely distributed plant pest that represents one of the major constraints for horticultural crop production. The purpose of the present work was to evaluate the oviposition preference, survivorship, and development of B. tabaci biotype B on semi-cultivated genotypes of Capsicum annuum from southeast Mexico. In free-choice experiments to evaluate the oviposition preference, lower number of eggs laid by B. tabaci biotype B was observed in the genotypes Maax and Xcat´ik relative to that in the commercial genotype Parado. Egg hatchability was significantly lower in Pico Paloma, Bolita, Blanco, Chawa, Payaso, and Xcat´ik than in the rest of the genotypes, including the commercial genotype Jalapeño. Likewise, survivorship of nymphs was significantly lower in Pico Paloma, Bolita, and Blanco than in the remaining genotypes. Nymph developmental time and the period of development from egg to adult were the shortest in Amaxito. Therefore, sources of resistance to B. tabaci biotype B by antibiosis (accumulation of plant defense compounds) might be found in the semi-cultivated genotypes Pico Paloma, Bolita, and Blanco.

  17. SoMART, a web server for miRNA, tasiRNA and target gene analysis in Solanaceae plants

    Science.gov (United States)

    Plant micro(mi)RNAs and trans-acting small interfering (tasi)RNAs mediate posttranscriptional silencing of genes and play important roles in a variety of biological processes. Although bioinformatics prediction and small (s)RNA cloning are the key approaches used for identification of miRNAs, tasiRN...

  18. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  19. Antioxidant, Antibacterial, Cytotoxic, and Anti-Inflammatory Potential of the Leaves of Solanum lycocarpum A. St. Hil. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Guilherme Augusto Ferreira da Costa

    2015-01-01

    Full Text Available Ethanol extract and fractions obtained from leaves of Solanum lycocarpum were examined in order to determine their phenolic composition, antioxidant, antibacterial, anti-inflammatory, and cytotoxic potential. High performance liquid chromatography coupled with DAD analysis indicated that the flavonoids apigenin and kaempferol were the main phenolic compounds present in dichloromethane and ethyl acetate fractions, respectively. The antioxidant activity was significantly more pronounced for dichloromethane, ethyl acetate, and hydroethanol fractions than that of the commercial antioxidant 2,6-di-tert-butyl-4-methylphenol. The hexane and dichloromethane fractions were more active against the tested bacteria. The hydroethanol fraction exhibited significant anti-inflammatory activity at the dose of 75 and 150 mg/kg in the later phase of inflammation. However, the antiedematogenic effect of the higher dose of the ethyl acetate fraction (150 mg/kg was more pronounced. The ethyl acetate fraction also presented a less cytotoxic effect than the ethanol extract and other fractions. These activities found in S. lycocarpum leaves can be attributed, at least in part, to the presence of phenolic constituents such as flavonoids. This work provided the knowledge of phenolic composition in the extract and fractions and the antioxidant, antibacterial, anti-inflammatory, and cytotoxic activities of leaves of S. lycocarpum.

  20. From introduced American weed to Cape Verde Islands endemic: the case of Solanum rigidum Lam. (Solanaceae, Solanum subgenus Leptostemonum).

    Science.gov (United States)

    Knapp, Sandra; Vorontsova, Maria S

    2013-01-01

    A Solanum species long considered an American introduction to the Cape Verde Islands off the west coast of Africa is identified as Solanum rigidum, a member of the Eggplant clade of Old World spiny solanums (Solanum subgenus Leptostemonum) and is probably endemic to the Cape Verde Islands. Collections of this species from the Caribbean are likely to have been introduced from the Cape Verde Islands on slave ships. We discuss the complex nomenclatural history of this plant and provide a detailed description, illustration and distribution map. The preliminary conservation status of Solanum rigidum is Least Concern, but needs to be reassessed in light of its endemic rather than introduced status.

  1. Bee Diversity and Solanum didymum (Solanaceae Flower–Visitor Network in an Atlantic Forest Fragment in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Francieli Lando

    2018-01-01

    Full Text Available Brazil’s Atlantic Forest biome is currently undergoing forest loss due to repeated episodes of devastation. In this biome, bees perform the most frequent pollination system. Over the last decade, network analysis has been extensively applied to the study of plant–pollinator interactions, as it provides a consistent view of the structure of plant–pollinator interactions. The aim of this study was to use palynological studies to obtain an understanding of the relationship between floral visitor bees and the pioneer plant S. didymum in a fragment of the Atlantic Forest, and also learn about the other plants that interact to form this network. Five hundred bees were collected from 32 species distributed into five families: Andrenidae, Apidae, Colletidae, Megachilidae, and Halictidae. The interaction network consisted of 21 bee species and 35 pollen types. The Solanum-type bee species with the highest number of interactions were Anthrenoides sp. 1, Augochlora sp. 2, and Augochloropsis notophos, representing 71.78% of their interactions. Augochloropsis notophos and Augochlora sp. 2 were the only common species in the flowers of S. didymum. Given the results of our study, we conclude that Solanum is an important source of pollen grains for several native bee species, mainly for the solitary species that are more diverse in the south of Brazil. Moreover, our results indicate that bees from the families Halictidae (A. notophos, Augochlora and Andrenidae (Anthrenoides are the pollinators of S. didymum.

  2. Knocking down expression of the auxin-amidohydrolase IAR3 alters defense responses in Solanaceae family plants

    Czech Academy of Sciences Publication Activity Database

    D'Ippolito, S.; Vaňková, Radomíra; Joosten, M.H.A.J.; Casalongue, C.A.; Fiol, D.F.

    2016-01-01

    Roč. 253, DEC (2016), s. 31-39 ISSN 0168-9452 Institutional support: RVO:61389030 Keywords : Auxin * Biotic stress * Cladosporium fulvum Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.437, year: 2016

  3. Two faces of Solanaceae telomeres: a comparison between Nicotiana and Cestrum telomeres and telomere-binding proteins

    Czech Academy of Sciences Publication Activity Database

    Peška, Vratislav; Sýkorová, Eva; Fajkus, Jiří

    2008-01-01

    Roč. 122, 3-4 (2008), s. 380-387 ISSN 1424-8581 R&D Projects: GA AV ČR(CZ) IAA600040505; GA AV ČR(CZ) IAA500040801; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : POT1-like proteins * C-terminal OB domain * telomere-binding protein Subject RIV: BO - Biophysics Impact factor: 1.965, year: 2008

  4. The behaviour of Bombus impatiens (Apidae, Bombini on tomato (Lycopersicon esculentum Mill., Solanaceae flowers: pollination and reward perception

    Directory of Open Access Journals (Sweden)

    Peter Kevan

    2013-10-01

    Full Text Available The foraging behaviour of pollinators can influence their efficiency in pollinating certain plant species. Improving our understanding of this behaviour can contribute to an improvement of management techniques to avoid pollination deficits. We investigated the relationship between the number of visits of bumble bees (Bombus impatiensto tomato flowers (Lycopersicon esculentum and two variables related to the quality of the resulting fruits (weight, number of seeds, as well as the relationship between foragers’ thoracic weights, physical characteristics of thoracic vibrations (main frequency, velocity amplitude, amount of pollen removed from flowers, and the quality-related variables. In addition, we studied the capability of foragers to assess the availability of pollen in flowers. Tomato weight and seed number did not increase with the number of bee visits, neither were they correlated with the foragers’ thorax weight. Thorax weight also did not correlate with the amount of pollen removed from the flowers nor with the physical characteristics of vibration. Vibration characteristics did not change in response to the amount of pollen available on tomato flowers. Instead, foragers adjusted the time spent visiting the flowers, spending fewer time on flowers from which some pollen had already been removed on previous visits. The quantity and the production-related variables of tomatoes are not dependent on the number of bee visits (usually one visit suffices for full pollination; bigger foragers are not more efficient in pollinating tomato flowers than smaller ones; and B. impatiens foragers are capable of evaluating the amount of pollen on a flower while foraging and during pollination.

  5. Efecto de Brugmansia arborea (L. Lagerheim (Solanacea en el sistema reproductor masculino de ratón

    Directory of Open Access Journals (Sweden)

    José Pino

    2008-12-01

    Full Text Available El objetivo del presente estudio fué investigar el efecto de la administracion del extracto acuoso de Brugmansia arborea (L. Lagerheim -floripondio-sobre algunos parámetros reproductivos en mamíferos. Ratones machos fueron tratados con 70 mg/kl/pc por 7 días, después de lo cual fueron eutanizados determinando los pesos de testículo, epidídimo e individualmente su región caudal; además, se contabilizó la concentración y malformaciones espermáticas. El peso del testículo y la cola del epidídimo disminuyeron; la concentración espermática fue menor que el control, se incrementaron las malformaciones espermáticas. Estos resultados sugieren que existe un efecto negativo de la dosis de B. arborea que alteraría la fertilidad del ratón.

  6. Pollination deficit in open-field tomato crops (Solanum lycopersicum L., Solanaceae in Rio de Janeiro state, Southeast Brazil

    Directory of Open Access Journals (Sweden)

    Maria Cristina Gaglianone

    2013-10-01

    Full Text Available More than 70% of world’s crops benefit from biotic pollination, and bees are their main pollinators. Despite the fact that some of these insects have been broadly studied, understanding the interactions between plant crops and their pollinators with a local scale approach is necessary when aiming to apply proper protective and management measures to pollinators and their respective crops. In this context, we analyzed the pollination status of open-field tomato crops (Solanum lycopersicum L., regarding fruit-set, visitation rate and the quality of fruits. We recorded the formation of fruits through spontaneous self-pollination and open-pollination, and the occurrence of pollinators in 24 areas of open-field tomato crops. We performed experiments of apomixis, spontaneous self-pollination, manual cross pollination and supplemental cross pollination (simulating the pollinator behavior in a greenhouse. The fruit quality was evaluated according to circumference, weight, volume and number of seeds. Higher production of fruits after open-pollination compared to spontaneous self-pollination indicates the importance of pollinators to increment productivity of S. lycopersicum in the study area. The circumference and the number of seeds from tomatoes of the greenhouse plantation did not differ between spontaneous self-pollination and the manual cross pollination. In the open-field crops the number of seeds was higher for fruits resulting from open-pollination. Our results indicate that the importance of bees is mainly related to the increase in fruit production, thus incrementing the productivity of tomato crops.

  7. Pollination deficit in open-field tomato crops (Solanum lycopersicum L., Solanaceae in Rio de Janeiro state, Southeast Brazil

    Directory of Open Access Journals (Sweden)

    Mariana Scaramussa Deprá

    2014-02-01

    Full Text Available More than 70% of world’s crops benefit from biotic pollination, and bees are their main pollinators. Despite the fact that some of these insects have been broadly studied, understanding the interactions between plant crops and their pollinators with a local scale approach is necessary when aiming to apply proper protective and management measures to pollinators and their respective crops. In this context, we analyzed the pollination status of open-field tomato crops (Solanum lycopersicum L., regarding fruit-set, visitation rate and the quality of fruits. We recorded the formation of fruits through spontaneous self-pollination and open-pollination, and the occurrence of pollinators in 24 areas of open-field tomato crops. We performed experiments of apomixis, spontaneous self-pollination, manual cross pollination and supplemental cross pollination (simulating the pollinator behavior in a greenhouse. The fruit quality was evaluated according to circumference, weight, volume and number of seeds. Higher production of fruits after open-pollination compared to spontaneous self-pollination indicates the importance of pollinators to increment productivity of S. lycopersicum in the study area. The circumference and the number of seeds from tomatoes of the greenhouse plantation did not differ between spontaneous self-pollination and the manual cross pollination. In the open-field crops the number of seeds was higher for fruits resulting from open-pollination. Our results indicate that the importance of bees is mainly related to the increase in fruit production, thus incrementing the productivity of tomato crops.

  8. Were sea level changes during the Pleistocene in the South Atlantic Coastal Plain a driver of speciation in Petunia (Solanaceae)?

    Science.gov (United States)

    Ramos-Fregonezi, Aline M C; Fregonezi, Jeferson N; Cybis, Gabriela B; Fagundes, Nelson J R; Bonatto, Sandro L; Freitas, Loreta B

    2015-05-20

    Quaternary climatic changes led to variations in sea level and these variations played a significant role in the generation of marine terrace deposits in the South Atlantic Coastal Plain. The main consequence of the increase in sea level was local extinction or population displacement, such that coastal species would be found around the new coastline. Our main goal was to investigate the effects of sea level changes on the geographical structure and variability of genetic lineages from a Petunia species endemic to the South Atlantic Coastal Plain. We employed a phylogeographic approach based on plastid sequences obtained from individuals collected from the complete geographic distribution of Petunia integrifolia ssp. depauperata and its sister group. We used population genetics tests to evaluate the degree of genetic variation and structure among and within populations, and we used haplotype network analysis and Bayesian phylogenetic methods to estimate divergence times and population growth. We observed three major genetic lineages whose geographical distribution may be related to different transgression/regression events that occurred in this region during the Pleistocene. The divergence time between the monophyletic group P. integrifolia ssp. depauperata and its sister group (P. integrifolia ssp. integrifolia) was compatible with geological estimates of the availability of the coastal plain. Similarly, the origin of each genetic lineage is congruent with geological estimates of habitat availability. Diversification of P. integrifolia ssp. depauperata possibly occurred as a consequence of the marine transgression/regression cycles during the Pleistocene. In periods of high sea level, plants were most likely restricted to a refuge area corresponding to fossil dunes and granitic hills, from which they colonized the coast once the sea level came down. The modern pattern of lineage geographical distribution and population variation was established by a range expansion with serial founder effects conditioned on soil availability.

  9. NOVEDADES EN CALIBRACHOA (SOLANACEAE Y NOTAS TAXONÓMICAS SOBRE EL GÉNERO PARA LA ARGENTINA

    Directory of Open Access Journals (Sweden)

    Julián A. Greppi

    2013-01-01

    Full Text Available Se describe e ilustra una nueva subespecie de Calibrachoa para Argentina y Brasil: C. linoides subsp. furcata. Se excluye a C. heterophylla de la flora argentina. Se consideran a C. linearis y a Petunia thymifolia f. gracilis como nuevos sinónimos de C. thymifolia y se esclarecen interpretaciones erróneas de dos especies (C. pubescens y C. humilis, previamente citadas para Argentina. Se designan lectotipos para Fabiana thymifolia, Petunia thymifolia f. gracilis y Salpiglossis linearis (= C. thymifolia.

  10. Diversification in the South American Pampas: the genetic and morphological variation of the widespread Petunia axillaris complex (Solanaceae).

    Science.gov (United States)

    Turchetto, Caroline; Fagundes, Nelson J R; Segatto, Ana L A; Kuhlemeier, Cris; Solís Neffa, Viviana G; Speranza, Pablo R; Bonatto, Sandro L; Freitas, Loreta B

    2014-02-01

    Understanding the spatiotemporal distribution of genetic variation and the ways in which this distribution is connected to the ecological context of natural populations is fundamental for understanding the nature and mode of intraspecific and, ultimately, interspecific differentiation. The Petunia axillaris complex is endemic to the grasslands of southern South America and includes three subspecies: P. a. axillaris, P. a. parodii and P. a. subandina. These subspecies are traditionally delimited based on both geography and floral morphology, although the latter is highly variable. Here, we determined the patterns of genetic (nuclear and cpDNA), morphological and ecological (bioclimatic) variation of a large number of P. axillaris populations and found that they are mostly coincident with subspecies delimitation. The nuclear data suggest that the subspecies are likely independent evolutionary units, and their morphological differences may be associated with local adaptations to diverse climatic and/or edaphic conditions and population isolation. The demographic dynamics over time estimated by skyline plot analyses showed different patterns for each subspecies in the last 100 000 years, which is compatible with a divergence time between 35 000 and 107 000 years ago between P. a. axillaris and P. a. parodii, as estimated with the IMa program. Coalescent simulation tests using Approximate Bayesian Computation do not support previous suggestions of extensive gene flow between P. a. axillaris and P. a. parodii in their contact zone. © 2013 John Wiley & Sons Ltd.

  11. The variability of leaf anatomical characteristics of Solanum nigrum L. (Solana-les, Solanaceae from different habitats

    Directory of Open Access Journals (Sweden)

    Krstić Lana N.

    2002-01-01

    Full Text Available In Europe on the whole as well as in Yugoslavia, the most widespread weed species from the genus Solanum is Solanum nigrum L. Since this species inhabits different habitats, it developed several ways of adaptation to environmental conditions. The influence of ecological factors on plant organism and resulting plant adaptations are most evident in leaf morphology and anatomy. Therefore, the anatomical structure of leaves and leaf epidermal tissue of S. nigrum was analyzed and compared among plants that originated from different habitats, in order to determine leaf structural adaptations. S. nigrum lamina has the mesomorphic structure with some xero-heliomorphic adaptations. The differences in stomata number, number of hairs, thickness of lamina, palisade and spongy tissue, as well as the size of mesophyll cells have been noticed. The highest values for most of the parameters have been recorded for the plants from cultivated soil. Largest variations of the examined characters were found for the leaves from ruderal habitats, where environmental conditions are most variable.

  12. The variability of leaf anatomical characteristics of Solanum nigrum L. (Solana-les, Solanaceae) from different habitats

    OpenAIRE

    Krstić Lana N.; Merkulov Ljiljana S.; Boža Pal P.

    2002-01-01

    In Europe on the whole as well as in Yugoslavia, the most widespread weed species from the genus Solanum is Solanum nigrum L. Since this species inhabits different habitats, it developed several ways of adaptation to environmental conditions. The influence of ecological factors on plant organism and resulting plant adaptations are most evident in leaf morphology and anatomy. Therefore, the anatomical structure of leaves and leaf epidermal tissue of S. nigrum was analyzed and compared among pl...

  13. Preliminary studies on antihepatotoxic effect of Physalis peruviana Linn. (Solanaceae) against carbon tetrachloride induced acute liver injury in rats.

    Science.gov (United States)

    Arun, M; Asha, V V

    2007-04-20

    Physalis peruviana is a medicinal herb used by Muthuvan tribes and Tamilian native who reside in the shola forest regions of Kerala, India against jaundice. It was evaluated for its antihepatotoxic, phytochemical analysis and the acute toxicity of the most promising extract in rats. Water, ethanol and hexane extracts of Physalis peruviana (500mg/kg body weight) showed antihepatotoxic activities against CCl(4) induced hepatotoxicity. The ethanol and hexane extracts showed moderate activity compared to water extract, which showed activity at a low dose of 125mg/kg. The results were judged from the serum marker enzymes. Histopathological changes induced by CCl(4) were also significantly reduced by the extract. Further, the extract administration to rats resulted in an increase in hepatic GSH and decrease in MDA. Preliminary phytochemical analysis revealed the presence of various components in the crude aqueous extract. The extract was found to be devoid of any conspicuous acute toxicity in rats.

  14. In Silico Analysis of Microarray-Based Gene Expression Profiles Predicts Tumor Cell Response to Withanolides

    Directory of Open Access Journals (Sweden)

    Thomas Efferth

    2012-05-01

    Full Text Available Withania somnifera (L. Dunal (Indian ginseng, winter cherry, Solanaceae is widely used in traditional medicine. Roots are either chewed or used to prepare beverages (aqueous decocts. The major secondary metabolites of Withania somnifera are the withanolides, which are C-28-steroidal lactone triterpenoids. Withania somnifera extracts exert chemopreventive and anticancer activities in vitro and in vivo. The aims of the present in silico study were, firstly, to investigate whether tumor cells develop cross-resistance between standard anticancer drugs and withanolides and, secondly, to elucidate the molecular determinants of sensitivity and resistance of tumor cells towards withanolides. Using IC50 concentrations of eight different withanolides (withaferin A, withaferin A diacetate, 3-azerininylwithaferin A, withafastuosin D diacetate, 4-B-hydroxy-withanolide E, isowithanololide E, withafastuosin E, and withaperuvin and 19 established anticancer drugs, we analyzed the cross-resistance profile of 60 tumor cell lines. The cell lines revealed cross-resistance between the eight withanolides. Consistent cross-resistance between withanolides and nitrosoureas (carmustin, lomustin, and semimustin was also observed. Then, we performed transcriptomic microarray-based COMPARE and hierarchical cluster analyses of mRNA expression to identify mRNA expression profiles predicting sensitivity or resistance towards withanolides. Genes from diverse functional groups were significantly associated with response of tumor cells to withaferin A diacetate, e.g. genes functioning in DNA damage and repair, stress response, cell growth regulation, extracellular matrix components, cell adhesion and cell migration, constituents of the ribosome, cytoskeletal organization and regulation, signal transduction, transcription factors, and others.

  15. The use of antigibberelins with different mechanisms of action on morphogenesis and production process regulation in the plant Solanum melongena (Solanaceae

    Directory of Open Access Journals (Sweden)

    V. G. Kuriata

    2016-03-01

    Full Text Available The influence of antigibberelin on the growth, development and productivity of eggplant was investigated. It was established that the use of tebuconazole and chlormequat chloride is a highly effective tool for regulation of morphogenesis and productivity of eggplant. We found that retardants slowed the growth of plants, and increased the number of leaves and leaf area and dry substance weight of the whole plant. Under the influence of Esfon ethylene producers the inhibition of the growth process was not accompanied by increase of the number, weight and area of leaves.Antigibberelin agents caused the thickening of chlorenchyma and the growth of the columnar cells and cell sizes of spongy parenchyma. Under the action of agents the thickness of the upper and lower epidermis of the leaf increased. As a result of mesostructural and morphometric changes of leaf structure under the influence of retardants the leaf index and specific leaf surface density increased.The growth inhibitory agents increased the chlorophyll content in leaves and caused the growth of chlorophyll index in crops.Retardants reduced the content of sugar and starch in leaves because of their enhanced outflow to fruits, the amount of which was predicted to be greater. Under the influence of Esfon the flow of carbohydrates to the acceptor areas was slower.The use of retardants of triazole and onium origin positively influenced the formation of productivity elements of the culture, which led to increase in the fruit yield. The use of tebuconazole was found to be the most effective.

  16. Impact of gibberelic acid and tebuconazole on formation of the leaf system and functioning of donor – acceptor plant system of solanaceae vegetable crops

    Directory of Open Access Journals (Sweden)

    V. H. Kuryata

    2017-04-01

    Full Text Available We studied the comparable effect of gibberelic acid and tebuconazole on morphogenesis, mesostructure formation and redistribution of flows in sweet peppers and tomatoes. It has been found that the use of gibberelic acid and tebuconazole retardant during budding leads to increased plant productivity due to optimization of the structure and operation of the plants’ leaf apparatus. It was established that both gibberelic and antigibberelic tebuconazole drug stimulated the formation and functioning of the photosynthetic apparatus of peppers and tomatoes, but the mechanisms of this regulation were different. Increased photosynthetic activity of plants under the influence of gibberellin was determined primarily by the formation of more leaves and total leaf surface. When using tebuconazole retardant there was a significant restructuring of the organization of leaf mezostructure: the leaves were thickened by chlorenchyma proliferation, there was an increase in the volume of columnar parenchyma cells and linear dimensions of spongy parenchyma leaf cells. The surface density of leaves significantly increased, the chlorophyll content and nitrogen content (especially protein also increased, compared with control variants and variants using gibberelin. Such a profound restructuring of the photosynthetic apparatus in plants under the actions of tebuconazole led to a significant increase in donor leaves function of peppers and tomatoes, which is an indicator of the growth of net productivity of photosynthesis – the highest among all the variants of the experiment. The results also show that increasing the chlorophyll phytocenotic index was more significant than the increase of leaf index: the tomatoes under the action of tebuconazole had a lower leaf index than in control options, but due to a higher chlorophyll index the crop productivity increased.Since during the fruiting period the costs of assimilates to the growth of vegetative organs are greatly reduced, optimization of photosynthetic apparatus in pepper and tomato plants led to the laying of more fruit per plant and increasing crop yield. The analysis of the mass ratio of the researched vegetative and fruit plants shows that the mass fraction of fruit (an acceptor sphere of plants during fruiting under the action of both drugs increased. Thus in both variants of the experiment both the mass fraction and donor assimilates of leaves were higher. Apart from the main source of assimilates – the processes of photosynthesis, which intensified due to the formation of a larger area of leaf surface (variant with gibberelin or optimization of mesostructure (variant with tebuconazole it is probable that the formation and growth of the embryo occurred in part due to reutilization of carbohydrates from the vegetative plant organs in carpogenesis processes.

  17. Potential pollinators of tomato, Lycopersicon esculentum (Solanaceae), in open crops and the effect of a solitary bee in fruit set and quality.

    Science.gov (United States)

    Santos, A O R; Bartelli, B F; Nogueira-Ferreira, F H

    2014-06-01

    We identified native bees that are floral visitors and potential pollinators of tomato in Cerrado areas, described the foraging behavior of these species, and verified the influence of the visitation of a solitary bee on the quantity and quality of fruits. Three areas of tomato crops, located in Minas Gerais, Brazil, were sampled between March and November 2012. We collected 185 bees belonging to 13 species. Exomalopsis (Exomalopsis) analis Spinola, 1853 (Hymenoptera: Apidae) was the most abundant. Ten species performed buzz pollination. Apis mellifera L. 1758 (Hymenoptera: Apidae) and Paratrigona lineata (Lepeletier, 1836) (Hymenoptera: Apidae) could also act as pollinators. The fruit set and number of seeds obtained from the pollination treatment by E. analis were higher than those in the control group. Our results allowed the identification of potential tomato pollinators in Cerrado areas and also contributed information regarding the impact of a single species (E. analis) on fruit set and quality. Although most of the visiting bees show the ability for tomato pollination, there is an absence of adequate management techniques, and its usage is difficult with the aim of increasing the crop production, which is the case for E. analis. Species such as Melipona quinquefasciata, P. lineata, and A. mellifera, which are easy to handle, are not used for pollination services. Finally, it is suggested that a combination of different bee species that are able to pollinate the tomato is necessary to prevent the super-exploitation of only a single species for pollination services and to guarantee the occurrence of potential pollinators in the crop area.

  18. Cytotoxic and genotoxic effects of Solanum lycocarpum St.-Hil (Solanaceae on the cell cycle of Lactuca sativa and Allium cepa

    Directory of Open Access Journals (Sweden)

    Raquel Bezerra Chiavegatto

    2017-06-01

    Full Text Available Solanum lycocarpum St.-Hil popularly known as ‘fruta-de-lobo’ or ‘lobeira’ is native to the Brazilian Cerrado, and used in folk medicine due to its phytotherapic properties. The action of S. lycocarpum on the cell cycle and chromosomes in order to demonstrate whether there are aneugenic and/or clastogenic effects is unknown. Thus, this study aimed at investigating the cytotoxic and genotoxic potential of methanol and hexane extracts of S. lycocarpum on growth and cell cycle of Lactuca sativa and Allium cepa. Roots from both species were exposed for 72 hours to methanol and hexane extracts with 50, 100, and 200 µg mL-1 of S. lycocarpum. Slides were prepared by the squash technique and then analyzed to determine the mitotic index and the total of chromosomal and nuclear abnormalities. The frequencies of chromosomal and nuclear abnormalities were high and significant with a dose-dependent effect, indicating that S. lycocarpum has a cytotoxic and genotoxic action depending on the dose used on meristem cells of A. cepa and L. sativa.

  19. Larvicidal activity of oils, fatty acids, and methyl esters from ripe and unripe fruit of Solanum lycocarpum (Solanaceae against the vector Culex quinquefasciatus (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Viviane de Cássia Bicalho Silva

    2015-10-01

    Full Text Available ABSTRACTINTRODUCTION:The larvicidal activity of oils, fatty acids, and methyl esters of Solanum lycocarpum fruit against Culex quinquefasciatus is unknown.METHODS:The larvicidal activity of samples of ripe and unripe fruit from S. lycocarpum was evaluated against third and fourth instar larvae of C. quinquefasciatus .RESULTS:The oils, fatty acids, and methyl esters of S. lycocarpum showed the greatest larvicidal effect (57.1-95.0% at a concentration of 100mg/L (LC 50values between 0.70 and 27.54mg/L.CONCLUSIONS:Solanum lycocarpum fruit may be a good source of new natural products with larvicidal activity.

  20. Larvicidal activity of the methanol extract and fractions of the green fruits of Solanum lycocarpum (Solanaceae against the vector Culex quinquefasciatus (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Thamer Matias Pereira

    2014-10-01

    Full Text Available Introduction The larvicidal activity of Solanum lycocarpum against Culex quinquefasciatus is unknown. Methods We evaluated the larvicidal activity of extracts of the green fruits of Solanum lycocarpum against third and fourth instar larvae of C. quinquefasciatus. Results Dichloromethane and ethyl acetate fractions showed the greatest larvicidal effect at 200mg/L (83.3% and 86.7%, respectively. The methanol and dichloromethane, ethyl acetate, and hydromethanolic fractions demonstrated larvicidal effects against C. quinquefasciatus, with LC50 values of 126.24, 75.13, 83.15, and 207.05mg/L, respectively. Conclusions Thus, when considering new drugs with larvicidal activity from natural products, S. lycocarpum fruits may be good candidate sources.

  1. Evaluación de diferentes combinaciones fitohormonales en la regeneración de Solanum tuberosum (Solanaceae Var. Pastusa Suprema a partir de explantes internodales

    Directory of Open Access Journals (Sweden)

    Jenny Paola Jiménez Barreto

    2009-07-01

    Full Text Available La regeneración de plantas mediante el cultivo de tejidos es un importante componente de la biotecnología que es requerido para procesos tales como la obtención de plantas transgénicas. Se estableció un sistema eficiente de regeneración para la especie Solanum tuberosum L. var. Pastusa Suprema, susceptible de ser transformada genéticamente. Se evaluó el efecto de las fitohormonas zeatina ribósido (ZR, ácido naftalénacetico (ANA y ácido gibérelico (AG3, utilizadas en combinaciones específicas, sobre la inducción de callo, la regeneración y el número de brotes producidos por explante. La presencia de ANA demostró ser esencial en la respuesta callogénica y regenerativa de los explantes. Se encontró que la adición de 3,0 mg/L de ZR, 0,02 mg/L de ANA y 1,0 mg/L de AG3 sobre un medio básico M-S, es una formulación hormonal adecuada para inducir el proceso de organogénesis indirecta sobre la variedad de papa Pastusa Suprema; produce callogénesis y regeneración en porcentajes superiores al 90%, con un promedio de seis regenerantes por explante.

  2. Caracterização química e atividade biológica de extratos aquosos de Brunfelsiacuneifolia J.A. Schmidt (Solanaceae

    Directory of Open Access Journals (Sweden)

    A.L.S. SCHNEIDER

    2015-01-01

    Full Text Available RESUMO O gênero Brunfelsia possui ainda poucas informações a respeito de sua composição química ou confirmações científicas de suas propriedades medicinais, apesar do uso na medicina tradicional pelos povos amazônicos. Este trabalho buscou caracterizar a espécie Brunfelsia cuneifolia, cultivada no estado do Rio Grande do Sul, quanto a sua composição química e atividade biológica. Foram obtidos extratos aquosos a quente, a frio, e por ultrassom, a partir de folhas frescas. A caracterização química realizada por CLAE determinou a presença dos compostos fenólicos: ácido ferúlico e rutina, em todos os extratos, sendo as maiores quantidades apresentadas pela extração a frio. A análise por EMAR identificou a fórmula molecular de nove substâncias nos diferentes extratos, incluindo a presença do alcaloide brunfelsamidina em todos os extratos obtidos. Para a atividade biológica, devido à similaridade de resposta e teor nas diferentes formas de extração, foi possível correlacionar a atividade antioxidante, avaliada através da redução do radical DPPH*, com o teor de compostos fenólicos totais obtidos pelo método de Folin-Ciocalteu. A toxicidade dos extratos avaliada pela utilização de Artemia salina revelou ausência de toxidez. Os resultados obtidos são os primeiros apresentados para a caracterização desta espécie, colaborando também para a pesquisa científica acerca dos usos popularmente atribuídos ao gênero.

  3. Etnobotánica del "coro" (Nicotiana paa, Solanaceae: Un tabaco silvestre poco conocido del extremo sur de Sudamérica

    Directory of Open Access Journals (Sweden)

    Gustavo F. Scarpa

    2011-07-01

    Full Text Available El "coro" es un tabaco silvestre de Argentina y Chile cuyas raíces son empleadas como fumatorio y mascatorio desde tiempos inmemoriales por grupos indígenas. Si bien existen noticias sobre su empleo desde la época colonial, en la actualidad no hay consenso sobre su identidad botánica a la par que sus modalidades de obtención, procesado y consumo han sido escasamente descriptas. Se efectuaron campañas etnobotánicas al sudoeste de la provincia del Chaco donde se colectaron ejemplares que responden a dicho nombre vernáculo en compañía de indígenas y se analizaron fuentes bibliográficas históricas disponibles. Se comprobó in situ que los mocovíes actualmente fuman sus raíces mezcladas con tabaco tanto en contextos ceremoniales como extra-ceremoniales. Como resultado del análisis bibliográfico se infiere que también lo emplearon en el pasado de manera homóloga indígenas vilelas, qom (tobas; wichi y abipones. Se descarta la correspondencia del "coro" con especies de Trichocline por la inexistencia de registros etnobotánicos al respecto. Se confirma que este fumatorio corresponde a Nicotiana paa Mart. rov. y se presentan y discuten nuevos datos sobre su obtención, procesamiento y consumo.

  4. [Chemical composition of essential oils from leaves of Helicteres guazumifolia (Sterculiaceae), Piper tuberculatum (Piperaceae), Scoparia dulcis (Arecaceae) and Solanum subinerme (Solanaceae) from Sucre, Venezuela].

    Science.gov (United States)

    Ordaz, Gabriel; D'Armas, Haydelba; Yáñez, Dayanis; Moreno, Shailili

    2011-06-01

    Essential oils, biosynthesized and accumulated in aromatic plants, have a wide range of applications in the pharmaceutical health, cosmetics, food and agricultural industry. This study aimed to analyze the secondary metabolites in some plant species in order to contribute to their chemotaxonomy. Leaves from Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis and Solanum subinerme were collected and their essential oils were obtained by means of hydro-distillation. The oil fraction was analyzed and identified by GC/MS. The extraction yields were of 0.004, 0.032, 0.016 and 0.005%, and the oil constituents of 88.00, 89.80, 87.50 and 89.47%, respectively. The principal oils found were: non-terpenoids volatile secondary metabolites (30.28%) in H. guazumifolia; sesquiterpenoids (20.82 and 26.09%) and oxigen derivated (52.19 and 25.18%) in P. tuberculatum and S. dulcis; and oxigen diterpenoids (39.67%) in S. subinerme. The diisobuthylphtalate (13.11%) in H. guazumifolia, (-)-spathulenol (11.37%) in P. tuberculatum and trans-phytol (8.29 and 36.00%) in S. dulcis and S. subinerme, were the principal constituents in their respective essential oils. The diisooctylphtalate were the essential oil common to all species, but the volatile compounds such as trans-pinane, L-linalool, beta-ionone, isophytol, neophytadiene, trans-phytol, dibutylphtalate and methyl hexadecanoate, were only detected in three of these essences. This suggests that these plants may require similar secondary metabolites for their ecological interactions, possibly due to common environmental factors.

  5. Multi-development-HPTLC method for quantitation of hyoscyamine, scopolamine and their biosynthetic precursors in selected solanaceae plants grown in natural conditions and as in vitro cultures.

    Science.gov (United States)

    Jaremicz, Zbigniew; Luczkiewicz, Maria; Kisiel, Mariusz; Zárate, Rafael; El Jaber-Vazdekis, Nabil; Migas, Piotr

    2014-01-01

    Hyoscyamine and scopolamine, anti-cholinergic agents widely used in medicine, are typically obtained from plants grown under natural conditions. Since field cultivation entails certain difficulties (changeable weather, pests, etc.), attempts have been made to develop a plant in vitro culture system as an alternative source for the production of these compounds. During experiments to locate the limiting steps in the biotechnological procedure, it is important to monitor not only the levels of the final products but also the changes in the concentration of their precursors. To develop a HPTLC method for the separation and quantitation of the main tropane alkaloids hyoscyamine and scopolamine, their respective direct precursors littorine and anisodamine, and cuscohygrine, a product of a parallel biosynthetic pathway that shares a common precursor (N-methyl-∆(1) -pyrrolium cation) with tropane alkaloids. Using alkaloid extracts from Atropa baetica hairy roots, different TLC chromatographic systems and developing procedures were investigated. Full separation of all compounds was obtained on HPTLC Si60 F254 plates preconditioned with mobile phase vapours (chloroform:methanol:acetone:25% ammonia ratios of 75:15:10:1.8, v/v/v/v). The chromatograms were developed twice (at distances of 4.0 and 3.0 cm) in a Camag twin trough chamber and visualised with Dragendorff's reagent. Densitometric detection (λ = 190 and 520 nm) was used for quantitative analyses of the different plant samples. This method can be recommended for quantitation of hyoscyamine, scopolamine, anisodamine, littorine and cuscohygrine in different plant material (field grown vs. in vitro cultures). Copyright © 2013 John Wiley & Sons, Ltd.

  6. Characterisation of an unusual telomere motif (TTTTTTAGGG)(n) in the plant Cestrum elegans (Solanaceae), a species with a large genome

    Czech Academy of Sciences Publication Activity Database

    Peška, Vratislav; Fajkus, Petr; Fojtová, Miloslava; Dvořáčková, Martina; Hapala, J.; Dvořáček, Vojtěch; Polanská, P.; Leitch, A. R.; Sýkorová, Eva; Fajkus, Jiří

    2015-01-01

    Roč. 82, č. 4 (2015), s. 644-654 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GP13-10948P Institutional support: RVO:68081707 Keywords : TERMINAL TRANSFERASE * SEQUENCING DATA * EVOLUTION Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2015

  7. MORFOMETRÍA COMPARADA DE SEMILLAS DE NICOTIANA (SOLANACEAE E IDENTIFICACIÓN DE SEMILLAS CARBONIZADAS PROVENIENTES DE UN SITIO ARQUEOLÓGICO EN CHILE CENTRAL

    Directory of Open Access Journals (Sweden)

    M. Teresa Planella

    2012-01-01

    Full Text Available La presencia frecuente de pipas para fumar en sitios arqueológicos del Período Alfarero Temprano deChile central y las evidencias en relación con la costumbre de fumar especies de Nicotiana halladas en sitios prehispánicos de otros lugares de las Américas, muestran la necesidad de contar con una metodología para identificar las especies de este género usadas en Chile. En este trabajo se ha realizado un estudio morfométrico en semillas de especies de Nicotiana que sirve de referencia para comparaciones con semillas de origen arqueológico. La forma y tamaño de la semilla, el patrón de ornamentación dado por las células epidérmicas y la ubicación del hilum resultaron ser caracteres relevantes para identificaciones confiables. Utilizando estos caracteres, se determinaron como N. corymbosa a las semillas recuperadas en el sitio arqueológico Las Morrenas 1, ubicado en Chile central.

  8. EVALUACIÓN DE LA MACROFAUNA DEL SUELO EN SOLANUM TUBEROSUM (SOLANALES: SOLANACEAE) CON SISTEMAS DE LABRANZA TRADICIONAL Y MÍNIMA

    OpenAIRE

    Botina G., Bibiana; Velásquez I., ángel; Bacca, Tito; Castillo F., Jesús; Dias, Lucimar G.

    2012-01-01

    El objetivo de esta investigación fue evaluar la diversidad, abundancia y biomasa de la macrofauna en cuatro diferentes usos del suelo; cultivo de papa con labranza mínima, cultivo de papa con labranza tradicional, suelo desnudo y una pradera de kikuyo. Para evaluar la fauna fue utilizada la metodología del programa Tropical Soil Biology and Fertility (TSBF). La macrofauna del suelo fue identificada hasta nivel de orden y familia. La mayor abundancia y diversidad de macroinvertebrados fue enc...

  9. Qualitative analysis of MDR-reversing Anastasia Black (Russian black sweet pepper, Capsicum annuum, Solanaceae) extracts and fractions by HPLC and LC-MS-MS methods.

    Science.gov (United States)

    Schelz, Zsuzsanna; Molnár, Joseph; Fogliano, Vincenzo; Ferracane, Rosalia; Pernice, Rita; Shirataki, Yoshiaki; Motohashi, Noboru

    2006-01-01

    In earlier experiments, the MDR (multidrug resistance)-reversal activities of Anastasia Black (Russian black sweet pepper) extracts had been analysed. Recently, the most effective MDR reversing extracts and fractions have been separated by HPLC (high-performance liquid chromatography, for carotenoids) and LC-MS-MS (HPLC combined with mass spectrometry, for phenolic compounds) methods. As a result of the analytical studies, the following flavonoids had been identified: feruloyl glucopyranoside, quercetin rhamnopyranoside glucopyranoside, luteolin glucopyranoside arabinopyranoside, apigenin glucopyranoside arabinopyranoside, quercetin rhamnopyranoside, luteolin arabinopyranoside diglucopy-ranoside, hesperidine and luteolin glucuronide. According to the literature, the aglycones of these phenolic compounds exhibit MDR-reversal activity in vitro, and the connection between the phenolic content of Anastasia Black and MDR-reversal action was therefore studied by different analytical methods. The results of this study revealed that the identified flavonoids of Anastasia Black may be only partially responsible for the modulation of the MDR of mouse lymphoma cells. Other lipophilic compounds, most probably carotenoids, present in Russian black sweet pepper may act as inhibitors of MDR reversal.

  10. Final Environmental Assessment Implementation of the Integrated Natural Resources Management Plan for Avon Park Air Force Range Florida

    Science.gov (United States)

    2004-01-01

    divine nightshade (Solanum nigrescens) Coast sandspur (Cenchrus incertus) Three plants — tropical soda apple (Solanum viarum), cogon grass ( Imperata ...consequence on the APAFR ecosystem. However in the last 5 years, there has been an increase in the number of sites where cogon grass ( Imperata ...verticillata Hydrilla Hymenachne amplexicaulis West In mdian arsh grass Imperata cylindrica Cogon grass Lantana camara Lantana Ligustrum sinense Chinese

  11. Allelic diversity in populations of Solanum lycocarpum A. St.-Hil (Solanaceae in a protected area and a disturbed environment Diversidade alélica em populações de Solanum lycocarpum A. St.-Hil (Solanaceae em Unidade de Conservação e em ambiente sob influência antrópica

    Directory of Open Access Journals (Sweden)

    Tânia Maria de Moura

    2011-12-01

    Full Text Available This study aimed to compare the genetic diversity of populations of Solanum lycocarpum A.St.-Hil between natural and human disturbed environments, with the assumption that protected areas have greater genetic diversity than disturbed areas. For this study, two populations were sampled in Goiás State, Brazil. One was located in a conservation unit, Serra de Caldas Novas State Park, in the Caldas Novas municipality. The other was located in a pasture area in the municipality of Morrinhos. The two populations are 41 km apart. We sampled 60 individuals from each population, which were genotyped with five microsatellite loci (SSR. The highest number of alleles was recorded in the population of the conservation unit, where we found 11 exclusive and five rare alleles. In the disturbed area, we recorded only three exclusive alleles and one rare allele. Although we did not observe significant inbreeding in these populations, genetic divergence between them was high (G ST (Hedrick=0.147 =0.147 for a species with long distance seed dispersal. The results corroborate the hypothesis that the population in the less disturbed area harbors greater allelic diversity. They also confirm the effectiveness of using protected areas to preserve the genetic diversity of the species.O presente trabalho teve por objetivo comparar a diversidade genética em populações de Solanum lycocarpum A.St.-Hil, em ambientes naturais e antropizados, sob a hipótese de que Unidades de Conservação abrigam maior diversidade genética que áreas antropizadas. Para isso foram estudadas duas populações da espécie, uma situada em uma Unidade de Conservação, o Parque Estadual da Serra de Caldas Novas (PESCAN em Caldas Novas/GO e outra situada em uma área de pastagem no município de Morrinhos-GO. As populações distanciam-se em 41 km. Foram amostrados 60 indivíduos de cada população e os mesmos foram genotipados com cinco locos microssatélites (SSR. Pode-se registrar a maior número de alelos na população de S. lycocarpum situada na unidade de conservação, quando comparada à outra localizada em ambiente antropizado. Na população natural ocorreram onze alelos exclusivos e cinco raros, enquanto que na antropizada foram registrados três alelos exclusivos e um raro. Embora não tenha sido observada endogamia significativa nas populações, a divergência genética entre as mesmas foi alta (G ST (Hedrick=0.147, para uma planta com dispersão a longas distâncias. Os resultados corroboram a hipótese, mostrando que a população sob menor influência antrópica abriga maior diversidade alélica, e confirmam a eficiência das Unidades de Conservação para a preservação da diversidade genética da espécie.

  12. First record on the use of leaves of Solanum lycocarpum (Solanaceae and fruits of Emmotum nitens (Icacinacea by Platyrrhinus lineatus (E. Geoffroy (Chiroptera, Phyllostomidae in the Brazilian Cerrado Primeiro registro do uso de folhas de Solanum lycocarpum (Solanaceae e de frutos de Emmotum nitens (Icacinacea por Platyrrhinus lineatus (E. Geoffroy (Chiroptera, Phyllostomidae no Cerrado brasileiro

    Directory of Open Access Journals (Sweden)

    Ludmilla M. de S. Aguiar

    2005-06-01

    Full Text Available During May, June and July of 2004, the feeding habits of Platyrrhinus lineatus (E. Geoffroy, 1810 were investigated. Each morning food remains (dry oral pellets, seeds, feces and partly eaten foods were collected in two day roosts sites located inside the main building at Embrapa Cerrados. Fruits of Emmotum nitens (Benth. Miers (1852 and leaves of Solanum lycocarpum S. Hil. (1833 were items consumed by P. lineatus. Independent of plant and bat distribution area, the use of Solanum leaves by P. lineatus appears to be common.Durante os meses de maio, junho e julho de 2004, os hábitos alimentares de Platyrrhinus lineatus (E. Geoffroy, 1810 foram investigados. Toda manhã os restos alimentares (pelotas de matéria seca, sementes, fezes e itens parcialmente comidos foram coletados em dois abrigos diurnos localizados dentro das dependências da Embrapa Cerrados. Além de frutos de Emmotum nitens (Benth. Miers (1852, folhas de Solanum lycocarpum S. Hil. (1833 foram consumidas por P. lineatus. Independentemente da área de distribuição, da planta ou do morcego, o uso de folhas de espécies do gênero Solanum por P. lineatus parece ser comum.

  13. Estudo fitoquímico preliminar e bioensaio toxicológico frente a larvas de Artemia salina Leach. de extrato obtido de frutos de Solanum lycocarpum A. St.-Hill (Solanaceae

    Directory of Open Access Journals (Sweden)

    Marcelo Gonzaga de Freitas Araújo

    2010-11-01

    Full Text Available

    Neste trabalho avaliou-se o perfil fitoquímico e a toxicidade preliminar frente a larvas de Artemia salina do extrato etanólico de frutos de Solanum lycocarpum. O extrato foi submetido à analise fitoquímica preliminar para identificação das principais classes de metabolitos secundários presentes e testado frente a larvas de A. salina para obtenção das concentrações letais médias (CL50%. Os testes fitoquímicos demonstraram a presença de fenóis, taninos, saponinas, alcalóides e esteróides e triterpenos livres. O extrato foi fracionado em diferentes solventes para a avaliação da toxicidade frente à A. salina, apresentando considerável citotoxicidade encontrada na fração hidroalcoólica (CL50% = 285,546 µg/mL. Palavras-chave: Solanum lycocarpum, Artemia salina, triagem fitoquímica preliminar. ABSTRACT The phytochemical profile of ethanolic extract of Solanum lycocarpum fruits was analyzed and preliminary toxicity tests were performed against brine shrimp larvae. The extract was subjected to preliminary phytochemical analysis to identify the main classes of secondary metabolites and tested against the larvae of A. salina to obtain the median lethal concentrations (LC50%. The phytochemical tests showed the presence of phenols, tannins, saponins, alkaloids and free steroids. The extract was fractionated with various solvents for toxicity testing against the larvae and the hydroalcoholic fraction showed considerable cytotoxicity (CL50% = 285.546 g/mL. Keywords: Solanum lycocarpum, Artemia salina, phytochemical screening

  14. Composición química de los aceites esenciales de las hojas de Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae y Solanum subinerme (Solanaceae, recolectadas en Sucre, Venezuela

    Directory of Open Access Journals (Sweden)

    Gabriel Ordaz

    2011-06-01

    Full Text Available Los aceites esenciales son biosintetizados por plantas aromáticas y pueden obtenerse de cualquier órgano de la misma, tienen gran aplicación en la industria farmacéutica, sanitaria, cosmética, agrícola y de alimentos. Los aceites esenciales de las hojas de las plantas Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis y Solanum subinerme fueron obtenidos mediante hidrodestilación con rendimientos de 0.004, 0.032, 0.016 y 0.005%, respectivamente. La CG/EM permitió identificar la mayoría de los constituyentes de estos aceites esenciales (88.00, 89.80, 87.50 y 89.47%, respectivamente, encontrándose en mayor proporción metabolitos no volátiles de estructura no terpenoidal en H. guazumifolia (30.28%, sesquiterpenoides oxigenados en P. tuberculatum (52.19%, sesquiterpenos en S. dulcis (26.09% y derivados oxigenados de diterpenos en S. subinerme (39.67%. Los constituyentes mayoritarios fueron el diisobutilftalato (13.11% en H. guazumifolia, (--espatulenol (11.37% en P. tuberculatum y el trans-fitol (8.29 y 36.00% para S. dulcis y S. subinerme, respectivamente. El diisooctilftalato fue el constituyente común en los aceites esenciales de todas las especies y los compuestos volátiles trans-pinano, L-linalool, β-ionona, isofitol, neofitadieno, trans-fitol, dibutilftalato y hexadecanoato de metilo, fueron detectados en tres de estas esencias. Esto sugiere que dichas plantas pueden requerir metabolitos secundarios similares para su interacción ecológica, posiblemente debido a factores ambientales comunes.

  15. Efeito alelopático de folhas e frutos de Solanum lycocarpum A. St.-Hil. (Solanaceae na germinação e crescimento de Sesamun indicum L. (Pedaliaceae em solo sob três temperaturas Allelopathic effect of leaves and fruits of Solanum lycocarpum A. St.-Hil. (Solanaceae on the germination and growth of Sesamum indicum L. (Pedaliaceae in soil under three temperatures

    Directory of Open Access Journals (Sweden)

    Stefano Salvo Aires

    2005-06-01

    Full Text Available Investigaram-se os efeitos de extratos aquosos de folhas e frutos de Solanum lycocarpum na germinação e crescimento inicial de Sesamum indicum em solo. Os experimentos foram conduzidos sob temperaturas de 22, 30 e 38 ºC. O extrato de folhas não interferiu significativamente no tempo médio, mas reduziu a germinabilidade e diminuiu o pico de germinação nas três temperaturas. Esse extrato não interferiu significativamente no crescimento da parte aérea, exceto a 30 ºC, mas reduziu significativamente o crescimento da radícula nas três temperaturas. Os extratos de frutos aumentaram significativamente o tempo médio de germinação a 30 ºC e reduziram a germinabilidade a 22 ºC. Também reduziram tanto o crescimento aéreo quanto das raízes das plântulas. Os resultados mostram que as propriedades alelopáticas de Solanum lycocarpum se manifestam no substrato solo em ampla faixa de temperatura.The effects of leaf aqueous extracts (3% and ground fruits (0.5% and 1% of Solanum lycocarpum were tested on Sesanum indicum seed germination and early seedling growth in soil. The experiments were conducted at 22 ºC, 30 ºC and 38 ºC. The leaf extract did not interfere significantly on the average time for germination, but it reduced the germinability and the germination peak at the three temperatures tested. The leaf extract did not alter substantially shoot growth, except at 30 ºC, but reduced significantly root growth at the three temperatures. The ground fruits increased significantly the average time for germination at 30 ºC, and reduced the germinability at 22 ºC. These ground fruits added to the soil reduced shoot and root growth in all temperatures tested. These results suggest allelopathic effects of Solanum lycocarpum debris in soil onto a large range of temperatures.

  16. Impacto dos nutrientes N e K e de açúcares solúveis sobre populações de Diabrotica speciosa (Germar (Coleoptera, Chrysomelidae e Agrotis ipsilon (Hüfnagel (Lepidoptera, Noctuidae na cultura da batata, Solanum tuberosum L. (Solanaceae Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar (Coleoptera, Chrysomelidae and Agrotis ipsilon (Hüfnagel (Lepidoptera, Noctuidae populations in potato crops, Solanum tuberosum L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Edson Henrique de Azeredo

    2004-03-01

    Full Text Available Foi estudada a ocorrência de Diabrotica speciosa (Germar, 1824 (Coleoptera, Chrysomelidae e de Agrotis ipsilon (Hüfnagel, 1767 (Lepidoptera, Noctuidae em plantas de batata, cultivares Achat e Monalisa, influenciadas por dosagens de nitrogênio e potássio, e teor mínimo de açúcares solúveis. Os seguintes parâmetros foram avaliados: concentração de nutrientes minerais e açúcar em folha verde, folha senescente, folha em abcisão, haste, tubérculo e planta total usando extratos de infusão em etanol 80%. A maior infestação por larvas de D. speciosa foi na cultivar Monalisa a 150 kg.ha-1 de N + K com 27,03% a PThe occurrence of Diabrotica speciosa (Germar, 1824 and Agrotis ipsilon (Hüfnagel, 1767 on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum theor of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha-1 of N + K with 27.03% at P< 0,05. It was observed that the effect of the dosage of N + K in the increment of the concentration of soluble sugars increased the damages in the tubercles and stems by A. ipsilon. The infestation by these species increased to 58.82% on the Monalisa cultivar, when the nitrogen dosage increased from zero to 150 kg.ha-1, in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensibilized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing.

  17. 7 CFR 361.6 - Noxious weed seeds.

    Science.gov (United States)

    2010-01-01

    ... aciculatus (Retzius) Trinius Commelina benghalensis L. Crupina vulgaris Cassini Cuscuta spp. Digitaria...), nightshade (Solanaceae), and sunflower (Asteraceae). (5) Dodder (Cuscuta spp.) seeds devoid of embryos and...

  18. Molecular Characterization of Cultivated Pawpaw (Asimina triloba) Using RAPD Markers

    Science.gov (United States)

    Hongwen Huang; Desmond R. Layne; Thomas L. Kubisiak

    2003-01-01

    Thirty-four extant pawpaw [Asimina triloba (L.) Dunal] cultivars and advanced selections representing a large portion of the gene pool of cultivated pawpaws were investigated using 71 randomly amplified polymorphic DNA (RAPD) markers to establish genetic identities and evaluate genetic relatedness. All 34 cultivated pawpaws were uniquely...

  19. RAPD inheritance and diversity in pawpaw (Asimina triloba)

    Science.gov (United States)

    Hongwen Huang; Desmond R. Layne; Thomas L. Kubisiak

    2000-01-01

    Twelve, 10-base primers amplified a total of 20 intense and easily scorable polymorphic bands in an interspecific cross of PPFl-5 pawpaw (Asimina triloba (L.) Dunal.) x RET (Asimina reticulata Shuttlew.). In this cross, all bands scored were present in, and inherited from, the A. triloba ...

  20. Efficacy of standardised herbal extracts in type 1 diabetes - an ...

    African Journals Online (AJOL)

    In the present study, the hypoglycemic activity of Withania somnifera Dunal, Allium sativum Linn., Gymnema sylvestre (Retz.) Schult, Ferula foetida (Bunge.) Reg. and Murraya koenigii (L.) Spreng. extracts have been studied in an experimental model of type 1 diabetes. Type 1 diabetes was induced in albino rats by a single ...

  1. Effects of substrates, different pretreatment protocols and ...

    African Journals Online (AJOL)

    induction of seeds germination of Xylopia aethiopica (Dunal) A. Rich. ... mixture of forest top soil and river sand) and 18 pre-germination treatments ... Keywords: Spice tree, domestication, seed dormancy, scarification, desiccation tolerance. ..... Figure 1: Germinated Xylopia aethiopica seeds at 50 days after sowing, showing ...

  2. 2626-IJBCS-Article-Ouedraogo Issoufou

    African Journals Online (AJOL)

    hp

    in this context that the use of essential oils could be an alternative in the management of the insect pests stocks. Thus, the essential ... concentration of 75 µl of essential oil of O. gratissimum induces 80% mortality of adults of S. zeamais after 24 h. With essential ...... Don, de Xylopia aethiopica Dunal et de. Lippia chevalieri.

  3. Efficacité des huiles essentielles de Cymbopogon citratus et de ...

    African Journals Online (AJOL)

    essential oils extracted from leaves of Cymbopogon citratus and Mentha piperita in conservation of fresh cow's milk in southern Benin. ... Mentha piperita essential oil has menthol (46.7%) and neomenthol (8.28%) as major compounds with a hydrogenated ..... des feuilles et fruits de Xylopia aethiopica (Dunal) A. Rich.

  4. 75 FR 76284 - Pesticide Tolerance Crop Grouping Program II; Revisions to General Tolerance Regulations

    Science.gov (United States)

    2010-12-08

    ... scabrum Mill 8-10A Goji berry, Lycium barbarum L 8-10A Groundcherry, Physalis alkekengi L., P. 8-10A grisea (Waterf.) M. Martinez, P. peruviana L., P. pubescens L. Martynia, Proboscidea louisianica 8-10B, 8... aethiopicum L. 8-10B, 8-10C Sunberry, Solanum retroflexum Dunal..... 8-10A Tomatillo, Physalis philadelphica...

  5. Efeito alelopático de folhas de Solanum lycocarpum A. St.-Hil. (Solanaceae na germinação e crescimento de Sesamum indicum L. (Pedaliaceae sob diferentes temperaturas Allelopathic effect of Solanum lycocarpum A. St.-Hil. leaves on the germination and growth of Sesamum indicum L.(Pedaliaceae under different temperatures

    Directory of Open Access Journals (Sweden)

    Sarah C. Caldas Oliveira

    2004-09-01

    Full Text Available Alelopatia pode ser definida como o efeito maléfico ou benéfico que uma planta exerce sobre a outra por meio de compostos químicos liberados no ambiente. Diversas espécies do gênero Solanum apresentam evidências de propriedades alelopáticas. S. lycocarpum A. St.-Hil (lobeira é espécie de ampla distribuição em ambientes perturbados do Cerrado. No presente trabalho foram investigados efeitos alelopáticos de extratos de folhas de lobeira na germinação e no crescimento do gergelim (Sesamum indicum L.. Extratos aquosos das folhas foram preparados nas concentrações de 1%, 2%, 3%, 4% e 5% (p/v. A osmolaridade dos extratos foi medida e soluções de polietileno glicol (PEG 6000, de osmolaridade similar, foram preparadas para avaliar possíveis efeitos osmóticos dos extratos aquosos. Nos testes de germinação, as sementes de gergelim foram colocadas em placas de Petri forradas com papel de filtro com a solução a ser testada e observadas a cada 8h. Para os experimemtos de crescimento, sementes de gergelim foram germinadas em água e posteriormente dispostas para crescimento nos extratos. Após 5 dias, foram medidos os comprimentos da parte aérea e radicular das plântulas. Todos os experimentos foram conduzidos a 22 ºC, 30 ºC e 38 ºC. Observou-se que os extratos de folhas não afetaram a germinabilidade, mas aumentaram o tempo médio de germinação em uma relação próxima à dose-dependente, nas três temperaturas. Quanto ao crescimento, a parte radicular foi a mais afetada pelos extratos aquosos, apresentando redução no tamanho, necroses, ausência de pêlos absorventes e formação de raízes laterais. Os efeitos dos extratos no crescimento das plântulas foram mais evidentes a 38 ºC. Os experimentos conduzidos com soluções de PEG 6000 mostraram que os efeitos observados na presença dos extratos não são de natureza osmótica.Allelopathy should be defined as any stimulatory or inhibitory effect by one plant on another through production of chemical compounds released into the environment. Several Solanum species have shown some allelopathic property. S. lycocarpum islargely distributed on disturbed areas of the Brazilian Cerrado. In the present study the effects of aqueous extracts of S. lycocarpum leaves on the germination and growth of Sesanum indicum L. (sesame were investigated. Aqueous leaf extracts at concentrations of 1%, 2%, 3%, 4%, and 5% (w/v were prepared. The osmolarity of the extracts were measured and solutions of polyethylene glycol (PEG 6000 of similar osmolarity were prepared to evaluate osmotic effects of the extracts on sesame germination and growth. The experiments were carried out on petri dishes lined by two layers of filter paper plus the solutions to be tested. For the germination experiments the number of germinated seeds was checked every 8h. For the growth experiments sesame seeds were previously germinated in water and disposed to grow in the extracts. After five days of incubation the root and shoot length of the seedlings was measured. All the experiments were performed at 22 ºC, 30 ºC and 38 ºC. The extracts did not affect the germinability but increased the average germination time in a dose-dependent manner at the three temperatures. The root growth was more affected by the extracts, showing tip-necrosis, absence of root hairs, and formation of secondary roots. These effects were more evident at 38 ºC. Using PEG 6000 it was shown that the observed effects were not due to osmotic properties of the leaf extracts.

  6. Hepatoprotective activity of aerial part and root extracts of ...

    African Journals Online (AJOL)

    ) extracts of Schwenckia americana Linn (Solanaceae) against carbon tetrachloride (CCl4)-induced hepatotoxicity in rats was studied. Adult Swiss albino rats of either sex were divided into six groups (n=6). Groups I-IV received MME and RME ...

  7. Untitled

    Indian Academy of Sciences (India)

    The berries (fruits) are green when unripe and of different shades of yellow ... to have high medicinal value in various diseases like cough, asthma, fever, heart disease, etc. The plant under investigation belongs to the natural order Solanacea.

  8. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96929 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  9. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96944 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  10. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT97016 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  11. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96931 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  12. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96911 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  13. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96668 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  14. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96940 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  15. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96935 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  16. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96933 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  17. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96937 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  18. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT97018 Solanum tuberosum Solanaceae ... After baking darkening Non-enzymatic discolo...uration of french fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  19. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96927 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  20. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96946 Solanum tuberosum Solanaceae ... after baking darkening Non-enzymatic discolo...uration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after baking.

  1. Antidiabetic activity of water extract of Solanum trilobatum (Linn.) in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-19

    Solanaceae), a medicinal plant widely used in the traditional Ayurveda and Siddha systems of medicine for the treatment of diabetes mellitus was evaluated in the alloxan monohydrate induced diabetic model. Graded doses of the ...

  2. Antidiabetic activity of water extract of Solanum trilobatum (Linn.) in ...

    African Journals Online (AJOL)

    Solanaceae), a medicinal plant widely used in the traditional Ayurveda and Siddha systems of medicine for the treatment of diabetes mellitus was evaluated in the alloxan monohydrate induced diabetic model. Graded doses of the water extract were ...

  3. Effect of ripening period on composition of pepino (Solanum ...

    African Journals Online (AJOL)

    USER

    % for raw and ... of glucose and fructose declined during ripening, whereas sucrose showed an increase in ... Solanaceae like tomato, potato, tobacco and pepper ... Abbreviation: NDF, Neutral detergent fiber; ADF, acid detergent fiber;. HPLC,.

  4. ORF Alignment: NC_003295 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available ECTION DURING STARVATION OR OXYDATIVE STRESS ... TRANSCRIPTION REGULATOR PROTEIN [Ralstonia solanacea...rum] ... ref|NP_520808.1| PUTATIVE DNA PROTECTION DURING ... STARVATION OR OXYDATIVE STRESS TR

  5. Morphological Characters, Occurrence and Distribution among ...

    African Journals Online (AJOL)

    ADOWIE PERE

    Key words: Solanaceae, Solanum, Stomata, trichomes, Complements, Comparative. .... kind of oil secretory function which gave the leaves and stems glossary outlook. .... 25. 96. 20.66%. Anomocyti c. CWO13. Capsicum frutescens. Linn. 5. 78.

  6. Effects of Ashwagandha (roots of Withania somnifera) on neurodegenerative diseases.

    Science.gov (United States)

    Kuboyama, Tomoharu; Tohda, Chihiro; Komatsu, Katsuko

    2014-01-01

    Neurodegenerative diseases commonly induce irreversible destruction of central nervous system (CNS) neuronal networks, resulting in permanent functional impairments. Effective medications against neurodegenerative diseases are currently lacking. Ashwagandha (roots of Withania somnifera Dunal) is used in traditional Indian medicine (Ayurveda) for general debility, consumption, nervous exhaustion, insomnia, and loss of memory. In this review, we summarize various effects and mechanisms of Ashwagandha extracts and related compounds on in vitro and in vivo models of neurodegenerative diseases such as Alzheimer's disease and spinal cord injury.

  7. Comparative analyses of six solanaceous transcriptomes reveal a high degree of sequence conservation and species-specific transcripts

    Directory of Open Access Journals (Sweden)

    Ouyang Shu

    2005-09-01

    Full Text Available Abstract Background The Solanaceae is a family of closely related species with diverse phenotypes that have been exploited for agronomic purposes. Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae. The availability of large collections of Expressed Sequence Tags (ESTs for the Solanaceae now provides the opportunity to assess sequence conservation and divergence on a genomic scale. Results All available ESTs and Expressed Transcripts (ETs, 449,224 sequences for six Solanaceae species (potato, tomato, pepper, petunia, tobacco and Nicotiana benthamiana, were clustered and assembled into gene indices. Examination of gene ontologies revealed that the transcripts within the gene indices encode a similar suite of biological processes. Although the ESTs and ETs were derived from a variety of tissues, 55–81% of the sequences had significant similarity at the nucleotide level with sequences among the six species. Putative orthologs could be identified for 28–58% of the sequences. This high degree of sequence conservation was supported by expression profiling using heterologous hybridizations to potato cDNA arrays that showed similar expression patterns in mature leaves for all six solanaceous species. 16–19% of the transcripts within the six Solanaceae gene indices did not have matches among Solanaceae, Arabidopsis, rice or 21 other plant gene indices. Conclusion Results from this genome scale analysis confirmed a high level of sequence conservation at the nucleotide level of the coding sequence among Solanaceae. Additionally, the results indicated that part of the Solanaceae transcriptome is likely to be unique for each species.

  8. Organic production of tomatoes in the amazon region by plants grafted on wild Solanum rootstocks

    Directory of Open Access Journals (Sweden)

    Elaine Aparecida de Paula Farias

    2013-08-01

    Full Text Available The production of organically grown tomatoes in the Amazonian region of Brazil is difficult due to inherent phytosanitary issues. The objectives of the present investigation were to evaluate the productivity of grafted tomato plants (Solanumlycopersicum cv. Santa Adélia grown organically in Rio Branco, Acre, Brazil, and to assess scion/rootstock compatibility under organic growth conditions. The Solanum species employed as rootstocks were S. gilo (jiló, S. lycocarpum (jurubebão, S. stramonifolium (jurubeba vermelha and S. viarum (joá, while the susceptible S.lycopersicum cultivar Santa Adélia was the scion. Ungrafted tomato plants and tomato grafted on tomato rootstock were employed as controls. The experiment was arranged in a completely randomized block design with six treatments and five repetitions of five plants each. Data were submitted to analysis of variance and the significance of differences between treatments were determined using the Tukey test (P<0.05. All ungrafted tomato plants and those comprising tomato grafted on S.lycopersicum rootstock became infected by brown rot and perished. The total numbers of fruits, numbers of marketable fruits, mean masses of fruits, total productivities and productivities of marketable fruits associated with tomato grafted on S. gilo, S. lycocarpum and S. stramonifolium rootstocks were significantly higher (P<0.05 than the equivalent values obtained with tomato grafted on S. viarum rootstock. S. gilo exhibited the best compatibility index (1.11 of all rootstock/scion combinations studied. It is concluded that tomato grafted on S. gilo, S. lycocarpum and S. stramonifolium rootstocks represent viable alternatives for the production of organic tomatoes in the Amazon region.

  9. Use of organic waste as biofumigant for controlling root knot nematodes (Meloidogyne spp.) on potato

    Science.gov (United States)

    Sari, D. I. P.; Lisnawita; Oemry, S.; Safni, I.; Lubis, K.; Tantawi, A. R.

    2018-02-01

    Root knot nematode (Meloidogyne spp.) is one of the important pathogens that causes big impact on potato crop yields. One of the control strategies for controlling this nematode is the use of biofumigants. Biofumigants are volatile toxic compound derived from plants, and have biocide properties against insects and plant pathogens. Organic waste such as Brassicaceae, Leguminoceae, and Solanaceae can be used as biofumigant sources. This research was conducted to determine the effectiveness of Brassicaceae, Leguminoceae, and Solanaceae as biofumigants against Meloidogyne spp. The experiment was set in a completely randomized design (CRD) with the treatments were organic wastes including Brassicaceae, Leguminoceae, and Solanaceae, both single and combinations, and 2 controls (positive and negative controls) with 3 replications. Each of the biofumigant treatments was prepared and stored for 2 weeks. Potato tubers were transplanted 15 days after germination into polybag inoculated with 1,000 Meloidogyne spp. J2s. The results showed that Brassicaceae + Solanaceae were effective in decreasing the number of galls in potato plants, however only Solanaceae improved plant growth.

  10. Transport of contaminants from energy-process-waste leachates through subsurface soils and soil components: laboratory experiments

    International Nuclear Information System (INIS)

    Wangen, L.E.; Stallings, E.A.; Walker, R.D.

    1982-08-01

    The subsurface transport and attenuation of inorganic contaminants common to a variety of energy process waste leachates are being studied using laboratory column methods. Anionic species currently being emphasized are As, B, Mo, and Se. Transport of the cations Cd and Ni is also being studied. The solid adsorbents consist of three soil mineral components (silica sand, kaolinite, and goethite), and four subsurface soils (a dunal sand, an oxidic sandy clay loam, an acidic clay loam, and an alkaline clay loam). Breakthrough patterns of these species from packed soil columns are followed by monitoring eluent concentrations vs time under carefully controlled laboratory conditions. This report describes the experimental methods being used, the results of preliminary batch adsorption studies, and the results of column experiments completed through calendar year 1981. Using column influent concentrations of about 10 mg/l, adsorption (mmoles/100 g) has been determined from the eluent volume corresponding to 50% breakthrough. On silica sand, kaolinite, dunal sand, and goethite, respectively, these are 2.0 x 10 -4 , 0.020, 0.013, and 0.31 for cadmium, 4.4 x 10 -4 , 0.039, 0.020, and 0.98 for nickel. On kaolinite, dunal sand, and goethite, respectively, adsorption values (mmoles/100 g) are As (0.24, 0.019, and 20.5), B (0.041, 0.0019, and 1.77), Mo (0.048, 0.0010, and 5.93), and Se (0.029, 0.00048, and 1.30). Arsenic is the most highly adsorbed contaminant species and goethite has the largest adsorption capacity of the adsorbents

  11. Niebla ceruchis from Laguna Figueroa: dimorphic spore morphology and secondary compounds localized in pycnidia and apothecia

    Science.gov (United States)

    Enzien, M.; Margulis, L.

    1988-01-01

    During and after the floods of 1979-80 Niebla ceruchis growing epiphytically on Lycium brevipes was one of the dominant aspects of the vegetation in the coastal dunal complex bordering the microbial mats at Laguna Figueroa, Baja California Norte, Mexico. The lichen on denuded branches of Lycium was far more extensively distributed than Lycium lacking lichen. Unusual traits of this Niebla ceruchis strain, namely localization of lichen compounds in the mycobiont reproductive structures (pycnidia and apothecia) and simultaneous presence of bilocular and quadrilocular ascospores, are reported. The abundance of this coastal lichen cover at the microbial mat site has persisted through April 1988.

  12. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75103 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 102.7-108.3 5.59 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  13. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75157 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr09 106.5-112.7 2.41 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  14. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75239 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr12 39.4-64.0 2.02 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  15. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75069 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr06 101.1-107.3 3.68 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  16. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75102 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 38.9-56.2 3.42 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  17. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75106 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 50% of the ger...mination of viable seeds (h-1) 2 ... Chr04 65.1-80.4 2.29 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  18. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75066 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr04 65.1-81.9 2.15 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  19. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75274 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-31.3 2.94 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  20. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75205 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-26.6 3.43 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  1. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75072 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr08 72.6-87.8 2.32 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  2. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75233 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 7.6-23.7 3.5 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  3. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75104 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr09 100.8-112.7 2.78 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  4. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75075 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr12 49.5-63.0 2.54 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  5. QTL list: RXopJ4 resistance locus [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT62244 Solanum lycopersicum Solanaceae RXopJ4 resistance locus resistance to bacterial spot... disease resistance to bacterial spot disease (Xanthomonas perforans (Xp)) 3 J350 ... Chr06 ... 10.1007/s00122-012-2004-6 23117718

  6. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. FENG LI CHUNYANG WEI CHAN QIAO ZHENXI CHEN PENG WANG PAN WEI RAN WANG LIFENG JIN JUN YANG FUCHENG LIN ZHAOPENG LUO. RESEARCH NOTE Volume 95 Issue ...

  7. Geographic distribution of wild potato species

    NARCIS (Netherlands)

    Hijmans, R.J.; Spooner, D.M.

    2001-01-01

    The geographic distribution of wild potatoes (Solanaceae sect. Petota) was analyzed using a database of 6073 georeferenced observations. Wild potatoes occur in 16 countries, but 88% of the observations are from Argentina, Bolivia, Mexico, and Peru. Most species are rare and narrowly endemic: for 77

  8. Marker list: QM109927 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ulation VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109927 Solanum lycopersicum Solanaceae L16L Others ATAGTGTCTACTTCAGGG CCATCAAACAGTTCTCT S. peruvianum pop

  9. Marker list: QM109928 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available GATGGCGTT S. peruvianum population VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109928 Solanum lycopersicum Solanaceae DH8R Others TAGAGAGACTATCCTTTA CACATTCAGT

  10. Comparing the cytotoxic potential of Withania somnifera water and ...

    African Journals Online (AJOL)

    The plant Withania somnifera (Linn.) (Solanacea) is a well-known herbal medicine used in many parts of the world. It has anti-inflammatory, antioxidant, and antitumor as well as neural protective properties. It seems as if the two most active withanolide components, namely withaferin A and withanolide D, found in methanol ...

  11. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96955 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr08 ... 10.1007/s00122-013-2254-y 24408376

  12. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96953 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr03 ... 10.1007/s00122-013-2254-y 24408376

  13. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96951 Solanum tuberosum Solanaceae ... flesh colour after cooking Yellow pigmentati...on intensity to the genetic control of tuber flesh yellowness in cooked tuber tissue. 1 ... Chr01 ... 10.1007/s00122-013-2254-y 24408376

  14. cDNA cloning and expression of anthocyanin biosynthetic genes in ...

    African Journals Online (AJOL)

    GRACE

    2006-05-16

    May 16, 2006 ... that influence anthocyanin pigments have been isolated from Solanaceae. A few genes of anthocyanin ... Long, 1955), and the purple anthocyanin pigments are primarily derived from the related compound ..... anthocyanin production in tuber skins. this result was similar with carrot (daucus carota l) cell ...

  15. Anti-Inflammatory and Antioxidant Activities of Methanol Extracts and ...

    African Journals Online (AJOL)

    Background: Methanol extracts and alkaloid fractions of different parts of four plant species belonging to Solanaceae family and used in Mexican traditional medicine were investigated for their total phenolic contents, anti-inflammatory and antioxidant properties. Materials and Methods: The total phenolic compounds of each ...

  16. AFLP

    African Journals Online (AJOL)

    AJL

    2012-05-29

    May 29, 2012 ... 3Institute of Medicinal Plants (IMP), Tehran, Iran. 4Agricultural Biotechnology Research Institute, ... Hyoscyamus sp. is one of the most important medicinal plants belonging to the Solanaceae family. ..... et al., 2006) and Matricaria chamomilla (Solouki et al.,. 2008). In conclusion, AFLP and retro/AFLP data ...

  17. Mechanism and control of Solanum lycocarpum

    NARCIS (Netherlands)

    Pinto, L.V.A.; Silva, Da E.A.A.; Davide, A.C.; Mendes de Jesus, V.A.; Toorop, P.E.; Hilhorst, H.W.M.

    2007-01-01

    Background Solanaceae seed morphology and physiology have been widely studied but mainly in domesticated crops. The present study aimed to compare the seed morphology and the physiology of germination of Solanum lycocarpum, an important species native to the Brazilian Cerrado, with two species with

  18. Bell pepper rootstock response to Phytophthora capsici under salinity stress

    Science.gov (United States)

    Vegetable grafting is currently used as an eco-friendly technology to increase crop productivity and overcome several biotic and abiotic stress conditions that affect Cucurbitaceae and Solanaceae vegetable crops. In recent years, researchers with breeding programs and seed companies have selected ro...

  19. Cross-species BAC-FISH painting of the tomato and potato chromosome 6 reveals undescribed chromosomal rearrangements

    NARCIS (Netherlands)

    Tang, X.; Szinay, D.; Ramanna, M.S.; Vossen, van der E.A.G.; Datema, E.; Klein Lankhorst, R.M.; Boer, de J.M.; Peters, S.A.; Bachem, C.W.B.; Stiekema, W.J.; Visser, R.G.F.; Jong, de J.H.; Bai, Y.

    2008-01-01

    Ongoing genomics projects of tomato (Solanum lycopersicum ) and potato (Solanum tuberosum) are providing unique tools for comparative mapping studies in Solanaceae. At the chromosomal level, BACs can be positioned on pachytene comple-ments by fluorescent in situ hybridization (FISH) on homoeologous

  20. Marker list: QM357356 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM357356 Solanum tuberosum Solanaceae toPt-437059 Others ... CIP703825 ... Chr10 ratio of tuber length to tuber... width trait and eye depth of tuber trait 1 10.1186/s12863-015-0213-0 26024857

  1. Bello et al (9)

    African Journals Online (AJOL)

    Timade VENTURE

    family Solanaceae and it is one of the largest and ... al.,2004). The taxonomy of this important genus is of ... importance of numerical taxonomic method in ..... SME. SAE. SAM. SNI. SER. SWR. SMA. SGI. -6.4. -4.8. -3.2. -1.6. 0. 1.6. 3.2. 4.8.

  2. Gut content analysis of a phloem-feeding insect, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae)

    Science.gov (United States)

    Potato psyllid, Bactericera cockerelli (Šulc) (Hemiptera: Triozidae) is a key pest of potato (Solanum tuberosum L., Solanales: Solanaceae) and a vector of "Candidatus Liberibacter solanacearum," the pathogen associated with zebra chip disease. In addition to its presence on cultivated crops, the p...

  3. Pharmacognostic and phytochemical evaluation of the Solanun ...

    African Journals Online (AJOL)

    Solanum sisymbriifolium Lam. (Solanaceae) is an important medicinal herb in Ayurvedic medicine. In the present investigation, the detailed pharmacognostic study of S. sisymbriifolium leaf was carried out to lay down the standards which could be useful in future experimental studies. The study included macroscopy, ...

  4. 10 - 18_Aworinde

    African Journals Online (AJOL)

    DR. AMINU

    From the data, Euphorbiaceae,. Solanaceae, Rutaceae, Malvaceae, Caesalpiniaceae, Poaceae and Apocynaceae (in order of decreasing number of species) were the most frequent Families. Taxa such as Musa species,. Vernonia amygdalina, Citrus species, Psidium guajava and Terminalia catappa were found to be the.

  5. 1271-IJBCS-Artticle-Dasmané Bambara

    African Journals Online (AJOL)

    hp

    L'objectif de l'étude est d'évaluer la diversité taxonomique et la variabilité inter et intra-spécifique des plantes cultivées ..... Culture (16). Tomate. Lycopersicum esculentum Mill. Solanaceae. Amérique. 33. 3. 11,54 ..... Calice plus long, sauce.

  6. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96907 Solanum tuberosum Solanaceae ... after cooking darkening Non-enzymatic discol...ouration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after cooking. After 1 hour of the coo...king, discolouration was evaluated. 1,4 ... Chr11 ... 10.1007/s00122-013-2254-y 24408376

  7. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT96905 Solanum tuberosum Solanaceae ... after cooking darkening Non-enzymatic discol...ouration of French fries or cooked tubers, through oxidation of iron-chlorogenic acid observed after cooking. After 1 hour of the coo...king, discolouration was evaluated. 1,4 ... Chr03 ... 10.1007/s00122-013-2254-y 24408376

  8. The effect of the halophytic shrub Lycium ruthenium (Mutt) on selected soil properties of a desert ecosystem in central Iran

    Science.gov (United States)

    Gholam Ali Jalali; Hossein Akbarian; Charles Rhoades; Hamed Yousefzadeh

    2012-01-01

    We compared soil properties beneath naturally-occurring patches of Lycium ruthenicum Murray (fam. Solanaceae) to evaluate the shrub’s potential to improve the fertility of saline soils. Soil pH, total nitrogen and carbon and extractable potassium, magnesium and phosphorus were respectively significantly higher in the A and B horizons of Lycium shrub patches...

  9. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT97962 Solanum tuberosum Solanaceae ... chip color of tuber at normal temperature after cold storage mean val...ue of 2 years 1,3 pPt-536041 ... Chr01 67.8 3.83 ... 10.1007/s11032-015-0415-1 26612975

  10. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT97965 Solanum tuberosum Solanaceae ... chip color of tuber at normal temperature after cold storage mean val...ue of 2 years 1,3 pPt-536863 ... Chr06 75.9 3.84 ... 10.1007/s11032-015-0415-1 26612975

  11. Potato psyllid and the South American desert plant Nolana: an unlikely psyllid host?

    Science.gov (United States)

    Managing zebra chip disease in the potato growing regions of Washington, Oregon, and Idaho is complicated by confusion about the role of non-crop plant species in zebra chip epidemiology. Weedy and ornamental Solanaceae have been shown to be reservoirs of both the potato psyllid (vector of the dise...

  12. Marker list: QM183663 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT

  13. Fungicide rotation schemes for managing Phytophthora fruit rot of watermelon across Southeastern United States (NC, SC, and GA)

    Science.gov (United States)

    Phytophthora capsici has been documented as a pathogen on a wide variety of vegetable crops in the family Solanaceae, Cucurbitaceae, Fabaceae, and plants belonging to 23 other families. Phytophthora fruit rot of watermelons caused by P. capsici is particularly severe in southeastern U.S where optima...

  14. QTL list: SpRg-7 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available entage concerning shoot regeneration 2 ME10-141 ... Chr07 19.51 6.84 ... 10.1186/1471-2229-11-140 22014149 ... QT73653 Solanum lycopersicum Solanaceae SpRg-7 In vitro plant regeneraion bud perc

  15. A preliminary floristic inventory in the Sierra de Mazatan, Municipios of Ures and Mazatan, Sonora, Mexico

    Science.gov (United States)

    Jose Jesus Sanchez-Escalante; Manuel Espericueta-Betancourt; Reyna Amanda Castillo-Gamez

    2005-01-01

    Presently, the flora of the Sierra de Mazatán contains 357 species of vascular plants distributed in 248 genera and 80 families. The families with the most species are Asteraceae (48), Fabaceae (45), Poaceae (28), Euphorbiaceae (18), and Acanthaceae, Cactaceae, Scrophulariaceae, and Solanaceae (11 each). The results show that the flora of the Sierra de Mazat...

  16. Potato Genome Sequencing: A Short Glimpse of the Non-Repetitive.

    Science.gov (United States)

    Potato is the world’s number one vegetable crop. The potato is a member of the Solanaceae family that contains other crops such tomato pepper and eggplant as well as model species tobacco and petunia. Tomato is both an important crop as well as a model species for genetic and physical genomic info...

  17. Infection of potato plants with potato leafroll virus changes attraction and feeding behaviour of Myzus persicae

    NARCIS (Netherlands)

    Alvarez, A.E.; Garzo, E.; Verbeek, M.; Vosman, B.; Dicke, M.; Tjallingii, W.F.

    2007-01-01

    Potato leafroll virus (PLRV; genus Polerovirus, family Luteoviridae) is a persistently transmitted circulative virus that depends on aphids for spreading. The primary vector of PLRV is the aphid Myzus persicae (Sulzer) (Homoptera: Aphididae). Solanum tuberosum L. potato cv. Kardal (Solanaceae) has a

  18. Taxonomic Treatment of Solanum Section Petota (Wild Potatoes) in Catálogo de Plantas Vasculares del Cono Sur (Argentina, Chile, Paraguay, Uruguay, y sur del Brasil)

    Science.gov (United States)

    Solanum section Petota (Solanaceae), which includes the cultivated potato (Solanum tuberosum) and its wild relatives, contains over 150 wild species distributed from the southwestern U.S.A. (38°N) to central Argentina and adjacent Chile (41°S). This catalog includes all species from the Southern Con...

  19. Drug: D03223 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D03223 Crude ... Drug Belladonna leaf (USP) Hyoscyamine [CPD:C02046], Atropine [CP...D:C01479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] ... Atropa belladonna [TAX:33113] ... Same as:... E00229 ATC code: A03BA04 Chemical group: DG00054 ... Solanaceae (nightshade family) Belladonna leaf ... PubChem: 17397376 ...

  20. Environ: E00010 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00010 Belladonna root (JP17) Crude drug Hyoscyamine [CPD:C02046], Atropine [CPD:C...01479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] Atropa belladonna [TAX:33113] Same as: D03224 ...Solanaceae (nightshade family) Belladonna root Major component: Hyoscyamine [DR:D00147] CAS: 8007-93-0

  1. Environ: E00229 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00229 Belladonna leaf (USP) Crude drug Hyoscyamine [CPD:C02046], Atropine [CPD:C0...1479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] Atropa belladonna [TAX:33113] Same as: D03223 Solanaceae (nightshade family) Belladonna leaf ...

  2. Drug: D03069 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D03069 Crude ... Drug Belladonna (USP); Belladonna extract (JP17) Hyoscyamine [CPD...:C02046], Atropine [CPD:C01479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] ... Atropa belladonna... [TAX:33113] ... Same as: E00008 ATC code: A03BA04 Chemical group: DG00054 ... Solanaceae (nightshade family) Belladon

  3. Environ: E00008 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00008 Belladonna extract (JP17) Belladonna (USP) Crude drug Hyoscyamine [CPD:C020...46], Atropine [CPD:C01479], Norhyoscyamine [CPD:C10862], Scopolamine [CPD:C01851] Atropa belladonna [TAX:331...13] Same as: D03069 Solanaceae (nightshade family) Belladonna root extract Major component: Hyoscyamine [DR:D00147] CAS: 8007-93-0

  4. Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Topik Hidayat

    2016-04-01

    Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

  5. Frugivoria e dispersão de sementes pelo lagarto teiú Tupinambis merianae (Reptilia: Teiidae Frugivory and seed dispersal by the tegu lizard Tupinambis merianae Reptilia: Teiidae

    Directory of Open Access Journals (Sweden)

    Everaldo Rodrigo de Castro

    2004-01-01

    Full Text Available Os lagartos teiús possuem uma dieta generalista, podendo agir como importantes dispersores de sementes em florestas semidecíduas do sudeste do Brasil. Foram estudadas a frugivoria e a dispersão de sementes de lagartos teiús usando animais em cativeiro, através da oferta de frutos de uma floresta semidecídua. Frutos de trinta espécies vegetais foram oferecidos aos lagartos em cativeiro, com diâmetro variando de 0,81 a 10,0 cm. Não foram encontradas diferenças estatísticas na germinação entre as sementes que passaram pelo trato digestivo do lagarto e as controle de Eugenia uniflora (chi²= 0.69, P>0.50, Genipa americana (chi²= 6.4, P>0.975, Cereus peruvianus (chi²= 0.018, P>0.10, e Solanum viarum (chi²= 6.23, P>0.975. O tempo de retenção da semente no tubo digestivo do teiú variou de 22 a 23 h para Solanum lycocarpum e 43 a 44 h para Syagrus romanzoffiana. Nossos resultados indicam que o lagarto teiú tem potencial para agir como um importante dispersor de sementes nos trópicos.Tegu lizards have a generalist diet and may play an important role as seed dispersers in semideciduous forests in south-east Brazil. We studied the frugivory and seed dispersal of tegu lizards using captive animals and offering wild fruits from a semideciduous forest. Thirty fruit species were eaten by the lizards in captivity, ranging from 0.81 to 10.0 cm (fruit diameter. Even large fruit adapted to dispersal by large mammals were swallowed (ex. Syagrus oleracea. There were no statistical differences in seed germination between seeds that passed through the lizard gut and the control in Eugenia uniflora (chi2 = 0.69, P>0.50, Genipa americana (chi2 = 6.4, P>0.975, Cereus peruvianus (chi2 = 0.018, P>0.10, and Solanum viarum (chi2 = 6.23, P>0.975. Seed retention time in the tegu gut ranged from 2224 h (Solanum lycocarpum to 4344 h (for Syagrus romanzoffiana. Our results indicate that tegu lizards have a potential to be an important seed dispersers in the

  6. Chemistry as the analytical tool in solving the taxonomic controversies of plants (abstract)

    International Nuclear Information System (INIS)

    Din, A.M.U.; Kashmiri, M.A.; Ahmad, S.

    2011-01-01

    The science of chemical taxonomy is used for the classification of plants on the basis of their chemical constituents which are deeply concerned with the molecular characteristics. Five locally available plant taxa of Solanum nigrum Complex viz.: S. americanum Mill., S. chenopodioides Lam., S. nigrum L., S. retroflexum Dunal and S. villosum Mill. were investigated to resolve the international taxonomic controversy about these plants. Comparative qualitative and quantitative analyses of these plant samples were undertaken keeping Alkaloids, Flavonoids and Epicuticular wax as potential characters. The glycosides of alkaloids and flavonoids were determined by HPLC whereas their aglycones and epicuticular waxes were analysed using GC-MS. HPLC and GC-MS analyses of these constituents from S. nigrum Complex had not been reported previously. Statistical analyses of results grouped taxa into different clusters on the basis of similarity index and Euclidean distance. (author)

  7. Evolutionary relationships among self-incompatibility RNases

    Science.gov (United States)

    Igic, Boris; Kohn, Joshua R.

    2001-01-01

    T2-type RNases are responsible for self-pollen recognition and rejection in three distantly related families of flowering plants—the Solanaceae, Scrophulariaceae, and Rosaceae. We used phylogenetic analyses of 67 T2-type RNases together with information on intron number and position to determine whether the use of RNases for self-incompatibility in these families is homologous or convergent. All methods of phylogenetic reconstruction as well as patterns of variation in intron structure find that all self-incompatibility RNases along with non-S genes from only two taxa form a monophyletic clade. Several lines of evidence suggest that the best interpretation of this pattern is homology of self-incompatibility RNases from the Scrophulariaceae, Solanaceae, and Rosaceae. Because the most recent common ancestor of these three families is the ancestor of ≈75% of dicot families, our results indicate that RNase-based self-incompatibility was the ancestral state in the majority of dicots. PMID:11698683

  8. A new species of solitary Meteorus (Hymenoptera: Braconidae) reared from caterpillars of toxic butterflies (Lepidoptera: Nymphalidae) in Ecuador.

    Science.gov (United States)

    Shaw, Scott R; Jones, Guinevere Z

    2009-01-01

    A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nymphalidae. A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nymphalidae.

  9. Potential economic pests of solanaceous crops: a new species of Solanum-feeding psyllid from Australia and first record from New Zealand of Acizzia solanicola (Hemiptera: Psyllidae).

    Science.gov (United States)

    Taylor, Gary S; Kent, Deborah S

    2013-02-11

    Acizzia credoensis sp. n. is described from a single population on the native plant, Solanum lasiophyllum, from semi-arid Western Australia. The host range of Acizzia solanicola Kent & Taylor, initially recorded as damaging eggplant, S. melongena, in commercial crops and gardens and on wild tobacco bush, S. mauritianum in eastern Australia, is expanded to include the following Solanaceae: rock nightshade, S. petrophilum, cape gooseberry, Physalis peruviana, and an undetermined species of angel's trumpet Brugmansia and Datura. New Zealand specimens of A. solanicola collected in early 2012 from S. mauritianum are the first record for this species from outside Australia, and possibly represent a very recent incursion. The potential for the solanaceous-inhabiting Psyllidae to vector Candidatus Liberibacter solanacearum, an economically important plant pathogen, on native Australian Solanaceae is discussed. The occurrence of A. credoensis and A. solanicola on native Australian Solanum supports the Australian origin for the solanaceous-inhabiting Acizzia psyllids.

  10. H:\\PMKER 25(3)\\TRAORE K..xps

    African Journals Online (AJOL)

    AISA

    Laboratoire de Phytopathologie de la Faculté d'Agronomie de l'Université de Parakou (Bénin) pour confirmer ou non la présence des trois virus responsables de maladies chez les Solanaceae à savoir le CMV, le PVMV et le PVYN. Des tampons ont été préparés conformément aux directives de Clarck et al. (1977), il s'agit.

  11. Pengaruh Waktu Pemberian Pupuk Mikoriza Terhadap Pertumbuhan Dan Hasil Tanaman Paprika (Capsicum Annum Var Grossum L.)

    OpenAIRE

    Milla, Yulius Ndara; Widnyana, I Ketut; Pandawani, Ni Putu

    2016-01-01

    Paprika (Capsicum annum var grossum L.) adalah tumbuhan penghasil buah yang berasa manis dan sedikit pedas dari suku terong-terongan atau Solanaceae. Sama dengan jenis cabai lainnya. Paprika memiliki nilai jual yang bagus, permintaan pasar akan sayuran ini juga terus meningkat, terutama permintaan dari banyak restoran dan hotel berkembang di Bali. Kenyataan ini bisa dimanfaatkan dengan mengembangkan budidaya tanaman paprika untuk memasok kebutuhan pasar akan paprika yang kian hari kian me...

  12. Diploidization and genome size change in allopolyploids is associated with differential dynamics of low- and high-copy sequences

    Czech Academy of Sciences Publication Activity Database

    Renny-Byfield, S.; Kovařík, Aleš; Kelly, L.J.; Macas, Jiří; Novák, Petr; Chase, M.W. (ed.); Nichols, R. A.; Pancholi, M. R.; Grandbastien, M.-A.; Leitch, Andrew R.

    2013-01-01

    Roč. 74, č. 5 (2013), s. 829-839 ISSN 0960-7412 R&D Projects: GA ČR GA13-10057S; GA ČR(CZ) GBP501/12/G090 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : ALLOTETRAPLOID TOBACCO * NICOTIANA SOLANACEAE * SEED PLANTS Subject RIV: BO - Biophysics; EB - Genetics ; Molecular Biology (BC-A) Impact factor: 6.815, year: 2013

  13. Diversité de Ralstonia Solanacearum au Cameroun et bases génétiques de la résistance chez le piment (Capsicum Annuum) et les Solanacées

    OpenAIRE

    Mahbou-Somo-Toukam , Gabriel

    2010-01-01

    The knowledge of genetic diversity of R. solanacearum as well as the knowledge of genetic determinism of pepper resistance are critical for elaborating a strategy against this ubiquist bacterium. They will facilitate the choice and direction of fighting methods and the development of well adapted tools for quarantine measures. In a modern approach of genetics more and more based on plant models, Solanaceaes occupy a place of pioneer. On another hand the emerging breakdown of resistances seems...

  14. Food Plants of 19 butterflies species (Lepidoptera from Loreto, Peru

    Directory of Open Access Journals (Sweden)

    Joel Vásquez Bardales

    2017-04-01

    Full Text Available This work reports the food plants utilized by 19 species of butterflies from Allpahuayo-Mishana Research Center and the Community of San Rafael, Loreto, Peru. We report 23 plant species and one hybrid of angiosperms used by the butterflies. Larval host plants were 21 species and five were adult nectar sources. Two species were both host plant and nectar source: Passiflora coccinea Aubl. and Passiflora edulis Sims. The most frequently used plant families were Solanaceae, Passifloraceae, Fabaceae and Aristolochiaceae.

  15. Vascular species composition of a contact zone between Seasonal and Araucaria forests in Guaraciaba, Far West of Santa Catarina state, southern Brazil

    OpenAIRE

    Gnigler, Luciana; Caddah, Mayara

    2015-01-01

    A floristic survey was carried out in a contact area between Araucaria Forest and Seasonal Forest areas, in the municipality of Guaraciaba, Far West of Santa Catarina state, southern Brazil. We provide a checklist containing 108 species and 42 plant families for the area. Families with the most encountered number of species were Myrtaceae (eight species), Solanaceae (eight), Euphorbiaceae (seven) and Poaceae (six). Two species are classified as endangered of extinction, following IUCN criteri...

  16. Étude ethnobotanique et évaluation in vitro de l'activité antifongique ...

    African Journals Online (AJOL)

    SARAH

    2016-02-29

    Feb 29, 2016 ... Torréfaction, pulvérisation. Cutané, rectale. 25 Scoparia dulcis L. Scrophulariaceae Gnongnon. GC - SZ H np. 1,75 Écorce,. Feuille pétrissage. Cutané, rectale. 26 Solanum verbascifolium. Linn. Solanaceae. Vi ahovi. GC. Arb mp. 1,75 Feuille pétrissage. Cutané, rectale. 27 Solenostemon monostachyus (P.

  17. Preliminary assessment of medicinal plants used as antimalarials in the southeastern Venezuelan Amazon

    Directory of Open Access Journals (Sweden)

    Caraballo Alejandro

    2004-01-01

    Full Text Available Eighteen species of medicinal plants used in the treatment of malaria in Bolívar State, Venezuela were recorded and they belonged to Compositae, Meliaceae, Anacardiaceae, Bixaceae, Boraginaceae, Caricaceae, Cucurbitaceae, Euphorbiaceae, Leguminosae, Myrtaceae, Phytolaccaceae, Plantaginaceae, Scrophulariaceae, Solanaceae and Verbenaceae families. Antimalarial plant activities have been linked to a range of compounds including anthroquinones, berberine, flavonoids, limonoids, naphthquinones, sesquiterpenes, quassinoids, indol and quinoline alkaloids.

  18. Contribution to the knowledge of chemical plants of northeast Brazil: Solanum buddleifolium SENDTN

    OpenAIRE

    Francisco das Chagas Lima Pinto

    2013-01-01

    This work describes the chemical study of Solanum buddleifolium (Solanaceae) aimed the isolation and structural characterization of its secondary metabolites. The chemical prospection was realized using chromatographic techniques such as chromatography over silica gel Sephadex LH-20 and solid phase extraction (SPE) besides High Performance Liquid Chromatography (HPLC) From EtOH were isolated the known compounds β-sitosterol and estigmasterol betulinic acid 13-hidroxysolavetrivone polista...

  19. Plant elicitor peptides are conserved signals regulating direct and indirect antiherbivore defense

    OpenAIRE

    Huffaker, Alisa; Pearce, Gregory; Veyrat, Nathalie; Erb, Matthias; Turlings, Ted C. J.; Sartor, Ryan; Shen, Zhouxin; Briggs, Steven P.; Vaughan, Martha M.; Alborn, Hans T.; Teal, Peter E. A.; Schmelz, Eric A.

    2013-01-01

    Insect-induced defenses occur in nearly all plants and are regulated by conserved signaling pathways. As the first described plant peptide signal, systemin regulates antiherbivore defenses in the Solanaceae, but in other plant families, peptides with analogous activity have remained elusive. In the current study, we demonstrate that a member of the maize (Zea mays) plant elicitor peptide (Pep) family, ZmPep3, regulates responses against herbivores. Consistent with being a signal, expression o...

  20. Potato (Solanum tuberosum L.).

    Science.gov (United States)

    Chetty, Venkateswari J; Narváez-Vásquez, Javier; Orozco-Cárdenas, Martha L

    2015-01-01

    Agrobacterium-mediated transformation is the most common method for the incorporation of foreign genes into the genome of potato as well as many other species in the Solanaceae family. This chapter describes protocols for the genetic transformation of three species of potato: Solanum tuberosum subsp. tuberosum (Desiréé), S. tuberosum subsp. andigenum (Blue potato), and S. tuberosum subsp. andigena using internodal segments as explants.

  1. A New Species of Solitary Meteorus (Hymenoptera: Braconidae) Reared from Caterpillars of Toxic Butterflies (Lepidoptera: Nymphalidae) in Ecuador

    OpenAIRE

    Shaw, Scott R.; Jones, Guinevere Z.

    2009-01-01

    A new species of parasitoid wasp, Meteorus rugonasus Shaw and Jones (Hymenoptera: Braconidae), is described from the Yanayacu Biological Station, Napo Province, Ecuador. The new species is diagnosed and compared to other species in the genus. It was reared from larvae of Pteronymia zerlina (Hewitson, 1855) (Lepidoptera: Nymphalidae, Ithomiinae) found feeding on leaves of Solanum (Solanaceae). The parasitoid is solitary. This is the first record of a Meteorus species attacking ithomiine Nympha...

  2. Comparison of bioassays using the anostracan crustaceans Artemia salina and Thamnocephalus platyurus for plant extract toxicity screening Comparação de bioensaios com os crustáceos Artemia salina e Thamnocephalus platyurus para abordagem de extratos de plantas com toxicidade

    OpenAIRE

    Pablo Mayorga; Karen R. Pérez; Sully M. Cruz; Armando Cáceres

    2010-01-01

    Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest) and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest), were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq.) Kunth ex ...

  3. Comparison of bioassays using the anostracan crustaceans Artemia salina and Thamnocephalus platyurus for plant extract toxicity screening

    OpenAIRE

    Mayorga,Pablo; Pérez,Karen R.; Cruz,Sully M.; Cáceres,Armando

    2010-01-01

    Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest) and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest), were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq.) Kunth ex ...

  4. Development and Characterization of Microsatellite Markers for the Cape Gooseberry Physalis peruviana

    OpenAIRE

    Simbaqueba, Jaime; S?nchez, Pilar; Sanchez, Erika; N??ez Zarantes, Victor Manuel; Chacon, Maria Isabel; Barrero, Luz Stella; Mari?o-Ram?rez, Leonardo

    2011-01-01

    Physalis peruviana, commonly known as Cape gooseberry, is an Andean Solanaceae fruit with high nutritional value and interesting medicinal properties. In the present study we report the development and characterization of microsatellite loci from a P. peruviana commercial Colombian genotype. We identified 932 imperfect and 201 perfect Simple Sequence Repeats (SSR) loci in untranslated regions (UTRs) and 304 imperfect and 83 perfect SSR loci in coding regions from the assembled Physalis peruvi...

  5. Comparative Characterization of the Leaf Tissue of Physalis alkekengi and Physalis peruviana Using RNA-seq and Metabolite Profiling

    OpenAIRE

    Fukushima, Atsushi; Nakamura, Michimi; Suzuki, Hideyuki; Yamazaki, Mami; Knoch, Eva; Mori, Tetsuya; Umemoto, Naoyuki; Morita, Masaki; Hirai, Go; Sodeoka, Mikiko; Saito, Kazuki

    2016-01-01

    The genus Physalis in the Solanaceae family contains several species of benefit to humans. Examples include P. alkekengi (Chinese-lantern plant, hôzuki in Japanese) used for medicinal and for decorative purposes, and P. peruviana, also known as Cape gooseberry, which bears an edible, vitamin-rich fruit. Members of the Physalis genus are a valuable resource for phytochemicals needed for the development of medicines and functional foods. To fully utilize the potential of these phytochemicals we...

  6. Minerals and essential fatty acids of the exotic fruit Physalis peruviana L. Minerais e ácidos graxos essenciais da fruta exótica Physalis peruviana L.

    OpenAIRE

    Eliseu Rodrigues; Ismael Ivan Rockenbach; Ciriele Cataneo; Luciano Valdemiro Gonzaga; Eduardo Sidinei Chaves; Roseane Fett

    2009-01-01

    Physalis peruviana is an exotic fruit that belongs to the Solanaceae family and which has recently started to be produced in Brazil, mainly in the Southern region. Once there is few data regarding its chemical composition, this work presents the centesimal and mineral composition and the fatty acid profile of the lipidic fraction of Physalis peruviana. Concerning the centesimal composition, Physalis presented high contents of ashes and total lipids, 0.8 and 3.16 g.100 g-1, respectively. In it...

  7. Taxonomy of Rhagoletis population associated with wild plums in Chile

    International Nuclear Information System (INIS)

    Frias, Daniel; Alvina, Andres

    2000-01-01

    In South America, there are about fifteen Rhagoletis species that live in association with wild and cultivated Solanaceae host plants (Foote 1981, Frias 1992). The principal information on taxonomy for these species is the morphology of adults. Thus, in the genus Rhagoletis, in general, there is little information about immature stages especially on first and second larva instars (Steck et al. 1990, Carrol and Wharton 1989, Steck and Wharton 1988, Persson 1963, White and Elson-Harris 1992, Hernandez-Ortiz 1992, 1993, Frias et al. 1993). Presently, in Chile, there are 4 species associated with Solanaceae host plants. R. tomatis Foote and R. nova (Schiner) are associated with cultivated Solanaceae Lycopersicum esculentum Miller or cultivated tomatoes and Solanum muricatum Aiton or sweet cucumber respectively. R. conversa Bethes has two Solanum host plants, S. nigrum L. and S. tomatillo (Remy) Phil. F. (Frias et al. 1984). The host for R. penela Foote is unknown. Moreover, in the last few years, a population on wild plums of the Myrobalan variety (Rosaceae) was detected (Gonzalez 1989). At present, there is no information about the origin and taxonomy of this population. In this work, we have studied the morphology of eggs, three instar larvae, pupae and adults of this population associated with wild plums as well as aspects of its geographical distribution in Chile

  8. Origin of allelic diversity in antirrhinum S locus RNases.

    Science.gov (United States)

    Xue, Y; Carpenter, R; Dickinson, H G; Coen, E S

    1996-01-01

    In many plant species, self-incompatibility (SI) is genetically controlled by a single multiallelic S locus. Previous analysis of S alleles in the Solanaceae, in which S locus ribonucleases (S RNases) are responsible for stylar expression of SI, has demonstrated that allelic diversity predated speciation within this family. To understand how allelic diversity has evolved, we investigated the molecular basis of gametophytic SI in Antirrhinum, a member of the Scrophulariaceae, which is closely related to the Solanaceae. We have characterized three Antirrhinum cDNAs encoding polypeptides homologous to S RNases and shown that they are encoded by genes at the S locus. RNA in situ hybridization revealed that the Antirrhinum S RNase are primarily expressed in the stylar transmitting tissue. This expression is consistent with their proposed role in arresting the growth of self-pollen tubes. S alleles from the Scrophulariaceae form a separate group from those of the Solanaceae, indicating that new S alleles have been generated since these families separated (approximately 40 million years). We propose that the recruitment of an ancestral RNase gene into SI occurred during an early stage of angiosperm evolution and that, since that time, new alleles subsequently have arisen at a low rate. PMID:8672882

  9. Dieta de murciélagos nectarívoros del Parque Nacional Cerros de Amotape, Tumbes

    Directory of Open Access Journals (Sweden)

    Edith Arias

    2011-07-01

    Full Text Available En el Perú se reporta la presencia de 18 especies de murciélagos nectarívoros, sin embargo se cuenta con poca información sobre la dieta de estas especies. En este estudio se reporta por primera vez la dieta de los nectarívoros Glossophaga soricina, Lonchophylla hesperia y Anoura geoffroyi en el bosque seco ecuatorial y del bosque tropical del Pacífico del Parque Nacional Cerros de Amotape, Tumbes. Analizamos 21 contenidos gastrointestinales e identificamos ocho morfotipos de polen pertenecientes a las familias Bombacaceae, Cactaceae, Fabaceae, Solanaceae, Rubiaceae, Myrtaceae, Malvaceae y Rosaceae. Encontramos evidencia del síndrome de quiropterofilia en Bombacaceae, Cactaceae, Fabaceae, Solanaceae y Rubiaceae. Observamos que A. geoffroyi consume polen de Ceiba trichistandra, Solanaceae y Rubiacea; G. soricina consume de Abutilon reflexum, Armathocereus cartwrightianus, C. trichistandra y Rubiaceae; y L. hesperia de A. cartwrightianus, Eriobotrya japonica, Fabaceae y Psidium sp.; sugiriendo una dieta generalista en estas especies. Los murciélagos G. soricina y A. geoffroyi comparten el consumo del ceibo C. trichistandra y de la Rubiaceae, mientras que G. soricina comparte con L. hesperia el consumo del cactus A. cartwrightianus. Los otros morfotipos de polen no fueron compartidos entre murciélagos. Se encuentra además que el ceibo C. trichistandra fue la especie más consumida, especialmente por G. soricina.

  10. Surtos populacionais de Bemisia tabaci no estado de São Paulo Outbreaks of Bemisia tabaci in the São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    André Luiz Lourenção

    1994-01-01

    Full Text Available A partir de 1991, tem sido observada a presença da mosca-branca Bemisia tabaci (Genn. (Homoptera: Aleyrodidae em altas populações em hortaliças e orna-mentais nos municípios paulistas de Paulínia, Holambra, Jaguariúna e Artur Nogueira. Foram constatadas infestações severas em tomateiro, brócolos, berinjela e aboboreira; nesta última, o sintoma observado em plantas infestadas pela mosca-branca é o prateamento da face superior das folhas, em conjunto com queda drástica da produção. Uma lavoura de tomate severamente infestada por B. tabaci apresentava o sintoma referido colo amadurecimento irregular dos frutos do tomateiro; plantas invasoras presentes nessa área também foram intensamente colonizadas, principalmente Sida rhombifolia L., Sonchus oleraceus L., Solanum viarum Dun. e Ipomoea acuminata Roem. & Schult. Em Holambra, verificaram-se ataques intensos em plantas ornamentais, principalmente crisântemo (Chrysantemum morifolium Ramat. e bico-de-papagaio (Euphorbia pulcherrima Willd.; roseiras foral pouco colonizadas. Nessas hortaliças e nas ornamentais, a aplicação quase diária de inseticidas não reduziu a infestação do inseto. Além dessas plantas, campos de algodão, em Holambra, e de feijão, em Paulínia, também foram infestados por B. tabaci. Nos E.U.A., a capacidade de certas populações de B. tabaci de induzir o prateamento da folha em aboboreira e de colonizar intensamente E. pulcherrima, entre outros fatores, têm levado à distinção do biótipo "B" ou "poinsétia", nome vulgar dessa euforbiácea; todavia, estudos recentes na Califórnia (E.U.A. mostram a possibilidade de se tratar de duas espécies distintas. Dada a similaridade entre as infestações associadas a B. tabaci que vêm ocorrendo naquele país e, mais recentemente, no Brasil, é provável que o biótipo B ou essa nova espécie tenha sido aqui introduzido.Since 1991, an increase in the populations of the whitefly Bemisia tabaci (Genn. (Homoptera

  11. Frugivoria em morcegos (Mammalia, Chiroptera no Parque Estadual Intervales, sudeste do Brasil Frugivory in bats (Mammalia, Chiroptera at the Intervales State Park, Southeastern Brazil

    Directory of Open Access Journals (Sweden)

    Fernando C. Passos

    2003-09-01

    Full Text Available This study was carried out at the Intervales State Park, an Atlantic Rain Forest area in Southeastern Brazil. Bats were monthly mist netted over a full year, and fecal samples were collected for dietary analysis. The seeds found in each sample were identified in the laboratory under a stereoscopic microscope by comparison with seeds taken from ripe fruits collected in the study area. Three hundred and seventy one bats were collected, of which 316 (85.2% were frugivorous. The total number of fecal samples with seeds and/or pulp was 121. Sturnira lilium (E. Geoffroy, 1810 was the most abundant species in the study area (n = 157 captures and Solanaceae fruits accounted for 78.5% of the fecal samples with seeds (n = 56. Artibeus fimbriatus Gray, 1838 (n = 21 samples fed mostly on Cecropiaceae (38% and Moraceae fruits (24%, and Artibeus lituratus (Olfers, 1818 (n = 7 samples on Cecropiaceae (57% and Moraceae (29%. Carollia perspicillata (Linnaeus, 1758 (n = 16 samples fed mostly on Piperaceae fruits (56,3%, but Solanaceae (31,3% and Rosaceae seeds (12,5% were also found in feces. Overall, seeds found in bat feces belong to eight plant families: Solanaceae (n = 67 samples; Cecropiaceae (n = 14; Piperaceae (n = 14; Moraceae (n = 8; Rosaceae (n = 3; Cucurbitaceae (n = 3; Cluseaceae (n = 1, and Araceae (n = 1. The close association of different bat species with fruits of certain plant families and genus may be related to a possible mechanism of resource partitioning that shapes the structure of the community.

  12. A duplex PCR assay for the detection of Ralstonia solanacearum phylotype II strains in Musa spp.

    Directory of Open Access Journals (Sweden)

    Gilles Cellier

    Full Text Available Banana wilt outbreaks that are attributable to Moko disease-causing strains of the pathogen Ralstonia solanacearum (Rs remain a social and economic burden for both multinational corporations and subsistence farmers. All known Moko strains belong to the phylotype II lineage, which has been previously recognized for its broad genetic basis. Moko strains are paraphyletic and are distributed among seven related but distinct phylogenetic clusters (sequevars that are potentially major threats to Musaceae, Solanaceae, and ornamental crops in many countries. Although clustered within the Moko IIB-4 sequevar, strains of the epidemiologically variant IIB-4NPB do not cause wilt on Cavendish or plantain bananas; instead, they establish a latent infection in the vascular tissues of plantains and demonstrate an expanded host range and high aggressiveness toward Solanaceae and Cucurbitaceae. Although most molecular diagnostic methods focus on strains that wilt Solanaceae (particularly potato, no relevant protocol has been described that universally detects strains of the Musaceae-infecting Rs phylotype II. Thus, a duplex PCR assay targeting Moko and IIB-4NPB variant strains was developed, and its performance was assessed using an extensive collection of 111 strains representing the known diversity of Rs Moko-related strains and IIB-4NPB variant strains along with certain related strains and families. The proposed diagnostic protocol demonstrated both high accuracy (inclusivity and exclusivity and high repeatability, detected targets on either pure culture or spiked plant extracts. Although they did not belong to the Moko clusters described at the time of the study, recently discovered banana-infecting strains from Brazil were also detected. According to our comprehensive evaluation, this duplex PCR assay appears suitable for both research and diagnostic laboratories and provides reliable detection of phylotype II Rs strains that infect Musaceae.

  13. Phyto-assisted synthesis of bio-functionalised silver nanoparticles and their potential anti-oxidant, anti-microbial and wound healing activities.

    Science.gov (United States)

    Mohanta, Yugal Kishore; Biswas, Kunal; Panda, Sujogya Kumar; Bandyopadhyay, Jaya; De, Debashis; Jayabalan, Rasu; Bastia, Akshaya Kumar; Mohanta, Tapan Kumar

    2017-12-01

    Bio- synthesis of silver nanoparticles (AgNPs) was made by using the aqueous leaf extract of Ardisia solanacea. Rapid formation of AgNPs was observed from silver nitrate upon treatment with the aqueous extract of A. solanacea leaf. The formation and stability of the AgNPs in the colloidal solution were monitored by UV-visible spectrophotometer. The mean particle diameter of AgNPs was calculated from the DLS with an average size ∼4 nm and ∼65 nm. ATR-FTIR spectroscopy confirmed the presence of alcohols, aldehydes, flavonoids, phenols and nitro compounds in the leaf which act as the stabilizing agent. Antimicrobial activity of the synthesized AgNPs was performed using agar well diffusion and broth dilution method against the Gram-positive and Gram-negative bacteria. Further, robust anti-oxidative potential was evaluated by DPPH assay. The highest antimicrobial activity of synthesized AgNPs was found against Pseudomonas aeruginosa (28.2 ± 0.52 mm) whereas moderate activity was found against Bacillus subtilis (16.1 ± 0.76), Candida kruseii (13.0 ± 1.0), and Trichophyton mentagrophytes (12.6 ± 1.52). Moreover, the potential wound healing activity was observed against the BJ-5Ta normal fibroblast cell line. Current research revealed that A. solanacea was found to be a suitable source for the green synthesis of silver nanoparticles.

  14. The Physalis peruviana leaf transcriptome: assembly, annotation and gene model prediction

    Directory of Open Access Journals (Sweden)

    Garzón-Martínez Gina A

    2012-04-01

    Full Text Available Abstract Background Physalis peruviana commonly known as Cape gooseberry is a member of the Solanaceae family that has an increasing popularity due to its nutritional and medicinal values. A broad range of genomic tools is available for other Solanaceae, including tomato and potato. However, limited genomic resources are currently available for Cape gooseberry. Results We report the generation of a total of 652,614 P. peruviana Expressed Sequence Tags (ESTs, using 454 GS FLX Titanium technology. ESTs, with an average length of 371 bp, were obtained from a normalized leaf cDNA library prepared using a Colombian commercial variety. De novo assembling was performed to generate a collection of 24,014 isotigs and 110,921 singletons, with an average length of 1,638 bp and 354 bp, respectively. Functional annotation was performed using NCBI’s BLAST tools and Blast2GO, which identified putative functions for 21,191 assembled sequences, including gene families involved in all the major biological processes and molecular functions as well as defense response and amino acid metabolism pathways. Gene model predictions in P. peruviana were obtained by using the genomes of Solanum lycopersicum (tomato and Solanum tuberosum (potato. We predict 9,436 P. peruviana sequences with multiple-exon models and conserved intron positions with respect to the potato and tomato genomes. Additionally, to study species diversity we developed 5,971 SSR markers from assembled ESTs. Conclusions We present the first comprehensive analysis of the Physalis peruviana leaf transcriptome, which will provide valuable resources for development of genetic tools in the species. Assembled transcripts with gene models could serve as potential candidates for marker discovery with a variety of applications including: functional diversity, conservation and improvement to increase productivity and fruit quality. P. peruviana was estimated to be phylogenetically branched out before the

  15. The Physalis peruviana leaf transcriptome: assembly, annotation and gene model prediction.

    Science.gov (United States)

    Garzón-Martínez, Gina A; Zhu, Z Iris; Landsman, David; Barrero, Luz S; Mariño-Ramírez, Leonardo

    2012-04-25

    Physalis peruviana commonly known as Cape gooseberry is a member of the Solanaceae family that has an increasing popularity due to its nutritional and medicinal values. A broad range of genomic tools is available for other Solanaceae, including tomato and potato. However, limited genomic resources are currently available for Cape gooseberry. We report the generation of a total of 652,614 P. peruviana Expressed Sequence Tags (ESTs), using 454 GS FLX Titanium technology. ESTs, with an average length of 371 bp, were obtained from a normalized leaf cDNA library prepared using a Colombian commercial variety. De novo assembling was performed to generate a collection of 24,014 isotigs and 110,921 singletons, with an average length of 1,638 bp and 354 bp, respectively. Functional annotation was performed using NCBI's BLAST tools and Blast2GO, which identified putative functions for 21,191 assembled sequences, including gene families involved in all the major biological processes and molecular functions as well as defense response and amino acid metabolism pathways. Gene model predictions in P. peruviana were obtained by using the genomes of Solanum lycopersicum (tomato) and Solanum tuberosum (potato). We predict 9,436 P. peruviana sequences with multiple-exon models and conserved intron positions with respect to the potato and tomato genomes. Additionally, to study species diversity we developed 5,971 SSR markers from assembled ESTs. We present the first comprehensive analysis of the Physalis peruviana leaf transcriptome, which will provide valuable resources for development of genetic tools in the species. Assembled transcripts with gene models could serve as potential candidates for marker discovery with a variety of applications including: functional diversity, conservation and improvement to increase productivity and fruit quality. P. peruviana was estimated to be phylogenetically branched out before the divergence of five other Solanaceae family members, S

  16. Management of Parkinson's disease in Ayurveda: Medicinal plants and adjuvant measures.

    Science.gov (United States)

    Pathak-Gandhi, Namyata; Vaidya, Ashok D B

    2017-02-02

    Medicinal plants like Mucuna pruriens L.(DC) and Withania somnifera L.(Dunal) have been used in traditional Ayurvedic medicine to manage neurodegenerative diseases like Parkinson's disease. The aim of this review is to share the role of Ayurveda's insights, traditional usage and contemporary investigations for translational, integrative applications to manage Idiopathic Parkinson's Disease. High impact journals for Parkinson's diseases, traditional textbooks from Ayurveda as well as relevant clinical and para clinical studies with botanicals are selectively incorporated to evolve the aforesaid translational application. . A. Parkinson's disease (PD) is a complex multi-system, neurodegenerative disease. Though predominantly perceived as a motor disease, it also has debilitating non- motor features, which are frequently missed and not treated. Major treatment goals are to increase striatal dopamine levels with precursor-substitution and/or reduce its breakdown. As the disease progresses, a steady increase in the dose of levodopa is inevitable. However, higher doses cause motor complications of dyskinesia and dystonia and compromise medical treatment. B. ROLE OF MUCUNA PRURIENS L.DC), THE MOST PROMISING BOTANICAL FROM AYURVEDA: Ayurveda offers a natural source of levodopa - the seeds of Mucuna pruriens L.(DC)- which have a long standing safe use in the condition. Its clinical studies have shown pharmacokinetic profile distinct from synthetic levodopa, which is likely to reduce the untoward motor complications. Additionally, its seed extracts have shown neuroprotective benefits which are unrelated to levodopa. C. AYURVEDIC REGIMENS AND MEDICINAL PLANTS FOR NEUROPROTECTIVE AND SYMPTOMATIC BENEFITS: Other regimens (Panchakarma) and medicinal plants used in Ayurveda have been subjected to exploratory studies with promising early results in the condition. The debilitating non motor symptoms in patients have shown response with one of the regimens - medicated oil enema

  17. Detection of herbaceous-plant pararetrovirus in lichen herbarium samples.

    Science.gov (United States)

    Petrzik, K; Koloniuk, I; Sarkisová, T; Číhal, L

    2016-06-01

    Cauliflower mosaic virus (CaMV) - a plant pararetrovirus that naturally causes diseases in Brassicaceae and Solanaceae plant hosts worldwide - has been detected by PCR for the first time in herbarium samples of Usnea sp. lichens. The virus's presence in these lichens did not result in any micro- or macromorphological changes, and the herbarium records were classified as representative for the distinct species. Sequence analyses classified all the detected viruses into one lineage of CaMV isolates. We have shown here that herbarium samples could be a good source for virus study, especially where a longer time span is involved.

  18. CARACTERÍSTICAS MORFOLÓGICAS Y DE CONCENTRACIÓN DE CAPSAICINA EN CINCO ESPECIES NATIVAS DEL GÉNERO Capsicum CULTIVADAS EN ECUADOR

    OpenAIRE

    Yánez, Patricio; Balseca, Diana; Rivadeneira, Lorena; Larenas, Christian

    2015-01-01

    Los recursos genéticos del género Capsicum (ajíes), familia: (Solanaceae), son importantes por ser fuente natural de Capsaicina. Los reportes sobre esta característica en los ajíes nativos de Ecuador son escasos. En el presente estudio se analizaron variables morfológicas de plantas, frutos y semillas de cinco especies de este género: C. baccatum, C. chinense, C. pubescens, C. annuum y C. frutescens, procedentes de las provincias de Loja, Santo Domingo de los Tsáchilas, Esmeraldas, L...

  19. Compositional and toxicological analysis of a GM potato line with reduced α-solanine content – A 90-day feeding study in the Syrian Golden hamster

    DEFF Research Database (Denmark)

    Langkilde, Søren; Schrøder, Malene; Frank, Thomas

    2012-01-01

    Steroidal glycoalkaloids (GAs) are toxins, produced by plants of the Solanaceae family. The potato plant (Solanum tuberosum L.) and its tubers predominantly contain the two GAs α-chaconine and α-solanine. These compounds are believed to act in synergy, and the degree of toxicity may therefore...... for compositional similarity by analysing for a range of potato constituents, and (2) used in a 90-day feeding trial with the Syrian Golden hamster to study differential toxicity. The animal feeding study used diets with up to 60% freeze-dried potato powder from either line. Whilst data indicated some compositional...... concerns with regard to human (or animal) consumption....

  20. Söke Ovasında (Aydın) yeni bir kültür bitkisi: Yer Kirazı/Altın Çilek (Physalis peruviana)

    OpenAIRE

    Özdemir, Yasemin; Günal, Nurten

    2018-01-01

    Cape gooseberry (Physalis peruviana) is an economically valuable species of Physalis in the family of Solanaceae. Native to the tropical South America, Cape Gooseberry then spread to tropical, subtropical, and sometimes mild climate zones. Physalis peruviana is a plant that highly needs heat, sun light and moisture, and that does not withstand low temperature and strong winds. It is not so much selective in terms of soil.Cape Gooseberry/Golden Strawberry was first grown in the town Bağarası i...

  1. N-trans-feruloyltyramine and flavonol glycosides from the leaves of Solanum sordidum

    Directory of Open Access Journals (Sweden)

    Regina Mikie Kanada

    2012-03-01

    Full Text Available Chemical investigation of the leaves of Solanum sordidum Sendtn., Solanaceae, resulted in the isolation and identification of sitosterol, stigmasterol, 3β-O-β-glycopyranosyl stigmasterol, 3β-O-β-glycopyranosyl sitosterol, kaempferol-3-O-α-rhamnopyranosyl-(1-6-α-glycopyranoside, rutin, and N-trans-feruloyltyramine. The structures of these compounds were established by analysis of 1D and 2D NMR spectrometric data and comparison with data in the literature. The evaluation of antioxidant activity showed an IC50 of 159.5 ppm for the chloroformic fraction and IC50 of 77.5 ppm for the hydromethanolic fraction.

  2. A new kaempferol diglycoside from Datura suaveolens Humb. & Bonpl. ex. Willd.

    Science.gov (United States)

    Sajeli Begum, A; Sahai, Mahendra; Fujimoto, Yoshinori; Asai, K; Schneider, Kathrin; Nicholson, Graeme; Suessmuth, Roderich

    2006-11-01

    A new flavonol glycoside, kaempferol 3-O-alpha-L-arabinopyranosyl-7-O-beta-D-glucopyranoside (1), has been isolated from methanol extract of leaves of Datura suaveolens (Solanaceae), along with six other known compounds, which include kaempferol 3-O-alpha-L-arabinopyranoside (2), 3-phenyl lactic acid, 3-(3-indolyl) lactic acid, and its methyl ester, physalindicanol A and physalindicanol B. The structural elucidation of 1 and characterization of the known compounds are based on detailed spectral analysis (ESI-FTICR-MS and 2D-NMR). This is the first report of isolation of these compounds from this plant.

  3. N-trans-feruloyltyramine and flavonol glycosides from the leaves of Solanum sordidum

    Directory of Open Access Journals (Sweden)

    Regina Mikie Kanada

    2012-06-01

    Full Text Available Chemical investigation of the leaves of Solanum sordidum Sendtn., Solanaceae, resulted in the isolation and identification of sitosterol, stigmasterol, 3β-O-β-glycopyranosyl stigmasterol, 3β-O-β-glycopyranosyl sitosterol, kaempferol-3-O-α-rhamnopyranosyl-(1-6-α-glycopyranoside, rutin, and N-trans-feruloyltyramine. The structures of these compounds were established by analysis of 1D and 2D NMR spectrometric data and comparison with data in the literature. The evaluation of antioxidant activity showed an IC50 of 159.5 ppm for the chloroformic fraction and IC50 of 77.5 ppm for the hydromethanolic fraction.

  4. Aproximación proteómica al estudio de la respuesta diferencial del metabolismo energético al estrés por bajas temperaturas en tomate y pimiento

    OpenAIRE

    Sánchez-Bel, Paloma; Egea, Isabel; Sánchez Ballesta, M. Teresa; Sevillano, Laura; Martínez Madrid, María Concepción; Romojaro Almela, Félix Ramón; Bolarín, María C.; Flores, Francisco B.

    2012-01-01

    Tomate (Solanum lycopersicum) y pimiento (Capsicum annuum), son dos especies hortofrutícolas pertenecientes a la familia Solanaceae susceptibles a sufrir daños por frío cuando se almacenan a bajas temperaturas, lo que afecta seriamente a la calidad de los frutos, siendo causa de importantes pérdidas económicas en el sector agro-alimentario. Una de las principales respuestas celulares al estrés por bajas temperaturas consiste en el mantenimiento de la homeostasis osmótica por la acumulación de...

  5. A Study of Selected Isozymes in Capsicum baccatum, Capsicum eximium, Capsicum cardenasii and Two Interspecific F1 Hybrids in Capsicum Species

    OpenAIRE

    ONUS, Ahmet Naci

    2014-01-01

    Selected isozymes were investigated in plants of Capsicum baccatum L. ( Solanaceae) accessions SA219 (P.G.Smith), Hawkes 6489 (P.G.Smith), Capsicum cardenasii Heiser and Smith accession SA268 (P.G.Smith), Capsicum eximium A.T.Hunz accession Hawkes 3860 (J.G.Hawkes) and two interspecific F1 hybrids, C. baccatum SA219 x C. eximium Hawkes 3860 and C. baccatum Hawkes 6489 x C. cardenasii SA 268. The standard technique of horizontal gel electrophoresis was employed. The gel was cut into severa...

  6. Efeitos dos frutos da Solanum lycocarpum St. Hil. em ratas prenhes e sua prole durante a gestação e início da lactação: alterações na esfera reprodutiva e na atividade dos sistemas monoaminérgicos centrais

    OpenAIRE

    Aline Schwarz

    2005-01-01

    A Solanum lycocarpum St. Hil (Solanaceae) é uma planta nativa do cerrado brasileiro, cujos frutos possuem os glicoalcalóides esteroidais solasonina e solamargina. É possível que a ingestão de frutos que contenham esses glicoalcalóides possam interferir no equilíbrio do sistema endócrino. O presente estudo foi realizado com o objetivo de avaliar os possíveis efeitos tóxicos provenientes da ingestão diária de frutos verdes da S. lycocarpum (10% na ração) por ratas prenhes, a partir do 6° dia da...

  7. Morfologia externa de Thyridia psidii cetoides (Rosenberg & Talbot. I. Cabeça e apêndices (Lepidoptera, Nymphalidae, Ithomiinae External morphology of Thyridia psidii cetoides (Rosenberg & Talbot. I. Cabeça e apêndices (Lepidoptera, Nymphalidae, Ithomiinae

    Directory of Open Access Journals (Sweden)

    Jorge Manuel Saraiva Bizarro

    2003-06-01

    Full Text Available A detailed study of the morphology of the head of Thyridia psidii cetoides (Rosenberg & Talbot, 1914 (Nymphalidae, Ithomiinae adults from both sexes is presented. The material was obtained at the city's plant nursery "Horto Florestal de Curitiba", Paraná, Brazil; mainly by rearing eggs and larvae collected there on Cyphomandra betacea (Canavilles Sendtner, 1845 (Solanaceae. When possible, all the results obtained were compared with those already available in the literature concerning external morphology studies pertinent to other Nymphalidae subfamilies (Brassolinae, Morphinae and Danainae.

  8. Cullin1-P is an Essential Component of Non-Self Recognition System in Self-Incompatibility in Petunia.

    Science.gov (United States)

    Kubo, Ken-Ichi; Tsukahara, Mai; Fujii, Sota; Murase, Kohji; Wada, Yuko; Entani, Tetsuyuki; Iwano, Megumi; Takayama, Seiji

    2016-11-01

    Self-incompatibility (SI) in flowering plants is a genetic reproductive barrier to distinguish self- and non-self pollen to promote outbreeding. In Solanaceae, self-pollen is rejected by the ribonucleases expressed in the styles (S-RNases), via its cytotoxic function. On the other side, the male-determinant is the S-locus F-box proteins (SLFs) expressed in pollen. Multiple SLFs collaboratively detoxify non-self S-RNases, therefore, non-self recognition is the mode of self-/non-self discrimination in Solanaceae. It is considered that SLFs function as a substrate-recognition module of the Skp1-Cullin1-F-box (SCF) complex that inactivates non-self S-RNases via their polyubiquitination, which leads to degradation by 26S proteasome. In fact, PhSSK1 (Petunia hybrida SLF-interacting Skp1-like1) was identified as a specific component of SCF SLF and was shown to be essential for detoxification of S-RNase in Petunia However, different molecules are proposed as the candidate Cullin1, another component of SCF SLF , and there is as yet no definite conclusion. Here, we identified five Cullin1s from the expressed sequence tags (ESTs) derived from the male reproductive organ in Petunia Among them, only PhCUL1-P was co-immunoprecipitated with S 7 -SLF2. In vitro protein-binding assay suggested that PhSSK1 specifically forms a complex with PhCUL1-P in an SLF-dependent manner. Knockdown of PhCUL1-P suppressed fertility of transgenic pollen in cross-compatible pollination in the functional S-RNase-dependent manner. These results suggested that SCF SLF selectively uses PhCUL1-P. Phylogeny of Cullin1s indicates that CUL1-P is recruited into the SI machinery during the evolution of Solanaceae, suggesting that the SI components have evolved differently among species in Solanaceae and Rosaceae, despite both families sharing the S-RNase-based SI. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For

  9. Structure and histochemistry of medicinal species of Solanum

    Directory of Open Access Journals (Sweden)

    Laudineia J. Matias

    Full Text Available ABSTRACT Studies on native medicinal plants strengthen initiatives to preserve the environments where those species naturally occur, many of them already strongly menaced even before their potential to humankind is known. Root and stem barks, leaves, and pericarps samples of Solanum agrarium Sendtn., S. lycocarpum A. St.-Hil., S. palinacanthum Dunal, S. paniculatum L., and S. stipulaceum Roem. & Schult., species that occur in the Cerrado (Brazililan savanna were processed according to common light microscopy techniques for structural analysis, and histochemical tests were performed to locate and identify classes of chemical compounds. The distinctive features identified were low concentration of crystal sand in the root and stem, presence of terpene resin in the root, and absence of hypodermis in the leaf, in S. agrarium; bright spots (group of sclereids in the root, isobilateral mesophyll, thickened cell walls with hemicelluloses and strong aroma in the fruit, in S. lycocarpum; high concentration of crystal sand in the root and stem, oval-shaped limb, presence of isolated crystals in the exocarp, in S. palinacanthum; strong sclerification and rays with great height in the root and stem, in S. paniculatum; and accumulation of soluble protein in the root and stem, presence of conspicuous membranaceous stipules, absence of spiniform trichomes, in S. stipulaceum. This work identifies distinctive structural features, its ecological importance, and determines the distribution of secondary compounds associated with the medicinal properties reported for these species and contributes to the conservation of the natural environments where they occur.

  10. Agro-transformation and evaluation of resistance to Phytophthora infestansin Solanum tuberosumL. variety Désirée

    Directory of Open Access Journals (Sweden)

    Jeanette Orbegozo

    2014-03-01

    Full Text Available The Oomycete Phytophthora infestans (Mont. de Bary, the causal agent of the disease known as late blight, is primarily responsible for the decreased in production performance and potato crops worldwide. The integration of the complete Rgenes sequences in the potato genome using Agro-transformation appears an alternative to be considered in the fight against this pathogen. The Rpi-blb2 gene (Rgene from the wild species Solanum bulbocastanumDunal shows a broad resistance to isolates ofP. infestans,making it an important candidate for plant breeding studies. This paper reports the integration of the Rpi-blb2gene into potato var. Désirée genome by Agrobacterium tumefaciens- mediated transformation system, the molecular characterization of 29 events transformed and whole plant infection with isolate POX67 of P. infestansfrom Peru. Désirée events [Rpi-blb2] 4 and Désirée [Rpi-blb2] 30, showed a substantial resistance to P. infestansinfection confirming complete transfer of the Rpi-blb2gene from a wild species to a cultivated species by genetic transformation.

  11. OVERCOMING SEED DORMANCY IN Annona macroprophyllata AND Annona purpureaUSING PLANT GROWTH REGULATORS

    Directory of Open Access Journals (Sweden)

    GISELA FERREIRA

    Full Text Available ABSTRACT Some Annonaceae seeds are known to exhibit dormancy mechanisms ranging from possible seed coat impermeability to physiological dormancy. Thus, the aim of this study was to evaluate the effects of gibberellin (GA GA3 and GA4+7 + benzyladenine (GA4+7 + BA application in seeds of Annona macroprophyllata Donn. Sm (papausa and Annona purpurea Moc. & Sessé ex Dunal (chincuya. The experiment was performed by the application of GA3 and GA4+7 + BA on seeds in concentrations of 0, 200, 400, 500, 600, 800 and 1000 mg L-1. The regulators broke the dormancy of both species. However, application of the GA4+7 + BA mixture had more significant results, with greater increases in germination in A. macroprophyllata than in A. purpurea. Treatments that promoted the highest germinations were GA4+7 + BA at a concentration of 200 mg L-1 for A. macroprophyllata (77% and 200 mg L-1 of GA4+7 + BA and 500 mg L-1 of GA3 for A. purpurea (30% and 29%, respectively. Rate index, mean time and frequency of germination were distinct for both species and both treatments. Although both GA3 and GA4+7 + BA promote germination, the GA4+7 + BA mixture was more effective than GA3 to overcoming seed dormancy of both species, A. purpurea has a harder dormancy than A. macroprophyllata

  12. Anomalous needle numbers on dwarf shoots of Pinus mugo and P. uncinata (Pinaceae

    Directory of Open Access Journals (Sweden)

    Krystyna Boratyńska

    2011-01-01

    Full Text Available The frequency of occurrence of abnormal, three- (or more needle dwarf shoots of most southern and central European two-needle pine (Pinus species were studied. No specimens with more than two-needle dwarf shoots were found in a population of P. nigra Arnold subsp. salzmannii (Dunal Franco from the Iberian Peninsula and in two populations of P. uliginosa Neumann from the Sudeten Mountains in Central Europe. Single specimens were found within one population of P. pinaster Aiton from the Iberian Peninsula and among six populations of P. sylvestris L. from the Iberian Peninsula and Central Europe. Abnormal dwarf shoots mostly with three, but also four, five or six needles were found among 24 of 25 surveyed populations of P. mugo Turra and P. uncinata Ramond. The average frequency of specimens with at least one three-needle dwarf shoot was 24% for P. mugo and 20% for P. uncinata. The frequencies of occurrence varied significantly among studied populations and were highest in samples collected from the upper elevational range limits of the species in the mountains and near the northern limits of their ranges. The frequency of abnormal dwarf shoots in the same populations was significantly high in 2-3 consecutive years. Needles from three-needle dwarf shoots were not significantly shorter than those of two-needle shoots.

  13. Genetic relatedness among Solanum L. species assayed by seed morphology and isozyme markers

    International Nuclear Information System (INIS)

    Ahmed, S.M.; Fadl, M.A.

    2016-01-01

    In spite of their economic and medicinal value, no adequate attention has been paid to the diversity, characterization and taxonomical identification of Solanum L. species in Saudi Arabia. In this study, Scanning Electron Microscopy (SEM) of seed coat morphology and isozyme electrophoresis were employed for studying the genetic variability and relationships among seven Solanum L. species namely; S. incanum L., S. nigrum L., S. villosum L., S. schemprianum Hochst, S. galabratum Dunal, S. lycopersicum L. and S. melongena L. collected from Taif highlands. Scanning Electron Microscope (SEM) investigation of seed coat sculpturing showed three basic patterns namely; rugulate, reticulate and levigate. The analyses on six enzymes were coded by 19 loci. The number of alleles ranged from one to three with a mean of 1.58 alleles per locus. The proportion of polymorphic loci for Solanum L. species ranged from 0.87 for S. nigrum L. and S. villosum L. to 0.80 for S. lycopersicum L. The mean observed heterozygosity varied from 0.00 to 1.00, while mean expected heterozygosity ranged between 0.00 and 0.5. The UPGMA phenogram confirmed the extensive genetic diversity existed in the studied Solanum L. species and showed the close relationship between S. incanum L. and S. melongena L. (author)

  14. Anti-Androgenic Activity of Nardostachys jatamansi DC and Tribulus terrestris L. and Their Beneficial Effects on Polycystic Ovary Syndrome-Induced Rat Models.

    Science.gov (United States)

    Sandeep, Palakkil Mavilavalappil; Bovee, Toine F H; Sreejith, Krishnan

    2015-08-01

    Polycystic ovary syndrome (PCOS) is a major hyperandrogenic disorder. Many drugs prescribed specifically to treat PCOS have side effects; however, previous studies suggest that natural therapeutics including botanicals may be less invasive and equally effective for the management of PCOS. In the present study, plants were screened for antiandrogenic activity using the RIKILT yeast Androgen bioAssay (RAA). Selected positive plants were subsequently tested for their efficacy against PCOS induced by estradiol valerate (EV) in rat models. RAA revealed the antiandrogenic property of Nardostachys jatamansi DC (NJ), Tribulus terrestris L. (TT), and Embelia tsjeriam-cottam DC (EJ), whereas Whithania somnifera Dunal (WS), Symplocos racemosa Roxb. (SR), and Helicteres isora L. (HI) exhibited androgenic properties. EJ also exhibited mild androgenic activity and therefore was excluded from further study. EV administration reduced the weight gain and disrupted cyclicity in all rats. NJ and TT extract treatment normalized estrous cyclicity and steroidal hormonal levels and regularized ovarian follicular growth. The in vitro antiandrogenic activity of plant extracts and their positive effects on different parameters of PCOS were proved in vivo.

  15. Application of Ethnobotanical Indices on the Use of Traditional Medicines against Common Diseases

    Directory of Open Access Journals (Sweden)

    Imran Khan

    2014-01-01

    Full Text Available The present study was aimed at documenting the detailed ethnomedicinal knowledge of an unexplored area of Pakistan. Semistructured interviews were taken with 55 informants randomly chosen regarding detailed ethnomedicinal and sociocultural information. The study exposed 67 medicinal plant species used to prepare 110 recipes and the major modes of herbal formulation were decoction and powdering (20% each. The disease categories with the highest Fic values were gastrointestinal and dermatological (0.87 each. The study determined 3 plant species, i.e., Acacia modesta Wall., Caralluma tuberculata R.Br., and Withania somnifera (L. Dunal with a FL of 100%. DMR results showed that Olea ferruginea (Sol. Steud. ranked first, Morus alba L. ranked second, and Melia azedarach L. ranked third. Among the 55 informants, the male concentration was high (61% and most of them were over 40 years old while a leading quantity of respondents (45% was uneducated. There is a dire need to take necessary steps for the conservation of important medicinal plants by inhibiting overgrazing and providing alternate fuel resources. Young generations should be educated regarding the importance of ethnomedicinal knowledge and plants with high Fic and FL values should be further checked chemically and pharmacologically for future exploration of modern medicine.

  16. Sterol partitioning by HMGR and DXR for routing intermediates toward withanolide biosynthesis.

    Science.gov (United States)

    Singh, Shefali; Pal, Shaifali; Shanker, Karuna; Chanotiya, Chandan Singh; Gupta, Madan Mohan; Dwivedi, Upendra Nath; Shasany, Ajit Kumar

    2014-12-01

    Withanolides biosynthesis in the plant Withania somnifera (L.) Dunal is hypothesized to be diverged from sterol pathway at the level of 24-methylene cholesterol. The conversion and translocation of intermediates for sterols and withanolides are yet to be characterized in this plant. To understand the influence of mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways on sterols and withanolides biosynthesis in planta, we overexpressed the WsHMGR2 and WsDXR2 in tobacco, analyzed the effect of transient suppression through RNAi, inhibited MVA and MEP pathways and fed the leaf tissue with different sterols. Overexpression of WsHMGR2 increased cycloartenol, sitosterol, stigmasterol and campesterol compared to WsDXR2 transgene lines. Increase in cholesterol was, however, marginally higher in WsDXR2 transgenic lines. This was further validated through transient suppression analysis, and pathway inhibition where cholesterol reduction was found higher due to WsDXR2 suppression and all other sterols were affected predominantly by WsHMGR2 suppression in leaf. The transcript abundance and enzyme analysis data also correlate with sterol accumulation. Cholesterol feeding did not increase the withanolide content compared to cycloartenol, sitosterol, stigmasterol and campesterol. Hence, a preferential translocation of carbon from MVA and MEP pathways was found differentiating the sterols types. Overall results suggested that MVA pathway was predominant in contributing intermediates for withanolides synthesis mainly through the campesterol/stigmasterol route in planta. © 2014 Scandinavian Plant Physiology Society.

  17. Botanicals as Modulators of Neuroplasticity: Focus on BDNF

    Directory of Open Access Journals (Sweden)

    Enrico Sangiovanni

    2017-01-01

    Full Text Available The involvement of brain-derived neurotrophic factor (BDNF in different central nervous system (CNS diseases suggests that this neurotrophin may represent an interesting and reliable therapeutic target. Accordingly, the search for new compounds, also from natural sources, able to modulate BDNF has been increasingly explored. The present review considers the literature on the effects of botanicals on BDNF. Botanicals considered were Bacopa monnieri (L. Pennell, Coffea arabica L., Crocus sativus L., Eleutherococcus senticosus Maxim., Camellia sinensis (L. Kuntze (green tea, Ginkgo biloba L., Hypericum perforatum L., Olea europaea L. (olive oil, Panax ginseng C.A. Meyer, Rhodiola rosea L., Salvia miltiorrhiza Bunge, Vitis vinifera L., Withania somnifera (L. Dunal, and Perilla frutescens (L. Britton. The effect of the active principles responsible for the efficacy of the extracts is reviewed and discussed as well. The high number of articles published (more than one hundred manuscripts for 14 botanicals supports the growing interest in the use of natural products as BDNF modulators. The studies reported strengthen the hypothesis that botanicals may be considered useful modulators of BDNF in CNS diseases, without high side effects. Further clinical studies are mandatory to confirm botanicals as preventive agents or as useful adjuvant to the pharmacological treatment.

  18. Assessment of bio-activities of the crude extract and components of Withania somnifera leaves by bioinformatics

    Directory of Open Access Journals (Sweden)

    Nashi widodo

    2010-10-01

    Full Text Available Traditional herbal medicines are now increasingly being appreciated with Western models of integrative health sciences and evidence-based approach both in the basic research and clinic scenario. Ashwagandha is a commonly used plant in Ayurvedic, Indian traditional medicine. Medicinal value of Ashwagandha (WithaniasomniferaDunal extends from anti-inflammatory, anti-arthritic, anti-rheumatic, rejuvenation and anti-cancer. Based on the belief that holistic multi-site mechanism of action offers greater chance of success, the traditional Ayurvedicmedicine practices the use of whole herb or its crude extract. It opposes with the mainstream of pharmaceutical industry that uses single and purified molecules. In the present study, we used bioinformatics approach to reveal the mechanism of action of (i crude extract of Ashwagandha leaf extract and its purified components, (ii Withanone and (iii Withaferin A. Whereas p53-p21 was identified as a common signaling pathway for the three kinds of reagents, specific signaling pathways for Withaferin-A and Withanone were identified. Whereas the crude extract and Withanone were selectively toxic to human cancer cells, WithaferinA showed cytotoxicity to the normal cells too. The study suggested that the crude extract or a combinational formulamay be a superior and safenatural reagent for cancer treatment.

  19. Evaluation of the potential cardioprotective activity of some Saudi plants against doxorubicin toxicity.

    Science.gov (United States)

    Ashour, Osama M; Abdel-Naim, Ashraf B; Abdallah, Hossam M; Nagy, Ayman A; Mohamadin, Ahmed M; Abdel-Sattar, Essam A

    2012-01-01

    Doxorubicin (DOX) is an anthracycline antibiotic widely used as a chemotherapeutic agent in the treatment of several tumours. However, its cardiac toxicity limits its use at maximum therapeutic doses. Most studies implicated increased oxidative stress as the major determinant of DOX cardiotoxicity. The local Saudi flora is very rich in a variety of plants of quite known folkloric or traditional medicinal uses. Tribulus macropterus Boiss., Olea europaea L. subsp. africana (Mill.) P. S. Green, Tamarix aphylla (L.) H. Karst., Cynomorium coccineum L., Cordia myxa L., Calligonum comosum L' Hér, and Withania somnifera (L.) Dunal are Saudi plants known to have antioxidant activities. The aim of the current study was to explore the potential protective effects of methanolic extracts of these seven Saudi plants against DOX-induced cardiotoxicity in rats. Two plants showed promising cardioprotective potential in the order Calligonum comosum > Cordia myxa. The two plant extracts showed potent in vitro radical scavenging and antioxidant properties. They significantly protected against DOX-induced alterations in cardiac oxidative stress markers (GSH and MDA) and cardiac serum markers (CK-MB and LDH activities). Additionally, histopathological examination indicated a protection against DOX-induced cardiotoxicity. In conclusion, C. comosum and C. myxa exerted protective activity against DOX-induced cardiotoxicity, which is, at least partly, due to their antioxidant effect.

  20. The local knowledge of food plants used by Karo ethnic in Semangat Gunung Village, North Sumatra, Indonesia

    Science.gov (United States)

    Nisyawati, Aini, R. N.; Silalahi, M.; Purba, E. C.; Avifah, N.

    2017-07-01

    Research on the local knowledge of food plants used by Karo ethnic in the Semangat Gunung Village, North Sumatra has been done. The aim of this study is to reveal plant species that used by the people of Karo ethnic as food. We used the ethnobotanical approach which included open-ended, semi-structural interview, and exploration method. One eldervillage, 2 traditional healers, and 30 respondents have been selected as sources of information. Descriptive statistics have been used to analyze the gathered data. A number of 109 species which belong to 83 genus and 45 families known to be used as food sources by Karo people. Four families have the highest number of food plant species, which are Solanaceae (8 species), Poaceae (7 species), Fabaceae (6 species), and Zingiberaceae (6 species). All of those families are found in the village, both wild and Cultivated. Solanaceae is used as source of fruits, vegetables, and spices. Poaceae is used as the source of the staple food, alternative food sources, snacks, spices, and traditional foods. Fabaceae is used as source of vegetables and traditional foods. Zingiberaceae is used as source of spices.

  1. S-allele diversity in Sorbus aucuparia and Crataegus monogyna (Rosaceae: Maloideae).

    Science.gov (United States)

    Raspé, O; Kohn, J R

    2002-06-01

    RT-PCR was used to obtain the first estimates from natural populations of allelic diversity at the RNase-based gametophytic self-incompatibility locus in the Rosaceae. A total of 20 alleles were retrieved from 20 Sorbus aucuparia individuals, whereas 17 alleles were found in 13 Crataegus monogyna samples. Estimates of population-level allele numbers fall within the range observed in the Solanaceae, the only other family with RNase-based incompatibility for which estimates are available. The nucleotide diversity of S-allele sequences was found to be much lower in the two Rosaceae species as compared with the Solanaceae. This was not due to a lower sequence divergence among most closely related alleles. Rather, it is the depth of the entire genealogy that differs markedly in the two families, with Rosaceae S-alleles exhibiting more recent apparent coalescence. We also investigated patterns of selection at the molecular level by comparing nucleotide diversity at synonymous and nonsynonymous sites. Stabilizing selection was inferred for the 5' region of the molecule, while evidence of diversifying selection was present elsewhere.

  2. Pollen-expressed F-box gene family and mechanism of S-RNase-based gametophytic self-incompatibility (GSI) in Rosaceae.

    Science.gov (United States)

    Sassa, Hidenori; Kakui, Hiroyuki; Minamikawa, Mai

    2010-03-01

    Many species of Rosaceae, Solanaceae, and Plantaginaceae exhibit S-RNase-based self-incompatibility (SI) in which pistil-part specificity is controlled by S locus-encoded ribonuclease (S-RNase). Although recent findings revealed that S locus-encoded F-box protein, SLF/SFB, determines pollen-part specificity, how these pistil- and pollen-part S locus products interact in vivo and elicit the SI reaction is largely unclear. Furthermore, genetic studies suggested that pollen S function can differ among species. In Solanaceae and the rosaceous subfamily Maloideae (e.g., apple and pear), the coexistence of two different pollen S alleles in a pollen breaks down SI of the pollen, a phenomenon known as competitive interaction. However, competitive interaction seems not to occur in the subfamily Prunoideae (e.g., cherry and almond) of Rosaceae. Furthermore, the effect of the deletion of pollen S seems to vary among taxa. This review focuses on the potential differences in pollen-part function between subfamilies of Rosaceae, Maloideae, and Prunoideae, and discusses implications for the mechanistic divergence of the S-RNase-based SI.

  3. In-vitro antimicrobial activity screening of some ethnoveterinary medicinal plants traditionally used against mastitis, wound and gastrointestinal tract complication in Tigray Region, Ethiopia.

    Science.gov (United States)

    Kalayou, Shewit; Haileselassie, Mekonnen; Gebre-Egziabher, Gebremedhin; Tiku'e, Tsegay; Sahle, Samson; Taddele, Habtamu; Ghezu, Mussie

    2012-07-01

    To screen the antibacterial activity of nine ethnoveterinary plants traditionally used for the treatment of mastitis, wound and gastrointestinal complications. Hydroalcoholic exctracts of medicinal plants namely, Achyranthes aspera (A. aspera) L. (Family Asparagaceae), Ficus caria (F. caria) (Family Moraceae), Malvi parviflora (M. parviflora) (Family Malvaceae), Vernonia species (V. species) (local name Alakit, Family Asteraceae), Solanum hastifolium (S. hastifolium) (Family Solanaceae), Calpurinia aurea (C. aurea) (Ait) Benth (Family Fabaceae), Nicotiana tabacum (N. tabacum) L. (Family Solanaceae), Ziziphus spina-christi (Z. spina-christi) (Family Rhamnaceae), Croton macrostachys (C. macrostachys) (Family Euphorbiaceae), were screened against clinical bacterial isolates of veterinary importance from October 2007 to April 2009. The antibacterial activity was tested using disc diffusion at two concentrations (200 mg/mL and 100 mg/mL) and broth dilution methods using 70% methanol macerated leaf extracts. With the exception of S. hastifolium all plant extracts exhibited antibacterial activity. Among the medicinal plants tested C. aurea, C. macrostachyus, A. aspera, N. tabacum and vernonia species (Alakit) showed the most promising antimicrobial properties. It can be concluded that many of the tested plants have antibacterial activity and supports the traditional usage of the plants for mastitis, wound and gastrointestinal complications treatment. Further studies into their toxicity and phytochemistry is advocated.

  4. Plantas invasoras da cultura do feijoeiro (Phaseolus vulgaris L. no Estado de Minas Gerais

    Directory of Open Access Journals (Sweden)

    Julio Pedro Laca-Buendia

    1989-01-01

    Full Text Available Nas áreas de cultura do feijoeiro (Phaseolus vulgaris L., no Estado de Minas Gerais, foram coletadas e identificadas 222 espécies de plantas invasoras (= plantas daninhas, pertencentes a 35 famílias botânias, representando 118 gêneros, sendo que as famílias Compositae, Leguminosae, Gramineae, Malvaceae, Convolvulaceae, Rubiaceae, Euphorbiaceae, Amaranthaceae, Cyperaceae e Solanaceae, são as mais importantes em relação à cultura. As plantas coletadas, devidamente etiquetadas e identificadas, foram anexadas no PAMG (Herbário da Empresa de Pesquisa Agropecuária de Minas Gerais, Belo Horizonte - (MG..A survey in the cultivation area of bean in the state of Minas Gerais, Brazil, resulted in the determination of 222 weeds species, of 118 genera belonging to 35 families presenting a greater number of species areas: Compositae, Leguminosae, Gramineae, Malvaceae, Convolvulaceae, Rubiaceae, Euphorbiaceae, Amaranthaceae, Cyperaceae and Solanaceae, with 33, 30, 25, 21, 12, 10. 10, 10, 9. 8 species respectively.

  5. A flórula invasora da cultura do café (Coffea arabica L. no Estado de Minas Gerais, Brasil Weeds in coffee (Coffea arabica L. plantations in the state of Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Manuel Losada Gavilanes

    1988-01-01

    Full Text Available Nas áreas de cultura de café (Coffea arábica L., no Estado de Minas Gerais, foram coletadas e identificadas 388 espécies de plantas invasoras (= plantas daninhas, pertencentes a 51 famílias botânicas, representando 182 gêneros, sendo que as famílias Compositae, Gramineae, Leguminosae, Malvaceae, Solanaceae, Euphorbiaceae, Rubiaceae, Amaranthaceae, Convolvulaceae e Verbenaceae, são as mais importantes em relação à cultura. As plantas coletadas, devidamente etiquetadas e identificadas, foram anexadas, parte delas no PAMG (Herbário da EPAMIG, Belo Horizonte, MG e, a outra parte, no Herbarium ESAL (Herbário do Departamento de Biologia da Escola Superior de Agricultura de Lavras - ESAL, Lavras - MG.A survey in the cultivation area of coffee in the State of Minas Gerais, Brazil, has resulted in the determination of 388 weed species, of 182 genera belonging to 51 families; the families presenting a greater number of espécies are: Compositae, Leguminosae, Gramineae, Malvaceae, Solanaceae, Rubiaceae, Convolvulaceae, Euphorbiaceae, Amaranthaceae and Verbenaceae with 65, 48, 42, 30, 19, 17, 16, 14, 12, 10 species, respectively.

  6. A Snapshot of the Emerging Tomato Genome Sequence

    Directory of Open Access Journals (Sweden)

    Lukas A. Mueller

    2009-03-01

    Full Text Available The genome of tomato ( L. is being sequenced by an international consortium of 10 countries (Korea, China, the United Kingdom, India, the Netherlands, France, Japan, Spain, Italy, and the United States as part of the larger “International Solanaceae Genome Project (SOL: Systems Approach to Diversity and Adaptation” initiative. The tomato genome sequencing project uses an ordered bacterial artificial chromosome (BAC approach to generate a high-quality tomato euchromatic genome sequence for use as a reference genome for the Solanaceae and euasterids. Sequence is deposited at GenBank and at the SOL Genomics Network (SGN. Currently, there are around 1000 BACs finished or in progress, representing more than a third of the projected euchromatic portion of the genome. An annotation effort is also underway by the International Tomato Annotation Group. The expected number of genes in the euchromatin is ∼40,000, based on an estimate from a preliminary annotation of 11% of finished sequence. Here, we present this first snapshot of the emerging tomato genome and its annotation, a short comparison with potato ( L. sequence data, and the tools available for the researchers to exploit this new resource are also presented. In the future, whole-genome shotgun techniques will be combined with the BAC-by-BAC approach to cover the entire tomato genome. The high-quality reference euchromatic tomato sequence is expected to be near completion by 2010.

  7. Mitochondria as a Possible Place for Initial Stages of Steroid Biosynthesis in Plants

    Directory of Open Access Journals (Sweden)

    Elena K. Shematorova

    2014-12-01

    Full Text Available With the aim of thorough comparison of steroidogenic systems of plants and animals, transgenic plants of Solanaceae family expressing CYP11A1 cDNA encoding cytochrome P450SCC of mammalian mitochondria were further analysed. Positive effect of CYP11A1 on resistance of the transgenic tobacco plants to the infection by fungal phytopathogene Botrytis cinerea was for the first time detected. Subtle changes in mitochondria of the transgenic Nicotiana tabacum plants expressing mammalian CYP11A1 cDNA were demonstrated by transmissive electron microscopy. The main components of the electron transfer chain of plant mitochondria were for the first time cloned and characterized. It was established that plants from the Solanacea family (tomato, tobacco and potato contain two different genes with similar exon-intron structures (all contain 8 exons encoding mitochondrial type ferredoxins (MFDX, and one gene for mitochondrial ferredoxin reductase (MFDXR. The results obtained point out on profound relatedness of electron transfer chains of P450-dependent monooxygenases in mammalian and plant mitochondria and support our previous findings about functional compatability of steroidogenic systems of Plantae and Animalia.

  8. Comparative analysis of pepper and tomato reveals euchromatin expansion of pepper genome caused by differential accumulation of Ty3/Gypsy-like elements

    Directory of Open Access Journals (Sweden)

    Ahn Jong Hwa

    2011-01-01

    Full Text Available Abstract Background Among the Solanaceae plants, the pepper genome is three times larger than that of tomato. Although the gene repertoire and gene order of both species are well conserved, the cause of the genome-size difference is not known. To determine the causes for the expansion of pepper euchromatic regions, we compared the pepper genome to that of tomato. Results For sequence-level analysis, we generated 35.6 Mb of pepper genomic sequences from euchromatin enriched 1,245 pepper BAC clones. The comparative analysis of orthologous gene-rich regions between both species revealed insertion of transposons exclusively in the pepper sequences, maintaining the gene order and content. The most common type of the transposon found was the LTR retrotransposon. Phylogenetic comparison of the LTR retrotransposons revealed that two groups of Ty3/Gypsy-like elements (Tat and Athila were overly accumulated in the pepper genome. The FISH analysis of the pepper Tat elements showed a random distribution in heterochromatic and euchromatic regions, whereas the tomato Tat elements showed heterochromatin-preferential accumulation. Conclusions Compared to tomato pepper euchromatin doubled its size by differential accumulation of a specific group of Ty3/Gypsy-like elements. Our results could provide an insight on the mechanism of genome evolution in the Solanaceae family.

  9. Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster.

    Science.gov (United States)

    Ventrella, Emanuela; Adamski, Zbigniew; Chudzińska, Ewa; Miądowicz-Kobielska, Mariola; Marciniak, Paweł; Büyükgüzel, Ender; Büyükgüzel, Kemal; Erdem, Meltem; Falabella, Patrizia; Scrano, Laura; Bufo, Sabino Aurelio

    2016-01-01

    Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed) generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.

  10. Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Emanuela Ventrella

    Full Text Available Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.

  11. Genome sequence of M6, a diploid inbred clone of the high-glycoalkaloid-producing tuber-bearing potato species Solanum chacoense, reveals residual heterozygosity.

    Science.gov (United States)

    Leisner, Courtney P; Hamilton, John P; Crisovan, Emily; Manrique-Carpintero, Norma C; Marand, Alexandre P; Newton, Linsey; Pham, Gina M; Jiang, Jiming; Douches, David S; Jansky, Shelley H; Buell, C Robin

    2018-05-01

    Cultivated potato (Solanum tuberosum L.) is a highly heterozygous autotetraploid that presents challenges in genome analyses and breeding. Wild potato species serve as a resource for the introgression of important agronomic traits into cultivated potato. One key species is Solanum chacoense and the diploid, inbred clone M6, which is self-compatible and has desirable tuber market quality and disease resistance traits. Sequencing and assembly of the genome of the M6 clone of S. chacoense generated an assembly of 825 767 562 bp in 8260 scaffolds with an N50 scaffold size of 713 602 bp. Pseudomolecule construction anchored 508 Mb of the genome assembly into 12 chromosomes. Genome annotation yielded 49 124 high-confidence gene models representing 37 740 genes. Comparative analyses of the M6 genome with six other Solanaceae species revealed a core set of 158 367 Solanaceae genes and 1897 genes unique to three potato species. Analysis of single nucleotide polymorphisms across the M6 genome revealed enhanced residual heterozygosity on chromosomes 4, 8 and 9 relative to the other chromosomes. Access to the M6 genome provides a resource for identification of key genes for important agronomic traits and aids in genome-enabled development of inbred diploid potatoes with the potential to accelerate potato breeding. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

  12. METABOLITOS SECUNDARIOS DE LAS FAMILIAS ANNONACEAE,

    Directory of Open Access Journals (Sweden)

    Luis Enrique Castillo

    2010-07-01

    Full Text Available Debido a los problemas que ocasionan los insecticidas sintéticos tanto en el ambiente como en la salud humana existe un resurgimiento en investigaciones sobre los extractos de origen vegetal para el control de insectos. Se presenta una revisión de literatura especializada de los trabajos publicados de los diferentes extractos vegetales obtenidos de las familias Annonaceae, Meliaceae y Solanaceae, describiendo los compuestos o mezcla de compuestos obtenidos, así como sus mecanismos de acción que presentan sobre insectos. Las especies vegetales de las tres familias presentan compuestos muy polares. La familia Meliaceae es la más estudiada, con la azadiractina como el compuesto activo más importante. Las acetogeninas, squamocin y annonacin de la familia Annonacea, son las de mayor impacto, mientras que en la familia Solanaceae son los alcaloides y glicósidos esteroidales los principios con mayor bioactividad. La actividad biológica de los metabolitos secundarios ha sido mayor cuando se prueban los extractos, que son mezclas complejas de compuestos secundarios. La mayoría de las investigaciones revisadas han sido bioensayos in vitro para la actividad insecticida, por lo que se desconoce la efectividad de los extractos en campo.

  13. Plants used in the treatment of leishmanial ulcers due to Leishmania (Viannia braziliensis in an endemic area of Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio França

    1996-06-01

    Full Text Available This paper records the plants used in the treatment of cutaneous leishmaniasis due to Leishmania (Viannia braziliensis (L(Vb among the rural population of a cocoa- producing coastal area of Bahia state, Brazil. An enquiry conducted among a hundred patients identified 49 plant species used to treat skin ulceration caused by this Leishmania species. The principal plants used are caju-branco (Anacardium occidentale - Anacardiaceae, used by 65% of the population, folha-fogo (Clidemia hirta - Melastomataceae 39%, alfavaca-grossa (Plectranthus amboinicus - Lamiaceae 33%, mastruz (Chenopodium ambrosioides - Chenopodiaceae 31%, erva-de-santa-maria (Solatium americanum - Solanaceae (25% and transagem (Plantago major - Plantaginaceae. 2%.Este trabalho relata as plantas usadas no tratamento da leishmaniose cutânea, causada por Leishmania (Viannia braziliensis (L(Vb, na população rural da faixa litorânea produtora de cacau do estado da Bahia, Brasil. Um inquérito realizado entre 100 pacientes, identificou 49 espécies de plantas usadas para tratar úlceras de pele causadas por esta espécie de Leishmânia. As principais plantas usadas foram o cajueiro-branco (Anacardium occidentale - Anacardiaceae usado por 65% da população, a folha-fogo (Clidemia hirta - Melastomataceae 39%, a alfavaca-grossa (Plectranthus amboinicus - Lamiaceae 33%, o mastruz (Chenopodium ambrosioides - henopodiaceae 31%, a erva-de-santa-maria (Solanum americanum - Solanaceae 25% e a transagem (Plantago major - Plantaginaceae 2%.

  14. Polen de las Mieles de la Patagonia Andina (Chubut-Argentina Pollen of honeys from the Andean Patagonia (Chubut-Argentina

    Directory of Open Access Journals (Sweden)

    Alicia Forcone

    2006-07-01

    Full Text Available Se describen e ilustran mediante fotomicrografías tomadas con MO y MEB, 30 tipos polínicos, determinados en las mieles producidas en la región andina de Chubut (Patagonia Argentina. Los tipos morfológicos descriptos pertenecen a las siguientes familias: Alstroemeriaceae, Apiaceae, Buddlejaceae, Caryophyllaceae, Caprifoliaceae, Celastraceae, Clusiaceae, Convolvulaceae, Ericaceae, Elaeocarpaceae, Fabaceae, Fagaceae, Lamiaceae, Papaveraceae, Polemoniaceae, Polygalaceae, Proteaceae, Ranunculaceae, Rosaceae, Saxifragaceae, Solanaceae, Thymelaceae y Verbenaceae. La mayoría de los tipos polínicos descriptos fueron hallados en las mieles como polen de menor importancia o traza con excepción de Aristotelia chilensis y Escallonia sp., que alcanzaron la categoría de polen dominante, y de Lomatia hirsuta, hallada como polen secundario.Thirty pollen types identified in the honeys from the Andean region of Chubut are described and illustrated by means of LM and SEM photomicrographs. Pollen types belong to the following families: Alstroemeriaceae, Apiaceae, Buddlejaceae, Caryophyllaceae, Caprifoliaceae, Celastraceae, Clusiaceae, Convolvulaceae, Ericaceae, Elaeocarpaceae, Fabaceae, Fagaceae, Lamiaceae, Papaveraceae, Polemoniaceae, Polygalaceae, Proteaceae, Ranunculaceae, Rosaceae, Saxifragaceae, Solanaceae, Thymelaceae, and Verbenaceae. Most pollen types described were found in the honeys as minor important pollen or traces, except Aristotelia chilensis, Escallonia sp., which reached the category of dominant pollen, and Lomatia hirsuta, which was found as secondary pollen.

  15. Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization

    Science.gov (United States)

    Qin, Cheng; Yu, Changshui; Shen, Yaou; Fang, Xiaodong; Chen, Lang; Min, Jiumeng; Cheng, Jiaowen; Zhao, Shancen; Xu, Meng; Luo, Yong; Yang, Yulan; Wu, Zhiming; Mao, Likai; Wu, Haiyang; Ling-Hu, Changying; Zhou, Huangkai; Lin, Haijian; González-Morales, Sandra; Trejo-Saavedra, Diana L.; Tian, Hao; Tang, Xin; Zhao, Maojun; Huang, Zhiyong; Zhou, Anwei; Yao, Xiaoming; Cui, Junjie; Li, Wenqi; Chen, Zhe; Feng, Yongqiang; Niu, Yongchao; Bi, Shimin; Yang, Xiuwei; Li, Weipeng; Cai, Huimin; Luo, Xirong; Montes-Hernández, Salvador; Leyva-González, Marco A.; Xiong, Zhiqiang; He, Xiujing; Bai, Lijun; Tan, Shu; Tang, Xiangqun; Liu, Dan; Liu, Jinwen; Zhang, Shangxing; Chen, Maoshan; Zhang, Lu; Zhang, Li; Zhang, Yinchao; Liao, Weiqin; Zhang, Yan; Wang, Min; Lv, Xiaodan; Wen, Bo; Liu, Hongjun; Luan, Hemi; Zhang, Yonggang; Yang, Shuang; Wang, Xiaodian; Xu, Jiaohui; Li, Xueqin; Li, Shuaicheng; Wang, Junyi; Palloix, Alain; Bosland, Paul W.; Li, Yingrui; Krogh, Anders; Rivera-Bustamante, Rafael F.; Herrera-Estrella, Luis; Yin, Ye; Yu, Jiping; Hu, Kailin; Zhang, Zhiming

    2014-01-01

    As an economic crop, pepper satisfies people’s spicy taste and has medicinal uses worldwide. To gain a better understanding of Capsicum evolution, domestication, and specialization, we present here the genome sequence of the cultivated pepper Zunla-1 (C. annuum L.) and its wild progenitor Chiltepin (C. annuum var. glabriusculum). We estimate that the pepper genome expanded ∼0.3 Mya (with respect to the genome of other Solanaceae) by a rapid amplification of retrotransposons elements, resulting in a genome comprised of ∼81% repetitive sequences. Approximately 79% of 3.48-Gb scaffolds containing 34,476 protein-coding genes were anchored to chromosomes by a high-density genetic map. Comparison of cultivated and wild pepper genomes with 20 resequencing accessions revealed molecular footprints of artificial selection, providing us with a list of candidate domestication genes. We also found that dosage compensation effect of tandem duplication genes probably contributed to the pungent diversification in pepper. The Capsicum reference genome provides crucial information for the study of not only the evolution of the pepper genome but also, the Solanaceae family, and it will facilitate the establishment of more effective pepper breeding programs. PMID:24591624

  16. Effectiveness of vegetable extracts for the control of Praticolella griseola (Pfeiffer (Gastropoda: Polygyridae

    Directory of Open Access Journals (Sweden)

    Carmen Verónica Martín Vasallo

    2017-07-01

    Full Text Available Molluscs have become a serious problem for vegetable crops, especially the species Praticolella griseola (Pfeiffer. Therefore, the objective was to evaluate the percentage of mortality of the plant extracts on P. griseola in both laboratory and field conditions. An "in vitro" assay was performed with vegetable extracts of maguey (Furcraea hexapetala (Jacq. Family: Agavaceae, spiny güirito (Solanum globiferum L., Family: Solanaceae, chili pepper (Capsicum frutescens L., Solanaceae, cardon (Euphorbia lactea Haw., Family: Euphorbiaceae. When evaluating three concentrations of the extract of each botanical species, a completely randomized design was used in "in vitro" conditions and random blocks on the field. The extraction of the chili pepper extract was carried out using the fruit baking method, the S. globiferum was obtained from the milling of the dried fruits and the F. hexapetala and E. lactea were obtained through the fragmentation of stalks. Extracts of F. hexapetala, S. globiferum, C. frutescens, E. lactea, are alternatives to be used by producers in the control of P. griseola. The highest percentages of mortality are reached with the extracts of C. frutescens and S. globiferum at 72 hours of application.

  17. Kisaran Inang dan Keragaman Gejala Infeksi Turnip Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Eliza Suryati Rusli

    2007-07-01

    Full Text Available The incidence of mosaic disease on vegetable crops in Indonesia has been reported recently. The disease is caused by TuMV which is considered as a new and important virus on caisin and turnip in Indonesia. Field survey has been conducted to determine disease incidence in vegetable growing areas. Symptom variability and host range of TuMV was further studied through mechanical inoculation to cruciferae and solanaceae plants. Observation during field survey has proved that TuMV has infected caisin and turnip in Java and Bali. The highest intensity of mosaic disease i.e. 63,3% occurs in Tumpangan-Malang, followed by Denpasar Selatan and Bandungan-Semarang with the intensity of 30,5% and 19,0% respectively. TuMV infection causes different types of symptoms, such as: wrinkled leaf, blistered leaf, vein banding, vein clearing, leaf distortion and proliferation. The host range of TuMV involves those plants belong to cruciferae (cabbage, broccoli, caisin, turnip, cauliflower, chinese cabbage, pak coy; solanaceae (N. tabacum, N. benthamiana, N. glutinosa; and chenopodiaceae (C. amaranticolor. Furthermore, N. glutinosa can be used as differential host for TuMV isolates.

  18. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  19. Subsocial Neotropical Doryphorini (Chrysomelidae, Chrysomelinae: new observations on behavior, host plants and systematics

    Directory of Open Access Journals (Sweden)

    Donald M. Windsor

    2013-09-01

    Full Text Available A summary of literature, documented observations and field studies finds evidence that mothers actively defend offspring in at least eight species and three genera of Neotropical Chrysomelinae associated with two host plant families. Reports on three Doryphora species reveal that all are oviparous and feed on vines in the Apocyanaceae. Mothers in the two subsocial species defend eggs and larvae by straddling, blocking access at the petiole and greeting potential predators with leaf-shaking and jerky advances. A less aggressive form of maternal care is found in two Platyphora and four Proseicela species associated with Solanaceae, shrubs and small trees. For these and other morphologically similar taxa associated with Solanaceae, genetic distances support morphology-based taxonomy at the species level, reveal one new species, but raise questions regarding boundaries separating genera. We urge continued study of these magnificent insects, their enemies and their defenses, both behavioral and chemical, especially in forests along the eastern versant of the Central and South American cordillera.

  20. Whole genome duplication of intra- and inter-chromosomes in the tomato genome.

    Science.gov (United States)

    Song, Chi; Guo, Juan; Sun, Wei; Wang, Ying

    2012-07-20

    Whole genome duplication (WGD) events have been proven to occur in the evolutionary history of most angiosperms. Tomato is considered a model species of the Solanaceae family. In this study, we describe the details of the evolutionary process of the tomato genome by detecting collinearity blocks and dating the WGD events on the tree of life by combining two different methods: synonymous substitution rates (Ks) and phylogenetic trees. In total, 593 collinearity blocks were discovered out of 12 pseudo-chromosomes constructed. It was evident that chromosome 2 had experienced an intra-chromosomal duplication event. Major inter-chromosomal duplication occurred among all the pseudo-chromosome. We calculated the Ks value of these collinearity blocks. Two peaks of Ks distribution were found, corresponding to two WGD events occurring approximately 36-82 million years ago (MYA) and 148-205 MYA. Additionally, the results of phylogenetic trees suggested that the more recent WGD event may have occurred after the divergence of the rosid-asterid clade, but before the major diversification in Solanaceae. The older WGD event was shown to have occurred before the divergence of the rosid-asterid clade and after the divergence of rice-Arabidopsis (monocot-dicot). Copyright © 2012. Published by Elsevier Ltd.

  1. Insecticidal Effect of Fruit Extracts from Xylopia aethiopica and Dennettia tripetala (Annonaceae against Sitophilus oryzae (Coleoptera: Curculionidae Efecto Insecticida de Extractos de Fruta de Xylopia aethiopica y Dennettia tripetala (Annonaceae contra Sitophilus oryzae (Coleoptera: Curculionidae

    Directory of Open Access Journals (Sweden)

    Donald A . Ukeh

    2012-06-01

    Full Text Available The insecticidal and repellent activities of fruit extracts of Xylopia aethiopica (Dunal A. Rich. and Dennettia tripetala (Baker f. G.E. Schatz belonging to the family Annonaceae was studied against Sitophilus oryzae (L., an economic, primary post-harvest pest of rice, and other cereal products. Infested rice grains (100 g treated with 1, 2, 3, 4, and 5% (w/w powders of both plants were evaluated for toxicity against S. oryzae every 24 h for 3 d, and during Fi progeny emergence. The essential oils of both plants were also applied at 0.5, 1, 1.5 and 2 mg cm-2 filter paper in Petri dishes for toxicity bioassays at 24 h exposure. Repellence bioassay with 10 μL solution of essential oils on filter paper was performed in a Y-Tube airflow olfactometer. Results indicate that powders of both plants significantly (P La actividad insecticida y repelente de los extractos frutales de Xylopia aethiopica (Dunal A. Rich. y Dennettia tripetala (Baker f. G.E. Schatz pertenecientes a la familia Annonaceae fueron evaluados contra Sitophilus oryzae (L., plaga primaria de importancia económica en poscosecha de arroz y otros cereales. Granos de arroz (100 g infestados tratados con polvos de ambas plantas al 1, 2, 3, 4, y 5% (p/p fueron evaluados para la toxicidad contra S. oryzae cada 24 h por 3 d y durante la emergencia de la progenie F1. Los aceites esenciales de ambas plantas también fueron aplicados en papel filtro a 0,5; 1; 1,5 y 2 mg cm-2 en cajas de Petri para bioensayos de toxicidad con exposición de 24 h. Bioensayos de repelencia con 10 μL de solución de los aceites esenciales impregnados en papel filtro fueron realizados en un olfatómetro de flujo de aire Y-Tube. Los resultados indican que los polvos de ambas plantas causan una mortalidad significativa de estos insectos (P < 0,001 y una reducción en la emergencia de la progenie F1 con relación al control. Los aceites esenciales también mostraron un efecto adulticida significativo (P < 0,001 despu

  2. Los métodos de vibración como herramienta no destructiva para la estimación de las propiedades resistentes de la madera aserrada estructural

    Directory of Open Access Journals (Sweden)

    Argüelles Álvarez, Ramón

    2007-06-01

    Full Text Available The non-destructive testing of structural sawn timber using the resonant frequency methods uses the natural frequency of pieces to assess the quality of test samples. This paper describes the theoretical basis of this non-destructive technique and an investigation into the suitability of this tool. The results of grading 120 pieces of gross cross-section (150 x 200 x 4,060 mm and 200 x 250 x 5,060 mm structural timber of European black pine, (Pinus nigra subsp. salzmannii (Dunal Franco are shown. Furthermore, the specimens were tested for bending according to the UNE-EN 408: 2004 standard, to compare the values of strength and stiffness obtained from this test with the results estimated using the non-destructive method. PLG (the Portable Lumber Grader developed at the Wood NDT Laboratory of the University of Western Hungary, in Sopron, was used to measure the frequency of the longitudinal stress wave. This equipment determines the frequency and the density of the specimens, and uses them, to evaluate the dynamic modulus of elasticity and to estimate the strength. For gross cross-section European black pine pieces, a strong relationship exists between dynamic modulus obtained by longitudinal vibration frequency and the mechanical properties. Acoustic measurements have become widely acceptable, because they are accurate, portable, cheap and easy to apply.La clasificación no destructiva de madera aserrada estructural mediante los métodos de vibración, utiliza la frecuencia natural de la pieza para llegar a definir la calidad del material. Este artículo describe los fundamentos teóricos de esta técnica no destructiva y un trabajo de investigación enfocado a valorar la idoneidad de dicha herramienta. Se muestran los resultados de clasificación de 120 piezas de gruesa escuadría (150 x 200 x 4.060 mm y 200 x 250 x 5.060 mm de madera aserrada estructural de pino laricio, (Pinus nigra subsp. salzmannii (Dunal Franco. Adicionalmente, las probetas

  3. Sertula Florae Colombiae, II

    Directory of Open Access Journals (Sweden)

    Uribe Uribe Lorenzo

    1955-08-01

    Full Text Available En el presente artículo el autor registra como nuevas para Colombia varias especies pertenecientes a las Familias botánicas Aristolochiaceae, Passifloraceae y Solanaceae; provee de una diagnosis latina a Aristolochia argyroneura con el fin de revalidar ese binomio empleado irreglamentariamente desde hace medio siglo por carecer de la debida descripción; y discute brevemente el problema suscitado en torno al género Dilkea (de las Pasifloráceas, al cual se han atribuido varias especies por algunos botánicos, mientras otros sospechan que se trata de simples formas de una misma entidad específica por lo cual el genero debe ser considerado como monotípico.

  4. Phenetic analysis of medicinally important species of the genus solanum from Pakistan

    International Nuclear Information System (INIS)

    Yousaf, Z.; Shinwari, Z.K.; Khan, M.A.

    2010-01-01

    Solanum is one of the largest and hyper diverse genera of the family Solanaceae. In Pakistan Solanum is represented by 15 species, of which 11 species have the medicinal properties. Taxonomically this is a complex genus because of the presence of number of hybrid and controversial taxonomic status of S. nigrum complex. In the present study numerical techniques were utilized to evaluate the taxonomic status of the genus Solanum. Cluster analysis was employed to work out the relationship among the taxa of the genus Solanum. The Euclidean distance measured similarity matrix and a dendrogram was constructed by using the complete linkage method. This analysis showed that all the species of genus Solanum can easily be divided into two groups at hundred percentage linkage distance. Co-relation of quantitative characters showed that floral characters had highly significant relationship with the stem characters, these characters plays a significant role in the identification of the species of the genus Solanum. (author)

  5. Polyphenol Oxidases in Crops: Biochemical, Physiological and Genetic Aspects

    Directory of Open Access Journals (Sweden)

    Francesca Taranto

    2017-02-01

    Full Text Available Enzymatic browning is a colour reaction occurring in plants, including cereals, fruit and horticultural crops, due to oxidation during postharvest processing and storage. This has a negative impact on the colour, flavour, nutritional properties and shelf life of food products. Browning is usually caused by polyphenol oxidases (PPOs, following cell damage caused by senescence, wounding and the attack of pests and pathogens. Several studies indicated that PPOs play a role in plant immunity, and emerging evidence suggested that PPOs might also be involved in other physiological processes. Genomic investigations ultimately led to the isolation of PPO homologs in several crops, which will be possibly characterized at the functional level in the near future. Here, focusing on the botanic families of Poaceae and Solanaceae, we provide an overview on available scientific literature on PPOs, resulting in useful information on biochemical, physiological and genetic aspects.

  6. Antibacterial screening of some Peruvian medicinal plants used in Callería District.

    Science.gov (United States)

    Kloucek, P; Polesny, Z; Svobodova, B; Vlkova, E; Kokoska, L

    2005-06-03

    Nine ethanol extracts of Brunfelsia grandiflora (Solanaceae), Caesalpinia spinosa (Caesalpiniaceae), Dracontium loretense (Araceae), Equisetum giganteum (Equisetaceae), Maytenus macrocarpa (Celastraceae), Phyllanthus amarus (Euphorbiaceae), Piper aduncum (Piperaceae), Terminalia catappa (Combretaceae), and Uncaria tomentosa (Rubiaceae), medicinal plants traditionally used in Calleria District for treating conditions likely to be associated with microorganisms, were screened for antimicrobial activity against nine bacterial strains using the broth microdilution method. Among the plants tested, Phyllanthus amarus and Terminalia catappa showed the most promising antibacterial properties, inhibiting all of the strains tested with minimum inhibitory concentrations (MICs) ranging from 0.25 to 16 mg/ml. The extract from aerial part of Piper aduncum was significantly more active against Gram-positive (MICs ranging from 1 to 2 mg/ml) than against Gram-negative bacteria (MICs > 16 mg/ml).

  7. Morfologia externa de Thyridia psidii cetoides (Rosenberg & Talbot (Lepidoptera, Nymphalidae, Ithomiinae. III. Abdome e apêndices External morphology of Thyridia psidii cetoides (Rosenberg & Talbot. III. Abdomen and appendages (Lepidoptera, Nymphalidae, Ithomiinae

    Directory of Open Access Journals (Sweden)

    Jorge Manuel Saraiva Bizarro

    2003-12-01

    Full Text Available A detailed study of the abdominal external morphology of both sexes of Thyridia psidii cetoides (Rosenberg & Talbot, 1914 is presented. The material for this research was obtained at the city's plant nursery "Horto Florestal de Curitiba", Paraná, Brazil; mainly by rearing eggs and larvae collected on Cyphomandra betacea (Canavilles Sendtner, 1845 (Solanaceae. When possible, the results obtained were compared with those already available in the literature concerning other Nymphalidae subfamilies morphology (Brassolinae, Morphinae and Danainae; the most striking feature being the asymmetrical valvae of the male and the length and faint sclerotinization of the third abdominal sternite in both sexes. A resume containing the main morphological differences to other nymphalid subfamillies, found throughout this research concerning head, thorax and abdome, is presented.

  8. Glicoalcaloides antifúngicos, flavonoides e outros constituintes químicos de Solanum asperum

    Directory of Open Access Journals (Sweden)

    Francisco das Chagas L. Pinto

    2011-01-01

    Full Text Available Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-α-L-ramnopyranosyl-kaempferol and 3-O-[ß-D-glucopyranosyl-(1→6-α-L-ramnopyranosyl]-7- O-α-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae. The structures of all compounds were determined by interpretation of their spectra (IR, MS, ¹H and 13C NMR and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 μg/mL against four filamentous fungi species of the genera Microsporum and Trichophyton.

  9. Determination of trace elements of Egyptian crops by neutron activation analysis. Pt. 3. Trace elements in African tea, ginger, canella bark, black pepper, sesame, lady's fingers, jew's mallow, tomatos, cucumber and marrow

    Energy Technology Data Exchange (ETDEWEB)

    Sherif, M K; Awadallah, R M; Amrallah, A H [Assiut Univ. (Egypt)

    1980-01-01

    Multielemental neutron activation analysis was used for the determination of Al, As, Au, Br, Ca, Cd, Co, Cr, Cu, Fe, La, Mn, Mo, Sb, Se, W and Zn in African tea and lady's fingers (Malvaceae Family), ginger (Zingiperanceae Family), canella bark (Laureceae Family), black pepper (Piperaceae Family), cucumber seeds and vegetable marrow seeds (Cucurbitaceae Family), tomatos seed (Solanaceae Family), safflower seeds (Compositae Family), jew's mallow seed (Tiliaceae Family) and sesame (Pedaliaceae Family). Trace elements determination was made for the analysis of destructive (using super pure nitric acid and adsorbing the metal-APDC and metal-Dz complexes on activated charcoal) and nondestructive (dry seeds) samples. The method is simple, precise and sensitive for the determination of microamounts of the elements (ppM to ppB).

  10. Genetic variability of Indonesian local chili pepper: The facts

    Science.gov (United States)

    Arumingtyas, Estri Laras; Kusnadi, Joni; Sari, Dewi Ratih Tirto; Ratih, Nursita

    2017-11-01

    Chili pepper (Capsicum frutescens) is one species of Solanaceae family that is very popular in Indonesia and some other tropical countries because of its pungency. Chili pepper is an important spice in Indonesia and is also eaten fresh as a pickle to increase appetite. In Indonesia, there are various local names for chili pepper includingcabai, cengek, lombok, pedesan etc. These varied local names represent the various morphological shapes of the chili pepper fruit. We have investigated the variability of some chili cultivars based on morphological characteristics, molecular markers, pungency, and capsaicin content. Some biological facts, such as the tendency of chili pepper to outbreed, have also been found. In this paper, the source of variability and the possible mechanism of increasing genetic variability of Indonesian local chili pepper are also discussed.

  11. [Plant poisoning cases in Turkey].

    Science.gov (United States)

    Oztekin-Mat, A

    1994-01-01

    In Turkey, the majority of the population live in rural areas where they use wild plants as food and medicine. The confusion of an edible plant with a poisonous one give rise to serious poisoning which may even result in death. The incidence of plant poisoning in Turkey is about 6% and especially high among children between ages of 2 and 11 living in rural areas. The number of species that cause poisoning is around twenty and Hyoscyamus niger (Solanaceae), Colchicum species (Liliaceae), Conium maculatum (Umbelliferae) and Prunus species (Rosaceae) are the most important. Mushroom poisoning is more frequent in spring and fall. The main reasons are their widespread usage as food and the inexperience of the gatherers in distinguishing the edibles from the poisonous. Amanita phalloides, A. verna, A. muscaria, A. pantherina are responsible for severe cases of poisoning.

  12. Uso tradicional de plantas medicinales en la vereda San Isidro, municipio de San José de Pare-Boyacá, Colombia: un estudio preliminar usando técnicas cuantitativas

    Directory of Open Access Journals (Sweden)

    Jarvis Yamith Toscano González

    2005-07-01

    se deben tener al ser administradas. Los datos fueron analizados mediante el Índice de Valor de Uso (IVUs y el Nivel de Uso Significativo de TRAMIL. Se registraron 35 especies de plantas de uso medicinal, distribuidas en 20 familias, representadas en su mayoría por Asteraceae, Lamiaceae, Solanaceae y Rutaceae. Se reportaron 11 especies con un mayor valor de importancia en medicina tradicional. La documentación de los usos de las plantas medicinales en el área de influencia, revela que el conocimiento tradicional continúa profundamente arraigado entre la comunidad y se mantiene el saber popular a manos de curanderos y madres cabeza de familia.

  13. Determination of free inositols and other low molecular weight carbohydrates in vegetables.

    Science.gov (United States)

    Hernández-Hernández, Oswaldo; Ruiz-Aceituno, Laura; Sanz, María Luz; Martínez-Castro, Isabel

    2011-03-23

    Different low molecular weight carbohydrates including saccharides, polyalcohols, sugar acids, and glycosides have been identified and quantified in different edible vegetables from Asteraceae, Amarantaceae, Amarylidaceae, Brassicaceae, Dioscoreaceae, and Solanaceae families by gas chromatography-mass spectrometry. Apart from glucose, fructose, and sucrose, other saccharides such as sedoheptulose in chicory, spinach, cabbage, purple yam, eggplant, radish, and oak leaf lettuce, rutinose in eggplant skin, and a glycosyl-inositol in spinach have been identified. chiro-Inositol was found in all vegetables of the Asteraceae family (3.1-32.6 mg 100 g(-1)), whereas scyllo-inositol was detected in those of purple yam, eggplant, artichoke, chicory, escarole, and endive (traces-23.2 mg 100 g(-1)). α-Galactosides, kestose, glucaric acid, and glycosyl-glycerols were also identified and quantified in some of the analyzed vegetables. Considering the bioactivity of most of these compounds, mainly chicory leaves, artichokes, lettuces, and purple yam could constitute beneficial sources for human health.

  14. Anti-tumor promoting potential of selected spice ingredients with antioxidative and anti-inflammatory activities: a short review.

    Science.gov (United States)

    Surh, Young-Joon

    2002-08-01

    A wide variety of phenolic substances derived from spice possess potent antimutagenic and anticarcinogenic activities. Examples are curcumin, a yellow colouring agent, contained in turmeric (Curcuma longa L., Zingiberaceae), [6]-gingerol, a pungent ingredient present in ginger (Zingiber officinale Roscoe, Zingiberaceae) and capsaicin, a principal pungent principle of hot chili pepper (Capsicum annuum L, Solanaceae). The chemopreventive effects exerted by these phytochemicals are often associated with their antioxidative and anti-inflammatory activities. Cyclo-oxygenase-2 (COX-2) has been recognized as a molecular target of many chemopreventive as well as anti-inflammatory agents. Recent studies have shown that COX-2 is regulated by the eukaryotic transcription factor NF-kappaB. This short review summarizes the molecular mechanisms underlying chemopreventive effects of the aforementioned spice ingredients in terms of their effects on intracellular signaling cascades, particularly those involving NF-kappaB and mitogen-activated protein kinases.

  15. Biological and molecular characterization of Brazilian isolates of Zucchini yellow mosaic virus

    Directory of Open Access Journals (Sweden)

    David Marques de Almeida Spadotti

    2015-02-01

    Full Text Available Zucchini yellow mosaic virus (ZYMV causes substantial economic losses in cucurbit crops. Although ZYMV has been present in Brazil for more than 20 years, there is little information about the biological and molecular characteristics of the isolates found in the country. This study aimed to characterize the experimental hosts, pathotypes and genetic diversity of a collection of eleven Brazilian ZYMV isolates within the coat protein gene. For biological analysis, plant species from Amaranthaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae, Solanaceae, and Pedaliaceae were mechanically inoculated and pathotypes were identified based on the reaction of a resistant Cucumis melo, accession PI414723. All of the cucurbit species/varieties and Sesamum indicum were systemically infected with all isolates. The nucleotide sequence variability of the coat protein gene ranged from 82 % to 99 % compared to the corresponding sequences of ZYMV isolates from different geographical locations. No recombination event was detected in the coat protein gene of the isolates.

  16. Enumeration of Antibacterial Activity of Few Medicinal Plants by Bioassay Method

    Directory of Open Access Journals (Sweden)

    B. Uma Reddy

    2010-01-01

    Full Text Available The present study was aimed to investigate the antibacterial activity of some common locally available plants, in order to estimate the biological potential of these herbs. The alcoholic extract of Tagetes erecta L (Asteraceae, Argemone mexicana L (Papavaraceae, Datura stramonium L. (Solanaceae and Tylophora indica (Burm.f. Merr. (Asclepiadaceae were evaluated for antibacterial activity using broth dilution bioassay method. It is clear from the results that, the extracts of these plants acts as a good source of antibiotics against various bacterial pathogens tested and exhibited broad spectrum of antibacterial activity. These plant extracts were shown to be moderate to maximum inhibitory effect against different bacterial forms such as Salmonella typhii, Proteus vulgaris, Pseudomonas aeruginosa and Escherichia coli, where as, mild to moderate activity against Klebsiella pneumoniae and Staphylococcus aureus. The results of these studies revealed most valuable information and also support the continued sustainable use of these plants in traditional systems of medicine.

  17. A checklist of the flora of Shanjan protected area, East Azerbaijan Province, NW Iran.

    Science.gov (United States)

    Bibalani, Ghassem Habibi; Taheri, Elnaz

    2013-01-01

    The flora of protected Shanjan rangeland in Shabestar district, Azerbaijan Province, NW Iran was studied using a 1 m × 1 m quadrate in spring and summer 2011. The climate of this area is cold and dry. In this area 94 plant species belonging to 25 families were identified as constituting the major part of the vegetation. The families in the area are Amaryllidaceae, Boraginaceae, Campanulaceae, Caryophllaceae, Cistaceae, Compositea, Cruciferae, Cyperaceae, Dipesaceae, Euphorbiaceae, Geraniaceae, Hypericaceae, Linaceae, Melvaceae, Orobachaceae, Papaveraceae, Paronychiaceae, Plantaginaceae, Polygolaceae, Ranunculaceae, Resedaceae, Rubiaceae, Scrophulariaceae, Solanaceae and Valerianacea. Floristic composition is Irano-Turanian elements. Detailed analysis showed that Biennial plants were 3.19%, Annual 41.49% and Perennial 55.32%.

  18. The trophic plasticity of genus phelipanche pomel (orobanchaceae in bulgaria Trofichna plastichnost na rod phelipanche pomel (orobanchaceae v bulgaria

    Directory of Open Access Journals (Sweden)

    Kiril STOYANOV

    2013-03-01

    Full Text Available New data about the natural parasitism of Phelipanche ramosa (L Pomel, P. mutelii (Shultz Pomel, P. oxyloba, P. arenaria and P. purpurea in Bulgaria are collected. The information for the hosts describes 46 new trophic systems with species from the families: Brassicaceae, Solanaceae, Fabaceae, Asteraceae, Apiaceae, Poaceae, Lamiaceae, Scrophulariaceae, Chenopodiaceae, Caryophyllaceae, Araliaceae, Euphorbiaceae, Geraniaceae, Dioscoreaceae and Verbenaceae. The samples are collected outside the crop fields, far from the known host crops, from different parts of the country. Some of the registered hosts are new for Bulgaria. The voucher specimens with physical connection to the hosts are deposited in the Herbarium of The Agricultural University - Plovdiv (SOA. The collected data suggest that genus Phelipanche is represented by two trophic groups according to the known sections. Sect. Phelipanche unites the polyphags P. ramosa, P. oxyloba and P. mutelii. Sect. Arenariae consist oligophags - P. arenaria and P. purpurea.

  19. Next Generation Sequencing Bulk Segregant Analysis of Potato Support that Differential Flux into the Cholesterol and Stigmasterol Metabolite Pools Is Important for Steroidal Glycoalkaloid Content

    DEFF Research Database (Denmark)

    Kaminski, Kacper Piotr; Kørup, Kirsten; Andersen, Mathias Neumann

    2016-01-01

    Potatoes and other Solanaceae species produce biologically active secondary metabolites called steroidal glycoalkaloids (GAs) which have antimicrobial, fungicidal, antiviral and insecticidal properties. GAs are, however, also toxic to animals and humans. Compared to wild species of potato, the el......, sterol 24-C-methyltransferase (SMT1), sterol desaturase (SD) and C-4 sterol methyl oxidase (SMO) genes were found, all encoding critical enzymes in the synthesis of the GAs precursor cholesterol........ Knowledge of metabolic pathways leading to the synthesis of GAs, as well as of the genes that are responsible for the observed differences in plant and tuber GA content is only partial. The primary purpose of this study was to identify genomic regions and candidate genes responsible for differential GA...

  20. Medicinal significance, pharmacological activities, and analytical aspects of solasodine: A concise report of current scientific literature

    Directory of Open Access Journals (Sweden)

    Kanika Patel

    2013-01-01

    Full Text Available Alkaloids are well known phytoconstituents for their diverse pharmacological properties. Alkaloids are found in all plant parts like roots, stems, leaves, flowers, fruits and seeds. Solasodine occurs as an aglycone part of glycoalkloids, which is a nitrogen analogue to sapogenins. Solanaceae family comprises of a number of plants with variety of natural products of medicinal significance mainly steroidal lactones, glycosides, alkaloids and flavanoids. It is a steroidal alkaloid based on a C27 cholestane skeleton. Literature survey reveals that solasodine has diuretic, anticancer, antifungal, cardiotonic, antispermatogenetic, antiandrogenic, immunomodulatory, antipyretic and various effects on central nervous system. Isolation and quantitative determination was achieved by several analytical techniques. Present review highlights the pharmacological activity of solasodine, with its analytical and tissue culture techniques, which may be helpful to the researchers to develop new molecules for the treatment of various disorders in the future.

  1. Obtenção de extrato padronizado de Solanum lycicarpum A. St.-Hil. contendo glicoalcalóides, desenvolvimento de método analítico por CLAE e de forma farmacêutica de uso tópico

    OpenAIRE

    Renata Fabiane Jorge Tiossi

    2010-01-01

    Solanum lycocarpum A. St.-Hil. (Solanaceae Solanum), popular lobeira, é espécie arbustiva nativa e característica do Cerrado brasileiro. Seus frutos são empregados na medicina caseira como diurética, calmante, anti-espasmódica, antiofídica e antiepilética. As espécies do gênero Solanum são produtoras de heterosídeos alcaloídicos, os quais possuem atividade antitumoral, incluindo-se anticâncer de pele. O câncer de pele tem preocupado as autoridades no mundo com os crescentes índices atuais e,...

  2. Melliferous flora and pollen characterization of honey samples of Apis mellifera L., 1758 in apiaries in the counties of Ubiratã and Nova Aurora, PR

    Directory of Open Access Journals (Sweden)

    ELIZABETE S. SEKINE

    2013-03-01

    Full Text Available The aim of this study was to carry out a survey of the flora with potential for beekeeping in the counties of Ubiratã and Nova Aurora-PR through the collection of plants and pollen analyses in honey samples collected monthly. 208 species of plants were recorded, distributed in 66 families. The families that showed the major richness of pollen types were: Asteraceae, Myrtaceae and Solanaceae. Approximately 80 pollen types were found in honey samples, most of them were characterized as heterofloral. Cultivated plants, such as Glycine max (soybean and Eucalyptus spp., were representative in some months of the year. Exotic species, such as Ricinus communis and Melia azedarach, were also frequent. However, over than 50% of the pollen types belong to native species of the region, such as Schinus terebinthifolius, Baccharis spp. Alchornea triplinervia, Parapiptadenia rigida, Hexaclamys edulis, Zanthoxylum sp. and Serjania spp., indicating the importance of the native vegetation for the survival of the colonies.

  3. First report of Maconellicoccus hirsutus (Green, 1908) (Hemiptera: Coccoidea: Pseudococcidae) and the associated parasitoid Anagyrus kamali Moursi, 1948 (Hymenoptera: Encyrtidae), in Brazil.

    Science.gov (United States)

    Marsaro Júnior, A L; Peronti, A L B G; Penteado-Dias, A M; Morais, E G F; Pereira, P R V S

    2013-05-01

    The pink hibiscus mealybug (PHM), Maconellicoccus hirsutus (Green) (Hemiptera: Pseudococcidae) and the associated hymenopterous parasitoid, Anagyrus kamali Moursi, 1948 (Hymenoptera: Encyrtidae), are reported for the first time in Brazil. Specimens of the PHM were collected on nine hosts plants, Annona muricata L. (Anonnaceae), Glycine max (L.) Merr. (Fabaceae), Centrolobium paraensis Tul. (Fabaceae), Inga edulis Mart. (Fabaceae), Hibiscus rosa-sinensis L. (Malvaceae), Psidium guajava L. (Myrtaceae), Averrhoa carambola L. (Oxalidaceae), Citrus sinensis (L.) Osbeck (Rutaceae) and Solanum lycopersicum L. (Solanaceae), in four municipalities in the north-northeast of the state of Roraima. The plants C. paraensis, I. edulis and C. sinensis are recorded for the first time as a hosts for PHM. Characteristic injuries observed on the host plants infested by PHM and suggestions for its management are presented.

  4. Evolutionary Profiling of Group II Pyridoxal-Phosphate-Dependent Decarboxylases Suggests Expansion and Functional Diversification of Histidine Decarboxylases in Tomato

    Directory of Open Access Journals (Sweden)

    Rahul Kumar

    2016-03-01

    Full Text Available Pyridoxal phosphate (PLP-dependent enzymes are one of the most important enzymes involved in plant N metabolism. Here, we explored the evolution of group II PLP-dependent decarboxylases (PLP_deC, including aromatic L-amino acid decarboxylase, glutamate decarboxylase, and histidine decarboxylase in the plant lineage. Gene identification analysis revealed a higher number of genes encoding PLP_deC in higher plants than in lower plants. Expression profiling of PLP_deC orthologs and syntelogs in (L. Heynh., pepper ( L., and tomato ( L. pointed toward conserved as well as distinct roles in developmental processes such as fruit maturation and ripening and abiotic stress responses. We further characterized a putative promoter of tomato ripening-associated gene ( operating in a complex regulatory circuit. Our analysis provides a firm basis for further in-depth exploration of the PLP_deC gene family, particularly in the economically important Solanaceae family.

  5. Determination of trace elements of Egyptian crops by neutron activation analysis Pt. 3

    International Nuclear Information System (INIS)

    Sherif, M.K.; Awadallah, R.M.; Amrallah, A.H.

    1980-01-01

    Multielemental neutron activation analysis was used for the determination of Al, As, Au, Br, Ca, Cd, Co, Cr, Cu, Fe, La, Mn, Mo, Sb, Se, W and Zn in African tea and lady's fingers (Malvaceae Family), ginger (Zingiperanceae Family), canella bark (Laureceae Family), black pepper (Piperaceae Family), cucumber seeds and vegetable marrow seeds (Cucurbitaceae Family), tomatos seed (Solanaceae Family), safflower seeds (Compositae Family), jew's mallow seed (Tiliaceae Family) and sesame (Pedaliaceae Family). Trace elements determination was made for the analysis of destructive (using super pure nitric acid and adsorbing the metal-APDC and metal-Dz complexes on activated charcoal) and nondestructive (dry seeds) samples. The method is simple, precise and sensitive for the determination of microamounts of the elements (ppm to ppb). (author)

  6. Cytotoxic derivatives of withanolides isolated from the leaves of Acnistus arborescens; Derivados citotoxicos de vitanolidos isolados das folhas de Acnistus arborescens

    Energy Technology Data Exchange (ETDEWEB)

    Minguzzi, Sandro, E-mail: sming@uems.b [Universidade Estadual de Mato Grosso do Sul, Navirai, MS (Brazil). Curso de Quimica; Barata, Lauro E.S. [Universidade Estadual de Campinas (IQ/UNICAMP), SP (Brazil). Inst. de Quimica; Cordell, Geoffrey A. [Natural Products Inc., Evanston, IL (United States)

    2011-07-01

    In view of anticancer activity of 7 beta-acetoxywithanolide D (2) and 7beta-16beta-diacetoxywithonide D (3), isolated from the leaves of Acnistus arborescens (Solanaceae), five withanolide derivatives were obtained and their structures were determined by NMR, MS and IV data analysis. The in vitro anticancer activity of these derivatives was evaluated in a panel of cancer cell lines: human breast (BC-1), human lung (Lu1), human colon (Col2) and human oral epidermoid carcinoma (KB). Compounds 2a (acetylation of 2), 3b (oxidation of 3) and 2c (hydrogenation of 2) exhibited the highest anticancer activity against human lung cancer cells, with ED{sub 50} values of 0.19, 0.25 and 0.63 mug/mL, respectively. (author)

  7. In vitro studies on the relationship between the anti-inflammatory activity of Physalis peruviana extracts and the phagocytic process.

    Science.gov (United States)

    Martínez, Willington; Ospina, Luis Fernando; Granados, Diana; Delgado, Gabriela

    2010-03-01

    The study of plants used in traditional medicine has drawn the attention of researchers as an alternative in the development of new therapeutics agents, such as the American Solanaceae Physalis peruviana, which has significant anti-inflammatory activity. The Physalis peruviana anti-inflammatory effect of ethanol or ether calyces extracts on the phagocytic process was assessed by using an in vitro phagocytosis model (Leishmania panamensis infection to murine macrophages). The Physalis peruviana extracts do not inhibit microorganism internalization and have no parasiticide effect. Most ET and EP extracts negatively affected the parasite's invasion of macrophages (Infected cells increased.). This observation might result from a down-regulation of the macrophage's microbicide ability associated with a selective reduction of proinflammatory cytokines levels. Physalis peruviana's anti-inflammatory activity described in this model is related to an immunomodulatory effect exerted on macrophages infected, which directly or indirectly "blocks" their ability to secrete soluble proinflammatory mediators.

  8. Development and characterization of microsatellite markers for the Cape gooseberry Physalis peruviana.

    Science.gov (United States)

    Simbaqueba, Jaime; Sánchez, Pilar; Sanchez, Erika; Núñez Zarantes, Victor Manuel; Chacon, Maria Isabel; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

    2011-01-01

    Physalis peruviana, commonly known as Cape gooseberry, is an Andean Solanaceae fruit with high nutritional value and interesting medicinal properties. In the present study we report the development and characterization of microsatellite loci from a P. peruviana commercial Colombian genotype. We identified 932 imperfect and 201 perfect Simple Sequence Repeats (SSR) loci in untranslated regions (UTRs) and 304 imperfect and 83 perfect SSR loci in coding regions from the assembled Physalis peruviana leaf transcriptome. The UTR SSR loci were used for the development of 162 primers for amplification. The efficiency of these primers was tested via PCR in a panel of seven P. peruviana accessions including Colombia, Kenya and Ecuador ecotypes and one closely related species Physalis floridana. We obtained an amplification rate of 83% and a polymorphic rate of 22%. Here we report the first P. peruviana specific microsatellite set, a valuable tool for a wide variety of applications, including functional diversity, conservation and improvement of the species.

  9. Solanáceas em sistema orgânico no Brasil: tomate, batata e physalis

    Directory of Open Access Journals (Sweden)

    Aniela Pilar Campos de Melo

    2017-01-01

    Full Text Available A pesquisa científica brasileira voltada para sistemas orgânicos ainda tem sido permeada por uma lógica baseada na mera substituição de insumos. Falta um aprofundamento em relação ao reconhecimento dos componentes dos sistemas de produção (ecofisiologia; manejo e fertilidade do solo; conservação de água e solo; manejo fitossanitário e como estes podem ser investigados de forma holística. Baseado em tais lacunas discute-se neste artigo de revisão as principais particularidades relacionadas a produção orgânica de tomate e batata, principais oleráceas da família Solanaceae, e de uma frutífera exótica potencial para sistemas orgânicos, a physalis (Physalis peruviana L..

  10. The protective effect of Physalis peruviana L. against cadmium-induced neurotoxicity in rats.

    Science.gov (United States)

    Abdel Moneim, Ahmed E; Bauomy, Amira A; Diab, Marwa M S; Shata, Mohamed Tarek M; Al-Olayan, Ebtesam M; El-Khadragy, Manal F

    2014-09-01

    The present study was carried out to investigate the protective effect of Physalis peruviana L. (family Solanaceae) against cadmium-induced neurotoxicity in rats. Adult male Wistar rats were randomly divided into four groups. Group 1 was used as control. Group 2 was intraperitoneally injected with 6.5 mg/kg bwt of cadmium chloride for 5 days. Group 3 was treated with 200 mg/kg bwt of methanolic extract of Physalis (MEPh). Group 4 was pretreated with MEPh 1 h before cadmium for 5 days. Cadmium treatment induced marked disturbances in neurochemical parameters as indicating by significant (p Physalis has a beneficial effect in ameliorating the cadmium-induced oxidative neurotoxicity in the brain of rats.

  11. Magnoliophyta species of restinga, state of Pernambuco, Brazil.

    Directory of Open Access Journals (Sweden)

    Zickel, C. S.

    2007-01-01

    Full Text Available Restinga vegetation occurs along the entire coast of Brazil. The 187 km of coastline of the state ofPernambuco demonstrates a diversity of habitats, such as beaches, dunes, and restingas. The present study sought toelaborate a checklist of the phanerogamic species found there. The species listed were compiled from surveysundertaken between 1951 and 2007, as well as from herbaria collections in that state. A total of 477 species distributedamong 303 genera and 95 families were encountered. The families with the greatest numbers of species were Poaceae(39 species, Fabaceae (34, Cyperaceae (26, Euphorbiaceae (25, Myrtaceae (24, Rubiaceae (20, Caesalpiniaceae(17, Mimosaceae (16, Asteraceae (14, Orchidaceae (14, Bromeliaceae (9, Boraginaceae (8, Malvaceae (8,Solanaceae (8, and Annonaceae, Araceae, Chrysobalanaceae, Malpighiaceae, and Melastomataceae (7 each.Approximately 60 % of the species were common to other restinga areas in northeastern Brazil, and 39.3 % wererestricted to the coast of Pernambuco.

  12. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  13. Evaluation of the bioavailability of major withanolides of Withania somnifera using an in vitro absorption model system.

    Science.gov (United States)

    Devkar, Santosh T; Kandhare, Amit D; Sloley, Brian D; Jagtap, Suresh D; Lin, James; Tam, Yun K; Katyare, Surendra S; Bodhankar, Subhash L; Hegde, Mahabaleshwar V

    2015-01-01

    Withania somnifera (L.) Dunal, shows several pharmacological properties which are attributed mainly to the withanolides present in the root. The efficacy of medicinally active withanolides constituents depends on the absorption and transportation through the intestinal epithelium. We examined these characteristics by employing the Sino-Veda Madin-Darby canine kidney cells culture system, which under in vitro condition shows the absorption characteristics similar to the human intestinal epithelium. Thus, the aim of the present investigation was to assess the bioavailability of individual withanolides. Withanolides were diluted in Hank's buffered saline at a concentration of 2 μg/ml were tested for permeability studies carried out for 1 h duration. Permeability was measured in terms of efflux pump (P eff) in cm/s. P eff values of withanolide A (WN A), withanone (WNN), 1,2-deoxywithastramonolide (1,2 DWM), withanolide B (WN B), withanoside IV-V (WS IV-V), and withaferin A were 4.05 × 10(-5), 2.06 × 10(-5), 1.97 × 10(-5), 1.80 × 10(-5), 3.19 × 10(-6), 3.03 × 10(-6) and 3.30 × 10(-7) respectively. In conclusion, the nonpolar and low molecular weight compounds (WN A, WNN, 1,2 DWM, and WN B) were highly permeable. As against this, the glycosylated and polar WS IV and WS V showed low permeability. Surprisingly and paradoxically, the highly biologically active withaferin A was completely impermeable, suggesting that further studies possibly using human epithelial colorectal adenocarcinoma (Caco-2) cells may be needed to delineate the absorption characteristics of withanolides, especially withaferin A.

  14. Ayurvedic approach in the management of spinal cord injury: A case study

    Directory of Open Access Journals (Sweden)

    Sarvesh Kumar Singh

    2015-01-01

    Full Text Available Spinal cord injury (SCI is associated with consequences such as full loss of spinal movements, incontinence of bladder functions, bed sores, etc. There is no satisfactory treatment available in biomedicine with only limited treatments only for enhancement of spinal cord function. These treatments have many limitations. Ayurvedic drugs and Pancakarma procedures have been in use to treat such conditions since a long time. We present a case of SCI with lesion at C4 level which was treated for 2 months with an Ayurvedic combined intervention. The combined treatment plan involved Ayurvedic oral medications (Brhadvātacintāmaṇi rasa - 125 mg, Ardhanāgavātāri rasa - 125 mg, Daśamūla kvātha - 40 ml, Aśvagandhācūrṇa [powder of Withania somnifera DUNAL] - 3 g, Amṛtā [Tinospora cordifolia WILLD] - 500 mg, Muktāśukti piṣṭi - 500 mg and Trayodaśāṅga guggulu - 500 mg twice daily. Combined procedures involved such as śāliṣaṣṭika piṇḍasvedana (sudation with medicated cooked bolus of rice every day for 2 months and Mātrā basti (enema for first 15 days with Aśvagandhā oil. From 16 th day, Mustādi yāpana basti (MYB, enema with medicated milk was given for 16 days. After an interval of 7 days, MYB was further repeated for next 16 days. Substantial clinical improvement was reported after 2 months of the Ayurvedic treatment in existing neurological deficits and in quality of life.

  15. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  16. Tricomas foliares em tomateiro com teores contrastantes do aleloquímico 2-tridecanona

    Directory of Open Access Journals (Sweden)

    Aragão Carlos Alberto

    2000-01-01

    Full Text Available Duas espécies de tomateiro, Lycopersicon esculentum Mill. (Linhagem TOM 556- padrão com baixo teor da metil cetona 2-tridecanona (2-TD e Lycopersicon hirsutum Dunal var. glabratum Mill. (Linhagem PI 134417- padrão com elevado teor de 2-TD, foram analisadas em conjunto para identificação e quantificação de tricomas foliares. A parte experimental constou da identificação dos tricomas, baseado na presença ou ausência da cabeça secretora na extremidade apical dos tricomas, arranjo e número de células da cabeça, comprimento dos tricomas, e da quantificação do número de tricomas glandulares e não glandulares nos folíolos. O delineamento utilizado para o número de tricomas foi inteiramente casualizado e as médias comparadas pelo teste de Tukey, a 5%. A identificação e quantificação para as espécies foram: a TOM 556: Tricomas não glandulares do tipo II + III + V (2590 cm-2 de área foliolar; glandular do tipo VI (16 cm-2; glandular do tipo VII (138 cm-2; b PI 134417: não glandulares do tipo II + III + V (140 cm-2 de área foliolar; glandular do tipo I + IV (843 cm-2; glandular do tipo VI (83 cm-2; glandular do tipo VII (11 cm-2. As maiores concentrações da 2-TD nos folíolos, estão associadas às maiores densidades de tricomas glandulares presentes em ambas espécies.

  17. Traditional uses of medicinal plants used by Indigenous communities for veterinary practices at Bajaur Agency, Pakistan.

    Science.gov (United States)

    Aziz, Muhammad Abdul; Khan, Amir Hasan; Adnan, Muhammad; Ullah, Habib

    2018-01-29

    The pastoral lifestyle of Indigenous communities of Bajaur Agency is bringing them close to natural remedies for treating their domestic animals. Several studies have been conducted across the globe describing the importance of traditional knowledge in veterinary care. Therefore, this study was planned with the aim to record knowledge on ethnoveterinary practices from the remote areas and share sit with other communities through published literature. Data was gathered from community members through semi-structured interviews and analyzed through informant consensus factor (Fic) to evaluate the consent of current ethnoveterinary practices among the local people. In total, 73 medicinal plants were recorded under the ethnoveterinary practices. Most widely used medicinal plants with maximum use reports (URs) were Visnaga daucoides Gaertn., Foeniculum vulgare Mill., Solanum virginianum L., Withania somnifera (L.) Dunal, Glycyrrhiza glabra L., and Curcuma longa L. New medicinal values were found with confidential level of citations for species including Heracleum candicans and Glycerhiza glabra. Family Apiaceae was the utmost family with high number (7 species) of medicinal plants. Maximum number of medicinal plants (32) was used for gastric problems. High Fic was recorded for dermatological (0.97) followed by reproductive (0.93) and gastrointestinal disorders (0.92). The main route of remedies administration was oral. Current study revealed that the study area has sufficient knowledge on ethnoveterinary medicinal plants. This knowledge is in the custody of nomadic grazers, herders, and aged community members. Plants with new medicinal uses need to be validated phytochemically and pharmacologically for the development of new alternative drugs for veterinary purposes.

  18. Tri-trophic insecticidal effects of African plants against cabbage pests.

    Directory of Open Access Journals (Sweden)

    Blankson W Amoabeng

    Full Text Available Botanical insecticides are increasingly attracting research attention as they offer novel modes of action that may provide effective control of pests that have already developed resistance to conventional insecticides. They potentially offer cost-effective pest control to smallholder farmers in developing countries if highly active extracts can be prepared simply from readily available plants. Field cage and open field experiments were conducted to evaluate the insecticidal potential of nine common Ghanaian plants: goat weed, Ageratum conyzoides (Asteraceae, Siam weed, Chromolaena odorata (Asteraceae, Cinderella weed, Synedrella nodiflora (Asteraceae, chili pepper, Capsicum frutescens (Solanaceae, tobacco, Nicotiana tabacum (Solanaceae cassia, Cassia sophera (Leguminosae, physic nut, Jatropha curcas (Euphorbiaceae, castor oil plant, Ricinus communis (Euphorbiaceae and basil, Ocimum gratissimum (Lamiaceae. In field cage experiments, simple detergent and water extracts of all botanical treatments gave control of cabbage aphid, Brevicoryne brassicae and diamondback moth, Plutella xylostella, equivalent to the synthetic insecticide Attack® (emamectin benzoate and superior to water or detergent solution. In open field experiments in the major and minor rainy seasons using a sub-set of plant extracts (A. conyzoides, C. odorata, S. nodiflora, N. tabacum and R. communis, all controlled B. brassicae and P. xylostella more effectively than water control and comparably with or better than Attack®. Botanical and water control treatments were more benign to third trophic level predators than Attack®. Effects cascaded to the first trophic level with all botanical treatments giving cabbage head weights, comparable to Attack® in the minor season. In the major season, R. communis and A conyzoides treatment gave lower head yields than Attack® but the remaining botanicals were equivalent or superior to this synthetic insecticide. Simply-prepared extracts from

  19. Tri-trophic insecticidal effects of African plants against cabbage pests.

    Science.gov (United States)

    Amoabeng, Blankson W; Gurr, Geoff M; Gitau, Catherine W; Nicol, Helen I; Munyakazi, Louis; Stevenson, Phil C

    2013-01-01

    Botanical insecticides are increasingly attracting research attention as they offer novel modes of action that may provide effective control of pests that have already developed resistance to conventional insecticides. They potentially offer cost-effective pest control to smallholder farmers in developing countries if highly active extracts can be prepared simply from readily available plants. Field cage and open field experiments were conducted to evaluate the insecticidal potential of nine common Ghanaian plants: goat weed, Ageratum conyzoides (Asteraceae), Siam weed, Chromolaena odorata (Asteraceae), Cinderella weed, Synedrella nodiflora (Asteraceae), chili pepper, Capsicum frutescens (Solanaceae), tobacco, Nicotiana tabacum (Solanaceae) cassia, Cassia sophera (Leguminosae), physic nut, Jatropha curcas (Euphorbiaceae), castor oil plant, Ricinus communis (Euphorbiaceae) and basil, Ocimum gratissimum (Lamiaceae). In field cage experiments, simple detergent and water extracts of all botanical treatments gave control of cabbage aphid, Brevicoryne brassicae and diamondback moth, Plutella xylostella, equivalent to the synthetic insecticide Attack® (emamectin benzoate) and superior to water or detergent solution. In open field experiments in the major and minor rainy seasons using a sub-set of plant extracts (A. conyzoides, C. odorata, S. nodiflora, N. tabacum and R. communis), all controlled B. brassicae and P. xylostella more effectively than water control and comparably with or better than Attack®. Botanical and water control treatments were more benign to third trophic level predators than Attack®. Effects cascaded to the first trophic level with all botanical treatments giving cabbage head weights, comparable to Attack® in the minor season. In the major season, R. communis and A conyzoides treatment gave lower head yields than Attack® but the remaining botanicals were equivalent or superior to this synthetic insecticide. Simply-prepared extracts from readily

  20. Molecular bases and evolutionary dynamics of self-incompatibility in the Pyrinae (Rosaceae).

    Science.gov (United States)

    De Franceschi, Paolo; Dondini, Luca; Sanzol, Javier

    2012-06-01

    The molecular bases of the gametophytic self-incompatibility (GSI) system of species of the subtribe Pyrinae (Rosaceae), such as apple and pear, have been widely studied in the last two decades. The characterization of S-locus genes and of the mechanisms underlying pollen acceptance or rejection have been topics of major interest. Besides the single pistil-side S determinant, the S-RNase, multiple related S-locus F-box genes seem to be involved in the determination of pollen S specificity. Here, we collect and review the state of the art of GSI in the Pyrinae. We emphasize recent genomic data that have contributed to unveiling the S-locus structure of the Pyrinae, and discuss their consistency with the models of self-recognition that have been proposed for Prunus and the Solanaceae. Experimental data suggest that the mechanism controlling pollen-pistil recognition specificity of the Pyrinae might fit well with the collaborative 'non-self' recognition system proposed for Petunia (Solanaceae), whereas it presents relevant differences with the mechanism exhibited by the species of the closely related genus Prunus, which uses a single evolutionarily divergent F-box gene as the pollen S determinant. The possible involvement of multiple pollen S genes in the GSI system of Pyrinae, still awaiting experimental confirmation, opens up new perspectives to our understanding of the evolution of S haplotypes, and of the evolution of S-RNase-based GSI within the Rosaceae family. Whereas S-locus genes encode the players determining self-recognition, pollen rejection in the Pyrinae seems to involve a complex cascade of downstream cellular events with significant similarities to programmed cell death.

  1. Identification of SFBB-containing canonical and noncanonical SCF complexes in pollen of apple (Malus × domestica).

    Science.gov (United States)

    Minamikawa, Mai F; Koyano, Ruriko; Kikuchi, Shinji; Koba, Takato; Sassa, Hidenori

    2014-01-01

    Gametophytic self-incompatibility (GSI) of Rosaceae, Solanaceae and Plantaginaceae is controlled by a single polymorphic S locus. The S locus contains at least two genes, S-RNase and F-box protein encoding gene SLF/SFB/SFBB that control pistil and pollen specificity, respectively. Generally, the F-box protein forms an E3 ligase complex, SCF complex with Skp1, Cullin1 (CUL1) and Rbx1, however, in Petunia inflata, SBP1 (S-RNase binding protein1) was reported to play the role of Skp1 and Rbx1, and form an SCFSLF-like complex for ubiquitination of non-self S-RNases. On the other hand, in Petunia hybrida and Petunia inflata of Solanaceae, Prunus avium and Pyrus bretschneideri of Rosaceae, SSK1 (SLF-interacting Skp1-like protein1) is considered to form the SCFSLF/SFB complex. Here, we isolated pollen-expressed apple homologs of SSK1 and CUL1, and named MdSSK1, MdCUL1A and MdCUL1B. MdSSK1 was preferentially expressed in pollen, but weakly in other organs analyzed, while, MdCUL1A and MdCUL1B were almost equally expressed in all the organs analyzed. MdSSK1 transcript abundance was significantly (>100 times) higher than that of MdSBP1. In vitro binding assays showed that MdSSK1 and MdSBP1 interacted with MdSFBB1-S9 and MdCUL1, and MdSFBB1-S9 interacted more strongly with MdSSK1 than with MdSBP1. The results suggest that both MdSSK1-containing SCFSFBB1 and MdSBP1-containing SCFSFBB1-like complexes function in pollen of apple, and the former plays a major role.

  2. Floral preferences and climate influence in nectar and pollen foraging by Melipona rufiventris Lepeletier (Hymenoptera: Meliponini) in Ubatuba, São Paulo state, Brazil.

    Science.gov (United States)

    Fidalgo, Adriana de O; Kleinert, Astrid de M P

    2010-01-01

    We describe the environment effects on the amount and quality of resources collected by Melipona rufiventris Lepeletier in the Atlantic Forest at Ubatuba city, São Paulo state, Brazil (44º48'W, 23º22'S). Bees carrying pollen and/or nectar were captured at nest entrances during 5 min every hour, from sunrise to sunset, once a month. Pollen loads were counted and saved for acetolysis. Nectar was collected, the volume was determined and the total dissolved solids were determined by refractometer. Air temperature, relative humidity and light intensity were also registered. The number of pollen loads reached its maximum value between 70% and 90% of relative humidity and 18ºC and 23ºC; for nectar loads this range was broader, 50-90% and 20-30ºC. The number of pollen loads increased as relative humidity rose (rs = 0.401; P < 0.01) and high temperatures had a strong negative influence on the number of pollen loads collected (rs = -0.228; P < 0.01). The number of nectar loads positively correlated with temperature (rs = 0.244; P < 0.01) and light intensity (rs = 0.414; P < 0.01). The percentage of total dissolved solids (TDS) on nectar loads positively correlated with temperature and light intensity (rs = 0.361; P < 0.01 and rs = 0.245; P < 0.01), negatively correlated with relative humidity (rs = -0.629; P < 0.01), and it increased along the day. Most nectar loads had TDS between 11% and 30%, with an average of 24.7%. The volume measures did not show any pattern. Important pollen sources were Sapindaceae, Anacardiaceae, Rubiaceae, Arecaceae, Solanaceae and Myrtaceae; nectar sources were Sapindaceae, Fabaceae, Rubiaceae, Arecaceae and Solanaceae.

  3. Tri-Trophic Insecticidal Effects of African Plants against Cabbage Pests

    Science.gov (United States)

    Amoabeng, Blankson W.; Gurr, Geoff M.; Gitau, Catherine W.; Nicol, Helen I.; Stevenson, Phil C.

    2013-01-01

    Botanical insecticides are increasingly attracting research attention as they offer novel modes of action that may provide effective control of pests that have already developed resistance to conventional insecticides. They potentially offer cost-effective pest control to smallholder farmers in developing countries if highly active extracts can be prepared simply from readily available plants. Field cage and open field experiments were conducted to evaluate the insecticidal potential of nine common Ghanaian plants: goat weed, Ageratum conyzoides (Asteraceae), Siam weed, Chromolaena odorata (Asteraceae), Cinderella weed, Synedrella nodiflora (Asteraceae), chili pepper, Capsicum frutescens (Solanaceae), tobacco, Nicotiana tabacum (Solanaceae) cassia, Cassia sophera (Leguminosae), physic nut, Jatropha curcas (Euphorbiaceae), castor oil plant, Ricinus communis (Euphorbiaceae) and basil, Ocimum gratissimum (Lamiaceae). In field cage experiments, simple detergent and water extracts of all botanical treatments gave control of cabbage aphid, Brevicoryne brassicae and diamondback moth, Plutella xylostella, equivalent to the synthetic insecticide Attack® (emamectin benzoate) and superior to water or detergent solution. In open field experiments in the major and minor rainy seasons using a sub-set of plant extracts (A. conyzoides, C. odorata, S. nodiflora, N. tabacum and R. communis), all controlled B. brassicae and P. xylostella more effectively than water control and comparably with or better than Attack®. Botanical and water control treatments were more benign to third trophic level predators than Attack®. Effects cascaded to the first trophic level with all botanical treatments giving cabbage head weights, comparable to Attack® in the minor season. In the major season, R. communis and A conyzoides treatment gave lower head yields than Attack® but the remaining botanicals were equivalent or superior to this synthetic insecticide. Simply-prepared extracts from readily

  4. Wild tobacco genomes reveal the evolution of nicotine biosynthesis.

    Science.gov (United States)

    Xu, Shuqing; Brockmöller, Thomas; Navarro-Quezada, Aura; Kuhl, Heiner; Gase, Klaus; Ling, Zhihao; Zhou, Wenwu; Kreitzer, Christoph; Stanke, Mario; Tang, Haibao; Lyons, Eric; Pandey, Priyanka; Pandey, Shree P; Timmermann, Bernd; Gaquerel, Emmanuel; Baldwin, Ian T

    2017-06-06

    Nicotine, the signature alkaloid of Nicotiana species responsible for the addictive properties of human tobacco smoking, functions as a defensive neurotoxin against attacking herbivores. However, the evolution of the genetic features that contributed to the assembly of the nicotine biosynthetic pathway remains unknown. We sequenced and assembled genomes of two wild tobaccos, Nicotiana attenuata (2.5 Gb) and Nicotiana obtusifolia (1.5 Gb), two ecological models for investigating adaptive traits in nature. We show that after the Solanaceae whole-genome triplication event, a repertoire of rapidly expanding transposable elements (TEs) bloated these Nicotiana genomes, promoted expression divergences among duplicated genes, and contributed to the evolution of herbivory-induced signaling and defenses, including nicotine biosynthesis. The biosynthetic machinery that allows for nicotine synthesis in the roots evolved from the stepwise duplications of two ancient primary metabolic pathways: the polyamine and nicotinamide adenine dinucleotide (NAD) pathways. In contrast to the duplication of the polyamine pathway that is shared among several solanaceous genera producing polyamine-derived tropane alkaloids, we found that lineage-specific duplications within the NAD pathway and the evolution of root-specific expression of the duplicated Solanaceae-specific ethylene response factor that activates the expression of all nicotine biosynthetic genes resulted in the innovative and efficient production of nicotine in the genus Nicotiana Transcription factor binding motifs derived from TEs may have contributed to the coexpression of nicotine biosynthetic pathway genes and coordinated the metabolic flux. Together, these results provide evidence that TEs and gene duplications facilitated the emergence of a key metabolic innovation relevant to plant fitness.

  5. Medicinal plants used to treat TB in Ghana.

    Science.gov (United States)

    Nguta, Joseph Mwanzia; Appiah-Opong, Regina; Nyarko, Alexander K; Yeboah-Manu, Dorothy; Addo, Phyllis G A

    2015-06-01

    The current study was designed to document medicinal plant species that are traditionally used to treat tuberculosis (TB) by Ghanaian communities. The medicinal plants used against TB or its signs and symptoms were selected using library and online published data searches. A guided questionnaire interview was also conducted with a botanist involved in plant collection at the Centre for Scientific Research into Plant Medicine (CSRPM) at Mampong. Data obtained were entered in Excel and summarized into means and frequencies using SPSS 12.0.1 for windows, and expressed as tables and bar graphs. A total of 15 medicinal plant species distributed between 13 genera and 13 families were documented. The following medicinal plant species were found to be used against TB in Greater Accra and Eastern parts of Ghana: Azadirachta indica A. Juss. Stem bark (Meliaceae), Hygrophila auriculata Heine, whole plant (Acanthaceae), Chenopodium ambrosioides L. leaves (Amaranthaceae), Coix lacryma-jobi L. glumes (Poaceae), Solanum torvum Sw. unripe fruits (Solanaceae), Solanum torvum Sw. leaves (Solanaceae), Bidens pilosa L. whole plant (Asteraceae), Phyllanthus fraternus G.L. Webster leaves (Phyllanthaceae), Dissotis rotundifolia (Sm.) Triana, leaves (Melastomataceae), Cymbopogon giganteus Chiov. Leaves (Poaceae), Cyperus articulatus L. roots (Cyperaceae), Allium sativum L. bulb (Amaryllidaceae), Zingiber officinale Roscoe, rhizomes (Zingiberaceae), Allium cepa L. bulbs (Amaryllidaceae), Allium cepa L. leaves (Amaryllidaceae), Aloe vera var. barbadensis aqueous extract from leaves (Xanthorrhoeaceae), Aloe vera var. barbadensis organic extract from leaves (Xanthorrhoeaceae), Cocos nucifera Linn, water (Arecaceae) and Cocos nucifera Linn. Husk (Arecaceae). The collected plant species could be a source of a new class of drugs against TB. Bioactivity guided fractionation is recommended to identify lead compounds for antimycobacterial activity. The current paper documents for the first time

  6. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d

    Directory of Open Access Journals (Sweden)

    Moffatt Barbara A

    2010-08-01

    Full Text Available Abstract Background Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB for coplanar aromatic motifs similar to those found in known glycan-binding proteins. Results The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192 in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Conclusions Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  7. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

    Science.gov (United States)

    Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

    2010-08-03

    Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  8. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  9. In vitro antimalarial activity of extracts of some plants from a biological reserve in Costa Rica.

    Science.gov (United States)

    Chinchilla, Misael; Valerio, Idalia; Sánchez, Ronald; Mora, Víctor; Bagnarello, Vanessa; Martínez, Laura; Gonzalez, Antonieta; Vanegas, Juan Carlos; Apestegui, Alvaro

    2012-06-01

    Treatment with the usual antimalarial drugs, have induced parasite resistance, reinforcing the need to finding natural antimalarial components that would be found on plants from the forest. Therefore, we decided to look for these components in Costa Rican plants from a protected forest area. Fresh and dry extracts of roots, bark, leaves, flowers and fruits of 25 plants from a biological reserve in Costa Rica, Reserva Biol6gica Alberto Manuel Brenes (REBAMB), were studied in vitro for the presence of substances with antimalarial activity. By studying the inhibition of P berghei schizogony, we assessed the antimalarial activity of several plant extracts: Aphelandra aurantiaca, A. tridentata (Acanthaceae); Xanthosoma undipes (Araceae); Iriartea deltoidea (Arecaceae); Neurolaena lobata (Asteraceae); Senna papillosa, Pterocarpus hayessi, Lonchocarpus pentaphyllus (Fabaceae); Nectandra membranacea, Persea povedae, Cinamomum chavarrianum (Lauraceae); Hampea appendiculata (Malvaceae); Ruagea glabra, Guarea glabra (Meliaceae); Psidium guajava (Myrtaceae); Bocconia frutescens (Papaveraceae); Piper friedrichsthalii (Piperaceae); Clematis dioica (Ranunculaceae); Prunus annularis (Rosaceae); Siparuna thecaphora (Siparunaceae); Solanum arboreum, Witheringia solanacea (Solanaceae); Ticodendrum incognitum (Ticodendraceae); Heliocarpus appendiculatus (Tiliaceae) and Myriocarpa longipes (Urticaceae). We used different parts of the plants as well as fresh and dried extracts for testing IC50. The solid content of the extracts ranged from 1-71.9 microg/mL. The fresh extracts showed stronger activity than the dry ones. Since the plants showing the strongest antimalarial activity are very common in Central America, and some similar genera of these plants have shown positives results in South America, we considered important to present these findings for discussion. On the other hand, this is the first systematic study of this kind ever realized in a circumscribed and protected area of

  10. Lack of S-RNase-Based Gametophytic Self-Incompatibility in Orchids Suggests That This System Evolved after the Monocot-Eudicot Split

    Directory of Open Access Journals (Sweden)

    Shan-Ce Niu

    2017-06-01

    Full Text Available Self-incompatibility (SI is found in approximately 40% of flowering plant species and at least 100 families. Although orchids belong to the largest angiosperm family, only 10% of orchid species present SI and have gametophytic SI (GSI. Furthermore, a majority (72% of Dendrobium species, which constitute one of the largest Orchidaceae genera, show SI and have GSI. However, nothing is known about the molecular mechanism of GSI. The S-determinants of GSI have been well characterized at the molecular level in Solanaceae, Rosaceae, and Plantaginaceae, which use an S-ribonuclease (S-RNase-based system. Here, we investigate the hypothesis that Orchidaceae uses a similar S-RNase to those described in Rosaceae, Solanaceae, and Plantaginaceae SI species. In this study, two SI species (Dendrobium longicornu and D. chrysanthum were identified using fluorescence microscopy. Then, the S-RNase- and SLF-interacting SKP1-like1 (SSK1-like genes present in their transcriptomes and the genomes of Phalaenopsis equestris, D. catenatum, Vanilla shenzhenica, and Apostasia shenzhenica were investigated. Sequence, phylogenetic, and tissue-specific expression analyses revealed that none of the genes identified was an S-determinant, suggesting that Orchidaceae might have a novel SI mechanism. The results also suggested that RNase-based GSI might have evolved after the split of monocotyledons (monocots and dicotyledons (dicots but before the split of Asteridae and Rosidae. This is also the first study to investigate S-RNase-based GSI in monocots. However, studies on gene identification, differential expression, and segregation analyses in controlled crosses are needed to further evaluate the genes with high expression levels in GSI tissues.

  11. Minerals and essential fatty acids of the exotic fruit Physalis peruviana L. Minerais e ácidos graxos essenciais da fruta exótica Physalis peruviana L.

    Directory of Open Access Journals (Sweden)

    Eliseu Rodrigues

    2009-09-01

    Full Text Available Physalis peruviana is an exotic fruit that belongs to the Solanaceae family and which has recently started to be produced in Brazil, mainly in the Southern region. Once there is few data regarding its chemical composition, this work presents the centesimal and mineral composition and the fatty acid profile of the lipidic fraction of Physalis peruviana. Concerning the centesimal composition, Physalis presented high contents of ashes and total lipids, 0.8 and 3.16 g.100 g-1, respectively. In its mineral composition, K, Mg, Ca and Fe were the main elements, and Fe is present in concentrations higher than those in the common sources such as beans. The lipidic fraction presented predominance of the linoleic acid (72,42% in its composition.Physalis peruviana é uma fruta exótica pertencente à família Solanaceae com produção recente no Brasil, principalmente na região Sul. Como há poucos dados em relação à sua composição química, este trabalho apresenta a composição centesimal e mineral e o perfil de ácidos graxos da fração lipídica da Physalis peruviana. Em relação à composição centesimal, a physalis apresentou alto conteúdo de cinzas e de lipídios totais, 0,8 e 3,16 g.100 g-1, respectivamente. Em sua composição mineral, o K, Mg, Ca e Fe foram os principais elementos, estando o ferro presente em concentrações superiores em relação a fontes conhecidas como o feijão. A fração lipídica apresenta predominância de ácido linoleico (72,42% em sua composição.

  12. In vitro antimalarial activity of extracts of some plants from a biological reserve in Costa Rica

    Directory of Open Access Journals (Sweden)

    Misael Chinchilla

    2012-06-01

    Full Text Available Treatment with the usual antimalarial drugs, have induced parasite resistance, reinforcing the need to finding natural antimalarial components that would be found on plants from the forest. Therefore, we decided to look for these components in Costa Rican plants from a protected forest area. Fresh and dry extracts of roots, bark, leaves, flowers and fruits of 25 plants from a biological reserve in Costa Rica, Reserva Biológica Alberto Manuel Brenes (REBAMB, were studied in vitro for the presence of substances with antimalarial activity. By studying the inhibition of P. berghei schizogony, we assessed the antimalarial activity of several plant extracts: Aphelandra aurantiaca, A. tridentata (Acanthaceae; Xanthosoma undipes (Araceae; Iriartea deltoidea (Arecaceae; Neurolaena lobata (Asteraceae; Senna papillosa, Pterocarpus hayessi, Lonchocarpus pentaphyllus (Fabaceae; Nectandra membranacea, Persea povedae, Cinamomum chavarrianum (Lauraceae; Hampea appendiculata (Malvaceae; Ruagea glabra, Guarea glabra (Meliaceae; Psidium guajava (Myrtaceae; Bocconia frutescens (Papaveraceae; Piper friedrichsthalii (Piperaceae; Clematis dioica (Ranunculaceae; Prunus annularis (Rosaceae; Siparuna thecaphora (Siparunaceae; Solanum arboreum, Witheringia solanácea (Solanaceae; Ticodendrum incognitum (Ticodendraceae; Heliocarpus appendiculatus (Tiliaceae and Myriocarpa longipes (Urticaceae. We used different parts of the plants as well as fresh and dried extracts for testing IC50. The solid content of the extracts ranged from 1-71.9μg/mL. The fresh extracts showed stronger activity than the dry ones. Since the plants showing the strongest antimalarial activity are very common in Central America, and some similar genera of these plants have shown positives results in South America, we considered important to present these findings for discussion. On the other hand, this is the first systematic study of this kind ever realized in a circumscribed and protected area of

  13. Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation

    Directory of Open Access Journals (Sweden)

    Huang Shan

    2009-05-01

    Full Text Available Abstract Cystic Fibrosis (CF is one of the most common autosomal genetic disorders in humans. This disease is caused by mutations within a single gene, coding for the cystic fibrosis transmembrane conductance regulator (CFTR protein. The phenotypic hallmark of CF is chronic lung infection and associated inflammation from opportunistic microbes such as Pseudomonas aeruginosa (PA, Haemophilus influenzae, and Staphylococcus aureus. This eventually leads to deterioration of lung function and death in most CF patients. Unfortunately, there is no approved therapy for correcting the genetic defect causal to the disease. Hence, controlling inflammation and infection in CF patients are critical to disease management. Accordingly, anti-inflammatory agents and antibiotics are used to manage chronic inflammation and infection in CF patients. However, most of the anti-inflammatory agents in CF have severe limitations due to adverse side effects, and resistance to antibiotics is becoming an even more prominent problem. Thus, new agents that can be used to control chronic inflammation in CF are needed in the absence of a cure for the disease. Activation of the transcription factor NFκB through Toll-like receptors (TLR following bacterial infection is principally involved in regulating lung inflammation in CF. NFκB regulates the transcription of several genes that are involved in inflammation, anti-apoptosis and anti-microbial activity, and hyper-activation of this transcription factor leads to a potent inflammatory response. Thus, NFκB is a potential anti-inflammatory drug target in CF. Screening of several compounds from natural sources in an in vitro model of CF-related inflammation wherein NFκB is activated by filtrates of a clinically isolated strain of PA (PAF led us to Withaferin A (WFA, a steroidal lactone from the plant Withania Somnifera L. Dunal. Our data demonstrate that WFA blocks PAF-induced activation of NFκB as determined using reporter

  14. Inhibition of NFkappaB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation.

    Science.gov (United States)

    Maitra, Rangan; Porter, Melissa A; Huang, Shan; Gilmour, Brian P

    2009-05-13

    Cystic Fibrosis (CF) is one of the most common autosomal genetic disorders in humans. This disease is caused by mutations within a single gene, coding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. The phenotypic hallmark of CF is chronic lung infection and associated inflammation from opportunistic microbes such as Pseudomonas aeruginosa (PA), Haemophilus influenzae, and Staphylococcus aureus. This eventually leads to deterioration of lung function and death in most CF patients. Unfortunately, there is no approved therapy for correcting the genetic defect causal to the disease. Hence, controlling inflammation and infection in CF patients are critical to disease management. Accordingly, anti-inflammatory agents and antibiotics are used to manage chronic inflammation and infection in CF patients. However, most of the anti-inflammatory agents in CF have severe limitations due to adverse side effects, and resistance to antibiotics is becoming an even more prominent problem. Thus, new agents that can be used to control chronic inflammation in CF are needed in the absence of a cure for the disease. Activation of the transcription factor NFkappaB through Toll-like receptors (TLR) following bacterial infection is principally involved in regulating lung inflammation in CF. NFkappaB regulates the transcription of several genes that are involved in inflammation, anti-apoptosis and anti-microbial activity, and hyper-activation of this transcription factor leads to a potent inflammatory response. Thus, NFkappaB is a potential anti-inflammatory drug target in CF. Screening of several compounds from natural sources in an in vitro model of CF-related inflammation wherein NFkappaB is activated by filtrates of a clinically isolated strain of PA (PAF) led us to Withaferin A (WFA), a steroidal lactone from the plant Withania Somnifera L. Dunal. Our data demonstrate that WFA blocks PAF-induced activation of NFkappaB as determined using reporter assays, IL

  15. Effect of seasonal variations on the phytoconstituents of Aśvagandhā w.r. to lunar cycles.

    Science.gov (United States)

    Tavhare, Swagata Dilip; Nishteswar, Karra; Shukla, Vinay J

    2016-01-01

    Suśruta, Caraka and other ācāryas advocate the collection of medicinal plants keeping in view the part used, season, soil in which the herb grows and the desired pharmacological actions or therapeutic benefits. The logic behind such recommendations is being validated by modern scientific research. To assess the effect of seasonal variations on the phytoconstituents of Aśvagandhā (Withania somnifera L. Dunal) w.s.r. to lunar cycles. The plant specimens were collected from Jamnagar identified pharmacognostically and cultivated under a defined habitat in a herbal garden of IPGT and RA on 7 Oct 2013. The root samples were collected on every paurṇimā (full moon) and amāvāsyā (new moon) days in śiśira and grīṣṃa ṛtu (as per classics) of the year 2013-14. The physicochemical parameters such as pH, ash values, extractive value, total alkaloid content, total flavonoids content (UV spectrometer with AlCl3 reagent), total phenolic content (Singleton and Rossi method), total carbohydrate content (UV spectroscopy with glucose as standard), UV-VIS-NIR and HPTLC were determined. The results of the analytical studies clearly validate the logic of the recommendations of Suśruta and Cakrapāṇi. According to these recommendations, uṣṇa vīrya drugs must be collected during āgneya ṛtu i.e. grīṣṃa ṛtu. In present study, total phenolic, flavonide and carbohydrate content were found more in pournima samples. GAP samples showed maximum differentiation from rest of the samples with regards to TCA, TCW, TFW, MEx, WEX, pH etc. parameters. The Grīṣṃa Jyeṣṭha Paurṇimā (GJP) and Āṣāḍha Paurṇimā (GAP) samples were found to be superior than amāvāsyā samples w.r.t. functional groups and withanoloid content respectively on HPTLC. The observations of experimental studies validate the concept of seasonal as well as lunar collection of herb Ashwagandha to yield a drug of superior quality of active principles.

  16. Coagulin-L ameliorates TLR4 induced oxidative damage and immune response by regulating mitochondria and NOX-derived ROS

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, Sukka Santosh [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Chauhan, Parul [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Maurya, Preeti [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Academy of Scientific and Innovative Research, New Delhi 110025 (India); Saini, Deepika [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Yadav, Prem Prakash, E-mail: pp_yadav@cdri.res.in [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Barthwal, Manoj Kumar, E-mail: manojbarthwal@cdri.res.in [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India)

    2016-10-15

    Withanolides possess diverse biological and pharmacological activity but their immunomodulatory function is less realized. Hence, coagulin-L, a withanolide isolated from Withania coagulans Dunal has been studied for such an effect in human and murine cells, and mice model. Coagulin-L (1, 3, 10 μM) exhibited immunomodulatory effect by suppressing TLR4 induced immune mediators such as cytokines (GMCSF, IFNα, IFNγ, IL-1α, IL-1Rα, IL-1β, IL-2, IL-2R, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12 (p40/p70), IL-13, IL-15, IL-17), chemokines (IL-8/CXCL8, MIG/CXCL9, IP-10/CXCL10, KC, MCP-1/CCL2, MIP-1α/CCL3, MIP-1β/CCL4, RANTES/CCL5, eotaxin/CCL11), growth factors (FGF-basic, VEGF), nitric oxide and intracellular superoxide. Mechanistically, coagulin-L abrogated LPS induced total and mitochondrial ROS generation, NOX2, NOX4 mRNA expression, IRAK and MAPK (p38, JNK, ERK) activation. Coagulin-L also attenuated IκBα degradation, which prevented NFκB downstream iNOS expression and pro-inflammatory cytokine release. Furthermore, coagulin-L (10, 25, 50 mg/kg, p.o.), undermined the LPS (10 mg/kg, i.p.) induced endotoxemia response in mice as evinced from diminished cytokine release, nitric oxide, aortic p38 MAPK activation and endothelial tissue impairment besides suppressing NOX2 and NOX4 expression in liver and aorta. Moreover, coagulin-L also alleviated the ROS mediated oxidative damage which was assessed through protein carbonyl, lipid hydroperoxide, 8-isoprostane and 8-hydroxy-2-deoxyguanosine quantification. To extend, coagulin-L also suppressed carrageenan-induced paw edema and thioglycollate-induced peritonitis in mice. Therefore, coagulin-L can be of therapeutic importance in pathological conditions induced by oxidative damage. - Highlights: • Coagulin-L demonstrates immunomodulatory effects in vivo and in vitro by modulating ROS. • Coagulin-L modulates TH1/TH2/TH17 immunokines. • Coagulin-L exerts immunomodulatory effect by regulating TLR4-IRAK- ROS

  17. Characterization of bacterial communities and functions of two submerged soils from San Vitale park (Italy)

    Science.gov (United States)

    Mocali, Stefano; Chiellini, Carolina; Lagomarsino, Alessandra; Ferronato, Chiara; Vittori Antisari, Livia; Vianello, Gilmo

    2015-04-01

    Subaqueous soils has been introduced in the last edition of the Keys to Soil Taxonomy (Soil surveystaff, 2014), to describe soils covered by a water column of up to 2.5 m where different pedogenetic processes can be recognized. However, the role of bacterial community structure and function in such environments and its potential use as pedogenetic indicator is still largely unknown. Two submerged soils (WAS-2 and WAS-4) were collected from San Vitale park (Italy), a site where the evolution of the landscape from subaqueous wetland to interdunal and dunal system, and the interfacing of freshwater with saltwater, made this site particularly suitable for examining the pedogenetic indicators which can characterize and predict the soil hydromorphism in trasitional ecosystems. The two soils were classified and their physicochemical and morphological features were investigated. Selective media were used to isolate both culturable aerobic and anaerobic (microaerophilic) bacteria associated with each horizon. In WAS-2 seven horizons were identified (depths 4-0, 0-6, 6-13, 13-20, 20-36, 36-59/60, and 59/60-83 cm) while in WAS-4, five horizons were identified (depths 0-14, 14-20, 20-40, 40-45, 45-100 cm) for a total of 12 horizons (samples). For each sample, aerobic bacterial plate count was performed on solid LB medium, coupled with microaerophilic bacterial plate count either on SA500 minimal medium and AYE medium (0.5% soft agar each). Molecular identification (16S rRNA gene sequencing) of ~100 strains isolated from each of the three used medium was performed, for a total of ~300 strains for each sample. To complete the characterization of the microbial communities in all horizons, Next Generation Sequencing (NGS) analysis was carried out with 454 platform on each of the 12 samples. Moreover, the N2O and CH4 emissions were determined from each pedon. All the parameters were used to highlight the similarities and the differences between and within the pedons. The results

  18. Inhibition of key enzymes linked to type 2 diabetes and sodium nitroprusside-induced lipid peroxidation in rat pancreas by water extractable phytochemicals from some tropical spices.

    Science.gov (United States)

    Adefegha, Stephen Adeniyi; Oboh, Ganiyu

    2012-07-01

    Spices have been used as food adjuncts and in folklore for ages. Inhibition of key enzymes (α-amylase and α-glucosidase) involved in the digestion of starch and protection against free radicals and lipid peroxidation in pancreas could be part of the therapeutic approach towards the management of hyperglycemia and dietary phenolics have shown promising potentials. This study investigated and compared the inhibitory properties of aqueous extracts of some tropical spices: Xylopia aethiopica [Dun.] A. Rich (Annonaceae), Monodora myristica (Gaertn.) Dunal (Annonaceae), Syzygium aromaticum [L.] Merr. et Perry (Myrtaceae), Piper guineense Schumach. et Thonn (Piperaceae), Aframomum danielli K. Schum (Zingiberaceae) and Aframomum melegueta (Rosc.) K. Schum (Zingiberaceae) against α-amylase, α-glucosidase, 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals and sodium nitroprusside (SNP)-induced lipid peroxidation in rat pancreas--in vitro using different spectrophotometric method. Aqueous extract of the spices was prepared and the ability of the spice extracts to inhibit α-amylase, α-glucosidase, DPPH radicals and SNP-induced lipid peroxidation in rat pancreas--in vitro was investigated using various spectrophotometric methods. All the spice extracts inhibited α-amylase (IC(50) = 2.81-4.83 mg/mL), α-glucosidase (IC(50) = 2.02-3.52 mg/mL), DPPH radicals (EC(50) = 15.47-17.38 mg/mL) and SNP-induced lipid peroxidation (14.17-94.38%), with the highest α-amylase & α-glucosidase inhibitory actions and DPPH radical scavenging ability exhibited by X. aethiopica, A. danielli and S. aromaticum, respectively. Also, the spices possess high total phenol (0.88-1.3 mg/mL) and flavonoid (0.24-0.52 mg/mL) contents with A. melegueta having the highest total phenolic and flavonoid contents. The inhibitory effects of the spice extracts on α-amylase, α-glucosidase, DPPH radicals and SNP-induced lipid peroxidation in pancreas (in vitro) could be attributed to the presence of biologically

  19. A major trade-off between structural and photosynthetic investments operative across plant and needle ages in three Mediterranean pines.

    Science.gov (United States)

    Kuusk, Vivian; Niinemets, Ülo; Valladares, Fernando

    2018-04-01

    Pine (Pinus) species exhibit extensive variation in needle shape and size between juvenile (primary) and adult (secondary) needles (heteroblasty), but few studies have quantified the changes in needle morphological, anatomical and chemical traits upon juvenile-to-adult transition. Mediterranean pines keep juvenile needles longer than most other pines, implying that juvenile needles play a particularly significant role in seedling and sapling establishment in this environment. We studied needle anatomical, morphological and chemical characteristics in juvenile and different-aged adult needles in Mediterranean pines Pinus halepensis Mill., Pinus pinea L. and Pinus nigra J. F. Arnold subsp. salzmannii (Dunal) Franco hypothesizing that needle anatomical modifications upon juvenile-to-adult transition lead to a trade-off between investments in support and photosynthetic tissues, and that analogous changes occur with needle aging albeit to a lower degree. Compared with adult needles, juvenile needles of all species were narrower with 1.6- to 2.4-fold lower leaf dry mass per unit area, and had ~1.4-fold thinner cell walls, but needle nitrogen content per dry mass was similar among plant ages. Juvenile needles also had ~1.5-fold greater mesophyll volume fraction, ~3-fold greater chloroplast volume fraction and ~1.7-fold greater chloroplast exposed to mesophyll exposed surface area ratio, suggesting overall greater photosynthetic activity. Changes in needle traits were similar in aging adult needles, but the magnitude was generally less than the changes upon juvenile to adult transition. In adult needles, the fraction in support tissues scaled positively with known ranking of species tolerance of drought (P. halepensis > P. pinea > P. nigra). Across all species, and needle and plant ages, a negative correlation between volume fractions of mesophyll and structural tissues was observed, manifesting a trade-off between biomass investments in different needle functions. These

  20. Potential of Central, Eastern and Western Africa Medicinal Plants for Cancer Therapy: Spotlight on Resistant Cells and Molecular Targets

    Directory of Open Access Journals (Sweden)

    Armelle T. Mbaveng

    2017-06-01

    Full Text Available Cancer remains a major health hurdle worldwide and has moved from the third leading cause of death in the year 1990 to second place after cardiovascular disease since 2013. Chemotherapy is one of the most widely used treatment modes; however, its efficiency is limited due to the resistance of cancer cells to cytotoxic agents. The present overview deals with the potential of the flora of Central, Eastern and Western African (CEWA regions as resource for anticancer drug discovery. It also reviews the molecular targets of phytochemicals of these plants such as ABC transporters, namely P-glycoprotein (P-gp, multi drug-resistance-related proteins (MRPs, breast cancer resistance protein (BCRP, ABCG2 as well as the epidermal growth factor receptor (EGFR/ErbB-1/HER1, human tumor suppressor protein p53, caspases, mitochondria, angiogenesis, and components of MAP kinase signaling pathways. Plants with the ability to preferentially kills resistant cancer cells were also reported. Data compiled in the present document were retrieved from scientific websites such as PubMed, Scopus, Sciencedirect, Web-of-Science, and Scholar Google. In summary, plant extracts from CEWA and isolated compounds thereof exert cytotoxic effects by several modes of action including caspases activation, alteration of mitochondrial membrane potential (MMP, induction of reactive oxygen species (ROS in cancer cells and inhibition of angiogenesis. Ten strongest cytotoxic plants from CEWA recorded following in vitro screening assays are: Beilschmiedia acuta Kosterm, Echinops giganteus var. lelyi (C. D. Adams A. Rich., Erythrina sigmoidea Hua (Fabaceae, Imperata cylindrical Beauv. var. koenigii Durand et Schinz, Nauclea pobeguinii (Pobég. ex Pellegr. Merr. ex E.M.A., Piper capense L.f., Polyscias fulva (Hiern Harms., Uapaca togoensis Pax., Vepris soyauxii Engl. and Xylopia aethiopica (Dunal A. Rich. Prominent antiproliferative compounds include: isoquinoline alkaloid isotetrandrine (51

  1. Potential of Central, Eastern and Western Africa Medicinal Plants for Cancer Therapy: Spotlight on Resistant Cells and Molecular Targets

    Science.gov (United States)

    Mbaveng, Armelle T.; Kuete, Victor; Efferth, Thomas

    2017-01-01

    Cancer remains a major health hurdle worldwide and has moved from the third leading cause of death in the year 1990 to second place after cardiovascular disease since 2013. Chemotherapy is one of the most widely used treatment modes; however, its efficiency is limited due to the resistance of cancer cells to cytotoxic agents. The present overview deals with the potential of the flora of Central, Eastern and Western African (CEWA) regions as resource for anticancer drug discovery. It also reviews the molecular targets of phytochemicals of these plants such as ABC transporters, namely P-glycoprotein (P-gp), multi drug-resistance-related proteins (MRPs), breast cancer resistance protein (BCRP, ABCG2) as well as the epidermal growth factor receptor (EGFR/ErbB-1/HER1), human tumor suppressor protein p53, caspases, mitochondria, angiogenesis, and components of MAP kinase signaling pathways. Plants with the ability to preferentially kills resistant cancer cells were also reported. Data compiled in the present document were retrieved from scientific websites such as PubMed, Scopus, Sciencedirect, Web-of-Science, and Scholar Google. In summary, plant extracts from CEWA and isolated compounds thereof exert cytotoxic effects by several modes of action including caspases activation, alteration of mitochondrial membrane potential (MMP), induction of reactive oxygen species (ROS) in cancer cells and inhibition of angiogenesis. Ten strongest cytotoxic plants from CEWA recorded following in vitro screening assays are: Beilschmiedia acuta Kosterm, Echinops giganteus var. lelyi (C. D. Adams) A. Rich., Erythrina sigmoidea Hua (Fabaceae), Imperata cylindrical Beauv. var. koenigii Durand et Schinz, Nauclea pobeguinii (Pobég. ex Pellegr.) Merr. ex E.M.A., Piper capense L.f., Polyscias fulva (Hiern) Harms., Uapaca togoensis Pax., Vepris soyauxii Engl. and Xylopia aethiopica (Dunal) A. Rich. Prominent antiproliferative compounds include: isoquinoline alkaloid isotetrandrine (51), two

  2. Post-Fire Seedling Recruitment and Morpho-Ecophysiological Responses to Induced Drought and Salvage Logging in Pinus halepensis Mill. Stands

    Directory of Open Access Journals (Sweden)

    Daniel Moya

    2015-05-01

    Full Text Available Salvage logging is the commonest post-fire emergency action, but has unclear ecological effects. In the Mediterranean Basin, drought periods and fire regimes are changing and forest management should be adapted. In summer 2009, a mid-high severity fire burned 968 ha of Aleppo pine (Pinus halepensis Mill. forest in southeast Spain, which was submitted to salvage logging six months later. In spring 2010, plots were set in untreated and logged areas to monitor the recruitment and survival of the main tree species and three companion species: Stipa tenacissima L. (resprouter, Cistus clusii Dunal and Rosmarinus officinalis L. (obligate seeders. We evaluated responses to different scenarios in relation to intensification of summer droughts and forest management to obtain differences in water stress, growth, and gas exchange to cope with summer drought. Drought was induced by using rain-exclusion shelters and recorded ecophysiological characteristics were obtained with a portable gas exchange system. The main tree species recruitment was poor, but companion species showed a high survival ratio. Lower water stress was found for obligate seeder seedlings, which was higher in logged areas with induced drought. The initial post-fire stage was similar for the studied areas. However, after two drought periods (2010 and 2011, significant differences were found in the morphological and ecophysiological responses. In the unmanaged area, the biggest size of individuals due to the most marked increases in height and coverage were observed mainly in resprouter S. tenacissima. In the area submitted to salvage logging, the growth ratios in plots with induced drought were lower, mainly for seeders. Greater productivity was related to higher transpiration, stomatal conductance, and net photosynthetic ratio, but lower water use efficiency was found in obligate seeders with no drought induction, and S. tenacissima obtained higher values in untreated areas. Our results

  3. Effect of seasonal variations on the phytoconstituents of Aśvagandhā w.r. to lunar cycles

    Directory of Open Access Journals (Sweden)

    Swagata Dilip Tavhare

    2016-01-01

    Aim: To assess the effect of seasonal variations on the phytoconstituents of Aśvagandhā (Withania somnifera L. Dunal w.s.r. to lunar cycles. Material and Methods: The plant specimens were collected from Jamnagar identified pharmacognostically and cultivated under a defined habitat in a herbal garden of IPGT and RA on 7 Oct 2013. The root samples were collected on every paurṃimā (full moon and amāvāsyā (new moon days in śiśira and grīşṃa ṃṛtu (as per classics of the year 2013-14. The physicochemical parameters such as pH, ash values, extractive value, total alkaloid content, total flavonoids content (UV spectrometer with AlCl3 reagent, total phenolic content (Singleton and Rossi method, total carbohydrate content (UV spectroscopy with glucose as standard, UV-VIS-NIR and HPTLC were determined. Result: The results of the analytical studies clearly validate the logic of the recommendations of Suśruta and Cakrapāṃi. According to these recommendations, uşṃa vīrya drugs must be collected during āgneya ṃṛtu i.e. grīşṃa ṃṛtu. In present study, total phenolic, flavonide and carbohydrate content were found more in pournima samples. GAP samples showed maximum differentiation from rest of the samples with regards to TCA, TCW, TFW, MEx, WEX, pH etc. parameters. The Grīşṃa Jyeşṃha Paurṃimā (GJP and Āşāḍha Paurṃimā (GAP samples were found to be superior than amāvāsyā samples w.r.t. functional groups and withanoloid content respectively on HPTLC. Conclusion: The observations of experimental studies validate the concept of seasonal as well as lunar collection of herb Ashwagandha to yield a drug of superior quality of active principles.

  4. Temporal effects of prescribed burning on terpene production in Mediterranean pines.

    Science.gov (United States)

    Valor, Teresa; Ormeño, Elena; Casals, Pere

    2017-12-01

    Prescribed burning is used to reduce fuel hazard but underburning can damage standing trees. The effect of burning on needle terpene storage, a proxy for secondary metabolism, in fire-damaged pines is poorly understood despite the protection terpenes confer against biotic and abiotic stressors. We investigated variation in needle terpene storage after burning in three Mediterranean pine species featuring different adaptations to fire regimes. In two pure-stands of Pinus halepensis Mill. and two mixed-stands of Pinus sylvestris L. and Pinus nigra ssp. salzmanni (Dunal) Franco, we compared 24 h and 1 year post-burning concentrations with pre-burning concentrations in 20 trees per species, and evaluated the relative contribution of tree fire severity and physiological condition (δ13C and N concentration) on temporal terpene dynamics (for mono- sesqui- and diterpenes). Twenty-four hours post-burning, monoterpene concentrations were slightly higher in P. halepensis than at pre-burning, while values were similar in P. sylvestris. Differently, in the more fire-resistant P. nigra monoterpene concentrations were lower at 24 h, compared with pre-burning. One year post-burning, concentrations were always lower compared with pre- or 24 h post-burning, regardless of the terpene group. Mono- and sesquiterpene variations were negatively related to pre-burning δ13C, while diterpene variations were associated with fire-induced changes in needle δ13C and N concentration. At both post-burning times, mono- and diterpene concentrations increased significantly with crown scorch volume in all species. Differences in post-burning terpene contents as a function of the pine species' sensitivity to fire suggest that terpenic metabolites could have adaptive importance in fire-prone ecosystems in terms of flammability or defence against biotic agents post-burning. One year post-burning, our results suggest that in a context of fire-induced resource availability, pines likely prioritize

  5. Sucessão vegetal em uma encosta reflorestada com leguminosas arbóreas em Angra dos Reis, RJ Natural succession under a nitrogen-fixing legume trees stand in a hillside at Angra dos Reis - RJ, Brazil

    Directory of Open Access Journals (Sweden)

    Sylvia de Souza Chada

    2004-12-01

    Full Text Available Em uma encosta reflorestada há sete anos com leguminosas arbóreas (Acacia auriculiformis, A. mangium e Mimosa tenuiflora em Angra dos Reis, RJ, foi avaliada a composição florística e fitossociológica da regeneração natural, comparando-as com as de um fragmento de Mata Secundária situado a 200 m de distância. Foram considerados os três terços da encosta, com declividades decrescentes. Em 12 parcelas de 200 m², quatro em cada terço da encosta, foram amostrados 699 indivíduos vegetais a partir de 40 cm de altura, distribuídos em 25 famílias e 50 espécies. As famílias com maior nº de indivíduos foram Meliaceae (298, Euphorbiaceae (70, Piperaceae (64 e Lauraceae (41. Já as famílias com maior nº de espécies foram Solanaceae (7, Melastomataceae (5 e Myrtaceae (5. As leguminosas plantadas não estavam regenerando na própria área. A evolução da sucessão natural apresentou um gradiente de desenvolvimento em razão da menor declividade e menor distância dos remanescentes florestais, com maior densidade de indivíduos e maior riqueza de espécies na área de menor declividade.The floristic composition and natural regeneration under a 7-year-old legume tree plantation (Acacia auriculiformis, A. mangium e Mimosa tenuiflora was investigated in comparing with a secondary forest 200 m away at Angra dos Reis, RJ. The hillside was divided in 3 parts following the slope. The lower part of the hillside was the nearest to the natural forest remnant. In 12 plots with 200 m² each, 4 of them in each section of the hillside, 699 plants larger then 40 cm height were observed, distributed in 25 families and 50 species. The families with the most individuals were Meliaceae (298, Euphorbiaceae (70, Piperaceae (64 and Lauraceae (41. The families with the most species were Solanaceae (7, Melastomataceae (5 and Myrtaceae (5. None of the legume species introduced in the area had produced natural regeneration. The evolution of natural succession

  6. Flora apícola primaveral en la región del Monte de la Provincia de La Pampa (Argentina Springtime beekeeping flora in the Monte region of La Pampa province (Argentine

    Directory of Open Access Journals (Sweden)

    Ofelia Naab

    Full Text Available Con el fin de evaluar la flora utilizada por Apis mellifera L. fueron analizadas muestras de miel inmadura y cargas corbiculares de dos apiarios demostradores ubicados en la Provincia Fitogeográfica del Monte, Provincia de La Pampa. Las muestras se extrajeron periódicamente durante la primavera y fueron analizadas aplicando las técnicas melisopalinológicas convencionales. La vegetación arbustiva nativa presentó la mayor abundancia y el mayor número de especies en óptima floración en noviembre. Las familias más representadas en los espectros polínicos de mieles inmaduras y de cargas corbiculares fueron: Zygophyllaceae ( Larrea divaricata Cav., Rhamnaceae ( Condalia microphylla Cav., Solanaceae ( Lycium sp., Asteraceae ( Senecio subulatus Don ex Hook. & Arn. y Verbenaceae ( Glandularia sp. - Junellia sp. - Verbena sp.. Los análisis polínicos evidenciaron que las especies nativas ofrecieron al mismo tiempo recursos nectaríferos y poliníferos sin embargo se observó una alta selección de pocos recursos florales. La oferta floral produjo mieles monoflorales de L. divaricata , C. microphylla y Lycium sp. Ambos apiarios pudieron diferenciarse teniendo en cuenta la diversidad de tipos polínicos y la presencia de ciertos taxones en las categorías de polen dominante y secundario.In order to evaluate the utilized flora by Apis mellifera L. we analized inmmature honey samples and corbicular pollen loads from two demonstrative apiaries located in the Monte Phytogeographical Province of La Pampa. The samples were periodically collected during springtime and were analyzed using the conventional melissopalynological techniques. The native flora presented the major abundance and the highest number of species at an optimum flowering level in november. The most represented families in the pollen spectrum of immature honeys and corbicular loads were: Zygophyllaceae ( Larrea divaricata Cav., Rhamnaceae ( Condalia microphylla Cav., Solanaceae

  7. Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition

    Directory of Open Access Journals (Sweden)

    O'Brien Kimberly

    2008-06-01

    Full Text Available Abstract Background The Solanaceae family contains a number of important crop species including potato (Solanum tuberosum which is grown for its underground storage organ known as a tuber. Albeit the 4th most important food crop in the world, other than a collection of ~220,000 Expressed Sequence Tags, limited genomic sequence information is currently available for potato and advances in potato yield and nutrition content would be greatly assisted through access to a complete genome sequence. While morphologically diverse, Solanaceae species such as potato, tomato, pepper, and eggplant share not only genes but also gene order thereby permitting highly informative comparative genomic analyses. Results In this study, we report on analysis 89.9 Mb of potato genomic sequence representing 10.2% of the genome generated through end sequencing of a potato bacterial artificial chromosome (BAC clone library (87 Mb and sequencing of 22 potato BAC clones (2.9 Mb. The GC content of potato is very similar to Solanum lycopersicon (tomato and other dicotyledonous species yet distinct from the monocotyledonous grass species, Oryza sativa. Parallel analyses of repetitive sequences in potato and tomato revealed substantial differences in their abundance, 34.2% in potato versus 46.3% in tomato, which is consistent with the increased genome size per haploid genome of these two Solanum species. Specific classes and types of repetitive sequences were also differentially represented between these two species including a telomeric-related repetitive sequence, ribosomal DNA, and a number of unclassified repetitive sequences. Comparative analyses between tomato and potato at the gene level revealed a high level of conservation of gene content, genic feature, and gene order although discordances in synteny were observed. Conclusion Genomic level analyses of potato and tomato confirm that gene sequence and gene order are conserved between these solanaceous species and that

  8. Bats (Mammalia, Chiroptera in the Ponta Grossa region, Campos Gerais, Paraná, Brazil Morcegos (Mammalia, Chiroptera na região de Ponta Grossa, Campos Gerais, Paraná, Brasil

    Directory of Open Access Journals (Sweden)

    Cibele M. V. Zanon

    2007-06-01

    Full Text Available The diet, reproduction and activity time of bat species found in Ponta Grossa county, Campos Gerais region, were studied. Collections were conducted in four forest fragments, during 272 hours, on 48 m² of nets and roosting sites; the total capture effort was 1.52.10³ h.m². Eight species (247 individuals were registered: Artibeuslituratus (Olfers, 1818, Sturniralilium (E. Geoffroy, 1810, Desmodusrotundus (E. Geoffroy, 1810 (Phyllostomidae; Tadaridabrasiliensis (Desmarest, 1819, Eumopsauripendulus (Shaw, 1800 (Molossidae; Eptesicusbrasiliensis (Shaw, 1800, Myotisnigricans (Schinz, 1821, and Histiotusvelatus (I. Geoffroy, 1824 (Vespertilionidae. The Phyllostomidae family was the most frequently captured. Solanaceae, Moraceae, Piperaceae, and Rosaceae were found in the diet of frugivores; six orders of insects and the class Arachnida were found in the diets of insectivores. Pregnant females were found in September and October and lactating ones in November and December. The collection peak was reached in the second hour-and-a-half. Preservation of the regional forested and altered areas is required for survival of the local chiropterofauna.Estudou-se as espécies de morcegos presentes em Ponta Grossa, na região dos Campos Gerais, Paraná, com o objetivo de conhecer seus aspectos ecológicos básicos (dieta, reprodução e horário de atividade. Realizou-se coletas em quatro fragmentos florestais, onde foram empregadas 272 horas de esforço com 48 m² de redes, e em locais de repouso, totalizando um esforço de captura de 1,52.10³ h.m². Registrou-se 247 indivíduos, de oito espécies: Artibeuslituratus (Olfers, 1818, Sturniralilium (E. Geoffroy, 1810, Desmodusrotundus (E. Geoffroy, 1810 (Phyllostomidae; Tadaridabrasiliensis (Desmarest, 1819, Eumopsauripendulus (Shaw, 1800 (Molossidae; Eptesicusbrasiliensis(Shaw, 1800, Myotisnigricans (Schinz, 1821, Histiotusvelatus (I. Geoffroy, 1824 (Vespertilionidae. Phyllostomidae foi a família mais

  9. Abundância e frugivoria da quiropterofauna (Mammalia, chiroptera de um fragmento no noroeste do Estado do Paraná, Brasil = Chiropterofauna abundance and frugivory in a forest remnant in northwestern Paraná State, Brazil

    Directory of Open Access Journals (Sweden)

    João Eduardo Cavalcanti Brito

    2010-07-01

    Full Text Available A abundância e a frugivoria de morcegos que compõem a taxocenose em uma área de mata ripária, à margem esquerda do rio Ivaí, foram foco do presente estudo. O Recanto Marista possui 57,6 hectares, dos quais 40,8 são cobertos por Floresta Estacional Semidecidual, situado no município de Doutor Camargo, região Noroeste do Estado do Paraná. Foram realizadas 14 noites de capturas de morcegos de maio de 2007 a janeiro de 2008, com redesneblina (7 x 2,5 m, totalizando 13.475 m² h de esforço amostral, distribuído em 72h de esforço. Foram capturados 193 indivíduos, representantes de dez espécies, pertencentes a duas famílias: Phyllostomidae (Artibeus lituratus, Sturnira lilium, Carollia perspicillata, Artibeus cf. fimbriatus, Artibeus planirotris, Desmodus rotundus e Pygoderma bilabiatum e Vespertilionidae (Myotis nigricans, Eptesicus sp. e Lasiurus blossevillii. Um representante da família Molossidae (Molossus rufus foi encontrado morto no solo. Foram consumidos frutos pertencentes às famílias Moraceae (Ficus guaranitica, Ficus insipida, Ficus sp. e Maclura tinctoria, Solanaceae (Solanum aspero-lanatum e Solanum sp., Piperaceae (Piper aduncum, Piper amalago e Piper sp. e Urticaceae (Cecropia pachystachya e Cecropia sp..This study aims to evaluate the abundance and frugivory of bats from the Recanto Marista, a small riparian forest remnant in the margins of the Ivaí river. The Recanto Marista has 57.6 ha, of which 40.8 ha are covered by semideciduous seasonal forest and is located in the Doutor Camargo municipality. Collections were conducted from May 2007to January 2008 using mist nets (7 x 2.5 m totaling 13,475 m² h and comprising about 72 hours. Ten species were found pertaining to two families, Phyllostomidae (Artibeus lituratus, Sturnira lilium, Carollia perspicillata, Artibeus cf. fimbriatus, Artibeus planirotris, Desmodus rotundus and Pygoderma bilabiatum and Vespertilionidae (Myotis nigricans, Eptesicus sp. and Lasiurus

  10. Nicotine Analysis in Several Non-Tobacco Plant Materials

    Directory of Open Access Journals (Sweden)

    Moldoveanu Serban C.

    2016-04-01

    Full Text Available Present study describes the determination of nicotine in various plant samples with a low content of this compound. Nicotine is found naturally in plants from the Solanaceae family. The plants from Nicotiana genus contain large levels of nicotine. However, only low levels are present in plants from Solanum genus including potato, tomato, eggplant, and from Capsicum genus, which are used as food. Because the levels of nicotine in these materials are in the range of parts per billion, the measurements are difficult and the results are very different from study to study. The present study evaluated the level of nicotine in a number of plants (fruits, roots, leaves, tubers from Solanaceae family (not including Nicotiana genus and from several other vegetables commonly used as food. The analysis consisted of the treatment of plant material with an aqueous solution 5% NaOH at 70°C for 30 min, followed by extraction with TBME containing d3-nicotine as an internal standard. The TBME organic layer was analyzed on a 7890B/7000C GC-MS/MS system with a 30 m × 0.25 mm, 0.25 μm film CAM column. The MS/MS system worked in MRM positive ionization mode monitoring the transition 162 - 84 for nicotine and 165 - 87 for d3-nicotine. Particular attention was given to the preservation of the intact levels of nicotine in the plant material. The plant material was analyzed as is, without drying and with minimal exposure to contaminations. Separately, the moisture of the plant material was measured in order to report the nicotine level on a dry-basis. Levels of nicotine around 180 ng/g dry material were obtained for tomatoes and eggplant (fruit and lower levels were obtained for green pepper and potato. Similar levels to that in the tomato fruit were detected in tomato leaves. Materials from other plant families also showed traces of nicotine. [Beitr. Tabakforsch. Int. 27 (2016 54-59

  11. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  12. Determinação dos parâmetros anatômicos, físico-químico e fitoquímicos das folhas de Solanum lycocarpum A. St.- Hill

    Directory of Open Access Journals (Sweden)

    M.E. GALLON

    2015-01-01

    Full Text Available RESUMO A espécie vegetal Solanum lycocarpum, Solanaceae, popularmente conhecida como lobeira, está distribuída por todo o Brasil, principalmente em áreas do cerrado. Estudos comprovam que os frutos possuem diversas atividades e, atualmente, estão sendo utilizados no tratamento da diabetes. As folhas são utilizadas popularmente contra afecções das vias urinárias, cólicas abdominais e renais, espasmos e epilepsia, porém são poucos os estudos científicos que verificam as atividades farmacológicas das folhas. Assim, torna-se necessária a determinação de parâmetros anatômicos, físico-químicos e fitoquímicos que auxiliarão em futuras identificações e controle de qualidade da droga vegetal. Neste estudo foi realizada a coleta, secagem e pulverização das folhas de Solanum lycocarpum para a obtenção da droga vegetal e posterior caracterização desta. As análises microscópicas do pecíolo, nervura central e mesofilo revelaram características típicas da família Solanaceae, observando-se um sistema vascular bicolateral e a presença de areia cristalina e tricomas estrelados. A triagem fitoquímica, constatou a presença de taninos, flavonoides, esteróides e triterpenos, cumarinas e saponinas. Obteve-se o teor médio de 9,90% de perda por dessecação, 7,91% de cinzas totais e de 0,37% de cinzas insolúveis em ácidos. Para as substâncias extraíveis por álcool, o teor médio encontrado foi de 14,479% para o método de extração por Soxhlet e 0,987% para o método de extração a frio. Assim, espera-se que esses dados possam ser utilizados na identificação e controle de qualidade da droga vegetal de Solanum lycocarpum para a produção de novos medicamentos fitoterápicos.

  13. Alien flora of Turkey: checklist, taxonomic composition and ecological attributes

    Directory of Open Access Journals (Sweden)

    Ahmet Uludag

    2017-06-01

    Full Text Available The paper provides an updated checklist of the alien flora of Turkey with information on its structure. The alien flora of Turkey comprises 340 taxa, among which there are 321 angiosperms, 17 gymnosperms and two ferns. Of the total number of taxa, 228 (68% are naturalized and 112 (32% are casual. There are 275 neophytes (172 naturalized and 103 casual and 61 archaeophytes (52 naturalized and 9 casual; four species could not be classified with respect to the residence time. In addition, 47 frequently planted taxa with a potential to escape are also listed. The richest families are Asteraceae (38 taxa, Poaceae (30, Fabaceae (23 and Solanaceae (22. As for the naturalized alien plants, the highest species richness is found in Asteraceae (31 taxa, Poaceae (22, Amaranthaceae (18 and Solanaceae (15. The majority of alien taxa are perennial (63.8% of the total number of taxa with this life history assigned, including those with multiple life histories, annuals contribute 33.8% and 2.4% are biennial aliens. Among perennials the most common life forms are phanerophytes, of which 20.3% are trees and 12.6% shrubs; woody vines, stem succulents, and aquatic plants are comparatively less represented. Most of the 340 alien taxa introduced to Turkey have their native ranges in Americas (44.7% and Asia (27.6%. Of other regions, 9.1% originated in Africa, 4.4% in Eurasia, 3.8% in Australia and Oceania and 3.5% in the Mediterranean. The majority of taxa (71.9% were introduced intentionally, whereas the remaining (28.1% were introduced accidentally. Among the taxa introduced intentionally, the vast majority are ornamental plants (55.2%, 10.0% taxa were introduced for forestry and 6.7% as crops. Casual alien plants are most commonly found in urban and ruderal habitats (40.1% where naturalized taxa are also often recorded (27.3%. Plants that occur as agricultural weeds are typically naturalized rather than casual (16.0% vs 7.1%, respectively. However, (seminatural

  14. Mortalidad y repelencia en Eupalamides cyparissias (Lepidoptera: Castniidae, plaga de la palma aceitera Elaeis guineensis, por efecto de diez extractos botánicos Mortality and repellence of Eupalamides cyparissias (Lepidoptera: Castniidae, pest of oil palm Elaeis guineensis, by effect of ten botanical extracts

    Directory of Open Access Journals (Sweden)

    Diana D. Pérez

    2008-06-01

    Full Text Available Las plantas con actividad insecticida constituyen un importante componente del manejo integrado de plagas. Bajo esta premisa, el objetivo del presente estudio fue evaluar la mortalidad y repelencia larval de Eupalamides cyparissias Fab. (Lepidoptera: Castniidae, plaga de la palma aceitera Elaeis guineensis Jacquin; empleando diez plantas con potencial insecticida: Ucullucuysacha (Heliotropium indicum L., Boraginaceae, Floripondio (Brugmansia x candida Pers., Solanaceae, Oreja de Tigre (Tradescantia zebrina Hort ex Bosse, Commelinaceae, Piñón Blanco (Jathropa curcas L., Euphorbiaceae, Sacha yoco (Paullinia clavigera Schltdl., Sapindaceae, Yuquilla (Euphorbia cotinifolia L., Euphorbiaceae, Achiote (Bixa orellana L., Bixaceae, Retama común (Cassia fistula L., Fabaceae, Huancahuisacha (Aristolochia pilosa Kunth, Aristolochiaceae y Curare (Chondrodendron tomentosum Ruiz & Pavon, Menispermaceae. Los bioensayos con E. cyparissias abarcaron entre 1 h y 24 h, bajo condiciones estandardizadas de laboratorio. A 24 h de exposición, los mayores porcentajes de mortalidad de E. cyparissias se presentaron en los tratamientos con Sacha yoco (63,3 %: corteza y hojas en decocción, Achiote (63,3 %: semillas en licuado y Yuquilla (48,3 %: hojas en licuado. En el caso de la repelencia, los mayores efectos se encontraron en los tratamientos con Achiote (83,30 %, Sacha yoco (75 % y Floripondio (66,7 %: hojas en licuado.The plants with insecticide activities constitute a main compound of integrated pest management. Under this premise, the aim of the current research was to evaluate mortality and repellence of Eupalamides cyparissias Fab. (Lepidoptera: Castniidae larvae, pest of oil palm Elaeis guineensis Jacquin, employing ten plants with insecticide potential: Indian heliotrope (Heliotropium indicum L., Boraginaceae, Angel´s trumpets (Brugmansia x candida Pers., Solanaceae, Wandering Jew (Tradescantia zebrina Hort ex Bosse, Commelinaceae, Nettles-purge (Jathropa

  15. Vascular flora of the Upper Paraná River floodplain Flora vascular da planície de inundação do Alto Rio Paraná

    Directory of Open Access Journals (Sweden)

    MC. Souza

    2009-06-01

    Full Text Available The purpose of this study was to update the floristic inventory found in the Upper Paraná River floodplain. Floristic surveys were performed from February 2000 through March 2008, as part of the Brazilian Long-Term Ecological Research Program (PELD/CNPq -Site 6. The material collected was identified from 774 species, 442 genera, and 116 families. The ten families with high species richness were Leguminosae, Poaceae, Rubiaceae, Asteraceae, Euphorbiaceae, Myrtaceae, Cyperaceae, Solanaceae, Sapindaceae, and Orchidaceae, which contributed to 46.1% of the total number of species. Genera with high richness were Solanum, Cyperus, Panicum, Eugenia, Tillandsia, Serjania, Casearia, and Polygonum, which together contributed to 10.2% of the total number of species. These data, combined with information published in 1997, recorded 955 species, 575 genera, and 128 families. These organisms were from several riparian environments and were distributed as herbs, shrubs, trees, climbers and epiphytes. Panicum maximum, Pennisetum purpureum, Ricinus communis, and Urochloa decumbens are considered weeds due to the wide distributions determined for these species. The results presented herein suggest the need to further investigate the control of these potential weed species.Com o objetivo de ampliar os conhecimentos sobre a flora da planície de inundação do Alto Rio Paraná, foram conduzidos inventários florísticos no período de fevereiro de 2000 a março de 2008, incluídos no Programa Brasileiro de Pesquisas Ecológicas de Longa Duração (PELD/CNPq - Sítio 6. O material coletado foi identificado em 774 espécies, 442 gêneros e 116 famílias. As dez famílias de maior riqueza de espécies foram Leguminosae, Poaceae, Rubiaceae, Asteraceae, Euphorbiaceae, Myrtaceae, Cyperaceae, Solanaceae, Sapindaceae e Orchidaceae, que juntas reuniram 46,1% do total do número de espécies. Os gêneros com maior riqueza de espécies foram Solanum, Cyperus, Panicum, Eugenia

  16. Abundância e frugivoria da quiropterofauna (Mammalia, chiroptera de um fragmento no noroeste do Estado do Paraná, Brasil - doi: 10.4025/actascibiolsci.v32i3.5351 Chiropterofauna abundance and frugivory in a forest remnant in northwestern Paraná State, Brazil - doi: 10.4025/actascibiolsci.v32i3.5351

    Directory of Open Access Journals (Sweden)

    Janaina Gazarini

    2010-09-01

    Full Text Available A abundância e a frugivoria de morcegos que compõem a taxocenose em uma área de mata ripária, à margem esquerda do rio Ivaí, foram foco do presente estudo. O Recanto Marista possui 57,6 hectares, dos quais 40,8 são cobertos por Floresta Estacional Semidecidual, situado no município de Doutor Camargo, região Noroeste do Estado do Paraná. Foram realizadas 14 noites de capturas de morcegos de maio de 2007 a janeiro de 2008, com redes-neblina (7 x 2,5 m, totalizando 13.475 m² h de esforço amostral, distribuído em 72h de esforço. Foram capturados 193 indivíduos, representantes de dez espécies, pertencentes a duas famílias: Phyllostomidae (Artibeus lituratus, Sturnira lilium, Carollia perspicillata, Artibeus cf. fimbriatus, Artibeus planirotris, Desmodus rotundus e Pygoderma bilabiatum e Vespertilionidae (Myotis nigricans, Eptesicus sp. e Lasiurus blossevillii. Um representante da família Molossidae (Molossus rufus foi encontrado morto no solo. Foram consumidos frutos pertencentes às famílias Moraceae (Ficus guaranitica, Ficus insipida, Ficus sp. e Maclura tinctoria, Solanaceae (Solanum aspero-lanatum e Solanum sp. , Piperaceae (Piper aduncum, Piper amalago e Piper sp. e Urticaceae (Cecropia pachystachya e Cecropia sp..This study aims to evaluate the abundance and frugivory of bats from the Recanto Marista, a small riparian forest remnant in the margins of the Ivaí river. The Recanto Marista has 57.6 ha, of which 40.8 ha are covered by semideciduous seasonal forest and is located in the Doutor Camargo municipality. Collections were conducted from May 2007 to January 2008 using mist nets (7 x 2.5 m totaling 13,475 m² h and comprising about 72 hours. Ten species were found pertaining to two families, Phyllostomidae (Artibeus lituratus, Sturnira lilium, Carollia perspicillata, Artibeus cf. fimbriatus, Artibeus planirotris, Desmodus rotundus and Pygoderma bilabiatum and Vespertilionidae (Myotis nigricans, Eptesicus sp. and Lasiurus

  17. Shadows of the colonial past--diverging plant use in Northern Peru and Southern Ecuador.

    Science.gov (United States)

    Bussmann, Rainer W; Sharon, Douglas

    2009-02-02

    This paper examines the traditional use of medicinal plants in Northern Peru and Southern Ecuador, with special focus on the Departments of Piura, Lambayeque, La Libertad, Cajamarca, and San Martin, and in Loja province, with special focus on the development since the early colonial period. Northern Peru represents the locus of the old Central Andean "Health Axis." The roots of traditional healing practices in this region go as far back as the Cupisnique culture early in the first millennium BC. Northern Peru and Southern Ecuador share the same cultural context and flora but show striking differences in plant use and traditional knowledge. Two hundred fifteen plant species used for medicinal purposes in Ecuador and 510 plant species used for medicinal purposes in Peru were collected, identified,. and their vernacular names, traditional uses, and applications recorded. This number of species indicates that the healers, market vendors, and members of the public interviewed in Peru still have a very high knowledge of plants in their surroundings, which can be seen as a reflection of the knowledge of the population in general. In Ecuador much of the original plant knowledge has already been lost. In Peru, 433 (85%) were Dicotyledons, 46 (9%) Monocotyledons, 21 (4%) Pteridophytes, and 5 (1%) Gymnosperms. Three species of Giartina (Algae) and one species of the Lichen genus Siphula were used. The families best represented were Asteraceae with 69 species, Fabaceae (35), Lamiaceae (25), and Solanaceae (21). Euphorbiaceae had 12 species, and Poaceae and Apiaceae each accounted for 11 species. In Ecuador the families best represented were Asteraceae (32 species), Euphorbiaceae, Lamiaceae, and Solanaceae (11 species each), and Apiaceae, Fabaceae, Lycopodiaceae (9 species each). One hundred eighty-two (85%) of the species used were Dicotyledons, 20 Monocotyledons (9.3%), 12 ferns (5.5%), and one unidentified lichen was used. Most of the plants used (83%) were native to Peru

  18. Directory of Open Access Journals (Sweden)

    ELIZABETE S. SEKINE

    2013-01-01

    Full Text Available The aim of this study was to carry out a survey of the flora with potential for beekeeping in the counties of Ubiratã and Nova Aurora-PR through the collection of plants and pollen analyses in honey samples collected monthly. 208 species of plants were recorded, distributed in 66 families. The families that showed the major richness of pollen types were: Asteraceae, Myrtaceae and Solanaceae. Approximately 80 pollen types were found in honey samples, most of them were characterized as heterofloral. Cultivated plants, such as Glycine max (soybean and Eucalyptus spp., were representative in some months of the year. Exotic species, such as Ricinus communis and Melia azedarach, were also frequent. However, over than 50% of the pollen types belong to native species of the region, such as Schinus terebinthifolius, Baccharis spp. Alchornea triplinervia, Parapiptadenia rigida, Hexaclamys edulis, Zanthoxylum sp. and Serjania spp., indicating the importance of the native vegetation for the survival of the colonies.O objetivo deste trabalho foi realizar um levantamento da flora com potencial apícola nos municípios de Ubiratã e Nova Aurora-PR, por meio da coleta de plantas e análises polínicas em amostras de mel coletadas mensalmente. Foram registradas 208 espécies de plantas, distribuídas em 66 famílias. As famílias que apresentaram maior riqueza de tipos polínicos foram Asteraceae, Myrtaceae e Solanaceae. Aproximadamente 80 tipos polínicos foram encontrados nas amostras de mel e, na maioria, foram caracterizados como heteroflorais. Plantas cultivadas, como Glycine max (soja e Eucalyptus spp. foram representativas em alguns meses do ano. Espécies exóticas, tais como Ricinus communis and Melia azedarach também foram frequentes. No entanto, mais de 50% dos tipos polínicos pertencem a espécies nativas da região, tais como Schinus terebinthifolius, Baccharis spp., Alchornea triplinervea, Parapiptadenia rigida, Hexaclamys edulis, Zanthoxylum sp

  19. Establishing of a Cape gooseberry working collection collected in the colombian southwest zone Establecimiento de una colección de trabajo de uchuva del suroccidente colombiano

    Directory of Open Access Journals (Sweden)

    Espinosa Piedrahíta Katherine

    2008-06-01

    Full Text Available Physalis peruviana L. is a promissory fruit specie for the Andean Colombian zone, however, it has not been a priority genetic resource for conservation. In this study a working collection of 222 accessions collected in the states of Nariño, Valle del Cauca, Cauca, Caldas, Quindío and Cundinamarca of Colombia was established and registered in a computational data base. It represent the variability present of native and spontaneous varieties. Seeds of the collected materials are available in cold room in the Experimental Centre of The National University of Colombia campus Palmira. This collection contributes to the conservation and genetic diversity studies in this specie, besides for implementing selection and breeding programs..Key words: Physalis peruviana ; Solanaceae; genetic diversity; germplasm bank.Physalis peruviana L. es una especie frutícola promisoria para la zona andina colombiana; sin embargo, no ha sido un recurso genético prioritario de conservación. En el estudio se estableció una colección de trabajo registrada en una base de datos computarizada de 222 accesiones recolectadas en los departamentos de Nariño, Valle del Cauca, Cauca, Caldas, Quindío y Cundinamarca que representan la variabilidad existente de cultivariedades nativas y espontáneas. Las semillas del material recolectado se encuentran en el cuarto frío del Centro Experimental de la Universidad Nacional de Colombia sede Palmira. Esta colección contribuye a la conservación y al estudio de la diversidad de esta especie y a la disponibilidad de una base genética para

  20. Dr. Roberto Miguel Klein Herbarium (FURB), Blumenau, Southern Brazil.

    Science.gov (United States)

    de Gasper, André Luís; Vibrans, Alexander Christian; Funez, Luís Adriano; Rigon, Morilo José; Bittencourt, Felipe; Vieira, Carina

    2014-01-01

    The premise of this study is to present the collection of the FURB herbarium, its collection area and type specimens, as well as its projects and contributions to the flora of the Subtropical Atlantic Forest. The FURB herbarium currently has nearly 41,000 records of vascular plants and has the largest collection of lycophytes and ferns in Southern Brazil, with more than 8,000 records. More than 4,500 scanned images of 4,436 species are available online, and it is expected that the whole collection will be scanned in less than one year. There are 198 families of angiosperms, 33 of ferns, three of lycophytes and six of gymnosperms. All collections of the Floristic and Forest Inventory of Santa Catarina project are recorded in FURB, which represents almost 35,000 herbarium specimens. The families with the largest number of species are: Cyperaceae (109 species), Rubiaceae (129), Solanaceae (131), Poaceae (155), Melastomataceae (157), Myrtaceae (257), Orchidaceae (288), Fabaceae (323), and Asteraceae (426), between angiosperms. Among the ferns and lycophytes are: Hymenophyllaceae (30), Thelypteridaceae (31), Aspleniaceae (32), Dryopteridaceae (43), Pteridaceae (54) and Polypodiaceae (60). There are five type specimens among them: one holotype, one isotype and three paratypes. To date, the FURB herbarium has donated 19,521 herbarium duplicates for identification or expansion of other herbaria.

  1. Mortalidad y repelencia en Eupalamides cyparissias (Lepidoptera: Castniidae, plaga de la palma aceitera Elaeis guineensis, por efecto de diez extractos botánicos

    Directory of Open Access Journals (Sweden)

    Diana D. PÉREZ

    2008-01-01

    Full Text Available Las plantas con actividad insecticida constituyen un importante componente del manejo integrado de plagas. Bajo esta premisa, el objetivo del presente estudio fue evaluar la mortalidad y repelencia larval de Eupalamides cyparissias Fab. (Lepidoptera: Castniidae, plaga de la palma aceitera Elaeis guineensis Jacquin; empleando diez plantas con potencial insecticida: Ucullucuysacha ( Heliotropium indicum L., Boraginaceae, Floripondio ( Brugmansia x candida Pers., Solanaceae, Oreja de Tigre ( Tradescantia zebrina Hort ex Bosse, Commelinaceae, Piñón Blanco ( Jathropa curcas L., Euphorbiaceae, Sacha yoco ( Paullinia clavigera Schltdl., Sapindaceae, Yuquilla ( Euphorbia cotinifolia L., Euphorbiaceae, Achiote ( Bixa orellana L., Bixaceae, Retama común ( Cassia fistula L., Fabaceae, Huancahuisacha ( Aristolochia pilosa Kunth, Aristolochiaceae y Curare ( Chondrodendron tomentosum Ruiz & Pavon, Menispermaceae. Los bioensayos con E. cyparissias abarcaron entre 1 h y 24 h, bajo condiciones estandardizadas de laboratorio. A 24 h de exposición, los mayores porcentajes de mortalidad de E. cyparissias se presentaron en los tratamientos con Sacha yoco (63,3 %: corteza y hojas en decocción, Achiote (63,3 %: semillas en licuado y Yuquilla (48,3 %: hojas en licuado. En el caso de la repelencia, los mayores efectos se encontraron en los tratamientos con Achiote (83,30 %, Sacha yoco (75 % y Floripondio (66,7 %: hojas en licuado.

  2. Ectopic expression of MPF2-like protein WSA206 leads to arrest in silique and seed development in heterologous host

    International Nuclear Information System (INIS)

    Khan, M.R.

    2016-01-01

    MPF2-like genes belonging to STMADS11 clade of MADS-box transcription factors are mostly involved in calyx inflation, floral reversion and fertility. However their role in fertility remained enigmatic. In this study we transformed WSA206 gene paralog - originated through genome duplication in a Solanaceous plant Withaniasomnifera - ectopically in a heterologous host Arabidopsis thaliana. Interesting phenotypes in floral organs and fruits were observed. Overexpression of WSA206 leads to arrest in silique development. The siliques were compressed and size was drastically reduced from 34mm to 3mm. Along with siliques, the seed development was also suppressed as revealed by shriveling of seeds and reduction in seed number. In extreme cases the siliques were devoid of any seeds. In cases where seeds developed, these were impaired in viability. Besides, the transgenic Arabidopsis also exhibited exorbitant growth of calyx to an extent that it resembled inflated calyx in Solanaceae. The calyx remained persistent and encapsulated the under-developed siliques containing non-viable seeds inside. Thus, fertility and sepal development are tightly coupled traits that are controlled by WSA206 paralog in heterologous system. (author)

  3. Antiparasitic herbs used in west regions ofIlam province located in west of Iran

    Directory of Open Access Journals (Sweden)

    Mahmoud Bahmani

    2014-09-01

    Full Text Available Objective: To identify antiparasitic medicinal plants used by people in southern regions of Ilam province in Iran. Methods: This study was carried out using questionnaire and interview method between February 2012 and April 2013 and also by means of public resources. Along with distributing questionnaires herbarium specimens of each plant were collected and then their genus and species were determined in the Natural Resources Research Center of Ilam province. Results: A total of 19 medicinal plants used as antiparasitic plants belonged to 14 families were identified in southern regions of Ilam province. Majority of antiparasite herbs were related to Compositeae (11%, Rosaceae (11%, Solanaceae (11%, Liliaceae (11%, and Asteraceae (11% families. Aerial parts with 28% were the most plant organs used for the treatment of parasitic diseases. Results of this study showed that infusion with 83% is the most popular form of herbal medications in southern regions of Ilam province. Conclusions: The report of medicinal plants belonged to northern regions of this province may provide necessary condition for researchers to identify effective substances and to study the clinical effects claimed for these plants and their effective substances on different parasitic diseases while traditional effects of these plants are documented.

  4. Allocation plasticity and plant-metal partitioning: Meta-analytical perspectives in phytoremediation

    Energy Technology Data Exchange (ETDEWEB)

    Audet, Patrick [Ottawa-Carleton Institute of Biology, Department of Biology, University of Ottawa, 30 Marie-Curie Street, Ottawa, ON K1N 6N5 (Canada)], E-mail: paude086@uottawa.ca; Charest, Christiane [Ottawa-Carleton Institute of Biology, Department of Biology, University of Ottawa, 30 Marie-Curie Street, Ottawa, ON K1N 6N5 (Canada)], E-mail: ccharest@uottawa.ca

    2008-11-15

    In this meta-analysis of plant growth and metal uptake parameters, we selected 19 studies of heavy metal (HM) phytoremediation to evaluate trends of allocation plasticity and plant-metal partitioning in roots relative to shoots. We calculated indexes of biomass allocation and metal distribution for numerous metals and plant species among four families of interest for phytoremediation purposes (e.g. Brassicaceae, Fabaceae, Poaceae, and Solanaceae). We determined that plants shift their biomass and distribute metals more to roots than shoots possibly to circumvent the challenges of increasing soil-HM conditions. Although this shift is viewed as a stress-avoidance strategy complementing intrinsic stress-tolerance, our findings indicate that plants express different levels of allocation plasticity and metal partitioning depending on their overall growth strategy and status as 'fast-grower' or 'slow-grower' species. Accordingly, we propose a conceptual model of allocation plasticity and plant-metal partitioning comparing 'fast-grower' and 'slow-grower' strategies and outlining applications for remediation practices. - This meta-analysis has revealed a shift in plant biomass and metal distribution from shoots to roots possibly to protect vital functions when subjected to metal stress.

  5. Allocation plasticity and plant-metal partitioning: Meta-analytical perspectives in phytoremediation

    International Nuclear Information System (INIS)

    Audet, Patrick; Charest, Christiane

    2008-01-01

    In this meta-analysis of plant growth and metal uptake parameters, we selected 19 studies of heavy metal (HM) phytoremediation to evaluate trends of allocation plasticity and plant-metal partitioning in roots relative to shoots. We calculated indexes of biomass allocation and metal distribution for numerous metals and plant species among four families of interest for phytoremediation purposes (e.g. Brassicaceae, Fabaceae, Poaceae, and Solanaceae). We determined that plants shift their biomass and distribute metals more to roots than shoots possibly to circumvent the challenges of increasing soil-HM conditions. Although this shift is viewed as a stress-avoidance strategy complementing intrinsic stress-tolerance, our findings indicate that plants express different levels of allocation plasticity and metal partitioning depending on their overall growth strategy and status as 'fast-grower' or 'slow-grower' species. Accordingly, we propose a conceptual model of allocation plasticity and plant-metal partitioning comparing 'fast-grower' and 'slow-grower' strategies and outlining applications for remediation practices. - This meta-analysis has revealed a shift in plant biomass and metal distribution from shoots to roots possibly to protect vital functions when subjected to metal stress

  6. Evolutionary divergence of the plant elicitor peptides (Peps) and their receptors: interfamily incompatibility of perception but compatibility of downstream signalling

    KAUST Repository

    Lori, M.

    2015-05-22

    Plant elicitor peptides (Peps) are potent inducers of pattern-triggered immunity and amplify the immune response against diverse pathogens. Peps have been discovered and studied extensively in Arabidopsis and only recently orthologs in maize were also identified and characterized in more detail. Here, the presence of PROPEPs, the Pep precursors, and PEPRs, the Pep receptors, was investigated within the plant kingdom. PROPEPs and PEPRs were identified in most sequenced species of the angiosperms. The conservation and compatibility of the Pep-PEPR-system was analysed by using plants of two distantly related dicot families, Brassicaceae and Solanaceae, and a representative family of monocot plants, the Poaceae. All three plant families contain important crop plants, including maize, rice, tomato, potato, and canola. Peps were not recognized by species outside of their plant family of origin, apparently because of a divergence of the Pep sequences. Three family-specific Pep motifs were defined and the integration of such a motif into the Pep sequence of an unrelated Pep enabled its perception. Transient transformation of Nicotiana benthamiana with the coding sequences of the AtPEPR1 and ZmPEPR1a led to the recognition of Pep peptides of Brassicaceae or Poaceae origin, respectively, and to the proper activation of downstream signalling. It was concluded that signalling machinery downstream of the PEPRs is highly conserved whereas the leucine-rich repeat domains of the PEPRs co-evolved with the Peps, leading to distinct motifs and, with it, interfamily incompatibility.

  7. RESPOSTA FUNCIONAL DA JOANINHA CRYPTOLAEMUS PREDANDO COCHONILHA BRANCA EM DIFERENTES TEMPERATURAS E SUBSTRATOS VEGETAIS

    Directory of Open Access Journals (Sweden)

    SERGIO ANTONIO DE BORTOLI

    2014-01-01

    Full Text Available This work was carried out to evaluate the functional response of Cryptolaemus montrouzieri Mulsant, 1850 (Coleoptera: Coccinellidae fed with Planococcus citri Risso, 1813 (Hemiptera: Pseudococcidae reared on a pumpkin hybrid (Cucurbita maxima x Cucurbita moscata (Cucurbitaceae, seedlings of Rangpur lime (Citrus limonia Rutaceae and potato (Solanum tuberosum (Solanaceae at two temperatures. The predation rate of C. montrouzieri was measured using Petri dishes of 15 cm diameter with 1, 2, 4, 8, 16 and 24 adults of P. Citri. One third instar larva, one fourfh instar and one newly emerged adult (without differentiation of sex of C. montrouzieri were added to each plate. The study was conducted in climatic chambers at temperatures of 25 and 30 º C and photophase of 12 hours. The predation rate was evaluated after 24 hours of prey exposition to the predator, by counting the number of preys trapped in the different treatments and control. The statistical design was completely randomized with four treatments x 6 subplots with 7 repetitions, the two temperatures. The values obtained were subjected to analysis of variance, to relate the number of scales preyed by larvae and adults of C. montrouzieri set up in different substrates. The amount of prey consumed by larvae and adults of the predator increased with increasing the prey density until it reaches a plateau, characterizing functional response type II. In general, the number of scales preyed by larvae and adults of C. montrouzieri was higher on potato and under temperature of 30 °C.

  8. Phytophthora infestans population structure: A worldwide scale

    International Nuclear Information System (INIS)

    Cardenas, Martha; Danies, Giovanna; Tabima, Javier; Bernal, Adriana; Restrepo, Silvia

    2012-01-01

    Phytophthora infestans, the causal agent of late blight disease in potato and other members of the Solanaceae family, is responsible for causing the Irish potato famine and, even today, it causes enormous economic losses all over the world. For the establishment of an adequate pest management strategy, the determination of the pathogen's population structure is required. To characterize P. infestans populations worldwide two allozymes, Gpi (Glucose-6-phospate isomerase) and Pep (Pep tidase), the RG57 DNA RFLP fingerprinting probe, as well as resistance to the fungicide metalaxyl and mating type, have been used as markers. P. infestans populations in Mexico have been one of the main focuses of research in the population biology of this pathogen because this country has been considered as one of the possible centers of origin of this oomycete. In this review we present the population structure of P. infestans in Mexico, Europe, Africa, Asia, North America, and South America, expanding it on the present situation of P. infestans in Colombia. Finally, we will discuss different lines of research that are being carried out today with respect to P. infestans in Colombia, which have shown the importance of continuing the study of this devastating plant pathogen in our country.

  9. Phytophthora infestans population structure: a worldwide scale

    Directory of Open Access Journals (Sweden)

    Martha Cárdenas Toquica

    2012-05-01

    Full Text Available Phytophthora infestans, the causal agent of late blight disease in potato and other members of the Solanaceae family, is responsible for causing the Irish potato famine and, even today, it causes enormous economic losses all over the world. For the establishment of an adequate pest management strategy, the determination of population structure is required. To characterize P. infestans populations worldwide two allozymes, Gpi (Glucose-6-phospate isomerase and Pep (Peptidase, the RG57 DNA RFLP fingerprinting probe, as well as resistance to the fungicide metalaxyl and the mating type, have been used as markers. P. infestans populations in Mexico have been one of the main focuses of research in the population biology of this pathogen because this country has been considered as one of the possible centers of origin of this oomycete. In this review we present the population structure of P. infestans in Mexico, Europe, Africa, Asia, North America, and South America expanding on the present situation of P. infestans in Colombia. Finally, we will discuss different lines of research that are being carried out today with respect to P. infestans in Colombia, which have shown the importance of continuing the study of this devastating plant pathogen in our country.

  10. Solanum paniculatum root extract reduces diarrhea in rats

    Directory of Open Access Journals (Sweden)

    Jonh A.B. Tenório

    Full Text Available Abstract Solanum paniculatum L., Solanaceae, locally known as "jurubeba", is widely used in Brazil for culinary purposes, and in folk medicine to treat of diverse disorder including gastric dysfunctions. In this study we investigated the antidiarrheal activity of S. paniculatum roots extract in rats at different concentrations (125, 250 and 500 mg/kg, p.o using different experimental models such as castor oil-induced diarrhea, enteropooling and gastrointestinal motility, determined by in vivo experimental models. The major compound of root extract was characterized as chlorogenic acid based in the IR, 1D and 2D NMR analysis. All the extract doses achieved antidiarrheal potency, as indicated by reduced weight of feces in castor oil-induced diarrhea, decreased intestinal motility and significantly inhibited castor oil-induced enteropooling compared to the vehicle group. The highest dose (500 mg/kg produced greater anti-motility effect and better reduction of enteropooling, similar to the reference drug Loperamide (5 mg/kg. Extract from S. paniculatum L. roots had antidiarrheal activity, as shown by the lower weight of the feces as well as decrease in the accumulation of intestinal fluid and slower transit, justifying the traditional use of plant for diarrhea.

  11. The effect of tomato juices and bean sprout extracts on vitro shoot regeneration of Physalis angulata L.

    Science.gov (United States)

    Mastuti, Retno; Munawarti, Aminatun; Rosyidah, Mufidatur

    2017-11-01

    Physalis angulata L. (Ciplukan) which belongs to Solanaceae is an important medicinal plant. In vitro culture medium contains carbon source, inorganic substance, vitamins, and plant growth regulators. However, organic growth supplements have frequently been added to improve regeneration capability of explants. This study was conducted to observe the effect of tomato juices and extract bean sprout on shoot regeneration and multiplication of in vitro nodal explants. The explants were cultured on MS basal medium + 6-benzyl amino purine (BAP) 2 mg/L + indole-3-acetic acid (IAA) 0.05 mg/L with and without organic supplements. Tomato juices (T) 5, 7.5 and 10% or bean sprout extract (B) 1.25, 2.5, and 3.75% were added as natural organic supplements. Almost all explants have produced shoots one week after culture. After six weeks of culture maximum shoot number (12.5±3.9) was produced in medium MS + T5 while maximum shoot length (10.7 ± 0.7 cm) was obtained in medium MS + T 7.5. Medium T tends to produce more shoots than the medium B and medium control. This result indicates the potential of natural organic supplements for supporting Ciplukan propagation through in vitro culture.

  12. Chrysomelinae species (Coleoptera, Chrysomelidae) and new biological data from Rio de Janeiro, Brazil

    Science.gov (United States)

    Flinte, Vivian; Abejanella, André; Daccordi, Mauro; Monteiro, Ricardo F.; Macedo, Margarete Valverde

    2017-01-01

    Abstract Chrysomelinae is one of the largest subfamilies in Chrysomelidae, yet much basic information remains unknown for Neotropical species. The present study aims to compile the first regional list of Chrysomelinae for the State of Rio de Janeiro, Brazil, and assemble natural history traits obtained from our fieldwork from 2005 to 2010 in Serra dos Órgãos National Park, a mountainous area of Atlantic forest. The species list was compiled from data from field work, collections, and literature, and recorded a total of 100 species, belonging to 21 genera in one tribe (Chrysomelini) and three subtribes: Chrysolinina (91 species), Chrysomelina (eight species) and Entomoscelina (one species). Of these, 91 species are new records for the state. Serra dos Órgaõs National Park holds records of 43 species, with Platyphora being the most species-rich genus, and Solanaceae the most common host plant family. Some new records of reproductive mode (larviparous vs. oviparous) and larval behavior are also given. These Brazil Chrysomelinae species exhibited a clear seasonal pattern, with more species recorded in the hot and rainy season from October to January, and considerably fewer species from June to August, during the drier and colder months. The fraction of new records in comparison with published species and natural history information illustrates how little we know of Chrysomelinae in the state and in the country. PMID:29391849

  13. Comparison of bioassays using the anostracan crustaceans Artemia salina and Thamnocephalus platyurus for plant extract toxicity screening

    Directory of Open Access Journals (Sweden)

    Pablo Mayorga

    2010-10-01

    Full Text Available Three lethality bioassays, using the salt-water crustacean Artemia salina Leach, Artemiidae, (conventional 96 microwell plate test and the Artoxkit M microbiotest and the freshwater crustacean Thamnocephalus platyurus Packard, Thamnocephalidae, (Thamnotoxkit F microbiotest, were compared using extracts of ten Guatemalan plant species. It was previously observed that five of them have anti-Artemia activity. These were: Solanum americanum Mill., Solanaceae, Gliricidia sepium (Jacq. Kunth ex Walp., Fabaceae, Neurolaena lobata (L. Cass., Asteraceae, Petiveria alliacea L., Phytolaccaceae, and Ocimum campechianum Mill., Lamiaceae. The five others: Curatella americana L., Dilleniaceae, Prunus barbata Koehne, Rosaceae, Quercus crispifolia Trel., Fagaceae, Rhizophora mangle L., Rhizophoraceae, and Smilax domingensis Willd., Smilacaceae, do not. All plants without anti-Artemia activity had no lethal effects in both assays with A. salina. For the plants with anti-Artemia activity the Artoxkit M was not sensitive to G. sepium and the conventional Artemia test was not sensitive to S. americanum, G. sepium and N. lobata. All the plant extracts, except for that of C. americana, had lethal effects on T. platyurus and the lethal median concentration (LC50 levels for this organism were in all cases substantially lower than those of the salt-water test species. This study revealed that T. platyurus is a promising test species worth further in depth investigation for toxicity screening of plant extracts with potential medicinal properties.

  14. Multilocus Sequence Analysis of Cercospora spp. from Different Host Plant Families

    Directory of Open Access Journals (Sweden)

    Floreta Fiska Yuliarni

    2014-06-01

    Full Text Available Identification of the genus Cercospora is still complicated due to the host preferences often being used as the main criteria to propose a new name. We determined the relationship between host plants and multilocus sequence variations (ITS rDNA including 5.8S rDNA, elongation factor 1-α, and calmodulin in Cercospora spp. to investigate the host specificity. We used 53 strains of Cercospora spp. infecting 12 plant families for phylogenetic analysis. The sequences of 23 strains of Cercospora spp. infecting the plant families of Asteraceae, Cucurbitaceae, and Solanaceae were determined in this study. The sequences of 30 strains of Cercospora spp. infecting the plant families of Fabaceae, Amaranthaceae, Apiaceae, Plumbaginaceae, Malvaceae, Cistaceae, Plantaginaceae, Lamiaceae, and Poaceae were obtained from GenBank. The molecular phylogenetic analysis revealed that the majority of Cercospora species lack host specificity, and only C. zinniicola, C. zeina, C. zeae-maydis, C. cocciniae, and C. mikaniicola were found to be host-specific. Closely related species of Cercospora could not be distinguished using molecular analyses of ITS, EF, and CAL gene regions. The topology of the phylogenetic tree based on the CAL gene showed a better topology and Cercospora species separation than the trees developed based on the ITS rDNA region or the EF gene.

  15. Checklist of the vascular flora of the sub-Andean forest at the Cachalu Biological Reserve, Santander (Colombia)

    International Nuclear Information System (INIS)

    Medina Ruth; Reina Miriam; Herrera Edna; Avila Fabio Andres; Chaparro Omar; Cortes B, Rocio

    2010-01-01

    A preliminary checklist of the vascular flora of the Reserva Biologica Cachalu is presented. Cachalu is located on the western slope of the Eastern Andes (Encino - Santander), and represents a sample of the sub - Andean forest of the Colombian Andes. The material was collected over a period of seven months in 2007 and 2008. General collections were carried out through Cachalu, and in a permanent plot at an altitudinal range between 1800 and 2350 m. A total of 443 species, included in 257 genera, and 101 families were recorded. Angiosperms represent 96% of the vascular flora, while pteridophyta 3.5% and gymnosperms only 0.5%. The Rubiaceae family has the highest richness at the genus and species level (18/36), followed by Melastomataceae (13/30), Orchidaceae (13/25), Asteraceae (13/21) and Solanaceae (8/21). The genera Psychotria, Miconia, Solanum and Anthurium show the highest number of species. For each species, the catalog contains the scientific name, collections used, habit, and the altitudinal range. The affinities of the flora of Cachalu with similar forests at the Guantiva - La Rusia - Iguaque biological corridor are discussed. Additionally, species considered at any level of threat are pointed so that they may be prioritized in restoration and conservation programs.

  16. Ácaros predadores (Acari em plantas nativas e cultivadas do Estado do Rio Grande do Sul, Brasil Predators mites (Acari in native and cultivated plants of the State of Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Noeli Juarez Ferla

    2002-12-01

    Full Text Available This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the families Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the sample plants. Most of the Phytoseiidae that were met belong to five species of the Euseius Wainstein, 1962 genus, the second genus of this family was Iphiseiodes DeLeon, 1966, with just one species. The Stigmaeidae come up as second family in number but fewer than Phytoseiidae. In this family, the most common mite belong to the Agistemus Sumers, 1960 genus. The biggest of the mites species (13 species, was met in Morus spp. (Moraceae and Tabebuia spp. (Bignoniaceae; Phaseolus vulgaris (Papilionaceae; only one species of the mite was met in Campomanesia spp. (Myrtaceae, Phaseolus vulgaris (Papilionaceae and Rosa spp. (Rosaceae. In Alamanda spp.(Apocinaceae, Ficus spp. (Moraceae, Jacaranda mimosifolia (Bignoniaceae and Solanum spp. (Solanaceae were met mites predators. A dichotomic key is presented to separate the families, genus and species of the mites.

  17. A Comprehensive Study of Molecular Evolution at the Self-Incompatibility Locus of Rosaceae.

    Science.gov (United States)

    Ashkani, Jahanshah; Rees, D J G

    2016-03-01

    The family Rosaceae includes a range of important fruit trees, most of which have the S-RNase-based self-incompatibility (SI). Several models have been developed to explain how pollen (SLF) and pistil (S-RNase) components of the S-locus interact. It was discovered in 2010 that additional SLF proteins are involved in pollen specificity, and a Collaborative Non-Self Recognition model has been proposed for SI in Solanaceae; however, the validity of such model remains to be elucidated for other species. The results of this study support the divergent evolution of the S-locus genes from two Rosaceae subfamilies, Prunoideae/Amygdaloideae and Maloideae, The difference identified in the selective pressures between the two lineages provides evidence for positive selection at specific sites in both the S-RNase and the SLF proteins. The evolutionary findings of this study support the role of multiple SLF proteins leading to a Collaborative Non-Self Recognition model for SI in the Maloideae. Furthermore, the identification of the sites responsible for SI specificity determination and the mapping of these sites onto the modelled tertiary structure of ancestor proteins provide useful information for rational functional redesign and protein engineering for the future engineering of new functional alleles providing increased diversity in the SI system in the Maloideae.

  18. Floristic Inventory, Ecological Characteristics and Biological Spectrum of Plants of Parachinar, Kurram Agency, Pakistan

    International Nuclear Information System (INIS)

    Badshah, L; Hussain, F.; Sher, Z.

    2016-01-01

    The present work was carried out to evaluate the floristic checklist and environmental distinctiveness of Plants of Parachinar, Kurram Agency across the year during 2014- 2015. A total of 283 species of 222 genera among 85 families were recorded. Asteraceae with (29 Sp.) was the most dominant followed by, Poaceae with (20 Sp.), Papilionaceae, Lamiaceae each with (19 Sp.), Brassicaceae (16 Sp.), Solanaceae (13 Sp.), Rosaceae (9 Sp.) and Polygonaceae (7 Sp.). While Euphorbiaceae, Caryophylaceae and Pinaceaeeach with (6 Sp.) were the co-dominant taxa. Rest of the families possessed either 5 or fewer species. Based on the habitat 252 (89.04 percent) species were grew in dry places as wild mesophytes and xerophytes. Seventeen species (6.00 percent) were cultivated while 11 species (3.88 percent) were aquatic. There were 18 spiny species (6.36 percent). Among the perennial, majority were evergreen. Three species (1.06 percent) namely Cuscutareflexa, Periplocaaphylla and P. calophyllawere leafless. The leaf lamina was simple in 230 species (81.27 percent) and 50 species (17.66 percent) contained composite foliage. Therophytes107 (37.80 percent) and nanophanerophyte 47 species (16.66 percent) respectively were dominant life form groups. Leaf spectra revealed that nanophylls with 121 species (42.75 percent) and leptophylls with 89 (31.44 percent) were dominant leaf size classes. The vegetation was also characterized by microphylls and mesophylls but of least concern. (author)

  19. Insights into the Prunus-Specific S-RNase-Based Self-Incompatibility System from a Genome-Wide Analysis of the Evolutionary Radiation of S Locus-Related F-box Genes.

    Science.gov (United States)

    Akagi, Takashi; Henry, Isabelle M; Morimoto, Takuya; Tao, Ryutaro

    2016-06-01

    Self-incompatibility (SI) is an important plant reproduction mechanism that facilitates the maintenance of genetic diversity within species. Three plant families, the Solanaceae, Rosaceae and Plantaginaceae, share an S-RNase-based gametophytic SI (GSI) system that involves a single S-RNase as the pistil S determinant and several F-box genes as pollen S determinants that act via non-self-recognition. Previous evidence has suggested a specific self-recognition mechanism in Prunus (Rosaceae), raising questions about the generality of the S-RNase-based GSI system. We investigated the evolution of the pollen S determinant by comparing the sequences of the Prunus S haplotype-specific F-box gene (SFB) with those of its orthologs in other angiosperm genomes. Our results indicate that the Prunus SFB does not cluster with the pollen S of other plants and diverged early after the establishment of the Eudicots. Our results further indicate multiple F-box gene duplication events, specifically in the Rosaceae family, and suggest that the Prunus SFB gene originated in a recent Prunus-specific gene duplication event. Transcriptomic and evolutionary analyses of the Prunus S paralogs are consistent with the establishment of a Prunus-specific SI system, and the possibility of subfunctionalization differentiating the newly generated SFB from the original pollen S determinant. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. Medicinal plants with potential anti-arthritic activity.

    Science.gov (United States)

    Choudhary, Manjusha; Kumar, Vipin; Malhotra, Hitesh; Singh, Surender

    2015-01-01

    Traditional medicinal plants are practiced worldwide for treatment of arthritis especially in developing countries where resources are meager. This review presents the plants profiles inhabiting throughout the world regarding their traditional usage by various tribes/ethnic groups for treatment of arthritis. Bibliographic investigation was carried out by analyzing classical text books and peer reviewed papers, consulting worldwide accepted scientific databases from the last six decades. Plants/their parts/extracts/polyherbal formulations, toxicity studies for arthritis have been included in the review article. The profiles presented also include information about the scientific name, family, dose, methodology along with mechanism of action and toxicity profile. Research status of 20 potential plant species has been discussed. Further, geographical distribution of research, plants distribution according to families has been given in graphical form. 485 plant species belonging to 100 families, traditionally used in arthritis are used. Among 100 plant families, malvaceae constitute 16, leguminasae 7, fabaceae 13, euphorbiaceae 7, compositae 20, araceae 7, solanaceae 12, liliaceae 9, apocynaceae, lauraceae, and rubiaceae 10, and remaining in lesser proportion. It was observed in our study that majority of researches are carried mainly in developing countries like India, China, Korea and Nigeria. This review clearly indicates that list of medicinal plants presented in this review might be useful to researchers as well as practioners. This review can be useful for preliminary screening of potential anti-arthritis plants. Further toxicity profile given in the review can be useful for the researchers for finding the safe dose.

  1. Medicinal plants from the Yanesha (Peru): evaluation of the leishmanicidal and antimalarial activity of selected extracts.

    Science.gov (United States)

    Valadeau, Céline; Pabon, Adriana; Deharo, Eric; Albán-Castillo, Joaquina; Estevez, Yannick; Lores, Fransis Augusto; Rojas, Rosario; Gamboa, Dionicia; Sauvain, Michel; Castillo, Denis; Bourdy, Geneviève

    2009-06-25

    Ninety-four ethanolic extracts of plants used medicinally by the Yanesha, an Amazonian Peruvian ethnic group, for affections related to leishmaniasis and malaria were screened in vitro against Leishmania amazonensis amastigotes and against a Plasmodium falciparum chloroquine resistant strain. The viability of Leishmania amazonensis amastigote stages was assessed by the reduction of tetrazolium salt (MTT) while the impact on Plasmodium falciparum was determined by measuring the incorporation of radio-labelled hypoxanthine. Six plant species displayed good activity against Plasmodium falciparum chloroquine resistant strain (IC(50) Piper aduncum L. and Piper sp.) and the leaves of Jacaranda copaia (Aubl.) D. Don (Bignoniaceae). Eight species displayed interesting leishmanicidal activities (IC50 < 10 microg/ml): Carica papaya L. (Caricaceae), Piper dennisii Trel (Piperaceae), Hedychium coronarium J. König (Zingiberaceae), Cestrum racemosum Ruiz & Pav. (Solanaceae), Renealmia alpinia (Rottb.) Zingiberaceae, Lantana sp. (Verbenaceae), Hyptis lacustris A. St.-Hil. ex Benth. (Lamiaceae) and Calea montana Klat. (Asteraceae). Most of them are used against skin affections by Yanesha people. Results are discussed herein, according to the traditional use of the plants and compared with data obtained from the literature.

  2. The WRKY transcription factor genes in eggplant (Solanum melongena L.) and Turkey Berry (Solanum torvum Sw.).

    Science.gov (United States)

    Yang, Xu; Deng, Cao; Zhang, Yu; Cheng, Yufu; Huo, Qiuyue; Xue, Linbao

    2015-04-07

    WRKY transcription factors, which play critical roles in stress responses, have not been characterized in eggplant or its wild relative, turkey berry. The recent availability of RNA-sequencing data provides the opportunity to examine WRKY genes from a global perspective. We identified 50 and 62 WRKY genes in eggplant (SmelWRKYs) and turkey berry (StorWRKYs), respectively, all of which could be classified into three groups (I-III) based on the WRKY protein structure. The SmelWRKYs and StorWRKYs contain ~76% and ~95% of the number of WRKYs found in other sequenced asterid species, respectively. Positive selection analysis revealed that different selection constraints could have affected the evolution of these groups. Positively-selected sites were found in Groups IIc and III. Branch-specific selection pressure analysis indicated that most WRKY domains from SmelWRKYs and StorWRKYs are conserved and have evolved at low rates since their divergence. Comparison to homologous WRKY genes in Arabidopsis revealed several potential pathogen resistance-related SmelWRKYs and StorWRKYs, providing possible candidate genetic resources for improving stress tolerance in eggplant and probably other Solanaceae plants. To our knowledge, this is the first report of a genome-wide analyses of the SmelWRKYs and StorWRKYs.

  3. Use of alpha-ionol + cade oil for detection and monitoring of Bactrocera latifrons (Diptera: Tephritidae) populations

    Energy Technology Data Exchange (ETDEWEB)

    McQuate, Grant T.; Jang, Eric B., E-mail: grant.mcquate@ars.usda.go, E-mail: eric.jang@ars.usda.go [U.S. Department of Agriculture (USDA/ARS), Hilo, HI (United States). Pacific Basin Agricultural Research Center; Bokonon-Ganta, Aime H., E-mail: aimehbg@hawaii.ed [University of Hawaii (CTAHR/PEPS/UH), Honolulu, HI (United States). Coll. of Tropical Agriculture and Human Resources. Dept. of Plant and Environmental Protection Sciences

    2006-07-01

    Bactrocera latifrons (Hendel) is a tephritid fruit fly that primarily infests solanaceous fruits. Although primarily of Asian distribution, it has invaded Hawaii and, more recently, the continent of Africa (Tanzania and Kenya). Male B. latifrons uniquely respond to alpha-ionol + cade oil, rather than to either methyl eugenol or cuelure, to which males of the majority of other Dacine fruit flies respond. Here we present research results detailing the age of male B. latifrons response to alpha-ionol + cade oil, the persistence of wick attractiveness, and the effectiveness of alpha-ionol + cade oil in detecting B. latifrons populations. Based on wind tunnel studies with wild flies, male response steadily increased from 5% at age 2 to 45% at age 28, with male response exceeding 50% of the peak response by Day 7 and exceeding 75% and 90% by days 14 and 21, respectively. The attractiveness of wicks treated with 2.0 ml alpha-ionol and 1.0 ml cade oil (on separate wicks) declined over time, with wick response reduced to about 50% of the fresh catch after 6 1/2 weeks. Based on concurrent alpha-ionol + cade oil based trapping and collections of turkey berry, Solanum torvum (Solanaceae), fruits, the presence of B. latifrons was detected at the time of fruit collection, 75.5 % of the time. (author)

  4. MOLECULAR IDENTIFICATION OF Liriomyza sp. IN THE NORTHEAST AND SOUTHEAST REGIONS OF BRAZIL

    Directory of Open Access Journals (Sweden)

    ELAINE CRISTINA BATISTA FERREIRA

    2017-01-01

    Full Text Available In Brazil, species of the genus Liriomyza are widely distributed and have economic importance as they cause damage to at least 14 plant families, especially Solanaceae, Cucurbitaceae, Asteraceae, and Fabaceae. Studies suggest existence of a species complex within this genus, based on the presence of morphological similarities among the species Liriomyza trifolii (Burgess, L. sativae Blanchard and L. huidobrensis (Blanchard. The present study aimed to use DNA barcoding to establish new distribution records of L. sativae in distinct regions in Brazil, determine intra- and inter-population genetic diversity, and reconstruct the phylogeny of Liriomyza species using the DNA barcode sequences. Identity values were between 97% and 99%, confirming that all the examined Brazilian populations belonged to the species L. sativae. Phylogenetic analyses indicated the presence of a single clade of L. sativae, composed of seven populations. Intra-population analysis on individuals of these populations indicated low levels of nucleotide and haplotype diversity. The haplotype network indicated presence of only 14 haplotypes distributed among the Brazilian populations. The genetic similarities shared by the Brazilian populations of L. sativae suggest that these populations are closely related. Genetic patterns observed among populations of L. sativae might be associated with bottleneck events or founder effect during establishment of this leafminer in Brazil.

  5. Herbarium Areqvipense (HUSA: computerization and representativeness of its collection

    Directory of Open Access Journals (Sweden)

    Italo F. Treviño

    2012-11-01

    Full Text Available Scientific collections and herbaria are essential sources of information and education for researchers and practitioners in biological sciences. The Herbarium Areqvipense (HUSA, registered at Index Herbariorum since 2004, holds one of the most important collections in Peru. In this paper we provide information about the collection, and its representativeness for the Peruvian flora. HUSA has more than 11000 specimens recorded to date, with more than 2300 determined species, consisting mostly of Magnoliophyta and Pteridophyta (ca. 98%, and a smaller proportion of Basidiomycetes, Ascomycetes (fungi and lichens and Bryophyta (mosses. The collection includes specimens from 23 departments of Peru, where the samples belonging to Arequipa have the largest number of individuals collected (3375 accounting for 31% of the collection. Asteraceae and Solanaceae are the most collected with 1571 and 964 specimens, respectively. The majority of geo-referenced specimens came from the tropical wet forest with 15%, followed by the tropical pre-montane wet forest with 8%. We also provide a list of the nomenclatural types and a brief summary of the history and development of HUSA since its creation.

  6. The combination effect of auxin and cytokinin on in vitro callus formation of Physalis angulata L. - A medicinal plant

    Science.gov (United States)

    Mastuti, Retno; Munawarti, Aminatun; Firdiana, Elok Rifqi

    2017-11-01

    Physalis angulata L. (Ciplukan) is one member of Solanaceae that has a potential as herbal medicine. This plant grows wild in the crop fields, forest edges, etc. However, ciplukan is increasingly difficult to find recently. In vitro callus is an alternative source to produce secondary metabolite production as well as to regenerate plants through indirect organogenesis. This study aims to identify the response of hypocotyl explants on in vitro callus formation induced by a combination of auxin and cytokinins. Two types of cytokinins, Kinetin and BAP (0.5 ppm) were combined with three types of auxin, i.e. 2.4-D, IBA and IAA, at three concentrations 0.5, 1.0 and 1.5 ppm. In all combinations of cytokinin and auxin, 50-100% of hypocotyl explants derived from in vitro seedling were able to produce callus either in a compact or watery friable texture. In MS medium supplemented with 2.4-D, callus FW (fresh weight) began to decline in the fourth week after culture. Callus FW that increased until 5 weeks of culture was obtained in medium IAA 0.5 + Kin 0.5, IBA 1.0 + Kin 0.5 and IBA 1 + BA 0.5. Almost all calli induced on a medium + Kinetin also produced roots. While medium + BAP was able to induce shoots regeneration.

  7. Biochemical Evaluation of Withania somnifera Root Powder on Adjuvant-Induced Arthritis in Rats

    Directory of Open Access Journals (Sweden)

    Mahaboobkhan Rasool

    2015-04-01

    Full Text Available The present investigation was carried out to evaluate the biochemical effect of Withania somnifera Linn. Solanaceae, commonly known as ashwagandha on adjuvant induced arthritic rats. Results were compared to Indomethacin, a non steroidal anti-inflammatory drug. Arthritis was induced by an intra dermal injection of Complete Freund’s Adjuvant (0.1 ml into the right hind paw of Wistar albino rats. Withania somnifera root powder (1000 mg/kg/day and Indomethacin (3 mg/kg/day were orally administered for 8 days (from 11th to 18th day after adjuvant injection. After the experimental period, all the animals were sacrificed and serum, liver and spleen samples were collected for further biochemical analysis. A significant increase in the activities of gluconeogenic enzymes, tissue marker enzymes, blood glucose level, WBC, platelet count, erythrocyte sedimentation rate, and acute phase proteins (hyaluronic acid, fibrinogen and ceruloplasmin was observed in adjuvant-induced arthritic rats, whereas the activities of glycolytic enzymes, body weight, levels of hemoglobin, RBC count, and packed cell volume were found to be decreased. These biochemical alterations observed in arthritic animals were ameliorated significantly after the administration of Withania somnifera root powder (1000 mg/kg/b.wt and Indomethacin (3 mg/kg/b.wt. Our results suggest that Withania somnifera root powder is capable of rectifying the above biochemical changes in adjuvant arthritis and it may prove to be useful in treating rheumatoid arthritis.

  8. Immature stages of Spodoptera eridania (Lepidoptera: Noctuidae): developmental parameters and host plants.

    Science.gov (United States)

    Montezano, Débora Goulart; Specht, Alexandre; Sosa-Gómez, Daniel Ricardo; Roque-Specht, Vânia Ferreira; de Barros, Neiva Monteiro

    2014-01-01

    This study aimed to detail the temporal and morphological parameters of the immature stages of southern armyworm Spodoptera eridania (Stoll, 1782) with larvae feed on artificial diet, under controlled conditions (25 ± 1°C, 70 ± 10% relative humidity and 14-h photophase) and gather information about their larval host plants. The viability of the egg, larval, pupal, and prepupal stages was 97.82, 93.62, 96.42, and 97.03%, respectively. The average duration of the egg, larval, pupal, and pre-pupal stages was 4.00, 16.18, 1.58, and 9.17 d, respectively. During the larval stage, 43.44% of females passed through seven instars, observing that the female's development was significant slower than males. The female larvae that developed through six and seven instars exhibited a mean growth rate of 1.52 and 1.44, respectively. Female pupae were significantly larger, exhibiting faster development than males. The rearing method proved to be adequate, providing more detailed observations of the biological cycle, especially at the larval stage, and resulting in an overall survival of almost 85%. Two hundred two plant species belonging to 58 families are listed as natural hosts for S. eridania, mainly including Asteraceae, Fabaceae, Solanaceae, Poaceae, Amaranthaceae, and Malvaceae. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

  9. Estimation of capsaicin through scanning densitometry and evaluation of different varieties of capsicum in India.

    Science.gov (United States)

    Gantait, Arunava; Maji, Amal; Barman, Tapu; Banerji, Pratim; Venkatesh, P; Mukherjee, Pulok K

    2012-01-01

    Capsicum annuum L. (family: Solanaceae) possesses therapeutic benefits for the treatment of rheumatism, neuropathy, psoriasis, flatulence and so on. In this study fruits of four different varieties of C. annuum from four different geographical regions in India were evaluated based on their total content of capsaicin. Ethanol extracts of the fruits were used. HPTLC plates were developed in a mobile phase containing benzene, ethyl acetate and methanol (75:20:5). Densitometric scanning was performed at a wavelength of 283 nm in the absorbance mode. The calibration curve was described by the equation Y=393.587+3.836*X with a correlation coefficient (r) of 0.99890. The content of capsaicin in Nagaland, Manipur, West Bengal and Shimla varieties was found to be 3.71%, 1.78%, 0.54% and 0.06%, respectively. The developed densitometric method was found to be specific, accurate and precise. A recovery study and precision showed low levels of %RSD values. The linearity range of the curve for capsaicin was found to be 300-900 ng per spot. The limit of detection and the limit of quantification values were determined to be 31 and 94 ng, respectively, proving the sensitivity of the method. Thus the method can be used to control the total content of capsaicin on an industrial scale.

  10. Physiochemical screening and performance calculation of steroidal saponins from three provenances of Solanum quitoense var. septentrionale Naranjillo

    International Nuclear Information System (INIS)

    Flechas, Henry; Sanchez, Laura; Silva, Jairo

    2008-01-01

    This research includes the study of aerial parts (fruits) of lulo de monte (Solanum quitoense var. Septentrionale).The main objective of this research was to determine the secondary metabolites and especially the presence and quantity of alkaloidal saponins, which are common in the Solanaceae family. These substances are used as precursors for the manufacture of several steroid-type drugs, hormones and anti-inflammatories. The study was conducted with species of three different origins and three different maturing stages gathered in the department of Cundinamarca, Colombia between 2.400 and 2.600 meters above sea level during the period from March to June. Sapogenins were extracted, isolated and purified through various techniques used for this purpose. The presence of saponins was proved through physical and chemical analysis, and the structural elucidation through NMR and IR spectroscopic techniques. The presence of hecogenin in green fruits from the three sources was determined. This molecular structure corresponds to a non-steroidal sapogenin reported in this species.

  11. Interaction networks and the use of floral resources by male orchid bees (Hymenoptera: Apidae: Euglossini in a primary rain forests of the Chocó Region (Colombia

    Directory of Open Access Journals (Sweden)

    Rodulfo Ospina-Torres

    2015-09-01

    Full Text Available Orchid bees are important keystone pollinators from the Neotropics. With the aim to study the relationships between orchid bees and their nectar and aromatic host species, we made systematic samplings of males across two conservation areas in the biogeographic Chocó Region of Colombia. We used chemical baits to collect 352 male bees during five months. The pollen attached to their bodies was extracted for palynological identification and to estimate interaction networks. The euglossine community consisted of at least 22 species including Eg. maculilabris, Eg. orellana, Eg. championiand Eg. ignita.The male bees were associated with 84 plants but depended on a small group of them (Peperomiaspp. and Anthuriumspp, as well as species of Solanaceae, Ericaceae and Malpighiaceae which were widely distributed across the altitudinal gradient, and were available through the year. The resulting interaction networks revealed a typical nested pattern usually found in plant-pollinator interactions, with several rare bee and plant species interaction with a small group of generalist bees and plant species. Albeit, we found variation within networks related to species composition. Such variation may be a consequence of specific differences in plant flowering phenology.

  12. Interaction networks and the use of floral resources by male orchid bees (Hymenoptera: Apidae: Euglossini) in a primary rain forests of the Chocó Region (Colombia).

    Science.gov (United States)

    Ospina-Torres, Rodulfo; Montoya-Pfeiffer, Paula María; Parra-H, Alejandro; Solarte, Victor; Tupac Otero, Joel

    2015-09-01

    Orchid bees are important keystone pollinators from the Neotropics. With the aim to study the relationships between orchid bees and their nectar and aromatic host species, we made systematic samplings of males across two conservation areas in the biogeographic Choc6 Region of Colombia. We used chemical baits to collect 352 male bees during five months. The pollen attached to their bodies was extracted for palynological identification and to estimate interaction networks. The euglossine community consisted of at least 22 species including Eg. maculilabris, Eg. orellana, Eg. championi and Eg. ignita. The male bees were associated with 84 plants but depended on a small group of them (Peperomia spp. and Anthurium spp, as well as species of Solanaceae, Ericaceae and Malpighiaceae) which were widely distributed across the altitudinal gradient, and were available through the year. The resulting interaction networks revealed a typical nested pattern usually found in plant-pollinator interactions, with several rare bee and plant species interaction with a small group of generalist bees and plant species. Albeit, we found variation within networks related to species composition. Such variation may be a consequence of specific differences in plant flowering phenology.

  13. A role in immunity for Arabidopsis cysteine protease RD21, the ortholog of the tomato immune protease C14.

    Directory of Open Access Journals (Sweden)

    Takayuki Shindo

    Full Text Available Secreted papain-like Cys proteases are important players in plant immunity. We previously reported that the C14 protease of tomato is targeted by cystatin-like EPIC proteins that are secreted by the oomycete pathogen Phytophthora infestans (Pinf during infection. C14 has been under diversifying selection in wild potato species coevolving with Pinf and reduced C14 levels result in enhanced susceptibility for Pinf. Here, we investigated the role C14-EPIC-like interactions in the natural pathosystem of Arabidopsis with the oomycete pathogen Hyaloperonospora arabidopsidis (Hpa. In contrast to the Pinf-solanaceae pathosystem, the C14 orthologous protease of Arabidopsis, RD21, does not evolve under diversifying selection in Arabidopsis, and rd21 null mutants do not show phenotypes upon compatible and incompatible Hpa interactions, despite the evident lack of a major leaf protease. Hpa isolates express highly conserved EPIC-like proteins during infections, but it is unknown if these HpaEPICs can inhibit RD21 and one of these HpaEPICs even lacks the canonical cystatin motifs. The rd21 mutants are unaffected in compatible and incompatible interactions with Pseudomonas syringae pv. tomato, but are significantly more susceptible for the necrotrophic fungal pathogen Botrytis cinerea, demonstrating that RD21 provides immunity to a necrotrophic pathogen.

  14. A Validated Reverse Phase HPLC Analytical Method for Quantitation of Glycoalkaloids in Solanum lycocarpum and Its Extracts

    Directory of Open Access Journals (Sweden)

    Renata Fabiane Jorge Tiossi

    2012-01-01

    Full Text Available Solanum lycocarpum (Solanaceae is native to the Brazilian Cerrado. Fruits of this species contain the glycoalkaloids solasonine (SN and solamargine (SM, which display antiparasitic and anticancer properties. A method has been developed for the extraction and HPLC-UV analysis of the SN and SM in different parts of S. lycocarpum, mainly comprising ripe and unripe fruits, leaf, and stem. This analytical method was validated and gave good detection response with linearity over a dynamic range of 0.77–1000.00 μg mL−1 and recovery in the range of 80.92–91.71%, allowing a reliable quantitation of the target compounds. Unripe fruits displayed higher concentrations of glycoalkaloids (1.04% ± 0.01 of SN and 0.69% ± 0.00 of SM than the ripe fruits (0.83% ± 0.02 of SN and 0.60% ± 0.01 of SM. Quantitation of glycoalkaloids in the alkaloidic extract gave 45.09% ± 1.14 of SN and 44.37% ± 0.60 of SM, respectively.

  15. Toxic ornamental plants in Venezuela

    Directory of Open Access Journals (Sweden)

    Carlos Varela Romero

    2017-01-01

    Full Text Available The aim of this research was to contribute information on toxic ornamental plants in Venezuela. Information on taxonomy, common names, habit, origin, status, location, propagation and toxicology (part of the plant, effects was compiled from articles, books, catalogs, herbarium collections. A botanical analysis (taxonomy, common names, habit, origin, status, location, propagation and toxicology (part of the plant, effects was performed. The information about plant poisoning cases was requested to SIMET (Pharmacy faculty -UCV. Seventy-eight species were found in 34 families, the most important were: Apocynaceae (10 genera/12 species, Araceae (9/9, Euphorbiaceae (4/10 and Solanaceae (5/6. Genus Euphorbia was the most species rich. Most species were exotic species (79.5% and shrubs (32.1%. The entire plant (35 and latex (19 were the most toxic parts and the most frequent accidental ingestion (61.5%. Twenty cases were reported between 2009-2013, of which 80% were minors, female and urban areas. There is very little information published in Hispanic American countries

  16. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  17. Characterization of Brugmansia mosaic virus Isolated from Brugmansia spp. in Korea

    Directory of Open Access Journals (Sweden)

    Chung Youl Park

    2014-12-01

    Full Text Available In May 2013, an angel’s trumpet leaves showing mosaic and malformation symptoms were collected from Suwon city, Gyeonggi-do. An analysis of the collected sample by transmission electron microscopy observation showed filamentous rod particles of 720-800 nm in length. On the basis of the these observations, we performed PCR against three reported Potyviruses (Brugmansia mosaic virus, Colombian datura virus and Brugmansia suaveolens mottle virus, and the sample was positive for BruMV. Pathogenicity and host range test of BruMV was determined by mechanical inoculation. Solanaceae (tobacco, tomato and eggplant and Amaranthaceae (ground cherry appeared typical virus symptoms. To determine coat protein of this virus, we designed specific primer pairs, and performed PCR amplification, cloning, and sequencing. Phylogenetic analysis showed that BruMV-SW was most closely related to BruMV isolate SK. Comparison of the BruMV-SW coat protein nucleotide sequences showed 92% to 99% identities to the other BruMV isolates.

  18. Associação de Rhizoctonia solani Grupo de Anastomose 4 (AG-4 HGI e HGIII à espécies de plantas invasoras de área de cultivo de batata Rhizoctonia solani anastomosis group 4 (AG-4 HGI and HGIII associated with weed species from a potato cropping area

    Directory of Open Access Journals (Sweden)

    Fátima Aparecida da Silva-Barreto

    2010-06-01

    Full Text Available Os grupos 3 e 4 de anastomose (AG-3 e AG-4 do fungo Rhizoctonia solani são importantes grupos associados à batata no mundo. No Brasil, o AG-3 é relatado afetando principalmente batata e fumo. Já o AG-4 causa perdas consideráveis em culturas de importância econômica, como a soja, o feijão e o amendoim, podendo ocorrer também em hortaliças como o espinafre, o pimentão, o brócolis, o tomate, a batata e frutíferas como o melão. Recentemente foi constatada, em Brasília-DF, a associação de R. solani a plantas invasoras em áreas de cultivo de batata. Entretanto, não há informação a respeito da etiologia do patógeno bem como do papel de espécies invasoras como outras hospedeiras no ciclo do patógeno. Objetivou-se com esse estudo caracterizar isolados de R. solani obtidos de batata e de outras três espécies de plantas invasoras associadas a áreas de cultivo da cultura: juá-de-capote [Nicandra physaloides (L. Pers., Solanaceae], beldroega (Portulaca oleracea L., Portulacaceae, e caruru (Amaranthus deflexus L., Amaranthaceae. Foi confirmada a hipótese de que os isolados obtidos de R. solani de beldroega, caruru e juá-de-capote pertencem ao grupo 4 de anastomose e são patogênicos à batata, exceto o isolado de beldroega. Estes isolados apresentaram patogenicidade cruzada às três espécies e também patogênicos à maria-pretinha (Solanum americanum Mill., uma outra espécie de Solanaceae invasora. A classificação dos isolados no grupo AG-4 HGI ou no grupo AG-4 HGIII (isolado de caruru foi confirmada através de características culturais e moleculares (seqüenciamento da região ITS-5.8S do rDNA. Os resultados deste trabalho trazem implicações importantes para o manejo das podridões radiculares de Rhizoctonia em batata.The anastomosis groups 3 and 4 (AG-3 and AG-4 of the fungus Rhizoctonia solani are important groups associated with potatoes worldwide. In Brazil, the AG-3 is reported affecting mainly potatoes and

  19. Arabidopsis EF-Tu receptor enhances bacterial disease resistance in transgenic wheat.

    Science.gov (United States)

    Schoonbeek, Henk-Jan; Wang, Hsi-Hua; Stefanato, Francesca L; Craze, Melanie; Bowden, Sarah; Wallington, Emma; Zipfel, Cyril; Ridout, Christopher J

    2015-04-01

    Perception of pathogen (or microbe)-associated molecular patterns (PAMPs/MAMPs) by pattern recognition receptors (PRRs) is a key component of plant innate immunity. The Arabidopsis PRR EF-Tu receptor (EFR) recognizes the bacterial PAMP elongation factor Tu (EF-Tu) and its derived peptide elf18. Previous work revealed that transgenic expression of AtEFR in Solanaceae confers elf18 responsiveness and broad-spectrum bacterial disease resistance. In this study, we developed a set of bioassays to study the activation of PAMP-triggered immunity (PTI) in wheat. We generated transgenic wheat (Triticum aestivum) plants expressing AtEFR driven by the constitutive rice actin promoter and tested their response to elf18. We show that transgenic expression of AtEFR in wheat confers recognition of elf18, as measured by the induction of immune marker genes and callose deposition. When challenged with the cereal bacterial pathogen Pseudomonas syringae pv. oryzae, transgenic EFR wheat lines had reduced lesion size and bacterial multiplication. These results demonstrate that AtEFR can be transferred successfully from dicot to monocot species, further revealing that immune signalling pathways are conserved across these distant phyla. As novel PRRs are identified, their transfer between plant families represents a useful strategy for enhancing resistance to pathogens in crops. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  20. Traditional medicinal plant use in Northern Peru: tracking two thousand years of healing culture

    Science.gov (United States)

    Bussmann, Rainer W; Sharon, Douglas

    2006-01-01

    This paper examines the traditional use of medicinal plants in Northern Peru, with special focus on the Departments of Piura, Lambayeque, La Libertad, Cajamarca, and San Martin. Northern Peru represents the center of the old Central Andean "Health Axis," stretching from Ecuador to Bolivia. The roots of traditional healing practices in this region go at least as far back as the Moche period (AC 100–800). Although about 50% of the plants in use reported in the colonial period have disappeared from the popular pharmacopoeia, the plant knowledge of the population is much more extensive than in other parts of the Andean region. 510 plant species used for medicinal purposes were collected, identified and their vernacular names, traditional uses and applications recorded. The families best represented were Asteraceae with 69 species, Fabaceae (35), Lamiaceae (25), and Solanaceae (21). Euphorbiaceae had twelve species, and Apiaceae and Poaceae 11 species. The highest number of species was used for the treatment of "magical/ritual" ailments (207 species), followed by respiratory disorders (95), problems of the urinary tract (85), infections of female organs (66), liver ailments (61), inflammations (59), stomach problems (51) and rheumatism (45). Most of the plants used (83%) were native to Peru. Fresh plants, often collected wild, were used in two thirds of all cases, and the most common applications included the ingestion of herb decoctions or the application of plant material as poultices. PMID:17090303