WorldWideScience

Sample records for viarum dunal solanaceae

  1. Biological control of tropical soda apple (Solanaceae) in Florida: Post-release evaluation

    Science.gov (United States)

    The leaf feeding beetle Gratiana boliviana Spaeth (Coleoptera: Chrysomelidae) was released as a biological control agent against tropical soda apple (TSA) (Solanum viarum Dunal (Solanaceae)) in Sumter County, FL in 2006. Evaluation of beetle feeding damage to TSA plants and changes in the beetle po...

  2. The genus Solanum (Solanaceae in southern Africa: subgenus Leptostemonum, the introduced sections Acanthophora and Torva

    Directory of Open Access Journals (Sweden)

    W. G. Welman

    2003-12-01

    Full Text Available In the genus Solanum L. (Solanaceae, subgenus Leptostemonum (Dunal Bitter, section Acanthophora Dunal has four representatives in the Flora of southern Africa region (South Africa. Lesotho, Swaziland, Namibia. Botswana, namely  S. aculeatissimum Jacq.. S. capsicoides Allioni. S. mammosum L. (cultivated only and S. viarum Dunal. Section  Ton a Nees has two representatives in southern Africa, namely S.  chnsotriclium Schltdl. (S.  hispidum auctt. non Pers. and S.  ton um Sw.; both are naturalized weeds.  Solanum capsicoides, S. viarum and S.  torvum have not been listed before for southern Africa. All are introduced species native to the New World. Descriptions, discussions, illustrations and distribution maps of the naturalized species are presented, as well as keys to the species of both sections.

  3. The genus Solanum (Solanaceae in southern Africa: subgenus Leptostemonum, the introduced sections Acanthophora and Torva

    Directory of Open Access Journals (Sweden)

    W. G. Welman

    2003-09-01

    Full Text Available In the genus Solanum L. (Solanaceae, subgenus Leptostemonum (Dunal Bitter, section Acanthophora Dunal has four representatives in the Flora of southern Africa region (South Africa. Lesotho, Swaziland, Namibia. Botswana, namely  S. aculeatissimum Jacq.. S. capsicoides Allioni. S. mammosum L. (cultivated only and S. viarum Dunal. Section  Ton a Nees has two representatives in southern Africa, namely S.  chnsotriclium Schltdl. (S.  hispidum auctt. non Pers. and S.  ton um Sw.; both are naturalized weeds.  Solanum capsicoides, S. viarum and S.  torvum have not been listed before for southern Africa. All are introduced species native to the New World. Descriptions, discussions, illustrations and distribution maps of the naturalized species are presented, as well as keys to the species of both sections.

  4. Estudo farmacobotânico comparativo de folhas de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St.-Hil., Solanaceae

    Directory of Open Access Journals (Sweden)

    Nathalia Diniz Araújo

    2010-09-01

    Full Text Available Neste trabalho realizou-se um estudo farmacobotânico de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St-Hil, espécies pertencentes à Solanum sect. Crinitum Child, com o objetivo de efetuar morfodiagnoses macroscópicas e microscópicas que possibilitem suas caracterizações. As três espécies são conhecidas popularmente como "jurubeba", fruta-de-lobo" e "lobeira" e usadas na medicina popular contra o diabetes e também para outros fins. Essas espécies compartilham vários caracteres morfológicos, dentre os quais se destacam o hábito arbustivo a arbóreo, o indumento velutino às vezes cerdoso, a corola é pentagonal-estrelada, roxa a púrpura, e o fruto globoso acima de 5 cm de diâmetro. Entretanto, apesar da grande semelhança morfológica entre as espécies estudadas, destacaram-se como parâmetros distintivos: a morfologia do pecíolo, a base do limbo, o indumento da face adaxial, a anatomia do mesofilo, os tipos de estômatos e a morfologia do bordo foliar.

  5. Fruit removal of a wild tomato, Solanum granulosoleprosum Dunal (Solanaceae, by birds, bats and non-flying mammals in an urban Brazilian environment

    Directory of Open Access Journals (Sweden)

    Cáceres Nilton Carlos

    2003-01-01

    Full Text Available A study of removal of fruits of the wild tomato, Solanum granulosoleprosum Dunal (N = 5 plants, by vertebrates was carried out in an urban environment of southern Brazil from January to May 1997 and February 1998. To verify diurnal and nocturnal removals, fruits were counted in several fruit bunches, being classified by size and color. Diurnal observations were made on plants to verify bird removal. A mist net was placed among the plants from the evening to 23:00 h to verify bat consumption. Live traps baited with S. granulosoleprosum fruits were placed on the ground among plants to verify terrestrial removers. On average it was found two ripe fruits available per bunch/day, but unripe, small, fruits were dominant (70%. Nocturnal mammals and birds-diurnal mammals partitioned fruits similarly. Bats removing fruits were Artibeus lituratus (Olfers, 1818, Pygoderma bilabiatum (Wagner, 1843 and Sturnira lilium (E. Geoffroy, 1810. Birds were Saltator similis Lafresnaye & d'Orbigny, 1837 and Thraupis sayaca (Linnaeus, 1766. Terrestrial mammals were a marsupial and three rodent species. Except for rodents, these vertebrates must be promoting the seed dispersal of S. granulosoleprosum seeds in disturbed mixed forests of southern Brazil.

  6. Successful biological control of tropical soda apple (Solanales: Solanaceae) in Florida: A review of key program components

    Science.gov (United States)

    Tropical soda apple (Solanum viarum Dunal) is a small shrub native to South America that is invasive in pastures and conservation areas across Florida. Dense patches of tropical soda apple not only reduce cattle stocking rates and limit their movement, but also serve as reservoirs for pests of solan...

  7. Influence of sun and shade conditions on Gratiana boliviana (Coleoptera: Chrysomelidae) abundance and feeding activity on tropical soda apple (Solanaceae) under field conditions

    Science.gov (United States)

    Tropical soda apple (Solanum viarum Dunal) is a perennial invasive weed species which has become a serious problem in both agricultural and natural areas of the southeastern United States. A field survey was conducted at a ranch in Madison County, Florida, to assess the effect of sun and shade condi...

  8. Estudo farmacobotânico comparativo de folhas de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St.-Hil., Solanaceae The pharmacobotanical comparative study of leaves of Solanum crinitum Lam., Solanum gomphodes Dunal and Solanum lycocarpum A. St-Hil, (Solanaceae

    Directory of Open Access Journals (Sweden)

    Nathalia Diniz Araújo

    2010-11-01

    Full Text Available Neste trabalho realizou-se um estudo farmacobotânico de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St-Hil, espécies pertencentes à Solanum sect. Crinitum Child, com o objetivo de efetuar morfodiagnoses macroscópicas e microscópicas que possibilitem suas caracterizações. As três espécies são conhecidas popularmente como "jurubeba", fruta-de-lobo" e "lobeira" e usadas na medicina popular contra o diabetes e também para outros fins. Essas espécies compartilham vários caracteres morfológicos, dentre os quais se destacam o hábito arbustivo a arbóreo, o indumento velutino às vezes cerdoso, a corola é pentagonal-estrelada, roxa a púrpura, e o fruto globoso acima de 5 cm de diâmetro. Entretanto, apesar da grande semelhança morfológica entre as espécies estudadas, destacaram-se como parâmetros distintivos: a morfologia do pecíolo, a base do limbo, o indumento da face adaxial, a anatomia do mesofilo, os tipos de estômatos e a morfologia do bordo foliar.In this work, a pharmacobotanical study of Solanum crinitum Lam., S. gomphodes Dunal and S. lycocarpum A. St-Hil., all belonging to the Solanum sect. Crinitum Child. has been realized with the objective of providing a macroscopical and microscopical morphodiagnosis for their characterizations. The three species are commonly named "jurubeba", "fruta-de-lobo" and "lobeira", and they are used in the folk medicine for the treatment of diabetes and others diseases. The three species studied share various morphological characters, like shrub and tree forms, the velutinous abaxial indument, the presence of bristles, the flower with stellate-pentagonal corollas ranging from violet to purple, and the fruit reaching up to 5 cm in diameter. The principal parameters to distinct the three species studied were the morphology of petiole and base of the blade leaf, the indument of adaxial surface, the anatomy of mesophyll, the types of stomata and the leaf margin.

  9. Efeito da época sobre a emergência de Sida rhombifolia e Solanum viarum em diferentes profundidades de semeadura

    Directory of Open Access Journals (Sweden)

    Marcelo Claro Souza

    2011-12-01

    Full Text Available O conhecimento da profundidade ideal de germinação de sementes de plantas daninhas é importante para o desenvolvimento de estratégias de manejo eficientes, seguras e econômicas. Com o objetivo de estudar a emergência de plântulas de Sida rhombifolia L. e Solanum viarum Dunal, em resposta à época (setembro de 2008 e janeiro de 2009 e às profundidades de semeadura (0, 1, 2, 3, 4 e 5 cm, foram realizados dois experimentos em casa de vegetação. Sida rhombifolia mostrou-se sensível às variações de temperatura, em decorrência das épocas de semeadura, e os maiores percentuais de emergência ocorreram nas profundidades entre 1 e 4 cm. Para S. viarum, observou-se forte influência da temperatura sobre a sua emergência, sendo, observado o máximo de emergência, nas profundidades de 1 a 5 cm e sua redução para as sementes locadas na superfície do solo.

  10. 158. Solanaceae

    DEFF Research Database (Denmark)

    Friis, Ib

    2007-01-01

    A taxonomic revision and a floristic account of all species in the plant family Solanaceae (nightshade family) recorded from Ethiopia and Eritrea.......A taxonomic revision and a floristic account of all species in the plant family Solanaceae (nightshade family) recorded from Ethiopia and Eritrea....

  11. Organogénesis directa in vitro a partir de hojas de la planta antiplasmodial solanum nudum dunal

    OpenAIRE

    Oscar Manuel Suárez Cardoso; Esther Julia Naranjo Gómez; Lucía Atehortúa Garcés; Silvia Blair Trujillo

    2012-01-01

    Título en inglés: Direct organogenesis in vitro from leaves of Solanum nudum Dunal – Antiplasmodial plant   Resumen Solanum nudum Dunal (Solanaceae), es una especie vegetal con potencial para desarrollar un tratamiento quimioterapéutico contra  la malaria. Este es el primer reporte de un protocolo rápido, eficiente y reproducible de organogénesis directa a partir de segmentos de hoja de plántulas in vitro  de esta especie. Los segmentos de hojas de plántulas de 5 meses de germinadas fuero...

  12. The genus Solanum (Solanaceae in southern Africa: subgenus Leptostemonum, section Giganteiformia

    Directory of Open Access Journals (Sweden)

    W. G. Welman

    2008-12-01

    Full Text Available In the genus Solanum L. (Solanaceae, subgenus Leptostemonum (Dunal Bitter, section Giganteiformia (Bitter Child has four representatives in the Flora of southern Africa region (South Africa, Namibia. Botswana. Swaziland. Lesotho, namely S. giganteum Jacq.. S. goetzei Dammer, S. tettense Klotzsch var.  renschii (Vatke A.E.Gonsalves and S. tettense Klotsch var.tettense. Descriptions, discussions, distribution maps and keys are presented, as well as an illustration of  S. goetzei.

  13. DETERMINACIÓN DE ALGUNOS METABOLITOS SECUNDARIOS EN TRES MORFOTIPOS DE COCONA (Solanum sessiliflorum Dunal

    Directory of Open Access Journals (Sweden)

    Juliana E. Cardona J.

    2011-12-01

    Full Text Available Se determinó la presencia y la estructura(mediante el uso de técnicas espectroscópicasy cromatográficas de algunos metabolitossecundarios en tres morfotiposdel fruto de cocona (Solanum sessiliflorumDunal; Solanaceae cultivados en eldepartamento del Guaviare. Se destacóla presencia de ácido p-cumárico, ácidop-hidroxidihidrocumárico, naringenina,salicilato de metilo, hidrocarburos decadena larga, ácidos grasos y sus ésteresmetílicos y etílicos. Algunos de estoscompuestos se acumulan únicamente enel epicarpio de la fruta. La comparaciónde metabolitos volátiles permitió establecerdiferencias químicas entre los tresmorfotipos de la fruta.

  14. In Vitro Assessment of Plants Growing in Cuba Belonging to Solanaceae Family Against Leishmania amazonensis.

    Science.gov (United States)

    Monzote, Lianet; Jiménez, Jenny; Cuesta-Rubio, Osmany; Márquez, Ingrid; Gutiérrez, Yamile; da Rocha, Cláudia Quintino; Marchi, Mary; Setzer, William N; Vilegas, Wagner

    2016-11-01

    In this study, an in vitro antileishmanial assessment of plant extracts from 12 genera and 46 species growing in Cuba belonging to Solanaceae family was performed. A total of 226 extracts were screened against promastigotes of Leishmania amazonensis, and cytotoxicity of active extracts [median inhibitory concentration (IC 50 ) promastigotes 5 were then assayed against intracellular amastigote. Metabolomics analysis of promissory extracts was performed using chemical profile obtained by ultra performance liquid chromatography. Only 11 extracts (4.9%) from nine plants were selected as potentially actives: Brunfelsia cestroides A. Rich, Capsicum annuum L., Capsicum chinense Jacq., Cestrum nocturnum L., Nicotiana plumbaginifolia Viv., Solanum havanense Jacq., Solanum myriacanthum Dunal, Solanum nudum Dunal and Solanum seaforthianum And., with IC 50  5. Metabolomics analysis demonstrated significant differences in the chemical profiles with an average of 42.8 (range 31-88) compounds from m/z 104 to 1477, which demonstrated the complex mixture of compounds. In addition, no common markers among active extracts were identified. The results demonstrate the importance of the Solanaceae family to search new antileishmanial agents, particularly in unexplored species of this family. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  15. Androgenesis in Solanaceae.

    Science.gov (United States)

    Seguí-Simarro, Jose M

    2016-01-01

    The Solanaceae is one of the most important families for global agriculture. Among the different solanaceous species, tobacco (Nicotiana tabacum), potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum) are five crops of outstanding importance worldwide. In these crops, maximum yields are produced by hybrid plants created by crossing pure (homozygous) lines with the desired traits. Pure lines may be produced by conventional breeding methods, which is time consuming and costly. Alternatively, it is possible to accelerate the production of pure lines by creating doubled haploid (DH) plants derived from (haploid) male gametophytes or their precursors (androgenesis). In this way, the different steps for the production of pure lines can be reduced to only one generation, which implies important time and cost savings. This and other advantages make androgenic DHs the choice in a number of important crops where any of the different experimental in vitro techniques (anther culture or isolated microspore culture) is well set up. The Solanaceae family is an excellent example of heterogeneity in terms of response to these techniques, including highly responding species such as tobacco, considered a model system, and tomato, one of the most recalcitrant species, where no reliable and reproducible methods are yet available. Interestingly, the first evidence of androgenesis, particularly through in vitro anther culture, was demonstrated in a solanaceous species, Datura innoxia. In this chapter, we report the state of the art of the research about androgenic DHs in Solanaceae, paying special attention to datura, tobacco, potato, tomato, eggplant, and pepper.

  16. Micromorphology, histochemistry and ultrastructure of the foliar trichomes of Withania somnifera (L.) Dunal (Solanaceae).

    Science.gov (United States)

    Munien, Prelina; Naidoo, Yougasphree; Naidoo, Gonasageran

    2015-11-01

    The leaves of Withania somnifera contained four morphologically distinct trichome types: glandular capitate, non-glandular dendritic (branched), non-glandular bicellular and non-glandular multicellular trichomes. Major phytochemical compounds present within glandular and non-glandular trichomes were alkaloids and phenolic compounds. The aim of this study was to characterize the micromorphology of the foliar trichomes of Withania somnifera as well as to elucidate the location and composition of the secretory products. Trichome density and length was also determined in three developmental stages of the leaves. Light microscopy and scanning electron microscopy showed the presence of four morphologically distinct trichome types: glandular capitate, non-glandular dendritic, non-glandular bicellular and non-glandular multicellular. The dendritic trichomes exhibited cuticular warts which are involved in the "Lotus-Effect". Glandular capitate and non-glandular dendritic trichomes were aggregated on the mid-vein of young and mature leaves, possibly to protect underlying vasculature. Histochemical staining also revealed the presence of two major classes of phytochemical compounds that are of medicinal importance, i.e. alkaloids and phenolic compounds. These compounds are used to treat a wide variety of ailments and also act as chemical deterrents in plants. The results of this study explain possible roles of four morphologically distinct trichome types based on their morphology, foliar distribution and content.

  17. Integrating varietal resistance with Xylopia aethiopica (Dunal) A ...

    African Journals Online (AJOL)

    In search for alternatives to synthetic pesticides in maize (Zea mays, L.) storage, an integrated weevil management scheme involving varietal resistance and Xylopia aethiopica (Dunal) A. Richard seed extract was evaluated in the laboratory. Varying rates of X. aethiopica extract were assessed on three maize varieties (Pajo ...

  18. Efficacy of Ashwagandha (Withania somnifera [L.] Dunal) in improving cardiorespiratory endurance in healthy athletic adults

    National Research Council Canada - National Science Library

    Choudhary, Bakhtiar; Shetty, A; Langade, Deepak G

    2015-01-01

    Ashwagandha (Withania somnifera [L.] Dunal) has been traditionally used for various actions ranging from vitalizer, improve endurance and stamina, promote longevity, improve immunity, and male and female fertility...

  19. Exploring plant tissue culture in Withania somnifera (L.) Dunal: in vitro propagation and secondary metabolite production.

    Science.gov (United States)

    Shasmita; Rai, Manoj K; Naik, Soumendra K

    2017-12-26

    Withania somnifera (L.) Dunal (family: Solanaceae), commonly known as "Indian Ginseng", is a medicinally and industrially important plant of the Indian subcontinent and other warmer parts of the world. The plant has multi-use medicinal potential and has been listed among 36 important cultivated medicinal plants of India that are in high demand for trade due to its pharmaceutical uses. The medicinal importance of this plant is mainly due to the presence of different types of steroidal lactones- withanolides in the roots and leaves. Owing to low seed viability and poor germination, the conventional propagation of W. somnifera falls short to cater its commercial demands particularly for secondary metabolite production. Therefore, there is a great need to develop different biotechnological approaches through tissue and organ culture for seasonal independent production of plants in large scale which will provide sufficient raw materials of uniform quality for pharmaceutical purposes. During past years, a number of in vitro plant regeneration protocols via organogenesis and somatic embryogenesis and in vitro conservation through synthetic seed based encapsulation technology have been developed for W. somnifera. Several attempts have also been made to standardize the protocol of secondary metabolite production via tissue/organ cultures, cell suspension cultures, and Agrobacterium rhizogenes-mediated transformed hairy root cultures. Employment of plant tissue culture based techniques would provide means for rapid propagation and conservation of this plant species and also provide scope for enhanced production of different bioactive secondary metabolites. The present review provides a comprehensive report on research activities conducted in the area of tissue culture and secondary metabolite production in W. somnifera during the past years. It also discusses the unexplored areas which might be taken into consideration for future research so that the medicinal properties and

  20. Estudos anatômicos de folhas de plantas daninhas: I - Nicandra physaloides, Solanum viarum, Solanum americanum e Raphanus raphanistrum Anatomical studies of weed leaves: I - Nicandra physaloides, Solanum viarum, Solanum americanum and Raphanus raphanistrum

    Directory of Open Access Journals (Sweden)

    E.A. Ferreira

    2002-08-01

    Full Text Available O objetivo deste trabalho foi estudar a anatomia das folhas das espécies de plantas daninhas Nicandra physaloides (joá-de-capote, Solanum viarum (joá-bravo, Solanum americanum (maria-pretinha e Raphanus raphanistrum (nabiça, visando obter melhor entendimento sobre as barreiras que cada espécie impõe à penetração dos herbicidas. Folhas completamente expandidas do terceiro ao quinto nó foram coletadas de plantas de ocorrência espontânea no campo. Das folhas de cada espécie foram obtidas três amostras da região central mediana, com aproximadamente 1 cm², as quais foram utilizadas em estudos da estrutura, clarificação e nas observações em microscópio eletrônico de varredura (MEV. Todas as espécies avaliadas são anfiestomáticas. O principal obstáculo foliar à penetração de herbicidas constatado em N. physaloides foi a alta densidade tricomática. Já em relação a S. viarum, baixa densidade estomática na face adaxial, alta densidade tricomática, presença de placas de cera epicuticular e grande espessura das cutículas foram as principais barreiras detectadas. S. americanum apresentou como principais obstáculos foliares à penetração de herbicidas a baixa densidade estomática na face adaxial e a grande espessura da cutícula da face adaxial, sendo esta última a única barreira constatada nas folhas de R. raphanistrum.This research aimed to study the leaf anatomy of the weed species Nicandra physaloides, Solanum viarum, Solanum americanum and Raphanus raphanistrum to acquire a better understanding of the barriers each species imposes upon herbicide penetration. Completely expanded leaves from the third to the fifth node were collected from plants spontaneously occurring in field. Three samples, with approximately 1 cm², were taken at the central portion of the leaves in each species. These samples were used in structural studies, clarification and observation using a scanning-electron microscope (SEM. All species

  1. Plastid genetic engineering in Solanaceae.

    Science.gov (United States)

    Venkatesh, Jelli; Park, Se Won

    2012-10-01

    Plastid genetic engineering has come of age, becoming today an attractive alternative approach for the expression of foreign genes, as it offers several advantages over nuclear transformants. Significant progress has been made in plastid genetic engineering in tobacco and other Solanaceae plants, through the use of improved regeneration procedures and transformation vectors with efficient promoters and untranslated regions. Many genes encoding for industrially important proteins and vaccines, as well as genes conferring important agronomic traits, have been stably integrated and expressed in the plastid genome. Despite these advances, it remains a challenge to achieve marked levels of plastid transgene expression in non-green tissues. In this review, we summarize the basic requirements of plastid genetic engineering and discuss the current status, limitations, and the potential of plastid transformation for expanding future studies relating to Solanaceae plants.

  2. 7 CFR 360.200 - Designation of noxious weeds.

    Science.gov (United States)

    2010-01-01

    ... ragwort) Setaria pallide-fusca (Schumacher) Stapf & Hubbard (cattail grass) Solanum torvum Swartz (turkeyberry) Solanum viarum Dunal (tropical soda apple) Spermacoce alata (Aublet) de Candolle Tridax... (giant salvinia) Solanum tampicense Dunal (wetland nightshade) Sparganium erectum Linnaeus (exotic bur...

  3. Frugivory and seed dispersal of Solanum granuloso-leprosum Dunal (Solanaceae) by birds in deciduous seasonal forest.

    Science.gov (United States)

    Jacomassa, F A F

    2016-01-01

    The goal of this study was to identify which bird species consume Solanum granuloso-leprosum fruits and disperse its seeds. 60 hours of focal observations were carried out between April and May 2006 on the edge of a deciduous forest fragment in the Uruguay River region, Rio Grande do Sul state, Brazil. Ten species were observed in total removing 443 fruits. Saltator similis removed 61.8% of the fruits, followed by Tangara sayaca (17.1%), Pipraeidea bonariensis (11.7%), and T. preciosa (6.8%), while the remaining six species accounted for only 2.5% of the fruits removed. Most fruit removal occurred early in the day or mid-afternoon. The most common feeding behaviors were picking (60.7%), followed by stalling (23%) and hovering (16%). Birds flew more than 10 m from the fruit plant in 62% of the removal events. All bird species observed here may be considered potential dispersers of S. granuloso-leprosum, as they moved the seeds away from the mother plant where strong competition and predation are likely to occur. Results also suggest that S. granuloso-leprosum may be useful in ecological restoration programs.

  4. In Vitro Propagation of Withania somnifera (L.) Dunal.

    Science.gov (United States)

    Singh, Pritika; Guleri, Rupam; Pati, Pratap Kumar

    2016-01-01

    Withania somnifera (L.) Dunal known as Ashwagandha is commonly used in traditional Indian medicine system. It possesses immense therapeutic value against a large number of ailments such as mental diseases, asthma, inflammation, arthritis, rheumatism, tuberculosis, and a variety of other diseases including cancer. The therapeutic potential of W. somnifera is due to the presence of secondary metabolites mainly, tropane alkaloids and withanolides (steroidal lactones). The growing realization of commercial value of the plant has initiated a new demand for in vitro propagation of elite chemotypes of Withania. Micropropagation which is an important tool for rapid multiplication requires optimization of number of factors such as nutrient medium, status of medium (solid and liquid), type of explant, and plant growth regulators. Similarly, an efficient and reproducible in vitro regeneration system which is a prerequisite for the development of genetic transformation protocol requires precise manipulation of various intrinsic and extrinsic factors.

  5. The Phytogeography of New Guinea Solanum (Solanaceae)

    NARCIS (Netherlands)

    Symon, D.E.

    1986-01-01

    The Solanaceae, of which Solanum is the type species, comprise a southern hemisphere family. A general biogeographical introduction is given, with an account of plate tectonics and a discussion of Wallace’s Line and the geographic history of New Guinea. The widely accepted sections of Solanum are

  6. Anther Wall Formation in Solanaceae Species

    Science.gov (United States)

    CARRIZO GARCÍA, CAROLINA

    2002-01-01

    Anther wall formation was studied in 32 species belonging to 27 genera of Solanaceae. Dicotyledonous and basic types of wall formation were observed, as well as several deviations due to subsequent periclinal divisions in the layers formed (middle layers and sometimes the endothecium). One type of wall formation was observed in each species. Some genera are uniform in their type of wall formation, while others are heterogeneous; a similar situation was observed at the tribal level. Summarizing all reported information on anther wall formation in the Solanaceae, 64 % of species show the basic type, while the remaining 36 % show the dicotyledonous type. Thus, neither type predominates, and no single type characterizes genera, tribes or the entire family. PMID:12451025

  7. Chromosomal evolution in the plant family Solanaceae.

    Science.gov (United States)

    Wu, Feinan; Tanksley, Steven D

    2010-03-17

    Over the past decades, extensive comparative mapping research has been performed in the plant family Solanaceae. The recent identification of a large set of single-copy conserved orthologous (COSII) markers has greatly accelerated comparative mapping studies among major solanaceous species including tomato, potato, eggplant, pepper and diploid Nicotiana species (as well as tetraploid tobacco). The large amount of comparative data now available for these species provides the opportunity to describe the overall patterns of chromosomal evolution in this important plant family. The results of this investigation are described herein. We combined data from multiple COSII studies, and other comparative mapping studies performed in tomato, potato, eggplant, pepper and diploid Nicotiana species, to deduce the features and outcomes of chromosomal evolution in the Solanaceae over the past 30 million years. This includes estimating the rates and timing of chromosomal changes (inversions and translocations) as well as deducing the age of ancestral progenitor species and predicting their genome configurations. The Solanaceae has experienced chromosomal changes at a modest rate compared with other families and the rates are likely conserved across different lineages of the family. Chromosomal inversions occur at a consistently higher rate than do translocations. Further, we find evidences for non-random positioning of the chromosomal rearrangement breakpoints. This finding is consistent with the similar finding in mammals, where hot spots for chromosomal breakages have apparently played a significant role in shaping genome evolution. Finally, by utilizing multiple genome comparisons we were able to reconstruct the most likely genome configuration for a number of now-extinct progenitor species that gave rise to the extant solanaceous species used in this research. The results from this study provide the first broad overview of chromosomal evolution in the family Solanaceae, and

  8. ISOL@: an Italian SOLAnaceae genomics resource

    Science.gov (United States)

    Chiusano, Maria Luisa; D'Agostino, Nunzio; Traini, Alessandra; Licciardello, Concetta; Raimondo, Enrico; Aversano, Mario; Frusciante, Luigi; Monti, Luigi

    2008-01-01

    Background Present-day ‘-omics’ technologies produce overwhelming amounts of data which include genome sequences, information on gene expression (transcripts and proteins) and on cell metabolic status. These data represent multiple aspects of a biological system and need to be investigated as a whole to shed light on the mechanisms which underpin the system functionality. The gathering and convergence of data generated by high-throughput technologies, the effective integration of different data-sources and the analysis of the information content based on comparative approaches are key methods for meaningful biological interpretations. In the frame of the International Solanaceae Genome Project, we propose here ISOLA, an Italian SOLAnaceae genomics resource. Results ISOLA (available at ) represents a trial platform and it is conceived as a multi-level computational environment. ISOLA currently consists of two main levels: the genome and the expression level. The cornerstone of the genome level is represented by the Solanum lycopersicum genome draft sequences generated by the International Tomato Genome Sequencing Consortium. Instead, the basic element of the expression level is the transcriptome information from different Solanaceae species, mainly in the form of species-specific comprehensive collections of Expressed Sequence Tags (ESTs). The cross-talk between the genome and the expression levels is based on data source sharing and on tools that enhance data quality, that extract information content from the levels' under parts and produce value-added biological knowledge. Conclusions ISOLA is the result of a bioinformatics effort that addresses the challenges of the post-genomics era. It is designed to exploit ‘-omics’ data based on effective integration to acquire biological knowledge and to approach a systems biology view. Beyond providing experimental biologists with a preliminary annotation of the tomato genome, this effort aims to produce a trial

  9. Chemical Constituents from Solanum glabratum Dunal var. sepicula

    Directory of Open Access Journals (Sweden)

    Essam Abdel-Sattar

    2015-01-01

    Full Text Available In the course of screening program of Saudi plants for their potential biological activity, the methanolic extract of Solanum glabratum Dunal var. sepicula as well as its different fractions were tested for its possible cytoxicity in prostate cancer (PC3 and colon cancer (HT29 cell lines using the MTT assay. In the present study, three spirostan saponins and one flavonoid glycoside were isolated from the active n-butanol fraction through a bio-guided fractionation approach. Two new saponin glycosides were identified as 23-β-D-glucopyranosyl (23S, 25R-spirost-5-en-3, 23 diol 3-O-α-L-rhamnopyranosyl-(1→2-O-[α-L-rhamnopyranosyl-(1→4]-β-D-glucopyranoside (2 and (25R-spirost-5-en-3-ol 3-O-α-L-rhamnopyranosyl-(1→2-O-[β-D-glucopyranosyl-(1→3]-β-D-galactopyranoside (3. In addition, two known compounds were also isolated and identified as isorhamnetin-3-O-α-L-rhamnopyranosyl (1→6 β-D-glucopyranoside (1 and (23S, 25R-spirost-5-en-3, 23 diol 3-O-α-L-rhamnopyranosyl-(1→2-O-[α-L-rhamnopyranosyl-(1→4]-β-D-glucopyranoside (4. The structures of the isolated compounds were elucidated based on their MS, one dimensional and extensive two dimensional NMR spectral data. Among the isolated metabolites, compound 3 showed the highest cytotoxic activity in both PC3 and HT29 cell lines with an IC 50 values of 14.8 and 19.5 m g/mL, respectively.

  10. Weed management in Solanaceae crops in Portugal.

    Science.gov (United States)

    Afonso, M Júlia

    2008-01-01

    Portugal has very good climatic-edafic conditions for Solanaceae crops, regarding to either yield quality or quantity. Tomato (Lycopersicon esculentum Miller.), potato (Solanum tuberosum L.) and pepper (Capsicum annuum L.) are the most social-economically important Solanaceae and aubergine (Solanum melongena L.) area of cultivation is increasing. Tomato is cultivated for fresh consumption and, primarily, for industrial processing. Is one of the most profitable vegetable crop and the main vegetable for industry. Potato is the annual vegetable crop with the largest cultivated area. Pepper is one of the main crops for vegetable frozen industry. Tomato, pepper and aubergine are cultivated in the field (outdoor) in Spring-Summer season. In greenhouses, they're also grown during other months and, at the southmost region (Algarve), during the whole year. Potato is cultivated almost the whole year through. Weed management is essential to achieve yield rentability and, for crops growing in the field, herbicides play an important role, due to their efficacy or inherent limitations of other control measures. This paper presents the state of art, in Portugal, regarding to some cultural and social-economical aspects of these crops (e.g., cultivated areas, productions, main producer regions), main weeds, weed control methods and, in particular, registered herbicides, with indication of their usage conditions (application timings and spectrum of weeds controlled) according to the principles of Good Plant Protection Practice and Integrated Weed Management.

  11. Wild relatives of the eggplant (Solanum melongena L.: Solanaceae: new understanding of species names in a complex group.

    Directory of Open Access Journals (Sweden)

    Sandra Knapp

    Full Text Available BACKGROUND: The common or brinjal eggplant (Solanum melongena L. belongs to the Leptostemonum Clade (the "spiny" solanums of the species-rich genus Solanum (Solanaceae. Unlike most of the genus, the eggplant and its relatives are from the Old World; most eggplant wild relatives are from Africa. An informal system for naming eggplant wild relatives largely based on crossing and other biosystematics data has been in use for approximately a decade. This system recognises several forms of two broadly conceived species, S. incanum L. and S. melongena. Recent morphological and molecular work has shown that species-level differences exist between these entities, and a new species-level nomenclature has been identified as necessary for plant breeders and for the maintenance of accurately named germplasm. METHODOLOGY/PRINCIPAL FINDINGS: We examined herbarium specimens from throughout the wild species ranges as part of a larger revision of the spiny solanums of Africa. Based on these morphological and molecular studies, we delimited species in the group to which the common eggplant belongs and constructed identification keys for the group. We also examined the monophyly of the group considered as the eggplant relatives by previous authors. CONCLUSIONS/SIGNIFICANCE: WE RECOGNISE TEN SPECIES IN THIS GROUP: S. aureitomentosum Bitter, S. campylacanthum A.Rich., S. cerasiferum Dunal, S. incanum L., S. insanum L., S. lichtensteinii Willd., S. linnaeanum Hepper & P.-M.L.Jaeger, S. melongena L., S. rigidum Lam. and S. umtuma Voronts. & S.Knapp. We review the history of naming and provide keys and character lists for all species. Ploidy level differences have not been investigated in the eggplant wild relatives; we identify this as a priority for improvement of crop wild relative use in breeding. The application of species-level names to these entities will help focus new collecting efforts for brinjal eggplant improvement and help facilitate information exchange.

  12. Proteomics survey of Solanaceae family: Current status and challenges ahead.

    Science.gov (United States)

    Ghatak, Arindam; Chaturvedi, Palak; Paul, Puneet; Agrawal, Ganesh Kumar; Rakwal, Randeep; Kim, Sun Tae; Weckwerth, Wolfram; Gupta, Ravi

    2017-10-03

    Solanaceae is one of the major economically important families of higher plants and has played a central role in human nutrition since the dawn of human civilization. Therefore, researchers have always been interested in understanding the complex behavior of Solanaceae members to identify key transcripts, proteins or metabolites, which are potentially associated with major traits. Proteomics studies have contributed significantly to understanding the physiology of Solanaceae members. A compilation of all the published reports showed that both gel-based (75%) and gel-free (25%) proteomic technologies have been utilized to establish the proteomes of different tissues, organs, and organelles under normal and adverse environmental conditions. Among the Solanaceae members, most of the research has been focused on tomato (42%) followed by potato (28%) and tobacco (20%), owing to their economic importance. This review comprehensively covers the progress made so far in the field of Solanaceae proteomics including novel methods developed to isolate the proteins from different tissues. Moreover, key proteins presented in this review can serve as a resource to select potential targets for crop improvement. We envisage that information presented in this review would enable us to design the stress tolerant plants with enhanced yields. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. The genus Capsicum (Solanaceae in Africa

    Directory of Open Access Journals (Sweden)

    W. H. Eshbaugh

    1983-12-01

    Full Text Available The genus Capsicum (Solanaceae includes approximately 20 wild species and 4-5 domesticated taxa commonly referred to as ‘chilies’ or ‘peppers’. The pre-Colombian distribution of the genus was New World. The evolutionary history of the genus is now envisaged as including three distinct lines leading to the domesticated taxa. The route of Capsicum to the Old World is thought to have followed three different courses. First, explorers introduced it to Europe with secondary introduction into Africa via further exploratory expeditions; second, botanical gardens played a major role in introduction; and third, introduction followed the slave trade routes. Today, pepper production in Africa is of two types, vegetable and spice. Statistical profiles on production are difficult to interpret, but the data available indicate that Nigeria, Egypt, Tunisia and Ghana are the leading producers. Production is mainly a local phenomenon and large acreage is seldom devoted to the growing of peppers. The primary peppers in Africa are C.  annuum and C.  frutescens.

  14. STUDI TRIKOMA DAUN PADA FAMILI SOLANACEAE SEBAGAI SUMBER BELAJAR BIOLOGI

    Directory of Open Access Journals (Sweden)

    Veni Puspita Dewi

    2015-07-01

    Full Text Available Penelitian dilakukan dengan melihat jaringan epidermis pada tujuh spesies yang mewakili family solanaceae (Solanum melongena, Solanum tuberosum, Capsicum frustescens, Capsicum annum, Datura metel, Physalis minima dan Lycopersicon pimpinellifolium yang ditemukan di daerah cangar kota Batu dengan metode jelajah. Kemudian dilakukan penelitian pada epidermis daun di Labolatorium Biologi Universitas Muhammadiyah Malang dengan menggunakan mikroskop SEM. Hasil penelitian menunjukkan bahwa trikoma pada famili solanaceae memiliki bentuk yang bervariasi. Dari 7 spesies ditemukan trikoma rambut sederhana, stellata, berkepala unicel dan hidatoda. Kemudian hasil penelitian ini untuk dikembangkan menjadi sumber belajar biologi SMA kelas XI melalui analisis KD, silabus dan RPP pada materi pembelajaran jaringan tumbuhan dengan penyajian bahan ajar berbentuk buku ilmiah

  15. Flora da Paraíba, Brasil: Solanum L. (Solanaceae Flora of Paraíba, Brazil: Solanum L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Maria de Fátima Agra

    2009-09-01

    Full Text Available Neste trabalho apresenta-se o tratamento taxonômico do gênero Solanum, como parte do projeto "Flora da Paraíba", que vem sendo realizado com o objetivo de identificar e catalogar as espécies da flora local. Realizaram-se coletas, observações de campo e estudos morfológicos para as identificações, descrições e ilustrações botânicas, com o auxílio da bibliografia especializada, complementadas pela análise de tipos e fotos de tipos de herbários nacionais e internacionais e de espécimes depositados nos herbários EAN e JPB. Foram registradas 22 espécies: Solanum agrarium Sendtn., S. americanum Mill., S. asperum Rich., S. asterophorum Mart., S. caavurana Vell., S. capsicoides All., S. crinitum Lam., S. jabrense Agra & M.Nee, S. melissarum Bohs, S. ovum-fringillae (Dunal Bohs, S. palinacanthum Dunal, S. paludosum Moric., S. paniculatum L., S. paraibanum Agra, S. polytrichum Moric., S. rhytidoandrum Sendtn., Solanum sp., S. stagnale Moric., S. stipulaceum Roem. & Schult., S. stramoniifolium Jacq., S. swartzianum Roem. & Schult. e S. torvum Sw. Três espécies, S. ovum-fringillae, Solanum sp. e S. swartzianum, são novas referências para a Paraíba.A taxonomic treatment of the genus Solanum was done as part of the project "Flora da Paraíba", which aims to identify and catalogue the species of the local flora. Botanical collections, field observations and morphological studies were done for identification, description and botanical illustration of the plant species, supported by the literature and analysis of national and foreign herbaria, and specimens from EAN and JPB. Twenty two species of Solanum were recorded in State of Paraíba, as follows: Solanum agrarium Sendtn., S. americanum Mill., S. asperum Rich., S. asterophorum Mart., S. caavurana Vell., S. capsicoides All., S. crinitum Lam., S. jabrense Agra & M.Nee, S. melissarum Bohs, S. ovum-fringillae (Dunal Bohs, S. palinacanthum Dunal, S. paludosum Moric., S. paniculatum L., S

  16. Numerical taxonomic study of some solanum l. Species (solanaceae ...

    African Journals Online (AJOL)

    This study employs the all inclusive numerical techniques to evaluate the taxonomic status of some species in the genus Solanum (Solanaceae) using vegetative and floral characters. This is an effort to resolve some of the conflicting taxonomic issues which arose as a result of gross morphological variability between and ...

  17. Evolution of the inflated calyx syndrome in Solanaceae.

    Science.gov (United States)

    Hu, Jin-Yong; Saedler, Heinz

    2007-11-01

    Species that express the inflated calyx syndrome (ICS) are found in several genera of the Solanaceae. The MADS-box protein MPF2, together with the plant hormones cytokinin and gibberellin, has been shown to be responsible for this trait in Physalis floridana. We have used sequence data from 114 species belonging to 35 genera to construct a molecular phylogeny of Solanaceae. Apart from the 2 Witheringia species analyzed, species within a given genus cluster together on the resulting cladogram. Witheringia solanacea is embedded within the Physalinae, but Witheringia coccoloboides is placed basal to the Iochrominae. The ICS trait seems to be of multiple origins both within the Solanaceae and the Physaleae. Surprisingly, expression of MPF2-like genes in floral organs appears to be plesiomorphic in both the Physaleae and the Capsiceae. Some species in these tribes that show neither ICS nor calyx accrescence fail to express the MPF2-like gene in floral organs. Among those that do express this gene in the calyx are the species Capsicum baccatum, Lycianthes biflora, Tubocapsicum anomalum, W. solanacea, and Vassobia breviflora, all of which form small calyces that do not respond to externally applied hormones. The plesiomorphic nature of MPF2-like gene expression in the calyx of the Physaleae and Capsiceae raises the possibility that originally ICS also was actually a plesiomorphic character in these 2 groups. However, this trait might have undergone changes in a number of species due to secondary loss of components in ICS formation, like hormone response of calyx development. These findings are discussed in an evolutionary context of a molecular pathway leading to ICS.

  18. Elicitation Approaches for Withanolide Production in Hairy Root Culture of Withania somnifera (L.) Dunal.

    Science.gov (United States)

    Sivanandhan, Ganeshan; Selvaraj, Natesan; Ganapathi, Andy; Manickavasagam, Markandan

    2016-01-01

    Withania somnifera (L.) Dunal is a versatile medicinal plant extensively utilized for production of phytochemical drug preparations. The roots and whole plants are traditionally used in Ayurveda, Unani, and Siddha medicines, as well as in homeopathy. Several studies provide evidence for an array of pharmaceutical properties due to the presence of steroidal lactones named "withanolides." A number of research groups have focused their attention on the effects of biotic and abiotic elicitors on withanolide production using cultures of adventitious roots, cell suspensions, shoot suspensions, and hairy roots in large-scale bioreactor for producing withanolides. This chapter explains the detailed procedures for induction and establishment of hairy roots from leaf explants of W. somnifera, proliferation and multiplication of hairy root cultures, estimation of withanolide productivity upon elicitation with salicylic acid and methyl jasmonate, and quantification of major withanolides by HPLC. The protocol herein described could be implemented for large-scale cultivation of hairy root biomass to improve withanolide production.

  19. Beach and dunal system monitoring at Su Giudeu beach, Sardinia (Italy)

    Science.gov (United States)

    Balzano, Andrea; Sulis, Andrea

    2014-05-01

    Even if coastal floods are quite rare events in Sardinia (Italy) at present, they have had dramatic consequences for coastal communities, particularly in conjunction with river flooding. However, flood risk (defined as the product of event probability, vulnerability and value of assets) is expected to increase significantly in the future, due to climate change, defence degradation and sea level rise. Sardinia island has a costal length of approximately 1.900 km including minor neighbouring islands (25% of the entire Italian coasts) and the estimation of the potential exposure of coastal communities to flooding is therefore a critical task. To date methods for achieving this have been based on modelling of coastal inundation using hydrodynamic or GIS-based models of varying complexity. The Dept of Civil and Environmental Engineering and Architecture at the University of Cagliari is carrying out a comprehensive activity of coastal flooding risk mapping at the regional scale within the framework of a scientific collaboration with the Sardinian Regional Authority for the Hydrographic District, that includes monitoring and scientific activities along the entire Sardinian coast. Bathymetry and topographical surveys, sediment characterization, waves and currents measurements, hydrodynamic and morphodynamic modelling are planned, focusing on critical extended areas. In this paper we present an overview of the entire activity programme and give an in-depth account of the ongoing monitoring survey of the dunal system of the Su Giudeu beach (Southern Sardinia, 50 km far from the city of Cagliari). Su Giudeu is a sandy, bay-shaped beach, extending for about 1200 m between two headlands, evolving under waves with a predominant direction of 220-240°N (Scirocco wind). The survey is expected to provide evidence of the response of the remarkable dunal system to wave runup occurring during storm events, to be used in the verification of existing numerical models of dune erosion.

  20. Transmission advantage favors selfing allele in experimental populations of self-incompatible Witheringia solanacea (solanaceae).

    Science.gov (United States)

    Stone, Judy L; VanWyk, Emily J; Hale, Jennifer R

    2014-07-01

    The evolution of self-fertilization is one of the most commonly traversed transitions in flowering plants, with profound implications for population genetic structure and evolutionary potential. We investigated factors influencing this transition using Witheringia solanacea, a predominantly self-incompatible (SI) species within which self-compatible (SC) genotypes have been identified. We showed that self-compatibility in this species segregates with variation at the S-locus as inherited by plants in F1 and F2 generations. To examine reproductive assurance and the transmission advantage of selfing, we placed SC and SI genotypes in genetically replicated gardens and monitored male and female reproductive success, as well as selfing rates of SC plants. Self-compatibility did not lead to increased fruit or seed set, even under conditions of pollinator scarcity, and the realized selfing rate of SC plants was less than 10%. SC plants had higher fruit abortion rates, consistent with previous evidence showing strong inbreeding depression at the embryonic stage. Although the selfing allele did not provide reproductive assurance under observed conditions, it also did not cause pollen discounting, so the transmission advantage of selfing should promote its spread. Given observed numbers of S-alleles and selfing rates, self-compatibility should spread even under conditions of exceedingly high initial inbreeding depression. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  1. Production of Pharmaceutical Proteins in Solanaceae Food Crops

    Directory of Open Access Journals (Sweden)

    Giorgio De Guzman

    2013-01-01

    Full Text Available The benefits of increased safety and cost-effectiveness make vegetable crops appropriate systems for the production and delivery of pharmaceutical proteins. In particular, Solanaceae edible crops could be inexpensive biofactories for oral vaccines and other pharmaceutical proteins that can be ingested as minimally processed extracts or as partially purified products. The field of crop plant biotechnology is advancing rapidly due to novel developments in genetic and genomic tools being made available today for the scientific community. In this review, we briefly summarize data now available regarding genomic resources for the Solanaceae family. In addition, we describe novel strategies developed for the expression of foreign proteins in vegetable crops and the utilization of these techniques to manufacture pharmaceutical proteins.

  2. Nicotine from edible Solanaceae and risk of Parkinson disease.

    Science.gov (United States)

    Nielsen, Susan Searles; Franklin, Gary M; Longstreth, W T; Swanson, Phillip D; Checkoway, Harvey

    2013-09-01

    To test whether risk of Parkinson disease (PD) is associated with consumption of nicotine-containing edibles from the same botanical family as tobacco, Solanaceae, including peppers, tomatoes, and potatoes. In a population-based study with 490 newly diagnosed idiopathic PD cases diagnosed during 1992-2008 at the University of Washington Neurology Clinic or Group Health Cooperative in western Washington State and 644 unrelated, neurologically normal controls, we examined whether PD was associated with self-reported typical frequency of consumption of peppers, tomatoes, tomato juice, and potatoes during adulthood, while adjusting for consumption of other vegetables, age, sex, race/ethnicity, tobacco use, and caffeine. PD was inversely associated with consumption of all edible Solanaceae combined (relative risk [RR] = 0.81, 95% confidence interval [CI] = 0.65-1.01 per time per day), but not consumption of all other vegetables combined (RR = 1.00, 95% CI = 0.92-1.10). The trend strengthened when we weighted edible Solanaceae by nicotine concentration (ptrend = 0.004). An inverse association was also evident for peppers specifically (ptrend = 0.005). The potentially protective effect of edible Solanaceae largely occurred in men and women who had never used tobacco or who had smoked cigarettes < 10 years. Dietary nicotine or other constituents of tobacco and peppers may reduce PD risk. However, confirmation and extension of these findings are needed to strengthen causal inferences that could suggest possible dietary or pharmaceutical interventions for PD prevention. Copyright © 2013 American Neurological Association.

  3. (Stocks) Dunal

    African Journals Online (AJOL)

    Jane

    2011-07-27

    Jul 27, 2011 ... MS medium with 2 mgl-1 IBA was found most effective for the induction of stout root system. Well-rooted plantlets were transferred to outside pots containing sterile soil, and sand mixture (2:1) showed 75% survival. Key words: In vitro, medicinal plant, propagation, Withania coagulans. INTRODUCTION.

  4. SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes.

    Science.gov (United States)

    D'Agostino, Nunzio; Traini, Alessandra; Frusciante, Luigi; Chiusano, Maria Luisa

    2009-11-30

    Since no genome sequences of solanaceous plants have yet been completed, expressed sequence tag (EST) collections represent a reliable tool for broad sampling of Solanaceae transcriptomes, an attractive route for understanding Solanaceae genome functionality and a powerful reference for the structural annotation of emerging Solanaceae genome sequences. We describe the SolEST database http://biosrv.cab.unina.it/solestdb which integrates different EST datasets from both cultivated and wild Solanaceae species and from two species of the genus Coffea. Background as well as processed data contained in the database, extensively linked to external related resources, represent an invaluable source of information for these plant families. Two novel features differentiate SolEST from other resources: i) the option of accessing and then visualizing Solanaceae EST/TC alignments along the emerging tomato and potato genome sequences; ii) the opportunity to compare different Solanaceae assemblies generated by diverse research groups in the attempt to address a common complaint in the SOL community. Different databases have been established worldwide for collecting Solanaceae ESTs and are related in concept, content and utility to the one presented herein. However, the SolEST database has several distinguishing features that make it appealing for the research community and facilitates a "one-stop shop" for the study of Solanaceae transcriptomes.

  5. Evaluación genotóxica del extracto acuoso liofilizado de Solanum sessiliflorum Dunal, cocona en células germinales del ratón

    OpenAIRE

    Betancourt B., José E.; Instituto de Medicina Tradicional IMET - EsSALUD.; Ríos, Felipe; Instituto de Medicina Tradicional IMET-EsSALUD.; Gorriti G., Arilmí; Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Córdova R., Augusta; Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Novoa C., Edgar; Facultad de Farmacia y Bioquímica UNAP.; López A., Doris L.; Facultad de Farmacia y Bioquímica UNAP.; Bicerra F., José L.; Facultad de Farmacia y Bioquímica UNAP.; Cruz F., Armando; Facultad de Farmacia y Bioquímica UNAP.

    2014-01-01

    The genotoxic potential of the aquosus extract lyophilized of fruits solanum sessiliflorum Dunal, by means of methad head anomaly of spermatozoid rnouse was evaluated. A total of 21 albino mice male of the cepa Balb/c-53 were used. Tree group experimentals with 7 animals for group: solanum sessiliflorum Dunal to dose 2000mg/kg, ciclofosfamide to dose 50 mg/kg (positive control) and saline solution 0.9 % (negative control) were established. The aquosus extract and saline solution were adminis...

  6. Proximate Nutritive Values and Mineral Components of Withania Somnifera (Linn. Dunal

    Directory of Open Access Journals (Sweden)

    S. R. Krishnamurthy

    2010-01-01

    Full Text Available Withania somnifera (Linn. Dunal is a subtropical shrub with important medicinal properties. The nutritive value and the elemental composition of different parts of plants, Withania somnifera which are grown in two distinct geographical regions (Sondekola and Karthikere of Karnataka have been determined. The investigation revealed that the variation of macro, micro and proximate components varied not only in the plants of different regions but also in the different parts of the same plant. Among the macro elements, Karthikere samples recorded maximum values of nitrogen, phosphorous and magnesium and Sondekola samples recorded maximum values of sodium, potassium and calcium. Among the components of micronutrients, the highest values of iron were recorded both in Sondekola and Karthikere samples. The average values of manganese, copper and zinc were more in the Karthikere samples and comparatively less in the Sondekola samples. Whereas, all the samples of Sondekola recorded maximum values of nutrition. It is believed that the dry climatic condition of the region may contribute the high values of nutrition. Further, the observations are discussed with reference to the geography, elemental composition and nutritional values. The strong and negative observations on herbal drugs and their validity, the study emphasizes the role of elemental composition, proximate components, nutritive value, habitat and geographical features which influence growth and development of Withania somnifera and also herbal products of Withania somnifera in particular and medicinal plants in general.

  7. Postharvest quality of cocona (Solanum sessiliflorum Dunal stored under ambient condition

    Directory of Open Access Journals (Sweden)

    Danielle Fabíola Pereira da Silva

    2011-08-01

    Full Text Available Cocona (Solanum sessiliflorum Dunal is an important genetic resource that has been traditionally used for a variety of purposes, including food, medical and cosmetics applications. The objective of this study was evaluated the quality and the period of postharvest shelf life of cocona 'Mosquet", through the physical, chemical and physiological characterization of fruits stored under the ambient conditions. Physiologically mature fruits were harvested from an orchard, washed with tap water and soaked in a solution of the fungicide Prochloraz (49.5 g/100 L of water for 5 minutes. After air drying, the fruits were packed in plastic containers and stored at 24 ± 2 ºC and relative humidity 60 ± 5% for 15 days. The fruits developed a respiratory climacteric respiratory patern and remained fit for consumption up to day 6 of storage, that is, without visual symptoms of loss of water and firmness. At this stage, the fruits showed firmness of 117,42 kPa, soluble solids of 6.62º Brix and citric acid of 1.22 %.

  8. Efficacy of Ashwagandha (Withania somnifera [L.] Dunal) in improving cardiorespiratory endurance in healthy athletic adults.

    Science.gov (United States)

    Choudhary, Bakhtiar; Shetty, A; Langade, Deepak G

    2015-01-01

    Ashwagandha (Withania somnifera [L.] Dunal) has been traditionally used for various actions ranging from vitalizer, improve endurance and stamina, promote longevity, improve immunity, and male and female fertility. However, clinical studies are needed to prove the clinical efficacy of this herb, especially in cardiovascular endurance and physical performance. This prospective, double-blind, randomized, and placebo-controlled study evaluated the efficacy of Ashwagandha roots extract in enhancing cardiorespiratory endurance and improving the quality of life (QOL) in 50 healthy male/female athletic adults. Cardiorespiratory endurance was assessed by measuring the oxygen consumption at peak physical exertion (VO2 max) levels during a 20 m shuttle run test. The World Health Organization self-reported QOL questionnaire (physical health, psychological health, social relationships, and environmental factors) was used to assess the QOL. Student's t-test was used to compare the differences in a mean and change from baseline VO2 max levels, whereas Wilcoxon signed-rank test was used to assess changes in QOL scores from baseline in the two groups. There was a greater increase from baseline (P Ashwagandha (n = 24) compared to placebo (n = 25) at 8 weeks (4.91 and 1.42, respectively) and at 12 weeks (5.67 and 1.86 respectively). The QOL scores for all subdomains significantly improved to a greater extent in the Ashwagandha group at 12 weeks compared to placebo (P Ashwagandha root extract enhances the cardiorespiratory endurance and improves QOL in healthy athletic adults.

  9. A Review of Bioinsecticidal Activity of Solanaceae Alkaloids

    Directory of Open Access Journals (Sweden)

    Szymon Chowański

    2016-03-01

    Full Text Available Only a small percentage of insect species are pests. However, pest species cause significant losses in agricultural and forest crops, and many are vectors of diseases. Currently, many scientists are focused on developing new tools to control insect populations, including secondary plant metabolites, e.g., alkaloids, glycoalkaloids, terpenoids, organic acids and alcohols, which show promise for use in plant protection. These compounds can affect insects at all levels of biological organization, but their action generally disturbs cellular and physiological processes, e.g., by altering redox balance, hormonal regulation, neuronal signalization or reproduction in exposed individuals. Secondary plant metabolites cause toxic effects that can be observed at both lethal and sublethal levels, but the most important effect is repellence. Plants from the Solanaceae family, which contains numerous economically and ecologically important species, produce various substances that affect insects belonging to most orders, particularly herbivorous insects and other pests. Many compounds possess insecticidal properties, but they are also classified as molluscides, acaricides, nematocides, fungicides and bactericides. In this paper, we present data on the sublethal and lethal toxicity caused by pure metabolites and crude extracts obtained from Solanaceae plants. Pure substances as well as water and/or alcohol extracts cause lethal and sublethal effects in insects, which is important from the economical point of view. We discuss the results of our study and their relevance to plant protection and management.

  10. Tropane alkaloids and calystegines as chemotaxonomic markers in the Solanaceae.

    Science.gov (United States)

    Pigatto, Aline G S; Blanco, Carolina C; Mentz, Lilian A; Soares, Geraldo L G

    2015-01-01

    This study assessed the occurrence and distribution of tropane alkaloids and calystegines in genera of the family Solanaceae to identify patterns of distribution and make evolutionary inferences. A database of tropane alkaloids and calystegines occurrences was constructed from the results of a search of scientific websites and a hand search of periodicals. The terms "Solanaceae", "tropane alkaloids", and "calystegines" were used as index terms for a full-text article search unrestricted by date of publications. The number of occurrence and chemical diversity indices were calculated and cluster analysis and principal components analysis were performed. Overall, 996 occurrences were reported, 879 of tropane alkaloids (88.3%) and 117 of calystegines (11.7%). The calystegines were significantly more relevant than tropane alkaloids for characterization of distinct groups of genera on both analyses performed here. This corroborates the trend toward a chemical dichotomy observed on database analysis and somewhat reinforces the correlation between geographic distribution and occurrence of secondary metabolites, as the presence of calystegines alone (without tropane alkaloids) was only reported in genera that have South America as their center of diversity.

  11. A Review of Bioinsecticidal Activity of Solanaceae Alkaloids.

    Science.gov (United States)

    Chowański, Szymon; Adamski, Zbigniew; Marciniak, Paweł; Rosiński, Grzegorz; Büyükgüzel, Ender; Büyükgüzel, Kemal; Falabella, Patrizia; Scrano, Laura; Ventrella, Emanuela; Lelario, Filomena; Bufo, Sabino A

    2016-03-01

    Only a small percentage of insect species are pests. However, pest species cause significant losses in agricultural and forest crops, and many are vectors of diseases. Currently, many scientists are focused on developing new tools to control insect populations, including secondary plant metabolites, e.g., alkaloids, glycoalkaloids, terpenoids, organic acids and alcohols, which show promise for use in plant protection. These compounds can affect insects at all levels of biological organization, but their action generally disturbs cellular and physiological processes, e.g., by altering redox balance, hormonal regulation, neuronal signalization or reproduction in exposed individuals. Secondary plant metabolites cause toxic effects that can be observed at both lethal and sublethal levels, but the most important effect is repellence. Plants from the Solanaceae family, which contains numerous economically and ecologically important species, produce various substances that affect insects belonging to most orders, particularly herbivorous insects and other pests. Many compounds possess insecticidal properties, but they are also classified as molluscides, acaricides, nematocides, fungicides and bactericides. In this paper, we present data on the sublethal and lethal toxicity caused by pure metabolites and crude extracts obtained from Solanaceae plants. Pure substances as well as water and/or alcohol extracts cause lethal and sublethal effects in insects, which is important from the economical point of view. We discuss the results of our study and their relevance to plant protection and management.

  12. A Review of Bioinsecticidal Activity of Solanaceae Alkaloids

    Science.gov (United States)

    Chowański, Szymon; Adamski, Zbigniew; Marciniak, Paweł; Rosiński, Grzegorz; Büyükgüzel, Ender; Büyükgüzel, Kemal; Falabella, Patrizia; Scrano, Laura; Ventrella, Emanuela; Lelario, Filomena; Bufo, Sabino A.

    2016-01-01

    Only a small percentage of insect species are pests. However, pest species cause significant losses in agricultural and forest crops, and many are vectors of diseases. Currently, many scientists are focused on developing new tools to control insect populations, including secondary plant metabolites, e.g., alkaloids, glycoalkaloids, terpenoids, organic acids and alcohols, which show promise for use in plant protection. These compounds can affect insects at all levels of biological organization, but their action generally disturbs cellular and physiological processes, e.g., by altering redox balance, hormonal regulation, neuronal signalization or reproduction in exposed individuals. Secondary plant metabolites cause toxic effects that can be observed at both lethal and sublethal levels, but the most important effect is repellence. Plants from the Solanaceae family, which contains numerous economically and ecologically important species, produce various substances that affect insects belonging to most orders, particularly herbivorous insects and other pests. Many compounds possess insecticidal properties, but they are also classified as molluscides, acaricides, nematocides, fungicides and bactericides. In this paper, we present data on the sublethal and lethal toxicity caused by pure metabolites and crude extracts obtained from Solanaceae plants. Pure substances as well as water and/or alcohol extracts cause lethal and sublethal effects in insects, which is important from the economical point of view. We discuss the results of our study and their relevance to plant protection and management. PMID:26938561

  13. Experimental therapeutic studies of Solanum aculeastrum Dunal. on Leishmania major infection in BALB/c mice.

    Science.gov (United States)

    Laban, Linet T; Anjili, Christopher O; Mutiso, Joshua M; Ingonga, Johnstone; Kiige, Samuel G; Ngedzo, Mgala M; Gicheru, Michael M

    2015-01-01

    Solanum acueastrum Dunal. has been shown to have some chemotherapeutic value. Leaf and berry water and methanol compounds of S. acueastrum were evaluated for possible antileishmanial activity In vivo on BALB/c mice and in vitro against Leishmania major promastigotes, amastigotes and vero cells. Dry S. aculeastrum berry and leaf material were extracted in methanol and water. L. major parasites were exposed to different concentrations of S. aculeastrum fruit and leaf compounds and the IC50 on the promastigotes, percentage of infection rate of macrophages by amastigotes and the toxicological effect on vero cells were determined. BALB/c mice were infected subcutaneously with 1×10(6) promastigotes and kept for four weeks to allow for disease establishment. Infected mice were treated with fruit and leaf methanolic and water compounds, amphotericin B (AmB), and sterile phosphate buffered saline (PBS). Fruit methanol compound was most effective in inhibiting the growth of promastigotes with IC5078.62 μg/ml. Fruit water compound showed the best activity in inhibiting infection of macrophages by amastigotes. Fruit methanol compound was more toxic at Ld50=8.06 mg/ml to vero cells than amphotericin B. Analysis of variance computation indicated statistically significant difference in lesion sizes between experimental and control mice groups (P=0.0001). Splenic impression smears ANOVA indicated a highly significant difference in parasitic numbers between the experimental and the control groups (P=0.0001). The results demonstrate that compounds from S. aculeastrum have potential anti-leishmanial activities and the medicinal use of the plant poses considerable toxicity against dividing vero cells.

  14. Efficacy of Ashwagandha (Withania somnifera [L.] Dunal) in improving cardiorespiratory endurance in healthy athletic adults

    Science.gov (United States)

    Choudhary, Bakhtiar; Shetty, A.; Langade, Deepak G.

    2015-01-01

    Introduction: Ashwagandha (Withania somnifera [L.] Dunal) has been traditionally used for various actions ranging from vitalizer, improve endurance and stamina, promote longevity, improve immunity, and male and female fertility. However, clinical studies are needed to prove the clinical efficacy of this herb, especially in cardiovascular endurance and physical performance. Aims: This prospective, double-blind, randomized, and placebo-controlled study evaluated the efficacy of Ashwagandha roots extract in enhancing cardiorespiratory endurance and improving the quality of life (QOL) in 50 healthy male/female athletic adults. Materials and Methods: Cardiorespiratory endurance was assessed by measuring the oxygen consumption at peak physical exertion (VO2 max) levels during a 20 m shuttle run test. The World Health Organization self-reported QOL questionnaire (physical health, psychological health, social relationships, and environmental factors) was used to assess the QOL. Student's t-test was used to compare the differences in a mean and change from baseline VO2 max levels, whereas Wilcoxon signed-rank test was used to assess changes in QOL scores from baseline in the two groups. Results: There was a greater increase from baseline (P < 0.0001) in the mean VO2 max with KSM-66 Ashwagandha (n = 24) compared to placebo (n = 25) at 8 weeks (4.91 and 1.42, respectively) and at 12 weeks (5.67 and 1.86 respectively). The QOL scores for all subdomains significantly improved to a greater extent in the Ashwagandha group at 12 weeks compared to placebo (P < 0.05). Conclusion: The findings suggest that Ashwagandha root extract enhances the cardiorespiratory endurance and improves QOL in healthy athletic adults. PMID:26730141

  15. Solanaceae endémicas del Perú

    Directory of Open Access Journals (Sweden)

    Sandra Knapp

    2013-10-01

    Full Text Available La familia Solanaceae es una de las más ricas en especies en la flora peruana, siendo reconocida con alrededor de 42 géneros y 600 especies (Brako & Zarucchi, 1993; Ulloa Ulloa et al., 2004, principalmente hierbas y arbustos. En este trabajo reconocemos 208 especies y seis variedades como endémicos, en 16 géneros. Esta familia ocupa el sexto lugar por su diversidad en especies endémicas, siendo Solanum, Nolana y Jaltomata los géneros más ricos en especies. Los taxones endémicos se encuentran en la mayoría de las regiones, principalmente en Mesoandina, Desierto Semicálido Tropical y Bosques Muy Húmedos Montanos, desde el nivel del mar hasta los 3800 m de altitud. Treinta y seis taxones se encuentran representados dentro del Sistema Nacional de Áreas Naturales Protegidas por el Estado.

  16. Three new acyltyramines from Anisodus luridus Link et Otto (Solanaceae).

    Science.gov (United States)

    Das, Lalit Kumar Lal; Verma, Mradul; Sahai, Mahendra

    2016-11-01

    Three new acyltyramines, N-[2-(4-hydroxyphenyl)ethyl]hentriacontanamide (1), N-[2-(4-hydroxyphenyl)ethyl]nonacosanamide (2) and N-[2-(4-hydroxyphenyl)ethyl]heneicosanamide (3) have been isolated from n-hexane extract of leaves of Anisodus luridus (Solanaceae). Successive extraction of defatted leaves of A. luridus with methanol afforded a residue on removal of solvent under reduced pressure. Residue was partitioned by means of chloroform and n-butanol. Chromatographic resolution of n-BuOH extract afforded six known compounds, apigenin (4), luteolin (5), quercetin (6), quercetin 3-O-α-l-rhamnoside (7), kaempferol 3-O-α-rhamnoside (8) and quercetin 3-O-α-l-rhamnopyranosyl-(1→6)-β-d-glucopyranoside (9). The structures of the isolated compounds were assigned with the help of spectroscopic techniques. This is the first report of isolation of these compounds from this plant.

  17. Profiling and quantification of regioisomeric caffeoyl glucoses in Solanaceae vegetables.

    Science.gov (United States)

    Patras, Maria A; Jaiswal, Rakesh; Kuhnert, Nikolai

    2017-12-15

    Based on the recently developed tandem MS based hierarchical scheme for the identification of regioisomeric caffeoyl glucoses, selected vegetables were profiled with respect to their caffeoyl glucose content. The dietary plants profiled were tomato, pepper, chilli and aubergine, all members of the Solanaceae family. 6-O-caffeoyl glucose was found to be the predominant isomer. In processed food such as tomato puree and ketchup a larger number of caffeoyl-glucose isomers formed through acyl migration reactions were observed. A LC-MS based quantitative method was developed, validated and caffeoyl glucose regioisomers quantified for the first time in dietary plants with quantitative data obtained from representative 30 food samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Unilateral Incompatibility in Capsicum (Solanaceae): Occurrence and Taxonomic Distribution

    Science.gov (United States)

    ONUS, A. NACI; PICKERSGILL, BARBARA

    2004-01-01

    • Background and aims Unilateral incompatibility (UI) occurs when pollinations between species are successful in one direction but not in the other. Self-incompatible (SI) species frequently show UI with genetically related, self-compatible (SC) species, as pollen of SI species is compatible on the SC pistil, but not vice versa. Many examples of unilateral incompatibility, and all those which have been studied most intensively, are found in the Solanaceae, particularly Lycopersicon, Solanum, Nicotiana and Petunia. The genus Capsicum is evolutionarily somewhat distant from Lycopersicon and Solanum and even further removed from Nicotiana and Petunia. Unilateral incompatibility has also been reported in Capsicum; however, this is the first comprehensive study of crosses between all readily available species in the genus. • Methods All readily available (wild and domesticated) species in the genus are used as plant material, including the three genera from the Capsicum pubescens complex plus eight other species. Pollinations were made on pot-grown plants in a glasshouse. The number of pistils pollinated per cross varied (from five to 40 pistils per plant), depending on the numbers of flowers available. Pistils were collected 24 h after pollination and fixed for 3–24 h. After staining, pistils were mounted in a drop of stain, squashed gently under a cover slip and examined microscopically under ultra-violet light for pollen tube growth. • Key results Unilateral incompatibility is confirmed in the C. pubescens complex. Its direction conforms to that predominant in the Solanaceae and other families, i.e. pistils of self-incompatible species, or self-compatible taxa closely related to self-incompatible species, inhibit pollen tubes of self-compatible species. • Conclusions Unilateral incompatibility in Capsicum does not seem to have arisen to prevent introgression of self-compatibility into self-incompatible taxa, but as a by-product of divergence of the C

  19. ORGANOGÉNESIS FLORAL EN ACNISTUS ARBORESCENS, DUNALIA SOLANACEA, DEPREA BITTERIANA, LARNAX GLABRA Y LARNAX HAWKESII - TRIBU PHYSALEAE (SOLANACEAE

    Directory of Open Access Journals (Sweden)

    GARZÓN-VENEGAS JAVIER

    2006-12-01

    Full Text Available Se estudió la organogénesis floral en las especies Acnistus arborescens, Dunaliasolanacea, Deprea bitteriana, Larnax glabra y Larnax hawkesii de la tribuPhysaleae (Solanaceae, empleando microscopía electrónica de barrido en modoambiental. Para fines de comparación de la organogénesis de las cinco especies, setuvieron en cuenta tres estados de desarrollo. Las especies estudiadas comparten lasecuencia acrópeta en la que surgen sépalos, pétalos, estambres y carpelos, así comoel arreglo simultáneo de corola y androceo. Comparten también la simpetalia tardía,siendo aún más tardía en las especies de Larnax. El tiempo de fusión de los pétalospuede considerarse un carácter importante para la diferenciación entre Deprea yLarnax. Se encontraron diferencias intergenéricas en cuanto al arreglo del cáliz, quees simultáneo en Dunalia solanacea, mientras que en Deprea bitteriana y en lasdos especies de Larnax es espiralado, en A. arborescens el patrón de desarrollo delos sépalos es intermedio. Los carpelos se desarrollan fusionados basalmente en unestadio temprano, todas las especies son bicarpelares, sin embargo, el gineceo de A.arborescens da la apariencia de ser tricarpelar por la formación de un “falso septo”.

  20. Evolution of genes associated with gynoecium patterning and fruit development in Solanaceae.

    Science.gov (United States)

    Ortiz-Ramírez, Clara Inés; Plata-Arboleda, Sayonara; Pabón-Mora, Natalia

    2018-02-17

    The genetic basis of fruit development has been extensively studied in Arabidopsis, where major transcription factors controlling valve identity (i.e. FRUITFULL), replum development (i.e. REPLUMLESS) and the differentiation of the dehiscence zones (i.e. SHATTERPROOF, INDEHISCENT and ALCATRAZ) have been identified. This gene regulatory network in other flowering plants is influenced by duplication events during angiosperm diversification. Here we aim to characterize candidate fruit development genes in the Solanaceae and compare them with those of Brassicaceae. ALC/SPT, HEC/IND, RPL and AG/SHP homologues were isolated from publicly available databases and from our own transcriptomes of Brunfelsia australis and Streptosolen jamesonii. Maximum likelihood phylogenetic analyses were performed for each of the gene lineages. Shifts in protein motifs, as well as expression patterns of all identified homologues, are shown in dissected floral organs and fruits in different developmental stages of four Solanaceae species exhibiting different fruit types. Each gene lineage has undergone different duplication time-points, resulting in very different genetic complements in the Solanaceae when compared with the Brassicaceae. In general, Solanaceae species have more copies of HEC1/2 and RPL than Brassicaceae, have fewer copies of SHP and the same number of copies of AG, ALC and SPT. Solanaceae lack IND orthologues, but have pre-duplication HEC3 homologues. The expression analyses showed opposite expression of SPT and ALC orthologues between dry- and fleshy-fruited species during fruit maturation. Fleshy-fruited species turn off RPL and SPT orthologues during maturation. The gynoecium patterning and fruit developmental genetic network in the Brassicaceae cannot be directly extrapolated to the Solanaceae. In Solanaceae ALC, SPT and RPL contribute differently to maturation of dry dehiscent and fleshy fruits, whereas HEC genes are not generally expressed in the gynoecium. RPL genes

  1. Improved Agrobacterium rhizogenes-mediated hairy root culture system of Withania somnifera (L.) Dunal using sonication and heat treatment.

    Science.gov (United States)

    Thilip, Chandrasekaran; Soundar Raju, Chellappan; Varutharaju, Kandhan; Aslam, Abubakker; Shajahan, Appakan

    2015-12-01

    An improved Agrobacterium rhizogenes-mediated genetic transformation of Withania somnifera (L.) Dunal was developed using the bacterial strain R1000 with leaf segment explants of in vitro raised plantlets. Out of the three strains used (R1000, MTCC 2364 and MTCC 532), the strain R1000 proved to be more efficient than others. Among the different conditions tested, the highest (93.3 %) transformation rate was observed after 3 weeks when the explants were subjected to sonication (15 s) and heat treatment (41 °C for 5 min). Transgenic status of the hairy roots was confirmed by PCR using rol B-specific primers. HPLC analysis showed the ability of hairy roots to synthesize withaferin A and withanolide A, both steroidal lactones of medicinal value. This protocol offers new avenue in A. rhizogenes-mediated hairy root induction and is useful for large-scale production of these bioactive compounds from W. somnifera.

  2. Efficacy and Safety of Ashwagandha (Withania somnifera (L.) Dunal) Root Extract in Improving Memory and Cognitive Functions.

    Science.gov (United States)

    Choudhary, Dnyanraj; Bhattacharyya, Sauvik; Bose, Sekhar

    2017-11-02

    Cognitive decline is often associated with the aging process. Ashwagandha (Withania somnifera (L.) Dunal) has long been used in the traditional Ayurvedic system of medicine to enhance memory and improve cognition. This pilot study was designed to evaluate the efficacy and safety of ashwagandha (Withania somnifera (L.) Dunal) in improving memory and cognitive functioning in adults with mild cognitive impairment (MCI). A prospective, randomized, double-blind, placebo-controlled study was conducted in 50 adults. Subjects were treated with either ashwagandha-root extract (300 mg twice daily) or placebo for eight weeks. After eight weeks of study, the ashwagandha treatment group demonstrated significant improvements compared with the placebo group in both immediate and general memory, as evidenced by Wechsler Memory Scale III subtest scores for logical memory I (p = 0.007), verbal paired associates I (p = 0.042), faces I (p = 0.020), family pictures I (p = 0.006), logical memory II (p = 0.006), verbal paired associates II (p = 0.031), faces II (p = 0.014), and family pictures II (p = 0.006). The treatment group also demonstrated significantly greater improvement in executive function, sustained attention, and information-processing speed as indicated by scores on the Eriksen Flanker task (p = 0.002), Wisconsin Card Sort test (p = 0.014), Trail-Making test part A (p = 0.006), and the Mackworth Clock test (p = 0.009). Ashwagandha may be effective in enhancing both immediate and general memory in people with MCI as well as improving executive function, attention, and information processing speed.

  3. The SOL Genomics Network. A Comparative Resource for Solanaceae Biology and Beyond1

    Science.gov (United States)

    Mueller, Lukas A.; Solow, Teri H.; Taylor, Nicolas; Skwarecki, Beth; Buels, Robert; Binns, John; Lin, Chenwei; Wright, Mark H.; Ahrens, Robert; Wang, Ying; Herbst, Evan V.; Keyder, Emil R.; Menda, Naama; Zamir, Dani; Tanksley, Steven D.

    2005-01-01

    The SOL Genomics Network (SGN; http://sgn.cornell.edu) is a rapidly evolving comparative resource for the plants of the Solanaceae family, which includes important crop and model plants such as potato (Solanum tuberosum), eggplant (Solanum melongena), pepper (Capsicum annuum), and tomato (Solanum lycopersicum). The aim of SGN is to relate these species to one another using a comparative genomics approach and to tie them to the other dicots through the fully sequenced genome of Arabidopsis (Arabidopsis thaliana). SGN currently houses map and marker data for Solanaceae species, a large expressed sequence tag collection with computationally derived unigene sets, an extensive database of phenotypic information for a mutagenized tomato population, and associated tools such as real-time quantitative trait loci. Recently, the International Solanaceae Project (SOL) was formed as an umbrella organization for Solanaceae research in over 30 countries to address important questions in plant biology. The first cornerstone of the SOL project is the sequencing of the entire euchromatic portion of the tomato genome. SGN is collaborating with other bioinformatics centers in building the bioinformatics infrastructure for the tomato sequencing project and implementing the bioinformatics strategy of the larger SOL project. The overarching goal of SGN is to make information available in an intuitive comparative format, thereby facilitating a systems approach to investigations into the basis of adaptation and phenotypic diversity in the Solanaceae family, other species in the Asterid clade such as coffee (Coffea arabica), Rubiaciae, and beyond. PMID:16010005

  4. Highly Oxygenated Flavonoids from the Leaves of Nicotiana plumbaginifolia (Solanaceae

    Directory of Open Access Journals (Sweden)

    Md. Shafiullah Shajib

    2017-11-01

    Full Text Available Nicotiana plumbaginifolia Viv. is an annual herb of the family Solanaceae, which grows abundantly in the weedy lands of Bangladesh . This plant possesses analgesic, antibacterial, anti-anxiety and hepatoprotective properties, and produces various phenolic compounds including flavonoids. The present study afforded determination of total phenolic and flavonoid contents, and for the first time, the isolation and characterization of highly oxygenated flavonoids, e.g., 3,3' ,5,6,7,8-hexamethoxy- 4',5'-methylenedioxyflavone (1, 3,3' ,4' ,5',5,6,7,8-octamethoxyflavone (2, exoticin, 6,7,4',5'-dimethylenedioxy-3,5,3'-trimethoxyflavone (3 and ( 3,3' ,4',5,5',8-hexamethoxy-6,7-methylenedioxyflavone (4 from the leaves of N. plumbaginifolia . All these flavonoids are rather rare natural products, and only found in a few genera, e.g.,Polygonum and Murraya. The structures of the isolated flavonoids were elucidated by comprehensive spectroscopic analyses, e.g., UV, 1H, 13C NMR, DEPT, HSQC, HMBC and MS.

  5. Leaf Structure and Taxonomy of Petunia and Calibrachoa (Solanaceae

    Directory of Open Access Journals (Sweden)

    Claudia dos Reis

    2002-03-01

    Full Text Available We studied the leaf anatomy of sixteen species of Calibrachoa and eight species of Petunia. In Calibrachoa leaves, the vascular bundles sheath (endodermis was formed by parenchymatous developed cells, different from those of the mesophyll. In Petunia, this sheath did not show a marked morphological differentiation. The Calibrachoa leaves could be separated according to the type of leaf margins, the distribution of the stomata on leaf surfaces, the organization of the mesophyll and the morphology of the trichomes. Based on these results, an indented dichotomous identification key was elaborated for the species of the genus Calibrachoa.Foram estudados, sob o ponto de vista anatômico, os limbos foliares de dezesseis espécies de Calibrachoa Llav. & Lex. e de oito espécies de Petunia Juss. (Solanaceae. Em Calibrachoa, a bainha que envolve os feixes vasculares (endoderme é formada por células desenvolvidas e distintas das do mesofilo. Em Petunia, esta bainha não apresenta diferenciação morfológica marcante. As folhas das espécies de Calibrachoa foram separadas entre si levando-se em conta a distribuição dos estômatos nas faces foliares, a organização do mesofilo, o tipo de bordo e a morfologia dos tricomas. Com base nesses resultados, foi elaborada uma chave dicotômica indentada de identificação para as espécies do gênero Calibrachoa.

  6. Evolutionary developmental genetics of fruit morphological variation within the Solanaceae

    Science.gov (United States)

    Wang, Li; Li, Jing; Zhao, Jing; He, Chaoying

    2015-01-01

    Morphological variations of fruits such as shape and size, and color are a result of adaptive evolution. The evolution of morphological novelties is particularly intriguing. An understanding of these evolutionary processes calls for the elucidation of the developmental and genetic mechanisms that result in particular fruit morphological characteristics, which determine seed dispersal. The genetic and developmental basis for fruit morphological variation was established at a microevolutionary time scale. Here, we summarize the progress on the evolutionary developmental genetics of fruit size, shape and color in the Solanaceae. Studies suggest that the recruitment of a pre-existing gene and subsequent modification of its interaction and regulatory networks are frequently involved in the evolution of morphological diversity. The basic mechanisms underlying changes in plant morphology are alterations in gene expression and/or gene function. We also deliberate on the future direction in evolutionary developmental genetics of fruit morphological variation such as fruit type. These studies will provide insights into plant developmental processes and will help to improve the productivity and fruit quality of crops. PMID:25918515

  7. Widespread flower color convergence in Solanaceae via alternate biochemical pathways.

    Science.gov (United States)

    Ng, Julienne; Smith, Stacey D

    2016-01-01

    Phenotypic convergence is rampant throughout the tree of life. While recent studies have made significant progress in ascertaining the proximate mechanisms underlying convergent phenotypes, less is known about the frequency and predictability with which convergent phenotypes arise via the same or multiple pathways at the macroevolutionary scale. We investigated the proximate causes and evolutionary patterns of red flower color in the tomato family, Solanaceae, using large-scale data mining and new sequence data to reconstruct a megaphylogeny of 1341 species. We then combined spectral and anatomical data to assess how many times red flowers have evolved, the relative contribution of different pathways to independent origins of red, and whether the underlying pathway is predicted by phylogenetic relatedness. We estimated at least 30 relatively recent origins of red flowers using anthocyanins, carotenoids, or a dual production of both pigments, with significant phylogenetic signal in the use of anthocyanins and dual production, indicating that closely related red-flowered species tend to employ the same mechanism for coloration. Our study is the first to test whether developmental pathways exhibit phylogenetic signal and implies that historical contingency strongly influences the evolution of new phenotypes. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  8. Eight new species of Cestrum (Solanaceae) from Mesoamerica.

    Science.gov (United States)

    Monro, Alex K

    2012-01-01

    As part of the preparation of a taxonomic revision of Cestrum (Solanaceae) for Flora Mesoamericana eight hitherto undescribed species from Mexico, Guatemala, Costa Rica and Panama were identified. These eight new species are described and illustrated. Affinities of the species are discussed and Global Species Conservation Assessments presented.The new species are Cestrum amistadense A.K. Monro, sp. nov. (Vulnerable) which most closely resembles Cestrum longiflorum Ruiz & Pav., Cestrum contrerasianum A.K. Monro, sp. nov. (Vulnerable) which most closely resembles Cestrum formosum C.V.Morton, Cestrum darienense A.K. Monro, sp. nov. (Near Threatened) which most closely resembles Cestrum morae Hunz., Cestrum gilliae A.K. Monro, sp. nov. (Near Threatened) which most closely resembles Cestrum morae, Cestrum haberii A.K. Monro, sp. nov. (Vulnerable) which most closely resembles Cestrum poasanum Donn.Sm., Cestrum knappiae A.K. Monro, sp. nov. (Near Threatened) which most closely resembles Cestrum acuminatum Francey, Cestrum lentii A.K. Monro, sp. nov. (Near Threatened) which most closely resembles Cestrum johnniegentrianum D'Arcy and Cestrum talamancaense A.K. Monro (Least Concern) which most closely resembles Cestrum laxum Benth.

  9. A review of the genus Hyoscyamus (Solanaceae in Iran

    Directory of Open Access Journals (Sweden)

    شادی حاج رسولیها

    2015-12-01

    Full Text Available The genus Hyoscyamus is belonging to the family Solanaceae. This genus with 12-19 species has a wide range of distribution in Iran. In different flora, some species of this genus are synonym due the similar morphology. Three subgenera are introduced for genus namely Hyoscyamus, Parahyoscyamus and Dendrotrichon in Iran. For accurate survey done the general review on this genus. For morphological studies the images of calyx species were plotted with stereo microscope with specified enlarge. For numerical taxonomy studies 42 qualitative and quantitative morphological characters were selected and analyzed with SPSS software with three methods cluster, PCA and FA. Then the results of analysis compared and reconciled with data from various studies conducted on this genus. Survey data confirmed the approximation of two species H.tenuicaulis and H. bornmulleri and H. bornmulleri is the synonym of H. tenuicaulis. Also, H. malekianus transferred from subgen. Parahyoscyamus to subgen. Dendrotrichon. Finally, a key to all species of the genus Hyoscyamus in Iran is provided.

  10. Palinologia de espécies de Solanum L. (Solanaceae A. Juss. ocorrentes nas restingas do Estado do Rio de Janeiro, Brasil Palynology of species of Solanum L. (Solanaceae A. Juss. from the restingas of Rio de Janeiro State, Brazil

    Directory of Open Access Journals (Sweden)

    Carla Patrícia Rodrigues Batista-Franklim

    2008-09-01

    Full Text Available Foram estudados 21 táxons de Solanum L., com o objetivo de caracterizá-los palinologicamente e, assim, contribuir para a elaboração de um catálogo polínico da flora das restingas do Estado do Rio de Janeiro. Os táxons examinados foram Solanum affine Sendtn., Solanum americanum Mill. var. americanum,Solanum argenteum Dunal ex Poir., Solanum aturense Dunal, Solanum caavurana Vell., Solanum capsicoides All., Solanum carautae Carv., Solanum cordifolium Dunal, Solanum curvispinum Dunal, Solanum echidnaeforme Dunal, Solanum gardneri Sendtn.,Solanum indigoferum A. St.-Hil., Solanum insidiosum Mart., Solanum mauritianum Scop., Solanum paludosum Moric., Solanum paniculatum L., Solanum paratyense Vell., Solanum pseudoquina A.St.-Hil., Solanum sisymbriifolium Lam., Solanum torvum Sw., Solanum velleum Sw. Os grãos de pólen foram acetolisados, mensurados, descritos e fotomicrografados. A análise sob microscopia eletrônica de varredura foi utilizada, em grãos de pólen não acetolisados, para confirmar as descrições feitas sob microscopia de luz e, em alguns casos para confirmar as descrições de abertura e ornamentação. Constatou-se que os grãos de pólen são pequenos ou médios, isopolares, subprolatos a oblato-esferoidais, 3-colporados, sexina granulada, rugulado-granulada ou escabrada. Pela análise dos resultados obtidos pôde-se concluir que os táxons analisados apresentam certa heterogeneidade polínica, quanto à forma, aos atributos das aberturas e à ornamentação da sexina, podendo-se usar estes caracteres na taxonomia do gênero.In this study 21 taxa of Solanum L. were investigated for palynological characterization and to contribute to the Pollen Catalog of the Flora of the Rio de Janeiro restingas. The taxa analysed were Solanum affine Sendtn., Solanum americanum Mill. var. americanum,Solanum argenteum Dunal ex Poir., Solanum aturense Dunal, Solanum caavurana Vell., Solanum capsicoides All., Solanum carautae Carv., Solanum

  11. Eocene lantern fruits from Gondwanan Patagonia and the early origins of Solanaceae.

    Science.gov (United States)

    Wilf, Peter; Carvalho, Mónica R; Gandolfo, María A; Cúneo, N Rubén

    2017-01-06

    The nightshade family Solanaceae holds exceptional economic and cultural importance. The early diversification of Solanaceae is thought to have occurred in South America during its separation from Gondwana, but the family's sparse fossil record provides few insights. We report 52.2-million-year-old lantern fruits from terminal-Gondwanan Patagonia, featuring highly inflated, five-lobed calyces, as a newly identified species of the derived, diverse New World genus Physalis (e.g., groundcherries and tomatillos). The fossils are considerably older than corresponding molecular divergence dates and demonstrate an ancient history for the inflated calyx syndrome. The derived position of these early Eocene fossils shows that Solanaceae were well diversified long before final Gondwanan breakup. Copyright © 2017, American Association for the Advancement of Science.

  12. A new species of Solanum (Solanaceae from South Africa related to the cultivated eggplant

    Directory of Open Access Journals (Sweden)

    Maria Vorontsova

    2012-01-01

    Full Text Available A new andromonoecious species related to the eggplant and belonging to Solanum subgenus Leptostemonum from southern Africa is described. Solanum umtuma Voronts. & S.Knapp, sp. nov. is found in the eastern part of South Africa, and is sympatric with its close relative S. linnaeanum Hepper & P.M-L.Jaeger. It is morphologically very similar to S. cerasiferum Dunal of northern tropical Africa. A comparison table with similar and closely related species is provided, as are a distribution map and illustration of S. umtuma.

  13. Discovery, identification and comparative analysis of non-specific lipid transfer protein (nsLtp) family in Solanaceae.

    Science.gov (United States)

    Liu, Wanfei; Huang, Dawei; Liu, Kan; Hu, Songnian; Yu, Jun; Gao, Gang; Song, Shuhui

    2010-12-01

    Plant non-specific lipid transfer proteins (nsLtps) have been reported to be involved in plant defense activity against bacterial and fungal pathogens. In this study, we identified 135 (122 putative and 13 previously identified) Solanaceae nsLtps, which are clustered into 8 different groups. By comparing with Boutrot's nsLtp classification, we classified these eight groups into five types (I, II, IV, IX and X). We compared Solanaceae nsLtps with Arabi-dopsis and Gramineae nsLtps and found that (1) Types I, II and IV are shared by Solanaceae, Gramineae and Arabidopsis; (2) Types III, V, VI and VIII are shared by Gramineae and Arabidopsis but not detected in Solanaceae so far; (3) Type VII is only found in Gramineae whereas type IX is present only in Arabidopsis and Solanaceae; (4) Type X is a new type that accounts for 52.59% Solanaceae nsLtps in our data, and has not been reported in any other plant so far. We further built and compared the three-dimensional structures of the eight groups, and found that the major functional diversification within the nsLtp family could be predated to the monocot/dicot divergence, and many gene duplications and sequence variations had happened in the nsLtp family after the monocot/dicot divergence, especially in Solanaceae. Copyright © 2010 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.

  14. In silico identification and characterization of microRNAs and their putative target genes in Solanaceae plants.

    Science.gov (United States)

    Kim, Hyun-Jin; Baek, Kwang-Hyun; Lee, Bong-Woo; Choi, Doil; Hur, Cheol-Goo

    2011-02-01

    MicroRNAs (miRNAs) are a class of small, single-stranded, noncoding RNAs ranging from 19 to 25 nucleotides. The miRNA control various cellular functions by negatively regulating gene expression at the post-transcriptional level. The miRNA regulation over their target genes has a central role in regulating plant growth and development; however, only a few reports have been published on the function of miRNAs in the family Solanaceae. We identified Solanaceae miRNAs and their target genes by analyzing expressed sequence tag (EST) data from five different Solanaceae species. A comprehensive bioinformatic analysis of EST data of Solanaceae species revealed the presence of at least 11 miRNAs and 54 target genes in pepper (Capsicum annuum L.), 22 miRNAs and 221 target genes in potato (Solanum tuberosum L.), 12 miRNAs and 417 target genes in tomato (Solanum lycopersicum L.), 46 miRNAs and 60 target genes in tobacco (Nicotiana tabacum L.), and 7 miRNAs and 28 target genes in Nicotiana benthamiana. The identified Solanaceae miRNAs and their target genes were deposited in the SolmiRNA database, which is freely available for academic research only at http://genepool.kribb.re.kr/SolmiRNA. Our data indicate that the Solanaceae family has both conserved and specific miRNAs and that their target genes may play important roles in growth and development of Solanaceae plants.

  15. The Tomato Sequencing Project, the first cornerstone of the International Solanaceae Project (SOL)

    NARCIS (Netherlands)

    Mueller, L.A.; Tanksley, S.D.; Giovannoni, J.J.; Eck, van J.; Stack, S.; Choi, D.; Dong Kim, B.; Chen, M.; Cheng, Z.; Li, C.; Ling, H.; Xue, Y.; Seymour, G.B.; Bishop, G.; Bryan, G.J.; Sharma, R.; Khurana, J.; Tyagi, A.; Chattopadhyay, D.; Singh, N.K.; Stiekema, W.; Lindhout, P.; Jesse, T.; Klein Lankhorst, R.M.; Bouzayen, M.; Shibata, D.; Tabata, S.; Granell, A.; Botella, M.A.; Giuliano, G.; Frusciante, L.; Causse, M.; Zamir, D.

    2005-01-01

    The genome of tomato (Solanum lycopersicum) is being sequenced by an international consortium of 10 countries (Korea, China, the United Kingdom, India, The Netherlands, France, Japan, Spain, Italy and the United States) as part of a larger initiative called the International Solanaceae Genome

  16. A new tetraploid species of Solanum section Solanum (Solanaceae) from Tanzania

    NARCIS (Netherlands)

    Manoko, M.L.K.; Weerden, van der G.M.; Berg, van den R.G.; Mariani, C.

    2012-01-01

    Solanum umalilaense Manoko sp. nov. (Solanaceae) is described from the Umalila area, in the southern highlands of Tanzania. Its novelty is supported with both morphological and AFLP data. Phenetic and phylogenetic analyses place Solanum umalilaense as a unique and well-supported taxon among

  17. A New Species and Key to the Jaltomata (Solanaceae) of Mexico

    Science.gov (United States)

    A new Jaltomata (Solanaceae) species from Mexico is described, and a key to the five Jaltomata of Mexico is provided. Known only from the type locality, the new Jaltomata species is distinguished from the similar Jaltomata by having a purple flowering calyx to 6.8 mm in diameter, calyx lobes both re...

  18. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  19. A phylogenetic framework for evolutionary study of the nightshades (Solanaceae): a dated 1000-tip tree.

    Science.gov (United States)

    Särkinen, Tiina; Bohs, Lynn; Olmstead, Richard G; Knapp, Sandra

    2013-09-30

    The Solanaceae is a plant family of great economic importance. Despite a wealth of phylogenetic work on individual clades and a deep knowledge of particular cultivated species such as tomato and potato, a robust evolutionary framework with a dated molecular phylogeny for the family is still lacking. Here we investigate molecular divergence times for Solanaceae using a densely-sampled species-level phylogeny. We also review the fossil record of the family to derive robust calibration points, and estimate a chronogram using an uncorrelated relaxed molecular clock. Our densely-sampled phylogeny shows strong support for all previously identified clades of Solanaceae and strongly supported relationships between the major clades, particularly within Solanum. The Tomato clade is shown to be sister to section Petota, and the Regmandra clade is the first branching member of the Potato clade. The minimum age estimates for major splits within the family provided here correspond well with results from previous studies, indicating splits between tomato and potato around 8 Million years ago (Ma) with a 95% highest posterior density (HPD) 7-10 Ma, Solanum and Capsicum c. 19 Ma (95% HPD 17-21), and Solanum and Nicotiana c. 24 Ma (95% HPD 23-26). Our large time-calibrated phylogeny provides a significant step towards completing a fully sampled species-level phylogeny for Solanaceae, and provides age estimates for the whole family. The chronogram now includes 40% of known species and all but two monotypic genera, and is one of the best sampled angiosperm family phylogenies both in terms of taxon sampling and resolution published thus far. The increased resolution in the chronogram combined with the large increase in species sampling will provide much needed data for the examination of many biological questions using Solanaceae as a model system.

  20. Withania somnifera (L.) Dunal root extract alleviates formalin-induced nociception in mice: involvement of the opioidergic system.

    Science.gov (United States)

    Orrù, Alessandro; Casu, Maria Antonietta; Tambaro, Simone; Marchese, Giorgio; Casu, Gianluca; Ruiu, Stefania

    2016-02-01

    Withania somnifera (L.) Dunal extracts (WSEs) may possess therapeutic perspectives in the treatment of inflammation and pain. We aimed to evaluate the antinociceptive property of a WSE in the formalin test and to investigate the involvement of several neurotransmitter systems in this effect. The time spent licking the formalin-injected paw was recorded in CD1 mice after pretreatment with increasing doses of WSE. Also, c-Fos spinal cord expression and the effects of different compounds were investigated under these experimental conditions. Finally, the efficacy of WSE was analyzed following an injection of glutamate. WSE reduced the antinociceptive response during the tonic but not the acute phase of the formalin test and decreased formalin-induced c-Fos expression in spinal neurons. These effects were antagonized by the opioid antagonist naltrexone, whereas GABA, cannabinoid, δ-opioid, and nitric oxide compounds were ineffective. The administration of WSE also reduced nociception and c-Fos expression induced by glutamate injection. These results showed that WSE is effective in assays of chemical-induced nociception, indicating that this plant has potential valuable properties for the treatment of specific painful conditions. The antinocicetive effects of WSE in the formalin test appeared to be specifically mediated by the opioidergic system, although the involvement of the glutamatergic system cannot be excluded.

  1. Withania somnifera Dunal (Indian ginseng) impairs acquisition and expression of ethanol-elicited conditioned place preference and conditioned place aversion.

    Science.gov (United States)

    Spina, Liliana; Longoni, Rosanna; Rosas, Michela; Collu, Maria; Peana, Alessandra T; Espa, Elena; Kasture, Sanjay; Cotti, Elisabetta; Acquas, Elio

    2015-11-01

    Withania somnifera Dunal (Indian Ginseng) has recently been shown to impair ethanol self-administration. In order to gain further insights on the ability of the Withania somnifera standardised root extract (WSE) to affect the motivational properties of ethanol, this study investigated whether WSE may also affect ethanol (2 g/kg)-elicited conditioned place preference (CPP) and aversion (CPA). To this end male CD-1 mice were conditioned under two distinct schedules: in backward conditioning experiments ethanol was administered before mice were placed in the conditioning apparatus (CPP) while, in forward conditioning experiments, ethanol was administered immediately after removing mice from the apparatus (CPA). Following these schedules, mice developed significant CPP and CPA, respectively. Administration of WSE significantly impaired both the acquisition (50 and 100 mg/kg) and the expression (50 mg/kg) of CPP and CPA without affecting spatial memory (50 mg/kg), as determined by a two-trial memory recognition task. Overall, the study highlights the ability of WSE to interfere with both positive and negative motivational properties of ethanol and suggests that the effects of WSE may target both ethanol's motivational properties and underpinning associative learning mechanisms. In conclusion, these results cast new light on Withania somnifera as an agent potentially useful to counteract distinct aspects of ethanol effects. © The Author(s) 2015.

  2. In silico analysis of Simple Sequence Repeats from chloroplast genomes of Solanaceae species

    Directory of Open Access Journals (Sweden)

    Evandro Vagner Tambarussi

    2009-01-01

    Full Text Available The availability of chloroplast genome (cpDNA sequences of Atropa belladonna, Nicotiana sylvestris, N.tabacum, N. tomentosiformis, Solanum bulbocastanum, S. lycopersicum and S. tuberosum, which are Solanaceae species,allowed us to analyze the organization of cpSSRs in their genic and intergenic regions. In general, the number of cpSSRs incpDNA ranged from 161 in S. tuberosum to 226 in N. tabacum, and the number of intergenic cpSSRs was higher than geniccpSSRs. The mononucleotide repeats were the most frequent in studied species, but we also identified di-, tri-, tetra-, pentaandhexanucleotide repeats. Multiple alignments of all cpSSRs sequences from Solanaceae species made the identification ofnucleotide variability possible and the phylogeny was estimated by maximum parsimony. Our study showed that the plastomedatabase can be exploited for phylogenetic analysis and biotechnological approaches.

  3. In silico prediction of proteins related to xyloglucan fucosyltransferases in Solanaceae genomes.

    Science.gov (United States)

    Lehner, Arnaud; Menu-Bouaouiche, Laurence; Dardelle, Flavien; Le Mauff, François; Driouich, Azeddine; Lerouge, Patrice; Mollet, Jean-Claude

    2015-01-01

    Two independent studies have shown that the cell wall of pollen tubes from tobacco and tomato species contained fucosylated xyloglucan (XyG). These findings are intriguing as many reports have shown that XyG of somatic cells of these species is not fucosylated but instead is arabinosylated. In order to produce fucosylated XyG, plants must express a functional galactoside α-2-fucosyltransferase. Here, using a bioinformatics approach, we show that several candidate genes coding for XyG fucosyltransferases are present in the genome of coffee and several Solanaceae species including tomato, tobacco, potato, eggplant and pepper. BLAST and protein alignments with the 2 well-characterized XyG fucosyltransferases from Arabidopsis thaliana and Pisum sativum revealed that at least 6 proteins from different Solanaceae species and from coffee displayed the 3 conserved motifs required for XyG fucosyltransferase activity.

  4. Algunos aspectos técnicos sobre la liofilización de pulpa de cocona (Solanum sessiliflorum Dunal

    Directory of Open Access Journals (Sweden)

    Leynard Natividad Marín

    2013-12-01

    Full Text Available La cocona (Solanum sessiliflorum Dunal es una fruta ampliamente distribuida en la Amazonia Sudamericana, con buenas características nutricionales y antioxidantes. El objetivo de este trabajo fue deshidratar la pulpa de cocona mediante liofilización para evaluar algunos aspectos técnicos de un nuevo tipo de producto que permita su mejor comercialización y mayores usos en la industria alimentaria. Los frutos fueron adquiridos en el Mercado Central de Frutas de Lima (Perú y procesados en el Centro Experimental Tecnológico de la Universidad Nacional del Callao (Callao, Perú. Fue realizado un acondicionamiento y liofilización de la materia prima; en el primero la muestra fue cortada, escaldada, pelada, despulpada, refinada y concentrada al vacío a temperatura de baño de 60 ºC durante 15 minutos y presión de -800 mbar; mientras que en la segunda, se congelaron previamente las muestras durante 12 horas a -20 ºC para su sublimación durante 24 horas a una presión inferior a 200 μHg. Asimismo, se determinaron los rendimientos y contenidos de humedad en el proceso. Se realizaron caracterizaciones en la pulpa refinada, muestra liofilizada y en la pulpa liofilizada reconstituida: contenido de humedad, proteína, extracto etéreo, cenizas, carbohidratos incluido el contenido de fibra, densidad, viscosidad, sólidos solubles, azúcares reductores, acidez titulable, pH y solubilidad, según fue el caso. Se obtuvo un polvo higroscópico, con solubilidad en agua de 84,33 % y con ligeras variaciones en sus características con respecto al producto inicial.

  5. Antidiabetic and antihyperlipidemic activity of hydroalcoholic extract of Withania coagulans Dunal dried fruit in experimental rat models

    Directory of Open Access Journals (Sweden)

    Ankur Datta

    2013-01-01

    Full Text Available Objective: Evaluation of antidiabetic potential of the hydroalcoholic extract of Withania coagulans Dunal dried fruit (WCDF alone and in combination with glipizide, in streptozotocin-induced diabetes, and evaluation of possible antihyperlipidemic activity of the same extract in high-cholesterol diet-induced hyperlipidemia, in albino rats. Materials and Methods: Experimental diabetes was induced in 30 albino rats with intraperitoneal injection of streptozotocin (55 mg/kg. The rats were divided into five groups receiving the following treatments orally for 4 weeks: Vehicle, glipizide (2.5 mg/kg, WCDF extract (1000 mg/kg, WCDF extract (1000 mg/kg plus glipizide (1 mg/kg and WCDF extract (1000 mg/kg plus0 glipizide (2.5 mg/kg. Fasting and postprandial blood glucose levels were measured every week for 4 weeks. Endocrine pancreas histopathology was done at the end. In a separate set of experiment, five groups of six albino rats each, received orally for 4 weeks, vehicle, cholesterol (25 mg/kg/day, cholesterol (25 mg/kg/day plus atorvastatin (7.2 mg/kg/day, cholesterol (25 mg/kg/day plus WCDF extract (1000 mg/kg/day and no treatment, respectively. Estimation of serum lipid profile and liver histopathology was done at the end of 4 weeks. Statistical Analysis: Between-group and within-group comparisons were respectively done by analysis of variance (ANOVA and repeated measures ANOVA, followed by post hoc Tukey′s test, with a significance level of P < 0.05. Results and Conclusions: The 4-week treatment with WCDF extract significantly reversed hyperglycemia in streptozotocin-induced diabetes that was comparable to glipizide. When combined with glipizide (2.5 mg/kg, WCDF extract produced a synergistic antihyperglycemic effect as well as improvement in pancreatic histopathology. Moreover, hydroalcoholic extract of WCDF was effective and comparable to atorvastatin in controlling the high-cholesterol diet-induced hyperlipidemia in rats.

  6. The Cucurbitaceae and Solanaceae illustrated in medieval manuscripts known as the Tacuinum Sanitatis

    Science.gov (United States)

    Paris, Harry S.; Daunay, Marie-Christine; Janick, Jules

    2009-01-01

    Background and Aims Beginning in the last two decades of the 14th century, richly illuminated versions of the Tacuinum Sanitatis, the Latin translation of an 11th-century Arabic manuscript known as Taqwim al-Sihha bi al-Ashab al-Sitta, were produced in northern Italy. These illustrated manuscripts provide a window on late medieval life in that region by containing some 200 full-page illustrations, many of which vividly depict the harvest of vegetables, fruits, flowers, grains, aromatics and medicinal plants. Our objective was to search for and identify the images of taxa of Cucurbitaceae and Solanaceae. Methods We have located all reported illustrated Tacuinum Sanitatis and similar or related manuscripts, searched through printed or electronic reproductions of them, categorized six of them that display full-page illustrations as archetypic, and established the identity of the Cucurbitaceae and Solanaceae appearing in these six manuscripts. Key Results and Conclusions Of the Cucurbitaceae, Cucumis sativus (short-fruited cucumbers), Cucumis melo (including round as well as elongate melons), Citrullus lanatus (both sweet watermelons and citrons), and Lagenaria siceraria (including bottle-shaped as well as long gourds), are illustrated. Of the Solanaceae, Solanum melongena (egg-shaped purple aubergines) and Mandragora sp. (mandrake) are illustrated. These depictions include some of the earliest known images of cucumber, casaba melon (Cucumis melo Inodorous Group) and aubergine, each of which closely resembles an extant cultivar-group or market type. Overall, the botanically most accurate images are in the version of the Tacuinum located in the Österreichische Nationalbibliothek, Vienna, cod. ser. n. 2644. Similarities and differences in botanical accuracy among the images of Cucurbitaceae and Solanaceae in the six archetypal Tacuinum manuscripts suggest to us that another illustrated Tacuinum, now lost, may have antedated and served as a model or inspiration for the

  7. SOME ASPECTS ON PHARMACOGNOSY OF TEN SPECIES OF THE FAMILY SOLANACEAE UTILIZ

    Directory of Open Access Journals (Sweden)

    MAITI R. K.

    2002-12-01

    Full Text Available In the present work ten species of the family Solanaceae were studied applyingtechniques of pharmacognosy and histochemistry for the differentiation and identificationof each of the species. The anatomical characteristics used in the differentiationof the species are the types of trichomes, stomatas, crystals, glands, andposition of pallisade parenchyma. In the histochemical tests the species presentdifferent grades of reaction in the contents of proteins, tannin, and alkaloids.

  8. ANÁLISIS CARIOTÍPICO DE CAPSICUM PUBESCENS (SOLANACEAE "ROCOTO"

    Directory of Open Access Journals (Sweden)

    Misael Guevara

    2014-06-01

    Full Text Available Análisis cariotípico de Capsicum pubescens R&P (Solanaceae. Los cromosomas han sido descritos, comparados y dibujados, usando una técnica de coloración modificada, C. pubescens tiene un número cromosómico diploide 2n = 24, de los cuales 11 pares son metacéntricos y 1 par submetacéntrico.

  9. Nicotine from edible Solanaceae and risk of Parkinson disease (ANA-12-1625)

    Science.gov (United States)

    Searles Nielsen, Susan; Franklin, Gary M.; Longstreth, W.T.; Swanson, Phillip D.; Checkoway, Harvey

    2015-01-01

    Objective To test whether risk of Parkinson disease (PD) is associated with consumption of nicotine-containing edibles from the same botanical family as tobacco, Solanaceae, including peppers, tomatoes and potatoes. Methods In a population-based study with 490 newly diagnosed idiopathic PD cases diagnosed during 1992–2008 at the University of Washington Neurology Clinic or Group Health Cooperative in western Washington State and 644 unrelated, neurologically normal controls, we examined whether PD was associated with self-reported typical frequency of consumption of peppers, tomatoes, tomato juice and potatoes during adulthood, while adjusting for consumption of other vegetables, age, sex, race/ethnicity, tobacco use and caffeine. Results PD was inversely associated with consumption of all edible Solanaceae combined (relative risk [RR]=0.81, 95% confidence interval [CI] 0.65–1.01 per time per day), but not consumption of all other vegetables combined (RR=1.00, 95% CI 0.92–1.10). The trend strengthened when we weighted edible Solanaceae by nicotine concentration (ptrend=0.004). An inverse association was also evident for peppers specifically (ptrend=0.005). The potentially protective effect of edible Solanaceae largely occurred in men and women who had never used tobacco or who had smoked cigarettes <10 years. Interpretation Dietary nicotine or other constituents of tobacco and peppers may reduce PD risk. However, confirmation and extension of these findings is needed to strengthen causal inferences that could suggest possible dietary or pharmaceutical interventions for PD prevention. PMID:23661325

  10. The Cucurbitaceae and Solanaceae illustrated in medieval manuscripts known as the Tacuinum Sanitatis.

    Science.gov (United States)

    Paris, Harry S; Daunay, Marie-Christine; Janick, Jules

    2009-06-01

    Beginning in the last two decades of the 14th century, richly illuminated versions of the Tacuinum Sanitatis, the Latin translation of an 11th-century Arabic manuscript known as Taqwim al-Sihha bi al-Ashab al-Sitta, were produced in northern Italy. These illustrated manuscripts provide a window on late medieval life in that region by containing some 200 full-page illustrations, many of which vividly depict the harvest of vegetables, fruits, flowers, grains, aromatics and medicinal plants. Our objective was to search for and identify the images of taxa of Cucurbitaceae and Solanaceae. We have located all reported illustrated Tacuinum Sanitatis and similar or related manuscripts, searched through printed or electronic reproductions of them, categorized six of them that display full-page illustrations as archetypic, and established the identity of the Cucurbitaceae and Solanaceae appearing in these six manuscripts. Of the Cucurbitaceae, Cucumis sativus (short-fruited cucumbers), Cucumis melo (including round as well as elongate melons), Citrullus lanatus (both sweet watermelons and citrons), and Lagenaria siceraria (including bottle-shaped as well as long gourds), are illustrated. Of the Solanaceae, Solanum melongena (egg-shaped purple aubergines) and Mandragora sp. (mandrake) are illustrated. These depictions include some of the earliest known images of cucumber, casaba melon (Cucumis melo Inodorous Group) and aubergine, each of which closely resembles an extant cultivar-group or market type. Overall, the botanically most accurate images are in the version of the Tacuinum located in the Osterreichische Nationalbibliothek, Vienna, cod. ser. n. 2644. Similarities and differences in botanical accuracy among the images of Cucurbitaceae and Solanaceae in the six archetypal Tacuinum manuscripts suggest to us that another illustrated Tacuinum, now lost, may have antedated and served as a model or inspiration for the six surviving archetypic manuscripts.

  11. Immunomodulatory and erythropoietic effects of aqueous extract of the fruits of Solanum torvum Swartz (Solanaceae)

    OpenAIRE

    Koffuor, George A.; Amoateng, Patrick; Andey, Terrick A.

    2011-01-01

    Aim: The effect of Solanum torvum (Fam: Solanaceae) on delayed type hypersensitivity (DTH) response, hemagglutinating antibody (HA) titer, white blood cells (WBC), red blood cells (RBC) and hemoglobin concentration was investigated in Sprague-Dawley rats to establish immunomodulatory and erythropoietic activity. Materials and Methods: Sheep red blood cells (SRBC)-immunized and challenged rats were treated with Solanum torvum extract, levamisole and dexamethasone. Phenylhydrazine (PHZ)-induced...

  12. Lectotypification of Ruiz and Pavón's names in Solanum (Solanaceae)

    OpenAIRE

    Knapp, Sandra

    2008-01-01

    Lectotypes or neotypes are confirmed or designated here for the 41 names coined by Hipólito Ruiz and José Pavón in the Flora peruviana et chilensis that were either described, or today recognised as, members of the large genus Solanum (Solanaceae): Solanum acuminatum, S. acutifolium, S. anceps, S. angulatum, S. angustifolium, S. asperolanatum, S. biformifolium, S. calygnaphalum, S. conicum, S. crispum, S. cymosum, S. dichotomum, S. diffusum, S. filiforme, S. foetidum, S. glandulosum, S. grand...

  13. Discrimination of Solanaceae taxa and quantification of scopolamine and hyoscyamine by ATR-FTIR spectroscopy.

    Science.gov (United States)

    Naumann, Annette; Kurtze, Lukas; Krähmer, Andrea; Hagels, Hansjoerg; Schulz, Hartwig

    2014-10-01

    Plant species of the Solanaceae family (nightshades) contain pharmacologically active anticholinergic tropane alkaloids, e.g., scopolamine and hyoscyamine. Tropane alkaloids are of special interest, either as active principles or as starting materials for semisynthetic production of other substances. For genetic evaluation, domestication, cultivation, harvest and post-harvest treatments, quantification of the individual active principles is necessary to monitor industrial processes and the resulting finished products. Up to now, frequently applied methods for quantification are based on high performance liquid chromatography and gas chromatography optionally combined with mass spectrometry. However, alternative analytical methods have the potential to replace the established standard methods partly. In this context, attenuated total reflection-Fourier transform infrared spectroscopy enabled chemotaxonomical classification of the Solanaceae Atropa belladonna, Datura stramonium, Hyoscyamus niger, Solanum dulcamara, and Duboisia in combination with cluster analysis. Also discrimination of genotypes within species was achieved to some extent. The most characteristic scopolamine bands could be identified in attenuated total reflection-Fourier transform infrared spectra of Solanaceae leaves, which allow a fast characterisation of plants with high scopolamine content. Applying a partial least square algorithm, very good calibration statistics were obtained for the prediction of the scopolamine content (residual prediction deviation = 7.67), and moderate prediction quality could be achieved for the hyoscyamine content (residual prediction deviation = 2.48). Georg Thieme Verlag KG Stuttgart · New York.

  14. Molecular phylogenetic analysis of Indonesia Solanaceae based on DNA sequences of internal transcribed spacer region

    Science.gov (United States)

    Hidayat, Topik; Priyandoko, Didik; Islami, Dina Karina; Wardiny, Putri Yunitha

    2016-02-01

    Solanaceae is one of largest family in Angiosperm group with highly diverse in morphological character. In Indonesia, this group of plant is very popular due to its usefulness as food, ornamental and medicinal plants. However, investigation on phylogenetic relationship among the member of this family in Indonesia remains less attention. The purpose of this study was to evaluate the phylogenetics relationship of the family especially distributed in Indonesia. DNA sequences of Internal Transcribed Spacer (ITS) region of 19 species of Solanaceae and three species of outgroup, which belongs to family Convolvulaceae, Apocynaceae, and Plantaginaceae, were isolated, amplified, and sequenced. Phylogenetic tree analysis based on parsimony method was conducted with using data derived from the ITS-1, 5.8S, and ITS-2, separately, and the combination of all. Results indicated that the phylogenetic tree derived from the combined data established better pattern of relationship than separate data. Thus, three major groups were revealed. Group 1 consists of tribe Datureae, Cestreae, and Petunieae, whereas group 2 is member of tribe Physaleae. Group 3 belongs to tribe Solaneae. The use of the ITS region as a molecular markers, in general, support the global Solanaceae relationship that has been previously reported.

  15. The Tomato Sequencing Project, the first cornerstone of the International Solanaceae Project (SOL).

    Science.gov (United States)

    Mueller, Lukas A; Tanksley, Steven D; Giovannoni, Jim J; van Eck, Joyce; Stack, Stephen; Choi, Doil; Kim, Byung Dong; Chen, Mingsheng; Cheng, Zhukuan; Li, Chuanyou; Ling, Hongqing; Xue, Yongbiao; Seymour, Graham; Bishop, Gerard; Bryan, Glenn; Sharma, Rameshwar; Khurana, Jiten; Tyagi, Akhilesh; Chattopadhyay, Debasis; Singh, Nagendra K; Stiekema, Willem; Lindhout, P; Jesse, Taco; Lankhorst, Rene Klein; Bouzayen, Mondher; Shibata, Daisuke; Tabata, Satoshi; Granell, Antonio; Botella, Miguel A; Giuliano, Giovanni; Frusciante, Luigi; Causse, Mathilde; Zamir, Dani

    2005-01-01

    The genome of tomato (Solanum lycopersicum) is being sequenced by an international consortium of 10 countries (Korea, China, the United Kingdom, India, The Netherlands, France, Japan, Spain, Italy and the United States) as part of a larger initiative called the 'International Solanaceae Genome Project (SOL): Systems Approach to Diversity and Adaptation'. The goal of this grassroots initiative, launched in November 2003, is to establish a network of information, resources and scientists to ultimately tackle two of the most significant questions in plant biology and agriculture: (1) How can a common set of genes/proteins give rise to a wide range of morphologically and ecologically distinct organisms that occupy our planet? (2) How can a deeper understanding of the genetic basis of plant diversity be harnessed to better meet the needs of society in an environmentally friendly and sustainable manner? The Solanaceae and closely related species such as coffee, which are included in the scope of the SOL project, are ideally suited to address both of these questions. The first step of the SOL project is to use an ordered BAC approach to generate a high quality sequence for the euchromatic portions of the tomato as a reference for the Solanaceae. Due to the high level of macro and micro-synteny in the Solanaceae the BAC-by-BAC tomato sequence will form the framework for shotgun sequencing of other species. The starting point for sequencing the genome is BACs anchored to the genetic map by overgo hybridization and AFLP technology. The overgos are derived from approximately 1500 markers from the tomato high density F2-2000 genetic map (http://sgn.cornell.edu/). These seed BACs will be used as anchors from which to radiate the tiling path using BAC end sequence data. Annotation will be performed according to SOL project guidelines. All the information generated under the SOL umbrella will be made available in a comprehensive website. The information will be interlinked with

  16. Tobacco drought stress responses reveal new targets for Solanaceae crop improvement.

    Science.gov (United States)

    Rabara, Roel C; Tripathi, Prateek; Reese, R Neil; Rushton, Deena L; Alexander, Danny; Timko, Michael P; Shen, Qingxi J; Rushton, Paul J

    2015-06-30

    The Solanaceae are an economically important family of plants that include tobacco (Nicotiana tabacum L.), tomato, and potato. Drought is a major cause of crop losses. We have identified major changes in physiology, metabolites, mRNA levels, and promoter activities during the tobacco response to drought. We have classified these as potential components of core responses that may be common to many plant species or responses that may be family/species-specific features of the drought stress response in tobacco or the Solanaceae. In tobacco the largest increase in any metabolite was a striking 70-fold increase in 4-hydroxy-2-oxoglutaric acid (KHG) in roots that appears to be tobacco/Solanaceae specific. KHG is poorly characterized in plants but is broken down to pyruvate and glyoxylate after the E. coli SOS response to facilitate the resumption of respiration. A similar process in tobacco would represent a mechanism to restart respiration upon water availability after drought. At the mRNA level, transcription factor gene induction by drought also showed both core and species/family specific responses. Many Group IX Subgroup 3 AP2/ERF transcription factors in tobacco appear to play roles in nicotine biosynthesis as a response to herbivory, whereas their counterparts in legume species appear to play roles in drought responses. We observed apparent Solanaceae-specific drought induction of several Group IId WRKY genes. One of these, NtWRKY69, showed ABA-independent drought stress-inducible promoter activity that moved into the leaf through the vascular tissue and then eventually into the surrounding leaf cells. We propose components of a core metabolic response to drought stress in plants and also show that some major responses to drought stress at the metabolome and transcriptome levels are family specific. We therefore propose that the observed family-specific changes in metabolism are regulated, at least in part, by family-specific changes in transcription factor

  17. Intoxicação por Cestrum laevigatum (Solanaceae em bubalinos Poisoning by Cestrum laevigatum (Solanaceae in buffaloes

    Directory of Open Access Journals (Sweden)

    José Diomedes Barbosa

    2010-12-01

    ões necrosadas observou-se um halo de hepatócitos com vacuolização.Based on the history and clinical and pathological data, as well as on inspection of the pastures, a mortality of buffaloes in the county of Itaguaí/RJ, Brazil, was diagnosed as poisoning by Cestrum laevigatum Schlecht., a plant of the Solanaceae family. The poisoning was reproduced in two buffaloes. Dried leaves of the shrub were administered by hand, in single doses corresponding to 20g/kg and 40g/kg of the fresh leaves, to four buffaloes of the Murrah breed. The dose corresponding to 40g/kg of the fresh leaves caused signs of poisoning, as apathy, anorexia, absence of rumen movements, dysmetria, excitement and aggressiveness, followed by death of the two buffaloes within 65 hours after administration. From the two buffaloes that received the corresponding dose of 20g/kg of the fresh plant, one presented clinical signs characterized mainly by decrease of the rumen movements, but recovered 97h22min after the administration; the other buffalo did not show symptoms of poisoning. Laboratory analyses for biochemical evaluation accused hepatic alterations. In one buffalo that died, the main macroscopic finding was an orange liver with a clear nutmeg appearance; in the second buffalo, the orange liver had no nutmeg appearance. Other alterations found in these two buffaloes were slight edema of the gall bladder wall, a slightly reddish mucous membrane of the abomasum, extensive echymoses in the endocard of the left ventricle and few petechiae in the endocard of the right ventricle; the abomasum content was slightly dry, and the large intestine had little and slightly dry contents wrapped by mucus. Histopatological examination revealed severe coagulative necrosis of the liver parenchyma in the centrolobular and intermediate lobular areas, with a halo of vacuolated hepatocytes at the periphery of the necrotic areas.

  18. NADPH-cytochrome P450 reductase: molecular cloning and functional characterization of two paralogs from Withania somnifera (L. dunal.

    Directory of Open Access Journals (Sweden)

    Satiander Rana

    Full Text Available Withania somnifera (L. Dunal, a highly reputed medicinal plant, synthesizes a large array of steroidal lactone triterpenoids called withanolides. Although its chemical profile and pharmacological activities have been studied extensively during the last two decades, limited attempts have been made to decipher the biosynthetic route and identification of key regulatory genes involved in withanolide biosynthesis. Cytochrome P450 reductase is the most imperative redox partner of multiple P450s involved in primary and secondary metabolite biosynthesis. We describe here the cloning and characterization of two paralogs of cytochrome P450 reductase from W. somnifera. The full length paralogs of WsCPR1 and WsCPR2 have open reading frames of 2058 and 2142 bp encoding 685 and 713 amino acid residues, respectively. Phylogenetic analysis demonstrated that grouping of dual CPRs was in accordance with class I and class II of eudicotyledon CPRs. The corresponding coding sequences were expressed in Escherichia coli as glutathione-S-transferase fusion proteins, purified and characterized. Recombinant proteins of both the paralogs were purified with their intact membrane anchor regions and it is hitherto unreported for other CPRs which have been purified from microsomal fraction. Southern blot analysis suggested that two divergent isoforms of CPR exist independently in Withania genome. Quantitative real-time PCR analysis indicated that both genes were widely expressed in leaves, stalks, roots, flowers and berries with higher expression level of WsCPR2 in comparison to WsCPR1. Similar to CPRs of other plant species, WsCPR1 was un-inducible while WsCPR2 transcript level increased in a time-dependent manner after elicitor treatments. High performance liquid chromatography of withanolides extracted from elicitor-treated samples showed a significant increase in two of the key withanolides, withanolide A and withaferin A, possibly indicating the role of WsCPR2 in

  19. Solanaceae XIPs are plasma membrane aquaporins that facilitate the transport of many uncharged substrates.

    Science.gov (United States)

    Bienert, Gerd Patrick; Bienert, Manuela Désirée; Jahn, Thomas Paul; Boutry, Marc; Chaumont, François

    2011-04-01

    Major intrinsic proteins (MIPs) transport water and uncharged solutes across membranes in all kingdoms of life. Recently, an uncharacterized MIP subfamily was identified in the genomes of plants and fungi and named X Intrinsic Proteins (XIPs). Here, we describe the genetic features, localization, expression, and functions of a group of Solanaceae XIPs. XIP cDNA and gDNA were cloned from tobacco, potato, tomato, and morning glory. A conserved sequence motif in the first intron of Solanaceae XIPs initiates an RNA-processing mechanism that results in two splice variants (α and β). When transiently or stably expressed in tobacco plants, yellow fluorescent protein-tagged NtXIP1;1α and NtXIP1;1β were both localized in the plasma membrane. Transgenic tobacco lines expressing NtXIP1;1-promoter-GUS constructs and RT-PCR studies showed that NtXIP1;1 was expressed in all organs. The NtXIP1;1 promoter was mainly active in cell layers facing the environment in all above-ground tissues. Heterologous expression of Solanaceae XIPs in Xenopus laevis oocytes and various Saccharomyces cerevisiae mutants demonstrated that these isoforms facilitate the transport of bulky solutes, such as glycerol, urea, and boric acid. In contrast, permeability for water was undetectable. These data suggest that XIPs function in the transport of uncharged solutes across the cell plasma membrane in specific plant tissues, including at the interface between the environment and external cell layers. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  20. Genome-wide analysis of SAUR gene family in Solanaceae species.

    Science.gov (United States)

    Wu, Jian; Liu, Songyu; He, Yanjun; Guan, Xiaoyan; Zhu, Xiangfei; Cheng, Lin; Wang, Jie; Lu, Gang

    2012-11-01

    The plant hormone auxin plays a vital role in regulating many aspects of plant growth and development. Small auxin up-regulated RNAs (SAURs) are primary auxin response genes hypothesized to be involved in auxin signaling pathway, but their functions remain unclear. Here, a genome-wide search for SAUR gene homologues in Solanaceae species identified 99 and 134 members of SAUR gene family from tomato and potato, respectively. Phylogenetic analysis indicated that the SAUR proteins from Arabidopsis, rice, sorghum, tomato and potato were divided into four major groups with 16 subgroups. Among them, 25 histidine-rich SAURs genes with metal-binding characteristics were found in Arabidopsis, sorghum and Solanaceae species, but not in rice. Using tomato as a model, a comprehensive overview of SAUR gene family is presented, including the gene structures, phylogeny and chromosome locations. Quantitative real-time PCR analysis indicated that 11 randomly selected SlSAUR genes in tomato could be expressed at least in one of the tomato organs/tissues tested. However, different SlSAUR genes displayed distinctive expression levels. SlSAUR16 and SlSAUR71 exhibited highly tissue-specific expression patterns. Almost all of the detected SlSAURs showed an accumulating pattern of mRNA along tomato flower and fruit development. Some of them displayed differential response to exogenous IAA treatment. The abiotic (cold, salt and drought) stresses significantly modified transcript levels of SlSAURs genes. Most of them were down-regulated in response to abiotic stresses (drought, heat and salinity), but SlSAUR58, as a histidine-rich SAUR gene, was up-regulated after salt treatment, indicating that it may play a specific role in the salt signaling transduction pathway. Our comparative analysis provides some basic genomic information for the SAUR genes in the Solanaceae species and will pave the way for deciphering their function during plant development. Copyright © 2012 Elsevier B.V. All

  1. Neuro-protective potential of a vesicular system of a standardized extract of a new chemotype of Withania somnifera Dunal (NMITLI118RT+) against cerebral stroke in rats.

    Science.gov (United States)

    Ahmad, Hafsa; Khandelwal, Kiran; Samuel, Sheeba Saji; Tripathi, Shivangi; Mitra, Kalyan; Sangwan, Rajender Singh; Shukla, Rakesh; Dwivedi, Anil Kumar

    2016-09-01

    Withania somnifera Dunal is an Indian medicinal plant with significant pharmacological properties, such as adaptogenic, anti-inflammatory, anti-oxidant, anti-platelet, anti-hypertensive, hypoglycemic and hypolipidemic effects. Several chemotypes of W. somnifera include NMITLI-101, NMITLI-118 and NMITLI-128. The present work elaborates the optimization and development of a liposomal delivery system for efficient delivery of NMITLI118RT+ [a standardized ethanolic extract of a new chemotype of W. somnifera Dunal (NMITLI-118) roots] against cerebral stroke in rats. Liposomal systems were prepared using thin-film hydration method and characterized on the basis of size, zeta potential, physical stability, FT-IR, DSC-TGA analysis and surface morphological studies by TEM. NMITLI118RT+ and its formulations (NMITLI118RT+LF) were evaluated for biological activity utilizing middle cerebral artery occlusion model in rats. The Z average of the developed liposomal formulation was about 142.6 ± 0.09 nm with a zeta potential of -31.20 ± 1.0 mV. Results of TEM revealed spherical particles in the range of 200 nm. The entrapment efficiency was found to be 94.603 ± 2%. The formulation was found to be physically stable over a 3-week period. Results were suggestive of the fact that both NMITLI118RT+ and its delivery system possess significant neuroprotective activity in cerebral ischemia. The liposomal system largely exhibits better performance over NMITLI118RT+ precisely in the post-treatment group. The present studies could elucidate the successful development of a delivery system for NMITLI118RT+ and demonstrate their beneficial neuro-protective potential in overcoming and reversing the consequences of I/R injury following stroke.

  2. Yellow tailflower mild mottle virus: a new tobamovirus described from Anthocercis littorea (Solanaceae) in Western Australia.

    Science.gov (United States)

    Wylie, Stephen J; Li, Hua; Jones, Michael G K

    2014-04-01

    The complete genome sequence of a tobamovirus was determined from a wild plant of yellow tailflower (Anthocercis littorea, family Solanaceae) that exhibited mild mottling and chlorosis on the leaves. The virus induced severe symptoms including systemic necrosis when inoculated to plants of three other solanaceous species. The viral genome was resequenced after passage in Nicotiana benthamiana. The two genomes were 6379 nucleotides in length, and they differed by three nucleotides. Phylogenetic analysis and the deduced architecture of the genome place the virus, provisionally named yellow tailflower mild mottle virus, with other tobamoviruses that infect solanaceous hosts.

  3. A new tetraploid species of Solanum L. sect. Solanum (Solanaceae) from Tanzania.

    Science.gov (United States)

    Manoko, Mkabwa L K; van Weerden, Gerard M; van Berg, Ronald G; Mariani, Celestina

    2012-01-01

    Solanum umalilaense Manoko sp. nov. (Solanaceae) is described from the Umalila area, in the southern highlands of Tanzania. Its novelty is supported with both morphological and AFLP data. Phenetic and phylogenetic analyses place Solanum umalilaense as a unique and well-supported taxon among tetraploid species of Solanum sect. Solanum from Africa. It can be distinguished from other African species by its extremely developed branching, each branch producing many multi-flowered inflorescences, flowers with short calyx lobes and its persistent, small, light yellowish brown fruits.

  4. Deprea auccana y Deprea physalidicalyx (Solanaceae), dos nuevas especies del Noreste de Perú

    OpenAIRE

    Leiva Gonzalez, Segundo; Barboza, Gloria Estela; Deanna, Rocío

    2017-01-01

    Se describe e ilustra en detalle Deprea auccana S. Leiva, Barboza & Deanna y D. physalidicalyx S. Leiva, Barboza & Deanna (Solanaceae), dos nuevas especies del noreste de Perú. Deprea auccana es propia de la Reserva Privada Abra Patricia (ECOAN; ruta Pomacochas-Nueva Cajamarca, Distrito Yambrasbamba, Prov. Bongará, Dpto. Amazonas, Perú). Se caracteriza principalmente por la forma y tamaño de sus hojas, el número de flores por nudo, la longitud de los lóbulos calicinos, estambres homodínamos y...

  5. Caavuranamide, a novel steroidal alkaloid from the ripe fruits of Solanum caavurana Vell. (Solanaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Vaz, Nelissa Pacheco; Santos, Erica L.; Marques, Francisco A.; Maia, Beatriz H.L.N. Sales, E-mail: noronha@ufpr.br [Departamento de Quimica, Universidade Federal do Parana, Centro Politecnico, Curitiba, PR (Brazil); Costa, Emmanoel V. [Departamento de Quimica, Universidade Federal de Sergipe, Sao Cristovao, SE (Brazil); Mikich, Sandra Bos [Laboratorio de Ecologia, Embrapa Florestas, Colombo, PR (Brazil); Braga, Raquel M. [Instituto de Quimica, Universidade Estadual de Campinas, SP (Brazil); Delarmelina, Camila; Duarte, Marta C.T. [Divisao de Microbiologia, Centro Pluridisciplinar de Pesquisas Quimicas Biologicas e Agricolas (CPQBA), Universidade Estadual de Campinas, SP (Brazil); Duarte, Marta C.T.; Ruiz, Ana Lucia T.G.; Souza, Vanessa H.S.; Carvalho, Joao E. de [Divisa de Farmacologia e Toxicologia, Centro Pluridisciplinar de Pesquisas Quimicas Biologicas e Agricolas (CPQBA), Universidade Estadual de Campinas, SP (Brazil)

    2012-07-01

    Phytochemical investigation of the ripe fruits of Solanum caavurana Vell. (Solanaceae) afforded a novel steroidal alkaloid with spirosolane-type skeleton, named as caavuranamide, together with the alkaloids 4-tomatiden-3-one and 5{alpha}-tomatidan-3-one. Their structures were elucidated on the basis of spectroscopic methods. The antiproliferative and antimicrobial activities for the ethanolic extract, sub-fractions obtained from partition and acid-base treatment were also evaluated. Caavuranamide showed antibacterial activity similar to the chloramphenicol positive control against Rhodococcus equi. (author)

  6. Cyclotides associate with leaf vasculature and are the products of a novel precursor in petunia (Solanaceae).

    Science.gov (United States)

    Poth, Aaron G; Mylne, Joshua S; Grassl, Julia; Lyons, Russell E; Millar, A Harvey; Colgrave, Michelle L; Craik, David J

    2012-08-03

    Cyclotides are a large family of plant peptides that are structurally defined by their cyclic backbone and a trifecta of disulfide bonds, collectively known as the cyclic cystine knot (CCK) motif. Structurally similar cyclotides have been isolated from plants within the Rubiaceae, Violaceae, and Fabaceae families and share the CCK motif with trypsin-inhibitory knottins from a plant in the Cucurbitaceae family. Cyclotides have previously been reported to be encoded by dedicated genes or as a domain within a knottin-encoding PA1-albumin-like gene. Here we report the discovery of cyclotides and related non-cyclic peptides we called "acyclotides" from petunia of the agronomically important Solanaceae plant family. Transcripts for petunia cyclotides and acyclotides encode the shortest known cyclotide precursors. Despite having a different precursor structure, their sequences suggest that petunia cyclotides mature via the same biosynthetic route as other cyclotides. We assessed the spatial distribution of cyclotides within a petunia leaf section by MALDI imaging and observed that the major cyclotide component Phyb A was non-uniformly distributed. Dissected leaf midvein extracts contained significantly higher concentrations of this cyclotide compared with the lamina and outer margins of leaves. This is the third distinct type of cyclotide precursor, and Solanaceae is the fourth phylogenetically disparate plant family to produce these structurally conserved cyclopeptides, suggesting either convergent evolution upon the CCK structure or movement of cyclotide-encoding sequences within the plant kingdom.

  7. Cyclotides Associate with Leaf Vasculature and Are the Products of a Novel Precursor in Petunia (Solanaceae)*

    Science.gov (United States)

    Poth, Aaron G.; Mylne, Joshua S.; Grassl, Julia; Lyons, Russell E.; Millar, A. Harvey; Colgrave, Michelle L.; Craik, David J.

    2012-01-01

    Cyclotides are a large family of plant peptides that are structurally defined by their cyclic backbone and a trifecta of disulfide bonds, collectively known as the cyclic cystine knot (CCK) motif. Structurally similar cyclotides have been isolated from plants within the Rubiaceae, Violaceae, and Fabaceae families and share the CCK motif with trypsin-inhibitory knottins from a plant in the Cucurbitaceae family. Cyclotides have previously been reported to be encoded by dedicated genes or as a domain within a knottin-encoding PA1-albumin-like gene. Here we report the discovery of cyclotides and related non-cyclic peptides we called “acyclotides” from petunia of the agronomically important Solanaceae plant family. Transcripts for petunia cyclotides and acyclotides encode the shortest known cyclotide precursors. Despite having a different precursor structure, their sequences suggest that petunia cyclotides mature via the same biosynthetic route as other cyclotides. We assessed the spatial distribution of cyclotides within a petunia leaf section by MALDI imaging and observed that the major cyclotide component Phyb A was non-uniformly distributed. Dissected leaf midvein extracts contained significantly higher concentrations of this cyclotide compared with the lamina and outer margins of leaves. This is the third distinct type of cyclotide precursor, and Solanaceae is the fourth phylogenetically disparate plant family to produce these structurally conserved cyclopeptides, suggesting either convergent evolution upon the CCK structure or movement of cyclotide-encoding sequences within the plant kingdom. PMID:22700981

  8. Comparative anatomical and developmental analysis of dry and fleshy fruits of Solanaceae.

    Science.gov (United States)

    Pabón-Mora, Natalia; Litt, Amy

    2011-09-01

    An anatomical examination of dry and fleshy fruits within the Solanaceae was carried out to identify comparable stages throughout development as well as features exclusive to each type of fruit. We studied fruit development of Nicotiana and Petunia, which have the plesiomorphic capsular fruit; Solanum and Iochroma, characterized by a derived fleshy berry; Cestrum, an independent origin of a fleshy fruit; and Datura, a reversion to a dry fruit. • Pre- and postanthesis carpels and fruits of all species were collected, sectioned, stained, and examined using light microscopy. • Comparable stages of carpel and fruit development were identified in all species. Furthermore, anatomical and developmental features were identified that characterize capsules in Solanaceae, including lack of increase in the number of pericarp cell layers, formation of a sclerified endocarp, and elongation of the epidermal cells of the placenta. Pericarps of fleshy fruits of the Solanoideae are characterized by abundant collenchyma, an increase in the number of cell layers, and a parenchymatous endocarp often expanding into the locules. Anatomical data show that early developmental stages of the fruit of Cestrum, a berry, are similar to the capsular fruits of Petunia and Nicotiana; similarly, Datura, one of the few capsular members of the Solanoideae, shares several anatomical features with closely related berried taxa. • Ontogenetically, all fleshy or all dry fruits do not necessarily share a common developmental ground plan. Independent evolution of fleshiness, sclerification, dryness, and dehiscence are discussed in a phylogenetic context.

  9. Cardioactive properties of Solanaceae plant extracts and pure glycoalkaloids on Zophobas atratus.

    Science.gov (United States)

    Ventrella, Emanuela; Marciniak, Paweł; Adamski, Zbigniew; Rosiński, Grzegorz; Chowański, Szymon; Falabella, Patrizia; Scrano, Laura; Bufo, Sabino A

    2015-04-01

    Glycoalkaloids, the biologically active secondary metabolites produced by Solanaceae plants, are natural defenses against animals, insects and fungi. In this paper, the effects of glycoalkaloids present in extracts of Solanaceae plants (potato, tomato and black nightshade) or pure commercial glycoalkaloids on the coleopteran Zophobas atratus F. were evaluated by in vitro and in vivo bioassays using heart experimental models. Each tested extract induced a dose-dependent cardioinhibitory effect. The perfusion of Zophobas atratus semi-isolated heart using the highest potato and tomato extract concentration (1 mmol/L) caused irreversible cardiac arrests, while extract from black nightshade produced fast but reversible arrests. Pure commercial glycoalkaloids caused similar but less evident effects compared with extracts. Our results showed that the bioactivity of tested compounds depended on their structure and suggested the existence of synergistic interactions when combinations of the main glycoalkaloids of potato and black nightshade were used for trials. Surprisingly, injection of tomato and potato extracts in 1-day-old pupae of Zophobas atratus induced reversible positive chronotropic effects and decreased the duration of the both phases (anterograde and retrograde) of the heart contractile activity. Furthermore, these extracts affected the amplitude of the heart contractions. © 2014 Institute of Zoology, Chinese Academy of Sciences.

  10. Identification and expression profiling of DNA methyltransferases during development and stress conditions in Solanaceae.

    Science.gov (United States)

    Kumar, Rahul; Chauhan, Pankaj Kumar; Khurana, Ashima

    2016-09-01

    DNA methyltransferase (DMTase) enzymes contribute to plant development and stress responses by de novo establishment and subsequent maintenance of DNA methylation during replication. However, the molecular mechanism underlying this activity remains obscure, especially in crop species. Using DMTase homolog complement in six Solanaceae species, we demonstrated here that their number remained conserved in Solanum lineage, whereas it was expanded in both pepper and Nicotiana benthamiana. Non-synonymous vs synonymous (Ka/Ks) substitution ratio revealed that most of the Solanaceous DMTase homologs undergo purifying selection. The genomic sequences of tomato DMT homologs in its wild relative, Solanum pennellii, remained highly conserved in their exons and methyltransferase domains. Structure analysis further revealed highly similar folding of DMTase homologs and conservation in the residues participating in protein-protein interaction in Solanum lineage, whereas a considerable diversification was observed of pepper homologs. Transcript profiling of DMTases highlighted both similar and distinct expression patterns of tomato homologs in other species during fruit development and stress responses. Overall, our analysis provides a strong basis for in-depth exploration of both conserved as well as distinct functions of tomato DMTase homologs in other economically important Solanaceae species.

  11. Plant Resistance Inducers against Pathogens in Solanaceae Species—From Molecular Mechanisms to Field Application

    Science.gov (United States)

    Alexandersson, Erik; Mulugeta, Tewodros; Lankinen, Åsa; Liljeroth, Erland; Andreasson, Erik

    2016-01-01

    This review provides a current summary of plant resistance inducers (PRIs) that have been successfully used in the Solanaceae plant family to protect against pathogens by activating the plant’s own defence. Solanaceous species include many important crops such as potato and tomato. We also present findings regarding the molecular processes after application of PRIs, even if the number of such studies still remains limited in this plant family. In general, there is a lack of patterns regarding the efficiency of induced resistance (IR) both between and within solanaceous species. In many cases, a hypersensitivity-like reaction needs to form in order for the PRI to be efficient. “-Omics” studies have already given insight in the complexity of responses, and can explain some of the differences seen in efficacy of PRIs between and within species as well as towards different pathogens. Finally, examples of field applications of PRIs for solanaceous crops are presented and discussed. We predict that PRIs will play a role in future plant protection strategies in Solanaceae crops if they are combined with other means of disease control in different spatial and temporal combinations. PMID:27706100

  12. Plant Resistance Inducers against Pathogens in Solanaceae Species-From Molecular Mechanisms to Field Application.

    Science.gov (United States)

    Alexandersson, Erik; Mulugeta, Tewodros; Lankinen, Åsa; Liljeroth, Erland; Andreasson, Erik

    2016-10-02

    This review provides a current summary of plant resistance inducers (PRIs) that have been successfully used in the Solanaceae plant family to protect against pathogens by activating the plant's own defence. Solanaceous species include many important crops such as potato and tomato. We also present findings regarding the molecular processes after application of PRIs, even if the number of such studies still remains limited in this plant family. In general, there is a lack of patterns regarding the efficiency of induced resistance (IR) both between and within solanaceous species. In many cases, a hypersensitivity-like reaction needs to form in order for the PRI to be efficient. "-Omics" studies have already given insight in the complexity of responses, and can explain some of the differences seen in efficacy of PRIs between and within species as well as towards different pathogens. Finally, examples of field applications of PRIs for solanaceous crops are presented and discussed. We predict that PRIs will play a role in future plant protection strategies in Solanaceae crops if they are combined with other means of disease control in different spatial and temporal combinations.

  13. A revision of the Dulcamaroid Clade of Solanum L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Sandra Knapp

    2013-05-01

    Full Text Available The Dulcamaroid clade of Solanum contains 45 species of mostly vining or weakly scandent species, including the common circumboreal weed Solanum dulcamara L. The group comprises members of the previously recognised infrageneric groupings sect. Andropedas Rusby, sect. Californisolanum A. Child, sect. Dulcamara (Moench Dumort., sect. Holophylla (G.Don Walp., sect. Jasminosolanum (Bitter Seithe, sect. Lysiphellos (Bitter Seithe, subsect. Nitidum A.Child and sect. Subdulcamara Dunal. These infrageneric groups are not monophyletic as traditionally recognised, and the complex history of the classification of the dulcamaroid solanums is reviewed. Many of the species in the clade are quite variable morphologically; plants are shrubs, herbaceous vines or woody canopy lianas, and habits can vary between these states in a single locality. Variation in leaf shape and pubescence density and type is also extreme and has lead to the description of many minor morphological variants as distinct species. The flowers of members of the group are generally very showy, and several species (e.g., S. crispum Ruiz & Pav., S. laxum Spreng., S. seaforthianum Andrews are popular ornamental plants that have occasionally escaped from cultivation and become naturalised. The clade is here divided into five morphologically and geographically delimited species groups to facilitate further study. One new species from southern Ecuador, Solanum agnoston S.Knapp sp. nov., is described here. Full descriptions and synonymies (including designations of lectotypes or neotypes, preliminary conservation assessments, illustrations, distribution maps, and an extensive list of localities are provided for all species.

  14. Evidence of sexual selection in Neoleucinodes elegantalis (Lepidoptera: Crambidae): correlation of female moth genitalia and Solanaceae host fruit size

    Science.gov (United States)

    Neoleucinodes elegantalis is a Neotropical moth considered a quarantine pest in the family Solanaceae. In previous studies, this species has shown population genetic structure FST =0.57 (P<0.0001) based on host plant associations. This genetic differentiation is further demonstrated here based on ad...

  15. Estudios en Solanaceae – XXIII sobre dos especies nuevas de cuatresia Estudios en Solanaceae – XXIII sobre dos especies nuevas de Cuatresia

    Directory of Open Access Journals (Sweden)

    Hunziker Armando T.

    1986-12-01

    Full Text Available Two new Colombian species of Cuatre sia (Solanaceae, are clescribed and illustrated. Con motivo de la preparación de una sinopsis preliminar sobre Cuatresia A. T. Hunz., ha quedado en evidencia una serie de especies indescritas, 2 de las cuales presento seguidamente.  Es esta una buena oportunidad para llamar la atención de los colegas sobre este difícil y olvidado género de Solanáceas.  En su gran mayoría, las dificultades se originan en los materiales disponibles, que son escasos y fragmentarios; varias especies se conocen por una única colección (a veces con apenas 1 o 2 flores, en la mayoría se ignora cómo son el fruto, la semilla y el embrión, y en otros casos, las observaciones sobre el color de la corola son contradictorias, o imprecisas, o faltan por completo. Por todo ello, quisiera incitar a quienes tienen el privilegio de acceder a las regiones donde crecen estas plantas, a que extremen los recaudos para que las colecciones de Cuatresia mejoren en calidad y cantidad.

  16. Confirming the identity of two enigmatic “spiny solanums” (Solanum subgenus Leptostemonum, Solanaceae collected by Jean-Baptiste Leschenault in Java

    Directory of Open Access Journals (Sweden)

    Xavier Aubriot

    2016-10-01

    Full Text Available Taxonomic revision of the tropical Asian species of Solanum revealed two names, Solanum poka Dunal and Solanum graciliflorum Dunal, whose identities were uncertain and whose application has always been tentative. Material collected in Java at the beginning of the 19th century by Jean-Baptiste Leschenault de la Tour and used to describe these taxa has not been found, despite extensive searches in European herbaria. We here stabilise use of these names by comparing herbarium specimens and drawings of original material made by the artist Toussaint François Node-Véran. Detailed descriptions with synonymy, preliminary conservation assessments and specimen citations are provided for both species. Lectotypes are designated for all names (including synonyms and epitypes designated for S. poka and S. graciliflorum to stabilise usage.

  17. Morphological and physiological features of the species Asimina triloba (L. dunal, introduced as an ornamental plant in Baia Mare (Maramureş county, Romania

    Directory of Open Access Journals (Sweden)

    Beatrice SZILAGYI

    2011-11-01

    Full Text Available Tree species Asimina triloba (L. Dunal, is native to North America. In the area of origin is cultivated, both as food species because the edible fruit, and as ornamental species. Ornamental value derives both from decorative flowers, that open in early spring, and because habitus species. The species is demanding from slightly acidic soils (pH 5.5 to 7.0 and well drained. Seedlings are susceptible to heatstroke and need areas of the sun, but since the second year, vegetate well in bright light conditions [27]. Optimum climate is temperate to subtropical one. The species exhibits unique quality traits for a temperate fruit that are similar to other fruit in the Annonaceae family, including cherimoya (Annona cherimola Mill., sugar apple or sweetsop, (A. squamosa L., soursop (A. muricata L., custard apple (A. reticulata L., and atemoya (A. squamosa X A. cherimola, all of which are tropical [2].This study follows the behavior of the species, in particular conditions of the Baia Mare and its surroundings. In this area a fewindividuals were introduced, in order to diversigy the range of species of ornamental plants. In Baia Mare, topoclimate is specifically depression, sheltered by mountains, more atenuated as temperature and winds, than in surrounding areas. As a result ofclimatic conditions, chestnut Castanea sativa, grows in good conditions in Baia Mare. Instead, the area is heavily polluted,especially at ground level. Pollution by heavy metals is a historical being generated by the mining industry.The introduction and use of a new plant species into a new area involves: 1. easy to obtain seed; 2.- maintaining the crown shape habitus and and leaf shape and size, respectively; 3 – determination of optimal physiological parameters. Therefore have been performed, the following experimental determinations: 1. - germination of seed obtained in the particular conditions of the Baia Mare; 2. - some morphomtric characteristics of leaves, in the juveniles

  18. What can we learn from tobacco and other Solanaceae about horizontal DNA transfer?

    Science.gov (United States)

    Talianova, Martina; Janousek, Bohuslav

    2011-08-01

    In eukaryotic organisms, horizontal gene transfer (HGT) is regarded as an important though infrequent source of reticulate evolution. Many confirmed instances of natural HGT involving multicellular eukaryotes come from flowering plants. This review intends to provide a synthesis of present knowledge regarding HGT in higher plants, with an emphasis on tobacco and other species in the Solanaceae family because there are numerous detailed reports concerning natural HGT events, involving various donors, in this family. Moreover, in-depth experimental studies using transgenic tobacco are of great importance for understanding this process. Valuable insights are offered concerning the mechanisms of HGT, the adaptive role and regulation of natural transgenes, and new routes for gene trafficking. With an increasing amount of data on HGT, a synthetic view is beginning to emerge.

  19. The Steroidal Glycoalkaloids from Solanaceae: Toxic Effect, Antitumour Activity and Mechanism of Action.

    Science.gov (United States)

    Sucha, Lenka; Tomsik, Pavel

    2016-03-01

    Steroidal glycoalkaloids present in Solanaceae are toxic compounds biosynthesised for the protection of the plants. However, many health benefits of these compounds have been reported so far. One of their promising targets might be cancer, as demonstrated in a large number of studies. However, the main mechanism of action seems to be unclear. It could include the induction of apoptosis or trigger a necrosis with a subsequent inflammatory response. The relatively high systemic toxicity of steroidal compounds is another effect that must be taken into account in anticancer research. The main aim of this work was to summarise the recent progress in the investigation of the mechanisms of their antitumour action and to discuss their potential. Georg Thieme Verlag KG Stuttgart · New York.

  20. A GIS model of habitat suitability for Solanum conocarpum (Solanaceae) in St. John, US Virgin Islands

    Science.gov (United States)

    Palumbo, Matthew D.; Fleming, Jonathan P.; Monsegur, Omar A.; Vilella, Francisco

    2016-01-01

    Solanum conocarpum (Solanaceae) (Marron Bacora) is a rare, dry-forest shrub endemic to the island of St. John, US Virgin Islands, considered for listing under the Endangered Species Act. Given its status as a species of conservation concern, we incorporated environmental characteristics of 3 observed populations and 5 additional known locations into a geographic information system (GIS) analysis to create a habitat-suitability model for the species on the island of St. John. Our model identified 1929.87 ha of highly suitable and moderately suitable habitat. Of these, 1161.20 ha (60.2%) occurred within the boundaries of Virgin Islands National Park. Our model provides spatial information on potential locations for future surveys and restoration sites for this endemic species of the US Virgin Islands.

  1. Immunomodulatory and erythropoietic effects of aqueous extract of the fruits of Solanum torvum Swartz (Solanaceae).

    Science.gov (United States)

    Koffuor, George A; Amoateng, Patrick; Andey, Terrick A

    2011-04-01

    The effect of Solanum torvum (Fam: Solanaceae) on delayed type hypersensitivity (DTH) response, hemagglutinating antibody (HA) titer, white blood cells (WBC), red blood cells (RBC) and hemoglobin concentration was investigated in Sprague-Dawley rats to establish immunomodulatory and erythropoietic activity. Sheep red blood cells (SRBC)-immunized and challenged rats were treated with Solanum torvum extract, levamisole and dexamethasone. Phenylhydrazine (PHZ)-induced anemia in rats was treated with the extract. The aqueous Solanum torvum extract and levamisole significantly enhanced DTH response, increased HA titer and WBC count, while dexamethasone significantly decreased DTH response, did not increase HA titer, and did not enhance WBC profile. The extract and Feroglobin, the reference heamatinic, were able to reverse PHZ-induced anemia, and increase the RBCs and Hb concentration above baseline values within 24 days. Solanum torvum extract showed a concentration-dependent immunostimulant and erythropoietic activity.

  2. Molluscicidal activity of some Brazilian Solanum spp. (Solanaceae) against Biomphalaria glabrata.

    Science.gov (United States)

    Silva, T M S; Batista, M M; Camara, C A; Agra, M F

    2005-06-01

    Plants in the genus Solanum (Solanaceae) produce a great variety of steroidal saponins and glycoalkaloids that confer natural resistance against several pests. Methanolic extracts of 13 Solanum species have now been tested for molluscicidal activity against Biomphalaria glabrata. The extracts investigated were prepared from the fruit of S. asperum, S. capsicoides, S. palinacantum, S. paludosum, S. paniculatum, S. paraibanum and S. sisymbriifolium, the aerial parts of S. asperum, S. capsicoides, S. crinitum, S. diamantinense, S. megalonyx, S. palinacantum, S. paniculatum, S. sisymbriifolium and S. torvum, and the roots of S. asperum, S. asterophorum, S. palinacantum, S. paludosum, S. paniculatum and S. stipulaceum. Encouragingly, the extracts from S. asperum, S. diamantinese, S. paludosum, S. sisymbriifolium and S. stipulaceum showed significant molluscicidal activity, the median lethal concentrations recorded (20-50 microg/ml) falling well below the threshold, of 100 microg/ml, set for a potential molluscicide by the World Health Organization.

  3. Andromonoecy and buzz pollination in Solanum species (Solanaceae endemic to the Canary Islands

    Directory of Open Access Journals (Sweden)

    Dupont, Yoko Luise

    2006-06-01

    Full Text Available We investigated the pollination and reproductive biology of two Canary Island endemics, Solanum vespertilio and S. lidii (Solanaceae. We measured male function (pollen development, female function (fruit initiation and spatial arrangement of reproductive parts within flowers and inflorescences. Furthermore, we observed flower visitors and monitored visitation rates. Both species of Solanum display andromonoecy: Longstyled flowers are functionally hermaphrodite and borne proximally on the inflorescences, while short-styled flowers are functionally male and borne distally on inflorescences. Large bees capable of buzzing were the main flower visitors. In particular, the endemic Canarian bumblebee, Bombus terrestris canariensis, was a frequent visitor and pollen vector of S. vespertilio.Se estudiaron la polinización y biología reproductiva de dos especies endémicas de las Islas Canarias: Solanum vespertilio y S. lidii (Solanaceae. Se midieron la función masculina (desarrollo polínico, la función femenina (iniciación de fruto y la disposición espacial de los órganos reproductivos, tanto en las flores como en las inflorescencias. Se registraron además los visitantes de las flores y su frecuencia. Ambos Solanum son andromonoicos: las flores con estilo largo son funcionalmente hermafroditas y proximales en las inflorescencias, mientras que las flores con estilo corto son funcionalmente masculinas y distales en la inflorescencia. Los visitantes más asiduos fueron grandes abejas y abejorros zumbadores. El abejorro endémico Bombus terrestris canariensis, en particular, fue un visitante frecuente y un vector de polen para S. vespertilio.

  4. Comparative evidence for the correlated evolution of polyploidy and self-compatibility in Solanaceae.

    Science.gov (United States)

    Robertson, Kelly; Goldberg, Emma E; Igić, Boris

    2011-01-01

    Breakdown of self-incompatibility occurs repeatedly in flowering plants with important evolutionary consequences. In plant families in which self-incompatibility is mediated by S-RNases, previous evidence suggests that polyploidy may often directly cause self-compatibility through the formation of diploid pollen grains. We use three approaches to examine relationships between self-incompatibility and ploidy. First, we test whether evolution of self-compatibility and polyploidy is correlated in the nightshade family (Solanaceae), and find the expected close association between polyploidy and self-compatibility. Second, we compare the rate of breakdown of self-incompatibility in the absence of polyploidy against the rate of breakdown that arises as a byproduct of polyploidization, and we find the former to be greater. Third, we apply a novel extension to these methods to show that the relative magnitudes of the macroevolutionary pathways leading to self-compatible polyploids are time dependent. Over small time intervals, the direct pathway from self-incompatible diploids is dominant, whereas the pathway through self-compatible diploids prevails over longer time scales. This pathway analysis is broadly applicable to models of character evolution in which sequential combinations of rates are compared. Finally, given the strong evidence for both irreversibility of the loss of self-incompatibility in the family and the significant association between self-compatibility and polyploidy, we argue that ancient polyploidy is highly unlikely to have occurred within the Solanaceae, contrary to previous claims based on genomic analyses. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

  5. Plant tropane alkaloid biosynthesis evolved independently in the Solanaceae and Erythroxylaceae.

    Science.gov (United States)

    Jirschitzka, Jan; Schmidt, Gregor W; Reichelt, Michael; Schneider, Bernd; Gershenzon, Jonathan; D'Auria, John Charles

    2012-06-26

    The pharmacologically important tropane alkaloids have a scattered distribution among angiosperm families, like many other groups of secondary metabolites. To determine whether tropane alkaloids have evolved repeatedly in different lineages or arise from an ancestral pathway that has been lost in most lines, we investigated the tropinone-reduction step of their biosynthesis. In species of the Solanaceae, which produce compounds such as atropine and scopolamine, this reaction is known to be catalyzed by enzymes of the short-chain dehydrogenase/reductase family. However, in Erythroxylum coca (Erythroxylaceae), which accumulates cocaine and other tropane alkaloids, no proteins of the short-chain dehydrogenase/reductase family were found that could catalyze this reaction. Instead, purification of E. coca tropinone-reduction activity and cloning of the corresponding gene revealed that a protein of the aldo-keto reductase family carries out this reaction in E. coca. This protein, designated methylecgonone reductase, converts methylecgonone to methylecgonine, the penultimate step in cocaine biosynthesis. The protein has highest sequence similarity to other aldo-keto reductases, such as chalcone reductase, an enzyme of flavonoid biosynthesis, and codeinone reductase, an enzyme of morphine alkaloid biosynthesis. Methylecgonone reductase reduces methylecgonone (2-carbomethoxy-3-tropinone) stereospecifically to 2-carbomethoxy-3β-tropine (methylecgonine), and has its highest activity, protein level, and gene transcript level in young, expanding leaves of E. coca. This enzyme is not found at all in root tissues, which are the site of tropane alkaloid biosynthesis in the Solanaceae. This evidence supports the theory that the ability to produce tropane alkaloids has arisen more than once during the evolution of the angiosperms.

  6. Inheritance of resistance to Phytophthora infestans (Peronosporales, Pythiaceae) in a new source of resistance in tomato (Solanum sp. (formerly Lycopersicon sp.), Solanales, Solanaceae)

    OpenAIRE

    Abreu, Flávia Barbosa; Silva, Derly José Henriques da; Cruz, Cosme Damião; Mizubuti, Eduardo Seiti Gomide

    2008-01-01

    In Brazil, no commercial tomato (Solanum lycopersicum L. formerly Lycopersicon esculentum Mill.) varieties are available which are resistant to the late blight, one of the most important tomato diseases, produced by the phytopathogenic oomycete Phytophthora infestans. The wild tomato (Solanum habrochaites Knapp & Spooner, formerly Lycopersicon hirsutum Dunal) shows resistance to P. infestans, because of which we investigated an interspecific cross between S. lycopersicum cv. Santa Clara a...

  7. Application of an index of biotic integrity for dunal, palustrine wetlands: Emphasis on assessment of nonpoint source landfill effects on the Grand Calumet Lagoons

    Science.gov (United States)

    Simon, T.P.; Stewart, P.M.

    1998-01-01

    Using a newly modified index of biotic integrity for assessing biological integrity of fish communities in dunal, palustrine wetlands, we assessed the non-point source influence of an industrial landfill on the Grand Calumet Lagoons. The landfill is primarily an iron and steel manufacturer's slag waste. No sensitive species, hybrids, headwater species, and either few or no simple lithophilic spawning species were collected from any of the sites in the Grand Calumet Lagoons. Species catch-per-unit of effort varied significantly between reaches in the Middle Lagoon and the West Lagoon. The most disturbed areas were adjacent to the industrial landfill and along the southern shore near the outflow from the West Lagoon. Near- and far-field stations possessed similar numbers of species and relative abundance. The near-field stations showed an increase in tolerant species, a higher proportion of omnivores and carnivores, and a lower environmental quality rating of ‘poor-very poor’. The far-field sites were classified as having ‘fair’ biological integrity and showed an increase in relative abundance, proportion of sensitive species, and an increase in simple lithophils. The loss of biological integrity in the West Pond was not accurately predicted using the modified index of biotic integrity, even though it was rated as extremely degraded by the biological diversity indices. Fish communities were negatively impacted by proximity to the landfill.

  8. Dietary supplementation of Ashwagandha (Withania somnifera, Dunal) enhances NK cell function in ovarian tumors in the laying hen model of spontaneous ovarian cancer.

    Science.gov (United States)

    Barua, Animesh; Bradaric, Michael J; Bitterman, Pincas; Abramowicz, Jacques S; Sharma, Sameer; Basu, Sanjib; Lopez, Heather; Bahr, Janice M

    2013-12-01

    Ovarian cancer (OVCA) disseminates in a distinct pattern through peritoneal metastasis and little is known about the immunosuppression in the tumor microenvironment. Our goal was to determine changes in NK cell population during OVCA development and the effects of Ashwagandha (Withania somnifera, Dunal) supplementation on NK cell localization in laying hens with OVCA. Frequency of NK cells in ovarian tumors at early and late stages in 3- to 4-year-old hens (exploratory study) as well as in hens supplemented with dietary Ashwagandha root powder for 90 days (prospective study) was examined. The population of stromal NK cells but not the intratumoral NK cells increased with OVCA development and progression. Ashwagandha supplementation decreased the incidence and progression of OVCA. Both the stromal and intratumoral NK cell population increased significantly (P Ashwagandha supplementated hens. The results of this study suggest that the population of stromal and tumorinfiltrating NK cells is increased by dietary Ashwagandha supplementation. Thus, Ashwagandha may enhance antitumor function of NK cells. This study may be useful for a clinical study to determine the effects of dietary Ashwagandha on NK cell immune function in patients with ovarian cancer. © 2013 John Wiley & Sons Ltd.

  9. Analysis of steroidal alkaloids and saponins in Solanaceae plant extracts using UPLC-qTOF mass spectrometry.

    Science.gov (United States)

    Heinig, Uwe; Aharoni, Asaph

    2014-01-01

    Plants of the Solanaceae family are renowned for the production of cholesterol-derived steroidal glycosides, including the nitrogen containing glycoalkaloids and steroidal saponins. In this chapter we describe the use of UPLC (Ultra Performance Liquid Chromatography) coupled with qTOF (Quadrupole Time-of-Flight) mass spectrometry for profiling of these two large classes of semipolar metabolites. The presented method includes an optimized sample preparation protocol, a procedure for high resolution chromatographic separation and metabolite detection using the TOF mass spectrometer which provides high resolution and mass accuracy. A detailed description for non-targeted data analysis and a strategy for putative identification of steroidal glycosides from complex extracts based on interpretation of mass fragmentation patterns is also provided. The described methodology allows profiling and putative identification of multiple steroidal glycoside compounds from the assortment of Solanaceae species producing these molecules.

  10. Unraveling the sequence dynamics of the formation of genus-specific satellite DNAs in the family solanaceae.

    Science.gov (United States)

    Jo, S-H; Park, H-M; Kim, S-M; Kim, H H; Hur, C-G; Choi, D

    2011-05-01

    Tandemly repeated DNAs, referred to as satellite DNAs, often occur in a genome in a genus-specific manner. However, the mechanisms for generation and evolution for these sequences are largely unknown because of the uncertain origins of the satellite DNAs. We found highly divergent genus-specific satellite DNAs that showed sequence similarity with genus-specific intergenic spacers (IGSs) in the family Solanaceae, which includes the genera Nicotiana, Solanum and Capsicum. The conserved position of the IGS between 25S and 18S rDNA facilitates comparison of IGS sequences across genera, even in the presence of very low sequence similarity. Sequence comparison of IGS may elucidate the procedure of the genesis of complex monomer units of the satellite DNAs. Within the IGS of Capsicum species, base substitutions and copy number variation of subrepeat monomers were causes of monomer divergence in IGS sequences. At the level of inter-generic IGS sequences of the family Solanaceae, however, genus-specific motif selection, motif shuffling between subrepeats and differential amplification among motifs were involved in formation of genus-specific IGS. Therefore, the genus-specific satellite DNAs in Solanaceae plants can be generated from differentially organized repeat monomers of the IGS rather than by accumulation of mutations from pre-existent satellite DNAs.

  11. Phytomonas (Euglenozoa: Trypanosomatidae): Phylogenetic analyses support infrageneric lineages and a new species transmitted to Solanaceae fruits by a pentatomid hemipteran.

    Science.gov (United States)

    Zanetti, Andernice; Ferreira, Robson C; Serrano, Myrna G; Takata, Carmen S A; Campaner, Marta; Attias, Marcia; de Souza, Wanderley; Teixeira, Marta M G; Camargo, Erney P

    2016-10-01

    The genus Phytomonas includes trypanosomatids transmitted to the fruits, latex, and phloem of vascular plants by hemipterans. We inferred the phylogenetic relationships of plant and insect isolates assigned to the previously defined genetic groups A-F and H of Phytomonas, particularly those from groups A, C and E comprising flagellates of Solanaceae fruits. Phylogenetic analyses using glycosomal Glyceraldehyde Phosphate Dehydrogenase (gGAPDH) and Small Subunit rRNA (SSU rRNA) genes strongly supported the monophyly of the genus Phytomonas and its division into seven main infrageneric phylogenetic lineages (Phy clades). Isolates from fruit or latex do not constitute monophyletic assemblages but disperse through more than one lineages. In this study, fruit flagellates were distributed in three clades: PhyA, formed by isolates from Solanaceae and phytophagous hemipterans; PhyC comprising flagellates from four plant families; and PhyE, which contains 15 fruit isolates from seven species of Solanaceae. The flagellates of PhyE are described as Phytomonas dolleti n. sp. according to their positioning in phylogenetic trees, complemented by data about their life cycle, and developmental and morphological characteristics in cultures, fruits of Solanum spp., and salivary glands of the vector, the phytophagous hemipteran Arvelius albopunctatus (Pentatomidae). Crown Copyright © 2016. Published by Elsevier GmbH. All rights reserved.

  12. Synopsis and lectotypification of Solanum (Solanaceae species endemic in the West Indies

    Directory of Open Access Journals (Sweden)

    Knapp, Sandra

    2009-06-01

    Full Text Available The West Indies (Bahamas, Greater and Lesser Antilles is an area of high species richness and more importantly, species-level endemism in many groups. Solanum (Solanaceae is diverse in the region with 25 endemic species (S. bahamense is near-endemic, bringing number to 26. Nineteen of these taxa are single-island endemics, and some have not been re-collected since the early 20th century. A synopsis of the species endemic to the West Indies is presented, with full synonymy and distribution; a single representative specimen is cited for each. All accepted names and synonyms are lectotypified where necessary; many of these taxa were described from collections in Berlin (B that are no longer extant. Lectotypes newly designated here are illustrated.Las Antillas (Bahamas, Grandes Antillas y Pequeñas Antillas es un área con gran riqueza florística y, lo que es más importante, con alto nivel de endemicidad en muchos grupos. Solanum (Solanaceae es un género muy diverso en la región, que tiene 25 especies endémicas (S. bahamense es casi endémica, con lo que el número se elevaría a 26. Diecinueve de estos táxones son endemismos de una sola isla, y algunos no se han vuelto a colectar desde principios del siglo XX. Se presenta ahora una sinopsis de las especies endémicas de las Antillas, con todos los sinónimos y su distribución y con cita de un espécimen representativo de cada especie. Todos los nombres aceptados y sinónimos se han lectotipificado cuando ha sido necesario; muchos de estos táxones fueron descritos a partir de colecciones que se conservaban en Berlín (B pero que han desaparecido. Los lectótipos designados aquí están ilustrados.

  13. Radiation of the Tnt1 retrotransposon superfamily in three Solanaceae genera

    Science.gov (United States)

    Manetti, Maria E; Rossi, Magdalena; Costa, Ana PP; Clausen, Andrea M; Van Sluys, Marie-Anne

    2007-01-01

    Background Tnt1 was the first active plant retrotransposon identified in tobacco after nitrate reductase gene disruption. The Tnt1 superfamily comprises elements from Nicotiana (Tnt1 and Tto1) and Lycopersicon (Retrolyc1 and Tlc1) species. The study presented here was conducted to characterise Tnt1-related sequences in 20 wild species of Solanum and five cultivars of Solanum tuberosum. Results Tnt1-related sequences were amplified from total genomic DNA using a PCR-based approach. Purified fragments were cloned and sequenced, and clustering analysis revealed three groups that differ in their U3 region. Using a network approach with a total of 453 non-redundant sequences isolated from Solanum (197), Nicotiana (140) and Lycopersicon (116) species, it is demonstrated that the Tnt1 superfamily can be treated as a population to resolve previous phylogenetic multifurcations. The resulting RNAseH network revealed that sequences group according to the Solanaceae genus, supporting a strong association with the host genome, whereas tracing the U3 region sequence association characterises the modular evolutionary pattern within the Tnt1 superfamily. Within each genus, and irrespective of species, nearly 20% of Tnt1 sequences analysed are identical, indicative of being part of an active copy. The network approach enabled the identification of putative "master" sequences and provided evidence that within a genus these master sequences are associated with distinct U3 regions. Conclusion The results presented here support the hypothesis that the Tnt1 superfamily was present early in the evolution of Solanaceae. The evidence also suggests that the RNAseH region of Tnt1 became fixed at the host genus level whereas, within each genus, propagation was ensured by the diversification of the U3 region. Different selection pressures seemed to have acted on the U3 and RNAseH modules of ancestral Tnt1 elements, probably due to the distinct functions of these regions in the retrotransposon

  14. Lectotypification of Ruiz and Pavón's names in Solanum (Solanaceae

    Directory of Open Access Journals (Sweden)

    Knapp, Sandra

    2008-12-01

    Full Text Available Lectotypes or neotypes are confirmed or designated here for the 41 names coined by Hipólito Ruiz and José Pavón in the Flora peruviana et chilensis that were either described, or today recognised as, members of the large genus Solanum (Solanaceae: Solanum acuminatum, S. acutifolium, S. anceps, S. angulatum, S. angustifolium, S. asperolanatum, S. biformifolium, S. calygnaphalum, S. conicum, S. crispum, S. cymosum, S. dichotomum, S. diffusum, S. filiforme, S. foetidum, S. glandulosum, S. grandiflorum, S. incanum, S. incarceratum, S. incurvum, S. laciniatum, S. lanceolatum, S. lineatum, S. mite, S. multifidum, S. nitidum, S. nutans. S. obliquum, S. oblongum, S. oppositifolium, S. pendulum, S. pinnatifidum, S. pubescens, S. runcinatum, S. scabrum, S. sericeum, S. sessile, S. stellatum, S. ternatum, S. variegatum and S. viridiflorum. A introduction assesses the importance of Ruiz and Pavón to the botany of their time, and identifies difficulties in lectotypifying names coined by them. The currently accepted name for each taxon is given. Each typification is accompanied by a discussion of the reasoning behind the choice of specimen, and all types are illustrated.Se confirman o designan los lectótipos o neótipos de 41 nombres acuñados por Hipólito Ruiz y José Pavón en la Flora peruviana et chilensis que fueron descritos dentro del género Solanum (Solanaceae o son actualmente reconocidos como parte del mismo: Solanum acuminatum, S. acutifolium, S. anceps, S. angulatum, S. angustifolium, S. asperolanatum, S. biformifolium, S. calygnaphalum, S. conicum, S. crispum, S. cymosum, S. dichotomum, S. diffusum, S. filiforme, S. foetidum, S. glandulosum, S. grandiflorum, S. incanum, S. incarceratum, S. incurvum, S. laciniatum, S. lanceolatum, S. lineatum, S. mite, S. multifidum, S. nitidum, S. nutans. S. obliquum, S. oblongum, S. oppositifolium, S. pendulum, S. pinnatifidum, S. pubescens, S. runcinatum, S. scabrum, S. sericeum, S. sessile, S. stellatum

  15. Comparative genomic analysis of light-regulated transcripts in the Solanaceae

    Directory of Open Access Journals (Sweden)

    Yanovsky Marcelo J

    2009-02-01

    Full Text Available Abstract Background Plants use different light signals to adjust their growth and development to the prevailing environmental conditions. Studies in the model species Arabidopsis thaliana and rice indicate that these adjustments are mediated by large changes in the transcriptome. Here we compared transcriptional responses to light in different species of the Solanaceae to investigate common as well as species-specific changes in gene expression. Results cDNA microarrays were used to identify genes regulated by a transition from long days (LD to short days (SD in the leaves of potato and tobacco plants, and by phytochrome B (phyB, the photoreceptor that represses tuberization under LD in potato. We also compared transcriptional responses to photoperiod in Nicotiana tabacum Maryland Mammoth (MM, which flowers only under SD, with those of Nicotiana sylvestris, which flowers only under LD conditions. Finally, we identified genes regulated by red compared to far-red light treatments that promote germination in tomato. Conclusion Most of the genes up-regulated in LD were associated with photosynthesis, the synthesis of protective pigments and the maintenance of redox homeostasis, probably contributing to the acclimatization to seasonal changes in irradiance. Some of the photoperiodically regulated genes were the same in potato and tobacco. Others were different but belonged to similar functional categories, suggesting that conserved as well as convergent evolutionary processes are responsible for physiological adjustments to seasonal changes in the Solanaceae. A β-ZIP transcription factor whose expression correlated with the floral transition in Nicotiana species with contrasting photoperiodic responses was also regulated by photoperiod and phyB in potato, and is a candidate gene to act as a general regulator of photoperiodic responses. Finally, GIGANTEA, a gene that controls flowering time in Arabidopsis thaliana and rice, was regulated by

  16. Novos registros do táxon Cestrum L. (Solanaceae para o Estado da Bahia-Brasil - DOI: 10.4025/actascibiolsci.v27i1.1357 New occurrences of the Genus Cestrum L. (Solanaceae taxon for the state of Bahia-Brazil - DOI: 10.4025/actascibiolsci.v27i1.1357

    Directory of Open Access Journals (Sweden)

    Silvana do Nascimento Silva

    2005-03-01

    Full Text Available Trabalho objetivou realizar um levantamento das espécies de Cestrum para o sul da Bahia. Foram feitas coletas assistemáticas mensais no sul da Bahia na floresta higrófila. O material coletado foi identificado, descrito e ilustrado da maneira convencional utilizado em estudos taxonômicos. Foram encontradas as seguintes espécies: Cestrum lanceolatum Schott. Ex Sendtn, C. megalophyllum Dunal, C. parqui L’Her e C. schlectendahlii G. DonThe objective of this study was to carry out a survey of the Cestrum species for southern Bahia. Systematic monthly collections of Cestrum were made in areas of southern Bahia Atlantic moist forest. The collected material was identified, described, and illustrated employing conventional methodology for botanical systematics. The following specimens were collected and identified in this Cestrum lanceolatum Schott. Ex Sendtn, C. megalophyllum Dunal, C. parqui L’Her, and C. schlectendahlii G. Don

  17. Hypolipidemic and antioxidant activity of aqueous extract of fruit of Withania coagulans (Stocks) Dunal in cholesterol-fed hyperlipidemic rabbit model.

    Science.gov (United States)

    Shukla, Kirtikar; Dikshit, Piyush; Shukla, Rimi; Sharma, Sonal; Gambhir, Jasvinder K

    2014-09-01

    Withania coagulans (family: Solanaceae, English: Indian Cheese Maker, Hindi: Doda Paneer) fruit is known for its ethanopharmacological significance in health care system of India. Diet rich in high-fat is an important risk factor for diabetes, atherosclerosis and macro and microvascular complications. Treatment with aqueous extract of fruit of W. coagulans (aqWC; 250 mg/kg body weight) in cholesterol-fed animals resulted in significant decrease in the levels of total cholesterol, triacylglycerol, low density lipoprotein, tissue lipid content and acetyl CoA carboxylase activity whereas, the level of high density lipoprotein and activity of HMGCoA reductase also recovered partially. Treatment with aqWC also significantly decreased plasma lipid peroxide levels and increased reduced glutathione and superoxide dismutase activities. These results suggest that the aqueous extract of W. coagulans has potent lipid lowering and antioxidant activities.

  18. Genitalic Differentiations in Neoleucinodes elegantalis (Gueneé) (Lepidoptera: Crambidae) Associated with Solanaceae Crops in Ecuador.

    Science.gov (United States)

    Noboa, Michelle; Viera, William; Díaz, Ana; Vásquez, Wilson; Ron, Lenin

    2017-08-31

    Neoleucinodes elegantalis (Guenée) is an oligophagous species of plants in the Solanaceae family that has a broad geographical distribution in the tropical zones of South America. It is the most important insect pest of naranjilla ( Solanum quitoense Lamarck), a crop grown in threatened areas of the tropical old-growth forest in Ecuador. In this study, two host-specific populations of N. elegantalis were collected from infested fruit of naranjilla and tree tomato ( Solanum betaceum Cavanilles) in different locations. Sexually virgin adult insects (93 females and 103 males) were dissected to extract their genitalia to measure 12 morphological variables in females and six in males, resulting in six and four informative variables respectively. Using univariate and multivariate analysis of variance, it was found that the Solanaceous host was the main factor differentiating the area measurements of the seventh abdominal segment and ostium bursae in female genitalia, and cornuti length in male genitalia. Principal components generated with these measurements were employed in a logistic regression model for the classification of the Solanaceous host. Female genitalia of individuals from S. betaceum showed significantly larger ostium bursae relative to female genitalia from S. quitoense . For males, individuals collected from S. betaceum showed longer cornuti length than samples collected from S. quitoense . The results suggest genotypic differentiation according to the Solanaceous host or phenotypic plasticity in N. elegantalis . Further molecular and bio-geographical studies are needed to properly differentiate N. elegantalis populations that would help in the control of this pest.

  19. A Community-Based Annotation Framework for Linking Solanaceae Genomes with Phenomes1[C][OA

    Science.gov (United States)

    Menda, Naama; Buels, Robert M.; Tecle, Isaak; Mueller, Lukas A.

    2008-01-01

    The amount of biological data available in the public domain is growing exponentially, and there is an increasing need for infrastructural and human resources to organize, store, and present the data in a proper context. Model organism databases (MODs) invest great efforts to functionally annotate genomes and phenomes by in-house curators. The SOL Genomics Network (SGN; http://www.sgn.cornell.edu) is a clade-oriented database (COD), which provides a more scalable and comparative framework for biological information. SGN has recently spearheaded a new approach by developing community annotation tools to expand its curational capacity. These tools effectively allow some curation to be delegated to qualified researchers, while, at the same time, preserving the in-house curators' full editorial control. Here we describe the background, features, implementation, results, and development road map of SGN's community annotation tools for curating genotypes and phenotypes. Since the inception of this project in late 2006, interest and participation from the Solanaceae research community has been strong and growing continuously to the extent that we plan to expand the framework to accommodate more plant taxa. All data, tools, and code developed at SGN are freely available to download and adapt. PMID:18539779

  20. On 'various contrivances': pollination, phylogeny and flower form in the Solanaceae.

    Science.gov (United States)

    Knapp, Sandra

    2010-02-12

    Members of the euasterid angiosperm family Solanaceae have been characterized as remarkably diverse in terms of flower morphology and pollinator type. In order to test the relative contribution of phylogeny to the pattern of distribution of floral characters related to pollination, flower form and pollinators have been mapped onto a molecular phylogeny of the family. Bilateral flower symmetry (zygomorphy) is prevalent in the basal grades of the family, and more derived clades have flowers that are largely radially symmetric, with some parallel evolution of floral bilateralism. Pollinator types ('syndromes') are extremely homoplastic in the family, but members of subfamily Solanoideae are exceptional in being largely bee pollinated. Pollinator relationships in those genera where they have been investigated more fully are not as specific as flower morphology and the classical pollinator syndrome models might suggest, and more detailed studies in some particularly variable genera, such as Iochroma and Nicotiana, are key to understanding the role of pollinators in floral evolution and adaptive radiation in the family. More studies of pollinators in the field are a priority.

  1. On ‘various contrivances’: pollination, phylogeny and flower form in the Solanaceae

    Science.gov (United States)

    Knapp, Sandra

    2010-01-01

    Members of the euasterid angiosperm family Solanaceae have been characterized as remarkably diverse in terms of flower morphology and pollinator type. In order to test the relative contribution of phylogeny to the pattern of distribution of floral characters related to pollination, flower form and pollinators have been mapped onto a molecular phylogeny of the family. Bilateral flower symmetry (zygomorphy) is prevalent in the basal grades of the family, and more derived clades have flowers that are largely radially symmetric, with some parallel evolution of floral bilateralism. Pollinator types (‘syndromes’) are extremely homoplastic in the family, but members of subfamily Solanoideae are exceptional in being largely bee pollinated. Pollinator relationships in those genera where they have been investigated more fully are not as specific as flower morphology and the classical pollinator syndrome models might suggest, and more detailed studies in some particularly variable genera, such as Iochroma and Nicotiana, are key to understanding the role of pollinators in floral evolution and adaptive radiation in the family. More studies of pollinators in the field are a priority. PMID:20047871

  2. Bioactive proteins from Solanaceae as quorum sensing inhibitors against virulence in Pseudomonas aeruginosa.

    Science.gov (United States)

    Singh, Gurpreet; Tamboli, Ekant; Acharya, Aurovind; Kumarasamy, Chellan; Mala, Kanchana; Raman, Pachaiappan

    2015-06-01

    Cell-to-cell communication or quorum sensing (QS) is a generic event in bacteria that is used to coordinate gene expression among local populations. The phenomenon of QS depends on the fact that presence of sufficient bacteria ascertains a threshold level of autoinducer concentration that allows bacteria to sense a critical cell mass and to activate or repress target genes. Thus, QS has been an attractive target for the development of anti-infective strategies that are not based on the use of antibiotics. Several anti-QS approaches have been demonstrated including natural products from plant-based secondary metabolites. However, the role of plant bioactive proteins as an anti-QS peptide is yet to be deciphered. Against a backdrop of ever-increasing antibiotic resistant pathogens, there is a strong need for development of alternative therapeutic strategies. Thus, our hypothesis is that bioactive proteins from the plant family Solanaceae are quorum quenching molecules that can be exploited to develop a therapeutic strategy against virulence. We presume that bioactive proteins will inactivate or inhibit or degrade QS signals from bacteria to prevent cell-to-cell communication and thus inhibit development of virulence in Pseudomonas aeruginosa. Further, the use of proteins as quorum quenchers will delay the bacteria to develop resistance against these quenching molecules. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Evolutionary correlations in flavonoid production across flowers and leaves in the Iochrominae (Solanaceae).

    Science.gov (United States)

    Berardi, Andrea E; Hildreth, Sherry B; Helm, Richard F; Winkel, Brenda S J; Smith, Stacey D

    2016-10-01

    Plant reproductive and vegetative tissues often use the same biochemical pathways to produce specialized metabolites. In such cases, selection acting on the synthesis of specific products in a particular tissue could result in correlated changes in other products of the pathway, both in the same tissue and in other tissues. This study examined how changes in floral anthocyanin pigmentation affect the production of other compounds of the flavonoid pathway in flowers and in leaves. Focusing on the Iochrominae, a clade of Solanaceae with a wide range of flower colors, liquid chromatography coupled with mass spectrometry and UV detection was used to profile and quantify the variation in two classes of flavonoids, anthocyanins and flavonols. Purple, red, orange and white-flowered Iochrominae produced all of the six common anthocyanidin types, as well as several classes of flavonols. Differences in anthocyanin and flavonol production were significantly correlated in flowers, particularly with respect to B ring hydroxylation pattern. However, these differences in floral flavonoids were not strongly related to differences in leaf chemistry. Specifically, most species made only flavonols (not anthocyanins) in leaves, and these comprised the two most common flavonols, quercetin and kaempferol, regardless of the color of the flower. These results suggest that shifts in flower color may occur without significant pleiotropic consequences for flavonoid production in vegetative tissues. Similar studies in other systems will be important for testing the generality of this pattern in other groups of flowering plants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. From manual curation to visualization of gene families and networks across Solanaceae plant species.

    Science.gov (United States)

    Pujar, Anuradha; Menda, Naama; Bombarely, Aureliano; Edwards, Jeremy D; Strickler, Susan R; Mueller, Lukas A

    2013-01-01

    High-quality manual annotation methods and practices need to be scaled to the increased rate of genomic data production. Curation based on gene families and gene networks is one approach that can significantly increase both curation efficiency and quality. The Sol Genomics Network (SGN; http://solgenomics.net) is a comparative genomics platform, with genetic, genomic and phenotypic information of the Solanaceae family and its closely related species that incorporates a community-based gene and phenotype curation system. In this article, we describe a manual curation system for gene families aimed at facilitating curation, querying and visualization of gene interaction patterns underlying complex biological processes, including an interface for efficiently capturing information from experiments with large data sets reported in the literature. Well-annotated multigene families are useful for further exploration of genome organization and gene evolution across species. As an example, we illustrate the system with the multigene transcription factor families, WRKY and Small Auxin Up-regulated RNA (SAUR), which both play important roles in responding to abiotic stresses in plants. Database URL: http://solgenomics.net/

  5. Genetic basis for a rare floral mutant in an Andean species of Solanaceae.

    Science.gov (United States)

    Coburn, Rachel A; Griffin, Randi H; Smith, Stacey D

    2015-02-01

    White forms of typically pigmented flowers are one of the most common polymorphisms in flowering plants. Although the range of genetic changes that give rise to white phenotypes is well known from model systems, few studies have identified causative mutations in natural populations. Here we combine genetic studies, in vitro enzyme assays, and biochemical analyses to identify the mechanism underlying the loss of anthocyanin pigment production in the naturally occurring white-flowered morph of Iochroma calycinum (Solanaceae). Comparison of anthocyanin gene sequences revealed a putative loss-of-function mutation, an 11 amino-acid deletion in dihydroflavonol 4-reductase (DFR), in the white morph. Functional assays of Dfr alleles from blue and white morphs demonstrated that this deletion results in a loss of enzymatic activity, indicating that the deletion could be solely responsible for the lack of pigment production. Consistent with this hypothesis, quantitative PCR showed no significant differences in expression of anthocyanin genes between the morphs. Also, thin layer chromatography confirmed that the white morph continues to accumulate compounds upstream of the DFR enzyme. Collectively, these experiments indicate that the structural mutation at Dfr underlies the rare white flower morph of I. calycinum. This study is one of only a few examples where a flower color polymorphism is due to a loss-of-function mutation in the coding region of an anthocyanin enzyme. The rarity of such mutations in nature suggests that negative consequences prevent fixation across populations. © 2015 Botanical Society of America, Inc.

  6. Multiple strong postmating and intrinsic postzygotic reproductive barriers isolate florally diverse species of Jaltomata (Solanaceae).

    Science.gov (United States)

    Kostyun, Jamie L; Moyle, Leonie C

    2017-06-01

    Divergence in phenotypic traits often contributes to premating isolation between lineages, but could also promote isolation at postmating stages. Phenotypic differences could directly result in mechanical isolation or hybrids with maladapted traits; alternatively, when alleles controlling these trait differences pleiotropically affect other components of development, differentiation could indirectly produce genetic incompatibilities in hybrids. Here, we determined the strength of nine postmating and intrinsic postzygotic reproductive barriers among 10 species of Jaltomata (Solanaceae), including species with highly divergent floral traits. To evaluate the relative importance of floral trait diversification for the strength of these postmating barriers, we assessed their relationship to floral divergence, genetic distance, geographical context, and ecological differences, using conventional tests and a new linear-mixed modeling approach. Despite close evolutionary relationships, all species pairs showed moderate to strong isolation. Nonetheless, floral trait divergence was not a consistent predictor of the strength of isolation; instead this was best explained by genetic distance, although we found evidence for mechanical isolation in one species, and a positive relationship between floral trait divergence and fruit set isolation across species pairs. Overall, our data indicate that intrinsic postzygotic isolation is more strongly associated with genome-wide genetic differentiation, rather than floral divergence. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  7. Sequencing and Comparative Analysis of a Conserved Syntenic Segment in the Solanaceae

    Science.gov (United States)

    Wang, Ying; Diehl, Adam; Wu, Feinan; Vrebalov, Julia; Giovannoni, James; Siepel, Adam; Tanksley, Steven D.

    2008-01-01

    Comparative genomics is a powerful tool for gaining insight into genomic function and evolution. However, in plants, sequence data that would enable detailed comparisons of both coding and noncoding regions have been limited in availability. Here we report the generation and analysis of sequences for an unduplicated conserved syntenic segment (CSS) in the genomes of five members of the agriculturally important plant family Solanaceae. This CSS includes a 105-kb region of tomato chromosome 2 and orthologous regions of the potato, eggplant, pepper, and petunia genomes. With a total neutral divergence of 0.73–0.78 substitutions/site, these sequences are similar enough that most noncoding regions can be aligned, yet divergent enough to be informative about evolutionary dynamics and selective pressures. The CSS contains 17 distinct genes with generally conserved order and orientation, but with numerous small-scale differences between species. Our analysis indicates that the last common ancestor of these species lived ∼27–36 million years ago, that more than one-third of short genomic segments (5–15 bp) are under selection, and that more than two-thirds of selected bases fall in noncoding regions. In addition, we identify genes under positive selection and analyze hundreds of conserved noncoding elements. This analysis provides a window into 30 million years of plant evolution in the absence of polyploidization. PMID:18723883

  8. Development of fruit color in Solanaceae: a story of two biosynthetic pathways.

    Science.gov (United States)

    Dhar, Manoj K; Sharma, Rupali; Koul, Archana; Kaul, Sanjana

    2015-05-01

    This review highlights the major differences between the regulation of two important pathways namely anthocyanin and carotenoid pathways, responsible for fruit color generation in Solanaceae mediated by transcription factors (TFs). The anthocyanin pathway is regulated by a common set of TFs (MYB, MYC and WD40) belonging to specific families of DNA-binding proteins. Their regulation is aimed at controlling the type and amount of pigments produced and the physiological conditions (like pH) at which they are finally stored. In the carotenoid pathway, the color diversity depends on the quantity of pigment produced and the point where the pathway is arrested. TFs in the latter case are accordingly found to influence the sequestration and degradation of these pigments, which determines their final concentration in the tissue. TFs (phytochrome interacting factors, MADS-BOX, HB-ZIP and B-ZIP) also regulate important rate-determining steps, which decide the direction in which the pathway proceeds and the point at which it is terminated. In the absence of a clear pattern of TF-mediated regulation, it is suggested that the carotenoid pathway is more significantly influenced by other regulatory methods which need to be explored. It is expected that common factors affecting these pathways are the ones acting much before the initiation of the biosynthesis of respective pigments. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  9. Competition for hummingbird pollination shapes flower color variation in Andean solanaceae.

    Science.gov (United States)

    Muchhala, Nathan; Johnsen, Sönke; Smith, Stacey Dewitt

    2014-08-01

    One classic explanation for the remarkable diversity of flower colors across angiosperms involves evolutionary shifts among different types of pollinators with different color preferences. However, the pollinator shift model fails to account for the many examples of color variation within clades that share the same pollination system. An alternate explanation is the competition model, which suggests that color divergence evolves in response to interspecific competition for pollinators, as a means to decrease interspecific pollinator movements. This model predicts color overdispersion within communities relative to null assemblages. Here, we combine morphometric analyses, field surveys, and models of pollinator vision with a species-level phylogeny to test the competition model in the primarily hummingbird-pollinated clade Iochrominae (Solanaceae). Results show that flower color as perceived by pollinators is significantly overdispersed within sites. This pattern is not simply due to phylogenetic history: phylogenetic community structure does not deviate from random expectations, and flower color lacks phylogenetic signal. Moreover, taxa that occur in sympatry occupy a significantly larger volume of color space than those in allopatry, supporting the hypothesis that competition in sympatry drove the evolution of novel colors. We suggest that competition among close relatives may commonly underlie floral divergence, especially in species-rich habitats where congeners frequently co-occur. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  10. The Chloroplast Genome of Hyoscyamus niger and a Phylogenetic Study of the Tribe Hyoscyameae (Solanaceae)

    Science.gov (United States)

    Sanchez-Puerta, M. Virginia; Abbona, Cinthia Carolina

    2014-01-01

    The tribe Hyoscyameae (Solanaceae) is restricted to Eurasia and includes the genera Archihyoscyamus, Anisodus, Atropa, Atropanthe, Hyoscyamus, Physochlaina, Przewalskia and Scopolia. Even though the monophyly of Hyoscyameae is strongly supported, the relationships of the taxa within the tribe remain unclear. Chloroplast markers have been widely used to elucidate plant relationships at low taxonomic levels. Identification of variable chloroplast intergenic regions has been developed based on comparative genomics of chloroplast genomes, but these regions have a narrow phylogenetic utility. In this study, we present the chloroplast genome sequence of Hyoscyamus niger and make comparisons to other solanaceous plastid genomes in terms of gene order, gene and intron content, editing sites, origins of replication, repeats, and hypothetical open reading frames. We developed and sequenced three variable plastid markers from eight species to elucidate relationships within the tribe Hyoscyameae. The presence of a horizontally transferred intron in the mitochondrial cox1 gene of some species of the tribe is considered here a likely synapomorphy uniting five genera of the Hyoscyameae. Alternatively, the cox1 intron could be a homoplasious character acquired twice within the tribe. A homoplasious inversion in the intergenic plastid spacer trnC-psbM was recognized as a source of bias and removed from the data set used in the phylogenetic analyses. Almost 12 kb of plastid sequence data were not sufficient to completely resolve relationships among genera of Hyoscyameae but some clades were identified. Two alternative hypotheses of the evolution of the genera within the tribe are proposed. PMID:24851862

  11. Callogenesis in root explants of four species of the family Solanaceae after inducing by Agrobacterium rhizogenes

    Directory of Open Access Journals (Sweden)

    Zahra Shakeran

    2015-09-01

    Full Text Available Studying explants affected by Agrobacterium rhizogenes shows that in addition to possible formation of hairy roots, it is likely that callogenesis can be induced in these tissues. The T-DNA region of A. rhizogenes codes enzymes that participate in biosynthesis of plants growth hormones. These hormones also affect callogenesis, hence, the formation of various calluses with different morphological properties are possible. It is very likely that the level of biosynthetic growth hormone, the plasmid carried by each bacteria strain, the position of T-DNA, and the level of gene expression contribute to this morphologic variation. In this study, the root explants of four species of the family Solanaceae namely Atropa belladonna, Datura metel, D. stramonium and Hyoscyamus niger were induced by using different strains of A. rhizogenes (A4, A7, AR15834, AR318, AR9402 and AR9543. Some of these explants entered callus phase and formed various calluses with different colors and shapes. Moreover, in some callus samples hairy roots were also appeared. These variations were probably caused by variations in the levels and ratios of auxin and cytokinine hormons after the induction. As shown in previous studies, the amount of secondary metabolites is reduced due to undifferentiated tissue produced in the callogenesis process.

  12. Content of atropine and scopolamine in poisonous solanaceae plants from Slovenia

    Directory of Open Access Journals (Sweden)

    Javor Kac

    2006-03-01

    Full Text Available Background: Some species from the Solanaceae family are still the cause of serious poisoning among youth in Slovenia. Usually intoxication is due to abuse of these plants to provoke hallucinations. There is still not enough data about the alkaloid content of these plants growing in Slovenia.Methods: Different plant samples were analyzed for the content of atropine and scopolamine with capillary electrophoresis after solid phase extraction of alkaloids. Plants were gathered from different areas of Slovenia between April and September 2004.Results: Results were compared and possible correlations between the alkaloid content and species, plant parts, growth conditions, and time of harvest were suggested. Atropine and scopolamine contents were assessed in deadly nightshade (Atropa belladonna L., thorn apple (Datura stramonium L., scopolia (Scopolia carniolica Jacq. and angel trumpet. The common name angel trumpet is used for Datura inoxia Mill. as well as for different Brugmansia Pers. species. The most intriguing results were the variable alkaloid content in various Brugmansia species and generally great differences in alkaloid content among various plants and their plant parts.Conclusions: All investigated plants have noticeable atropine and/or scopolamine content. The content is variable between various plants and their plant parts and therefore special care should be taken in cases of possible intoxication. It was shown that smaller or greater amounts of ingested drug can cause the same level of intoxication due to the variability in alkaloid content.

  13. A molecular marker for in situ genetic resource conservation of Capsicum annuum var. acuminatum (Solanaceae).

    Science.gov (United States)

    Kaewdoungdee, N; Tanee, T

    2013-02-28

    The Thailand cultivar pepper 'phrik man bangchang' (Capsicum annuum var. acuminatum, Solanaceae) was originally cultivated in the Bangchang Subdistrict, Amphawa District in Samut Songkhram Province. The cultivated areas are limited; we verified its distribution in Thailand for in situ 'phrik man bangchang' genetic resource conservation. Samples were collected from the original cultivation area of Bangchang Subdistrict (Or) and were randomly explored in Ratchaburi Province (RB), Khon Kaen Province (KK), and Sakon Nakhon Province (SN). A pure line from The Tropical Vegetable Research Center at Kasetsart University was used as the standard indicator. Two more Capsicum species, C. chinensis and C. frutescens, and a species from another genus in the family, Solanum melongena, were included. A dendrogram constructed from random amplified polymorphic DNA fingerprints indicated that the Or, RB, KK, and SN samples were C. annuum var. acuminatum with supportive similarity coefficients of 0.79 to 0.98. Finally, DNA barcodes, from psbA-trnH spacer region, were provided for the 3 wild species, C. annuum var. acuminatum, C. chinensis, and C. frutescens under GenBank accession Nos. JQ087869-JQ087871. The nucleotide variations between species were 0.23 to 0.26. In summary, 'phrik man bangchang' is still being planted in Bangchang Subdistrict, but only in small areas. The distribution of planting areas is expected to be throughout Thailand.

  14. Separation of four flavonol glycosides from Solanum rostratum Dunal using aqueous two-phase flotation followed by preparative high-performance liquid chromatography.

    Science.gov (United States)

    Chang, Lin; Shao, Qian; Xi, Xingjun; Chu, Qiao; Wei, Yun

    2017-02-01

    Aqueous two-phase flotation followed by preparative high-performance liquid chromatography was used to separate four flavonol glycosides from Solanum rostratum Dunal. In the aqueous two-phase flotation section, the effects of sublation solvent, solution pH, (NH4 )2 SO4 concentration in aqueous solution, cosolvent, N2 flow rate, flotation time, and volumes of the polyethylene glycol phase on the recovery were investigated in detail, and the optimal conditions were selected: 50 wt% polyethylene glycol 1000 ethanol solvent as the flotation solvent, pH 4, 350 g/L of (NH4 )2 SO4 concentration in aqueous phase, 40 mL/min of N2 flow rate, 30 min of flotation time, 10.0 mL of flotation solvent volume, and two times. After aqueous two-phase flotation concentration, the flotation products were purified by preparative high-performance liquid chromatography. The purities of the final products A and B were 98.1 and 99.0%. Product B was the mixture of three compounds based on the analysis of high-performance liquid chromatography at the temperature of 10°C, while product A was hyperoside after the identification by nuclear magnetic resonance. Astragalin, 3'-O-methylquercetin 3-O-β-d-galactopyranoside, and 3'-O-methylquercetin 3-O-β-d-glucopyranoside were obtained with the purity of 93.8, 97.1, and 99.2%, respectively, after the further separation of product B using preparative high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Functional and Morphological Correlates in the Drosophila LRRK2 loss-of-function Model of Parkinson's Disease: Drug Effects of Withania somnifera (Dunal) Administration.

    Science.gov (United States)

    De Rose, Francescaelena; Marotta, Roberto; Poddighe, Simone; Talani, Giuseppe; Catelani, Tiziano; Setzu, Maria Dolores; Solla, Paolo; Marrosu, Francesco; Sanna, Enrico; Kasture, Sanjay; Acquas, Elio; Liscia, Anna

    2016-01-01

    The common fruit fly Drosophila melanogaster (Dm) is a simple animal species that contributed significantly to the development of neurobiology whose leucine-rich repeat kinase 2 mutants (LRRK2) loss-of-function in the WD40 domain represent a very interesting tool to look into physiopathology of Parkinson's disease (PD). Accordingly, LRRK2 Dm have also the potential to contribute to reveal innovative therapeutic approaches to its treatment. Withania somnifera Dunal, a plant that grows spontaneously also in Mediterranean regions, is known in folk medicine for its anti-inflammatory and protective properties against neurodegeneration. The aim of this study was to evaluate the neuroprotective effects of its standardized root methanolic extract (Wse) on the LRRK2 loss-of-function Dm model of PD. To this end mutant and wild type (WT) flies were administered Wse, through diet, at different concentrations as larvae and adults (L+/A+) or as adults (L-/A+) only. LRRK2 mutants have a significantly reduced lifespan and compromised motor function and mitochondrial morphology compared to WT flies 1% Wse-enriched diet, administered to Dm LRRK2 as L-/A+and improved a) locomotor activity b) muscle electrophysiological response to stimuli and also c) protected against mitochondria degeneration. In contrast, the administration of Wse to Dm LRRK2 as L+/A+, no matter at which concentration, worsened lifespan and determined the appearance of increased endosomal activity in the thoracic ganglia. These results, while confirming that the LRRK2 loss-of-function in the WD40 domain represents a valid model of PD, reveal that under appropriate concentrations Wse can be usefully employed to counteract some deficits associated with the disease. However, a careful assessment of the risks, likely related to the impaired endosomal activity, is required.

  16. The standardized Withania somnifera Dunal root extract alters basal and morphine-induced opioid receptor gene expression changes in neuroblastoma cells.

    Science.gov (United States)

    Caputi, Francesca Felicia; Acquas, Elio; Kasture, Sanjay; Ruiu, Stefania; Candeletti, Sanzio; Romualdi, Patrizia

    2018-01-10

    Behavioral studies demonstrated that the administration of Withania somnifera Dunal roots extract (WSE), prolongs morphine-elicited analgesia and reduces the development of tolerance to the morphine's analgesic effect; however, little is known about the underpinning molecular mechanism(s). In order to shed light on this issue in the present paper we explored whether WSE promotes alterations of μ (MOP) and nociceptin (NOP) opioid receptors gene expression in neuroblastoma SH-SY5Y cells. A range of WSE concentrations was preliminarily tested to evaluate their effects on cell viability. Subsequently, the effects of 5 h exposure to WSE (0.25, 0.50 and 1.00 mg/ml), applied alone and in combination with morphine or naloxone, on MOP and NOP mRNA levels were investigated. Data analysis revealed that morphine decreased MOP and NOP receptor gene expression, whereas naloxone elicited their up-regulation. In addition, pre-treatment with naloxone prevented the morphine-elicited gene expression alterations. Interestingly, WSE was able to: a) alter MOP but not NOP gene expression; b) counteract, at its highest concentration, morphine-induced MOP down-regulation, and c) hamper naloxone-induced MOP and NOP up-regulation. Present in-vitro data disclose novel evidence about the ability of WSE to influence MOP and NOP opioid receptors gene expression in SH-SY5Y cells. Moreover, our findings suggest that the in-vivo modulation of morphine-mediated analgesia by WSE could be related to the hindering of morphine-elicited opioid receptors down-regulation here observed following WSE pre-treatment at its highest concentration.

  17. Functional and Morphological Correlates in the Drosophila LRRK2 loss-of-function Model of Parkinson’s Disease: Drug Effects of Withania somnifera (Dunal) Administration

    Science.gov (United States)

    Catelani, Tiziano; Setzu, Maria Dolores; Solla, Paolo; Marrosu, Francesco; Sanna, Enrico; Kasture, Sanjay; Acquas, Elio

    2016-01-01

    The common fruit fly Drosophila melanogaster (Dm) is a simple animal species that contributed significantly to the development of neurobiology whose leucine-rich repeat kinase 2 mutants (LRRK2) loss-of-function in the WD40 domain represent a very interesting tool to look into physiopathology of Parkinson’s disease (PD). Accordingly, LRRK2 Dm have also the potential to contribute to reveal innovative therapeutic approaches to its treatment. Withania somnifera Dunal, a plant that grows spontaneously also in Mediterranean regions, is known in folk medicine for its anti-inflammatory and protective properties against neurodegeneration. The aim of this study was to evaluate the neuroprotective effects of its standardized root methanolic extract (Wse) on the LRRK2 loss-of-function Dm model of PD. To this end mutant and wild type (WT) flies were administered Wse, through diet, at different concentrations as larvae and adults (L+/A+) or as adults (L-/A+) only. LRRK2 mutants have a significantly reduced lifespan and compromised motor function and mitochondrial morphology compared to WT flies 1% Wse-enriched diet, administered to Dm LRRK2 as L-/A+and improved a) locomotor activity b) muscle electrophysiological response to stimuli and also c) protected against mitochondria degeneration. In contrast, the administration of Wse to Dm LRRK2 as L+/A+, no matter at which concentration, worsened lifespan and determined the appearance of increased endosomal activity in the thoracic ganglia. These results, while confirming that the LRRK2 loss-of-function in the WD40 domain represents a valid model of PD, reveal that under appropriate concentrations Wse can be usefully employed to counteract some deficits associated with the disease. However, a careful assessment of the risks, likely related to the impaired endosomal activity, is required. PMID:26727265

  18. Functional and Morphological Correlates in the Drosophila LRRK2 loss-of-function Model of Parkinson's Disease: Drug Effects of Withania somnifera (Dunal Administration.

    Directory of Open Access Journals (Sweden)

    Francescaelena De Rose

    Full Text Available The common fruit fly Drosophila melanogaster (Dm is a simple animal species that contributed significantly to the development of neurobiology whose leucine-rich repeat kinase 2 mutants (LRRK2 loss-of-function in the WD40 domain represent a very interesting tool to look into physiopathology of Parkinson's disease (PD. Accordingly, LRRK2 Dm have also the potential to contribute to reveal innovative therapeutic approaches to its treatment. Withania somnifera Dunal, a plant that grows spontaneously also in Mediterranean regions, is known in folk medicine for its anti-inflammatory and protective properties against neurodegeneration. The aim of this study was to evaluate the neuroprotective effects of its standardized root methanolic extract (Wse on the LRRK2 loss-of-function Dm model of PD. To this end mutant and wild type (WT flies were administered Wse, through diet, at different concentrations as larvae and adults (L+/A+ or as adults (L-/A+ only. LRRK2 mutants have a significantly reduced lifespan and compromised motor function and mitochondrial morphology compared to WT flies 1% Wse-enriched diet, administered to Dm LRRK2 as L-/A+and improved a locomotor activity b muscle electrophysiological response to stimuli and also c protected against mitochondria degeneration. In contrast, the administration of Wse to Dm LRRK2 as L+/A+, no matter at which concentration, worsened lifespan and determined the appearance of increased endosomal activity in the thoracic ganglia. These results, while confirming that the LRRK2 loss-of-function in the WD40 domain represents a valid model of PD, reveal that under appropriate concentrations Wse can be usefully employed to counteract some deficits associated with the disease. However, a careful assessment of the risks, likely related to the impaired endosomal activity, is required.

  19. EVALUACIÓN DE DENSIDADES DE SIEMBRA EN Solanum sessiliflorum dunal “COCONA” Y SU EFECTO EN EL RENDIMIENTO DE FRUTO

    Directory of Open Access Journals (Sweden)

    Rodrigo Gonzáles Vega

    2012-12-01

    Full Text Available La cocona es una especie vegetal nativa de América Tropical, cuyos frutos maduros son ricos en hierro, vitamina B5 (Niacina, se utilizan en la preparación de jugos, refrescos, jarabes y ensaladas. El estudio se realizó en el Campo Experimental “El Dorado” de Estación Experimental San Roque, del INIA Loreto con el objetivo principal de determinar el mejor distanciamiento para establecer plantaciones comerciales de Solanum sessiliflorum dunal “Cocona”, en condiciones de suelos no inundables o de altura. Se evaluaron cuatro densidades de siembra 2,0m x 2,0m; 1,5m x 1,5m, 2,0m x 1,0 y 1,5m x 1,0m. Las variables evaluadas fueron el número de frutos, peso de frutos y rendimiento de frutos por cada tratamiento en estudio, el diseño experimental utilizado fue Bloques Completos al Azar (DBCA, con cuatro repeticiones, los datos fueron analizados mediante el Análisis de Variancia y Prueba Estadística de Tukey, usando el software SPSS, versión 10. De los resultados Obtenidos se determinó que la densidad 1,5m x 1,0m (6 666 plantas/ha, produjo el mejor rendimiento con 14 600 kg/ha de fruto, superando significativamente a los tratamientos 2m x 1,0, 1,5m x 1,5m y 2,0 x 2,0m, que alcanzaron rendimientos de fruto de 12020, 11 330 y 10 570 kg/ha, respectivamente. Se concluye que la densidad de siembra influye en el rendimiento de fruto, así a menor número de plantas, mayor número y peso de fruto por planta se obtiene un menor rendimiento de fruto/ha.

  20. Anti-diabetic effect of Xylopia aethiopica (Dunal) A. Rich. (Annonaceae) fruit acetone fraction in a type 2 diabetes model of rats.

    Science.gov (United States)

    Mohammed, Aminu; Koorbanally, Neil Anthony; Islam, Md Shahidul

    2016-03-02

    In traditional medicine from West Africa, the fruit decoction of Xylopia aethiopica (Dunal) A. Rich. is widely used for the treatment of diabetes mellitus (DM) either alone or in combination with other plants. The present study is designed to investigate the anti-diabetic effects of X. aethiopica acetone fraction (XAAF) from fruit ethanolic extract in a type 2 diabetes (T2D) model of rats. T2D was induced in rats by feeding a 10% fructose solution ad libitum for 2 weeks followed by a single intraperitoneal injection of streptozotocin (40 mg/kg body weight) and the animals were orally treated with 150 or 300 mg/kg body weight (bw) of the XAAF once daily for four weeks. After 4 weeks study period, diabetic untreated animals (DBC) exhibited significantly higher serum glucose, serum fructosamine, LDH, CK-MB, serum lipids, liver glycogen, insulin resistance (HOMA-IR), AI, CRI and lower serum insulin, β-cell function (HOMA-β) and glucose tolerance ability compared to the normal animals. Histopathological examination of their pancreas revealed corresponding pathological changes in the islets and β-cells. These alterations were reverted to near-normal after the treatment of XAAF at 150 (DXAL) and 300 (DXAH) mg/kg bw with the effects being more pronounced in the DXAH group compared to the DXAL group. Moreover, the effects in the animals of DXAH group were comparable to the diabetic metformin (DMF) treated animals. In addition, no significant alterations were observed in non-diabetic animals treated with 300 mg/kg bw of XAAF (NXAH). The results of our study suggest that XAAF treatment showed excellent anti-diabetic effects in a T2D model of rats. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species.

    Science.gov (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu

    2017-05-05

    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  2. Multiple recent horizontal transfers of the cox1 intron in Solanaceae and extended co-conversion of flanking exons.

    Science.gov (United States)

    Sanchez-Puerta, Maria V; Abbona, Cinthia C; Zhuo, Shi; Tepe, Eric J; Bohs, Lynn; Olmstead, Richard G; Palmer, Jeffrey D

    2011-09-27

    The most frequent case of horizontal transfer in plants involves a group I intron in the mitochondrial gene cox1, which has been acquired via some 80 separate plant-to-plant transfer events among 833 diverse angiosperms examined. This homing intron encodes an endonuclease thought to promote the intron's promiscuous behavior. A promising experimental approach to study endonuclease activity and intron transmission involves somatic cell hybridization, which in plants leads to mitochondrial fusion and genome recombination. However, the cox1 intron has not yet been found in the ideal group for plant somatic genetics - the Solanaceae. We therefore undertook an extensive survey of this family to find members with the intron and to learn more about the evolutionary history of this exceptionally mobile genetic element. Although 409 of the 426 species of Solanaceae examined lack the cox1 intron, it is uniformly present in three phylogenetically disjunct clades. Despite strong overall incongruence of cox1 intron phylogeny with angiosperm phylogeny, two of these clades possess nearly identical intron sequences and are monophyletic in intron phylogeny. These two clades, and possibly the third also, contain a co-conversion tract (CCT) downstream of the intron that is extended relative to all previously recognized CCTs in angiosperm cox1. Re-examination of all published cox1 genes uncovered additional cases of extended co-conversion and identified a rare case of putative intron loss, accompanied by full retention of the CCT. We infer that the cox1 intron was separately and recently acquired by at least three different lineages of Solanaceae. The striking identity of the intron and CCT from two of these lineages suggests that one of these three intron captures may have occurred by a within-family transfer event. This is consistent with previous evidence that horizontal transfer in plants is biased towards phylogenetically local events. The discovery of extended co

  3. Flora da Paraíba, Brasil: Combretaceae Flora of Paraíba, Brazil: Solanum L., Solanaceae

    Directory of Open Access Journals (Sweden)

    Maria Iracema Bezerra Loiola

    2009-06-01

    Full Text Available Apresenta-se o tratamento taxonômico da família Combretaceae como parte do projeto "Flora da Paraíba", que vem sendo realizado com o objetivo de identificar e catalogar as espécies da flora local. As identificações, descrições e ilustrações botânicas foram efetuadas pela análise morfológica de amostras frescas e espécimes herborizados, com o auxílio da bibliografia e análise de tipos, complementadas pelas observações de campo. Foram registradas 11 espécies subordinadas a cinco gêneros: Buchenavia (1, Combretum (8, Conocarpus (1 e Laguncularia (1. Algumas espécies possuem distribuição restrita aos manguezais, como Conocarpus erectus L. e Laguncularia racemosa (L. C.F. Gaertn., à Caatinga, como Combretum glaucocarpum Mart., C. leprosum Mart. e C. hilarianum D. Dietr., e a Floresta Atlântica, como Buchenavia tetraphylla (Aubl. R.A. Howard, Combretum fruticosum (Loefl. Stuntz e C. laxum Jacq.This taxonomic treatment of the genus Solanum is part of the "Flora da Paraíba" project which aims to identify and catalogue the species of the local flora. Botanical collections, field observations and morphological studies were done for identification, description and botanical illustration of the plant species, also supported by the literature and analysis of Brazilian and foreign herbaria, plus specimens from EAN and JPB herbaria. Twenty two species of Solanum were recorded in the state of Paraíba: Solanum agrarium Sendtn., S. americanum Mill., S. asperum Rich., S. asterophorum Mart., S. caavurana Vell., S. capsicoides All., S. crinitum Lam., S. jabrense Agra & M.Nee, S. melissarum Bohs, S. ovum-fringillae (Dunal Bohs, S. palinacanthum Dunal, S. paludosum Moric., S. paniculatum L., S. paraibanum Agra, S. polytrichum Moric., S. rhytidoandrum Sendtn., Solanum sp., S. stagnale Moric., S. stipulaceum Roem. & Schult., S. stramoniifolium Jacq., S. swartzianum Roem. & Schult. and S. torvum Sw. Three species are new records for Paraíba: S

  4. The historical role of species from the Solanaceae plant family in genetic research.

    Science.gov (United States)

    Gebhardt, Christiane

    2016-12-01

    This article evaluates the main contributions of tomato, tobacco, petunia, potato, pepper and eggplant to classical and molecular plant genetics and genomics since the beginning of the twentieth century. Species from the Solanaceae family form integral parts of human civilizations as food sources and drugs since thousands of years, and, more recently, as ornamentals. Some Solanaceous species were subjects of classical and molecular genetic research over the last 100 years. The tomato was one of the principal models in twentieth century classical genetics and a pacemaker of genome analysis in plants including molecular linkage maps, positional cloning of disease resistance genes and quantitative trait loci (QTL). Besides that, tomato is the model for the genetics of fruit development and composition. Tobacco was the major model used to establish the principals and methods of plant somatic cell genetics including in vitro propagation of cells and tissues, totipotency of somatic cells, doubled haploid production and genetic transformation. Petunia was a model for elucidating the biochemical and genetic basis of flower color and development. The cultivated potato is the economically most important Solanaceous plant and ranks third after wheat and rice as one of the world's great food crops. Potato is the model for studying the genetic basis of tuber development. Molecular genetics and genomics of potato, in particular association genetics, made valuable contributions to the genetic dissection of complex agronomic traits and the development of diagnostic markers for breeding applications. Pepper and eggplant are horticultural crops of worldwide relevance. Genetic and genomic research in pepper and eggplant mostly followed the tomato model. Comparative genome analysis of tomato, potato, pepper and eggplant contributed to the understanding of plant genome evolution.

  5. Inter-species grafting caused extensive and heritable alterations of DNA methylation in Solanaceae plants.

    Science.gov (United States)

    Wu, Rui; Wang, Xiaoran; Lin, Yan; Ma, Yiqiao; Liu, Gang; Yu, Xiaoming; Zhong, Silin; Liu, Bao

    2013-01-01

    Grafting has been extensively used to enhance the performance of horticultural crops. Since Charles Darwin coined the term "graft hybrid" meaning that asexual combination of different plant species may generate products that are genetically distinct, highly discrepant opinions exist supporting or against the concept. Recent studies have documented that grafting enables exchanges of both RNA and DNA molecules between the grafting partners, thus providing a molecular basis for grafting-induced genetic variation. DNA methylation is known as prone to alterations as a result of perturbation of internal and external conditions. Given characteristics of grafting, it is interesting to test whether the process may cause an alteration of this epigenetic marker in the grafted organismal products. We analyzed relative global DNA methylation levels and locus-specific methylation patterns by the MSAP marker and locus-specific bisulfite-sequencing in the seed plants (wild-type controls), self- and hetero-grafted scions/rootstocks, selfed progenies of scions and their seed-plant controls, involving three Solanaceae species. We quantified expression of putative genes involved in establishing and/or maintaining DNA methylation by q-(RT)-PCR. We found that (1) hetero-grafting caused extensive alteration of DNA methylation patterns in a locus-specific manner, especially in scions, although relative methylation levels remain largely unaltered; (2) the altered methylation patterns in the hetero-grafting-derived scions could be inherited to sexual progenies with some sites showing further alterations or revisions; (3) hetero-grafting caused dynamic changes in steady-state transcript abundance of genes encoding for a set of enzymes functionally relevant to DNA methylation. Our results demonstrate that inter-species grafting in plants could produce extensive and heritable alterations in DNA methylation. We suggest that these readily altered, yet heritable, epigenetic modifications due to

  6. The effect of polyploidy and hybridization on the evolution of floral colour in Nicotiana (Solanaceae).

    Science.gov (United States)

    McCarthy, Elizabeth W; Arnold, Sarah E J; Chittka, Lars; Le Comber, Steven C; Verity, Robert; Dodsworth, Steven; Knapp, Sandra; Kelly, Laura J; Chase, Mark W; Baldwin, Ian T; Kovařík, Aleš; Mhiri, Corinne; Taylor, Lin; Leitch, Andrew R

    2015-06-01

    Speciation in angiosperms can be accompanied by changes in floral colour that may influence pollinator preference and reproductive isolation. This study investigates whether changes in floral colour can accompany polyploid and homoploid hybridization, important processes in angiosperm evolution. Spectral reflectance of corolla tissue was examined for 60 Nicotiana (Solanaceae) accessions (41 taxa) based on spectral shape (corresponding to pigmentation) as well as bee and hummingbird colour perception in order to assess patterns of floral colour evolution. Polyploid and homoploid hybrid spectra were compared with those of their progenitors to evaluate whether hybridization has resulted in floral colour shifts. Floral colour categories in Nicotiana seem to have arisen multiple times independently during the evolution of the genus. Most younger polyploids displayed an unexpected floral colour, considering those of their progenitors, in the colour perception of at least one pollinator type, whereas older polyploids tended to resemble one or both of their progenitors. Floral colour evolution in Nicotiana is weakly constrained by phylogeny, and colour shifts do occur in association with both polyploid and homoploid hybrid divergence. Transgressive floral colour in N. tabacum has arisen by inheritance of anthocyanin pigmentation from its paternal progenitor while having a plastid phenotype like its maternal progenitor. Potentially, floral colour evolution has been driven by, or resulted in, pollinator shifts. However, those polyploids that are not sympatric (on a regional scale) with their progenitor lineages are typically not divergent in floral colour from them, perhaps because of a lack of competition for pollinators. © The Author 2015. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes.

    Science.gov (United States)

    Daniell, Henry; Lee, Seung-Bum; Grevich, Justin; Saski, Christopher; Quesada-Vargas, Tania; Guda, Chittibabu; Tomkins, Jeffrey; Jansen, Robert K

    2006-05-01

    Despite the agricultural importance of both potato and tomato, very little is known about their chloroplast genomes. Analysis of the complete sequences of tomato, potato, tobacco, and Atropa chloroplast genomes reveals significant insertions and deletions within certain coding regions or regulatory sequences (e.g., deletion of repeated sequences within 16S rRNA, ycf2 or ribosomal binding sites in ycf2). RNA, photosynthesis, and atp synthase genes are the least divergent and the most divergent genes are clpP, cemA, ccsA, and matK. Repeat analyses identified 33-45 direct and inverted repeats >or=30 bp with a sequence identity of at least 90%; all but five of the repeats shared by all four Solanaceae genomes are located in the same genes or intergenic regions, suggesting a functional role. A comprehensive genome-wide analysis of all coding sequences and intergenic spacer regions was done for the first time in chloroplast genomes. Only four spacer regions are fully conserved (100% sequence identity) among all genomes; deletions or insertions within some intergenic spacer regions result in less than 25% sequence identity, underscoring the importance of choosing appropriate intergenic spacers for plastid transformation and providing valuable new information for phylogenetic utility of the chloroplast intergenic spacer regions. Comparison of coding sequences with expressed sequence tags showed considerable amount of variation, resulting in amino acid changes; none of the C-to-U conversions observed in potato and tomato were conserved in tobacco and Atropa. It is possible that there has been a loss of conserved editing sites in potato and tomato.

  8. Hidden variability of floral homeotic B genes in Solanaceae provides a molecular basis for the evolution of novel functions.

    Science.gov (United States)

    Geuten, Koen; Irish, Vivian

    2010-08-01

    B-class MADS box genes specify petal and stamen identities in several core eudicot species. Members of the Solanaceae possess duplicate copies of these genes, allowing for diversification of function. To examine the changing roles of such duplicate orthologs, we assessed the functions of B-class genes in Nicotiana benthamiana and tomato (Solanum lycopersicum) using virus-induced gene silencing and RNA interference approaches. Loss of function of individual duplicates can have distinct phenotypes, yet complete loss of B-class gene function results in extreme homeotic transformations of petal and stamen identities. We also show that these duplicate gene products have qualitatively different protein-protein interaction capabilities and different regulatory roles. Thus, compensatory changes in B-class MADS box gene duplicate function have occurred in the Solanaceae, in that individual gene roles are distinct, but their combined functions are equivalent. Furthermore, we show that species-specific differences in the stamen regulatory network are associated with differences in the expression of the microRNA miR169. Whereas there is considerable plasticity in individual B-class MADS box transcription factor function, there is overall conservation in the roles of the multimeric MADS box B-class protein complexes, providing robustness in the specification of petal and stamen identities. Such hidden variability in gene function as we observe for individual B-class genes can provide a molecular basis for the evolution of regulatory functions that result in novel morphologies.

  9. Dramatic Number Variation of R Genes in Solanaceae Species Accounted for by a Few R Gene Subfamilies.

    Science.gov (United States)

    Wei, Chunhua; Chen, Jiongjiong; Kuang, Hanhui

    2016-01-01

    Most disease resistance genes encode nucleotide-binding-site (NBS) and leucine-rich-repeat (LRR) domains, and the NBS-LRR encoding genes are often referred to as R genes. Using newly developed approach, 478, 485, 1,194, 1,665, 2,042 and 374 R genes were identified from the genomes of tomato Heinz1706, wild tomato LA716, potato DM1-3, pepper Zunla-1 and wild pepper Chiltepin and tobacco TN90, respectively. The majority of R genes from Solanaceae were grouped into 87 subfamilies, including 16 TIR-NBS-LRR (TNL) and 71 non-TNL subfamilies. Each subfamily was annotated manually, including identification of intron/exon structure and intron phase. Interestingly, TNL subfamilies have similar intron phase patterns, while the non-TNL subfamilies have diverse intron phase due to frequent gain of introns. Prevalent presence/absence polymorphic R gene loci were found among Solanaceae species, and an integrated map with 427 R loci was constructed. The pepper genome (2,042 in Chiltepin) has at least four times of R genes as in tomato (478 in Heinz1706). The high number of R genes in pepper genome is due to the amplification of R genes in a few subfamilies, such as the Rpi-blb2 and BS2 subfamilies. The mechanism underlying the variation of R gene number among different plant genomes is discussed.

  10. Identification of miniature inverted-repeat transposable elements (MITEs) and biogenesis of their siRNAs in the Solanaceae: new functional implications for MITEs.

    Science.gov (United States)

    Kuang, Hanhui; Padmanabhan, Chellappan; Li, Feng; Kamei, Ayako; Bhaskar, Pudota B; Ouyang, Shu; Jiang, Jiming; Buell, C Robin; Baker, Barbara

    2009-01-01

    Small RNAs regulate the genome by guiding transcriptional and post-transcriptional silencing machinery to specific target sequences, including genes and transposable elements (TEs). Although miniature inverted-repeat transposable elements (MITEs) are closely associated with euchromatic genes, the broader functional impact of these short TE insertions in genes is largely unknown. We identified 22 families of MITEs in the Solanaceae (MiS1-MiS22) and found abundant MiS insertions in Solanaceae genomic DNA and expressed sequence tags (EST). Several Solanaceae MITEs generate genome changes that potentially affect gene function and regulation, most notably, a MiS insertion that provides a functionally indispensable alternative exon in the tobacco mosaic virus N resistance gene. We show that MITEs generate small RNAs that are primarily 24 nt in length, as detected by Northern blot hybridization and by sequencing small RNAs of Solanum demissum, Nicotiana glutinosa, and Nicotiana benthamiana. Additionally, we show that stable RNAi lines silencing DICER-LIKE3 (DCL3) in tobacco and RNA-dependent RNA polymerase 2 (RDR2) in potato cause a reduction in 24-nt MITE siRNAs, suggesting that, as in Arabidopsis, TE-derived siRNA biogenesis is DCL3 and RDR2 dependent. We provide evidence that DICER-LIKE4 (DCL4) may also play a role in MITE siRNA generation in the Solanaceae.

  11. Report of a Working Group on Solanaceae : first meeting of the Working group and ad hoc meeting of the database managers, 14-17 Februari 2012, Menemen, Turkey

    NARCIS (Netherlands)

    Dooijeweert, van W.; Maggioni, L.; Daunay, M.C.; Lipman, E.

    2012-01-01

    The Solanaceae Working Group (WG) of the European Cooperative Programme for Plant Genetic Resources (ECPGR) has established six databases for the crops that form its mandate. These include three major crops (Eggplant, Pepper and Tomato) and three minor crops (Cyphomandra, Pepino and Physalis). The

  12. Screening of non-tuber bearing Solanaceae for resistance to and induction of juvenile hatch of potato cyst nematodes and their potential for trap cropping

    NARCIS (Netherlands)

    Scholte, K.

    2000-01-01

    Ninety accessions of non-tuber bearing Solanaceae were screened for (i) resistance to and (ii) stimulatory effect on juvenile hatch of potato cyst nematodes, and (iii) their growth under temperate climatic conditions. All plant species belonging to the genus Solanum tested induced hatching but this

  13. Tuber resistance and slow rotting characteristics of potato clones associated with the Solanaceae Coordinated Agricultural Project to the US-24 clonal lineage of Phytophthora infestans

    Science.gov (United States)

    Late blight, caused by Phytophthora infestans, is a devastating disease on potato worldwide and new lineages of the pathogen continue to develop in the U.S. Breeding for resistance is important for economic and environmental purposes. The Solanaceae Coordinated Agricultural Project (SolCAP) focuses ...

  14. Association of potato psyllid (Bactericera cockerelli; Hemiptera: Triozidae) with Lycium spp. (Solanaceae) in potato growing regions of Washington, Idaho, and Oregon

    Science.gov (United States)

    Potato psyllid, Bactericera cockerelli (Šulc), is a vector of the bacterium that causes zebra chip disease of potato (Solanum tuberosum L.). When cultivated crops are not available, potato psyllid may often be found on non-crop hosts within the Solanaceae. This study determined that species of Lyci...

  15. phytochemical and antimicrobial properties of solanum macranthum ...

    African Journals Online (AJOL)

    MR J.O. OLAYEMI

    Key words: Solanum macranthum, Solanaceae, antimicrobial activity, phytochemical screening. INTRODUCTION. Solanum species (family: Solanaceae) comprises of. 1,700 species which are commonly found in the temperate and tropical regions of the world. Solanum macranthum Dunal (Syn. Solanum wrightii Benth) or.

  16. Comparative anti-inflammatory properties of Capsaicin and ethyl-aAcetate extract of Capsicum frutescens linn [Solanaceae] in rats.

    Science.gov (United States)

    Jolayemi, A T; Ojewole, J A O

    2013-06-01

    The analgesic effect of capsaicin (the active ingredient in Capsicum frutescens Linn. [Solanaceae]) had been reported in several studies. Current research is being directed at producing analgesics, anti-inflammatory agents with better side effect profile. To investigate if either the ethyl acetate extract of Capsicum frutescens Linn. [Solanaceae] (CFE) or capsaicin (Fluka Biotechnika-CPF) (in addition to the known analgesic properties) has any anti-inflammatory effect comparable to nonsteroidal anti-inflammatory analgesics (NSAIDS). The effects of ethyl acetate extract of Capsicum frutescens Linn. [Solanaceae] (CFE) and capsaicin (Fluka Biotechnika-CPF) was examined on rat hind paw. Inflammation was induced in the rat's hind paw by subplantar injections of fresh egg albumin (0.5 ml/kg). Diclofenac (100 mg/kg) was used as the reference anti-inflammatory agent for comparison, while distilled water was used as the placebo. The leucocytes count, corticosterone and C - reactive protein (CRP) levels were measured as biomarkers of inflammation. Data obtained were pooled and analysed using repeated ANOVA, in a general linear model with the CPSS software. Sub-plantar injections of fresh egg albumin (0.5 ml/kg) produced profound and time-related oedema in the rat hind paw of the 'control' rats. Diclofenac (DIC, 100 mg/kg, i.p.) and reference capsaicin (CPF, 2.5 mg/kg, i.p.) significantly inhibited paw swelling at (p<0.05-0.001) (CI 95%) compared to distilled water-treated 'controls'. While the corticosterone levels were all very low in 7 rats treated with capsaicin, the leucocytes count was within normal range in 9 rats. However, in 16 specimens randomly assigned for CRP levels, there were very high CRP readings, up to a magnitude of 10 times the normal range. Capsaicin in both forms (CFE and CPF) produced anti-inflammatory effects that were comparable to diclofenac in the experimental rat model at p<0.05. It may be concluded that capsaicin has both analgesic and anti

  17. Pollen morphology and study of the visitors (Hymenoptera, Apidae of Solanum stramoniifolium Jacq. (Solanaceae in Central Amazon Morfologia polínica e estudo dos visitantes (Hymenoptera, Apidae de Solanum stramoniifolium Jacq. (Solanaceae na Amazônia Central

    Directory of Open Access Journals (Sweden)

    Alexandre Coletto da Silva

    2004-09-01

    Full Text Available The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The pollen of S. stramoniifolium is tricolporate and psilate or without ornamentation. In a word, S. stramoniifolium constitutes a potential source of pollen for different species of bees with and without sting, providing an interesting field for germination studies, insect-plant interactions and floral biology that are already under way.A família Solanaceae tem ampla distribuição, principalmente nas áreas tropicais e subtropicais da América do Sul. Solanum L. é um dos mais importantes gêneros desta família com aproximadamente 1.200 espécies. O objetivo deste trabalho foi o de estudar a biologia floral com enfoque na morfologia polínica e no registro de algumas abelhas visitantes de S. stramoniifolium. Dados preliminares indicam a presença de uma espécie de abelha com ferrão e quatro espécies sem ferrão como visitantes de S. stramoniifolium. O pólen de S. stramoniifolium é tricolporado e psilado, ou seja, sem ornamentação. Conclui-se, após o estudo da biologia floral, que S. stramoniifolium constitui fonte potencial de pólen para diferentes espécies de abelhas com e sem ferrão, representando interessante campo para estudos de germinação, interações inseto-planta e biologia floral.

  18. A new proteinaceous pathogen-associated molecular pattern (PAMP) identified in Ascomycete fungi induces cell death in Solanaceae.

    Science.gov (United States)

    Franco-Orozco, Barbara; Berepiki, Adokiye; Ruiz, Olaya; Gamble, Louise; Griffe, Lucie L; Wang, Shumei; Birch, Paul R J; Kanyuka, Kostya; Avrova, Anna

    2017-06-01

    Pathogen-associated molecular patterns (PAMPs) are detected by plant pattern recognition receptors (PRRs), which gives rise to PAMP-triggered immunity (PTI). We characterized a novel fungal PAMP, Cell Death Inducing 1 (RcCDI1), identified in the Rhynchosporium commune transcriptome sampled at an early stage of barley (Hordeum vulgare) infection. The ability of RcCDI1 and its homologues from different fungal species to induce cell death in Nicotiana benthamiana was tested following agroinfiltration or infiltration of recombinant proteins produced by Pichia pastoris. Virus-induced gene silencing (VIGS) and transient expression of Phytophthora infestans effectors PiAVR3a and PexRD2 were used to assess the involvement of known components of PTI in N. benthamiana responses to RcCDI1. RcCDI1 was highly upregulated early during barley colonization with R. commune. RcCDI1 and its homologues from different fungal species, including Zymoseptoria tritici, Magnaporthe oryzae and Neurospora crassa, exhibited PAMP activity, inducing cell death in Solanaceae but not in other families of dicots or monocots. RcCDI1-triggered cell death was shown to require N. benthamiana Brassinosteroid insensitive 1-Associated Kinase 1 (NbBAK1), N. benthamiana suppressor of BIR1-1 (NbSOBIR1) and N. benthamiana SGT1 (NbSGT1), but was not suppressed by PiAVR3a or PexRD2. We report the identification of a novel Ascomycete PAMP, RcCDI1, recognized by Solanaceae but not by monocots, which activates cell death through a pathway that is distinct from that triggered by the oomycete PAMP INF1. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  19. Intoxicação natural e experimental por Metternichia princeps (Solanaceae em caprinos

    Directory of Open Access Journals (Sweden)

    Juliana da Silva Prado

    2012-09-01

    Full Text Available Entre os anos de 2007 e 2009 ocorreu uma doença nefrotóxica de evolução subaguda com alta mortandade em caprinos em uma propriedade no município de Itaguaí, estado do Rio de Janeiro. Levantou-se a suspeita de que Metternichia princeps, planta pertencente à família Solanaceae, seria a causa. Através de experimentação em caprinos o quadro clínico-patológico de intoxicação por esta planta e a dose letal foram estabelecidos. Na experimentação foram utilizados 12 caprinos de diferentes raças, de ambos os sexos, jovens a adultos, com pesos acima de 15 kg. Os animais que receberam as doses de 30g/kg em 5 dias, 15g/kg em 3 dias, doses únicas de 10g/kg e de 5g/kg, morreram. Dos três animais que receberam as doses únicas de 2,5g/kg, dois morreram e um não apresentou sinais clínicos e o animal que recebeu a dose única de 1,25g/kg, também não apresentou sinais clínicos. O início dos sinais clínicos após a administração da planta variou entre 7h e 46h45min. A evolução variou entre 3h6min e 126h40min. Os primeiros sinais clínicos apresentados foram inapetência, adipsia, apatia e relutância ao movimento. Em seguida os animais entravam em decúbito esternal e ao serem colocados em estação, mantinham os membros anteriores flexionados, apoiavam apenas os posteriores no chão até evoluírem para flexão dos quatro membros e seguia-se o decúbito lateral. À necropsia destacaram-se o edema de tecido adiposo perirrenal, rins pálidos e, ao corte, com estriação esbranquiçada desde o córtex até a região medular. À histopatologia foi verificada acentuada necrose coagulativa das células epiteliais dos túbulos uriníferos. Comparativamente aos casos naturais, os caprinos intoxicados experimentalmente por M. princeps apresentaram quadro clínico-patológico semelhante. Desta maneira foi comprovado que Metternichia princeps é responsável pela doença nefrotóxica em caprinos no Rio de Janeiro; a menor dose que causou a

  20. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  1. A new Aceria species (Acari: Eriophyidae) from Spain on Pycnocomon rutifolium (Dipsacaceae) and supplementary descriptions of Aceria eucricotes and A. kuko from Lycium spp. (Solanaceae).

    Science.gov (United States)

    Ripka, Géza; Sánchez, Iňigo

    2017-03-19

    A new species of eriophyoid mite, Aceria pycnocomi sp. nov., associated with Pycnocomon rutifolium (Dipsacaceae), is described and illustrated from Spain. Morphological differences distinguishing this new species from similar Aceria species are discussed. The female, male and nymph of Aceria eucricotes (Nalepa, 1892) and Aceria kuko (Kishida, 1927) are redescribed and illustrated from Spain and Hungary, respectively; both were collected from Lycium spp. (Solanaceae). Morphological differences distinguishing these two species are discussed.

  2. Genome-Wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Science.gov (United States)

    Seo, Eunyoung; Kim, Seungill; Yeom, Seon-In; Choi, Doil

    2016-01-01

    Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR) immune receptors are known play critical roles in effector-triggered immunity (ETI) plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analysis and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL) subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analysis of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding. PMID:27559340

  3. Genome-wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Directory of Open Access Journals (Sweden)

    Eunyoung Seo

    2016-08-01

    Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.

  4. Evolutionarily Dynamic, but Robust, Targeting of Resistance Genes by the miR482/2118 Gene Family in the Solanaceae.

    Science.gov (United States)

    de Vries, Sophie; Kloesges, Thorsten; Rose, Laura E

    2015-11-19

    Plants are exposed to pathogens around the clock. A common resistance response in plants upon pathogen detection is localized cell death. Given the irreversible nature of this response, multiple layers of negative regulation are present to prevent the untimely or misexpression of resistance genes. One layer of negative regulation is provided by a recently discovered microRNA (miRNA) gene family, miR482/2118. This family targets the transcripts of resistance genes in plants. We investigated the evolutionary history and specificity of this miRNA gene family within the Solanaceae. This plant family includes many important crop species, providing a set of well-defined resistance gene repertoires. Across 14 species from the Solanaceae, we identified eight distinct miR482/2118 gene family members. Our studies show conservation of miRNA type and number in the group of wild tomatoes and, to a lesser extent, throughout the Solanaceae. The eight orthologous miRNA gene clusters evolved under different evolutionary constraints, allowing for individual subfunctionalization of the miRNAs. Despite differences in the predicted targeting behavior of each miRNA, the miRNA-R-gene network is robust due to its high degree of interconnectivity and redundant targeting. Our data suggest that the miR482/2118 gene family acts as an evolutionary buffer for R-gene sequence diversity. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.

    Science.gov (United States)

    Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas

    2016-05-01

    Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  6. Effects of seco-steroids purified from Physalis angulata L., Solanaceae, on the viability of Leishmania sp Efeitos de seco-esteróides purificados de Physalis angulata L., Solanaceae na viabilidade de Leishmania sp

    Directory of Open Access Journals (Sweden)

    Elisalva T. Guimarães

    2010-12-01

    Full Text Available Physalis angulata L., Solanaceae, is an annual herb commonly used in popular medicine in many tropical and subtropical countries. P. angulata extracts contain a variety of substances, but little is known about their pharmacological activities. In this work we investigated the in vitro antileishmanial activity of seco-steroids (physalins purified from P. angulata. Addition of physalins B, F, and G caused a concentration-dependent inhibition in the growth of L. amazonensis promastigotes, being the IC50 values were 6.8, 1.4, and 9.2 μM, respectively. Physalin D was less active and had an IC50 value of 30.5 μM. Physalins were also active in cultures of other Leishmania species (L. major, L. braziliensis, and L. chagasi. Our results demonstrate the potent antileishmanial activity of physalins in cultures of Leishmania species of the New and Old Worlds and suggest the therapeutic potential of these seco-steroids in leishmaniasis.Physalis angulata L., Solanaceae, é uma erva anual utilizada na medicina popular em muitos países tropicais e subtropicais. Apesar dos extratos da P. angulata apresentarem uma grande variedade de substâncias, pouco é conhecido sobre a sua atividade farmacológica. Neste trabalho foi investigado a atividade antileishmania in vitro de seco-esteroides (fisalinas purificados da P. angulata. O tratamento com as fisalinas B, F e G causou uma inibição concentração-dependente do crescimento de promastigotas de Leishmania amazonensis em cultura axênica, com valores de IC50 de 6,8, 1,4, e 9,2 μM respectivamente. A fisalina D foi menos ativa, com valores de IC50 de 30,5 μM. Foi também observada uma atividade leishmanicida em culturas de outras espécies de Leishmania (L. major, L. braziliensis e L. chagasi. Nossos resultados demonstram que as fisalinas inibem o crescimento dos promastigotas com o tratamento de espécies de Leishmania do Velho e do Novo Mundos e sugerem o potencial terapêutico destas moléculas na

  7. Biologia floral e polinização de pimenta malagueta (Capsicum frutescens L., Solanaceae: um estudo de caso = Floral biology and pollination of hot pepper (Capsicum frutescens L., Solanaceae: a case study

    Directory of Open Access Journals (Sweden)

    Darci de Oliveira Cruz

    2007-10-01

    Full Text Available A antese, a deiscência das anteras, a receptividade do estigma, o padrão de crescimento do tubo polínico e o percentual de vingamento dos frutos de Capsicum frutescens L. (Solanaceae foram estudados em São Miguel do Anta, Minas Gerais, sudeste brasileiro. As flores de C. frutescens são perfeitas, protogínicas e recebem a visita de várias espécies de abelhas, principalmente da abelha melífera Apis mellifera L., que coleta pólen e néctar. Foram comparados tratamentos de polinização por abelhas, polinização cruzada manual, polinização aberta, polinização aberta emasculada e autopolinização espontânea. O padrão de crescimento dos tubos polínicos mostrou-se semelhante em todos os tratamentos. Os tubos atingiram o ovário cerca de 24 horas após a polinização. Apesar de C. frutescens ser considerada autógama, essa cultura beneficia-se da polinização realizada por A. mellifera,produzindo significativamente maior quantidade de frutos, quando comparada com a autopolinização espontânea.The anthesis, anther dehiscence, pistil receptivity, pollen tubegrowth and fruit set of Capsicum frutescens L. (Solanaceae were studied in São Miguel do Anta, Minas Gerais State, southeastern Brazil. C. frutescens flowers are perfect, protogynous and receive visits from many bee species, mainly Apis mellifera L., which collect pollen and nectar. Treatments of pollination by bees, hand cross pollination, open pollination, emasculated open pollination and spontaneous self pollination were performed. Pollen tube growth pattern did not differ among treatments. Pollen tubes were observed in the ovary within 24 hours after pollination. Despite C. frutescens being considered autogamous, this crop benefits from pollination by A. mellifera, producing better fruit set than by using spontaneous self-pollination.

  8. Caracterização e avaliação do potencial agronômico e nutricional de etnovariedades de cubiu (Solanum sessiliflorum Dunal da Amazônia Characterization and evaluation of the agronomic and nutritional potential of ethnovarieties of cubiu (Solanum sessiliflorum Dunal in Amazonia

    Directory of Open Access Journals (Sweden)

    Danilo Fernandes da Silva Filho

    2005-12-01

    Full Text Available O cubiu (Solanum sessiliflorum Dunal é um importante recurso genético para o povo da Amazônia, porque produz frutos tradicionalmente utilizados como alimento, medicamento e cosméticos. Por se tratar de um excelente produto para o agro-negócio, aprofundar o conhecimento sobre a espécie, será uma contribuição de grande valia para a sociedade da região. Este trabalho teve o objetivo de caracterizar e avaliar o potencial de diferentes etnovariedades (ETNs por meio de descritores agronômicos e minerais dos seus frutos. O Experimento foi conduzido na Estação Experimental de Hortaliças do INPA, em Manaus, em solo Podzólico vermelho-amarelo, álico, textura arenosa e de baixa fertilidade. Adotou-se um delineamento experimental de blocos ao acaso, com 28 tratamentos (as ETNs em quatro repetições. Os seguintes descritores agronômicos e minerais dos frutos foram avaliados: forma dos frutos, número de frutos, comprimento do fruto, largura do fruto, peso médio do fruto, espessura da polpa, potássio, zinco, manganês, sódio, ferro, magnésio e cálcio. As análises de variância detectaram diferenças significativas entre as etnovariedades para todos os caracteres. As 28 ETNs puderam ser classificadas em nove formatos diferentes de frutos. As plantas produziram em média 4 a 89 frutos, variando em peso de 18,5 a 301 g. Entre os micro-elementos analisados a concentração de ferro variou de 97,3 a 352,7 mg em 100g da polpa in natura. Destacou-se em conteúdo deste elemento, a ETN3, originária de Barcelos (AM. Entre os macro-elementos, o potássio (variando entre 54,6 a 563,5 mg em 100g da polpa in natura apresentou maior concentração nas 28 ETNs avaliadas. A ETN9, originária de Lábrea (AM, foi a que produziu os frutos mais ricos nesse elemento. De maneira geral, as ETNs estudadas apresentam variabilidade genética ampla para ser explorada em programa de melhoramento do cubiu.Cubiu (Solanum sessiliflorum Dunal, is an important genetic

  9. Mapeo de genes ribosómicos y heterocromatina en seis especies de Lycium de sudamérica (solanaceae

    Directory of Open Access Journals (Sweden)

    Soledad Blanco

    2012-12-01

    Full Text Available El clado Lycieae (Solanaceae reune 92 especies, actualmente agrupadas en un único género, Lycium. Se realizó un estudio citogenético en seis especies sudamericanas de este género, usándose por primera vez en el grupo la técnica de FISH, además de la técnica de bandeo CMA/DAPI. Se emplearon ápices radicales de las siguientes especies: L. boerhaviifolium (previamente Grabowskia, L. bridgesii (previamente Phrodus, el tetraploide L. chilense y los diploides L. cestroides, L. ciliatum y L. tenuispinosum. Se confirmó el número básico x=12. La técnica de bandeo reveló la presencia de una banda CMA+/DAPI- asociada a NORs en el primer par metacéntrico en las especies diploides, y en los dos primeros pares m en la tetraploide. Además, L. tenuispinosum mostró una banda intercalar CMA+/DAPI- en uno de sus cromosomas, en tanto que en L. bridgesii se encontraron bandas terminales e intercalares en todos los cromosomas. Con la técnica de FISH se observó que los loci 18-5,8-26S fueron consistentes con los bloques CMA+/DAPI-/NORs. Las especies diploides presentaron siempre un par cromosómico m portador de genes ADNr 5S, mientras que la especie tetraploide presentó dos pares, concordando con su nivel de ploidía. En las especies estudiadas, la diversificación no fue acompañada por rearreglos cromosómicos estructurales significativos, excepto L. bridgesii, que se destaca por poseer una fórmula cariotípica distinta y un mayor porcentaje de heterocromatina.Mapping of ribosomal genes and heterochromatin in Lycium of South America (Solanaceae. The clade Lycieae (Solanaceae embraces 92 species, currently gathered in a single genus, Lycium. A study was conducted in six South American species of this genus, using the FISH technique for the first time in the group, in addition to the CMA/DAPI banding technique. Root tips of the following species were employed: L. boerhaviifolium (previously Grabowskia, L. bridgesii (previously Phrodus, the

  10. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  11. Interaction patterns between potato virus Y and eIF4E-mediated recessive resistance in the Solanaceae.

    Science.gov (United States)

    Moury, Benoît; Janzac, Bérenger; Ruellan, Youna; Simon, Vincent; Ben Khalifa, Mekki; Fakhfakh, Hatem; Fabre, Frédéric; Palloix, Alain

    2014-09-01

    The structural pattern of infectivity matrices, which contains infection data resulting from inoculations of a set of hosts by a set of parasites, is a key parameter for our understanding of biological interactions and their evolution. This pattern determines the evolution of parasite pathogenicity and host resistance, the spatiotemporal distribution of host and parasite genotypes, and the efficiency of disease control strategies. Two major patterns have been proposed for plant-virus genotype infectivity matrices. In the gene-for-gene model, infectivity matrices show a nested pattern, where the host ranges of specialist virus genotypes are subsets of the host ranges of less specialized viruses. In contrast, in the matching-allele (MA) model, each virus genotype is specialized to infect one (or a small set of) host genotype(s). The corresponding infectivity matrix shows a modular pattern where infection is frequent for plants and viruses belonging to the same module but rare for those belonging to different modules. We analyzed the structure of infectivity matrices between Potato virus Y (PVY) and plant genotypes in the family Solanaceae carrying different eukaryotic initiation factor 4E (eIF4E)-coding alleles conferring recessive resistance. Whereas this system corresponds mechanistically to an MA model, the expected modular pattern was rejected based on our experimental data. This was mostly because PVY mutations involved in adaptation to a particular plant genotype displayed frequent pleiotropic effects, conferring simultaneously an adaptation to additional plant genotypes with different eIF4E alleles. Such effects should be taken into account for the design of strategies of sustainable control of PVY through plant varietal mixtures or rotations. The interaction pattern between host and virus genotypes has important consequences on their respective evolution and on issues regarding the application of disease control strategies. We found that the structure of the

  12. No evidence for Fabaceae Gametophytic self-incompatibility being determined by Rosaceae, Solanaceae, and Plantaginaceae S-RNase lineage genes.

    Science.gov (United States)

    Aguiar, Bruno; Vieira, Jorge; Cunha, Ana E; Vieira, Cristina P

    2015-06-02

    Fabaceae species are important in agronomy and livestock nourishment. They have a long breeding history, and most cultivars have lost self-incompatibility (SI), a genetic barrier to self-fertilization. Nevertheless, to improve legume crop breeding, crosses with wild SI relatives of the cultivated varieties are often performed. Therefore, it is fundamental to characterize Fabaceae SI system(s). We address the hypothesis of Fabaceae gametophytic (G)SI being RNase based, by recruiting the same S-RNase lineage gene of Rosaceae, Solanaceae or Plantaginaceae SI species. We first identify SSK1 like genes (described only in species having RNase based GSI), in the Trifolium pratense, Medicago truncatula, Cicer arietinum, Glycine max, and Lupinus angustifolius genomes. Then, we characterize the S-lineage T2-RNase genes in these genomes. In T. pratense, M. truncatula, and C. arietinum we identify S-RNase lineage genes that in phylogenetic analyses cluster with Pyrinae S-RNases. In M. truncatula and C. arietinum genomes, where large scaffolds are available, these sequences are surrounded by F-box genes that in phylogenetic analyses also cluster with S-pollen genes. In T. pratense the S-RNase lineage genes show, however, expression in tissues not involved in GSI. Moreover, levels of diversity are lower than those observed for other S-RNase genes. The M. truncatula and C. arietinum S-RNase and S-pollen like genes phylogenetically related to Pyrinae S-genes, are also expressed in tissues other than those involved in GSI. To address if other T2-RNases could be determining Fabaceae GSI, here we obtained a style with stigma transcriptome of Cytisus striatus, a species that shows significant difference on the percentage of pollen growth in self and cross-pollinations. Expression and polymorphism analyses of the C. striatus S-RNase like genes revealed that none of these genes, is the S-pistil gene. We find no evidence for Fabaceae GSI being determined by Rosaceae, Solanaceae, and

  13. DISPONIBILIDADE DE LUZ, TIPO DE VEDAÇÃO E DE FRASCO NA GERMINAÇÃO E CRESCIMENTO INICIAL IN VITRO DE PLÂNTULAS DE CUBIU (Solanum sessiliflorum DUNAL

    Directory of Open Access Journals (Sweden)

    Adilson Ricken Schuelter

    2015-09-01

    Full Text Available This work aimed to evaluate the different types of sealing and flask size in relation to the rates of germination and biomass partitioning in seedlings of two varieties of Solanum sessiliflorum Dunal. Seeds of varieties Santa Luzia and Thais were inoculated into flasks of varying sizes, containing culture medium Murashige and Skoog (1962 with 50% of the concentration and sealed with different materials. It was found shriveling leaf in plantlets of both varieties grown in sealed flasks with polyvinyl chloride (PVC. The varieties Santa Luzia and Thais showed high germination percentage in flasks sealed with PVC and aluminum foil. Furthermore, the type of flask and sealing influenced the accumulation of assimilates in both varieties. It was found yet, the highest average of fresh matter in large flasks and sealed with aluminum for the Thais variety, while the Santa Luzia variety, the flask size does not interfere with weight, but those sealed with aluminum have a higher average weight. The dry matter accumulation for Thais variety were higher for plantlets cultivated in large flasks sealed with PVC, and for Santa Luzia variety were large flasks or sealed with PVC. Both varieties, when grown with aluminum foil have the highest average length of the aerial part. Plantlets cultivated in small flasks and sealed with PVC presented higher rootlength. It was concluded that the leaf shriveling was remarkable in flasks sealed with PVC and the accumulation of assimilates is influenced by the type of flask and seal for both varieties in the presence of light.

  14. Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII markers

    Directory of Open Access Journals (Sweden)

    Felix Enciso-Rodríguez

    2010-01-01

    Full Text Available The Lulo or naranjilla (Solanum quitoense Lam. and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt. are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32 and tree tomatoes (n = 30 through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII in other Solanaceae (Asterid species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested and tree tomatoes (26 out of 41 for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with F ST > 0.90, which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species.

  15. Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII) markers.

    Science.gov (United States)

    Enciso-Rodríguez, Felix; Martínez, Rodrigo; Lobo, Mario; Barrero, Luz Stella

    2010-04-01

    The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae (Asterid) species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested) and tree tomatoes (26 out of 41) for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with F(ST) > 0.90), which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species.

  16. Anti-inflammatory and antioxidant activities of methanol extracts and alkaloid fractions of four Mexican medicinal plants of Solanaceae.

    Science.gov (United States)

    Gutiérrez A, Dora M; Bah, Moustapha; Garduño R, María L; Mendoza D, Sandra O; Serrano C, Valentina

    2014-01-01

    Methanol extracts and alkaloid fractions of different parts of four plant species belonging to Solanaceae family and used in Mexican traditional medicine were investigated for their total phenolic contents, anti-inflammatory and antioxidant properties. The total phenolic compounds of each extract was determined according to the Folin-Ciocalteu method, while the in vitro radical scavenging activities of the extracts were assessed using the DPPH and ABTS radicals. The in vivo anti-inflammatory activity was determined using the TPA-induced mouse ear edema model. The methanol extracts contained the highest concentrations of phenolic compounds and also exhibited the best reducing power on the DPPH and ABTS radicals, in a concentration-dependent fashion. However, the anti-inflammatory activity did not follow the same trend, as some alkaloid fractions that showed low radical reducing power exhibited the strongest anti-inflammatory activity. The methanol extract obtained from the flowers of Nicotiana glauca presented the best overall performance with the largest amount of phenolic compounds (111 µg garlic acid equivalents/g of extract), the best antioxidant activity (94.80% inhibition of DPPH and 97.57% of ABTS) and the highest anti-inflammatory activity (81.93% inhibition of the inflammation).

  17. Identification of candidate MLO powdery mildew susceptibility genes in cultivated Solanaceae and functional characterization of tobacco NtMLO1.

    Science.gov (United States)

    Appiano, Michela; Pavan, Stefano; Catalano, Domenico; Zheng, Zheng; Bracuto, Valentina; Lotti, Concetta; Visser, Richard G F; Ricciardi, Luigi; Bai, Yuling

    2015-10-01

    Specific homologs of the plant Mildew Locus O (MLO) gene family act as susceptibility factors towards the powdery mildew (PM) fungal disease, causing significant economic losses in agricultural settings. Thus, in order to obtain PM resistant phenotypes, a general breeding strategy has been proposed, based on the selective inactivation of MLO susceptibility genes across cultivated species. In this study, PCR-based methodologies were used in order to isolate MLO genes from cultivated solanaceous crops that are hosts for PM fungi, namely eggplant, potato and tobacco, which were named SmMLO1, StMLO1 and NtMLO1, respectively. Based on phylogenetic analysis and sequence alignment, these genes were predicted to be orthologs of tomato SlMLO1 and pepper CaMLO2, previously shown to be required for PM pathogenesis. Full-length sequence of the tobacco homolog NtMLO1 was used for a heterologous transgenic complementation assay, resulting in its characterization as a PM susceptibility gene. The same assay showed that a single nucleotide change in a mutated NtMLO1 allele leads to complete gene loss-of-function. Results here presented, also including a complete overview of the tobacco and potato MLO gene families, are valuable to study MLO gene evolution in Solanaceae and for molecular breeding approaches aimed at introducing PM resistance using strategies of reverse genetics.

  18. Simultaneous determination of scopolamine, hyoscyamine and anisodamine in in vitro growth media of selected Solanaceae hairy roots by CE method.

    Science.gov (United States)

    Dziomba, Szymon; Łepek, Teresa; Jaremicz, Zbigniew; Łuczkiewicz, Maria; Prahl, Adam; Kowalski, Piotr

    2015-09-15

    An electrophoretic method for fast separation of three tropane alkaloids (hyoscyamine, anisodamine and scopolamine) was presented. The substances were complete resolved in less than one minute due to utilization of relatively short capillary (20.2cm effective length) and high voltage (25kV). Detector probing frequency was found among the parameters that significantly affected the detection sensitivity. The performed experiments showed insufficient available probing frequency of used commercial spectrophotometric detector according to capillary electrophoresis (CE) separation potential. Under the optimized conditions the background electrolyte (BGE) was composed of 20mM Tris, 6mM HCl and 20mM NaCl (pH 8.50). All analyses were carried out in fused silica capillaries of 50μm (inner diameter) and 31.2cm (total capillary length). Samples were injected hydrodynamically (5s; 3.45kPa) without any sample preparation step and separation was performed at 25kV. The elaborated method was applied in plant cultures growth media analysis after incubation with hairy roots of selected Solanaceae species. The performed experiments proved the usefulness of CE in quality control of biotechnological processes. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Brunfelsia (Solanaceae): a genus evenly divided between South America and radiations on Cuba and other Antillean islands.

    Science.gov (United States)

    Filipowicz, Natalia; Renner, Susanne S

    2012-07-01

    Hallucinogenic or toxic species of Brunfelsia (Solanaceae: Petunieae) are important in native cultures throughout South America, and the genus also contains several horticulturally important species. An earlier morphological revision of the c. 50 species recognized three main groups, one consisting of the 23 Antillean species, another of southern South American and Andean species, and a third of species from the Amazon Basin and Guiana Shield. Based on plastid and nuclear DNA sequences from up to 65 accessions representing 80% of the species, we generated a phylogeny and a calibrated chronogram for Brunfelsia to infer clade expansion and shifts in pollinators and fruit types. Brunfelsia flowers offer nectar, and attract lepidoptera, hummingbirds, or bees; the fruits are dry or fleshy. Our results imply that Brunfelsia is 16-21 Myr old and entered the Antilles from South America early during its history, with subsequent expansion along the island arc. The ancestor of the Antillean clade was hawk-moth-pollinated and had fleshy capsules, perhaps facilitating dispersal by birds. The only shift to hummingbird pollination occurred on Cuba, which also harbors the largest single radiation, with 11 species (10 included in our study) that apparently arose over the past 4 Myr. Jamaica, Hispaniola, and Puerto Rico each sustained smaller radiations. The data also reveal at least one new species. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. High genetic abundance of Rpi-blb2/Mi-1.2/Cami gene family in Solanaceae.

    Science.gov (United States)

    Zhao, Lina; Zhang, Qijun; Gao, Rongchao; Yang, Sihai; Liu, Haoxuan; Zhang, Xiaohui

    2015-09-30

    Three NBS-LRR genes, Rpi-blb2, Mi-1.2, and Cami, constitute a very special plant resistance gene family. These genes confer resistance against 4 distantly related pathogen species in 3 different Solanaceae hosts. To characterize this noted resistance, we conducted a series of studies on this gene family. First, homologs of this gene family were identified in the pepper, tomato and potato genomes. This revealed a large variation in copy number within this gene family among species and a great divergence was found both between and within species. To gain more information pertaining to gene resistance within this family, 121 LRR regions were cloned in 16 different wild/cultivated potato accessions. Again, frequent copy number variations and a high level of divergence between homolog were observed common among accessions. The divergence within species was so high that it reaches the level of divergence between species. Also, frequent frameshift mutations and abundant gene conversion events were identified in these LRR regions. Our findings suggest that this family harbors an unusually high level of genetic abundance, making it of particular interest. Together with other reported examples, our study also provides evidence that multi-resistance is a common trait in R gene families like this.

  1. Quantitative genetic analysis indicates natural selection on leaf phenotypes across wild tomato species (Solanum sect. Lycopersicon; Solanaceae).

    Science.gov (United States)

    Muir, Christopher D; Pease, James B; Moyle, Leonie C

    2014-12-01

    Adaptive evolution requires both raw genetic material and an accessible path of high fitness from one fitness peak to another. In this study, we used an introgression line (IL) population to map quantitative trait loci (QTL) for leaf traits thought to be associated with adaptation to precipitation in wild tomatoes (Solanum sect. Lycopersicon; Solanaceae). A QTL sign test showed that several traits likely evolved under directional natural selection. Leaf traits correlated across species do not share a common genetic basis, consistent with a scenario in which selection maintains trait covariation unconstrained by pleiotropy or linkage disequilibrium. Two large effect QTL for stomatal distribution colocalized with key genes in the stomatal development pathway, suggesting promising candidates for the molecular bases of adaptation in these species. Furthermore, macroevolutionary transitions between vastly different stomatal distributions may not be constrained when such large-effect mutations are available. Finally, genetic correlations between stomatal traits measured in this study and data on carbon isotope discrimination from the same ILs support a functional hypothesis that the distribution of stomata affects the resistance to CO2 diffusion inside the leaf, a trait implicated in climatic adaptation in wild tomatoes. Along with evidence from previous comparative and experimental studies, this analysis indicates that leaf traits are an important component of climatic niche adaptation in wild tomatoes and demonstrates that some trait transitions between species could have involved few, large-effect genetic changes, allowing rapid responses to new environmental conditions. Copyright © 2014 by the Genetics Society of America.

  2. Genetic variation in the Solanaceae fruit bearing species lulo and tree tomato revealed by Conserved Ortholog (COSII) markers

    Science.gov (United States)

    2010-01-01

    The Lulo or naranjilla (Solanum quitoense Lam.) and the tree tomato or tamarillo (Solanum betaceum Cav. Sendt.) are both Andean tropical fruit species with high nutritional value and the potential for becoming premium products in local and export markets. Herein, we present a report on the genetic characterization of 62 accessions of lulos (n = 32) and tree tomatoes (n = 30) through the use of PCR-based markers developed from single-copy conserved orthologous genes (COSII) in other Solanaceae (Asterid) species. We successfully PCR amplified a set of these markers for lulos (34 out of 46 initially tested) and tree tomatoes (26 out of 41) for molecular studies. Six polymorphic COSII markers were found in lulo with a total of 47 alleles and five polymorphic markers in tree tomato with a total of 39 alleles in the two populations. Further genetic analyses indicated a high population structure (with FST > 0.90), which may be a result of low migration between populations, adaptation to various niches and the number of markers evaluated. We propose COSII markers as sound tools for molecular studies, conservation and the breeding of these two fruit species. PMID:21637482

  3. Divergences of MPF2-like MADS-domain proteins have an association with the evolution of the inflated calyx syndrome within Solanaceae.

    Science.gov (United States)

    Zhang, Jisi; Khan, Muhammad Ramzan; Tian, Ying; Li, Zhichao; Riss, Simone; He, Chaoying

    2012-10-01

    The inflated calyx syndrome (ICS) is a post-floral novelty within Solanaceae. Previous work has shown that MPF2-like MADS-box genes have been recruited for the development and evolution of ICS through heterotopic expression from vegetative to floral organs. ICS seems to be a plesiomorphic trait in Physaleae, but it has been secondarily lost in some lineages during evolution. We hypothesized that molecular and functional divergences of MPF2-like proteins might play a role in the loss of ICS. In this study we analyzed the phylogeny, selection and various functions of MPF2-like proteins with respect to the evolution of ICS. Directional selection of MPF2-like orthologs toward evolution of ICS was detected. While auto-activation capacity between proteins varies in yeast, MPF2-like interaction with floral MADS-domain proteins is robustly detected, hence substantiating their integration into the floral developmental programs. Dimerization with A- (MPF3) and E-function (PFSEP1/3) proteins seems to be essential for ICS development within Solanaceae. Moreover, the occurrence of the enlarged sepals, reminiscent of ICS, and MPF2-like interactions with these specific partners were observed in transgenic Arabidopsis. The interaction spectrum relevant to ICS seems to be plesiomorphic, reinforcing the plesiomorphy of this trait. The inability of some MPF2-like to interact with either the A-function or any of the E-function partners characterized is correlated with the loss of ICS in the lineages that showed a MPF2-like expression in the calyx. Our findings suggest that, after recruitment of MPF2-like genes for floral development, diversification in their coding region due to directional selection leads to a modification of the MADS-domain protein interacting spectrum, which might serve as a constraint for the evolution of ICS within Solanaceae.

  4. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    OpenAIRE

    Danila Montewka Melotto-Passarin; Irving Joseph Berger; Keini Dressano; Valentina de Fátima De Martin; Giancarlo Conde Xavier Oliveira; Ralph Bock; Helaine Carrer

    2008-01-01

    Intergenic spacers of chloroplast DNA (cpDNA) are very useful in phylogenetic and population genetic studies of plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer of cpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability to contribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenic spacer mad...

  5. Etnobotánica de las especies de Solanum, subgénero Bassovia, sección Pachyphylla (Solanaceae de Misiones, Argentina

    Directory of Open Access Journals (Sweden)

    Héctor A. Keller

    2012-01-01

    Full Text Available Se informa sobre los nombres y la utilidad de tres especies de Solanum L. (Solanaceae de Misiones, Argentina que pertenecen al subgénero Bassovia, sección Pachyphylla. Dos de ellas, S. corymbiflorum y S. sciadostylis, crecen espontáneamente en la provincia y son ampliamente conocidas y utilizadas por los guaraníes para fines medicinales, mágicos y alimenticios. Solanum betaceumes una especie del centro y nordeste de Argentina que ha sido incorporada como incipiente cultivo en Misiones

  6. Synergistic complex from plants Solanaceae exhibits cytotoxicity for the human hepatocellular carcinoma cell line HepG2.

    Science.gov (United States)

    Schwarzlin, Romina; Pušenjak, Nika; Makuc, Damjan; Križman, Mitja; Vovk, Irena; Plavec, Janez; Švajger, Urban

    2016-10-18

    It had been demonstrated that sugars from various plants can act as potent agents, which induce apoptosis of cancer cells. Using HPLC, we fractionated a mixture of two plant extracts from the plant family Solanaceae, namely Capsicum chinense and the plant family Amaryllidaceae namely Allium sativum. We evaluated the effect of different fractions on apoptosis of HepG2 cell line. The most effective fraction was further studied to determine its molecular composition using mass spectrometry (MS) and NMR. We further evaluated the effect of determined molecular composition found in the selected fraction by using a mixture of commercially available substances, which were found in the fraction and tested its pro-apoptotic effect on HepG2 cells. To get some insight into potential apoptotic mechanisms we studied caspase-3 activity and mitochondrial integrity in treated cells. Out of 93 fractions obtained by HPLC from the plant extract we found HPLC fraction 10 (10 min elution) was the most effective. MS and NMR studies revealed high presence of cellobiose together with vitamin C, sulphur (S) and trace amounts of selenium (Se). HPLC fraction 10 triggered apoptosis of HepG2 within 3 h in the 0.01-1.0 mg/mL concentration range. Furthermore, a mixture of pure cellobiose, vitamin C, S and Se (complex cellobiose/C/S/Se) had a very similar capacity in inducing apoptosis of HepG2 cells compared to HPLC fraction 10. Complex cellobiose/C/S/Se was capable of inducing caspase-3 activity and led to loss of mitochondrial integrity. The capacity of cellobiose alone to induce apoptosis of HepG2 was approximately 1000-fold lower compared to complex cellobiose/C/S/Se. In this study we present the highly synergistic effect of a unique complex consisting of cellobiose, vitamin C, sulphur and selenium on triggering the apoptosis of human hepatocellular carcinoma (HepG2) cell line.

  7. Accumulation of acidic SK₃ dehydrins in phloem cells of cold- and drought-stressed plants of the Solanaceae.

    Science.gov (United States)

    Szabala, Bartosz Mieczyslaw; Fudali, Sylwia; Rorat, Tadeusz

    2014-04-01

    The role of acidic SK(n) dehydrins in stress tolerance of important crop and model species of the Solanaceae remains unknown. We have previously shown that the acidic SK₃ dehydrin DHN24 from Solanum sogarandinum is constitutively expressed and its expression is associated with cold acclimation. Here we found that DHN24 is specifically localized to phloem cells of vegetative organs of non-acclimated plants. More precise localization of DHN24 revealed that it is primarily found in sieve elements (SEs) and companion cells (CCs) of roots and stems. In cold-acclimated plants, DHN24 is mainly present in all cell types of the phloem. Dhn24 transcripts are also predominantly localized to phloem cells of cold-acclimated stems. Immunoelectron microscopy localized DHN24 to the cytosol and close to organelle membranes of phloem cells, the lumen with phloem protein filaments, parietal cytoplasm of SEs and the nucleoplasm of some nuclei. Cell fractionation experiments revealed that DHN24 was detected in the cytosolic, nuclear and microsomal fractions. We also determined whether homologous members of the acidic subclass dehydrins from Capsicum annuum and Lycopersicon chilense share the characteristics of DHN24. We showed that they are also constitutively expressed, but their protein level is upregulated preferentially by drought stress. Immunofluorescent localization revealed that they are detected in SEs and CCs of unstressed plants and throughout the phloem in drought-stressed plants. These results suggest that one of the primary roles of DHN24 and its homologs may be the protection of the phloem region from adverse effects of abiotic stresses.

  8. Anti-ulcerogenic properties of the aqueous and methanol extracts from the leaves of Solanum torvum Swartz (Solanaceae) in rats.

    Science.gov (United States)

    Nguelefack, Télesphore B; Feumebo, Catherine B; Ateufack, Gilbert; Watcho, Pierre; Tatsimo, Simplice; Atsamo, Albert D; Tane, Pierre; Kamanyi, Albert

    2008-09-02

    Solanum torvum (Solanaceae) is a plant currently used in Cameroon ethnomedicine for the treatment of stomach ailments. The present study was undertaken to determine the anti-ulcer potential of the aqueous and methanol extracts from the leaves of Solanum torvum. The aqueous and methanol extracts from the leaves of Solanum torvum were tested orally at the doses of 250, 500 and 750 mg/kg, on gastric ulcerations experimentally induced by HCl/ethanol, indomethacin, pylorus ligation and stress. The fractionation of the methanol extract through silica gel column chromatography produced seven different fractions (A-G) which were tested orally at the dose of 100mg/kg against HCl/ethanol-induced ulceration. The methanol extract at the dose of 750 mg/kg produced 98.12, 99.16, 98.70 and 96.03% inhibition when gastric ulcerations were induced by HCl/ethanol, indomethacin, pylorus ligation and stress, respectively. The aqueous extract at the same dose produced 96.55, 96.86, 98.63 and 98.63% inhibition on ulcerations induced respectively by HCl/ethanol, indomethacin, pylorus ligation and stress. All the fractions of the methanol extract significantly inhibited ulcer formation. Fraction F which contains flavonoids and triterpens was the most active and exhibited an inhibitory percentage of 84.74. Both extracts significantly increased mucus production and reduced gastric acid secretion. The aqueous and methanol extracts of the leaves of Solanum turvum possess anti-ulcerogenic properties that may be due to cytoprotective mechanism. These results support the ethnomedical uses of the plant in the treatment of gastric ulcer.

  9. Multi-analysis determination of tropane alkaloids in cereals and solanaceaes seeds by liquid chromatography coupled to single stage Exactive-Orbitrap.

    Science.gov (United States)

    Marín-Sáez, Jesús; Romero-González, Roberto; Garrido Frenich, Antonia

    2017-10-06

    Tropane alkaloids are a wide group of substances that comprises more than 200 compounds occurring especially in the Solanaceae family. The main aim of this study is the development of a method for the analysis of the principal tropane alkaloids as atropine, scopolamine, anisodamine, tropane, tropine, littorine, homatropine, apoatropine, aposcopolamine, scopoline, tropinone, physoperuvine, pseudotropine and cuscohygrine in cereals and related matrices. For that, a simple solid-liquid extraction was optimized and a liquid chromatographic method coupled to a single stage Exactive-Orbitrap was developed. The method was validated obtaining recoveries in the range of 60-109% (except for some compounds in soy), precision values (expressed as relative standard deviation) lower than 20% and detection and quantification limits equal to or lower than 2 and 3μg/kg respectively. Finally, the method was applied to the analysis of different types of samples as buckwheat, linseed, soy and millet, obtaining positives for anisodamine, scopolamine, atropine, littorine and tropinone in a millet flour sample above the quantification limits, whereas atropine and scopolamine were detected in a buckwheat sample, below the quantification limit. Contaminated samples with Solanaceaes seeds (Datura Stramonium and Brugmansia Arborea) were also analysed, detecting concentrations up to 693μg/kg (scopolamine) for contaminated samples with Brugmansia seeds and 1847μg/kg (atropine) when samples were contaminated with Stramonium seeds. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Hidden Variability of Floral Homeotic B Genes in Solanaceae Provides a Molecular Basis for the Evolution of Novel Functions[C][W

    Science.gov (United States)

    Geuten, Koen; Irish, Vivian

    2010-01-01

    B-class MADS box genes specify petal and stamen identities in several core eudicot species. Members of the Solanaceae possess duplicate copies of these genes, allowing for diversification of function. To examine the changing roles of such duplicate orthologs, we assessed the functions of B-class genes in Nicotiana benthamiana and tomato (Solanum lycopersicum) using virus-induced gene silencing and RNA interference approaches. Loss of function of individual duplicates can have distinct phenotypes, yet complete loss of B-class gene function results in extreme homeotic transformations of petal and stamen identities. We also show that these duplicate gene products have qualitatively different protein–protein interaction capabilities and different regulatory roles. Thus, compensatory changes in B-class MADS box gene duplicate function have occurred in the Solanaceae, in that individual gene roles are distinct, but their combined functions are equivalent. Furthermore, we show that species-specific differences in the stamen regulatory network are associated with differences in the expression of the microRNA miR169. Whereas there is considerable plasticity in individual B-class MADS box transcription factor function, there is overall conservation in the roles of the multimeric MADS box B-class protein complexes, providing robustness in the specification of petal and stamen identities. Such hidden variability in gene function as we observe for individual B-class genes can provide a molecular basis for the evolution of regulatory functions that result in novel morphologies. PMID:20807882

  11. Inheritance of resistance to Phytophthora infestans (Peronosporales, Pythiaceae in a new source of resistance in tomato (Solanum sp. (formerly Lycopersicon sp., Solanales, Solanaceae

    Directory of Open Access Journals (Sweden)

    Flávia Barbosa Abreu

    2008-01-01

    Full Text Available In Brazil, no commercial tomato (Solanum lycopersicum L. formerly Lycopersicon esculentum Mill. varieties are available which are resistant to the late blight, one of the most important tomato diseases, produced by the phytopathogenic oomycete Phytophthora infestans. The wild tomato (Solanum habrochaites Knapp & Spooner, formerly Lycopersicon hirsutum Dunal shows resistance to P. infestans, because of which we investigated an interspecific cross between S. lycopersicum cv. Santa Clara and S. habrochaites accession BGH 6902 maintained at the Horticultural Germplasm Bank at the Federal University of Viçosa (Banco de Germoplasma de Horticultura (BGH, Universidade Federal de Viçosa (UFV, Viçosa, Minas Gerais, Brazil The genitors, F1, F2, BC1 and BC2 were used to study the inheritance of resistance to P. infestans and to estimate the genetic parameters associated with resistance. Analysis of the area under the disease progress curve (AUDPC indicated that inheritance is polygenic and that dominance controls character, whereas mean analysis showed that the additive effect was the most important. Although the character presents variability, the heritability is low which generates the need to better control the environment to obtain success with the selection.

  12. POLEN DE LAS MAGNOLIOPSIDA EN EL VOLCÁN (PAMPLONA, COLOMBIA II: FAMILIAS HYPERICACEAE, LAMIACEAE, LOBELIACEAE, POLYGONACEAE, RHAMNACEAE, ROSACEAE, RUBIACEAE, SCROPHULARIACEAE Y SOLANACEAE

    Directory of Open Access Journals (Sweden)

    JORGE D. MERCADO-GÓMEZ

    2013-12-01

    Full Text Available Se caracterizó la morfología polínica de las especies pertenecientes a las familias, Hypericaceae, Lamiaceae, Lobeliaceae, Polygonaceae, Rhamnaceae, Rosaceae, Rubiaceae, Scrophulariaceae y Solanaceae, encontradas en la zona El Volcán (Pamplona, Colombia. Las observaciones, descripciones y microfotografías de los granos de polen se realizaron con microscopio de luz, contando un mínimo de 25 granos por especie. Todas las familias presentan un carácter euripalinologico, excepto Melastomataceae la cual es estenopalinologica. Asimismo, al realizar comparaciones sobre algunas especies que fueron descritas en otras zonas del bosque altoandino y páramo en la cordillera Central y Occidental, fue posible determinar variaciones en la morfología polínica.

  13. Biosynthesis of steroidal alkaloids in Solanaceae plants: incorporation of 3β-hydroxycholest-5-en-26-al into tomatine with tomato seedlings.

    Science.gov (United States)

    Ohyama, Kiyoshi; Okawa, Akiko; Fujimoto, Yoshinori

    2014-08-01

    The C-26 amino group of tomatine, a representative Solanaceae steroidal alkaloid, is introduced in an early step of its biosynthesis from cholesterol. We recently proposed a transamination mechanism for the C-26 amination as opposed to the previously proposed mechanism involving a nitrogen nucleophilic displacement. In the present study, a deuterium labeled C-26 aldehyde, (24,24,27,27,27-(2)H5)-3β-hydroxycholest-5-en-26-al, was synthesized and fed to a tomato (Solanum lycopersicum) seedling. LC-MS analysis of the biosynthesized tomatine indicated that the labeled aldehyde was incorporated into tomatine. The finding strongly supports the intermediacy of the aldehyde and the transamination mechanism during C-26 amination. Copyright © 2014. Published by Elsevier Ltd.

  14. Antifungal glycoalkaloids, flavonoids and other chemical constituents of Solanum asperum Rich (Solanaceae); Glicoalcaloides antifugincos, flavonoides e outros constituintes quimicos de Solanum asperum

    Energy Technology Data Exchange (ETDEWEB)

    Pinto, Francisco das Chagas L.; Uchoa, Daniel Esdras de A.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo, E-mail: opessoa@ufc.b [Universidade Federal do Ceara (DQOI/UFC), Fortaleza, CE (Brazil). Dept. de Quimica Organica e Inorganica; Silva, Fernanda M. e; Theodoro, Phellipe N.E.T.; Espindola, Laila S. [Universidade de Brasilia (FCS/UnB), DF (Brazil). Fac. de Ciencias da Saude

    2011-07-01

    Two glycoalkaloids: solamargine and solasonine; three flavonoids: tiliroside, 7-O-alpha-L-ramnopyranosyl-kaempferol and 3-O-[beta-D-glucopyranosyl-(1->6)-alpha-L-ramnopyranosyl ]-7-O-alpha-L-ramnopyranosyl-kaempferol, in addition to the tripeptide Leu-Ile-Val, the aminoacid proline and the eicosanoic acid were isolated from Solanum asperum (Solanaceae). The structures of all compounds were determined by interpretation of their spectra (IR, MS, {sup 1}H and {sup 13}C NMR) and comparison with the literature data. All compounds, except the glycoalkaloids, are being reported for the first time for S. asperum. Solasonine showed strong activity (MIC < 0.24 mug/mL) against four filamentous fungi species of the genera Microsporum and Trichophyton. (author)

  15. (Solanaceae) from Uganda

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... The taxonomy of species belonging to Solanum section Solanum (sometimes referred to as the. Solanum nigrum complex or black nightshades) is known to be difficult and has resulted in extensive synonymy. Yet, these species play a significant role in nutrition and food security, especially in developing ...

  16. Problemas fitopatológicos en especies de la familia Solanaceae causados por los géneros Phytophthora, Alternaria y Ralstonia en Colombia. Una revisión.

    Directory of Open Access Journals (Sweden)

    Carreño Natalia

    2007-12-01

    Full Text Available

    La familia Solanaceae es considerada el tercer taxa botánico más importante a nivel agronómico, hecho que ha generado que mundialmente se invierta un gran esfuerzo en estudiar la biología, ecología y diversidad de hábitats de muchas de sus especies. En Colombia, las especies más cultivadas son comúnmente atacadas por patógenos que limitan la producción y la calidad final del producto. El presente documento expone la recopilación de los estudios publicados realizados en Colombia, referentes a las enfermedades causadas por tres de los patógenos más importantes que afectan la familia Solanaceae: Phytophthora, Alternaria y Ralstonia.

  17. Three new aromatic glycosides from the ripe fruit of cherry tomato.

    Science.gov (United States)

    Ono, Masateru; Shiono, Yuki; Tanaka, Takayuki; Masuoka, Chikako; Yasuda, Shin; Ikeda, Tsuyoshi; Okawa, Masafumi; Kinjo, Junei; Yoshimitsu, Hitoshi; Nohara, Toshihiro

    2010-10-01

    Three new aromatic glycosides were isolated from the ripe fruit of cherry tomato [Lycopersicon esculentum var. cerasiforme (Dunal) Alef. (Solanaceae)] along with six known aromatic glycosides and one known steroidal alkaloid glycoside. Their chemical structures were determined on the basis of spectroscopic data as well as chemical evidence.

  18. Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum cultivar Micro-Tom, a reference system for the Solanaceae genomics

    Directory of Open Access Journals (Sweden)

    Kikuchi Mari

    2010-03-01

    Full Text Available Abstract Background The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. Results To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706 was estimated to be 0.061%. Conclusion The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the

  19. Typification of Solanum (Solanaceae species described by Martín de Sessé y Lacasta and José Mariano Mociño

    Directory of Open Access Journals (Sweden)

    Knapp, Sandra

    2008-06-01

    Full Text Available Lectotypes, neotypes or epitypes are confirmed or designated here for 16 of the 22 names coined by Martín Sessé y Lacasta and José Mariano Mociño that were described as members of the large genus Solanum (Solanaceae: Solanum bifidum, S. cordovense, S. declinatum, S. dichotomum, S. diphyllum, S. lanceifolium, S. lanceolatum, S. lineatum (both homonyms, S. longifolium, S. mexicanum, S. nutans, S. sarmentosum, S. scandens, S. tlacotalpense and S. uniflorum. A brief introduction assesses the importance of the Sessé & Mociño expedition (the Real Expedición Botánica a Nueva España to the botany of their time, and identifies difficulties in identifying and neotypifying or lectotypifying names coined by them. More than half of the names coined by Sessé and Mociño have no material associated with them. The currently accepted name for each taxon is given, and taxa of uncertain status are indicated. Each typification is accompanied by a discussion of the reasoning behind the choice of specimen, and all newly designated types are illustrated.Se confirman o designan los lectótipos, neótipos o epítipos de 16 de los 22 nombres acuñados por Martín de Sessé y Lacasta y José Mariano Mociño que o bien fueron descritos dentro del género Solanum (Solanaceae o son actualmente reconocidos como parte del mismo: Solanum bifidum, S. cordovense, S. declinatum, S. dichotomum, S. diphyllum, S. lanceifolium, S. lanceolatum, S. lineatum (ambos homónimos, S. longifolium, S. mexicanum, S. nutans, S. sarmentosum, S. scandens, S. tlacotalpense y S. uniflorum. Se incluye una breve introducción explicando la importancia de la Real Expedición Botánica a Nueva España (expedición de Sessé y Mociño para la botánica de su tiempo, así como las dificultades que entraña neotipificar o lectotipificar los nombres acuñados por éllos. Se incluye el nombre aceptado para cada taxon cuando es posible y cada tipificación se acompaña de una discusión explicando

  20. Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum) cultivar Micro-Tom, a reference system for the Solanaceae genomics.

    Science.gov (United States)

    Aoki, Koh; Yano, Kentaro; Suzuki, Ayako; Kawamura, Shingo; Sakurai, Nozomu; Suda, Kunihiro; Kurabayashi, Atsushi; Suzuki, Tatsuya; Tsugane, Taneaki; Watanabe, Manabu; Ooga, Kazuhide; Torii, Maiko; Narita, Takanori; Shin-I, Tadasu; Kohara, Yuji; Yamamoto, Naoki; Takahashi, Hideki; Watanabe, Yuichiro; Egusa, Mayumi; Kodama, Motoichiro; Ichinose, Yuki; Kikuchi, Mari; Fukushima, Sumire; Okabe, Akiko; Arie, Tsutomu; Sato, Yuko; Yazawa, Katsumi; Satoh, Shinobu; Omura, Toshikazu; Ezura, Hiroshi; Shibata, Daisuke

    2010-03-30

    The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs) was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706) was estimated to be 0.061%. The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the tomato whole-genome sequence and aid in tomato functional

  1. Phylogeography of the Solanaceae-infecting Basidiomycota fungus Rhizoctonia solani AG-3 based on sequence analysis of two nuclear DNA loci

    Directory of Open Access Journals (Sweden)

    Vilgalys Rytas J

    2007-09-01

    Full Text Available Abstract Background The soil fungus Rhizoctonia solani anastomosis group 3 (AG-3 is an important pathogen of cultivated plants in the family Solanaceae. Isolates of R. solani AG-3 are taxonomically related based on the composition of cellular fatty acids, phylogenetic analysis of nuclear ribosomal DNA (rDNA and beta-tubulin gene sequences, and somatic hyphal interactions. Despite the close genetic relationship among isolates of R. solani AG-3, field populations from potato and tobacco exhibit comparative differences in their disease biology, dispersal ecology, host specialization, genetic diversity and population structure. However, little information is available on how field populations of R. solani AG-3 on potato and tobacco are shaped by population genetic processes. In this study, two field populations of R. solani AG-3 from potato in North Carolina (NC and the Northern USA; and two field populations from tobacco in NC and Southern Brazil were examined using sequence analysis of two cloned regions of nuclear DNA (pP42F and pP89. Results Populations of R. solani AG-3 from potato were genetically diverse with a high frequency of heterozygosity, while limited or no genetic diversity was observed within the highly homozygous tobacco populations from NC and Brazil. Except for one isolate (TBR24, all NC and Brazilian isolates from tobacco shared the same alleles. No alleles were shared between potato and tobacco populations of R. solani AG-3, indicating no gene flow between them. To infer historical events that influenced current geographical patterns observed for populations of R. solani AG-3 from potato, we performed an analysis of molecular variance (AMOVA and a nested clade analysis (NCA. Population differentiation was detected for locus pP89 (ΦST = 0.257, significant at P ST = 0.034, not significant. Results based on NCA of the pP89 locus suggest that historical restricted gene flow is a plausible explanation for the geographical

  2. Efeito de extratos de plantas silvestres da família Solanaceae sobre o controle de Brevicoryne brassicae em couve (Brassica oleracea var. acephala Extracts effect of wild plants of the Solanaceae family on Brevicoryne brassicae control in cabbage (Brassica oleracea var. acephala

    Directory of Open Access Journals (Sweden)

    Patrícia Braga Lovatto

    2004-08-01

    Full Text Available O objetivo principal deste trabalho foi testar o efeito de extratos de plantas silvestres da família Solanaceae disponíveis na região do Vale do Rio Pardo, RS, sobre o pulgão-da-couve (Brevicoryne brassicae, praga agrícola de significativa importância. Nove espécies tóxicas de Solanaceae estão disponíveis na região de estudo: seis pertencem ao gênero Solanum, uma ao gênero Brugmansia e duas são cultivadas e pertencem ao gênero Nicotiana e Capsicum. A fim de determinar a capacidade de repelência e o efeito inseticida, foram testadas as seguintes espécies: B. suaveolens (trombeteira, C. annuum var. variegated (pimenta-de-jardim, N. tabacum var. virginia (fumo, S. aculeatissimum (joá-bravo, S. americanum (erva-moura, S. diflorum (tomatinho, S. fastigiatum var. acicularium (jurubeba, S. fastigiatum var. fastigiatum (jurubeba e S. sisymbriifolium (arrebenta-cavalo. Para obtenção dos extratos foram utilizadas folhas, flores e frutos aplicando-se duas técnicas distintas de elaboração: decocção do material fresco e extração a frio do material seco. Quanto à capacidade de repelência dos extratos, os tratamentos utilizando material fresco de S. fastigiatum var. acicularium (frutos verdes e maduros, 2,5% e 5% de concentração e S. diflorum (frutos verdes e maduros, 2,5% e 5% de concentração demonstraram maior eficácia. Nos testes sobre a biologia do inseto os tratamentos mais eficazes como inseticida foram S. fastigiatum var. fastigiatum e var. acicularium (folhas a 10% de concentração.The objective of this study was to test the effect of plant extracts from Solanaceae available in Vale do Rio Pardo region, RS, on the aphid Brevicoryne brassicae, agricultural pest of significant importance. Nine toxic Solanaceae species are available in the area of study: six are wild belonging to the genus Solanum, one to the genus Brugmansia, and two are cultivated and belong to the genus Nicotiana and Capsicum. To determine the

  3. Reproductive biology of endemic Solanum melissarum Bohs (Solanaceae) and updating of its current geographic distribution as the basis for its conservation in the Brazilian Cerrado.

    Science.gov (United States)

    Coelho, C P; Gomes, D C; Guilherme, F A G; Souza, L F

    2017-11-01

    The genus Solanum (family Solanaceae) includes more than 1400 species and has buzz-pollinated flowers with poricidal anthers. The present study aimed to describe the distribution, breeding system and pollination mechanism of Solanum melissarum, a species endemic to Brazil. The study of breeding system was conducted in an urban forest fragment in Jataí, GO. Distribution data were gathered from floristic surveys and digital plant databases. The floral morphology and the pollination mechanism were studied on through field observations and preserved flowers. The breeding system was determined through hand pollination treatments. The species has a distribution only in the Brazilian Atlantic forest coastal, and this study provides the first records of S. melissarum for the state of Goiás. The pendulous flowers have poricidal anthers close to the stigma, with membranous thecae joined by a connective bearing osmophores that attract males of Euglossa cordata bees. As they collect fragrances, the bees press the thecae and pollen is released through a bellows mechanism. Based on the hand-pollination treatments, this species is self-incompatible. Isolated forest fragments may not include enough pollinators to ensure the pollination of plants with specialized systems. However, they are essential for the conservation of species with interesting phytogeographic patterns, such as the vicariance observed in S. melissarum, and for the conservation of regional diversity.

  4. Distribution of a Ty3/gypsy-like retroelement on the A and B-chromosomes of Cestrum strigilatum Ruiz & Pav. and Cestrum intermedium Sendtn. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Jéferson Nunes Fregonezi

    2007-01-01

    Full Text Available Retroelements are a diversified fraction of eukaryotic genomes, with the Ty1/copia and Ty3/gypsy groups being very common in a large number of plant genomes. We isolated an internal segment of the Ty3/gypsy retroelement of Cestrum strigilatum (Solanaceae using PCR amplification with degenerate primers for a conserved region of reverse transcriptase. The isolated segment (pCs12 was sequenced and showed similarity with Ty3/gypsy retroelements of monocotyledons and dicotyledons. This segment was used as probe in chromosomes of C. strigilatum and Cestrum intermedium. Diffuse hybridization signals were observed along the chromosomes and more accentuated terminal signals in some chromosome pairs, always associated with nucleolus organizer regions (NORs. The physical relationship between the hybridization sites of pCs12 and pTa71 ribosomal probes was assessed after sequential fluorescence in situ hybridization (FISH. Hybridization signals were also detected in the B chromosomes of these species, indicating an entail among the chromosomes of A complement and B-chromosomes.

  5. In vitro production of secondary metabolite using Atropa komarovii Bline&Shal (Solanaceae hairy root culture via Agrobacterium rhizogenes ATCC15834

    Directory of Open Access Journals (Sweden)

    Ofelia Banihashemi

    2017-07-01

    Full Text Available Background & Aim:A new sustainable tissue-based system is presented by plant hairy roots, preserving all of the several specialized types of cell with critical roles in allowing bioactive secondary molecules to be synthesized more consistently as usual. The system is also essential for studying the production of alkaloid in culture. Experimental: The Atropa komarovii leaves were wounded and infected with soil gram-negative bacterium Agrobacterium rhizogenes ATCC15834. After three weeks, the transformation roots and control roots without infection, appeared, and for confirming that T-DNA Ri plasmid fragments were transformed and integrated to plant genome, the rolB gene region, was amplified using PCR. HPLC method was then used for assaying how two tropane alkaloids such as atropine (hyosciamine and scopolamine (hyoscine were produced in hairy roots,control roots, leaves and roots of plantlet. Results: The data indicated that diagnostic 500bp rol B product amplification was exhibited to be present by all the transformed hairy roots. Scopolamine content in hairy roots was considerably greater than that in control roots but greatest (Hyoscyamine atropine content was observed in control roots. Analysis of DW, FW and root length showed that fresh and dry root weight increased in hairy roots compared with that in non transformed root. Recommended applications/industries: The present study demonstrated that secondary metabolite production using medicinal plants concerns many researchers worldwide today and hairy root culture is a useful method for producing tropane alkaloids in solanaceae.

  6. Reproductive biology of endemic Solanum melissarum Bohs (Solanaceae and updating of its current geographic distribution as the basis for its conservation in the Brazilian Cerrado

    Directory of Open Access Journals (Sweden)

    C. P. Coelho

    2017-05-01

    Full Text Available Abstract The genus Solanum (family Solanaceae includes more than 1400 species and has buzz-pollinated flowers with poricidal anthers. The present study aimed to describe the distribution, breeding system and pollination mechanism of Solanum melissarum, a species endemic to Brazil. The study of breeding system was conducted in an urban forest fragment in Jataí, GO. Distribution data were gathered from floristic surveys and digital plant databases. The floral morphology and the pollination mechanism were studied on through field observations and preserved flowers. The breeding system was determined through hand pollination treatments. The species has a distribution only in the Brazilian Atlantic forest coastal, and this study provides the first records of S. melissarum for the state of Goiás. The pendulous flowers have poricidal anthers close to the stigma, with membranous thecae joined by a connective bearing osmophores that attract males of Euglossa cordata bees. As they collect fragrances, the bees press the thecae and pollen is released through a bellows mechanism. Based on the hand-pollination treatments, this species is self-incompatible. Isolated forest fragments may not include enough pollinators to ensure the pollination of plants with specialized systems. However, they are essential for the conservation of species with interesting phytogeographic patterns, such as the vicariance observed in S. melissarum, and for the conservation of regional diversity.

  7. The tomato kinome and the tomato kinase library ORFeome: novel resources for the study of kinases and signal transduction in tomato and solanaceae species.

    Science.gov (United States)

    Singh, Dharmendra K; Calviño, Mauricio; Brauer, Elizabeth K; Fernandez-Pozo, Noe; Strickler, Susan; Yalamanchili, Roopa; Suzuki, Hideyuki; Aoki, Koh; Shibata, Daisuke; Stratmann, Johannes W; Popescu, George V; Mueller, Lukas A; Popescu, Sorina C

    2014-01-01

    Protein kinase-driven phosphorylation constitutes the core of cellular signaling. Kinase components of signal transduction pathways are often targeted for inactivation by pathogens. The study of kinases and immune signal transduction in the model crop tomato (Solanum lycopersicum) would benefit from the availability of community-wide resources for large scale and systems-level experimentation. Here, we defined the tomato kinome and performed a comprehensive comparative analysis of the tomato kinome and 15 other plant species. We constructed a tomato kinase library (TOKN 1.0) of over 300 full-length open reading frames (ORF) cloned into a recombination-based vector. We developed a high-throughput pipeline to isolate and transform tomato protoplasts. A subset of the TOKN 1.0 library kinases were expressed in planta, were purified, and were used to generate a functional tomato protein microarray. All resources created were utilized to test known and novel associations between tomato kinases and Pseudomonas syringae DC3000 effectors in a large-scale format. Bsk7 was identified as a component of the plant immune response and a candidate effector target. These resources will enable comprehensive investigations of signaling pathways and host-pathogen interactions in tomato and other Solanaceae spp.

  8. Testing the SI × SC rule: Pollen-pistil interactions in interspecific crosses between members of the tomato clade (Solanum section Lycopersicon, Solanaceae).

    Science.gov (United States)

    Baek, You Soon; Covey, Paul A; Petersen, Jennifer J; Chetelat, Roger T; McClure, Bruce; Bedinger, Patricia A

    2015-02-01

    Interspecific reproductive barriers (IRBs) act to ensure species integrity by preventing hybridization. Previous studies on interspecific crosses in the tomato clade have focused on the success of fruit and seed set. The SI × SC rule (SI species × SC species crosses are incompatible, but the reciprocal crosses are compatible) often applies to interspecific crosses. Because SI systems in the Solanaceae affect pollen tube growth, we focused on this process in a comprehensive study of interspecific crosses in the tomato clade to test whether the SI × SC rule was always followed. Pollen tube growth was assessed in reciprocal crosses between all 13 species of the tomato clade using fluorescence microscopy. In crosses between SC and SI species, pollen tube growth follows the SI × SC rule: interspecific pollen tube rejection occurs when SI species are pollinated by SC species, but in the reciprocal crosses (SC × SI), pollen tubes reach ovaries. However, pollen tube rejection occurred in some crosses between pairs of SC species, demonstrating that a fully functional SI system is not necessary for pollen tube rejection in interspecific crosses. Further, gradations in the strength of both pistil and pollen IRBs were revealed in interspecific crosses using SC populations of generally SI species. The SI × SC rule explains many of the compatibility relations in the tomato clade, but exceptions occur with more recently evolved SC species and accessions, revealing differences in strength of both pistil and pollen IRBs. © 2015 Botanical Society of America, Inc.

  9. Enantiomeric determination and evaluation of the racemization process of atropine in Solanaceae seeds and contaminated samples by high performance liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Marín-Sáez, Jesús; Romero-González, Roberto; Garrido Frenich, Antonia

    2016-11-25

    A new method has been developed for the enantioselective separation of (-) and (+) hyoscyamine in Solanaceaes seeds and contaminated buckwheat. Chromatographic separation was optimized, evaluating two chiral columns, Chirobiotic V and Chiralpal-AY3. Better resolution was obtained using a Chiralpak-AY3 column, utilizing as mobile phase ethanol (0.1% diethanolamine). An extraction procedure based on a modified QuEChERS (Quick, Easy, Cheap, Effective, Rugged and Safe) was applied, using water and acetonitrile containing 1% of acetic acid, and a clean-up step utilizing primary secondary amine (PSA) and graphitized carbon black (GCB) as sorbents. The extract was diluted with ethanol (50/:50, v/v) prior to chromatographic analysis, and the separation was carried out avoiding the racemization during this stage. Enantiomerization process of atropine was studied in samples at different conditions such as temperature (30, 50 and 80°C) and pH (3, 5, 7 and 9), observing that racemization occurs at high pH (9) and temperature (80°C). Stramonium and Brugmansia seeds were analyzed and the concentration of (-)-hyoscyamine was 1500mg/kg and 320mg/kg respectively. Contaminated buckwheat was also determined and (-)-hyoscyamine was detected at 170μg/kg. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Genealogy and fine mapping of obscuravenosa, a gene affecting the distribution of chloroplasts in leaf veins, and evidence of selection during breeding of tomatoes (Lycopersicon esculentum; Solanaceae).

    Science.gov (United States)

    Jones, Carl M; Rick, Charles M; Adams, Dawn; Jernstedt, Judy; Chetelat, Roger T

    2007-06-01

    In the processes of plant domestication and variety development, some traits are under direct selection, while others may be introduced by indirect selection or linkage. In the cultivated tomato (Lycopersicon esculentum = Solanum lycopersicum), and all other Solanaceae examined, chloroplasts are normally absent from subepidermal and mesophyll cells surrounding the leaf veins, and thus, veins appear clear upon subillumination. The tomato mutant obscuravenosa (obv), in contrast, contains chloroplasts in cells around the vein, and thus, veins appear as dark as the surrounding leaf tissue. Among tomato cultivars, the obv allele is common in processing varieties bred for mechanical harvest, but is otherwise rare. We traced the source of obv in processing tomatoes to the cultivar Earliana, released in the 1920s. The obv locus was mapped to chromosome 5, bin 5G, using introgression lines containing single chromosome segments from the wild species L. pennellii. This region also contains a quantitative trait locus (QTL) for plant height, pht5.4, which cosegregated with SP5G, a paralog of self-pruning (sp), the gene that controls the switch between determinate and indeterminate growth in tomato. The pht5.4 QTL was partially dominant and associated with a reduced percentage of red fruit at harvest. Our data suggest that the prevalence of obv in nearly all processing varieties may have resulted from its tight linkage to a QTL conferring a more compact, and horticulturally desirable, plant habit.

  11. (L.) Dunal using RAPD and AFLP markers

    African Journals Online (AJOL)

    A strong correlation was observed between morphology and molecular marker systems. Identification of specific markers to wild as well as cultivated accessions is yet another important finding in the present study. Such genetic diversity is useful in facilitating the development of large number of new varieties through ...

  12. (L.) Dunal using RAPD and AFLP markers

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... PCO generated using UPGMA (3D view). et al., 2003). A high degree of correlation between marker systems has also been reported in wheat and safflower (Bohn et al., 1999). However, Powell et al. (1996) observed little correlation between various marker systems in soybean. The incongruity between ...

  13. Dispersals of Hyoscyameae and Mandragoreae (Solanaceae) from the New World to Eurasia in the early Miocene and their biogeographic diversification within Eurasia.

    Science.gov (United States)

    Tu, Tieyao; Volis, Sergei; Dillon, Michael O; Sun, Hang; Wen, Jun

    2010-12-01

    The cosmopolitan Solanaceae contains 21 tribes and has the greatest diversity in South America. Hyoscyameae and Mandragoreae are the only tribes of this family distributed exclusively in Eurasia with two centers of diversity: the Mediterranean-Turanian (MT) region and the Tibetan Plateau (TP). In this study, we examined the origins and biogeographical diversifications of the two tribes based on the phylogenetic framework and chronogram inferred from a combined data set of six plastid DNA regions (the atpB gene, the ndhF gene, the rps16-trnK intergenic spacer, the rbcL gene, the trnC-psbM region and the psbA-trnH intergenic spacer) with two fossil calibration points. Our data suggest that Hyoscyameae and Mandragoreae each forms a monophyletic group independently derived from different New World lineages in the early Miocene. Phylogenetic relationships within both tribes are generally well resolved. All genera of Hyoscyameae are found to be monophyletic and they diversified in middle to late Miocene. At nearly the same time, Mandragoreae split into two clades, corresponding to the MT region and the TP region, respectively. Both the phylogenetic relationships and the estimated ages of Hyoscyameae and Mandragoreae support two independent dispersal events of their ancestors from the New World into Eurasia. After their arrivals in Eurasia, the two tribes diversified primarily in the MT region and in the TP region via multiple biogeographic processes including vicariance, dispersal, recolonization or being preserved as relicts, from the mid Miocene to the late Quaternary. Published by Elsevier Inc.

  14. Deciphering the Physalis floridana Double-Layered-Lantern1 Mutant Provides Insights into Functional Divergence of the GLOBOSA Duplicates within the Solanaceae1[C][W

    Science.gov (United States)

    Zhang, Ji-Si; Li, Zhichao; Zhao, Jing; Zhang, Shaohua; Quan, Hui; Zhao, Man; He, Chaoying

    2014-01-01

    Physalis spp. develop the “Chinese lantern” trait, also known as inflated calyx syndrome, that is a morphological novelty. Here, we identified the double-layered-lantern1 (doll1) mutant, a recessive and monofactorial mutation, in Physalis floridana; its corolla and androecium were transformed into the calyx and gynoecium, respectively. Two GLOBOSA-like MADS-box paralogous genes PFGLO1 and PFGLO2 were found in Physalis floridana, while the mutated phenotype was cosegregated with a large deletion harboring PFGLO1 and was complemented by the PFGLO1 genomic locus in transgenic plants, and severe PFGLO1 knockdowns phenocopied doll1. Thus, DOLL1 encodes the PFGLO1 protein and plays a primary role in determining corolla and androecium identity. However, specific PFGLO2 silencing showed no homeotic variation but rather affected pollen maturation. The two genes featured identical floral expression domains, but the encoding proteins shared 67% identity in sequences. PFGLO1 was localized in the nucleus when expressed in combination with a DEFICIENS homolog from Physalis floridana, whereas PFGLO2 was imported to the nucleus on its own. The two proteins were further found to have evolved different interacting partners and regulatory patterns, supporting the hypothesis that PFGLO2 is functionally separated from organ identity. Such a divergent pattern of duplicated GLO genes is unusual within the Solanaceae. Moreover, the phenotypes of the PFGLO1PFGLO2 double silencing mutants suggested that PFGLO2, through genetically interacting with PFGLO1, also exerts a role in the control of organ number and tip development of the second floral whorl. Our results, therefore, shed new light on the functional evolution of the duplicated GLO genes. PMID:24390390

  15. Effets biocides des alcaloïdes, des saponines et des flavonoïdes extraits de Capsicum frutescens L. (Solanaceae sur Bemisia tabaci (Gennadius (Homoptera : Aleyrodidae

    Directory of Open Access Journals (Sweden)

    Blenzar A.

    2005-01-01

    Full Text Available Biocide effects of alkaloids, saponins and flavonoids extracted from Capsicum frutescens L. (Solanaceae on Bemisia tabaci (Gennadius (Homoptera: Aleyrodidae. In an attempt to elaborate a strategy of integrated pest management on vegetable crops in Morocco, insecticidal activities of alkaloids, saponins and flavonoids extracted from Capsicum frutescens L. fruits against eggs and adults of Bemisia tabaci infesting tomato plants, Lycopersicon esculentum Mill. var. Daniella, were carried out under controlled conditions. Alkaloids, saponins and flavonoids, dissolved in ethanol at 1%, were tested at 0, 5, 10 and 20 g.l-1. The three compounds affected egg and adult survival, significantly. The mortality of embryo and adult varied according to the compound considered and for each compound according to concentration and exposure duration. For eggs, the corrected mortality varied from 35 to 59% for alkaloids, 14 to 31% for saponins and 10 to 14% for flavonoids. In adults, the mortalities were spread from 29% to 86%, 14 to 48% and 6 to 29% with alkaloids, saponins and flavonoids, respectively. Significant correlation between egg and adult mortality, due to the compounds tested, were observed. However, eggs required higher concentrations than adults; the LC50 was 13.78 vs. 6.83 g.l-1 for alkaloids, 98.63 vs. 32.28 g.l-1 for saponins and nontoxic vs. 120.65 g.l-1 for the flavonoids. Therefore, alkaloids were shown more effective against B. tabaci than saponins or flavonoids. However, the LT50 estimated for compounds, killing more than 50% of the population studied, was sufficient for viruliferous adults to inoculate TYLCV to plants before they died. The use of these compounds in integrated pest management merit further study.

  16. Linking Demography and Consumption of Henosepilachna vigintioctopunctata (Coleoptera: Coccinellidae) Fed on Solanum photeinocarpum (Solanales: Solanaceae): With a New Method to Project the Uncertainty of Population Growth and Consumption.

    Science.gov (United States)

    Huang, Hsiu-Wen; Chi, Hsin; Smith, Cecil L

    2018-02-09

    Because life tables are capable of providing the most comprehensive description on the survival, stage differentiation, and the reproduction of animal populations, they can be considered as the bases of population ecology and pest management. Researchers concerned with studies involving life tables inevitably face the problem of describing the variabilities that occur in the survival, stage differentiation, and fecundity data. Finding a means to include these variabilities in population projections concerning pest management may be problematic. Henosepilachna vigintioctopunctata (F.) (Coleoptera: Coccinellidae) is a pest of many plant species in Asia, including cultivated crops, ornamentals, and wild plants. The raw life history data (survival, stage differentiation, and fecundity) and consumption rate of both sexes of H. vigintioctopunctata reared on Solanum photeinocarpum Nakamura et Odashima (Solanales: Solanaceae) were collected in the laboratory and analyzed based on the age-stage, two-sex life table theory. The intrinsic rate of increase (r), finite rate of increase (λ), net reproductive rate (R0), mean generation time (T), and net consumption rate (C0) of H. vigintioctopunctata were 0.1312 d-1, 1.1402 d-1, 603.5 offspring, 48.8 d, and 77.8 cm2, respectively. By using the bootstrap technique with 100,000 samples, we demonstrated that the life tables constructed based on the 2.5th and 97.5th percentiles of R0 and λ can be used to describe the variabilities found in the survival and fecundity curves and to project the uncertainty of population growth. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Biologia floral e polinização de pimenta malagueta (Capsicum frutescens L., Solanaceae: um estudo de caso - DOI: 10.4025/actascibiolsci.v29i4.877 Floral biology and pollination of hot pepper (Capsicum frutescens L., Solanaceae: a case study - DOI: 10.4025/actascibiolsci.v29i4.877

    Directory of Open Access Journals (Sweden)

    Darci de Oliveira Cruz

    2008-02-01

    Full Text Available A antese, a deiscência das anteras, a receptividade do estigma, o padrão de crescimento do tubo polínico e o percentual de vingamento dos frutos de Capsicum frutescens L. (Solanaceae foram estudados em São Miguel do Anta, Minas Gerais, sudeste brasileiro. As flores de C. frutescens são perfeitas, protogínicas e recebem a visita de várias espécies de abelhas, principalmente da abelha melífera Apis mellifera L., que coleta pólen e néctar. Foram comparados tratamentos de polinização por abelhas, polinização cruzada manual, polinização aberta, polinização aberta emasculada e autopolinização espontânea. O padrão de crescimento dos tubos polínicos mostrou-se semelhante em todos os tratamentos. Os tubos atingiram o ovário cerca de 24 horas após a polinização. Apesar de C. frutescens ser considerada autógama, essa cultura beneficia-se da polinização realizada por A. mellifera, produzindo significativamente maior quantidade de frutos, quando comparada com a autopolinização espontânea.The anthesis, anther dehiscence, pistil receptivity, pollen tube growth and fruit set of Capsicum frutescens L. (Solanaceae were studied in São Miguel do Anta, Minas Gerais State, southeastern Brazil. C. frutescens flowers are perfect, protogynous and receive visits from many bee species, mainly Apis mellifera L., which collect pollen and nectar. Treatments of pollination by bees, hand cross pollination, open pollination, emasculated open pollination and spontaneous self pollination were performed. Pollen tube growth pattern did not differ among treatments. Pollen tubes were observed in the ovary within 24 hours after pollination. Despite C. frutescens being considered autogamous, this crop benefits from pollination by A. mellifera, producing better fruit set than by using spontaneous self-pollination.

  18. Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Hufnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae); Impacto dos nutrientes N e K e de acucares soluveis sobre populacoes de Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) e Agrotis ipsilon (Hufnagel) (Lepidoptera, Noctuidae) na cultura da batata, Solanum tuberosum L. (Solanaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Azeredo, Edson Henrique de [Universidade Federal Fluminense (UFF), Pinheiral, RJ (Brazil). Pro-Reitoria de Extensao], e-mail: edsonhenrique.azeredo@bol.com.br; Lima, Eduardo [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Agronomia. Dept. de Solos; Cassino, Paulo Cesar Rodrigues [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Inst. de Biologia. Centro Integrado de Manejo de Pragas C.R.G.

    2004-03-15

    Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar) (Coleoptera, Chrysomelidae) and Agrotis ipsilon (Huefnagel) (Lepidoptera, Noctuidae) populations in potato crops, Solanum tuberosum L. (Solanaceae). The occurrence of Diabrotica speciosa (Germar, 1824) and Agrotis ipsilon (Huefnagel, 1767) on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum quantity of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha{sup -1} of N + K with 27.03% at P< 0,05. It was observed that the effect of the dosage of N + K in the increment of the concentration of soluble sugars increased the damages in the tubercles and stems by A. ipsilon. The infestation by these species increased to 58.82% on the Monalisa cultivar, when the nitrogen dosage increased from zero to 150 kg.ha{sup -1}, in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensitized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing. (author)

  19. Anti-ulcer and anti-Helicobacter pylori potentials of the ethyl acetate fraction of Physalis alkekengi L. var. franchetii (Solanaceae) in rodent.

    Science.gov (United States)

    Wang, Yong; Wang, Sui Lou; Zhang, Jiong Yi; Song, Xiao Ning; Zhang, Zhi Yong; Li, Jing Feng; Li, Song

    2018-01-30

    Physalis alkekengi L. var. franchetii (Solanaceae) has been widely used in Chinese folk medicine due to its wide distribution throughout the country, for the treatment of a wide range of diseases including heat and cold, sore throat, fever, fungal infection, inflammation, toothache, rheumatism, burn, analgesic, ulcer and urinary diseases. However, the effect of P. alkekengi var. franchetii on ulcer and Helicobacter pylori infection has not been reported to date. This study was designed to investigate the anti-inflammatory, anti-ulcer, anti-Helicobacter pylori and analgesic properties of ethyl acetate fraction of the crude aqueous methanolic extract from the aerial parts of the plant P. alkekengi L. var. franchetii in rodents. Acute toxicity of the crude extract of P. alkekengi L. var. franchetii (PAF) was evaluated in rats. The petroleum ether fraction (PEF), butanol fraction (BF), ethyl acetate fraction (EAF) and aqueous fraction (AF) of crude aqueous methanolic extract from PAF were screened for anti-inflammatory and anti-ulcer potential at doses of 100, 250 and 500mg/kg (p.o.), using carrageenin-induced hind paw edema and ethanol-induced gastric lesions test in rats. In vitro anti-Helicobacter pylori activity of EAF was assayed subsequently. In addition, three doses of EAF were evaluated for analgesic activity using hot plate and writhing tests, respectively. Finally, we performed a phytochemical analysis of EAF. Four fractions of crude extract from PAF significantly reduced the paw volume in carrageenin-induced hind paw edema model at different doses (100, 250 and 500mg/kg, p.o.). The fraction EAF at a dose of 500mg/kg exhibited the highest (75.92%) (0.150 ± 0.045***, ***p acetic acid. By HPLC, we determined some steroid, terpenoid and flavonoids (four compounds): kaempferol, quercetin, Blumenol A and physalindicanols A, which were isolated from the ethyl acetate fraction and identified using 1 H NMR and 13 C NMR spectra analysis. This study demonstrated the

  20. Biologia floral e sistema de polinização de Solanum stramonifolium Jacq. (Solanaceae em remanescente de Mata Atlântica, Pernambuco Floral biology and pollination system of Solanum stramonifolium Jacq. (Solanaceae in an Atlantic Forest remnant in Pernambuco

    Directory of Open Access Journals (Sweden)

    Elisangela Lúcia de S. Bezerra

    2003-06-01

    Full Text Available A deiscência de anteras através de pequenos poros apicais é uma característica encontrada em várias espécies da família Solanaceae, especialmente no gênero Solanum, característica esta que restringe a polinização a um grupo de abelhas fêmeas capazes de vibrar as anteras para retirada do pólen. A fenologia, biologia floral e a polinização de Solanum stramonifolium foram estudadas entre os meses de agosto/1999 a dezembro/2000 em populações naturais ocorrentes no Parque Estadual de Dois Irmãos, um dos poucos remanescentes de Mata Atlântica localizada em Recife, Pernambuco (8°7'30"S e 34°52'30"W. Solanum stramonifolium é um arbusto com flores dispostas em inflorescências racemosas, apresentando corola branca e cinco estames de um amarelo intenso, com anteras poricidas dispostas ao redor do gineceu. A antese ocorre nas primeiras horas do dia, havendo reflexão de luz ultravioleta e presença de áreas de concentração de emissão de odor por toda a corola e na região apical das anteras. Solanum stramonifolium tem padrão de floração contínuo e apresenta flores hermafroditas (62% e funcionalmente masculinas (38%, o que caracteriza a espécie como andromonóica.Treze espécies de abelhas foram observadas visitando as flores de S. stramonifolium (nove polinizadores e quatro pilhadores. A constante e grande produção de flores faz com que Solamun stramonifolium mantenha sua guilda de polinizadores e garanta assim a sua reprodução, sendo, ao mesmo tempo, uma importante fonte de recursos para a manutenção destas abelhas.The anthers deiscense through two small apical pores is a feature found in many species of Solanaceae, especially in the genus Solanum. This feature restricts pollination to a group of female bees which are able to vibrate the anthers (buzz pollination. The phenology, floral biology and pollination of Solanum stramonifolium were studied between August/1999 and December/2000 in natural populations occurring

  1. Discovery of an unknown diversity of Leucinodes species damaging Solanaceae fruits in sub-Saharan Africa and moving in trade (Insecta, Lepidoptera, Pyraloidea

    Directory of Open Access Journals (Sweden)

    Richard Mally

    2015-01-01

    Full Text Available The larvae of the Old World genera Leucinodes Guenée, 1854 and Sceliodes Guenée, 1854 are internal feeders in the fruits of Solanaceae, causing economic damage to cultivated plants like Solanum melongena and S. aethiopicum. In sub-Saharan Africa five nominal species of Leucinodes and one of Sceliodes occur. One of these species, the eggplant fruit and shoot borer L. orbonalis Guenée, 1854, is regarded as regularly intercepted from Africa and Asia in Europe, North and South America and is therefore a quarantine pest on these continents. We investigate the taxonomy of African Leucinodes and Sceliodes based on morphological characters in wing pattern, genitalia and larvae, as well as mitochondrial DNA, providing these data for identification of all life stages. The results suggest that both genera are congeneric, with Sceliodes syn. n. established as junior subjective synonym of Leucinodes. L. orbonalis is described from Asia and none of the samples investigated from Africa belong to this species. Instead, sub-Saharan Africa harbours a complex of eight endemic Leucinodes species. Among the former nominal species of Leucinodes (and Sceliodes from Africa, only L. laisalis (Walker, 1859, comb. n. (Sceliodes is confirmed, with Leucinodes translucidalis Gaede, 1917, syn. n. as a junior subjective synonym. The other African Leucinodes species were unknown to science and are described as new: L. africensis sp. n., L. ethiopica sp. n., L. kenyensis sp. n., L. malawiensis sp. n., L. pseudorbonalis sp. n., L. rimavallis sp. n. and L. ugandensis sp. n. An identification key based on male genitalia is provided for the African Leucinodes species. Most imports of Leucinodes specimens from Africa into Europe refer to Leucinodes africensis, which has been frequently imported with fruits during the last 50 years. In contrast, L. laisalis has been much less frequently recorded, and L. pseudorbonalis as well as L. rimavallis only very recently in fruit imports

  2. Sessea regnellii (Solanaceae en Argentina

    Directory of Open Access Journals (Sweden)

    Héctor A. Keller

    2006-01-01

    Full Text Available Se cita por primera vez a Sessea regnelli para la flora argentina. Se presenta una descripción de la especie sobre la base de los ejemplares examinados, como así también ilustraciones y observaciones ecológicas.

  3. A new steroidal glycoside and a new phenyl glycoside from a ripe cherry tomato.

    Science.gov (United States)

    Ono, Masateru; Shiono, Yuki; Yanai, Yoshihiro; Fujiwara, Yukio; Ikeda, Tsuyoshi; Nohara, Toshihiro

    2008-10-01

    A new steroidal glycoside and a new phenyl glycoside have been isolated from a ripe cherry tomato [Lycopersicon esculentum var. cerasiforme (DUNAL) ALEF., Solanaceae] along with two known steroidal alkaloid glycosides, esculeoisides A and B, and five aromatic compounds, zizibeoside I, benzyl alcohol beta-gentiobioside, rutin, methyl caffeate, and phenylalanine. Their chemical structures were determined on the basis of spectroscopic data as well as chemical evidence.

  4. In silico analysis reveals widespread presence of three gene families, MAPK, MAPKK and MAPKKK, of the MAPK cascade from crop plants of Solanaceae in comparison to the distantly-related syntenic species from Rubiaceae, coffee

    Directory of Open Access Journals (Sweden)

    Hira Iftikhar

    2017-06-01

    Full Text Available Mitogen-activated protein kinases (MAPKs are an important family of genes which play roles in vital plant processes, and they also help in coping against various kinds of environmental stresses including abiotic as well as biotic factors. The advancement of genomics calls for the annotation, identification, and detailed processing of the essential gene families in plants in order to provide insights into the importance of their central roles as well as for providing the basis for making their growth vigorous even under stressed conditions and, ultimately, to benefit from them by foreseeing the potential threats to their growth. In the current study, MAPK, MAPKK, and MAPKKK families of the MAPK cascade were identified and reported from five different agriculturally and economically important crop species of the Solanaceae and Rubiaceae families based on conserved signature motifs aligned throughout the members of the families under this gene superfamily. Genes reported from the species after strict filtering were: 89, tomato; 108, potato; 63, eggplant; 79, pepper; 64, coffee. These MAPKs were found to be randomly distributed throughout the genome on the chromosomes of the respective species. Various characteristics of the identified genes were studied including gene structure, gene and coding sequence length, protein length, isoelectric point, molecular weight, and subcellular localization. Moreover, maximum likelihood test of phylogeny was conducted on the retrieved sequences for the three MAPK cascade families to determine their homologous relationships which were also analyzed quantitatively by heat plots.

  5. In silico analysis reveals widespread presence of three gene families, MAPK, MAPKK and MAPKKK, of the MAPK cascade from crop plants of Solanaceae in comparison to the distantly-related syntenic species from Rubiaceae, coffee

    Science.gov (United States)

    Naveed, Nayab; Bhatti, Muhammad Faraz; Song, Fengming

    2017-01-01

    Mitogen-activated protein kinases (MAPKs) are an important family of genes which play roles in vital plant processes, and they also help in coping against various kinds of environmental stresses including abiotic as well as biotic factors. The advancement of genomics calls for the annotation, identification, and detailed processing of the essential gene families in plants in order to provide insights into the importance of their central roles as well as for providing the basis for making their growth vigorous even under stressed conditions and, ultimately, to benefit from them by foreseeing the potential threats to their growth. In the current study, MAPK, MAPKK, and MAPKKK families of the MAPK cascade were identified and reported from five different agriculturally and economically important crop species of the Solanaceae and Rubiaceae families based on conserved signature motifs aligned throughout the members of the families under this gene superfamily. Genes reported from the species after strict filtering were: 89, tomato; 108, potato; 63, eggplant; 79, pepper; 64, coffee. These MAPKs were found to be randomly distributed throughout the genome on the chromosomes of the respective species. Various characteristics of the identified genes were studied including gene structure, gene and coding sequence length, protein length, isoelectric point, molecular weight, and subcellular localization. Moreover, maximum likelihood test of phylogeny was conducted on the retrieved sequences for the three MAPK cascade families to determine their homologous relationships which were also analyzed quantitatively by heat plots. PMID:28603666

  6. Development of a real-time PCR method for the differential detection and quantification of four solanaceae in GMO analysis: potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum).

    Science.gov (United States)

    Chaouachi, Maher; El Malki, Redouane; Berard, Aurélie; Romaniuk, Marcel; Laval, Valérie; Brunel, Dominique; Bertheau, Yves

    2008-03-26

    The labeling of products containing genetically modified organisms (GMO) is linked to their quantification since a threshold for the presence of fortuitous GMOs in food has been established. This threshold is calculated from a combination of two absolute quantification values: one for the specific GMO target and the second for an endogenous reference gene specific to the taxon. Thus, the development of reliable methods to quantify GMOs using endogenous reference genes in complex matrixes such as food and feed is needed. Plant identification can be difficult in the case of closely related taxa, which moreover are subject to introgression events. Based on the homology of beta-fructosidase sequences obtained from public databases, two couples of consensus primers were designed for the detection, quantification, and differentiation of four Solanaceae: potato (Solanum tuberosum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), and eggplant (Solanum melongena). Sequence variability was studied first using lines and cultivars (intraspecies sequence variability), then using taxa involved in gene introgressions, and finally, using taxonomically close taxa (interspecies sequence variability). This study allowed us to design four highly specific TaqMan-MGB probes. A duplex real time PCR assay was developed for simultaneous quantification of tomato and potato. For eggplant and pepper, only simplex real time PCR tests were developed. The results demonstrated the high specificity and sensitivity of the assays. We therefore conclude that beta-fructosidase can be used as an endogenous reference gene for GMO analysis.

  7. Ashwagandha ( Withania somnifera L. Dunal) crop as affected by ...

    African Journals Online (AJOL)

    The vegetative parameters of ashwagandha (viz. plant height, number of primary branches, plant spread and dry weight of shoot) were enhanced significantly with the application of 12.5 mg P2O5 kg-1 soil, whereas; dry weight of roots was enhanced up to the application level of 25 mg P2O5 kg-1 soil. FYM at the rate of 12.5 ...

  8. Shoot Regeneration from Leaf Explants of Withania somnifera (L. Dunal

    Directory of Open Access Journals (Sweden)

    Aruna Girish JOSHI

    2010-03-01

    Full Text Available Regeneration from leaf explants of Withania somnifera (L. for mass propagation was studied on Murashige and Skoog�s medium supplemented with Kinetin (Kn and 6-benzylaminopurine (BAP alone or in combination. Shoot buds were induced from the midrib on the abaxial side in presence of Kn and BAP (4 �M. These shoot buds developed into shoots on the same medium. Rooting of these shoots was achieved in 0.5 �M of IBA.

  9. In Vitro Propagation and Conservation of Withania somnifera (Dunal) L.

    Science.gov (United States)

    Fatima, Nigar; Ahmad, Naseem; Anis, Mohammad

    2016-01-01

    Plant tissue culture offers several techniques for rapid clonal propagation, germplasm conservation, regeneration of genetically manipulated superior clones, production of phyto-constituents, and ex vitro conservation of valuable phytodiversity. An improved and efficient micropropagation protocol for Withania somnifera (L.), a drug-producing medicinal plant, using juvenile explants (nodal explants) has been developed. Highest multiplication and subsequent elongation of shoots is observed on MS medium containing BA and NAA. The regenerated microshoots roots best on ½ MS medium containing NAA, established in earthen pots containing garden soil and are maintained in the greenhouse with 95 % survival rate. Genetic uniformity of micropropagated plants is confirmed by PCR-based DNA fingerprinting techniques, viz., RAPD and ISSR. No variation is observed in DNA fingerprinting patterns among the micropropagated plants, which are similar to that of the donor plant illustrating their genetic uniformity.

  10. Shoot Regeneration from Leaf Explants of Withania somnifera (L.) Dunal

    OpenAIRE

    Aruna Girish JOSHI; Mainavati A. PADHYA

    2010-01-01

    Regeneration from leaf explants of Withania somnifera (L.) for mass propagation was studied on Murashige and Skoog�s medium supplemented with Kinetin (Kn) and 6-benzylaminopurine (BAP) alone or in combination. Shoot buds were induced from the midrib on the abaxial side in presence of Kn and BAP (4 �M). These shoot buds developed into shoots on the same medium. Rooting of these shoots was achieved in 0.5 �M of IBA.

  11. Shoot Regeneration from Leaf Explants of Withania somnifera (L. Dunal

    Directory of Open Access Journals (Sweden)

    Aruna Girish JOSHI

    2010-03-01

    Full Text Available Regeneration from leaf explants of Withania somnifera (L. for mass propagation was studied on Murashige and Skoogs medium supplemented with Kinetin (Kn and 6-benzylaminopurine (BAP alone or in combination. Shoot buds were induced from the midrib on the abaxial side in presence of Kn and BAP (4 M. These shoot buds developed into shoots on the same medium. Rooting of these shoots was achieved in 0.5 M of IBA.

  12. Integrating varietal resistance with Xylopia aethiopica (Dunal) A ...

    African Journals Online (AJOL)

    SERVER

    2008-04-17

    %) mortality at 24 h post treatment in all varieties ... increasingly being utilized for livestock feed, it is still a very important staple food for ... especially along rivers in the dry country sides (Irvine,. 1961). X. aethiopica has a wide ...

  13. Composición química de los aceites esenciales de las hojas de Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae y Solanum subinerme (Solanaceae, recolectadas en Sucre, Venezuela

    Directory of Open Access Journals (Sweden)

    Gabriel Ordaz

    2011-06-01

    Full Text Available Los aceites esenciales son biosintetizados por plantas aromáticas y pueden obtenerse de cualquier órgano de la misma, tienen gran aplicación en la industria farmacéutica, sanitaria, cosmética, agrícola y de alimentos. Los aceites esenciales de las hojas de las plantas Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis y Solanum subinerme fueron obtenidos mediante hidrodestilación con rendimientos de 0.004, 0.032, 0.016 y 0.005%, respectivamente. La CG/EM permitió identificar la mayoría de los constituyentes de estos aceites esenciales (88.00, 89.80, 87.50 y 89.47%, respectivamente, encontrándose en mayor proporción metabolitos no volátiles de estructura no terpenoidal en H. guazumifolia (30.28%, sesquiterpenoides oxigenados en P. tuberculatum (52.19%, sesquiterpenos en S. dulcis (26.09% y derivados oxigenados de diterpenos en S. subinerme (39.67%. Los constituyentes mayoritarios fueron el diisobutilftalato (13.11% en H. guazumifolia, (--espatulenol (11.37% en P. tuberculatum y el trans-fitol (8.29 y 36.00% para S. dulcis y S. subinerme, respectivamente. El diisooctilftalato fue el constituyente común en los aceites esenciales de todas las especies y los compuestos volátiles trans-pinano, L-linalool, β-ionona, isofitol, neofitadieno, trans-fitol, dibutilftalato y hexadecanoato de metilo, fueron detectados en tres de estas esencias. Esto sugiere que dichas plantas pueden requerir metabolitos secundarios similares para su interacción ecológica, posiblemente debido a factores ambientales comunes.Chemical composition of essential oils from leaves of Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae and Solanum subinerme (Solanaceae from Sucre, Venezuela. Essential oils, biosynthesized and accumulated in aromatic plants, have a wide range of applications in the pharmaceutical health, cosmetics, food and agricultural industry. This study aimed to analyze the secondary

  14. Flowerlocation in Solanum dulcamara L. (Solanaceae)

    National Research Council Canada - National Science Library

    Irina Zhuravlyeva

    2013-01-01

    The morphology of inflorescence of Solanum dulcamara is studied. Pseudolateral location of inflorescence relatively to plant body is set, the absence of bracteae and the sympodial type of growing of branches are found out. From W...

  15. Flowerlocation in Solanum dulcamara L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Irina Zhuravlyeva

    2013-01-01

    Full Text Available The morphology of inflorescence of Solanum dulcamara is studied. Pseudolateral location of inflorescence relatively to plant body is set, the absence of bracteae and the sympodial type of growing of branches are found out. From W. Troll point of view the inflorescence of nightshade is defined as the polytelica synflorescence – complex dichasium.

  16. Induction of cell death on Plasmodium falciparum asexual blood stages by Solanum nudum steroids

    DEFF Research Database (Denmark)

    López, Mary Luz; Vommaro, Rossiane; Zalis, Mariano

    2010-01-01

    Solanum nudum Dunal (Solanaceae) is a plant used in traditional medicine in Colombian Pacific Coast, from which five steroids denominated SNs have been isolated. The SNs compounds have antiplasmodial activity against asexual blood stages of Plasmodium falciparum strain 7G8 with an IC50 between 20...... found that trophozoite and schizont stages were the most sensitive to SNs. By Giemsa-stained smears, induction of crisis forms was observed. Transmission electron microscopy of treated parasites showed morphological abnormalities such as a cytoplasm rich in vesicles and myelinic figures...

  17. Withanolide A is inherently de novo biosynthesized in roots of the medicinal plant Ashwagandha (Withania somnifera).

    Science.gov (United States)

    Sangwan, Rajender Singh; Das Chaurasiya, Narayan; Lal, Payare; Misra, Laxminarain; Tuli, Rakesh; Sangwan, Neelam Singh

    2008-06-01

    Ashwagandha (Withania somnifera Dunal., Solanaceae) is one of the most reputed medicinal plants of Ayurveda, the traditional medical system. Several of its traditionally proclaimed medicinal properties have been corroborated by recent molecular pharmacological investigations and have been shown to be associated with its specific secondary metabolites known as withanolides, the novel group of ergostane skeletal phytosteroids named after the plant. Withanolides are structurally distinct from tropane/nortropane alkaloids (usually found in Solanaceae plants) and are produced only by a few genera within Solanaceae. W. somnifera contains many structurally diverse withanolides in its leaves as well as roots. To date, there has been little biosynthetic or metabolism-related research on withanolides. It is thought that withanolides are synthesized in leaves and transported to roots like the tropane alkaloids, a group of bioactive secondary metabolites in Solanaceae members known to be synthesized in roots and transported to leaves for storage. To examine this, we have studied incorporation of (14)C from [2-(14)C]-acetate and [U-(14)C]-glucose into withanolide A in the in vitro cultured normal roots as well as native/orphan roots of W. somnifera. Analysis of products by thin layer chromatography revealed that these primary metabolites were incorporated into withanolide A, demonstrating that root-contained withanolide A is de novo synthesized within roots from primary isoprenogenic precursors. Therefore, withanolides are synthesized in different parts of the plant (through operation of the complete metabolic pathway) rather than imported.

  18. Amadurecimento de frutos de cubiu (Solanum sessiliflorum Dunal tratados com Etefon Postharvest ripening of Ethephon-treated cubiu (Solanum sessiliflorum Dunal fruits

    Directory of Open Access Journals (Sweden)

    Suzana Stefanello

    2010-09-01

    Full Text Available O presente trabalho teve como objetivo avaliar a qualidade pós-colheita de frutos de cubiu (Solanum sessiliflorum durante o amadurecimento após o tratamento com Etefon. Frutos das variedades Santa Luzia e Thais no estádio verde-maduro foram coletados, lavados e pulverizados até o completo molhamento com 1000 mg L-1 de Etefon e o controle com água. A cada três dias, durante 12 dias foram realizadas análises da firmeza do pericarpo, pH, teor de sólidos solúveis totais, acidez total titulável (ATT, umidade e cinzas. Foi avaliada a liberação de C0(2 e etileno diariamente durante 12 dias, conjuntamente com a perda de matéria fresca e evolução da cor, a cada três dias, sempre no mesmo grupo de frutos. Foi empregado o delineamento experimental inteiramente casualizado. Os dados foram submetidos à análise de variância e análise de regressão. Ocorreu perda de firmeza do pericarpo dos frutos com o tempo de armazenamento pós-colheita, com diminuição do pH, aumento da ATT e perda da matéria fresca. A aplicação de Etefon promoveu poucas mudanças na qualidade interna dos frutos, porém foi eficiente no desverdecimento da casca, o que pode ser verificado pelos menores valores do ângulo de cor e maiores da cromaticidade e luminosidade. O comportamento da respiração e produção de etileno aponta para um modelo de amadurecimento não climatérico.The objective of the present work was to evaluate postharvest quality of cubiu (Solanum sessiliflorum fruits during ripening after Ethephon treatment. Fruits from the varieties Santa Luzia and Thais were harvested at green-mature stage, washed and sprayed until run off with Ethephon (0 e 1000 mg L-1. At every three days, during 12 days, the following analyses were performed: pericarp firmness, pH, total soluble solid content, total titratable acidity (ATT, water content and ashes. CO2 and ethylene production were evaluated daily for 12 days, together with the loss of fresh matter and color evolution, at every three days, always the same fruit group. The experiment was arranged in a complete randomized design. Data were examined by analysis of variance and regression analysis. There was loss of pericarp firmness with time of postharvest storage, with decrease in pH, increase in ATT and loss of fresh matter. Ethephon promoted small changes in the internal quality of fruits, whereas it was efficient to induce degreening of fruit peel, which can be verified by the lower color angles and higher chromaticity and brightness. Respiration rates and ethylene production of the fruit suggest that cubiu has non-climateric behavior.

  19. Plastisphere in action: evidence for an interaction between expanded polystyrene and dunal plants.

    Science.gov (United States)

    Poeta, Gianluca; Fanelli, Giuliano; Pietrelli, Loris; Acosta, Alicia T R; Battisti, Corrado

    2017-04-01

    Among the many threats that can be recorded on sandy beaches, plastic litter represents a serious problem for these complex and endangered ecosystems. Expanded polystyrene (EPS) is increasingly abundant as a form of plastic litter in natural environments, particularly along shores and waterways. Nevertheless, despite the great number of scientific articles concerning the impact of litter on animal species, there are still no research focusing on the interaction between this type of beach litter and other biodiversity components. In this work, we reported the first evidence of interactions between EPS and living plants along a sandy beach of Tyrrhenian central Italy. We sampled 540 EPS items, mainly deriving from fishery activities (>75%). We obtained evidence for an interaction between EPS and plants: about 5% of items resulted perforated or have roots of three species (Phragmites australis, Spartina versicolor, Anthemis maritima). Apparently, we did not observed a relationship between plants and EPS items size. More research is needed to assess if the plant assemblage growing on EPS is random or if peculiar substrate exerts some sort of selection on the plant community.

  20. Chemical characterization of the pulp, peel and seeds of cocona (Solanum sessiliflorum Dunal)

    National Research Council Canada - National Science Library

    Liliana SERNA-COCK; Diana Patricia VARGAS-MUÑOZ; Carlos Andrés RENGIFO-GUERRERO

    2015-01-01

    ....). The carbohydrate, dietary fibre and mineral contents of the pulp, peel and seeds also highlighted the agroindustrial potential of the fruit in that these constituents could be used to develop...

  1. Optimization of osmotic dehydration ofTerung Asam(Solanum lasiocarpumDunal).

    Science.gov (United States)

    Chiu, Moi-Thin; Tham, Heng Jin; Lee, Jau-Shya

    2017-09-01

    This study was designed to determine the effect of osmotic dehydration (OD) process temperature (35-55 °C), sucrose concentration (40-60% w/w) and immersion time (90-210 min) on the water loss (WL), solid gain (SG), DPPH radical scavenging activity, ferric reducing antioxidant power (FRAP) and sensory quality of the dehydrated Terung Asam slices. Response Surface Methodology with Central Composite Design was applied to investigate the influence of these variables on the aforementioned responses. The increase in the levels of these processing parameters increased the WL and SG. The antioxidant activities also increased with sugar concentration, but reduced with immersion time and temperature elevation. About 36-80% of IC 50 and 47-72% of FRAP were depleted after osmotic process. The loss of antioxidants was predominantly due to leaching during osmotic treatment rather than hot air drying. Despite the losses of these compounds, osmotic pretreatment was able to improve the sensory quality of the product. The optimum OD process condition was predicted as process temperature 38.1 °C, sucrose concentration 55.6% and osmotic duration 126.3 min.

  2. Experimental therapeutic studies of Solanum aculeastrum Dunal. on Leishmania major infection in BALB/c mice

    Directory of Open Access Journals (Sweden)

    Linet T Laban

    2015-01-01

    Conclusion: The results demonstrate that compounds from S. aculeastrum have potential anti-leishmanial activities and the medicinal use of the plant poses considerable toxicity against dividing vero cells.

  3. Microbial secondary metabolites ameliorate growth, in planta contents and lignification in Withania somnifera (L.) Dunal.

    Science.gov (United States)

    Singh, Akanksha; Gupta, Rupali; Srivastava, Madhumita; Gupta, M M; Pandey, Rakesh

    2016-04-01

    In the present investigation, metabolites of Streptomyces sp. MTN14 and Trichoderma harzianum ThU significantly enhanced biomass yield (3.58 and 3.48 fold respectively) in comparison to the control plants. The secondary metabolites treatments also showed significant augmentation (0.75-2.25 fold) in withanolide A, a plant secondary metabolite. Lignin deposition, total phenolic and flavonoid content in W. somnifera were maximally induced in treatment having T. harzianum metabolites. Also, Trichoderma and Streptomyces metabolites were found much better in invoking in planta contents and antioxidants compared with their live culture treatments. Therefore, identification of new molecular effectors from metabolites of efficient microbes may be used as biopesticide and biofertilizer for commercial production of W. somnifera globally.

  4. An efficient hairy root culture system for Withania somnifera (L.) Dunal

    African Journals Online (AJOL)

    Withania somnifera is an important aromatic medicinal plant and possesses wide array of pharmacological properties. In the present investigation, an improved version of hairy root culture system was developed by optimizing various transformation parameters such as type of explant, concentration of acetosyringone, ...

  5. Effect of Withania somnifera (L.) Dunal on Sex Hormone and Gonadotropin Levels in Addicted Male Rats.

    Science.gov (United States)

    Rahmati, Batool; Ghosian Moghaddam, Mohammad Hassan; Khalili, Mohsen; Enayati, Ehsan; Maleki, Maryam; Rezaeei, Saeedeh

    2016-01-01

    Opioid consumption has been widely increasing across the globe; how- ever, it can cause adverse effects on the body. Morphine, an opioid, can reduce sex hor- mones and fertility. Withania somnifera (WS) is a traditional herb used to improve sexual activities. This study strives to investigate the effect of WS on sex hormones and gonado- tropins in addicted male rats. In this experimental study, forty-eight male National Maritime Research Institute (NMRI) rats were randomly divided into four groups: i. Control group, ii. WS-treated control group, iii. Addicted group, and iv. WS-treated addicted group. Wa- ter-soluble morphine was given to rats for 21 days to induce addiction, concurrently the treated groups (2 and 4) also received WS plant-mixed pelleted food (6.25%). At the end of the treatment, the sex hormone and gonadotropin levels of the rats' sera were deter- mined in all the groups. Except for follicle-stimulating hormone (FSH), morphine reduced most of the gonadotropin and sex hormone levels. Whereas WS caused a considerable increase in the hormones in the treated addicted group, there was only a slight increase in the treated control group. WS increased sex hormones and gonadotropins-especially testosterone, es- trogen, and luteinizing hormone-in the addicted male rats and even increased the proges- terone level, a stimulant of most sex hormones in addicted male rats.

  6. Effect of Withania somnifera (L. Dunal on Sex Hormone and Gonadotropin Levels in Addicted Male Rats

    Directory of Open Access Journals (Sweden)

    Rahmati Batool

    2016-07-01

    Full Text Available Background Opioid consumption has been widely increasing across the globe; how- ever, it can cause adverse effects on the body. Morphine, an opioid, can reduce sex hor- mones and fertility. Withania somnifera (WS is a traditional herb used to improve sexual activities. This study strives to investigate the effect of WS on sex hormones and gonado- tropins in addicted male rats. Materials and Methods In this experimental study, forty-eight male National Maritime Research Institute (NMRI rats were randomly divided into four groups: i. Control group, ii. WS-treated control group, iii. Addicted group, and iv. WS-treated addicted group. Wa- ter-soluble morphine was given to rats for 21 days to induce addiction, concurrently the treated groups (2 and 4 also received WS plant-mixed pelleted food (6.25%. At the end of the treatment, the sex hormone and gonadotropin levels of the rats’ sera were deter- mined in all the groups. Results Except for follicle-stimulating hormone (FSH, morphine reduced most of the gonadotropin and sex hormone levels. Whereas WS caused a considerable increase in the hormones in the treated addicted group, there was only a slight increase in the treated control group. Conclusion WS increased sex hormones and gonadotropins-especially testosterone, es- trogen, and luteinizing hormone-in the addicted male rats and even increased the proges- terone level, a stimulant of most sex hormones in addicted male rats.

  7. Efficacy of Ashwagandha (Withania somnifera Dunal. Linn.) in the management of psychogenic erectile dysfunction.

    Science.gov (United States)

    Mamidi, Prasad; Thakar, A B

    2011-07-01

    Erectile dysfunction (ED) has been defined as the persistent inability to attain and maintain an erection sufficient to permit satisfactory sexual performance. By 2025, men with ED will be approximately 322 million, an increase of nearly 170 million men from 1995. The present study was aimed to evaluate the efficacy of Ashwagandha (Withania somnifera) in the management of psychogenic erectile dysfunction. In this study, a total of 95 patients with psychogenic erectile dysfunction satisfying the DSM IV TR diagnostic criteria were selected, out of them 86 patients completed the course of treatment. In Trial Group, Ashwagandha root powder and in Control group, Placebo (Wheat powder) were given for 60 days. Treatment selection and its allocation were done by following computerized randomization plan. Criterion of assessment was based on the scoring of International Index of Erectile Function (IIEF) Scale. Paired and Unpaired t test were used for statistical analysis. In Trial group (n=41), 12.6% and in Control group (n=45), 19.11% of improvement was observed with the significance of (P0.05) found in between the two groups. Both Ashwagandha and Placebo provided no relief (<25% improvement on IIEF) in psychogenic erectile dysfunction.

  8. Influence of lunar cycles on growth of Ashwagandha (Withania somnifera [L.] Dunal).

    Science.gov (United States)

    Tavhare, Swagata D; Nishteswar, K; Shukla, Vinay J

    2015-01-01

    Ayurvedic classics have advocated to collect the medicinal plants according to part used and seasons in order to get desired pharmacological action and therapeutic benefits. The logic behind this principle is being validated by recent researches. To analyze the influence of lunar cycles on growth of Ashwagandha in Shishira and Greeshma Ritu (winter and summer season). Fourteen small crops of Ashwagandha of average size 10 cm were collected on October 7, 2013, from institute campus and then replantation was done at Charaka Herbal Garden, Gujarat Ayurved University, Jamnagar in an area of 60 cm × 60 cm (l × b). No fertilizers or pesticides were used. The plants were watered daily and plants were uprooted as per lunar cycles for analysis. Eight samples were collected and observed during Shishira and Greeshma season on Pournima (full moon) and Amavasya (new moon) days. The measurements were taken thrice and average values were taken into consideration for study purpose. The variations in morphological characteristics such as length, breadth, weight, and number of roots and twigs were studied through statistical procedure of principle component analysis, which makes interpretation of all possible related variables. Root weight (RW), pith diameter (PD) and internodal distance (ID) were found to be increased on full moon days as compared to new moon days. The maximum RW was observed during Greeshma Aashadha Pournima. The study has shown a definite influence of lunar cycles on the growth of the plant parts assessed by RW, PD, and ID that have found to be increased on full moon days as compared to new moon days.

  9. Withanolide biosynthesis recruits both mevalonate and DOXP pathways of isoprenogenesis in Ashwagandha Withania somnifera L. (Dunal).

    Science.gov (United States)

    Chaurasiya, Narayan D; Sangwan, Neelam S; Sabir, Farzana; Misra, Laxminarain; Sangwan, Rajender S

    2012-10-01

    Withanolides are pharmaceutically important C(28)-phytochemicals produced in most prodigal amounts and diversified forms by Withania somnifera. Metabolic origin of withanolides from triterpenoid pathway intermediates implies that isoprenogenesis could significantly govern withanolide production. In plants, isoprenogenesis occurs via two routes: mevalonate (MVA) pathway in cytosol and non-mevalonate or DOXP/MEP pathway in plastids. We have investigated relative carbon contribution of MVA and DOXP pathways to withanolide biosynthesis in W. somnifera. The quantitative NMR-based biosynthetic study involved tracing of (13)C label from (13)C(1)-D-glucose to withaferin A in withanolide producing in vitro microshoot cultures of the plant. Enrichment of (13)C abundance at each carbon of withaferin A from (13)C(1)-glucose-fed cultures was monitored by normalization and integration of NMR signal intensities. The pattern of carbon position-specific (13)C enrichment of withaferin A was analyzed by a retro-biosynthetic approach using a squalene-intermediated metabolic model of withanolide (withaferin A) biosynthesis. The pattern suggested that both DOXP and MVA pathways of isoprenogenesis were significantly involved in withanolide biosynthesis with their relative contribution on the ratio of 25:75, respectively. The results have been discussed in a new conceptual line of biosynthetic load-driven model of relative recruitment of DOXP and MVA pathways for biosynthesis of isoprenoids. Key message The study elucidates significant contribution of DOXP pathway to withanolide biosynthesis. A new connotation of biosynthetic load-based role of DOXP/MVA recruitment in isoprenoid biosynthesis has been proposed.

  10. Breeding systems in some representatives of the genus Lycium (Solanaceae

    Directory of Open Access Journals (Sweden)

    L. Minne

    1994-12-01

    Full Text Available The development of the ovule and the embryo sac of five of the 17 species of Lycium and of one hybrid, recorded for southern Africa, was investigated. All specimens of four of the species and the hybrid (between a hermaphroditic and a functionally dioecious species were found to be functionally dioecious: they express only one sex, although both male and female organs are present in the same tlower. One species was hermaphroditic. The embryo sacs of all species, and of the hybrid, were of the normal eight-nucleate Polygonum type. The structure of the ovary and the development of the embryo sac are similar to those of L europaeum L. The absence of unreduced embryo sacs indicates that apomixis does not occur at any ploidy level in the species studied.

  11. Systematic Review of Chemical Constituents in the Genus Lycium (Solanaceae).

    Science.gov (United States)

    Qian, Dan; Zhao, Yaxing; Yang, Guang; Huang, Luqi

    2017-06-08

    The Lycium genus is widely used as a traditional Chinese medicine and functional food. Many of the chemical constituents of the genus Lycium were reported previously. In this review, in addition to the polysaccharides, we have enumerated 355 chemical constituents and nutrients, including 22 glycerogalactolipids, 29 phenylpropanoids, 10 coumarins, 13 lignans, 32 flavonoids, 37 amides, 72 alkaloids, four anthraquinones, 32 organic acids, 39 terpenoids, 57 sterols, steroids, and their derivatives, five peptides and three other constituents. This comprehensive study could lay the foundation for further research on the Lycium genus.

  12. Systematic Review of Chemical Constituents in the Genus Lycium (Solanaceae

    Directory of Open Access Journals (Sweden)

    Dan Qian

    2017-06-01

    Full Text Available The Lycium genus is widely used as a traditional Chinese medicine and functional food. Many of the chemical constituents of the genus Lycium were reported previously. In this review, in addition to the polysaccharides, we have enumerated 355 chemical constituents and nutrients, including 22 glycerogalactolipids, 29 phenylpropanoids, 10 coumarins, 13 lignans, 32 flavonoids, 37 amides, 72 alkaloids, four anthraquinones, 32 organic acids, 39 terpenoids, 57 sterols, steroids, and their derivatives, five peptides and three other constituents. This comprehensive study could lay the foundation for further research on the Lycium genus.

  13. Solanaceae III: henbane, hags and Hawley Harvey Crippen.

    Science.gov (United States)

    Lee, M R

    2006-12-01

    Hyoscyamus, the henbane, is one of the drugs of the ancients. Initially used both as a poison and narcotic, it was widely adopted by witches, wizards and soothsayers as a component of their hallucinatory and flying ointments. It was also used by notorious poisoners such as Madame Voisin in France. Eventually, in the nineteenth century its active principle was isolated by Ladenburg and called l-hyoscine. It proved to be a tropane alkaloid very similar to atropine. These two alkaloids proved to be very important in the study of the parasympathetic component of the autonomic nervous system, and together with physostigmine, allowed the major neurotransmitter acetylcholine to be isolated and its mechanisms of action to be characterised. The Crippen murder case in 1910 gave hyoscine further fame, indeed, notoriety. The unassuming homeopathic doctor murdered his wife with the alkaloid and then decamped for Canada with his mistress Ethel Le Neve. The case became a worldwide sensation for several reasons: the arrest of the fugitive couple by wireless telegraphy (Marconigram) and the extensive chemical and histological evidence presented by Willcox and Spilsbury. Some authorities claim that this was the beginning of the science of forensic medicine in Britain. Hyoscine is now hardly ever used in modern therapeutics but its history from antiquity to the witches and on to Dr Crippen is both bizarre and fascinating.

  14. Genetics, breeding and selection of rootstocks for Solanaceae and Cucurbitaceae

    Science.gov (United States)

    Limited availability of arable land and high market demand for off-season vegetables often leads to continuous cultivation and cultivation under unfavorable conditions such as too cold, wet, dry, or under low-light winter greenhouses. Successive cropping can increase salinity, the incidence of vege...

  15. Meristem maturation and inflorescence architecture--lessons from the Solanaceae.

    Science.gov (United States)

    Park, Soon Ju; Eshed, Yuval; Lippman, Zachary B

    2014-02-01

    Plant apical meristems (AMs) grow continuously by delicately balancing cells leaving at the periphery to form lateral organs with slowly dividing central domain cells that replenish reservoirs of pluripotent cells. This balance can be modified by signals originating from within and outside the meristem, and their integration results in a gradual maturation process that often culminates with the meristem differentiating into a flower. Accompanying this 'meristem maturation' are changes in spacing and size of lateral organs and in rates at which lateral meristems are released from apical dominance. Modulation of distinct meristem maturation parameters through environmental and genetic changes underlies the remarkable diversity of shoot architectures. Here, we discuss recent studies relating the dynamics of meristem maturation with organization of floral branching systems--inflorescences--in the nightshades. From this context, we suggest general principles on how factors coordinating meristem maturation impact shoot organization more broadly. Published by Elsevier Ltd.

  16. Annotated checklist of Solanum L. (Solanaceae) for Peru

    Science.gov (United States)

    The genus Solanum is among the most species-rich genera both of the Peruvian flora and of the tropical Andes in general. The present revised checklist treats 276 species of Solanum L., of which 253 are native, while 23 are introduced and/or cultivated. A total of 74 Solanum species (29% of native sp...

  17. Taxonomy of Cultivated Potatoes (Solanum section Petota: Solanaceae)

    Science.gov (United States)

    Solanum tuberosum, the cultivated potato of world commerce, is a primary food crop worldwide. Wild and cultivated potatoes form the germplasm base for international breeding efforts to improve potato in the face of variety of disease, environmental, and agronomic constraints. A series of national an...

  18. Physalis (Solanaceae) In Nigeria | Olorode | Ife Journal of Science

    African Journals Online (AJOL)

    Ife Journal of Science. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 15, No 1 (2013) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load here ...

  19. Six cultivars of Solanum macrocarpon (Solanaceae in Ghana

    Directory of Open Access Journals (Sweden)

    Z. R. Bukenya

    1987-10-01

    Full Text Available The  Solanum macrocarpon complex (the cultivated egg plant has been studied in Ghana using morphological and experimental methods. Six cultivars belonging to the S.  macrocarpon complex have been recognized and described. The cultivars are  S. macrocarpon ‘Gboma’,  S. macrocarpon ‘Mankessim’,  S. macrocarpon ‘Akwaseho’,  S. macrocarpon ‘Kade’,  S. macrocarpon ‘Sarpeiman’ and  S. macrocarpon ‘Bui’. The very spiny, hairy plant traditionally called S. dasyphyllum is regarded as the wild ancestor from which the cultivars have been derived through a process of crop evolution. The variation within S. macrocarpon complex is attributable to genotypic differences and environmental factors.

  20. Comparative genetics of disease resistance within the solanaceae.

    Science.gov (United States)

    Grube, R C; Radwanski, E R; Jahn, M

    2000-06-01

    Genomic positions of phenotypically defined disease resistance genes (R genes) and R gene homologues were analyzed in three solanaceous crop genera, Lycopersicon (tomato), Solanum (potato), and Capsicum (pepper). R genes occurred at corresponding positions in two or more genomes more frequently than expected by chance; however, in only two cases, both involving Phytophthora spp., did genes at corresponding positions have specificity for closely related pathogen taxa. In contrast, resistances to Globodera spp., potato virus Y, tobacco mosaic virus, and tomato spotted wilt virus were mapped in two or more genera and did not occur in corresponding positions. Without exception, pepper homologues of the cloned R genes Sw-5, N, Pto, Prf, and I2 were found in syntenous positions in other solanaceous genomes and in some cases also mapped to additional positions near phenotypically defined solanaceous R genes. This detailed analysis and synthesis of all available data for solanaceous R genes suggests a working hypothesis regarding the evolution of R genes. Specifically, while the taxonomic specificity of host R genes may be evolving rapidly, general functions of R alleles (e.g., initiation of resistance response) may be conserved at homologous loci in related plant genera.

  1. Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant' Anna, Carlos M.R., E-mail: mgeraldo@ufrrj.b [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Dept. de Quimica; Benassi Neto, Mario; Eberlin, Marcos N. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacases, RJ (Brazil). Setor de Quimica de Produtos Naturais. Lab. de Ciencias Quimicas

    2010-07-01

    The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-{beta}-D-apiofuranosyl-(1->5)-{beta}-D-apiofuranosyl-(1->6)-{beta}-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete {sup 1}H and {sup 13}C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)

  2. Genetic structure of European accessions of Solanum dulcamara L. (Solanaceae)

    NARCIS (Netherlands)

    Golas, T.M.; Feron, R.M.C.; Berg, van den R.G.; Weerden, van der G.M.; Mariani, C.; Allefs, J.J.H.M.

    2010-01-01

    Solanum dulcamara (bittersweet) is one of the few native species of Solanum present in Europe. It is a common weed that occupies a wide range of habitats and is often found in the direct vicinity of cultivated potatoes (Solanum tuberosum), where it could transmit diseases. A broad sampling of

  3. Breeding systems in some representatives of the genus Lycium (Solanaceae

    Directory of Open Access Journals (Sweden)

    L. Minne

    1994-10-01

    Full Text Available The development of the ovule and the embryo sac of five of the 17 species of Lycium and of one hybrid, recorded for southern Africa, was investigated. All specimens of four of the species and the hybrid (between a hermaphroditic and a functionally dioecious species were found to be functionally dioecious: they express only one sex, although both male and female organs are present in the same tlower. One species was hermaphroditic. The embryo sacs of all species, and of the hybrid, were of the normal eight-nucleate Polygonum type. The structure of the ovary and the development of the embryo sac are similar to those of L europaeum L. The absence of unreduced embryo sacs indicates that apomixis does not occur at any ploidy level in the species studied.

  4. Fatty acid composition of Brunfelsia uniflora (Solanaceae seed oil

    Directory of Open Access Journals (Sweden)

    Guzmán, C. A.

    1995-04-01

    Full Text Available The seeds of Brunfelsia uniflora contained 30.5% of oil. The oil was analysed and components were identified by infrared (IR, gas chromatography-mass spectrometry (GC-MS and chemical methods. Linoleic acid predominated (75.5% followed by oleic (11.8% and palmitic (7.25% acids. Ricinoleic acid was present in small quantities (0.52%.Las semillas de Brunfelsia uniflora contuvieron 30.5% de aceite. El aceite fue analizado y los componentes fueron indentificados por espectroscopia de infrarrojo (IR, cromatografía gaseosa-espectrometría de masa (CGEM y métodos químicos. Predominó el ácido linoleico (75.5% seguido por el oleico (11.8% y el palmítico (7.25%. El ácido ricinoleico estuvo presente en pequeñas cantidades (0.52%.

  5. Flower Colour Inheritance in Nicotiana alata (Solanaceae) and its ...

    African Journals Online (AJOL)

    In Nicotiana alata, flower colour inheritance has followed Mendelian inheritance with dark colours being dominant over lighter colours. Reciprocal crosses concluded the absence of the cytoplasm involvement in the determination of flower colour. The backcross confirmed the dominant nature of red as the backcross ...

  6. An explosive innovation: Phylogenetic relationships of Solanum section Gonatotrichum (Solanaceae

    Directory of Open Access Journals (Sweden)

    Stephen Stern

    2012-01-01

    Full Text Available Solanum is one of the largest plant genera and exhibits a wide range of morphological diversity. Solanum section Gonatotrichum, the focus of this study, is unique within the genus because of its fruits that swell with turgor pressure and explosively dehisce to disperse the seeds. We infer phylogenetic relationships within section Gonatotrichum using DNA sequence data from two nuclear regions (ITS and the granule-bound starch synthase gene [GBSSI or waxy] and the chloroplast region trnT-F. The resulting phylogenetic trees support the monophyly of the section with the inclusion of S. lignescens, a species not previously thought to belong to the group due to the presence of stellate hairs. This inclusion of this species in section Gonatotrichum suggests that the simple, often geniculate hairs of species in the group may represent reduced stellate hairs. The presence of heterantherous flowers appears to be derived in the section, but this character is largely lost in S. parcistrigosum.

  7. Annotated checklist of Solanum L. (Solanaceae for Peru

    Directory of Open Access Journals (Sweden)

    Tiina Särkinen

    2015-04-01

    Full Text Available The genus Solanum is among the most species-rich genera both of the Peruvian flora and of the tropical Andes in general. The present revised checklist treats 276 species of Solanum L., of which 253 are native, while 23 are introduced and/or cultivated. A total of 74 Solanum species (29% of native species are endemic to Peru. Additional 58 species occur only in small number of populations outside Peru, and these species are here labelled as near-endemics to highlight the role Peru playes in their future protection. Species diversity is observed to peak between 2500 – 3000 m elevation, but endemic species diversity is highest between 3000 – 3500 m elevation. Cajamarca has the highest number of endemic (29 spp. and total species (130 spp., even when considering the effect of area. Centers of endemic species diversity are observed in provinces of Cajamarca (Cajamarca, Huaraz and Carhuaz (Ancash, and Canta and Huarochirí (Lima. Secondary centres of endemism with high concentrations of both endemics and near-endemics are found in San Ignacio and Cutervo (Cajamarca, Santiago de Chuco (La Libertad, Oxapampa (Pasco, and Cusco (Cusco. Current diversity patterns are highly correlated with collection densities, and further collecting is needed across all areas, especially from Arequipa, Ayacucho, Puno, Ancash, Huánuco, Amazonas and Cajamarca, where high levels of species diversity and endemism are indicated but only a few collections of many species are known.

  8. Phytochemical investigation of the tomatillo fruit (Physalis ixocarpa Brot., Solanaceae

    Directory of Open Access Journals (Sweden)

    K. Drost-Karbowska

    2014-01-01

    Full Text Available The occurence of alkaloids, witanolides, saponosides and flavonoids was investigated in the fruits of tomatillo (Physalis ixocarpa Brot. cv. Bujna and Rendidora. The tomatillo is commonly cultivated in Mexico and has been introduced on a small scale in Poland. The chromatographic analysis of alkaloids showed only trace amounts of compounds reacting with the Dragendorff reagent. In the fraction of quaternary alkaloids soluble in water, only choline was found. Witanolides were not detected in tomatillo fruits. The saponosides were found only in trace amounts and their hemolytic indexes as well as saponification numbers were very low. Flavonoids were represented by the derivatives of quercetine differring with their sugar moieties attached to the hydroxyl group at C-3. It is concluded that the toxic compounds which would be harmful to human health were not found in tomatillo fruits. The presence of choline in them, as well as of flavonoids belonging to the vitamin P group is advantageous for health.

  9. Amelioration of bromobenzene hepatotoxicity by Withania somnifera pretreatment: Role of mitochondrial oxidative stress

    Directory of Open Access Journals (Sweden)

    Mahima Vedi

    2014-01-01

    Full Text Available The present study investigated the possible protective role of Withania somnifera (Linn. Dunal (Solanaceae root powder against bromobenzene-induced oxidative damage in rat liver mitochondria. Administration of bromobenzene (10 mmol/kg body weight to rats resulted in increased levels of liver marker enzymes, lipid peroxidation, TNF-α, IL-1β and VEGF. There was also marked depletion in the levels of mitochondrial enzymes and antioxidant activity. Pre-treatment with W. somnifera significantly decreased the levels of liver marker enzymes, TNF-α, IL-1β, VEGF and ameliorated histopathological manifestations in bromobenzene-treated rats. The molecular docking analysis predicted that the pro-inflammatory mediator NF-κB showed significant interaction with selected various active components of W. somnifera (withaferin A, withanolide D and withanolide E. This study demonstrates a good protective effect of W. somnifera against bromobenzene-induced oxidative stress.

  10. Phospholipid complexation of NMITLI118RT+: way to a prudent therapeutic approach for beneficial outcomes in ischemic stroke in rats.

    Science.gov (United States)

    Ahmad, Hafsa; Arya, Abhishek; Agrawal, Satish; Samuel, Sheeba Saji; Singh, Sandeep Kumar; Valicherla, Guru Raghavendra; Sangwan, Neelam; Mitra, Kalyan; Gayen, Jiaur R; Paliwal, Sarwesh; Shukla, Rakesh; Dwivedi, Anil Kumar

    2016-11-01

    Withania somnifera Dunal (Solanaceae) known as Ashwagandha, a popular plant of Indian origin is known to possess tremedous medicinal potential, often used as anti-inflammatory, anti-platelet, antihypertensive, hypoglycemic, hypolipidemic and adaptogenic candidate. Some of its chemotypes developed by CSIR, India includes NMITLI-101, NMITLI-118, NMITLI-128. In this study the investigators have attempted development of a phytosomal complex of NMITLI118RT + (standardized ethanolic extract of a new chemotype of W. somnifera Dunal.), its pharmaceutical characterization and evaluation of its neuro-protective potential against experimenal stroke in rats in continuation with their previous work in this area. The phytosomal complex (NIMPLC) was prepared by following a cohesive optimization design and was characterized on the basis of solubility, dissolution profile, FT-IR, DSC-TGA analysis, zeta potential, physical stability, forced degradation and photolytic degradation. Results were suggestive of a pharmaceutically acceptable formulation. NIMPLC was taken up further for biological evaluation using the middle cerebral artery occlusion (MCAO) model in rats. It could be demonstrated that the beneficial effects of NMITLI118RT + could be augmented by NIMPLC in 1 h pre and 6 h post treatment as was evident from reduction in MDA levels, increment in GSH levels, reduction in neurological deficit (ND) scores and reduction in infarct size. The study could successfully demonstrate the beneficial effects of NIMPLC in brain function restoration following stroke.

  11. Desenvolvimento e aceitabilidade de geléia dietética de cubiu (Solanum sessiliflorum Dunal Development and acceptability of a low calorie cubiu (Solanum sessiliflorum Dunal jam

    Directory of Open Access Journals (Sweden)

    Lucia Kiyoko Ozaki Yuyama

    2008-12-01

    Full Text Available Visando o aproveitamento de frutos amazônicos e atender à demanda crescente por novos produtos no mercado, foi formulada e avaliada a aceitabilidade e vida-de-prateleira da geléia de cubiu contendo xilitol em substituição à sacarose. Os frutos procedentes da Estação Experimental do Ariaú do Instituto Nacional de Pesquisas da Amazônia foram branqueados, despolpados, triturados, peneirados e acondicionados em embalagens plásticas à temperatura de -20 ± 1 °C até o momento da utilização. Concomitantemente, uma alíquota da polpa foi analisada quanto à umidade, proteínas, lipídios, fibras solúveis e insolúveis, cinza, pH, acidez total, açúcares totais e redutores, e compostos fenólicos. Para a formulação da geléia com uso de xilitol e convencional foi utilizada a proporção de 1:1 (polpa:xilitol e polpa:sacarose, respectivamente. A mistura foi concentrada até a obtenção de 65 °Brix , com ajuste de pH e adição de pectina. As geléias foram avaliadas quanto aos teores de proteínas, lipídios, cinza, pH, acidez, açúcares e compostos fenólicos e a vida-de-prateleira por meio de análises físico-química, microbiológica e sensorial, mensalmente, por um período de 180 dias. Os resultados demonstraram que não houve diferença estatística entre a aceitabilidade das geléias à base de xilitol e convencional, e que ambas apresentaram estabilidade físico-química e microbiológica durante o seu armazenamento. O xilitol pode ser uma alternativa viável em substituição à sacarose para o preparo de geléia de cubiu.With the aim of improving utilization of Amazonian fruits and satisfying the growing demand for new products in the market, we formulated a low calorie cubiu jam with xylitol as a sucrose substitute, and evaluated its shelf life and acceptability. The cubiu fruits from the Experimental Station of the National Research Institute of Amazonia (INPA were harvested, bleached, pealed, ground, sieved, and stored in plastic bags at -20 ± 1 °C until their utilization. At the same time, triplicate samples of the cubiu pulp were analysed for humidity, protein, lipids, soluble and insoluble fibers, ash, pH, total acidity, total and reducing sugars, and phenolic compounds. The conventional and the xylitol-based jams were prepared with a 1:1 proportion of pulp:sucrose or pulp:xylitol, respectively. The mixture was concentrated up to 65° Brix with pH adjustment and pectin addition. The jams were analyzed for protein, lipids, ash, pH, acidity, sugar, and phenolic compounds. The shelf life was evaluated through monthly physicochemical, microbiological, and sensory analyses for a period of 180 days. The results showed no statistical difference between the acceptability of conventional and xylitol-based jams and presented the same physicochemical, microbiological stability during storage. Xylitol can be a viable sucrose substitute for the preparation of cubiu jams.

  12. Chemical characterization of the pulp, peel and seeds of cocona (Solanum sessiliflorum Dunal)/Caracterização química da polpa, casca e sementes de cocona (Solanum sessiliflorum Dunal)

    National Research Council Canada - National Science Library

    Liliana Serna-Cock; Diana Patricia Vargas-Muñoz; Carlos Andrés Rengifo-Guerrero

    2015-01-01

    ....). The carbohydrate, dietary fibre and mineral contents of the pulp, peel and seeds also highlighted the agroindustrial potential of the fruit in that these constituents could be used to develop...

  13. Role of growth regulators on in vitro regeneration and histological analysis in Indian ginseng (Withania somnifera L.) Dunal.

    Science.gov (United States)

    Fatima, Nigar; Anis, Mohammad

    2012-01-01

    An efficient, rapid and improved in vitro plant regeneration protocol has been established for Withania somnifera L. using shoot tip and nodal explants, excised from 15 days old aseptic seedlings. A range of cytokinins were investigated for multiple shoot regeneration. Of the three cytokinins, 6-benzyladenine (BA), Kinetin (Kin) and 2-isopentenyl adenine (2-iP) evaluated as supplement to Murashige and Skoog (MS) medium, BA at an optimal concentration of 2.5 μM was most effective in proliferating apical and axillary buds. The highest regeneration frequency (95 %) and number of shoots (36.1 ± 0.33) were obtained on MS medium fortified with BA (2.5 μM) and NAA (0.5 μM) from nodal segments. High frequency of rooting (100 %) was obtained in in vitro raised shoots when transferred to half-strength MS medium supplemented with NAA (0.5 μM). Histological sections revealed that additional shoot bud primordia were differentiated within the explants just underneath the suberized cells which appeared to be arrested in their development. The presence of additional bud primordia within the explants is thereby helpful to maximize the potential of this system. The regenerated plantlets with well developed shoots and roots were hardened successfully, established in earthen pots containing garden soil and maintained in greenhouse with 95 % survival rate.

  14. Entomofauna asociada con la Cocona (Solanum sessiliflorum dunal) en Tingo María, Huánuco

    OpenAIRE

    Anteparra M., E.; Ruiz S., M.; Granados L., B.; Díaz W., C.

    2016-01-01

    El trabajo forma parte de las memorias del I Encuentro de Investigadores Ambientales: Avances de la Investigación Ambiental en la Región Amazonas, desarrollado del 12 al 13 de diciembre del 2012 en la ciudad de Iquitos. Tiene por finalidad dar a conocer los diferentes artrópodos que están asociados con la parte aérea de este cultivo, a fin de poder establecer estrategias de manejo dentro del cultivo de la cocona. Se han colectado cincuenta especies de insectos asociadas con la cocona. Se han ...

  15. Sonication, Vacuum Infiltration and Thiol Compounds Enhance the Agrobacterium-Mediated Transformation Frequency of Withania somnifera (L.) Dunal

    Science.gov (United States)

    Sivanandhan, Ganeshan; Kapil Dev, Gnajothi; Theboral, Jeevaraj; Selvaraj, Natesan; Ganapathi, Andy; Manickavasagam, Markandan

    2015-01-01

    In the present study, we have established a stable transformation protocol via Agrobacterium tumafacines for the pharmaceutically important Withania somnifera. Six day-old nodal explants were used for 3 day co-cultivation with Agrobacterium tumefaciens strain LBA4404 harbouring the vector pCAMIBA2301. Among the different injury treatments, sonication, vacuum infiltration and their combination treatments tested, a vacuum infiltration for 10 min followed by sonication for 10 sec with A. tumefaciens led to a higher transient GUS expression (84% explants expressing GUS at regenerating sites). In order to improve gene integration, thiol compounds were added to co-cultivation medium. A combined treatment of L-Cys at 100 mg/l, STS at 125 mg/l, DTT at 75 mg/l resulted in a higher GUS expression (90%) in the nodal explants. After 3 days of co-cultivation, the explants were subjected to three selection cycles with increasing concentrations of kanamycin [100 to 115 mg/l]. The integration and expression of gusA gene in T0 and T1 transgenic plants were confirmed by polymerase chain reaction (PCR), and Southern blott analysis. These transformed plants (T0 and T1) were fertile and morphologically normal. From the present investigation, we have achieved a higher transformation efficiency of (10%). Withanolides (withanolide A, withanolide B, withanone and withaferin A) contents of transformed plants (T0 and T1) were marginally higher than control plants. PMID:25927703

  16. Sonication, Vacuum Infiltration and Thiol Compounds Enhance the Agrobacterium-Mediated Transformation Frequency of Withania somnifera (L. Dunal.

    Directory of Open Access Journals (Sweden)

    Ganeshan Sivanandhan

    Full Text Available In the present study, we have established a stable transformation protocol via Agrobacterium tumafacines for the pharmaceutically important Withania somnifera. Six day-old nodal explants were used for 3 day co-cultivation with Agrobacterium tumefaciens strain LBA4404 harbouring the vector pCAMIBA2301. Among the different injury treatments, sonication, vacuum infiltration and their combination treatments tested, a vacuum infiltration for 10 min followed by sonication for 10 sec with A. tumefaciens led to a higher transient GUS expression (84% explants expressing GUS at regenerating sites. In order to improve gene integration, thiol compounds were added to co-cultivation medium. A combined treatment of L-Cys at 100 mg/l, STS at 125 mg/l, DTT at 75 mg/l resulted in a higher GUS expression (90% in the nodal explants. After 3 days of co-cultivation, the explants were subjected to three selection cycles with increasing concentrations of kanamycin [100 to 115 mg/l]. The integration and expression of gusA gene in T0 and T1 transgenic plants were confirmed by polymerase chain reaction (PCR, and Southern blott analysis. These transformed plants (T0 and T1 were fertile and morphologically normal. From the present investigation, we have achieved a higher transformation efficiency of (10%. Withanolides (withanolide A, withanolide B, withanone and withaferin A contents of transformed plants (T0 and T1 were marginally higher than control plants.

  17. Changes in the leaf proteome profile of Withania somnifera (L. Dunal in response to Alternaria alternata infection.

    Directory of Open Access Journals (Sweden)

    Varinder Singh

    Full Text Available Withania somnifera is a high value medicinal plant which is used against large number of ailments. The medicinal properties of the plant attributes to a wide array of important secondary metabolites. The plant is predominantly infected with leaf spot pathogen Alternaria alternata, which leads to substantial biodeterioration of pharmaceutically important metabolites. To develop an effective strategy to combat this disease, proteomics based approach could be useful. Hence, in the present study, three different protein extraction methods tris-buffer based, phenol based and trichloroacetic acid-acetone (TCA-acetone based method were comparatively evaluated for two-dimensional electrophoresis (2-DE analysis of W. somnifera. TCA-acetone method was found to be most effective and was further used to identify differentially expressed proteins in response to fungal infection. Thirty-eight differentially expressed proteins were identified by matrix assisted laser desorption/ionization time of flight-mass spectrometry (MALDI TOF/TOF MS/MS. The known proteins were categorized into eight different groups based on their function and maximum proteins belonged to energy and metabolism, cell structure, stress and defense and RNA/DNA categories. Differential expression of some key proteins were also crosschecked at transcriptomic level by using qRT-PCR and were found to be consistent with the 2-DE data. These outcomes enable us to evaluate modifications that take place at the proteomic level during a compatible host pathogen interaction. The comparative proteome analysis conducted in this paper revealed the involvement of many key proteins in the process of pathogenesis and further investigation of these identified proteins could assist in the discovery of new strategies for the development of pathogen resistance in the plant.

  18. Validation of dbEST-SSRs and transferability of some other solanaceous species SSR in ashwagandha [Withania Somnifera (L.) Dunal].

    Science.gov (United States)

    Parmar, Eva K; Fougat, Ranbir S; Patel, Chandni B; Zala, Harshvardhan N; Patel, Mahesh A; Patel, Swati K; Kumar, Sushil

    2015-12-01

    Cross-species transferability and expressed sequence tags (ESTs) in public databases are cost-effective means for developing simple sequence repeats (SSRs) for less-studied species like medicinal plants. In this study, 11 EST-SSR markers developed from 742 available ESTs of Withania Somnifera EST sequences and 95 SSR primer pairs derived from other solanaceous crops (tomato, eggplant, chili, and tobacco) were utilized for their amplification and validation. Out of 11, 10 EST-SSRs showed good amplification quality and produced 13 loci with a product size ranging between 167 and 291 bp. Similarly, of the 95 cross-genera SSR loci assayed, 20 (21 %) markers showed the transferability of 5, 27, 32, and 14.2 % from eggplant, chili, tomato, and tobacco, respectively, to ashwagandha. In toto, these 30 SSR markers reported here will be valuable resources and may be applicable for the analysis of intra- and inter-specific genetic diversity in ashwagandha for which till date no information about SSR is available.

  19. Effect of Withania somnifera Dunal Root Extract on Behavioral Despair Model in Mice: a Possible Role for Nitric Oxide.

    Science.gov (United States)

    Attari, Mahshid; Jamaloo, Fatemeh; Shadvar, Sahar; Fakhraei, Nahid; Dehpour, Ahmad Reza

    2016-03-01

    Withania somnifera (WS) possess anti-inflammatory and antioxidant properties. WS preparations have a potential therapeutic role in the central nervous system (CNS) related disorders in animal models. In this study, the possible protective effect of acute aqueous WS root extract on behavioral despair was explored and compared with fluoxetine, an antidepressant with selective serotonin (5-HT) reuptake inhibitor activity (SSRI). Further, the probable involvement of nitric oxide (NO) determined to measure immobility time in forced swimming test (FST) and tail suspension test (TST) in male mice. Immediately after assessment of locomotor activity, the immobility time was evaluated. WS was administered intraperitoneally (200, 400 mg/kg; i.p.) 60 min before the behavioral tests. To assess the involvement of NO in the possible protective effect of WS, a non-specific NO synthase inhibitor, NG-L-arginine methyl ester (L-NAME, 10 mg/kg, i.p.) was administered 30 min before the extract administration (400 mg/kg, i.p.), 90 min before the tests. Acute WS extract (200, 400 mg/kg, i.p.) dose-dependently decreased the immobility time in FST, P<0.05, P<0.001, respectively and 400 mg/kg proved the most effective dose and this dose was comparable to fluoxetine (20 mg/kg, i.p. WS (400 mg/kg, i.p.) also lowered the immobility measure in TST (P<0.05). However, these effects were not related to change in locomotor activity. Moreover, L-NAME (10 mg/kg, i.p.) did not influence the effect of the extract on the behavioral tests. As a consequence, the immobility time was virtually constant between the group received the extract (400 mg/kg) alone, and the group received L-NAME (10 mg/kg) before the extract. It is probable that NO does not mediate this beneficial effect, and WS may affect other neurochemical systems and pathways.

  20. Leaf spot disease adversely affects human health-promoting constituents and withanolide biosynthesis in Withania somnifera (L.) Dunal.

    Science.gov (United States)

    Singh, V; Singh, B; Sharma, A; Kaur, K; Gupta, A P; Salar, R K; Hallan, V; Pati, P K

    2017-01-01

    The present work investigates the implication of leaf spot disease on the antioxidant potential and commercial value of pharmaceutically important constituents of Withania somnifera, a high-valued medicinal plant. Leaf spot disease was induced in W. somnifera by inoculating Alternaria alternata (Fr.) Keiss. pathogen. Total polyphenolic content and antioxidant potential showed a significant decrease during leaf spot disease. Evaluation of pharmaceutically active constituents withaferin A, withanone and withanolide A utilizing high-performance liquid chromatography showed a significant decrease in diseased samples as compared to healthy ones. Quantitative expression of major genes involved in withanolide biosynthesis also showed down-regulation in diseased samples. Alterations in the ultra-structure of chloroplasts were also analysed under transmission electron microscopy to get a better insight into the changes of withanolide biosynthesis in leaf during disease infestation. The present work suggests that when the pathogenic fungus invades the host plants, it evokes multiple responses, which could be studied at various levels. The knowledge gained from this work will provide appropriate rationale for controlling the bio-deterioration of the pharmaceutically active metabolites in W. somnifera and development of suitable strategies against leaf spot disease. This is the first study to investigate the effect of leaf spot disease on the human health-promoting constituents and withanolide biosynthesis in this high-valued medicinal plant. © 2016 The Society for Applied Microbiology.

  1. Development of microsatellite markers and their correlation with morphological and chemical markers in Withania somnifera (L. Dunal

    Directory of Open Access Journals (Sweden)

    Punit Kumar Khanna

    2016-04-01

    Full Text Available The genetic variation and relationships among 14 Withania accessions were evaluated using morphological, chemical and Simple Sequence Repeat (SSR markers. Wild accessions are more robust and better performing in morphological and chemical metabolite accumulation than cultivated one. The results revealed that out of fourteen, four primers showed distinct polymorphism, indicating the robust nature of microsatellites in revealing polymorphism. The banding pattern was recorded in the form of 0-1 data sheet which was analyzed using unweighted pair group method with arithmetic mean (UPGMA based on Jaccard's similarity coefficient. The cluster analysis showed higher level of genetic variation among the accessions. Similarity coefficients ranged from 0.125 to 1. The dendrogram revealed 3 major distinct clusters. Higher range of similarity values for related genotypes using simple sequence repeats (SSR provides greater confidence for the assessment of genetic diversity and relationships. The polymorphism information content (PIC value for the SSR loci ranged from 0.0 to 0.40. Higher PIC values were associated with higher level of polymorphism. Results of this study showed a high degree of variation among analyzed accessions, indicating an important source of genetic diversity that can be used in future breeding programs.

  2. Effect of combination of Withania somnifera Dunal and Tribulus terrestris Linn on letrozole induced polycystic ovarian syndrome in rats.

    Science.gov (United States)

    Saiyed, Amrin; Jahan, Nasreen; Makbul, Shaikh Ajij Ahmed; Ansari, Mushir; Bano, Humaira; Habib, Syeda Hajera

    2016-12-01

    To investigate the effect of the combination of hydroalcoholic extract of Withania somnifera (WS) and Tribulus terrestris (TT) on letrozole induced polycystic ovarian syndrome (PCOS) in rat. Twenty four female Wistar rats of regular estrus cycle were divided into four groups of six animals each. The negative control group received 1 mL of 0.5% carboxy methyl cellulose. The animals of the other groups were treated with letrozole (1 mg/kg) for 21 days for induction of PCOS. The animals of the positive control group were sacrificed on the 22nd day. In the test and standard groups, the treatment was started from the 22nd day and continued for a further 28 days. The test group was treated with hydroalcoholic extract of the combination of WS and TT (198 mg/kg) and the standard group with clomiphene citrate (1 mg/kg). Throughout the study, vaginal smears were collected daily from each animal for the determination of different phases of the estrus cycle. After completion of the treatment schedule all the animals of each group were sacrificed; analysis of hormones, total cholesterol, blood glucose, ovarian and uterine weight, and histopathological study of the ovary were carried out. The combination of the test drugs showed significant effects in normalizing the estrus cycle after being altered by letrozole. In the positive control group follicle-stimulating hormone level was decreased although luteinizing hormone, estradiole, and testosterone levels were increased (p < 0.05), however, after treatment the reverse effect was observed in the level of these hormones. Significant reduction in serum total cholesterol was also observed (p < 0.05). The test drugs decreased ovarian weight, and uterine weight was also returned to normalcy. Histopathology of the ovary showed almost normal ovary. The above findings indicate the effectiveness of the combination of hydroalcoholic extract of WS and TT against letrozole induced polycystic ovarian syndrome in rat. This validates the usefulness of combination in PCOS and other related disorders as mentioned by Unani physicians.

  3. Effect of Withania somnifera Dunal Root Extract on Behavioral Despair Model in Mice: a Possible Role for Nitric Oxide

    Directory of Open Access Journals (Sweden)

    Mahshid Attari

    2016-04-01

    Full Text Available Withania somnifera (WS possess anti-inflammatory and antioxidant properties. WS preparations have a potential therapeutic role in the central nervous system (CNS related disorders in animal models. In this study, the possible protective effect of acute aqueous WS root extract on behavioral despair was explored and compared with fluoxetine, an antidepressant with selective serotonin (5-HT reuptake inhibitor activity (SSRI. Further, the probable involvement of nitric oxide (NO determined to measure immobility time in forced swimming test (FST and tail suspension test (TST in male mice. Immediately after assessment of locomotor activity, the immobility time was evaluated. WS was administered intraperitoneally (200, 400 mg/kg; i.p. 60 min before the behavioral tests. To assess the involvement of NO in the possible protective effect of WS, a non-specific NO synthase inhibitor, NG-L-arginine methyl ester (L-NAME, 10 mg/kg, i.p. was administered 30 min before the extract administration (400 mg/kg, i.p., 90 min before the tests. Acute WS extract (200, 400 mg/kg, i.p. dose-dependently decreased the immobility time in FST, P<0.05, P<0.001, respectively and 400 mg/kg proved the most effective dose and this dose was comparable to fluoxetine (20 mg/kg, i.p. WS (400 mg/kg, i.p. also lowered the immobility measure in TST (P<0.05. However, these effects were not related to change in locomotor activity. Moreover, L-NAME (10 mg/kg, i.p. did not influence the effect of the extract on the behavioral tests. As a consequence, the immobility time was virtually constant between the group received the extract (400 mg/kg alone, and the group received L-NAME (10 mg/kg before the extract. It is probable that NO does not mediate this beneficial effect, and WS may affect other neurochemical systems and pathways.

  4. Exogenous application of IAA alleviates effects of supplemental ultraviolet-B radiation in the medicinal plant Withania somnifera Dunal.

    Science.gov (United States)

    Takshak, S; Agrawal, S B

    2017-11-01

    Supplemental (s)-UV-B radiation has adverse effects on the majority of plants. The present study was conducted to evaluate the effects of exogenous application of the growth hormone indole acetic acid (IAA) on various morphological, physiological and biochemical characteristics of Withania somnifera, an indigenous medicinal plant, subjected to s-UV-B. The s-UV-B-treated plants received ambient + 3.6 kJm-2 ·day-1 biologically effective UV-B, and IAA was applied at two doses (200 and 400 ppm) to s-UV-B-exposed plants. The plant was forced to compromise its growth, development and photosynthetic patterns to survive under s-UV-B by increasing concentrations of secondary metabolites and antioxidants (thiol, proline, ascorbic acid, α-tocopherol, ascorbate peroxidase, catalase, glutathione reductase, peroxidase, polyphenol oxidase, superoxide dismutase) to counteract oxidative stress. Increases in secondary metabolites were evidenced as increased activity of phenylpropanoid pathway enzymes: phenylalanine ammonia lyase, cinnamyl alcohol dehydrogenase, 4-coumarate CoA ligase, chalcone isomerase and dihydroflavonol reductase. Application of different IAA doses reversed the detrimental effects of s-UV-B on W. somnifera by improving growth and photosynthesis and reducing concentrations of secondary metabolites and non-enzymatic antioxidants. Antioxidant enzymes, however, had a synergistic effect on s-UV-B treatment and IAA application. The effects of s-UV-B on W. somnifera are ameliorated to varying degrees upon exogenous IAA application, and synergistic enhancement of antioxidant enzymes under s-UV-B+IAA treatment might be responsible for the partial recuperation of growth and plant protein content, as a UV-B-exposed plant is forced to allocate most of its photosynthate towards production of enzymes related to antioxidant defence. © 2017 German Botanical Society and The Royal Botanical Society of the Netherlands.

  5. Changes in the leaf proteome profile of Withania somnifera (L.) Dunal in response to Alternaria alternata infection.

    Science.gov (United States)

    Singh, Varinder; Singh, Baldev; Joshi, Robin; Jaju, Puneet; Pati, Pratap Kumar

    2017-01-01

    Withania somnifera is a high value medicinal plant which is used against large number of ailments. The medicinal properties of the plant attributes to a wide array of important secondary metabolites. The plant is predominantly infected with leaf spot pathogen Alternaria alternata, which leads to substantial biodeterioration of pharmaceutically important metabolites. To develop an effective strategy to combat this disease, proteomics based approach could be useful. Hence, in the present study, three different protein extraction methods tris-buffer based, phenol based and trichloroacetic acid-acetone (TCA-acetone) based method were comparatively evaluated for two-dimensional electrophoresis (2-DE) analysis of W. somnifera. TCA-acetone method was found to be most effective and was further used to identify differentially expressed proteins in response to fungal infection. Thirty-eight differentially expressed proteins were identified by matrix assisted laser desorption/ionization time of flight-mass spectrometry (MALDI TOF/TOF MS/MS). The known proteins were categorized into eight different groups based on their function and maximum proteins belonged to energy and metabolism, cell structure, stress and defense and RNA/DNA categories. Differential expression of some key proteins were also crosschecked at transcriptomic level by using qRT-PCR and were found to be consistent with the 2-DE data. These outcomes enable us to evaluate modifications that take place at the proteomic level during a compatible host pathogen interaction. The comparative proteome analysis conducted in this paper revealed the involvement of many key proteins in the process of pathogenesis and further investigation of these identified proteins could assist in the discovery of new strategies for the development of pathogen resistance in the plant.

  6. Evaluation and selection of candidate reference genes for normalization of quantitative RT-PCR in Withania somnifera (L. Dunal.

    Directory of Open Access Journals (Sweden)

    Varinder Singh

    Full Text Available Quantitative real-time PCR (qRT-PCR is now globally used for accurate analysis of transcripts levels in plants. For reliable quantification of transcripts, identification of the best reference genes is a prerequisite in qRT-PCR analysis. Recently, Withania somnifera has attracted lot of attention due to its immense therapeutic potential. At present, biotechnological intervention for the improvement of this plant is being seriously pursued. In this background, it is important to have comprehensive studies on finding suitable reference genes for this high valued medicinal plant. In the present study, 11 candidate genes were evaluated for their expression stability under biotic (fungal disease, abiotic (wounding, salt, drought, heat and cold stresses, in different plant tissues and in response to various plant growth regulators (methyl jasmonate, salicylic acid, abscisic acid. The data as analyzed by various software packages (geNorm, NormFinder, Bestkeeper and ΔCt method suggested that cyclophilin (CYP is a most stable gene under wounding, heat, methyl jasmonate, different tissues and all stress conditions. T-SAND was found to be a best reference gene for salt and salicylic acid (SA treated samples, while 26S ribosomal RNA (26S, ubiquitin (UBQ and beta-tubulin (TUB were the most stably expressed genes under drought, biotic and cold treatment respectively. For abscisic acid (ABA treated samples 18S-rRNA was found to stably expressed gene. Finally, the relative expression level of the three genes involved in the withanolide biosynthetic pathway was detected to validate the selection of reliable reference genes. The present work will significantly contribute to gene analysis studies in W. somnifera and facilitate in improving the quality of gene expression data in this plant as well as and other related plant species.

  7. Effect of combination of Withania somnifera Dunal and Tribulus terrestris Linn on letrozole induced polycystic ovarian syndrome in rats

    Directory of Open Access Journals (Sweden)

    Amrin Saiyed

    2016-12-01

    Conclusion: The above findings indicate the effectiveness of the combination of hydroalcoholic extract of WS and TT against letrozole induced polycystic ovarian syndrome in rat. This validates the usefulness of combination in PCOS and other related disorders as mentioned by Unani physicians.

  8. Withanolide A biogeneration in in vitro shoot cultures of ashwagandha (Withania somnifera DUNAL), a main medicinal plant in Ayurveda.

    Science.gov (United States)

    Sangwan, Rajender Singh; Chaurasiya, Narayan Das; Lal, Payare; Misra, Laxminarain; Uniyal, Girish Chandra; Tuli, Rakesh; Sangwan, Neelam Singh

    2007-09-01

    Multiple shoot cultures of two experimental lines of Withania somnifera plants (RS-Selection-1 and RS-Selection-2) were established using nodal segments as explants. The hormonal combinations of benzyl adenine and kinetin not only influenced their morphogenetic response but also differentially modulated the level of biogeneration of withanolide A in the in vitro shoots of the two lines. Interestingly, withanolide-A, that was hardly detectable in the aerial parts of field-grown Withania somnifera (explant source), accumulated considerably in the in vitro shoot cultures of the plant. The productivity of withanolide A in the cultures varied considerably (ca. 10-fold, 0.014 to 0.14 mg per gram fresh weight) with the change in the hormone composition of the culture media as well as genotype used as source of the explant. The shoot culture of RS-Selection-1 raised at 1.00 ppm of BAP and 0.50 ppm of kinetin displayed the highest concentration of withanolide A in the green shoots of 0.238 g per 100 g dry weight tissue. This was a more analytical concentration keeping in view the isolation yields so far reported from the dried roots of the field-grown plant (ca. 0.015 g per 100 g dry weight), even if isolation losses are considered during purification. The enhanced de novo biogenesis of withanolide A in shoot cultures was corroborated with radiolabel incorporation studies using [2-(14)C] acetate as a precursor. Production of withaferin A was also found in the in vitro shoot cultures. As this compound is a predominant withanolide of native shoots as well and has been already reported to be accumulated in in vitro shoot cultures, its biogeneration observed in these shoot cultures is not discussed in detail.

  9. Evaluation of apoptotic activity of Withania coagulans methanolic extract against human breast cancer and Vero cell lines.

    Science.gov (United States)

    Ahmad, Rumana; Fatima, Afreen; Srivastava, A N; Khan, Mohsin Ali

    The genus Withania (Family: Solanaceae) holds an important position in Ayurveda, the Indian traditional system of medicine. Withania somnifera Dunal and Withania coagulans Dunal have been documented in folklore as panaceas for various ailments since time immemorial. W. coagulans (WC), commonly called as Indian cheese maker is used for fermenting milk for cheese production in various parts of India. In the study, in vitro cytotoxicity of methanolic extract of dried fruits (berries) of WC was evaluated in a dose dependent manner using trypan blue dye exclusion method against human breast cancer cell line MDA-MB-231 and normal kidney epithelial cell line Vero in the range 20-200 μg/ml. The percentage viability of the cell lines was determined by using MTT assay and cytometry. Methanolic extract of WC showed significant anticancer activity against MDA-MB-231 cell line. Cell viability was reduced to about 50% at 40 μg/ml of methanolic extract in 50% DMSO. Cytotoxicity of the extract was lower in 10% and 1% DMSO. On the other hand, methanolic extract of WC did not exhibit any significant in vitro activity against Vero cells at 170 and 200 μg/ml. AGE of isolated DNA from treated cancer cells revealed characteristic ladder like fragmentation, a hallmark of apoptosis. HPLC profiling was carried out for identification of the active components, which demonstrated the presence of Withaferin A in the methanolic extract. Methanolic extract of WC possesses apoptotic activity against human breast cancer cells in vitro albeit lower in comparison to W. somnifera and warrants further investigation. Copyright © 2017 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  10. ESTUDIO DE LA DIVERSIDAD CITOGENÉTICA DE Physalis peruviana L. (Solanaceae Study of the cytogenetic diversity of Physalis peruviana L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    C NOHRA

    2006-06-01

    Full Text Available Se caracterizó el cariotipo de cinco ecotipos de Physalis peruviana L., tres silvestres distribuidas en los municipios de Villa de Leyva (Boyacá, Colombia, La Calera y Choachí (Cundinamarca, Colombia y dos cultivados, uno de ellos nativo, el ecotipo Colombia distribuido en el municipio de Subachoque (Cundinamarca y uno foráneo, procedente de Kenia, cultivado en el municipio de Paipa (Cundinamarca. Ápices radicales obtenidos a partir de semillas y de hojas en medios de cultivo in vitro enriquecidos con auxinas se emplearon para estandarizar el protocolo de obtención de cromosomas, con las diferentes técnicas de pretratamiento, fijación, hidrólisis y montaje de las muestras. Adicionalmente se evaluó la duración del ciclo celular para establecer la hora mitótica. Se encontró variabilidad genética entre los ecotipos evaluados. Los ecotipos silvestres presentaron una dotación cromosómica 2n=24, el ecotipo Colombia 2n=32 y el ecotipo Kenia 2n=48. Los ecotipos exhibieron también variación en las características morfológicas y anatómicas, que de acuerdo a la literatura, son un reflejo del nivel de ploidía, como altura, área foliar, número de estomas/mm², número de cloroplastos en las células guarda de los estomas, diámetro de frutos, semillas y contenido de masa seca.We report here the karyotype characterization of five Physalis peruviana L. ecotypes. Three wild types were collected from the areas around Villa de Leyva (Boyacá, Colombia, La Calera and Choachí municipalities (Cundinamarca, Colombia and two were from cultivated cape gooseberry crops. One of the latter was the native Colombia ecotype found near the Subachoque municipality (Cundinamarca and the other was a foreign ecotype from Kenya, which had been cultivated near Paipa municipality (Cundinamarca. Karyotypes were obtained after standardizing a protocol involving obtation of radical apexes from seeds and leaves, using in vitro auxinenriched culture medium. The chromosomes protocol was standardized using different pretreatment, fixation, hydrolysis and samplemounting techniques. Duration of the cellular cycle was also evaluated for determining the mitotic hour. A wide genetic variability among the ecotypes was observed. Wild ecotypes presented 2n=24 chromosomes while Colombia and Kenya ecotypes 2n=32 and 2n=48, respectively. Morphological and anatomical characterization also showed variation among the ecotypes reflecting ploidy level, according to the literature, in terms of plant height, foliate area, number of stoma/mm², chloroplast number in stoma guard cells, fruit and seed diameter and dry mass content.

  11. Fruit anatomy of species of Solanum sect. Torva (Solanaceae Anatomía del fruto en especies de Solanum sect. Torva (Solanaceae

    Directory of Open Access Journals (Sweden)

    Franco E. Chiarini

    2010-12-01

    Full Text Available The mature fruits of 10 South American species of Solanum sect. Torva were studied. Cross and longitudinal microtome sections, stained with astra blue/basic fuchsin, were made for microscopic examination. All species present an epidermis formed by a unistrate layer of small, isodiametric cells, with dense content and cellulosic walls. Immediately below, a hypodermis is always found, consisting of a well-defined layer of lignified cells with a single calcium oxalate crystal occupying the whole lumen of each cell. This is followed by one layer of cellulosic, isodiametric cells with dense cytoplasm and then several collenchymatous layers, sometimes with sclerified cell walls. The mesocarp comprises two zones histologically differentiated: an external one (formed by regular, vacuolated, medium-sized cells with small intercellular spaces, and an internal one, commonly juicy, and developing proliferations among the seeds. The fruits analyzed are alike, and despite some particularities, they can be classified as berries in the conventional sense. All the traits examined agree with the ornithochorous dispersal syndrome. The homogeneity in fruit traits may be due to shared habit, habitat and sexual system.Se estudiaron los frutos maduros de 10 especies sudamericanas de Solanum sect. Torva. Se examinaron en microscopio cortes microtómicos transversales y longitudinales teñidos con azul astral/fucsina básica. Todas las especies presentaron una epidermis unistrata de células pequeñas, isodiamétricas, de contenido denso y paredes celulósicas. Inmediatamente por debajo se encontró siempre una hipodermis, formada por una capa bien definida de células lignificadas con un cristal de oxalato de calcio en el lúmen de cada célula. A continuación se halló otra capa de celulas isodiamétricas, celulósicas, de contenido denso, y luego varias capas de colénquima, en ocasiones con paredes esclerificadas. El mesocarpo presentó dos zonas histologicamente diferenciadas: una externa (formada por células regulares, vacuoladas, de tamaño medio y espacios intercelulares pequeños y una interna, comúnmente jugosa y que prolifera entre las semillas. No obstante algunas particularidades, los frutos analizados son similares entre sí, y se clasificaron como bayas en sentido convencional. Todos los rasgos analizados concuerdan con el síndrome de dispersión ornitócoro. La homogeneidad en los caracteres puede deberse al hábito, hábitat y sistema sexual compartidos.

  12. Evaluación in vivo de la actividad antimalárica de 25 plantas provenientes de una Reserva de Conservación Biológica de Costa Rica In vivo evaluation of the antimalarial activity of 25 plants from a Biological Conservation Reserve of Costa Rica

    Directory of Open Access Journals (Sweden)

    MISAEL CHINCHILLA-CARMONA

    2011-03-01

    Full Text Available Se realizó una evaluación in vivo de la actividad antimalárica de las hojas, flores, frutos, corteza y raíz de 25 plantas de la Reserva Biológica Alberto Manuel Brenes (REBAMB, situada en San Ramón, Alajuela, Costa Rica. Las plantas estudiadas fueron Aphelandra aurantiaca (Scheidw. Lindl., Aphelandra tridentata Hemsl. (Acanthaceae, Xanthosoma undipes (K. Koch & C.D. Bouché K. Koch. (Araceae, Iriartea deltoidea Ruiz & Pav. (Arecaceae, Neurolaena lobata (L. Cass. (Asteraceae, Lonchocarpus pentaphyllus (Poir. Kunth ex DC., Pterocarpus hayesii Hemsl., Senna papillosa (Britton & Rose H.S. Irwin & Barneby., Cinnamomum chavarrianum (Hammel Kosterm. (Fabaceae, Nectandra membranacea (Sw. Griseb., Persea povedae W.C. Burger. (Lauraceae, Hampea appendiculata (Donn. Sm. Standl. (Malvaceae, Guarea glabra Vahl., Ruagea glabra Triana & Planch. (Meliaceae, Psidium guajava L. (Myrtaceae, Bocconia frutescens L. (Papaveraceae, Piper friedrichsthalii C. DC. (Piperaceae, Clematis dioica L. (Ranunculaceae, Prunus annularis Koehne. (Rosaceae, Siparuna thecaphora (Poepp. & Endl. A. DC. (Siparunaceae, Solanum arboreum Dunal., Witheringia solanacea L'Hér. (Solanaceae, Ticodendron incognitum Gómez-Laur. & L.D. Gómez. (Ticodendraceae, Heliocarpus appendiculatus Turcz. (Tiliaceae y Myriocarpa longipes Liebm. (Urticaceae. Los extractos alcohólicos frescos y secos, fueron evaluados por su actividad inhibitoria de la parasitemia causada por Plasmodium berghei en ratones Swiss. Al realizar las prueba de CI50 las plantas en que esa actividad fue muy relevante fueron (en mg kg-1 de peso: 12 para la corteza de B. frutescens, 18 para la raíz de H. appendiculata, 14 para la raíz de I. deltoidea, 4 para el fruto inmaduro de M. longipes, 21 para la raíz de N. membranacea, 19 para las hojas tiernas de P. povedae y 16 para el fruto inmaduro de S. tecaphora. Los extractos frescos presentaron una mayor actividad antimalárica que los sometidos a desecación. Este estudio es

  13. Two new records of Fabiana stephanii Hunz. & Barboza (Solanaceae from Arequipa and Ayacucho (Peru

    Directory of Open Access Journals (Sweden)

    Eliana Linares Perea

    2016-08-01

    Full Text Available In this work, two new records of Fabiana stephanii Hunz. & Barboza for the flora of Southern Peru are reported, including taxonomical, biogeographical and phytosociological data on this species.

  14. A revision of the Solanum elaeagnifolium clade (Elaeagnifolium clade; subgenus Leptostemonum, Solanaceae)

    Science.gov (United States)

    Knapp, Sandra; Sagona, Eva; Carbonell, Anna K.Z.; Chiarini, Franco

    2017-01-01

    Abstract The Solanum elaeagnifolium clade (Elaeagnifolium clade) contains five species of small, often rhizomatous, shrubs from deserts and dry forests in North and South America. Members of the clade were previously classified in sections Leprophora, Nycterium and Lathyrocarpum, and were not thought to be closely related. The group is sister to the species-rich monophyletic Old World clade of spiny solanums. The species of the group have an amphitropical distribution, with three species in Mexico and the southwestern United States and three species in Argentina. Solanum elaeagnifolium occurs in both North and South America, and is a noxious invasive weed in dry areas worldwide. Members of the group are highly variable morphologically, and this variability has led to much synonymy, particularly in the widespread S. elaeagnifolium. We here review the taxonomic history, morphology, relationships and ecology of these species and provide keys for their identification, descriptions, full synonymy (including designations of lectotypes) and nomenclatural notes. Illustrations, distribution maps and preliminary conservation assessments are provided for all species. PMID:29033654

  15. Diversification of andromonoecy in Solanum section Lasiocarpa (Solanaceae): the roles of phenotypic plasticity and architecture.

    Science.gov (United States)

    Miller, Jill S; Diggle, Pamela K

    2003-05-01

    Quantitative analyses of sexual expression show extensive interspecific variation in the strength of andromonoecy (proportions of hermaphroditic and staminate flowers) among Solanum species in the monophyletic section Lasiocarpa. The roles of phenotypic plasticity and inter- and intra-inflorescence architecture in the diversification of andromonoecy within this small clade were analyzed. Four species that represent a range of expression of andromonoecy were examined. Staminate flowers produced within inflorescences ranged from 3% (S. candidum) to 7% (S. ferox) in weakly andromonoecious species and from 39% (S. pseudolulo) to 60% (S. quitoense) in more strongly andromonoecious species. Manipulation of fruit set on clonal replicates of multiple genotypes demonstrated variation among species for phenotypic plasticity. The strongly andromonoecious species, S. pseudolulo and S. quitoense, were not plastic and produced a large proportion of staminate flowers regardless of fruiting treatment, whereas S. candidum and S. ferox were phenotypically plastic and produced significantly more staminate flowers in the presence of developing fruit. Staminate flower production of all four species varied both within and among inflorescences. A greater proportion of staminate flowers were produced in distal (later produced) inflorescences. Within inflorescences, hermaphroditic flowers occurred in basal positions, whereas staminate flowers, when produced, occurred more distally. This pattern of staminate flower production is qualitatively the same in all species investigated; however, quantitative variation in the transition from hermaphroditic to staminate flower production within and among inflorescences is associated with variation in the strength of andromonoecy. At least three factors have contributed to the diversification of andromonoecy in section Lasiocarpa including the presence or absence of phenotypic plasticity in response to fruit set, quantitative variation in intra- and inter-inflorescence architectural effects, and total flower production.

  16. Flower morphology and pollinator dynamics in Solanum carolinense (Solanaceae): implications for the evolution of andromonoecy.

    Science.gov (United States)

    Quesada-Aguilar, Andrea; Kalisz, Susan; Ashman, Tia-Lynn

    2008-08-01

    Flower morphology and pollinator dynamics play an important role in the evolution and maintenance of many breeding systems, including andromonoecy. We used a series of field experiments to test the functional relationship between flower morphology and pollination dynamics (e.g., pollen receipt and export) in Solanum carolinense. We find that long-styled flowers serve primarily as pollen recipients and short-styled flowers as pollen donors, making this the first study to support the male-female interference hypothesis for the evolution of andromonoecy. However, this difference in the primary male or female function of the flowers depends on the pollinator identity. In flowers visited by Bombus impatiens, style length has a positive relationship with pollen deposition and a negative relationship with pollen removal. In contrast, neither morphological nor behavioral traits determine pollen deposition or removal by small halictid bees. We demonstrate that different pollinators could select for different floral morphologies, and thus, our research suggests that pollinator-specific interactions with flower morphology play an important role in the evolution and maintenance of anrdromonoecy.

  17. Floral morphometrics and the evolution of sexual dimorphism in Lycium (Solanaceae).

    Science.gov (United States)

    Miller, Jill S; Venable, D Lawrence

    2003-01-01

    Plants of Lycium californicum, L. exsertum, and L. fremontii produce flowers that are either male-sterile (female) or hermaphroditic, and populations are morphologically gynodioecious. As is commonly found in gynodioecious species, flowers on female plants are smaller than those on hermaphrodites for a number of floral traits. Floral size dimorphism has often been hypothesized to be the result of either a reduction in female flower size that allows reallocation to greater fruit and seed production, or an increase in hermaphroditic flower size due to the increased importance of pollinator attraction and pollen export for hermaphroditic flowers. We provide a test of these two alternatives by measuring 11 floral characters in eight species of Lycium and using a phylogeny to reconstruct the floral size shifts associated with the evolution of gender dimorphism. Our analyses suggest that female flowers are reduced in size relative to the ancestral condition, whereas flowers on hermaphrodites have changed only slightly in size. Female and hermaphroditic flowers have also diverged both from one another and from ancestral cosexual species in several shape characteristics. We expected sexual dimorphism to be similar among the three dimorphic taxa, as gender dimorphism evolved only a single time in the ancestor of the American dimorphic lineage. While the floral sexual dimorphism is broadly similar among the three dimorphic species, there are some species-specific differences. For example, L. exsertum has the greatest floral size dimorphism, whereas L. fremontii had the greatest size-independent dimorphism in pistil characters. To determine the degree to which phylogenetic uncertainty affected reconstruction of ancestral character states, we performed a sensitivity analysis by reconstructing ancestral character states on alternative topologies. We argue that investigations such as this one, that examine floral evolution from an explicitly phylogenetic perspective, provide new insights into the study of the evolution of floral sexual dimorphism.

  18. Estudio citogenético en Physalis peruviana l. “Uchuva” (Solanaceae

    Directory of Open Access Journals (Sweden)

    Perea Dallos Margarita

    2004-12-01

    Full Text Available En la presente investigación se estudian las características citogenéticas de cinco ecotipos de Physalis peruviana, tres silvestres distribuidos en Boyacá y Cundinamarca y dos ecotipos cultivados, uno nativo el ecotipo “Colombia”  distribuido en Cundinamarca y un ecotipo foráneo, procedente de Kenia, que se cultiva actualmente en nuestro país en el municipio de Paipa (Cundinamarca. Los resultados citogenéticos se obtienen luego de la estandarización del protocolo de obtención de ápices radicales a partir de semillas y hojas, empleando medios de cultivo in vitro. Se estandarizó el protocolo de obtención de cromosomas, empleando diferentes técnicas de pretratamiento, fijación, hidrólisis y montaje de las muestras, adicionalmente se evaluó la duración
    del ciclo celular para establecer la hora mitótica. Los resultados de la aplicación de estas técnicas, muestran una amplia variabilidad en la dotación cromosómica de las poblaciones
    estudiadas. Adicionalmente se evaluaron características morfológicas y anatómicas (Altura de las plantas, área foliar, número de estomas/mm2, número de cloroplastos en las células guarda de los estomas, diámetro de los frutos y semillas y contenido de masa seca para confrontarlas con
    los datos citogenéticos. Sé evalúo la acción de la colchicina, para inducir la poliploidización en esta especie, para ello se eligieron frutos del ecotipo “Colombia” con un alto contenido de azúcares y sus semillas se cultivaron in vitro con el inhibidor mitótico, obteniéndose un diploide directo de este ecotipo. Se recomendó hacer un seguimiento de este material, para evaluar esta técnica dentro del programa de fitomejoramiento.

  19. Effects of Brugmansia arborea (L.) Lagerheim (Solanacea) in the male reproductive system of mouse

    OpenAIRE

    Pino, José; Laboratorio de Reproducción y Biología del Desarrollo, Facultad de Ciencias Biológicas, Universidad Nacional Mayor de San Marcos, Lima, Perú; Alvis, Rafael; Laboratorio de Reproducción y Biología del Desarrollo, Facultad de Ciencias Biológicas, Universidad Nacional Mayor de San Marcos, Lima, Perú

    2008-01-01

    El objetivo del presente estudio fué investigar el efecto de la administracion del extracto acuoso de Brugmansia arborea (L.) Lagerheim -floripondio-sobre algunos parámetros reproductivos en mamíferos. Ratones machos fueron tratados con 70 mg/kl/pc por 7 días, después de lo cual fueron eutanizados determinando los pesos de testículo, epidídimo e individualmente su región caudal; además, se contabilizó la concentración y malformaciones espermáticas. El peso del testículo y la cola del epidídim...

  20. A clarified position for solanum lycopersicum var. cerasiforme in the evolutionary history of tomatoes (solanaceae

    Directory of Open Access Journals (Sweden)

    Causse Mathilde

    2008-12-01

    Full Text Available Abstract Background The natural phenotypic variability present in the germplasm of cultivated plants can be linked to molecular polymorphisms using association genetics. However it is necessary to consider the genetic structure of the germplasm used to avoid false association. The knowledge of genetic structure of plant populations can help in inferring plant evolutionary history. In this context, we genotyped 360 wild, feral and cultivated accessions with 20 simple sequence repeat markers and investigated the extent and structure of the genetic variation. The study focused on the red fruited tomato clade involved in the domestication of tomato and confirmed the admixture status of cherry tomatoes (Solanum lycopersicum var. cerasiforme. We used a nested sample strategy to set-up core collection maximizing the genetic diversity with a minimum of individuals. Results Molecular diversity was considerably lower in S. lycopersicum i.e. the domesticated form. Model-based analysis showed that the 144 S. lycopersicum var. cerasiforme accessions were structured into two groups: one close to the domesticated group and one resulting from the admixture of the S. lycopersicum and S. pimpinellifolium genomes. SSR genotyping also indicates that domesticated and wild tomatoes have evolved as a species complex with intensive level of hybridization. We compiled genotypic and phenotypic data to identify sub-samples of 8, 24, 32 and 64 cherry tomato accessions that captured most of the genetic and morphological diversity present in the entire S. lycopersicum var. cerasiforme collection. Conclusion The extent and structure of allelic variation is discussed in relation to historical events like domestication and modern selection. The potential use of the admixed group of S. lycopersicum var. cerasiforme for association genetics studies is also discussed. Nested core collections sampled to represent tomato diversity will be useful in diversity studies. Molecular and phenotypic variability of these core collections is defined. These collections are available for the scientific community and can be used as standardized panels for coordinating efforts on identifying novel interesting genes and on examining the domestication process in more detail.

  1. Keanekaragaman, aktivitas kunjungan, dan keefektifan lebah penyerbuk pada tanaman tomat (Solanum lycopersicum L: Solanaceae

    Directory of Open Access Journals (Sweden)

    Andi Gita Maulidyah Indraswari

    2016-12-01

    Full Text Available Tomato (Solanum lycopersicum L. is a hermaphrodite plant and capable of auto pollination. However it still need pollinators to maximize pollination success. This research was aimed to determine the diversity, foraging activity of pollinator bees and its effectiveness on seeds and fruits formation of tomato. Scan sampling method was used to determine the diversity of pollinators and focal sampling method was used to observe visiting behavior of the bees. We conducted two experiments i.e., screen caged plants and open plants to compare the effect of the bee pollinators on fruits and seeds set formation. Results showed that eleven species of bees were found, i.e., Megachile conjuncta Smith, Megachile fulfifrons Smith, Megachile unbripennis Smith, Xylocopa confusa Latreille, Xylocopa latipes Drury, Xylocopa caerulea Fabricius, Ceratina cognata Latreille, Nomia quadridentata Bingham, Amegilla cyrtandrae Lieftinck, Amegilla burneensis Friese, and Apis cerana Fabricius. Three species of bees were dominant, i.e., X. confusa, A. cyrtandrae, and C. cognata. Bee, X. confusa visited more flowers per minute, followed by A. cyrtandrae and C. cognata. The longest species visiting in plants were C. cognata, followed by X. confusa and A. cyrtandrae. Bee pollinators increase 8.92% of fruiting, 43% of fruit size, 189% of number of seeds per fruit, and 355% of weight of seeds of tomato plants.

  2. A 10-gene phylogeny of Solanum section Herpystichum (Solanaceae) and a comparison of phylogenetic methods.

    Science.gov (United States)

    Tepe, Eric J; Farruggia, Frank T; Bohs, Lynn

    2011-08-01

    Solanum section Herpystichum is a lineage that comprises both widespread and very narrowly distributed species. This study investigates the phylogenetic relationships of sect. Herpystichum and evaluates several phylogenetic methods for analysis of multiple sequences. Sequence data from seven nuclear (ITS, GBSSI, and five COSII) and three plastid (psbA-trnH, trnT-trnF, and trnS-trnG) regions were concatenated and analyzed under maximum parsimony and Bayesian criteria. In addition, we used two analytical methods that take into account differences in topologies resulting from the analyses of the individual markers: Bayesian Estimation of Species Trees (BEST) and supertree analysis. The monophyletic Solanum sect. Herpystichum was resolved with moderate support in the concatenated maximum parsimony and Bayesian analyses and the supertree analysis, and relationships within the section were well-resolved and strongly supported. The BEST topology, however, was poorly resolved. Also, because of how BEST deals with missing sequences, >25% of our accessions, including two species, had to be excluded from the analyses. Our results indicate a progenitor-descendent relationship with two species nested within the widespread S. evolvulifolium. Analytical methods that consider individual topologies are important for studies based on multiple molecular markers. On the basis of analyses in this study, BEST had the serious shortcoming that taxa with missing sequences must be removed from the analysis or they can produce spurious topologies. Supertree analysis provided a good alternative for our data by allowing the inclusion of all 10 species of sect. Herpystichum.

  3. Anatomic Aspects of Formation and Growth of the Cape Gooseberry Fruit Physalis peruviana (Solanaceae

    Directory of Open Access Journals (Sweden)

    Manuel Fernando Mazorra

    2006-01-01

    confirmed that anatomically the Cape gooseberry fruits, ecotipo Colombia, and ruderal type are similar, which demonstrates the absence of appreciable anatomical changes that explain the greater size of the fruits of ecotipo Colombia.

  4. Sensitivity among species of Solanaceae to AAL toxins produced by Alternaria alternata f.sp lycopersici

    NARCIS (Netherlands)

    Mesbah, LA; van der Weerden, GM; Nijkamp, HJJ; Hille, J

    2000-01-01

    The necrotrophic fungus Alternaria alternata f.sp. lycopersici produces AAL toxins that cause necrosis in tomato tissues with high specificity. Resistance or susceptibility of tomato to the fungus and insensitivity or sensitivity to AAL toxins are determined by a single locus, Asc. In order to

  5. Effect of different substrates for organic agriculture in seedling development of traditional species of Solanaceae

    Energy Technology Data Exchange (ETDEWEB)

    Olaria, M.; Nebot, J.F.; Molina, H.; Troncho, P.; Lapeña, P.; Llorens, E.

    2016-11-01

    Sowing of seedlings is one of the most critical processes on the establishment of a crop, since the future development of the plant depends largely on its health when is planted on the field. Moreover, organic agriculture has to deal with the low application of fertilizers and pesticides, which hinder the growth of seedlings. In this work, we studied the big influence of different mixtures of substrates suitable for organic agriculture based on peat, coconut husk and vermicompost in traditional varieties of tomato, pepper and eggplant. Our results indicate that the use of coconut husk based substrates in organic agriculture can reduce the growth of seedlings between 20 and 30% compared with peat-based substrates. Moreover, the plants growth in this substrate showed lower levels of chlorophyll and lower weight, but the results are strongly dependent on the species tested. Comparison between traditional plants demonstrates that traditional varieties are strongly influenced by the substrate, whereas the growth of a commercial variety of tomato barely differs when different substrates are used. The election of the substrate in organic agriculture is critical to the correct development of the plant, especially when traditional plant varieties are used. (Author)

  6. Proximate and elemental analysis of five selected medicinal plants of family Solanaceae.

    Science.gov (United States)

    Hameed, Ishfaq; Hussain, Farrukh

    2015-07-01

    The proximate analysis revealed the presence of ash, moisture, protein, fiber, fats and carbohydrate. ANOVA showed that ash and moisture contents was non significant between the plant parts and phenological stages. Crude protein was non significant between the plant parts and phenological stages except for Datura innoxia parts but not for its phenolgical stages, while crude fats were non significant between the plant parts and phenological stages except for Solanum nigrum and Solanum surattense parts but not for their phenolgical stages. Crude fiber was non significant between the plant parts and phenological stages except for Datura innoxia parts but not for its phenolgical stages. And carbohydrates was non significant between the plant parts and phenological stages except for the phenolgical stages of Solanum surattense and Withania coagulans. The mineral analysis showed the presence of Cr, Zn, Cu, Mn, Fe, Ca, K, Mg and Na in the roots, stems, leaves, flowers and fruits of the plants in three different phenological stages. Only the micro-minerals were present in traces while the macro-minerals were present high quantities as compared to the micro-minerals.

  7. Population structure and genetic diversity of native and invasive populations of Solanum rostratum (Solanaceae.

    Directory of Open Access Journals (Sweden)

    Jiali Zhao

    Full Text Available AIMS: We investigate native and introduced populations of Solanum rostratum, an annual, self-compatible plant that has been introduced around the globe. This study is the first to compare the genetic diversity of Solanum rostratum between native and introduced populations. We aim to (1 determine the level of genetic diversity across the studied regions; (2 explore the likely origins of invasive populations in China; and (3 investigate whether there is the evidence of multiple introductions into China. METHODS: We genotyped 329 individuals at 10 microsatellite loci to determine the levels of genetic diversity and to investigate population structure of native and introduced populations of S. rostratum. We studied five populations in each of three regions across two continents: Mexico, the U.S.A. and China. IMPORTANT FINDINGS: We found the highest genetic diversity among Mexican populations of S. rostratum. Genetic diversity was significantly lower in Chinese and U.S.A. populations, but we found no regional difference in inbreeding coefficients (F IS or population differentiation (F ST. Population structure analyses indicate that Chinese and U.S.A. populations are more closely related to each other than to sampled Mexican populations, revealing that introduced populations in China share an origin with the sampled U.S.A. populations. The distinctiveness between some introduced populations indicates multiple introductions of S. rostratum into China.

  8. Taxonomy of Wild Tomatoes and their Relatives(Solanum sect. Lycopersicoides, sect. Juglandifolia, sect. Lycopersicon; Solanaceae)

    Science.gov (United States)

    Wild tomatoes are tremendous sources of useful traits in tomato breeding, to improve disease resistances, environmental tolerances, and improved agronomic traits such as increased soluble solids. This chapter includes historical and updated information on the phylogenetic relationships of wild tomat...

  9. The evolution of chili peppers (Capsicum-Solanaceae): a cytogenetic perspective

    Science.gov (United States)

    Capsicum (chili peppers) is a New World genus with five crop species of great economic importance for food and spices. An up-to-date summary of the karyotypic knowledge is presented, including data on classical staining (chromosome number, size and morphology), silver impregnation (number and positi...

  10. Antifungal Saponins from the Maya Medicinal Plant Cestrum schlechtendahlii G. Don (Solanaceae).

    Science.gov (United States)

    Ta, Chieu Anh Kim; Guerrero-Analco, J Antonio; Roberts, Elizabeth; Liu, Rui; Mogg, Christopher D; Saleem, Ammar; Otárola-Rojas, Marco; Poveda, Luis; Sanchez-Vindas, Pablo; Cal, Victor; Caal, Federico; Subramaniam, Rajagopal; Smith, Myron L; Arnason, John T

    2016-03-01

    Bioassay-guided fractionation of the crude extract (80% EtOH) of the leaves of Cestrum schlechtendahlii, a plant used by Q'eqchi' Maya healers for treatment of athlete's foot, resulted in the isolation and identification of two spirostanol saponins (1 and 2). Structure elucidation by MS, 1D-NMR, and 2D-NMR spectroscopic methods identified them to be the known saponin (25R)-1β,2α-dihydroxy-5α-spirostan-3-β-yl-O-α-L-rhamnopyranosyl-(1 → 2)-β-D-galactopyranoside (1) and new saponin (25R)-1β,2α-dihydroxy-5α-spirostan-3-β-yl-O-β-D-galactopyranoside (2). While 2 showed little or no antifungal activity at the highest concentration tested, 1 inhibited growth of Saccharomyces cerevisiae (minimum inhibitory concentration (MIC) of 15-25 μM), Candida albicans, Cryptococcus neoformans, and Fusarium graminearum (MIC of 132-198 μM). Copyright © 2015 John Wiley & Sons, Ltd.

  11. The GHKL ATPase MORC1 Modulates Species-Specific Plant Immunity in Solanaceae.

    Science.gov (United States)

    Manosalva, Patricia; Manohar, Murli; Kogel, Karl-Heinz; Kang, Hong-Gu; Klessig, Daniel F

    2015-08-01

    The microrchidia (MORC) proteins, a subset of the GHKL ATPase superfamily, were recently described as components involved in transcriptional gene silencing and plant immunity in Arabidopsis. To assess the role of MORC1 during resistance to Phytophthora infestans in solanaceous species, we altered the expression of the corresponding MORC1 homologs in potato, tomato, and Nicotiana benthamiana. Basal resistance to P. infestans was compromised in StMORC1-silenced potato and enhanced in overexpressing lines, indicating that StMORC1 positively affects immunity. By contrast, silencing SlMORC1 expression in tomato or NbMORC1 expression in N. benthamiana enhanced basal resistance to this oomycete pathogen. In addition, silencing SlMORC1 further enhanced resistance conferred by two resistance genes in tomato. Transient expression of StMORC1 in N. benthamiana accelerated cell death induced by infestin1 (INF1), whereas SlMORC1 or NbMORC1 suppressed it. Domain-swapping and mutational analyses indicated that the C-terminal region dictates the species-specific effects of the solanaceous MORC1 proteins on INF1-induced cell death. This C-terminal region also was required for homodimerization and phosphorylation of recombinant StMORC1 and SlMORC1, and its transient expression induced spontaneous cell death in N. benthamiana. Thus, this C-terminal region likely plays important roles in both determining and modulating the biological activity of MORC1 proteins.

  12. A revision of the Solanum elaeagnifolium clade (Elaeagnifolium clade; subgenus Leptostemonum, Solanaceae

    Directory of Open Access Journals (Sweden)

    Sandra Knapp

    2017-08-01

    Full Text Available The Solanum elaeagnifolium clade (Elaeagnifolium clade contains five species of small, often rhizomatous, shrubs from deserts and dry forests in North and South America. Members of the clade were previously classified in sections Leprophora, Nycterium and Lathyrocarpum, and were not thought to be closely related. The group is sister to the species-rich monophyletic Old World clade of spiny solanums. The species of the group have an amphitropical distribution, with three species in Mexico and the southwestern United States and three species in Argentina. Solanum elaeagnifolium occurs in both North and South America, and is a noxious invasive weed in dry areas worldwide. Members of the group are highly variable morphologically, and this variability has led to much synonymy, particularly in the widespread S. elaeagnifolium. We here review the taxonomic history, morphology, relationships and ecology of these species and provide keys for their identification, descriptions, full synonymy (including designations of lectotypes and nomenclatural notes. Illustrations, distribution maps and preliminary conservation assessments are provided for all species.

  13. Withanolides from three species of the genus Deprea (Solanaceae). Chemotaxonomical considerations.

    Science.gov (United States)

    Casero, Carina N; Oberti, Juan C; Orozco, Clara I; Cárdenas, Alejandro; Brito, Iván; Barboza, Gloria E; Nicotra, Viviana E

    2015-02-01

    Nine withanolides were isolated from the aerial parts of Deprea bitteriana, Depreacuyacensis, and Depreazamorae. D.bitteriana yielded two withaphysalins, D. cuyacensis gave two 13,14-seco withaphysalins, while D. zamorae yielded five physangulidines. The compounds were fully characterized by a combination of spectroscopic methods (1D and 2D NMR and MS). All compounds isolated from D.bitteriana and D. cuyacensis were obtained as epimeric mixtures at C-18. The structure of physangulidine D was confirmed by X-ray diffraction analysis. The skeletons found in this research support the chemotaxonomical position of the genus Deprea in the tribe Physalideae. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Distinct cell wall architectures in seed endosperms in representatives of the Brassicaceae and Solanaceae.

    Science.gov (United States)

    Lee, Kieran J D; Dekkers, Bas J W; Steinbrecher, Tina; Walsh, Cherie T; Bacic, Antony; Bentsink, Leónie; Leubner-Metzger, Gerhard; Knox, J Paul

    2012-11-01

    In some species, a crucial role has been demonstrated for the seed endosperm during germination. The endosperm has been shown to integrate environmental cues with hormonal networks that underpin dormancy and seed germination, a process that involves the action of cell wall remodeling enzymes (CWREs). Here, we examine the cell wall architectures of the endosperms of two related Brassicaceae, Arabidopsis (Arabidopsis thaliana) and the close relative Lepidium (Lepidium sativum), and that of the Solanaceous species, tobacco (Nicotiana tabacum). The Brassicaceae species have a similar cell wall architecture that is rich in pectic homogalacturonan, arabinan, and xyloglucan. Distinctive features of the tobacco endosperm that are absent in the Brassicaceae representatives are major tissue asymmetries in cell wall structural components that reflect the future site of radicle emergence and abundant heteromannan. Cell wall architecture of the micropylar endosperm of tobacco seeds has structural components similar to those seen in Arabidopsis and Lepidium endosperms. In situ and biomechanical analyses were used to study changes in endosperms during seed germination and suggest a role for mannan degradation in tobacco. In the case of the Brassicaceae representatives, the structurally homogeneous cell walls of the endosperm can be acted on by spatially regulated CWRE expression. Genetic manipulations of cell wall components present in the Arabidopsis seed endosperm demonstrate the impact of cell wall architectural changes on germination kinetics.

  15. Evolutionary analysis of RB/Rpi-blb1 locus in the Solanaceae family.

    Science.gov (United States)

    Xie, Zhengqing; Si, Weina; Gao, Rongchao; Zhang, Xiaohui; Yang, Sihai

    2015-12-01

    Late blight caused by the oomycete Phytophthora infestans is one of the most severe threats to potato production worldwide. Numerous studies suggest that the most effective protective strategy against the disease would be to provide potato cultivars with durable resistance (R) genes. However, little is known about the origin and evolutional history of these durable R-genes in potato. Addressing this might foster better understanding of the dynamics of these genes in nature and provide clues for identifying potential candidate R-genes. Here, a systematic survey was executed at RB/Rpi-blb1 locus, an exclusive broad-spectrum R-gene locus in potato. As indicated by synteny analysis, RB/Rpi-blb1 homologs were identified in all tested genomes, including potato, tomato, pepper, and Nicotiana, suggesting that the RB/Rpi-blb1 locus has an ancient origin. Two evolutionary patterns, similar to those reported on RGC2 in Lactuca, and Pi2/9 in rice, were detected at this locus. Type I RB/Rpi-blb1 homologs have frequent copy number variations and sequence exchanges, obscured orthologous relationships, considerable nucleotide divergence, and high non-synonymous to synonymous substitutions (Ka/Ks) between or within species, suggesting rapid diversification and balancing selection in response to rapid changes in the oomycete pathogen genomes. These characteristics may serve as signatures for cloning of late blight resistance genes.

  16. Biosynthesis of steroidal alkaloids in Solanaceae plants: involvement of an aldehyde intermediate during C-26 amination.

    Science.gov (United States)

    Ohyama, Kiyoshi; Okawa, Akiko; Moriuchi, Yuka; Fujimoto, Yoshinori

    2013-05-01

    The C-26 amino group of steroidal alkaloids, such as tomatine, is introduced during an early step of their biosynthesis from cholesterol. In the present study, the mechanism of C-26 amination was reinvestigated by administering stable isotope labeled compounds, such as (26,26,26,27,27,27-(2)H6)cholesterol during biosynthesis of tomatine, solanine and solasonine. The chemical compositions of tomatine and solanine so obtained were analyzed by LC-MS after administering the d6-cholesterol to a tomato seedling and a potato shoot, respectively. The resulting spectra indicated that two deuterium atoms were eliminated from C-26 of cholesterol during biosynthesis. Furthermore, administration of (6-(13)C(2)H3)mevalonate in combination with lovastatin to an eggplant seedling, followed by GC-MS analysis of solasodine after TMS derivatization established that two deuterium atoms were eliminated from C-26 of cholesterol during solasonine biosynthesis. These findings are in contrast to an earlier observation that one hydrogen atom was lost from C-26 during tomatidine biosynthesis, and suggest that C-26 nitrogen atom addition involves an aldehyde intermediate. Thus, it is proposed that the C-26 amination reaction that occurs during steroidal alkaloid biosynthesis proceeds by way of a transamination mechanism. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Genetic diversity and structure in semiwild and domesticated chiles (Capsicum annuum; Solanaceae) from Mexico.

    Science.gov (United States)

    Aguilar-Meléndez, Araceli; Morrell, Peter L; Roose, Mikeal L; Kim, Seung-Chul

    2009-06-01

    The chile of Mesoamerica, Capsicum annuum, is one of five domesticated chiles in the Americas. Among the chiles, it varies the most in size, form, and color of its fruits. Together with maize, C. annuum is one of the principal elements of the neotropical diets of Mesoamerican civilizations. Despite the great economic and cultural importance of C. annuum both worldwide and in Mexico, however, very little is known about its geographic origin and number of domestications. Here we sampled a total of 80 accessions from Mexico (58 semiwild and 22 domesticated) and examined nucleotide sequence diversity at three single- or low-copy nuclear loci, Dhn, G3pdh, and Waxy. Across the three loci, we found an average reduction of ca. 10% in the diversity of domesticates relative to semiwild chiles and geographic structure within Mexican populations. The Yucatan Peninsula contained a large number of haplotypes, many of which were unique, suggesting an important region of chile domestication and center of diversity. The present sampling of loci did not conclusively resolve the number and location of domestications, but several lines of evidence suggest multiple independent domestications from widely distributed progenitor populations.

  18. Analgesic and anti-inflammatory properties of aqueous extract from leaves of Solanum torvum (Solanaceae).

    Science.gov (United States)

    Ndebia, E J; Kamgang, R; Nkeh-ChungagAnye, B N

    2006-11-13

    Solanum torvum is used in Cameroonian traditional medicine for the management of pain and inflammation. The present work assesses the pain-killing and anti-inflammatory properties of the aqueous extracts of Solanum torvum leaves. Acetic acid- and pressure- induced pains were reduced by this extract while carrageenan-induced inflammation was inhibited at various doses of the extract. The extract therefore has both analgesic and anti-inflammatory properties.

  19. Analgesic and Anti-Inflammatory Properties of Aqueous Extract from Leaves of Solanum Torvum (Solanaceae)

    OpenAIRE

    Ndebia, E J; Kamgang, R; Nkeh-ChungagAnye, B N

    2006-01-01

    Solanum torvum is used in Cameroonian traditional medicine for the management of pain and inflammation. The present work assesses the pain-killing and anti-inflammatory properties of the aqueous extracts of Solanum torvum leaves. Acetic acid- and pressure- induced pains were reduced by this extract while carrageenan-induced inflammation was inhibited at various doses of the extract. The extract therefore has both analgesic and anti-inflammatory properties.

  20. MORPHOLOGY OF FOLIAR EPIDERMIS IN TWO GROUPS OF SOLANUM SECTION GEMINATA (SOLANACEAE

    Directory of Open Access Journals (Sweden)

    Benítez de Rojas Carmen

    2009-06-01

    Full Text Available Solanum arboreum, S. falconense, S. gratum, S. lucens, S. ripense and S. tanysepalum of the S. arboreum group; S. imberbe and S. sieberi of Solanum deflexiflorum group were studied in the context of ongoing anatomical research in the Geminata section of the genus Solanum, in order to identity epidermal features that can be recognized and employed as useful taxonomic characters. Leaf materials were taken from herbarium specimens and treated using conventional anatomical procedures. Qualitative features such as epidermal cell wall shape and thickeness; stomata distribution, type and density, and trichome type and distribution were evaluated as well as quantitative traits such as stomatal length and width, stomatal index (SI and trichome density. Some of the studied epidermal features are of particular interest, especially on the adaxial surface, because they differ conspicuously between species. Polygonal cells are unique in all studied species but S. lucens and S. tanysepalum. Differences were also found in trichome, distribution (on intercostal areas of S. imberbe and S. sieberi as well as trichome type, which preved useful in differentiating some of the studied species. Glandular long and short, branched trichomes were found only on the adaxial epidermis in S. tanysepalum. On the abaxial surface only S. falconense showed eglandular, long and unbranched trichomes. A key for identification of the species is provided.

  1. Karyotype differentiation of four Cestrum species (Solanaceae based on the physical mapping of repetitive DNA

    Directory of Open Access Journals (Sweden)

    Jéferson Nunes Fregonezi

    2006-01-01

    Full Text Available We studied the karyotypes of four Brazilian Cestrum species (C. amictum, C. intermedium, C. sendtnerianum and C. strigilatum using conventional Feulgen staining, C-Giemsa and C-CMA3/DAPI banding, induction of cold-sensitive regions (CSRs and fluorescent in situ hybridization (FISH with rDNA probes. We found that the karyotypes of all four species was 2n = 2x = 16, with, except for the eighth acrocentric pair, a predominance of meta- and submetacentric chromosomes and various heterochromatin classes. Heterochromatic types previously unreported in Cestrum as neutral C-CMA3(0/DAPI0 bands, CMA3+ bands not associated with NORs, and C-Giemsa/CSR/DAPI- bands were found. The heterochromatic blocks varied in size, number, position and composition. The 45S rDNA probe preferentially located in the terminal and subterminal regions of some chromosomes, while 5S rDNA appeared close to the centromere of the long arm of pair 8. These results suggest that karyotype differentiation can occur mainly due to changes in repetitive DNA, with little modification in the general composition of the conventionally stained karyotype.

  2. Anatomical study of different fruit types in Argentine species of Solanum subgen. Leptostemonum (Solanaceae

    Directory of Open Access Journals (Sweden)

    Chiarini, Franco

    2007-12-01

    Full Text Available The fruits of 11 species of Solanum subgen. Leptostemonum were studied. Cross and/or longitudinal microtome sections, stained mostly with astra blue/basic fuchsin, were prepared for microscopic examination. The fruits, notably heterogeneous, were classified into three categories. Three different kinds of cells were found of the epidermis, immediately below which a hypodermis, consisting in any of five types of structures, was always found. The mesocarp presented two histologically differentiated zones, an external one (formed by normal or spongy parenchyma, depending on the species, and an internal one, commonly juicy, and with proliferations among the seeds. This morpho-anatomical information was used to distinguish between non-capsular dehiscent fruits and the berry traditionally described for Solanum. The relationship between structure and function, and the probable dispersal syndromes are also discussed.Se estudiaron los frutos de 11 especies de Solanum subgen. Leptostemonum. Para ello, se efectuaron cortes microtómicos longitudinales y/o transversales, teñidos en su mayor parte con azul astral/fucsina, y fueron examinados al microscopio. Los frutos, notablemente heterogéneos, fueron clasificados en tres categorías. Tres diferentes tipos de células fueron encontrados en la epidermis, e inmediatamente por debajo se observó siempre una hipodermis, constituida por uno de cinco tipos de estructuras. El mesocarpio presentó dos zonas histológicamente diferenciadas: una externa (formada por parénquima normal o esponjoso, según la especie y una interna, comúnmente jugosa y con proliferaciones entre las semillas. Esta información morfoanatómica fue usada para distinguir entre el fruto dehiscente no capsular y la baya tradicionalmente descrita para Solanum. Se discutieron además la relación entre estructura y función y los probables síndromes de dispersión.

  3. Anatomical structure and surface micromorphology of tomatillo leaf and flower (Physalis ixocarpa Brot., Solanaceae

    Directory of Open Access Journals (Sweden)

    Barbara Dyki

    2014-01-01

    Full Text Available Tomatillo (Physalis ixocarpa Brot. is a newly introduced cultivated plant in Poland. Its anatomy was investigated in light and scanning electron microscopes. Tomatillo adult leaf had one layer of palisade parenchyma. The 1-2 cell layers of spongy parenchyma situated just below the palisade parenchyma showed large, tightly packed cells with great druses. The remaining spongy parenchyma was built of cells showing several extensions. Peculiarity of the sepals were the stomata situated on columns or hills formed of many cells. The petals had a very loose mesophyl. Their adaxial epidermis was composed of papillate cells. Such structure of the petal epidermis probably contributes to light dispersion and prevents glittering. There were several types of trichomes on the leaves, sepals and petals, some of them glandular and some simple. The large, very ramified, dendritic trichomes situated on the petals at the entry to the ovary might eventually protect it against excessive drying. The pollen grain was spherical, three-colpate. The style had a hollow channel inside. The stigma was of a wet, pa-pillate type. Sometimes thorny trichomes were found among papillae.

  4. [Incidence and altitudinal distribution of 13 virus cultures in Solanum tuberosum (Solanaceae) from Costa Rica].

    Science.gov (United States)

    Vásquez, Viviana; Montero-Astúa, Mauricio; Rivera, Carmen

    2006-12-01

    A survey was conducted in 30 fields located at three different altitudes in Cartago, Costa Rica's main potato producing area. Twenty plants were sampled per farm, for a total of 600 samples with 200 samples per altitude. ELISA was used with commercial reagents to independently test for PVX, PVY, PVM, PVA, PVS, PLRV, PMTV, PAMV, PVV, PVT, APLV, APMoV and TRSV. The presence of the following viruses was determined: PVX (77 %), PAMV (62 %), PLRV (42 %), TRSV (42 %), PVT (39 %), PVV (37 %), PMTV (31%), PVY (30 %), PVS (19 %), PVM (13 %), PVA (8 %), and APMoV (8%). APLV was not detected in any sample. This is the first report in Costa Rica of the presence of the viruses PMTV, PAMV, PVV, PVT and APMoV. A high viral incidence in the tuber seed production area as well as a high rate of mixed infections is reported.

  5. A clarified position for Solanum lycopersicum var. cerasiforme in the evolutionary history of tomatoes (solanaceae).

    Science.gov (United States)

    Ranc, Nicolas; Muños, Stéphane; Santoni, Sylvain; Causse, Mathilde

    2008-12-20

    The natural phenotypic variability present in the germplasm of cultivated plants can be linked to molecular polymorphisms using association genetics. However it is necessary to consider the genetic structure of the germplasm used to avoid false association. The knowledge of genetic structure of plant populations can help in inferring plant evolutionary history. In this context, we genotyped 360 wild, feral and cultivated accessions with 20 simple sequence repeat markers and investigated the extent and structure of the genetic variation. The study focused on the red fruited tomato clade involved in the domestication of tomato and confirmed the admixture status of cherry tomatoes (Solanum lycopersicum var. cerasiforme). We used a nested sample strategy to set-up core collection maximizing the genetic diversity with a minimum of individuals. Molecular diversity was considerably lower in S. lycopersicum i.e. the domesticated form. Model-based analysis showed that the 144 S. lycopersicum var. cerasiforme accessions were structured into two groups: one close to the domesticated group and one resulting from the admixture of the S. lycopersicum and S. pimpinellifolium genomes. SSR genotyping also indicates that domesticated and wild tomatoes have evolved as a species complex with intensive level of hybridization. We compiled genotypic and phenotypic data to identify sub-samples of 8, 24, 32 and 64 cherry tomato accessions that captured most of the genetic and morphological diversity present in the entire S. lycopersicum var. cerasiforme collection. The extent and structure of allelic variation is discussed in relation to historical events like domestication and modern selection. The potential use of the admixed group of S. lycopersicum var. cerasiforme for association genetics studies is also discussed. Nested core collections sampled to represent tomato diversity will be useful in diversity studies. Molecular and phenotypic variability of these core collections is defined. These collections are available for the scientific community and can be used as standardized panels for coordinating efforts on identifying novel interesting genes and on examining the domestication process in more detail.

  6. Listado anotado de Solanum L. (Solanaceae) en el Perú

    DEFF Research Database (Denmark)

    Särkinen, Tiina; Baden, Maria; Gonzáles, Paúl

    2015-01-01

    ), and Canta and Huarochirí (Lima). Secondary centres of endemism with high concentrations of both endemics and near-endemics are found in San Ignacio and Cutervo (Cajamarca), Santiago de Chuco (La Libertad), Oxapampa (Pasco), and Cusco (Cusco). Current diversity patterns are highly correlated with collection...

  7. Constraint around Quarter-Power Allometric Scaling in Wild Tomatoes (Solanum sect. Lycopersicon; Solanaceae).

    Science.gov (United States)

    Muir, Christopher D; Thomas-Huebner, Meret

    2015-09-01

    The West-Brown-Enquist (WBE) metabolic scaling theory posits that many organismal features scale predictably with body size because of selection to minimize transport costs in resource distribution networks. Many scaling exponents are quarter-powers, as predicted by WBE, but there are also biologically significant deviations that could reflect adaptation to different environments. A central but untested prediction of the WBE model is that wide deviation from optimal scaling is penalized, leading to a pattern of constraint on scaling exponents. Here, we demonstrate, using phylogenetic comparative methods, that variation in allometric scaling between mass and leaf area across 17 wild tomato taxa is constrained around a value indistinguishable from that predicted by WBE but significantly greater than 2/3 (geometric-similarity model). The allometric-scaling exponent was highly correlated with fecundity, water use, and drought response, suggesting that it is functionally significant and therefore could be under selective constraints. However, scaling was not strictly log-log linear but rather declined during ontogeny in all species, as has been observed in many plant species. We caution that although our results supported one prediction of the WBE model, it did not strongly test the model in other important respects. Nevertheless, phylogenetic comparative methods such as those used here are powerful but underutilized tools for metabolic ecology that complement existing methods to adjudicate between models.

  8. Leaf epidermal characters of Solanum sect. polytrichum (Solanaceae) as taxonomic evidence.

    Science.gov (United States)

    Nurit-Silva, Kiriaki; De Fátima Agra, Maria

    2011-12-01

    The morphological similarities among the species of Solanum are remarkable, and are often very difficult one clear distinction between them. This paper presents a comparative anatomical study of the leaf epidermis of five Brazilian species of Solanum sect. Polytrichum, carried out using light and scanning electron microscopy. The leaf epidermis surfaces were investigated to evaluate their taxonomic significance to be used for separation and delimitation of the species of the section. As results, some micro-morphological characters of the leaf epidermis, such as density, distribution and type of stellate trichomes, and the anticlinal walls of epidermal cells, and also the type and distribution of stomata proved to be the most useful and distinctive characters for the separation and delimitation of the species, and also may contribute as an additional support to the interspecific taxonomy and systematic of Solanum sect. Polytrichum. Copyright © 2011 Wiley Periodicals, Inc.

  9. COMPUESTOS FENÓLICOS AISLADOS DE LA ESPECIE Solanum validinervium (Solanaceae SECCION GEMINATA

    Directory of Open Access Journals (Sweden)

    Luis Enrique Cuca Suárez

    2008-03-01

    Full Text Available A partir del extracto etanólico de la parte aérea de la especie Solanum validinervium  se aisló el compuesto 2-(4’-hidroxifenil-etanol, las cumarinas esculetina e isoescopoletina y un nuevo glucósido de cumarina identificado como 1’-O-7-esculetina-4’-O-1’’-etilenglicol-β-D-glucopiranosa. Sus estructuras fueron elucidadas por medio de técnicas espectroscópicas (IR y RMN-1H, RMN-13C  en una y dos dimensiones.

  10. Induction of quinone reductase (QR) by withanolides isolated from Physalis pubescens L. (Solanaceae).

    Science.gov (United States)

    Ji, Long; Yuan, Yonglei; Ma, Zhongjun; Chen, Zhe; Gan, Lishe; Ma, Xiaoqiong; Huang, Dongsheng

    2013-09-01

    In the present study, it was demonstrated that the dichloromethane extract of Physalis pubescens L. (DEPP) had weak potential quinone reductase (QR) inducing activity, but an UPLC-ESI-MS method with glutathione (GSH) as the substrate revealed that the DEPP had electrophiles (with an α,β-unsaturated ketone moiety). These electrophiles could induce quinone reductase (QR) activity, which might be attributed to the modification of the highly reactive cysteine residues in Keap1. Herein, four withanolides, including three new compounds physapubescin B (2), physapubescin C (3), physapubescin D (4), together with one known steroidal compound physapubescin (1) were isolated. Structures of these compounds were determined by spectroscopic analysis and that of physapubescin C (3) was confirmed by a combination of molecular modeling and quantum chemical DFT-GIAO calculations. Evaluation of the QR inducing activities of all withanolides indicated potent activities of compounds 1 and 2, which had a common α,β-unsaturated ketone moiety. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Induction of quinone reductase (QR) by withanolides isolated from Physalis angulata L. var. villosa Bonati (Solanaceae).

    Science.gov (United States)

    Ding, Hui; Hu, Zhijuan; Yu, Liyan; Ma, Zhongjun; Ma, Xiaoqiong; Chen, Zhe; Wang, Dan; Zhao, Xiaofeng

    2014-08-01

    In the present study, the EtOAc extract of the persistent calyx of Physalis angulata L. var. villosa Bonati (PA) was tested for its potential quinone reductase (QR) inducing activity with glutathione (GSH) as the substrate using an UPLC-ESI-MS method. The result revealed that the PA had electrophiles that could induce quinone reductase (QR) activity, which might be attributed to the modification of the highly reactive cysteine residues in Keap1. Herein, three new withanolides, compounds 3, 6 and 7, together with four known withanolides, compounds 1, 2, 4 and 5 were isolated from PA extract. Their structures were determined by spectroscopic techniques, including (1)H-, (13)C NMR (DEPT), and 2D-NMR (HMBC, HMQC, (1)H, (1)H-COSY, NOESY) experiments, as well as by HR-MS. All the seven compounds were tested for their QR induction activities towards mouse hepa 1c1c7 cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. A Community-Based Annotation Framework for Linking Solanaceae Genomes with Phenomes

    National Research Council Canada - National Science Library

    Naama Menda; Robert M. Buels; Isaak Tecle; Lukas A. Mueller

    2008-01-01

    The amount of biological data available in the public domain is growing exponentially, and there is an increasing need for infrastructural and human resources to organize, store, and present the data in a proper context...

  13. Estudio de la diversidad citogenética de Physalis peruviana L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Nohra Cecilia Rodríguez Castillo

    2006-07-01

    Full Text Available municipios de Villa de Leyva (Boyacá, Colombia, La Calera y Choachí (Cundinamarca, Colombia y dos cultivados, uno de ellos nativo, el ecotipo Colombia distribuido en el municipio de Subachoque (Cundinamarca y uno foráneo, procedente de Kenia, cultivado en el municipio de Paipa (Cundinamarca. Ápices radicales obtenidos a partir de semillas y de hojas en medios de cultivo in vitro enriquecidos con auxinas se emplearon para estandarizar el protocolo de obtención de cromosomas, con las diferentes técnicas de pretratamiento, fijación, hidrólisis y montaje de las muestras. Adicionalmente se evaluó la duración del ciclo celular para establecer la hora mitótica. Se encontró variabilidad genética entre los ecotipos evaluados. Los ecotipos silvestres presentaron una dotación cromosómica 2n=24, el ecotipo Colombia 2n=32 y el ecotipo Kenia 2n=48. Los ecotipos exhibieron también variación en las características morfológicas y anatómicas, que de acuerdo a la literatura, son un reflejo del nivel de ploidía, como altura, área foliar, número de estomas/mm', número de cloroplastos en las células guarda de los estomas, diámetro de frutos, semillas y contenido de masa seca.

  14. Antioxidant, antibacterial and cytotoxic potential of the ripe fruits of Solanum lycocarpum A. St. Hil. (Solanaceae).

    Science.gov (United States)

    Morais, Melissa Grazielle; da Costa, Guilherme Augusto Ferreira; Aleixo, Álan Alex; de Oliveira, Graziela Teixeira; Alves, Lucas Ferreira; Duarte-Almeida, Joaquim Maurício; Siqueira Ferreira, Jaqueline Maria; Lima, Luciana Alves Rodrigues dos Santos

    2015-01-01

    Ethanol extract (EE) and fractions obtained from the ripe fruits of Solanum lycocarpum were examined in order to determine their phenolic composition, antioxidant capacity, antibacterial activities and cytotoxic potential. High-performance liquid chromatography coupled with DAD analysis indicated that caffeic and chlorogenic acids were the main phenolic compounds present in the EE, dichloromethane (DCM) and ethyl acetate (Ac) fractions. The antioxidant activity assessed by the scavenging ability on 1,1-diphenyl-2-picrylhydrazyl radical was significantly more pronounced for DCM and Ac fractions than that of the commercial antioxidant 2,6-di-tert-butyl-4-methylphenol (BHT). EE and fractions exhibited selective antibacterial activity against Gram-positive bacteria, especially the hexane (Hex) and DCM fractions. EE and fractions exhibited low toxicity towards the LLC-MK2 cell line, especially the Hex, DCM and Ac fractions. This work provides the knowledge of phenolic composition in the extract and fractions from the ripe fruits of S. lycocarpum and their antioxidant, antibacterial and cytotoxic activities.

  15. Inbreeding depression in Solanum carolinense (Solanaceae), a species with a plastic self-incompatibility response

    NARCIS (Netherlands)

    Mena-Ali, J.I.; Keser, L.H.; Stephenson, A.G.

    2008-01-01

    Solanum carolinense (horsenettle) is a highly successful weed with a gametophytic self-incompatibility (SI) system. Previous studies reveal that the strength of SI in S. carolinense is a plastic trait, associated with particular S-alleles. The importance of this variation in self-fertility on the

  16. Effect of different substrates for organic agriculture in seedling development of traditional species of Solanaceae

    Directory of Open Access Journals (Sweden)

    Hector Molina

    2016-03-01

    Full Text Available Sowing of seedlings is one of the most critical processes on the establishment of a crop, since the future development of the plant depends largely on its health when is planted on the field. Moreover, organic agriculture has to deal with the low application of fertilizers and pesticides, which hinder the growth of seedlings. In this work, we studied the big influence of different mixtures of substrates suitable for organic agriculture based on peat, coconut husk and vermicompost in traditional varieties of tomato, pepper and eggplant. Our results indicate that the use of coconut husk based substrates in organic agriculture can reduce the growth of seedlings between 20 and 30% compared with peat-based substrates. Moreover, the plants growth in this substrate showed lower levels of chlorophyll and lower weight, but the results are strongly dependent on the species tested. Comparison between traditional plants demonstrates that traditional varieties are strongly influenced by the substrate, whereas the growth of a commercial variety of tomato barely differs when different substrates are used. The election of the substrate in organic agriculture is critical to the correct development of the plant, especially when traditional plant varieties are used.

  17. Fruit Morphology as Taxonomic Features in Five Varieties of Capsicum annuum L. Solanaceae

    Directory of Open Access Journals (Sweden)

    Daniel Andrawus Zhigila

    2014-01-01

    Full Text Available Variations in the fruit morphological features of Capsicum annuum varieties were studied. Varieties studied include var. abbreviatum, var. annuum, var. accuminatum, var. grossum, and var. glabriusculum. The fruit morphology revealed attenuated fruit shape with rounded surfaces in var. glabriusculum, and cordate fruit shape with flexuous surface in var. annuum, abbreviatum and accuminatum. The fruit is a berry and may be green, yellow, or red when ripe. The fruit epidermal cell-wall patterns are polygonal in shape with straight and curved anticlinal walls in all the five varieties. The fruit of var. abbreviatum and var. grossum is trilocular, while that of var. accuminatum and annuum is bilocular, and that of var. glabriusculum is tetralocular. Capsicum annuum var. glabriusculum had the highest mean number of seeds (108.4 and var. annuum had the lowest number of seeds (41.3 per fruit. The fruit is conspicuously hollowed in var. glabriusculum, accuminatum, and annuum but inconspicuously hollowed in var. abbreviatum and var. grossum. These features are shown to be good taxonomic characters for delimiting the five varieties of Capsicum annuum.

  18. Avaliação da atividade antibiofilme de Capsicum baccatum var. pendulum (Solanaceae)

    OpenAIRE

    Rafael Gomes Von Borowski

    2015-01-01

    Muitas espécies de pimentas vermelhas do gênero Capsicum são utilizadas em práticas medicinais tradicionais. Essas plantas são empregadas em algumas preparações para tratar uma variedade de doenças, incluindo infecções. Algumas bactérias produzem biofilme como um importante fator de virulência, pois a estrutura do biofilme intermedia a adesão bacteriana a superfícies, como em dispositivos implantados, sondas e cateteres além de promover proteção física contra os antibióticos ou as respostas d...

  19. Analysis of fatty acid composition of Withania coagulans fruits by gas chromatography/mass spectrometry

    Directory of Open Access Journals (Sweden)

    A. Ali

    2017-10-01

    Full Text Available Background and objectives: Withania coagulans Dunal (Solanaceae fruits are recommended to treat asthma, dyspepsia, biliousness, flatulent colic, liver complaints, intestinal infections, strangury, wounds and as diuretic, emetic and sedative agent in Indian traditional system of medicine. The objective of this study was to describe the systematic fatty acid composition of the petroleum ether extract of W. coagulans fruits. Methods: Petroleum ether extract of W. coagulans fruits was prepared by maceration. Components of the W. coagulans petroleum ether extract were identified by gas chromatography-mass spectrometry and their concentrations were determined. Results: The fixed oil of W. coagulans fruits constituted of twenty nine components including unsaturated (52.36% and saturated (22.15% fatty acids, alkenes (5.65%, phytosterols (4.39%, fatty alcohols (4.14%, aromatic acid (3.56%, monoterpenes (3.22%, triterpenoids (1.83% and alkanes (2.7%. Most of the saturated and unsaturated fatty acids were identified as their methyl esters. Conclusions: Palmitoleic and 11-eicosenoic acids have been reported for the first time in petroleum ether extract of the W. coagulans fruits. The present study has illustrated the chemical nature of W. coagulans fruit and described its fatty acids composition.

  20. Vasoactive and antioxidant activities of plants used in Mexican traditional medicine for the treatment of cardiovascular diseases.

    Science.gov (United States)

    Ibarra-Alvarado, C; Rojas, A; Mendoza, S; Bah, M; Gutiérrez, D M; Hernández-Sandoval, L; Martínez, M

    2010-07-01

    This study demonstrated that the aqueous extracts of plants employed in Mexican traditional medicine for the treatment of cardiovascular diseases are able to modify the tone of arterial smooth muscle. Agastache mexicana (Kunth) Lint & Epling (Labiatae), Chenopodium murale L. (Chenopodiaceae), Chirantodendron pentadactylon Larreat (Sterculiaceae), Dracocephalum moldavica L. (Labiatae), Psittacanthus calyculatus G. Don (Loranthaceae), Prunus serotina ssp. capuli (Cav. ex Spreng) McVaugh (Rosaceae), and Sechium edule Sw. (Cucurbitaceae) contain secondary metabolites that promote vascular relaxation and display antioxidant activities. As expected, their antioxidant effects showed a significant correlation with the polyphenolics content. However, a lower correlation was found between the antioxidant activity and the maximum vasodilatory effect, suggesting that the vasodilatation elicited by the plant extracts could be only partly attributed to their antioxidant properties. The extract of P. calyculatus, which displayed a maximum vasorelaxant effect that was higher than that of acetylcholine, induced endothelium-dependent vasodilatation. Futhermore, the vasorelaxant response to the P. calyculatus extract was reduced after adding an inhibitor of soluble guanylate cyclase activity, providing evidence that the NO/cGMP pathway is involved. On the other hand, the extracts of Bocconia frutescens L. (Papaveraceae), Magnolia grandiflora L. (Magnoliaceae), and Solanum rostratum Dunal (Solanaceae) induced concentration-dependent contraction of rat aortic rings, suggesting that these plants have potential health benefits for the treatment of ailments such as venous insufficiency. The pharmacological activities of the extracts studied provide scientific support for their ethnomedical use.

  1. Effect of Withania Somnifera Root Powder on the Levels of Circulatory Lipid Peroxidation and Liver Marker Enzymes in Chronic Hyperammonemia

    Directory of Open Access Journals (Sweden)

    B. Harikrishnan

    2008-01-01

    Full Text Available Withania somnifera (L Dunal (Solanaceae, commonly called Ashwagandha (Sanskrit is an Ayurvedic Indian medicinal plant, which has been widely used as a home remedy for several ailments. We have investigated the influence of W.somnifera root powder on the levels of circulatory ammonia, urea, lipid peroxidation products such as TBARS (thiobarbituric acid and reactive substances, HP (hydroperoxides and liver marker enzymes such as AST (aspartate transaminase, ALT (alanine transaminase and ALP (alkaline phosphatase, for its hepatoprotective effect in ammonium chloride induced hyperammonemia. Ammonium chloride treated rats showed a significant increase in the levels of circulatory ammonia, urea, AST, ALT, ALP, TBARS and HP. These changes were significantly decreased in rats treated with W.somnifera root powder and ammonium chloride. Our results indicate that W.somnifera offers hepatoprotection by influencing the levels of lipid peroxidation products and liver markers in experimental hyperammonemia and this could be due to (i the presence of alkaloids, withanolids and flavonoids, (ii normalizing the levels of urea and urea related compounds, (iii its free radical scavenging property and (iv its antioxidant property. The exact underlying mechanism is still unclear and further research needed.

  2. Changes in pectinases, dietary fibers, and physicochemical indices related to the flavor of cubiu fruits during ripening

    Directory of Open Access Journals (Sweden)

    Moacir Couto de Andrade Júnior

    2015-05-01

    Full Text Available The objective of this study was to evaluate the changes in the activity of pectinases (pectinesterase and polygalacturonase, dietary fiber content (alcohol-insoluble solids, pectin, and total fiber, and physicochemical indices related to the flavor (pH, titratable acidity, soluble solids, Brix/acid ratio, and reducing and nonreducing sugars of cubiu fruits (Solanum sessiliflorum Dunal at different stages of ripening (green, turning, ripe, and fully ripe. Alcohol-insoluble solids and pectin were very similar, with the highest levels detected at the green and turning stages, and the lowest levels occurring at the fully ripe stage. The amount of total fiber was consistent at the green, turning, and ripe stages, but declined at the fully ripe stage. These changes correlated with the pectinase activities, the profiles of which resembled those of other species of the Solanaceae family during fruit ripening. However, cubiu fruits were significant sources of dietary fiber at all stages. The reducing sugar content reached the highest level at the turning stage, with glucose as the major sugar. The content of nonreducing sugars, such as sucrose, remained low at all stages. The other physicochemical indices displayed increases during ripening, characterizing cubiu as a very acidic fruit with a small degree of sweetness.

  3. Resistance of Wild Solanum Accessions to Aphids and Other Potato Pests in Quebec Field Conditions

    Science.gov (United States)

    Fréchette, B.; Bejan, M.; Lucas, É.; Giordanengo, P.; Vincent, C.

    2010-01-01

    Two experiments were done to determine the susceptibility of six wild potato accessions to the aphids Macrosiphum euphorbiae (Thomas) (Hemiptera: Aphididae) and Myzus persicae (Sulzer). Densities of aphid colonies were compared between caged Solanum pinnatisectum Dunal (Solanales: Solanaceae), S. polyadenium Greenmam, S. tarijense Hawkes, S. infundibuliforme Philippi, S. oplocense Hawkes, and S. stoloniferum Schlechted and Bouché, and the commercially cultivated potato plant S. tuberosum L. cv. Désirée. Moreover the susceptibility of S. polyadenium and S. tarijense to the Colorado potato beetle Leptinotarsa decemlineata (Say) (Coleoptera: Chrlysomelidae), the potato flea beetle Epitrix cucumeris (Harris), and the potato leafhopper Empoasca fabae (Harris) (Hemiptera: Cicadellidae) was compared to that of S. tuberosum cv. Désirée in the field. Results indicated that S. polyadenium and S. tarijense were more resistant to M. persicae than S. pinnatisectum and the commercially cultivated S. tuberosum cv. Désirée. Solanum polyadenium was more resistant to aphids than S. tarijense in 2004, but not in 2005. Moreover, S. polyadenium and S. tarijense were more resistant than S. tuberosum cv. Désirée to L. decemlineata, E. cucumeris and E. fabae. PMID:21054161

  4. Anticancer activities of Withania somnifera: Current research, formulations, and future perspectives.

    Science.gov (United States)

    Rai, Mahendra; Jogee, Priti S; Agarkar, Gauravi; dos Santos, Carolina Alves

    2016-01-01

    Cancer, being a cause of death for major fraction of population worldwide, is one of the most studied diseases and is being investigated for the development of new technologies and more accurate therapies. Still the currently available therapies for cancer have many lacunae which affect the patient's health severely in the form of side effects. The natural drugs obtained from the medicinal plants provide a better alternative to fight against this devastating disease. Withania somnifera L. Dunal (Solanaceae), a well-known Ayurvedic medicinal plant, has been traditionally used to cure various ailments for centuries. Considering the immense potential of W. somnifera, this review provides a detail account of its vital phytoconstituents and summarizes the present status of the research carried out on its anticancerous activities, giving future directions. The sources of scientific literature were accessed from various electronic databases such as PubMed, Google Scholar, Science Direct, and library search. Various parts of W. somnifera especially the roots with its unique contents have been proved effective against different kinds of cancers. The most active components withanolides and withaferins along with a few other metabolites including withanone (WN) and withanosides have been reported effective against different types of cancer cell lines. This herb holds an important place among various anticancer medicinal plants. It is very essential to further screen and to investigate different formulations for anticancer therapy in vitro as well as in vivo in combination with established chemotherapy.

  5. Hepatoprotective effect of withanolide-rich fraction in acetaminophen-intoxicated rat: decisive role of TNF-α, IL-1β, COX-II and iNOS.

    Science.gov (United States)

    Devkar, Santosh T; Kandhare, Amit D; Zanwar, Anand A; Jagtap, Suresh D; Katyare, Surendra S; Bodhankar, Subhash L; Hegde, Mahabaleshwar V

    2016-11-01

    Overdose of acetaminophen (APAP) is common in humans and is often associated with hepatic damage. Withania somnifera (L.) Dunal (Solanaceae) shows multiple pharmacological activities including antioxidant and anti-inflammatory potential. To evaluate the possible mechanism of hepatoprotective activity of withanolide-rich fraction (WRF) isolated from a methanolic extract of Withania somnifera roots. Hepatotoxicity was induced by oral administration of APAP (750 mg/kg, p.o.) for 14 d. The control group received the vehicle. APAP-treated animals were given either silymarin (25 mg/kg) or graded doses of WRF (50, 100 and 200mg/kg) 2 h prior to APAP administration. Animals were killed on 15th day and blood and liver tissue samples were collected for the further analysis. In WRF-treated group, there was significant and dose-dependent (p hepatic SOD, GSH and total antioxidant capacity. The level of MDA and NO decreased significantly (p < 0.01) by WRF treatment. Up-regulated mRNA expression of TNF-α, IL-1β, COX-II and iNOS was significantly down-regulated (p < 0.001) by WRF. Histological alternations induced by APAP in liver were restored to near normality by WRF pretreatment. WRF may exert its hepatoprotective action by alleviating inflammatory and oxido-nitrosative stress via inhibition of TNF-α, IL-1β, COX-II and iNOS.

  6. Antibacterial efficacy of Withania somnifera (ashwagandha) an indigenous medicinal plant against experimental murine salmonellosis.

    Science.gov (United States)

    Owais, M; Sharad, K S; Shehbaz, A; Saleemuddin, M

    2005-03-01

    In the present study, we evaluated the antibacterial activity of ashwagandha [Withania somnifera L. Dunal (Solanaceae; root and leaves)], an Indian traditional medicinal plant against pathogenic bacteria. Both aqueous as well as alcoholic extracts of the plant (root as well as leaves) were found to possess strong antibacterial activity against a range of bacteria, as revealed by in vitro Agar Well Diffusion Method. The methanolic extract was further subfractionated using various solvents and the butanolic sub-fraction was found to possess maximum inhibitory activity against a spectrum of bacteria including Salmonella typhimurium. Moreover, in contrast to the synthetic antibiotic (viz. chloramphenicol), these extracts did not induce lysis on incubation with human erythrocytes, advocating their safety to the living cells. Finally, the antibacterial efficacy of the extracts isolated from plant (both root and leaves) was determined against experimental salmonellosis in Balb/C mice. Oral administration of the aqueous extracts successfully obliterated salmonella infection in Balb/C mice as revealed by increased survival rate as well as less bacterial load in various vital organs of the treated animals.

  7. Analgesic effects of an ethanol extract of the fruits of Xylopia aethiopica (Dunal A. Rich (Annonaceae and the major constituent, xylopic acid in murine models

    Directory of Open Access Journals (Sweden)

    Eric Woode

    2012-01-01

    Full Text Available Background: Fruit extracts of Xylopia aethiopica are used traditionally in the management of pain disorders including rheumatism, headache, colic pain, and neuralgia. Little pharmacological data exists in scientific literature of the effect of the fruit extract and its major diterpene, xylopic acid, on pain. The present study evaluated the analgesic properties of the ethanol extract of X. aethiopica (XAE and xylopic acid (XA, in murine models. Materials and Methods: XAE and XA were assessed in chemical (acetic acid-induced abdominal writhing and formalin tests, thermal (Tail-flick and Hargreaves thermal hyperalgesia tests, and mechanical (Randall-Selitto paw pressure test pain models. Results: XAE and XA exhibited significant analgesic activity in all the pain models used. XAE (30-300 mg kg -1 , p.o. and XA (10-100 mg kg -1 , p.o. inhibited acetic acid-induced visceral nociception, formalin- induced paw pain (both neurogenic and inflammatory, thermal pain as well as carrageenan-induced mechanical and thermal hyperalgesia in animals. Morphine (1-10 mg kg -1 , i.p. and diclofenac (1-10 mg kg -1 , i.p., used as controls, exhibited similar anti-nociceptive activities. XAE and XA did not induce tolerance to their respective anti-nociceptive effects in the formalin test after chronic administration. Morphine tolerance did not also cross-generalize to the analgesic effects of XAE or XA. Conclusions: These findings establish the analgesic properties of the ethanol fruit extract of X. aethiopica and its major diterpene, xylopic acid.

  8. Chemical variability of the leaf essential oil of Xylopia aethiopica (Dunal) A.Rich. from Côte d'Ivoire.

    Science.gov (United States)

    Yapi, Thierry Acafou; Boti, Jean Brice; Ahibo, Coffy Antoine; Bighelli, Ange; Castola, Vincent; Casanova, Joseph; Tomi, Félix

    2012-12-01

    The chemical composition of 48 essential-oil samples isolated from the leaves of Xylopia aethiopica harvested in six Ivoirian forests was investigated by GC-FID and (13) C-NMR analyses. In total, 23 components accounting for 82.5-96.1% of the oil composition were identified. The composition was dominated by the monoterpene hydrocarbons β-pinene (up to 61.1%) and α-pinene (up to 18.6%) and the sesquiterpene hydrocarbon germacrene D (up to 28.7%). Hierarchical cluster and principal component analyses allowed the distinction of two groups on the basis of the β-pinene and germacrene D contents. The chemical composition of the oils of Group I (38 oil samples) was clearly dominated by β-pinene, while those of Group II (10 samples) were characterized by the association of β-pinene and germacrene D. The leaves collected in the four inland forests produced β-pinene-rich oils (Group I), while the oil samples belonging to Group II were isolated from leaves harvested in forests located near the littoral. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  9. Efeito hipolipemiante da suplementação dietética com a farinha do cubiu (Solanum sessiliflorum Dunal em ratos hipercolesterolêmicos

    Directory of Open Access Journals (Sweden)

    J.R.P. MAIA

    2015-03-01

    Full Text Available Estudos com frutas e vegetais ricos em fibra alimentar tem demonstrado efeito redutor das concentrações sanguíneas de colesterol total, atuando de forma preventiva contra a hipercolesterolemia. O objetivo do presente trabalho foi analisar a composição química da farinha de cubiu e avaliar o efeito de seu consumo sobre a lipemia de ratos hipercolesterolêmicos. Foram utilizados 8 animais para cada tratamento, em 7 grupos sendo: 1 controle; 3 experimentais com 5%, 25% e 50% da recomendação de fibras (AIN-93 provenientes da farinha de cubiu; e 3 grupos per feeding tendo celulose e pectina como fonte de fibra alimentar nas mesmas proporções dos grupos experimentais. Ao final do ensaio foi verificado que não houve variação significativa no consumo de ração pelos animais e no ganho de massa corporal no decorrer do experimento. Os tratamentos com farinha de cubiu reduziram as concentrações de colesterol total (-21,6%, LDL-c (-56,8%, aumentaram a excreção de colesterol fecal (+116%, e diminuíram o colesterol hepático (-32,1%. Nenhum dos tratamentos promoveu alteração significativa nas concentrações de triglicerídeos. Os tratamentos com pectina e celulose demonstraram resultados semelhantes aos do cubiu. Os resultados observados servem como base para futuros estudos visando o aproveitamento biotecnológico deste fruto.

  10. Enhanced Biosynthesis of Withanolides by Elicitation and Precursor Feeding in Cell Suspension Culture of Withania somnifera (L.) Dunal in Shake-Flask Culture and Bioreactor

    Science.gov (United States)

    Sivanandhan, Ganeshan; Selvaraj, Natesan; Ganapathi, Andy; Manickavasagam, Markandan

    2014-01-01

    The present study investigated the biosynthesis of major and minor withanolides of Withania somnifera in cell suspension culture using shake-flask culture and bioreactor by exploiting elicitation and precursor feeding strategies. Elicitors like cadmium chloride, aluminium chloride and chitosan, precursors such as cholesterol, mevalonic acid and squalene were examined. Maximum total withanolides detected [withanolide A (7606.75 mg), withanolide B (4826.05 mg), withaferin A (3732.81 mg), withanone (6538.65 mg), 12 deoxy withanstramonolide (3176.63 mg), withanoside IV (2623.21 mg) and withanoside V (2861.18 mg)] were achieved in the combined treatment of chitosan (100 mg/l) and squalene (6 mM) along with 1 mg/l picloram, 0.5 mg/l KN, 200 mg/l L-glutamine and 5% sucrose in culture at 4 h and 48 h exposure times respectively on 28th day of culture in bioreactor. We obtained higher concentrations of total withanolides in shake-flask culture (2.13-fold) as well as bioreactor (1.66-fold) when compared to control treatments. This optimized protocol can be utilized for commercial level production of withanolides from suspension culture using industrial bioreactors in a short culture period. PMID:25089711

  11. Nitrogen treatment enhances sterols and withaferin A through transcriptional activation of jasmonate pathway, WRKY transcription factors, and biosynthesis genes in Withania somnifera (L.) Dunal.

    Science.gov (United States)

    Pal, Shaifali; Yadav, Akhilesh Kumar; Singh, Anup Kumar; Rastogi, Shubhra; Gupta, Madan Mohan; Verma, Rajesh Kumar; Nagegowda, Dinesh A; Pal, Anirban; Shasany, Ajit Kumar

    2017-01-01

    The medicinal plant Withania somnifera is researched extensively to increase the quantity of withanolides and specifically withaferin A, which finds implications in many pharmacological activities. Due to insufficient knowledge on biosynthesis and unacceptability of transgenic approach, it is preferred to follow alternative physiological methods to increase the yield of withanolides. Prior use of elicitors like salicylic acid, methyl jasmonate, fungal extracts, and even mechanical wounding have shown to increase the withanolide biosynthesis with limited success; however, the commercial viability and logistics of application are debatable. In this investigation, we tested the simple nitrogeneous fertilizers pertaining to the enhancement of withaferin A biosynthesis. Application of ammonium sulfate improved the sterol contents required for the withanolide biosynthesis and correlated to higher expression of pathway genes like FPPS, SMT1, SMT2, SMO1, SMO2, and ODM. Increased expression of a gene homologous to allene oxide cyclase, crucial in jasmonic acid biosynthetic pathway, suggested the involvement of jasmonate signaling. High levels of WRKY gene transcripts indicated transcriptional regulation of the pathway genes. Increase in transcript level could be correlated with a corresponding increase in the protein levels for WsSMT1 and WsWRKY1. The withaferin A increase was also demonstrated in the potted plants growing in the glasshouse and in the open field. These results implicated simple physiological management of nitrogen fertilizer signal to improve the yield of secondary metabolite through probable involvement of jasmonate signal and WRKY transcription factor for the first time, in W. somnifera besides improving the foliage.

  12. Nutrient analysis of Kunapa jala and Pancha gavya and their evaluation on germination of Ashwagandha (Withania somnifera Dunal) and Kalamegha (Andrographis paniculata Nees.) seeds: A comparative study.

    Science.gov (United States)

    Ankad, Gireesh M; Hiremath, Jagadishchandra; Patil, R T; Pramod, H J; Hegde, Harsha V

    2017-11-10

    Vrikshayurveda, an ancient science of plant life described by Surapala, deals with healthy growth and productivity of plants, which has clearly outlined a systematized agricultural practice that insisted the use of Kunapa jala (KJ) and Pancha gavya (PG). An experiment was conducted to validate KJ and PG by nutrient analysis and their effect on the germination parameters of Ashwagandha and Kalamegha seeds in comparison with other treatment groups. KJ and PG were prepared according to the classical references. The nutrient contents and germination parameters of KJ and PG were compared with other groups namely control (Contr), farmyard manure (FYM), humic acid (HA) and NPK. The pH and EC were 5.793, 2.653 dS/m and 5.584, 2.216 dS/m for KJ and PG respectively. KJ possess highest nutrient contents followed by PG. The germination parameters revealed the better activity of NPK followed by KJ, PG, HA, FYM and Contr. KJ and PG were found to be good in nutrient contents and were found to be effective on studied germination parameters of Ashwagandha and Kalamegha seeds. Copyright © 2017 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  13. A decade of molecular understanding of withanolide biosynthesis and in vitro studies in Withania somnifera (L. Dunal: Prospects and perspectives for pathway engineering

    Directory of Open Access Journals (Sweden)

    Niha eDhar

    2015-11-01

    Full Text Available Withania somnifera, a multipurpose medicinal plant is a rich reservoir of pharmaceutically active triterpenoids that are steroidal lactones known as withanolides. Though the plant has been well characterized in terms of phytochemical profiles as well as pharmaceutical activities, limited attempts have been made to decipher the biosynthetic route and identification of key regulatory genes involved in withanolide biosynthesis. This scenario limits biotechnological interventions for enhanced production of bioactive compounds. Nevertheless, recent emergent trends vis-à-vis, the exploration of genomic, transcriptomic, proteomic, metabolomic and in vitro studies have opened new vistas regarding pathway engineering of withanolide production. During recent years, various strategic pathway genes have been characterized with significant amount of regulatory studies which allude towards development of molecular circuitries for production of key intermediates or end products in heterologous hosts. Another pivotal aspect covering redirection of metabolic flux for channelizing the precursor pool towards enhanced withanolide production has also been attained by deciphering decisive branch point(s as robust targets for pathway modulation. With these perspectives, the current review provides a detailed overview of various studies undertaken by the authors and collated literature related to molecular and in vitro approaches employed in W. Somnifera for understanding various molecular network interactions in entirety.

  14. A Decade of Molecular Understanding of Withanolide Biosynthesis and In vitro Studies in Withania somnifera (L.) Dunal: Prospects and Perspectives for Pathway Engineering.

    Science.gov (United States)

    Dhar, Niha; Razdan, Sumeer; Rana, Satiander; Bhat, Wajid W; Vishwakarma, Ram; Lattoo, Surrinder K

    2015-01-01

    Withania somnifera, a multipurpose medicinal plant is a rich reservoir of pharmaceutically active triterpenoids that are steroidal lactones known as withanolides. Though the plant has been well-characterized in terms of phytochemical profiles as well as pharmaceutical activities, limited attempts have been made to decipher the biosynthetic route and identification of key regulatory genes involved in withanolide biosynthesis. This scenario limits biotechnological interventions for enhanced production of bioactive compounds. Nevertheless, recent emergent trends vis-à-vis, the exploration of genomic, transcriptomic, proteomic, metabolomics, and in vitro studies have opened new vistas regarding pathway engineering of withanolide production. During recent years, various strategic pathway genes have been characterized with significant amount of regulatory studies which allude toward development of molecular circuitries for production of key intermediates or end products in heterologous hosts. Another pivotal aspect covering redirection of metabolic flux for channelizing the precursor pool toward enhanced withanolide production has also been attained by deciphering decisive branch point(s) as robust targets for pathway modulation. With these perspectives, the current review provides a detailed overview of various studies undertaken by the authors and collated literature related to molecular and in vitro approaches employed in W. somnifera for understanding various molecular network interactions in entirety.

  15. Enhanced biosynthesis of withanolides by elicitation and precursor feeding in cell suspension culture of Withania somnifera (L. Dunal in shake-flask culture and bioreactor.

    Directory of Open Access Journals (Sweden)

    Ganeshan Sivanandhan

    Full Text Available The present study investigated the biosynthesis of major and minor withanolides of Withania somnifera in cell suspension culture using shake-flask culture and bioreactor by exploiting elicitation and precursor feeding strategies. Elicitors like cadmium chloride, aluminium chloride and chitosan, precursors such as cholesterol, mevalonic acid and squalene were examined. Maximum total withanolides detected [withanolide A (7606.75 mg, withanolide B (4826.05 mg, withaferin A (3732.81 mg, withanone (6538.65 mg, 12 deoxy withanstramonolide (3176.63 mg, withanoside IV (2623.21 mg and withanoside V (2861.18 mg] were achieved in the combined treatment of chitosan (100 mg/l and squalene (6 mM along with 1 mg/l picloram, 0.5 mg/l KN, 200 mg/l L-glutamine and 5% sucrose in culture at 4 h and 48 h exposure times respectively on 28th day of culture in bioreactor. We obtained higher concentrations of total withanolides in shake-flask culture (2.13-fold as well as bioreactor (1.66-fold when compared to control treatments. This optimized protocol can be utilized for commercial level production of withanolides from suspension culture using industrial bioreactors in a short culture period.

  16. Secondary metabolites and phenylpropanoid pathway enzymes as influenced under supplemental ultraviolet-B radiation in Withania somnifera Dunal, an indigenous medicinal plant.

    Science.gov (United States)

    Takshak, Swabha; Agrawal, S B

    2014-11-01

    The present study aims to investigate the effects of supplemental ultraviolet B (3.6 kJ m(-2)day(-1) above ambient) radiation on secondary metabolites and phenylpropanoid pathway enzymes of Withania somnifera under field conditions at 40, 70, and 100 days after transplantation. Secondary metabolites' (alkaloids, anthocyanins, carotenoids, flavonoids, lignin, phytosterols, saponins, and tannins) concentrations were analysed at the end of the treatments. Activities of phenylalanine ammonia lyase (PAL), cinnamyl alcohol dehydrogenase (CAD), 4-coumarate-CoA ligase (4CL), chalcone-flavanone isomerase (CHI), and dihydroflavonol reductase (DFR) were also determined. In treated plants, secondary metabolite-concentrations generally increased (higher concentrations being recorded in roots compared to leaves). Anomalies were recorded for lycopene in roots and phytosterols in leaves (all sampling ages); β-carotene declined in leaves at third sampling age. s-UV-B-treated plants depicted decrease in withanolide A content with concomitant increase in withaferin A (two major alkaloids analysed by HPLC) compared to their respective controls. Phenylpropanoid pathway enzyme-activities increased in leaves and roots under s-UV-B treatment, the latter showing greater increase. The study concludes that s-UV-B is a potent factor in increasing the concentrations of secondary metabolites and their biosynthetic pathway enzymes in W. somnifera. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Effect of cadmium stress on inductive enzymatic and nonenzymatic responses of ROS and sugar metabolism in multiple shoot cultures of Ashwagandha (Withania somnifera Dunal).

    Science.gov (United States)

    Mishra, Bhawana; Sangwan, Rajender S; Mishra, Smrati; Jadaun, Jyoti S; Sabir, Farzana; Sangwan, Neelam S

    2014-09-01

    Withania somnifera is one of the most important medicinal plant and is credited with various pharmacological activities. In this study, in vitro multiple shoot cultures were exposed to different concentrations (5-300 μM) of cadmium (Cd) as cadmium sulphate to explore its ability to accumulate the heavy metal ion and its impact on the metabolic status and adaptive responses. The results showed that supplemental exposure to Cd interfered with N, P, and K uptake creating N, P, and K deficiency at higher doses of Cd that also caused stunting of growth, chlorosis, and necrosis. The study showed that in vitro shoots could markedly accumulate Cd in a concentration-dependent manner. Enzymatic activities and isozymic pattern of catalase, ascorbate peroxidase, guaiacol peroxidase, peroxidase, glutathione-S-transferase, glutathione peroxidase, monodehydroascorbate reductase, and dehydroascorbate reductase were altered substantially under Cd exposure. Sugar metabolism was also markedly modulated under Cd stress. Various other parameters including contents of photosynthetic pigments, phenolics, tocopherol, flavonoids, reduced glutathione, nonprotein thiol, ascorbate, and proline displayed major inductive responses reflecting their protective role. The results showed that interplay of enzymatic as well as nonenzymatic responses constituted a system endeavor of tolerance of Cd accumulation and an efficient scavenging strategy of its stress implications.

  18. Light and auxin responsive cytochrome P450s from Withania somnifera Dunal: cloning, expression and molecular modelling of two pairs of homologue genes with differential regulation.

    Science.gov (United States)

    Srivastava, Sudhakar; Sangwan, Rajender Singh; Tripathi, Sandhya; Mishra, Bhawana; Narnoliya, L K; Misra, L N; Sangwan, Neelam S

    2015-11-01

    Cytochrome P450s (CYPs) catalyse a wide variety of oxygenation/hydroxylation reactions that facilitate diverse metabolic functions in plants. Specific CYP families are essential for the biosynthesis of species-specialized metabolites. Therefore, we investigated the role of different CYPs related to secondary metabolism in Withania somnifera, a medicinally important plant of the Indian subcontinent. In this study, complete complementary DNAs (cDNAs) of four different CYP genes were isolated and christened as WSCYP93Id, WSCYP93Sm, WSCYP734B and WSCYP734R. These cDNAs encoded polypeptides comprising of 498, 496, 522 and 550 amino acid residues with their deduced molecular mass of 56.7, 56.9, 59.4 and 62.2 kDa, respectively. Phylogenetic study and molecular modelling analysis of the four cloned WSCYPs revealed their categorization into two CYP families (CYP83B1 and CYP734A1) belonging to CYP71 and CYP72 clans, respectively. BLASTp searches showed similarity of 75 and 56 %, respectively, between the two CYP members of CYP83B1 and CYP734A1 with major variances exhibited in their N-terminal regions. The two pairs of homologues exhibited differential expression profiles in the leaf tissues of selected chemotypes of W. somnifera as well as in response to treatments such as methyl jasmonate, wounding, light and auxin. Light and auxin regulated two pairs of WSCYP homologues in a developing seedling in an interesting differential manner. Their lesser resemblance and homology with other CYP sequences suggested these genes to be more specialized and distinct ones. The results on chemotype-specific expression patterns of the four genes strongly suggested their key/specialized involvement of the CYPs in the biosynthesis of chemotype-specific metabolites, though their further biochemical characterization would reveal the specificity in more detail. It is revealed that WSCYP93Id and WSCYP93Sm may be broadly involved in the oxygenation reactions in the plant and, thereby, control various pathways involving such metabolic reactions in the plant. As a representative experimental validation of this notion, WSCYP93Id was heterologouly expressed in Escherichia coli and catalytic capabilities of the recombinant WSCYP93Id protein were evaluated using withanolides as substrates. Optimized assays with some major withanolides (withanone, withaferin A and withanolide A) involving spectrophotometric as well as high-pressure liquid chromatography (HPLC)-based evaluation (product detection) of the reactions showed conversion of withaferin A to a hydroxylated product. The genes belonging to other CYP group are possibly involved in some specialised synthesis such as that of brassinosteroids.

  19. Effect of Ethanolic Extract from Seeds or Pods of Xylopia Aethiopica (Dunal) A. Rich (Annonaceae) on the Testicular Function of Adult Male Rats.

    Science.gov (United States)

    Abarikwu, Sunny O; Ogunlaja, Aemere; Otuechere, Chiagoziem A; Gideon, OlatunBosun

    2017-10-01

    Xylopia aethiopica (Annonaceae) is used in some folk medicines and widely consumed as a spice in some parts of Nigeria. Its efficacy as an anti-androgenic substance has warranted the attention of African scholars. This study evaluated the enzymatic activity of lactate dehydrogenase (LDH), γ-glutamyl transferase (γ-GT), sperm quality (motility, count, morphology), testosterone level and histo-pathological changes of the testis of rats chronically treated with ethanolic extract of the pods (without seeds), seeds, and fruits (pods + seeds) of Xylopia aethiopica. Male Wistar (224-246 g) rats were treated with the extract of the pods, seeds, and fruits of Xylopia aethiopica at the dose of 0, 50, 100, and 200 mg/kg body wt. for 60 days. Serum biochemistry, sperm quality and histo-pathological examination of the testis were assessed for any treatment-related adverse effects. After treatment with Xylopia aethiopica, testosterone level was decreased dose-dependently in the animals treated with the seed extract compared to all other groups. The enzymatic activities of LDH and γ-GT were higher in rats treated with the seed and fruit extracts compared with those treated with the pods. The numbers of motile sperm, and counts were decreased while the numbers of sperm with morphological defects were higher in rats treated with the seed and fruit extracts compared to the control. Histopathological changes of the testis were also more severe in rats treated with the highest dose of the seed extract. We conclude that the compounds related to the anti-infertility effects of Xylopia aethiopica are present in the seeds.

  20. Efeitos de extratos de Nierembergia veitchii (Hook Solanaceae sobre a fertilidade de ratas e morfologia óssea dos fetos The effects of Nierembergia veitchii (Hook Solanaceae extracts in rat fertility and fetal skeleton morphology

    Directory of Open Access Journals (Sweden)

    João Roberto Braga de Mello

    2000-06-01

    Full Text Available Os efeitos da administração oral dos extratos aquoso (NvH2O, metanólico (NvmeOH, butanólico (Nvbut e hexano (Nvhex, obtidos, seqüencialmente, de 500g de Nierembergia veitchii (planta seca, foram comparados aos obtidos com vitamina D3 (2,5mg.kg-1 e aos de um grupo controle (solução fisiológica - SF, quando administrados, durante todo o período de gestação (21 dias, a ratas albinas Wistar. A redução do ganho de peso foi evidente nas fêmeas tratadas com Nvhex, Nvbut e vitamina D3. Nesses grupos, houve redução do número de implantes uterinos (9,3 ± 1,4; 9,6 + 1,4 e 8,4 ± 1,4, quando comparados com o controle (SF (11,2 ± 0,4. Essa redução também foi observada no número de filhotes por ninhada (8,1 ± 1,3; 9,0 ± 1,5; 5,1 ± 1,7 e 10,3 ± 0,6, e na massa corporal dos filhotes ao nascer (2,1g ± 0,5; 2,9g ± 0,4; 1,9g ± 0,1 e 3,3g ± 0,1. Os resultados obtidos com NvH2O e NvmeOH não diferiram dos obtidos com o grupo controle. Anomalias macroscópicas foram observadas em fetos de ratas tratadas com Nvhex e Nvbut, 0,1 e 0,2% respectivamente. Os resultados da análise da morfologia óssea dos fetos mostraram a ocorrência de 33,3%; 45%; 9,8% e 11,1% de anomalias para os grupos NvH2O, NvmeOH, Nvbut e SF, respectivamente. As anomalias ósseas mais freqüentemente observadas ocorreram no crânio e constaram de ossificação incompleta de supraoccipital, interparietais, parietais, frontal e temporal.The effects of oral administration of aqueous (NvH2O, methanolic (NvmeOH, buthanolic (Nvbut and hexan (Nvhex extracts, sequentialy obtained from 500g Nierembergia veitchii (dried plant were compared with a vitamin D3 treated group and with a control group (saline, when administered during the pregnancy to Wistar rats (21 days. Weigth gain was reduced in dams treated with Nvhex, Nvbut and vitamin D3. In these groups it was observed a reduction in uterine implantations (9.3 ± 1.4, 9.6 ± 1.4 and 8.4 ± 1.4 when compared with the control (11.2 ± 0.4. The reduction could also be observed in the number of pups per litter (8.1 ± 1.3, 9.0 ± 1.5, 5.1 ± 1.7 and 10.3 ± 0.6, and in the weigth of pups at birth (2.1g ± 0.5, 2.9g ± 0.4, 1.9g ± 0.1 and 3.3g ± 0.1. We didn’t observe any difference betwen NvH2O, NvmeOH and control group. Macroscopicaly abnormalities were observed in some pups of Nvhex and Nvbut groups (0.1% and 0.2% respectively. The results of the skeleton avaliation showed 33.3%, 45%, 9.8% e 11.1% of abnormalities for NvH2O, NvmeOH, Nvbut and control group respectively. The most frequently observed abnormalities were found in the skull, and were: incomplete ossification of supraocciopital, interparietal, parietal, frontal and temporal.

  1. Anatomia foliar comparativa das cultivares de Nicotiana tabacum L. (Solanaceae sensível e tolerante ao ozônio Comparative leaf anatomy of Nicotiana tabacum L. (Solanaceae cultivars sensitive and tolerant to ozone

    Directory of Open Access Journals (Sweden)

    Andrea Nunes Vaz Pedroso

    2008-03-01

    Full Text Available O ozônio troposférico causa necroses foliares em Nicotiana tabacum. Cultivares de tabaco são muito utilizadas como bioindicadoras de ozônio, em programas de biomonitoramento da qualidade do ar. Dentre elas destacam-se as cultivares Bel-W3 (sensível e Bel-B (tolerante. Este estudo teve como objetivo verificar se as duas cultivares apresentam variações na estrutura foliar que possam ajudar a explicar a diferença na sensibilidade ao ozônio que ambas apresentam. Em plantas que cresceram em ambiente isento de poluentes aéreos foram coletadas folhas do terceiro nó e que foram processadas segundo técnicas usuais empregadas em anatomia vegetal. Realizaram-se análises quantitativas e qualitativas dos tecidos foliares. A cultivar Bel-W3, quando comparada à Bel-B, apresentou menor densidade estomática na superfície abaxial e maior espessura do mesofilo. Qualitativamente as células de ambas cultivares mostraram aspecto sadio, com os vacúolos ocupando praticamente todo o volume celular. A cultivar sensível apresentou visivelmente mais espaços intercelulares, câmaras estomáticas maiores e estômatos ligeiramente salientes em ambas superfícies foliares. Tais características, que facilitam a entrada e a difusão dos poluentes na folha, podem explicar, do ponto de vista estrutural, a maior sensibilidade da cultivar Bel-W3.Tropospheric ozone produces symptoms such as leaf injury in Nicotiana tabacum. Tobacco cultivars are often used as ozone indicators in air-quality biomonitoring programs. Bel-W3 (sensitive and Bel-B (tolerant cultivars are better known. The aim of this study was to verify if the two cultivars show variation in leaf structure that may help to explain differences in ozone sensitivity. Expanded leaves from plants growing in pollutant-free air were collected, processed according to the usual techniques of plant anatomy, and analyzed quantitatively and qualitatively. The sensitive cultivar showed lower stomatal density on the abaxial leaf surface and thicker mesophyll cells when compared to the tolerant cultivar. Qualitatively speaking, both cultivars had healthy cells with unaltered vacuoles. In the sensitive cultivar, we could see more intercellular spaces, larger substomatal chambers and slightly prominent stomata on both leaf surfaces. From a structural view point, these features explain why cultivar Bel-W3 is more sensitive.

  2. Ocorrência de flavonas, flavonóis e seus glicosídeos em espécies do gênero Solanum (Solanaceae Occurrence of flavones and flavonols aglycones and its glycosides in Solanum (Solanaceae

    Directory of Open Access Journals (Sweden)

    Tania Maria Sarmento da Silva

    2003-08-01

    Full Text Available During the last decades several flavonoids of Solanum species have been isolated. This review describes the flavones, flavonols and their glycosides presently known as constituents of Solanum species.

  3. CARACTERIZACIÓN DE LA MORFOLOGÍA FLORAL DE DOS CULTIVARES DE BERENJENA (Solanum melongena L. (Solanaceae FLORAL MORPHOLOGY CHARACTERIZATION OF TWO CULTIVARS OF EGGPLANT (Solanum melongena L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Hermes Araméndiz Tatis

    2009-12-01

    Full Text Available La berenjena es una especie perteneciente al género Solanum, de gran importancia en la horticultura del Caribe colombiano. El estudio tuvo como objetivo describir la morfología floral de dos cultivares de berenjena “Long Purple” y “Criolla Lila”, que tienen origen geográfico diferente, utilizando para ello, una muestra aleatoria de 100 cojines florales por cultivar. Se estimaron la media, rango, varianza, desviación estándar, coeficiente de variación y se aplicó la prueba t, para determinar diferencias entre los dos cultivares. Los resultados indicaron que el cultivar “Long Purple”, presenta flores distílicas, en tanto que en el “Criollo Lila” se observó la presencia de tristilia. El potencial de producción de frutos, fue del 76,5% y 57,52%, para el “Criollo Lila” y “Long Purple”, respectivamente. Las flores brevistílicas en ambos cultivares, incrementan la aptitud masculina y por ende un desbalance entre las flores con funcionamiento masculino y hermafrodita.The eggplant is a specie of genus Solanum, of great importance in horticulture of colombian Caribbean region. The objective of study was to describe the floral morphology of two cultivars of eggplant “Long Purple” and “Lilac land race”, which have different geographic origin. We used a random sample of 100 floral cushions for cultivar. The mean, range, variance, standard deviation, variation coefficient were estimated. The t-test was applied to determine differences between two cultivars. The results indicated that genotype ‘Long Purple’, showed distylics flowers, while in the “Lilac land race” was observed the presence of tristylics flowers. The potential for production of fruit was 76.50% and 57.52% for the “Lilac land race” and “Long Purple”, respectively. Brevistylics flowers in the two cultivars, increased male fitness and thus produced a nonbalance on functioning between male and hermaphrodite flowers.

  4. Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae in the Linhares Forest, Espírito Santo state, Brazil Dispersão de sementes de Solanum thomasiifolium Sendtner (Solanaceae na Floresta de Linhares, Espírito Santo, Brasil

    Directory of Open Access Journals (Sweden)

    João Vasconcellos-Neto

    2009-12-01

    Full Text Available The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of "nativo" vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous, and one species of lizard (Tropidurus torquatus fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds, 19% (crab-eating fox and 4% (lizards. Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control, bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.O propósito deste estudo foi analisar a dispersão de sementes e o estabelecimento de Solanum thomasiifolium em uma área de vegetação de "nativo" no Estado do Espírito Santo, na costa do sudeste do Brasil. Dez espécies de aves, o cachorro-do-mato (Cerdocyon thous e uma espécie de lagarto (Tropidurus torquatus alimentaram-se de frutos de S. thomasiifolium e dispersaram sementes viáveis em suas fezes. A contribuição proporcional de cada um destes grupos na dispersão de sementes foi de 77% para aves, 19% para o cachorro-do-mato e 4% para o lagarto. Formigas também contribuíram com a dispersão de sementes. Mais sementes foram depositadas nas ilhas de vegetação do que nas áreas abertas vizinhas. As taxas de germinação de sementes oriundas de frutos (controle, fezes de aves, fezes do cachorro do mato e do lagarto foram, respectivamente, 64 %, 64 %, 53% e 80%. As diferenças entre estas taxas foram todas significativas, exceto entre o controle e fezes de aves. Lagartos foram importantes como transportadores de sementes entre ilhas de vegetação próximas e defecaram uma grande proporção de sementes viáveis. As aves e o cachorro-do-mato não aumentaram a germinação de sementes, mas promoveram a dispersão sobre uma área maior. A arquitetura da planta, a produtividade de frutos, as características do fruto e a diversidade de frugívoros são importante no sucesso de S. thomasiifolium para colonização do habitat.

  5. Speeding up the discovery of unknown plants: a case study of Solanum (Solanaceae endemics from the Brazilian Atlantic Forest

    Directory of Open Access Journals (Sweden)

    Leandro Lacerda Giacomin

    2014-10-01

    Full Text Available Brazil holds one of the richest floras in the world, what makes it challenging to document its entirety. Recent estimates point that the richer the area, the more undescribed plant species it might hold, and therefore Brazil is among the areas that might have a representative number of plant species to be discovered. In this study we present an application of Species Distribution Predictive Models not exhaustively discussed in literature: to accelerate plant species discovery. We used MaxEnt algorithm in order to help finding new populations of narrowly distributed Solanum species from the Brazilian Atlantic Forest. We applied the Model-Based Search approach to species and a clade as a whole and it enabled us to find new presence points to rare species, and guided us to an unexpected area that actually held a new species. The use of SDPMs allied with biological and evolutionary knowledge of species or clades can be helpful to accelerate discoveries in rich but poorly known areas.

  6. Bee Diversity and Solanum didymum (Solanaceae Flower–Visitor Network in an Atlantic Forest Fragment in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Francieli Lando

    2018-01-01

    Full Text Available Brazil’s Atlantic Forest biome is currently undergoing forest loss due to repeated episodes of devastation. In this biome, bees perform the most frequent pollination system. Over the last decade, network analysis has been extensively applied to the study of plant–pollinator interactions, as it provides a consistent view of the structure of plant–pollinator interactions. The aim of this study was to use palynological studies to obtain an understanding of the relationship between floral visitor bees and the pioneer plant S. didymum in a fragment of the Atlantic Forest, and also learn about the other plants that interact to form this network. Five hundred bees were collected from 32 species distributed into five families: Andrenidae, Apidae, Colletidae, Megachilidae, and Halictidae. The interaction network consisted of 21 bee species and 35 pollen types. The Solanum-type bee species with the highest number of interactions were Anthrenoides sp. 1, Augochlora sp. 2, and Augochloropsis notophos, representing 71.78% of their interactions. Augochloropsis notophos and Augochlora sp. 2 were the only common species in the flowers of S. didymum. Given the results of our study, we conclude that Solanum is an important source of pollen grains for several native bee species, mainly for the solitary species that are more diverse in the south of Brazil. Moreover, our results indicate that bees from the families Halictidae (A. notophos, Augochlora and Andrenidae (Anthrenoides are the pollinators of S. didymum.

  7. Response of Bemisia tabaci Genn. (Hemiptera: Aleyrodidae) biotype B to genotypes of pepper Capsicum annuum (Solanales: Solanaceae).

    Science.gov (United States)

    Ballina-Gomez, H; Ruiz-Sanchez, E; Chan-Cupul, W; Latournerie-Moreno, L; Hernández-Alvarado, L; Islas-Flores, I; Zuñiga-Aguilar, J J

    2013-04-01

    Bemisia tabaci Genn. biotype B is a widely distributed plant pest that represents one of the major constraints for horticultural crop production. The purpose of the present work was to evaluate the oviposition preference, survivorship, and development of B. tabaci biotype B on semi-cultivated genotypes of Capsicum annuum from southeast Mexico. In free-choice experiments to evaluate the oviposition preference, lower number of eggs laid by B. tabaci biotype B was observed in the genotypes Maax and Xcat´ik relative to that in the commercial genotype Parado. Egg hatchability was significantly lower in Pico Paloma, Bolita, Blanco, Chawa, Payaso, and Xcat´ik than in the rest of the genotypes, including the commercial genotype Jalapeño. Likewise, survivorship of nymphs was significantly lower in Pico Paloma, Bolita, and Blanco than in the remaining genotypes. Nymph developmental time and the period of development from egg to adult were the shortest in Amaxito. Therefore, sources of resistance to B. tabaci biotype B by antibiosis (accumulation of plant defense compounds) might be found in the semi-cultivated genotypes Pico Paloma, Bolita, and Blanco.

  8. Aislamiento e identtificación de alcaloides del tropano en especies del género Bngmansia (Solanaceae)

    OpenAIRE

    Roses, Otmaro Enrique; López, Clara M.; García Fernández, J. C.

    1987-01-01

    En flores y hojas de Brugmansia candida Pers. y Brugmansia arborra (L.) Lagerh se determinaron los niveles de "bases totales" (en todos los casos) y en algunos se valoraron los alcaloides que se pudieron identificar, empleándose técnicas de titrirnetría y cromatografía gaseosa. respectivamente. Los valores hallados en los ejemplares de Brugmansia candida Pers. dieron una media de 234 y 112,1 mg de "bases totales" por 100 g de sustancia seca para flores y hojas, respectivamente. En los ejempla...

  9. Phylogeny and biogeography of the Canarian Solanum vespertilio and S. lidii (Solanaceae)

    OpenAIRE

    Anderson, Gregory J.; Bernardello,Gabriel; Weese, Terri; Bohs, Lynn; Santos-Guerra, Arnoldo

    2006-01-01

    The endemic and rare Solanum vespertilio and S. lidii from the Canary Islands are notable in being andromonoecious, self compatible, highly heterandrous (with short >reward= anthers and one very long >pollination= anther), and bearing strongly zygomorphic corollas. Solanum vespertilio flowers are also tetramerous, and some display enantiostyly. Given their island distribution, uncommon for solanums, and many distinctive reproductive features, the phylogenetic position is of interest. With new...

  10. Remorin, a Solanaceae Protein Resident in Membrane Rafts and Plasmodesmata, Impairs Potato virus X Movement[W

    Science.gov (United States)

    Raffaele, Sylvain; Bayer, Emmanuelle; Lafarge, David; Cluzet, Stéphanie; German Retana, Sylvie; Boubekeur, Tamy; Leborgne-Castel, Nathalie; Carde, Jean-Pierre; Lherminier, Jeannine; Noirot, Elodie; Satiat-Jeunemaître, Béatrice; Laroche-Traineau, Jeanny; Moreau, Patrick; Ott, Thomas; Maule, Andrew J.; Reymond, Philippe; Simon-Plas, Françoise; Farmer, Edward E.; Bessoule, Jean-Jacques; Mongrand, Sébastien

    2009-01-01

    Remorins (REMs) are proteins of unknown function specific to vascular plants. We have used imaging and biochemical approaches and in situ labeling to demonstrate that REM clusters at plasmodesmata and in ∼70-nm membrane domains, similar to lipid rafts, in the cytosolic leaflet of the plasma membrane. From a manipulation of REM levels in transgenic tomato (Solanum lycopersicum) plants, we show that Potato virus X (PVX) movement is inversely related to REM accumulation. We show that REM can interact physically with the movement protein TRIPLE GENE BLOCK PROTEIN1 from PVX. Based on the localization of REM and its impact on virus macromolecular trafficking, we discuss the potential for lipid rafts to act as functional components in plasmodesmata and the plasma membrane. PMID:19470590

  11. AFLP and DNA sequence variation in an Andean domesticate, pepino (Solanum muricatum, Solanaceae): implications for evolution and domestication.

    Science.gov (United States)

    Blanca, José M; Prohens, Jaime; Anderson, Gregory J; Zuriaga, Elena; Cañizares, Joaquín; Nuez, Fernando

    2007-07-01

    The pepino (Solanum muricatum) is a vegetatively propagated, domesticated native of the Andes, where it grows with wild relatives. We used AFLPs and a 1-kb sequence of the 3-methylcrotonyl-CoA carboxylase gene to study variation of 27 accessions of S. muricatum and 35 collections of 10 species of wild relatives (Solanum section Basarthrum). A total of 298 AFLP fragments and 29 DNA sequence haplotypes were detected. Cluster and principal coordinate analyses and other genetic parameters estimated from both types of markers, show that S. muricatum is closely related to the species from one of the series (Caripensia) of section Basarthrum and that >90% of the variation of the cultigen is also represented in that series. Pepino is highly diverse, either because it is not monophyletic or it has been subjected to regular introgression with wild species, or both. Although a continuous distribution of the genetic variation occurred within the cultivated species, three genetic clusters were recognized. Cluster 1 is mostly centered in Ecuador, cluster 2 in Ecuador and Peru, and cluster 3 in Colombia and Ecuador. Cluster 3 also includes all modern cultivars studied. These results and other evidence suggest that northern Ecuador/southern Colombia is the main center of pepino diversity and the center of origin. The high genetic variation of this cultigen indicates that domestication does not always produce a genetic bottleneck.

  12. The variability of leaf anatomical characteristics of Solanum nigrum L. (Solana-les, Solanaceae from different habitats

    Directory of Open Access Journals (Sweden)

    Krstić Lana N.

    2002-01-01

    Full Text Available In Europe on the whole as well as in Yugoslavia, the most widespread weed species from the genus Solanum is Solanum nigrum L. Since this species inhabits different habitats, it developed several ways of adaptation to environmental conditions. The influence of ecological factors on plant organism and resulting plant adaptations are most evident in leaf morphology and anatomy. Therefore, the anatomical structure of leaves and leaf epidermal tissue of S. nigrum was analyzed and compared among plants that originated from different habitats, in order to determine leaf structural adaptations. S. nigrum lamina has the mesomorphic structure with some xero-heliomorphic adaptations. The differences in stomata number, number of hairs, thickness of lamina, palisade and spongy tissue, as well as the size of mesophyll cells have been noticed. The highest values for most of the parameters have been recorded for the plants from cultivated soil. Largest variations of the examined characters were found for the leaves from ruderal habitats, where environmental conditions are most variable.

  13. Exploring the use of NIR reflectance spectroscopy in prediction of free L-Asparagine in solanaceae plants.

    Science.gov (United States)

    Guorong, Du; Yanjun, Ma; Li, Ma; Jun, Zhou; Yue, Huang

    2016-10-01

    Much researches of Near-infrared spectroscopy modeling methods that are utilized to analyze the trace amount components, especially indirect modeling on complex system, have gained widely attraction in recent years. Amino acids in plants are essential nutrients of maintaining growth and ensuring health. As the important participants in various biochemical reactions in plants, nondestructive detection of free amino acids will provide meaningful observation on physiological changing in different steps of plant growth. In this research, two hundred and twenty-two samples were measured to obtain the concentration of free L-Asparagine in plant by amino acid analyzer. NIR spectra were also collected for conducting chemometrics modeling. Different spectral pretreatments and variables selecting methods were employed to optimize the NIR models. Independent validation set as well as unknown samples from different years were successfully predicted by using the slope intercept correction. Results in this study demonstrated that fast analysis of free L-Asparagine can be established by NIR modeling approach. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Application of coal fly ash, cow dung and grass cuttings mix in cultivation of few vegetables of Solanaceae family

    Energy Technology Data Exchange (ETDEWEB)

    Rani, K.; Kalpana, S. [Government College, Kota (India). PG Dept. of Chemistry

    2009-07-15

    Addition of coal fly ash (CFA), a by-product of Thermal Power Plants, with soil alters its physical and chemical properties. Few pot and field experiments were conducted to study the impact of bio modified CFA in cultivation of selected varieties of tomato and brinjal/egg plant fruit and physicochemical studies have been carried out for different composts obtained by successive replacement of CFA for soil/earth in constituents of original or reference compost. Cow dung and grass cuttings were used as organic manure. CFA obtained from Kota Super Thermal Power Plant was used. Increase in rate of growth and improvement in quality of product was observed with the increase in percentage of CFA.

  15. Mosquitocidal properties of Solanum trilobatum L. (Solanaceae) leaf extracts against three important human vector mosquitoes (Diptera: Culicidae).

    Science.gov (United States)

    Premalatha, Selvaraj; Elumalai, Kuppusamy; Jeyasankar, Alagarmalai

    2013-11-01

    To determine the larvicidal and pupicidal activites of Solanum trilobatum (S. trilobatum) leaf extracts against Aedes aegypti (Ae. aegypti), Culex quinquefasciatus (Cx. quinquefasciatus) and Anopheles stephensi (An. stephensi). The larvicidal and pupucidal was determined at five different concentrations of 50, 100, 150, 200 and 250 ppm. Percentage of larval mortality was assessed after 48 h. Methanol extracts of S. trilobatum was found to be more susceptible against the larvae of Ae. aegypti, Cx. quinquefasciatus and An. stephensi at 250 ppm with a LC50 value of 125.43, 127.77 and 116.64 ppm respectively. Leaf methanol extracts of S. trilobatum also exhibited pupicidal and adult emergence properties. These results suggested that the leaf extracts of S. trilobatum showed potential to be used as an ideal ecofriendly approach for the control of the Ae. Aegypti, Cx. quinquefasciatus and An. stephensi. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  16. Pollination deficit in open-field tomato crops (Solanum lycopersicum L., Solanaceae in Rio de Janeiro state, Southeast Brazil

    Directory of Open Access Journals (Sweden)

    Mariana Scaramussa Deprá

    2014-02-01

    Full Text Available More than 70% of world’s crops benefit from biotic pollination, and bees are their main pollinators. Despite the fact that some of these insects have been broadly studied, understanding the interactions between plant crops and their pollinators with a local scale approach is necessary when aiming to apply proper protective and management measures to pollinators and their respective crops. In this context, we analyzed the pollination status of open-field tomato crops (Solanum lycopersicum L., regarding fruit-set, visitation rate and the quality of fruits. We recorded the formation of fruits through spontaneous self-pollination and open-pollination, and the occurrence of pollinators in 24 areas of open-field tomato crops. We performed experiments of apomixis, spontaneous self-pollination, manual cross pollination and supplemental cross pollination (simulating the pollinator behavior in a greenhouse. The fruit quality was evaluated according to circumference, weight, volume and number of seeds. Higher production of fruits after open-pollination compared to spontaneous self-pollination indicates the importance of pollinators to increment productivity of S. lycopersicum in the study area. The circumference and the number of seeds from tomatoes of the greenhouse plantation did not differ between spontaneous self-pollination and the manual cross pollination. In the open-field crops the number of seeds was higher for fruits resulting from open-pollination. Our results indicate that the importance of bees is mainly related to the increase in fruit production, thus incrementing the productivity of tomato crops.

  17. Knocking down expression of the auxin-amidohydrolase IAR3 alters defense responses in Solanaceae family plants.

    Science.gov (United States)

    D'Ippolito, Sebastian; Vankova, Radomira; Joosten, Matthieu H A J; Casalongué, Claudia A; Fiol, Diego F

    2016-12-01

    In plants, indole-3-acetic acid (IAA) amido hydrolases (AHs) participate in auxin homeostasis by releasing free IAA from IAA-amino acid conjugates. We investigated the role of IAR3, a member of the IAA amido hydrolase family, in the response of Solanaceous plants challenged by biotrophic and hemi-biotrophic pathogens. By means of genome inspection and phylogenic analysis we firstly identified IAA-AH sequences and putative IAR3 orthologs in Nicotiana benthamiana, tomato and potato. We evaluated the involvement of IAR3 genes in defense responses by using virus-induced gene silencing. We observed that N. benthamiana and tomato plants with knocked-down expression of IAR3 genes contained lower levels of free IAA and presented altered responses to pathogen attack, including enhanced basal defenses and higher tolerance to infection in susceptible plants. We showed that IAR3 genes are consistently up-regulated in N. benthamiana and tomato upon inoculation with Phytophthora infestans and Cladosporium fulvum respectively. However, IAR3 expression decreased significantly when hypersensitive response was triggered in transgenic tomato plants coexpressing the Cf-4 resistance gene and the avirulence factor Avr4. Altogether, our results indicate that changes in IAR3 expression lead to alteration in auxin homeostasis that ultimately affects plant defense responses. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Host genetic resistance to root-knot nematodes, Meloidogyne spp., in Solanaceae: from genes to the field.

    Science.gov (United States)

    Barbary, Arnaud; Djian-Caporalino, Caroline; Palloix, Alain; Castagnone-Sereno, Philippe

    2015-12-01

    Root-knot nematodes (RKNs) heavily damage most solanaceous crops worldwide. Fortunately, major resistance genes are available in a number of plant species, and their use provides a safe and economically relevant strategy for RKN control. From a structural point of view, these genes often harbour NBS-LRR motifs (i.e. a nucleotide binding site and a leucine rich repeat region near the carboxy terminus) and are organised in syntenic clusters in solanaceous genomes. Their introgression from wild to cultivated plants remains a challenge for breeders, although facilitated by marker-assisted selection. As shown with other pathosystems, the genetic background into which the resistance genes are introgressed is of prime importance to both the expression of the resistance and its durability, as exemplified by the recent discovery of quantitative trait loci conferring quantitative resistance to RKNs in pepper. The deployment of resistance genes at a large scale may result in the emergence and spread of virulent nematode populations able to overcome them, as already reported in tomato and pepper. Therefore, careful management of the resistance genes available in solanaceous crops is crucial to avoid significant reduction in the duration of RKN genetic control in the field. From that perspective, only rational management combining breeding and cultivation practices will allow the design and implementation of innovative, sustainable crop production systems that protect the resistance genes and maintain their durability. © 2015 Society of Chemical Industry.

  19. SoMART, a web server for miRNA, tasiRNA and target gene analysis in Solanaceae plants

    Science.gov (United States)

    Plant micro(mi)RNAs and trans-acting small interfering (tasi)RNAs mediate posttranscriptional silencing of genes and play important roles in a variety of biological processes. Although bioinformatics prediction and small (s)RNA cloning are the key approaches used for identification of miRNAs, tasiRN...

  20. Seed predation and fruit damage of Solanum lycocarpum (Solanaceae) by rodents in the cerrado of central Brazil

    Science.gov (United States)

    Briani and, Denis C., Jr.; Guimarães, Paulo R.

    2007-01-01

    Although neotropical savannas and grasslands, collectively referred to as cerrado, are rich in seed-eating species of rodents, little is known about seed predation and its determinants in this habitat. In this study, we investigated seed predation and damage to fruits of the widespread shrub Solanum lycocarpum. In addition, the influence of two possible determinants (distance from the parental plant and total crop size) on the feeding behaviour of Oryzomys scotti (Rodentia, Sigmodontinae) was also examined. O. scotti were captured more frequently close to the shrubs or on shrub crops, indicating that these rodents were attracted to the shrubs and that seed predation was probably distance-dependent. Moreover, the proportion of damaged fruit on the plant decreased as the total crop size increased; consequently, more productive plants were attacked proportionally less by rodents. This pattern of fruit damage may reflect predator satiation caused by the consumption of a large amount of pulp. Alternatively, secondary metabolites in S. lycocarpum fruits may reduce the pulp consumption per feeding event, thereby limiting the number of fruits damaged.

  1. Phytochemical Study of the Genus Salpichroa (Solanaceae), Chemotaxonomic Considerations, and Biological Evaluation in Prostate and Breast Cancer Cells.

    Science.gov (United States)

    Basso, Ana Valentina; Leiva González, Segundo; Barboza, Gloria Estela; Careaga, Valeria Pilar; Calvo, Juan Carlos; Sacca, Paula A; Nicotra, Viviana Estela

    2017-08-01

    Twelve Salpichroa taxa have been phytochemically analyzed. From the aerial parts of S. scandens, four known salpichrolides A, C, I, S, and an unreported withanolide named salpichrolide V (1), were isolated. In S. dependens, S. gayi, S. glandulosa subsp. glandulosa, S. glandulosa subps. weddellii, S. leucantha, S. micrantha, S. microloba, S. proboscidea, S. ramosissima, S. tristis var. tristis, and S. weberbauerii, no withanolides were found. The chemical content of ca. 85% of the Salpichroa taxa is in agreement with molecular studies, which suggest that Salpichroa and Jaborosa, a genus considered morphologically close to Salpichroa, are distant in the systematic of the Solanoideae subfamily. Moreover, the in vitro cytotoxic activity of a set of natural salpichrolides and derivatives was examined against two prostate carcinoma cell lines (PC3 and LNCaP) and two human breast cancer cell lines (MCF-7 and T47D). Several compounds showed moderate activity (IC 50  = 64.91 - 29.97 μm). © 2017 Wiley-VHCA AG, Zurich, Switzerland.

  2. Were sea level changes during the Pleistocene in the South Atlantic Coastal Plain a driver of speciation in Petunia (Solanaceae)?

    Science.gov (United States)

    Ramos-Fregonezi, Aline M C; Fregonezi, Jeferson N; Cybis, Gabriela B; Fagundes, Nelson J R; Bonatto, Sandro L; Freitas, Loreta B

    2015-05-20

    Quaternary climatic changes led to variations in sea level and these variations played a significant role in the generation of marine terrace deposits in the South Atlantic Coastal Plain. The main consequence of the increase in sea level was local extinction or population displacement, such that coastal species would be found around the new coastline. Our main goal was to investigate the effects of sea level changes on the geographical structure and variability of genetic lineages from a Petunia species endemic to the South Atlantic Coastal Plain. We employed a phylogeographic approach based on plastid sequences obtained from individuals collected from the complete geographic distribution of Petunia integrifolia ssp. depauperata and its sister group. We used population genetics tests to evaluate the degree of genetic variation and structure among and within populations, and we used haplotype network analysis and Bayesian phylogenetic methods to estimate divergence times and population growth. We observed three major genetic lineages whose geographical distribution may be related to different transgression/regression events that occurred in this region during the Pleistocene. The divergence time between the monophyletic group P. integrifolia ssp. depauperata and its sister group (P. integrifolia ssp. integrifolia) was compatible with geological estimates of the availability of the coastal plain. Similarly, the origin of each genetic lineage is congruent with geological estimates of habitat availability. Diversification of P. integrifolia ssp. depauperata possibly occurred as a consequence of the marine transgression/regression cycles during the Pleistocene. In periods of high sea level, plants were most likely restricted to a refuge area corresponding to fossil dunes and granitic hills, from which they colonized the coast once the sea level came down. The modern pattern of lineage geographical distribution and population variation was established by a range expansion with serial founder effects conditioned on soil availability.

  3. Identification of candidate MLO powdery mildew susceptibility genes in cultivated Solanaceae and functional characterization of tobacco NtMLO1

    NARCIS (Netherlands)

    Appiano, M.; Pavan, S.N.C.; Catalano, D.; Zheng Zheng, Zheng; Bracuto, V.; Lotti, C.; Visser, R.G.F.; Ricciardi, L.; Bai, Y.

    2015-01-01

    Specific homologs of the plant Mildew Locus O (MLO) gene family act as susceptibility factors towards the powdery mildew (PM) fungal disease, causing significant economic losses in agricultural settings. Thus, in order to obtain PM resistant phenotypes, a general breeding strategy has been proposed,

  4. Efecto de Brugmansia arborea (L. Lagerheim (Solanacea en el sistema reproductor masculino de ratón

    Directory of Open Access Journals (Sweden)

    José Pino

    2008-12-01

    Full Text Available El objetivo del presente estudio fué investigar el efecto de la administracion del extracto acuoso de Brugmansia arborea (L. Lagerheim -floripondio-sobre algunos parámetros reproductivos en mamíferos. Ratones machos fueron tratados con 70 mg/kl/pc por 7 días, después de lo cual fueron eutanizados determinando los pesos de testículo, epidídimo e individualmente su región caudal; además, se contabilizó la concentración y malformaciones espermáticas. El peso del testículo y la cola del epidídimo disminuyeron; la concentración espermática fue menor que el control, se incrementaron las malformaciones espermáticas. Estos resultados sugieren que existe un efecto negativo de la dosis de B. arborea que alteraría la fertilidad del ratón.

  5. Involvement of central noradrenaline, serotonin and dopamine system in the antidepressant activity of fruits of Solanum torvum (Solanaceae).

    Science.gov (United States)

    Momin, Rehan; Mohan, Mahalaxmi

    2012-01-01

    The methanolic extract (ME) of Solanum torvum seeds and its ethyl acetate fraction (EAF) were investigated for their antidepressant activity using behavioral (forced swim test, FST and tail suspension test, TST) and biochemical (monoamine oxidase, MAO reduced activity) tests. ME (10, 30 and 100 mg kg(-1)) and EAF (10 and 30 mg kg(-1)) dose dependently inhibited the immobility period, increased noradrenaline, serotonin and dopamine levels and inhibited the MAO enzymes in FST and TST using mice. Furthermore, we have observed antagonism between the threshold dose of ME (30 and 100 mg kg(-1)) and EAF (10 and 30 mg kg(-1)) with antagonists on behaviour mediated by neurotransmitters noradrenaline, serotonin and dopamine. MAO-A inhibition was more prominent as compared to MAO-B inhibition. The study provides evidence for antidepressant actions of S. torvum.

  6. Epigenetic regulation of the expression of WRKY75 transcription factor in response to biotic and abiotic stresses in Solanaceae plants.

    Science.gov (United States)

    López-Galiano, María José; González-Hernández, Ana I; Crespo-Salvador, Oscar; Rausell, Carolina; Real, M Dolores; Escamilla, Mónica; Camañes, Gemma; García-Agustín, Pilar; González-Bosch, Carmen; García-Robles, Inmaculada

    2017-10-27

    SlyWRKY75: gene expression was induced in response to biotic stresses, especially in Botrytis cinerea-infected tomato plants, in which Sly-miR1127-3p is a putative SlyWRKY75 regulator and epigenetic marks were detected. WRKY75 transcription factor involved in Pi homeostasis was recently found also induced in defense against necrotrophic pathogens. In this study, we analyzed by RT-qPCR the expression of SlyWRKY75 gene in tomato plants in response to abiotic stresses (drought or heat) and biotic stresses (Colorado potato beetle larvae infestation, Pseudomonas syringae or Botrytis cinerea infection) being only differentially expressed following biotic stresses, especially upon B. cinerea infection (55-fold induction). JA and JA-Ile levels were significantly increased in tomato plants under biotic stresses compared with control plants, indicating that SlyWRKY75 might be a transcriptional regulator of the JA pathway. The contribution of miRNAs and epigenetic molecular mechanisms to the regulation of this gene in B. cinerea-infected tomato plants was explored. We identified a putative Sly-miR1127-3p miRNA predicted to bind the intronic region of the SlyWRKY75 genomic sequence. Sly-miR1127-3p miRNA was repressed in infected plants (0.4-fold) supporting that it might act as an epigenetic regulation factor of SlyWRKY75 gene expression rather than via the post-transcriptional mechanisms of canonical miRNAs. It has been proposed that certain miRNAs can mediate DNA methylation in the plant nucleus broadening miRNA functions with transcriptional gene silencing by targeting intron-containing pre-mRNAs. Histone modifications analysis by chromatin immunoprecipitation (ChIP) demonstrated the presence of the activator histone modification H3K4me3 on SlyWRKY75 transcription start site and gene body. The induction of this gene in response to B. cinerea correlates with the presence of an activator mark. Thus, miRNAs and chromatin modifications might cooperate as epigenetic factors to modulate SlyWRKY75 gene expression.

  7. Assessing the tobacco-rattle-virus-based vectors system as an efficient gene silencing technique in Datura stramonium (Solanaceae).

    Science.gov (United States)

    Eftekhariyan Ghamsari, Mohammad Reza; Karimi, Farah; Mousavi Gargari, Seyed Latif; Hosseini Tafreshi, Seyed Ali; Salami, Seyed Alireza

    2014-12-01

    Datura stramonium is a well-known medicinal plant, which is important for its alkaloids. There are intrinsic limitations for the natural production of alkaloids in plants; metabolic engineering methods can be effectively used to conquer these limitations. In order for this the genes involved in corresponding pathways need to be studied. Virus-Induced Gene Silencing is known as a functional genomics technique to knock-down expression of endogenous genes. In this study, we silenced phytoene desaturase as a marker gene in D. stramonium in a heterologous and homologous manner by tobacco-rattle-virus-based VIGS vectors. Recombinant TRV vector containing pds gene from D. stramonium (pTRV2-Dspds) was constructed and injected into seedlings. The plants injected with pTRV2-Dspds showed photobleaching 2 weeks after infiltration. Spectrophotometric analysis demonstrated that the amount of chlorophylls and carotenoids in leaves of the bleached plants decreased considerably compared to that of the control plants. Semi-Quantitative RT-PCR results also confirmed that the expression of pds gene in the silenced plants was significantly reduced in comparison with the control plants. The results showed that the viral vector was able to influence the levels of total alkaloid content in D. stramonium. Our results illustrated that TRV-based VIGS vectors are able to induce effective and reliable functional gene silencing in D. stramonium as an alternative tool for studying the genes of interest in this plant, such as the targeted genes in tropane alkaloid biosynthetic pathway. The present work is the first report of establishing VIGS as an efficient method for transient silencing of any gene of interest in D. stramonium.

  8. Morphological and anatomical determinants of mesophyll conductance in wild relatives of tomato (Solanum sect. Lycopersicon, sect. Lycopersicoides; Solanaceae).

    Science.gov (United States)

    Muir, Christopher D; Hangarter, Roger P; Moyle, Leonie C; Davis, Phillip A

    2014-06-01

    Natural selection on photosynthetic performance is a primary factor determining leaf phenotypes. The complex CO2 diffusion path from substomatal cavities to the chloroplasts - the mesophyll conductance (g(m)) - limits photosynthetic rate in many species and hence shapes variation in leaf morphology and anatomy. Among sclerophyllous and succulent taxa, structural investment in leaves, measured as the leaf dry mass per area (LMA), has been implicated in decreased gm . However, in herbaceous taxa with high g(m), it is less certain how LMA impacts CO2 diffusion and whether it significantly affects photosynthetic performance. We addressed these questions in the context of understanding the ecophysiological significance of leaf trait variation in wild tomatoes, a closely related group of herbaceous perennials. Although g(m) was high in wild tomatoes, variation in g(m) significantly affected photosynthesis. Even in these tender-leaved herbaceous species, greater LMA led to reduced g(m). This relationship between g(m) and LMA is partially mediated by cell packing and leaf thickness, although amphistomy (equal distribution of stomata on both sides of the leaf) mitigates the effect of leaf thickness. Understanding the costs of increased LMA will inform future work on the adaptive significance of leaf trait variation across ecological gradients in wild tomatoes and other systems. © 2013 John Wiley & Sons Ltd.

  9. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  10. From introduced American weed to Cape Verde Islands endemic: the case of Solanum rigidum Lam. (Solanaceae, Solanum subgenus Leptostemonum).

    Science.gov (United States)

    Knapp, Sandra; Vorontsova, Maria S

    2013-01-01

    A Solanum species long considered an American introduction to the Cape Verde Islands off the west coast of Africa is identified as Solanum rigidum, a member of the Eggplant clade of Old World spiny solanums (Solanum subgenus Leptostemonum) and is probably endemic to the Cape Verde Islands. Collections of this species from the Caribbean are likely to have been introduced from the Cape Verde Islands on slave ships. We discuss the complex nomenclatural history of this plant and provide a detailed description, illustration and distribution map. The preliminary conservation status of Solanum rigidum is Least Concern, but needs to be reassessed in light of its endemic rather than introduced status.

  11. Natural and experimental poisoning by Cestrum laevigatum (Solanaceae among cattle in the Agreste region of Paraíba, Brazil

    Directory of Open Access Journals (Sweden)

    Temístocles Soares de Oliveira Neto

    2017-10-01

    Full Text Available An outbreak of natural poisoning by Cestrum laevigatum was reported among cattle in the Agreste region of Paraíba, which affected six out of 20 animals. Four animals were found dead and two presented clinical signs, including, dyspnea, drooling, jugular vein engorgement, muscle tremors and ataxia, which subsequently progressed to recumbence and death. An experimental poisoning was performed in two bovines who were administered single doses of 35 g kg-1 and 50 g kg-1 body weight (BW, respectively, of fresh leaves and fruits. The animal that received 35 g kg-1 BW had mild clinical signs, consisting of apathy, salivation and reduced ruminal movements with recovery 30 hours after the onset of initial signs. The animal that received 50 g kg-1 BW showed apathy, dry stool, drooling, hyperexcitability, head pressing, opisthotonos, nystagmus, miosis, jugular and episcleral vessel engorgement, ruminal atony, muscle tremors, ataxia, falling, seizures, and sternal recumbence, followed by lateral recumbence, with death occurring 21 hours and 37 minutes after ingestion. The enzyme activities of aspartate aminotransferase and gamma-glutamyltransferase in the serum increased significantly 18 hours after the administration of the plant. The primary gross lesions in the natural and experimental cases were enlarged livers, with rounded edges and accentuation of the lobular pattern on the capsular and cut surfaces. Histopathology revealed diffuse centrilobular coagulative necrosis with hemorrhages and congestion, and the presence of degenerated hepatocytes in the midzonal regions. Based on the epidemiological and clinicopathological data, we concluded that C. laevigatum was responsible for an acute hepatotoxic disease among cattle in the Agreste region of Paraíba.

  12. Sex allocation and reproductive success in the andromonoecious perennial, Solanum carolinense (Solanaceae). II. paternity and functional gender

    OpenAIRE

    Elle, E; Meagher, Thomas Robert

    2000-01-01

    The work was supported by a National Science Foundation Doctoral Dissertation Improvement grant (DEB‐9411513), by the Society for Sigma Xi, and by a Hutcheson Memorial Forest grant. According to Bateman's principle, male fitness in entomophilous plant species should be limited by mating opportunity, which is influenced by the size or number of flowers. We determined male-specific fitness consequences of floral phenotype in andromonoecious Solanum carolinense, examined the relationship betw...

  13. PERCEPTIONS ABOUT MALARIA TRANSMISSION AND CONTROL ...

    African Journals Online (AJOL)

    Solanaceae), Solanum panduriforme E. May (Solanaceae), Diplorhynchus condylocarpon (Muell. Arg.) Pick. (Apocynaceae), Harungana madagascariensis Poir (Guittiferae), Pterocarpus angolensis DC (Leguminosae), Euclea divinorum Hiern ...

  14. Screening of indigenous Palestinian medicinal plants for potential anti-inflammatory and cytotoxic activity.

    Science.gov (United States)

    Kaileh, Mary; Vanden Berghe, Wim; Boone, Elke; Essawi, Tamer; Haegeman, Guy

    2007-09-25

    Organic extracts of 24 selected plant species, used by Palestinian traditional healers to treat different illnesses and diseases, were tested for their anti-inflammatory and anti-tumoral activities. The plant selection was based on existing ethnobotanic information and interviews with local healers. The extracts of the plants under investigation were tested for their potential anti-tumor (cytotoxic) effect on the murine fibrosarcoma L929sA cells, and on the human breast cancer cells MDA-MB231 and MCF7. Cytotoxicity screening models provide important preliminary data to select plant extracts with potential antineoplastic properties. MTT (Tetrazolium blue) colorimetric assay was used to evaluate the reduction of viability of cell cultures in the presence or absence of the extracts. The extract from Withania somnifera, L. Dunal (Solanaceae) presented an IC(50) value at 24h of 150 and 60 microg/ml, on L929sA and MCF7 cells, respectively, while the extract from Psidium guajava L. (Myrtaceae) presented an IC(50) value at 24h of 55 microg/ml on MCF7 cells. Other extracts examined, like Laurus nobilis L. (Lauraceae) and Salvia fruticosa M. (Labiatae), also displayed a remarkable activity. Additionally, as the nuclear transcription factor NFkappaB regulates the expression of various genes that play critical roles in apoptosis and immunomodulation, we further investigated the effect of nine promising plant extracts, withheld from the first cell viability screening on NFkappaB activation. The extracts showed variable degrees of NFkappaB-inhibitory activity. Whereas Withania somnifera extract demonstrated the strongest NFkappaB-inhibitory activity, other extracts derived from Laurus nobilis, Psidium guajava and Foeniculum vulgare M. (Umbiliferrae) also revealed immunomodulatory NFkappaB activities. These species are good candidates for further activity-monitored fractionation to identify active constituents.

  15. Comprehensive assessment of the genes involved in withanolide biosynthesis from Withania somnifera: chemotype-specific and elicitor-responsive expression.

    Science.gov (United States)

    Agarwal, Aditya Vikram; Gupta, Parul; Singh, Deeksha; Dhar, Yogeshwar Vikram; Chandra, Deepak; Trivedi, Prabodh Kumar

    2017-07-01

    Withania somnifera (L.) Dunal (Family, Solanaceae), is among the most valuable medicinal plants used in Ayurveda owing to its rich reservoir of pharmaceutically active secondary metabolites known as withanolides. Withanolides are C28-steroidal lactones having a triterpenoidal metabolic origin synthesised via mevalonate (MVA) pathway and methyl-D-erythritol-4-phosphate (MEP) pathway involving metabolic intermediacy of 24-methylene (C30-terpenoid) cholesterol. Phytochemical studies suggest differences in the content and/or nature of withanolides in different tissues of different chemotypes. Though development of genomic resources has provided information about putative genes encoding enzymes for biosynthesis of intermediate steps of terpenoid backbone, not much is known about their regulation and response to elicitation. In this study, we generated detailed molecular information about genes catalysing key regulatory steps of withanolide biosynthetic pathway. The full-length sequences of genes encoding enzymes for intermediate steps of terpenoid backbone biosynthesis and their paralogs have been characterized for their functional and structural properties as well as phylogeny using bioinformatics approach. The expression analysis suggests that these genes are differentially expressed in different tissues (with maximal expression in young leaf), chemotypes and in response to salicylic acid (SA) and methyl jasmonate (MJ) treatments. Sub-cellular localization studies suggest that both paralogs of sterol ∆-7 reductase (WsDWF5-1 and WsDWF5-2) are localized in the endoplasmic reticulum (ER) thus supporting their indispensible role in withanolide biosynthesis. Comprehensive information developed, in this study, will lead to elucidation of chemotype- as well as tissue-specific withanolide biosynthesis and development of new tools for functional genomics in this important medicinal plant.

  16. Preliminary evaluation for cancer chemopreventive and cytotoxic potential of naturally growing ethnobotanically selected plants of Pakistan.

    Science.gov (United States)

    Ihsan-ul-Haq; Mirza, Bushra; Kondratyuk, Tamara P; Park, Eun-Jung; Burns, Brittany E; Marler, Laura E; Pezzuto, John M

    2013-03-01

    Natural products are a very productive source of leads for the development of medicines. Six Pakistani plants were chosen for study based on ethnobotanical data. Exploration of important medicinal plants of Pakistan for cancer treatment. The crude extracts of the six plants and their fractions were tested for inhibition of nuclear factor κB (NFκB), aromatase, and nitric oxide (NO) production in lipopolysaccharide (LPS)-activated murine macrophage RAW 264.7 cells, induction of quinone reductase 1 (QR1), agonism of retinoid X receptor, and growth inhibition with MCF-7, LU-1 and MDA-MB-231 cancer cells. Two samples of Withania coagulans (Stocks) Dunal (Solanaceae) demonstrated inhibition of TNF-α induced activity of NFκB with IC₅₀ values of 2.6 and 4.3 µg/mL, respectively. Two fractions from W. coagulans and Euphorbia wallichii Hook F. (Euphorbiaceae) aerial parts inhibited aromatase with IC₅₀ values of 17.0 and 17.7 µg/mL, respectively. A total of 13 samples (five from E. wallichii, one from Acer oblongifolium Hort. ex Dippel (Aceraceae), one from Aster thomsonii C. B. Clarke (Asteraceae) and six from W. coagulans aerial parts with fruits) inhibited NO production with IC₅₀ values ranging from 1.3 to 15.6 µg/mL. Fourteen samples demonstrated induction of QR1 with CD ranging from 1.0 to 20.6 µg/mL, and a total of eight extracts and fractions inhibited the proliferation of cancer cells in culture with IC₅₀ values ranging from 1.2 to 7.8 µg/mL. Selected plants can be a valuable source of chemopreventive and anticancer products. W. coagulans aerial parts showed the strongest activity.

  17. Effect of Withania somnifera (Ashwagandha) root extract on amelioration of oxidative stress and autoantibodies production in collagen-induced arthritic rats.

    Science.gov (United States)

    Khan, Mahmood Ahmad; Subramaneyaan, Mythily; Arora, Vinod Kumar; Banerjee, Basu Dev; Ahmed, Rafat Sultana

    2015-06-01

    Rheumatoid arthritis is an inflammatory autoimmune disorder. Withania somnifera Dunal (Solanaceae) (WS), is a common medicinal plant used in traditional systems of medicine for the treatment of arthritis, and is an ingredient of anti-arthritic polyherbal formulations such as Habb-e-Asgand® and Arthritin™. In the present study, we evaluated the antioxidant and anti-arthritic activity of aqueous extract of WS root (WSAq) in collagen-induced arthritic (CIA) rats. CIA rats were treated by using three doses of WSAq (100, 200, 300 mg/kg b. wt., orally) and methotrexate (MTX, 0.25 mg/kg b. wt. i.p.) as a standard reference drug for 20 days. The anti-arthritic effect was assayed by measuring the arthritic index, autoantibodies such as rheumatoid factor (RF), anti-cyclic citrullinated peptide antibody (a-CCP), anti-nuclear antibody (ANA), anti-collagen type II antibody (a-CII) and inflammatory marker like C-reactive protein (CRP). The oxidative stress parameters were also measured. Treatment with WSAq resulted in a dose-dependent reduction in arthritic index, autoantibodies and CRP (p < 0.05) with maximum effect at dose of 300 mg/kg b. wt. and the results were comparable to that of MTX-treated rats. Similarly, oxidative stress in CIA rats was ameliorated by treatment with different doses of WSAq, as evidenced by a decrease in lipid peroxidation and glutathione-S-transferase activity and an increase in the glutathione content and ferric-reducing ability of plasma (p < 0.05). The results showed that WSAq exhibited antioxidant and anti-arthritic activity and reduced inflammation in CIA rats and suggests the potential use of this plant in the treatment of arthritis.

  18. Effects of 2,4-D and 4-CPA on yield and quality of the tomato, Lycopersicon esculentum Miller (Solanaceae)

    DEFF Research Database (Denmark)

    Gemici, Meliha; Türkyilmaz, B.; Tan, Kit

    2007-01-01

    Synthetic plant growth substances augment plant growth when applied at specific concentrations; they are also reported as without causing significant increases in the amount of internal plant hormones. Exceeding recommended dosages, however, affects yield and quality adversely. An experiment, to ...... (IAA) and decrease in abscissic acid (ABA) during early stages of fruit development....

  19. Using chromosomal data in the phylogenetic and molecular dating framework: karyotype evolution and diversification in Nierembergia (Solanaceae) influenced by historical changes in sea level.

    Science.gov (United States)

    Acosta, M C; Moscone, E A; Cocucci, A A

    2016-05-01

    Karyotype data within a phylogenetic framework and molecular dating were used to examine chromosome evolution in Nierembergia and to infer how geological or climatic processes have influenced in the diversification of this solanaceous genus native to South America and Mexico. Despite the numerous studies comparing karyotype features across species, including the use of molecular phylogenies, to date relatively few studies have used formal comparative methods to elucidate chromosomal evolution, especially to reconstruct the whole ancestral karyotypes. Here, we mapped on the Nierembergia phylogeny one complete set of chromosomal data obtained by conventional staining, AgNOR-, C- and fluorescent chromosome banding, and fluorescent in situ hybridisation. In addition, we used a Bayesian molecular relaxed clock to estimate divergence times between species. Nierembergia showed two major divergent clades: a mountainous species group with symmetrical karyotypes, large chromosomes, only one nucleolar organising region (NOR) and without centromeric heterochromatin, and a lowland species group with asymmetrical karyotypes, small chromosomes, two chromosomes pairs with NORs and centromeric heterochromatin bands. Molecular dating on the DNA phylogeny revealed that both groups diverged during Late Miocene, when Atlantic marine ingressions, called the 'Paranense Sea', probably forced the ancestors of these species to find refuge in unflooded areas for about 2 Myr. This split agrees with an increased asymmetry and heterochromatin amount, and decrease in karyotype length and chromosome size. Thus, when the two Nierembergia ancestral lineages were isolated, major divergences occurred in chromosomal evolution, and then each lineage underwent speciation separately, with relatively minor changes in chromosomal characteristics. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  20. Parámetros para la caracterización micrográfica de Solanaceae empleadas en infusiones o fumatorios psicoactivos

    OpenAIRE

    Carpano, Stella Maris; Spegazzini, Etile Dolores; Nájera, Marta Teresa

    1990-01-01

    Se estudiaron comparativamente las superficies foliares de las siguientes especies: Datura stramonium L., D. ferox L., D. innoxia Mill. y Brugmansia arborea (L.) Lagerth., empleadas como psicotomiméticos en infusiones o fumatorios, confeccionándose un cuadro de caracteres diagnósticos que permiten la identificación de las citadas especies aún cuando se hallen fragmentadas o pulverizadas.

  1. Studies on antimicrobial activity, in vitro, of Physalis angulata L. (Solanaceae fraction and physalin B bringing out the importance of assay determination

    Directory of Open Access Journals (Sweden)

    Melissa TG Silva

    2005-11-01

    Full Text Available Complex physalin metabolites present in the capsules of the fruit of Physalis angulata L. have been isolated and submitted to a series of assays of antimicrobial activity against Pseudomonas aeruginosa ATCC 27853, Staphylococcus aureus ATCC 29213, S. aureus ATCC 25923, S. aureus ATCC 6538P, Neisseria gonorrhoeae ATCC 49226, Escherichia coli ATCC 8739; E. coli ATCC 25922, Candida albicans ATCC 10231 applying different methodologies such as: bioautography, dilution broth, dilution agar, and agar diffusion techniques. A mixture of physalins (pool containing physalins B, D, F, G inhibit S. aureus ATCC 29213, S. aureus ATCC 25923, S. aureus ATCC 6538P, and N. gonorrhoeae ATCC 49226 at a concentration of 200 mg/µl, using agar dilution assays. The mixture was inactive against P. aeruginosa ATCC27853, E. coli ATCC 8739; E. coli ATCC 25922, C. albicans ATCC 10231 when applying bioautography assays. Physalin B (200 µg/ml by the agar diffusion assay inhibited S. aureus ATCC 6538P by ± 85%; and may be considered responsible for the antimicrobial activity.

  2. MORFOMETRÍA COMPARADA DE SEMILLAS DE NICOTIANA (SOLANACEAE E IDENTIFICACIÓN DE SEMILLAS CARBONIZADAS PROVENIENTES DE UN SITIO ARQUEOLÓGICO EN CHILE CENTRAL

    Directory of Open Access Journals (Sweden)

    M. Teresa Planella

    2012-01-01

    Full Text Available La presencia frecuente de pipas para fumar en sitios arqueológicos del Período Alfarero Temprano deChile central y las evidencias en relación con la costumbre de fumar especies de Nicotiana halladas en sitios prehispánicos de otros lugares de las Américas, muestran la necesidad de contar con una metodología para identificar las especies de este género usadas en Chile. En este trabajo se ha realizado un estudio morfométrico en semillas de especies de Nicotiana que sirve de referencia para comparaciones con semillas de origen arqueológico. La forma y tamaño de la semilla, el patrón de ornamentación dado por las células epidérmicas y la ubicación del hilum resultaron ser caracteres relevantes para identificaciones confiables. Utilizando estos caracteres, se determinaron como N. corymbosa a las semillas recuperadas en el sitio arqueológico Las Morrenas 1, ubicado en Chile central.

  3. Plastid trnF pseudogenes are present in Jaltomata, the sister genus of Solanum (Solanaceae): molecular evolution of tandemly repeated structural mutations.

    Science.gov (United States)

    Poczai, Péter; Hyvönen, Jaakko

    2013-11-01

    Extensive gene duplication arranged in a tandem array is rare in the plastome of embryophytes. Interestingly, we found pseudogene copies of the trnF gene in the genus Jaltomata, the sister genus of Solanum where such gene duplication has been previously reported. In each Jaltomata sequence available we found two pseudogene copies in close 5'-proximity to the original functional gene. The size of each pseudogene copy ranged between 17 and 48 bp and the anticodon domain was identified as the most conserved element. A common ATT(G)n motif is particularly interesting and its modifications were found to border the 3' of the duplicated regions. Other motifs were partial residues, or entire parts of the T- and D-domains, and both domains proved to be variable in length among the pseudogenes identified. The residues of the 3' and 5' acceptor stem were not found among the copies. We further compared the newly discovered copies of Jaltomata with those ones previously described from Solanum and inferred phylogenetic relationships of the copies aligned. The evolution of Solanum copies, in contrast to Jaltomata, is hard to explain as resulting only in parsimonious changes since reticulate evolutionary patterns were detected among the copies. The dynamic evolutionary patterns of Solanum might be explained by possible inter- or intrachromosomal recombination. © 2013 Elsevier B.V. All rights reserved.

  4. Using the knowns to discover the unknowns: MS-based dereplication uncovers structural diversity in 17-hydroxygeranyllinalool diterpene glycoside production in the Solanaceae.

    Science.gov (United States)

    Heiling, Sven; Khanal, Santosh; Barsch, Aiko; Zurek, Gabriela; Baldwin, Ian T; Gaquerel, Emmanuel

    2016-02-01

    Exploring the diversity of plant secondary metabolism requires efficient methods to obtain sufficient structural insights to discriminate previously known from unknown metabolites. De novo structure elucidation and confirmation of known metabolites (dereplication) remain a major bottleneck for mass spectrometry-based metabolomic workflows, and few systematic dereplication strategies have been developed for the analysis of entire compound classes across plant families, partly due to the complexity of plant metabolic profiles that complicates cross-species comparisons. 17-hydroxygeranyllinalool diterpene glycosides (HGL-DTGs) are abundant defensive secondary metabolites whose malonyl and glycosyl decorations are induced by jasmonate signaling in the ecological model plant Nicotiana attenuata. The multiple labile glycosidic bonds of HGL-DTGs result in extensive in-source fragmentation (IS-CID) during ionization. To reconstruct these IS-CID clusters from profiling data and identify precursor ions, we applied a deconvolution algorithm and created an MS/MS library from positive-ion spectra of purified HGL-DTGs. From this library, 251 non-redundant fragments were annotated, and a workflow to characterize leaf, flower and fruit extracts of 35 solanaceous species was established. These analyses predicted 105 novel HGL-DTGs that were restricted to Nicotiana, Capsicum and Lycium species. Interestingly, malonylation is a highly conserved step in HGL-DTG metabolism, but is differentially affected by jasmonate signaling among Nicotiana species. This MS-based workflow is readily applicable for cross-species re-identification/annotation of other compound classes with sufficient fragmentation knowledge, and therefore has the potential to support hypotheses regarding secondary metabolism diversification. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  5. Multi-development-HPTLC method for quantitation of hyoscyamine, scopolamine and their biosynthetic precursors in selected solanaceae plants grown in natural conditions and as in vitro cultures.

    Science.gov (United States)

    Jaremicz, Zbigniew; Luczkiewicz, Maria; Kisiel, Mariusz; Zárate, Rafael; El Jaber-Vazdekis, Nabil; Migas, Piotr

    2014-01-01

    Hyoscyamine and scopolamine, anti-cholinergic agents widely used in medicine, are typically obtained from plants grown under natural conditions. Since field cultivation entails certain difficulties (changeable weather, pests, etc.), attempts have been made to develop a plant in vitro culture system as an alternative source for the production of these compounds. During experiments to locate the limiting steps in the biotechnological procedure, it is important to monitor not only the levels of the final products but also the changes in the concentration of their precursors. To develop a HPTLC method for the separation and quantitation of the main tropane alkaloids hyoscyamine and scopolamine, their respective direct precursors littorine and anisodamine, and cuscohygrine, a product of a parallel biosynthetic pathway that shares a common precursor (N-methyl-∆(1) -pyrrolium cation) with tropane alkaloids. Using alkaloid extracts from Atropa baetica hairy roots, different TLC chromatographic systems and developing procedures were investigated. Full separation of all compounds was obtained on HPTLC Si60 F254 plates preconditioned with mobile phase vapours (chloroform:methanol:acetone:25% ammonia ratios of 75:15:10:1.8, v/v/v/v). The chromatograms were developed twice (at distances of 4.0 and 3.0 cm) in a Camag twin trough chamber and visualised with Dragendorff's reagent. Densitometric detection (λ = 190 and 520 nm) was used for quantitative analyses of the different plant samples. This method can be recommended for quantitation of hyoscyamine, scopolamine, anisodamine, littorine and cuscohygrine in different plant material (field grown vs. in vitro cultures). Copyright © 2013 John Wiley & Sons, Ltd.

  6. Report of ad hoc meeting of the Chairs, Vice-Chairs and Central Crop Database Managers of the ECPGR Solanaceae and Cucurbits Working Groups

    NARCIS (Netherlands)

    Díez Niclós, M.J.; Valcárcel, J.V.; Íñigo, A.G.; Dooijeweert, van W.; Menting, F.; Weerden, van der G.; Daunay, M.

    2013-01-01

    The scope of this two-day ad hoc meeting was to explore the possibility to abandon Central Crop Databases (CCDBs) and focus on EURISCO, in order to avoid duplication of data and working efforts. The main facilities of both systems were discussed. Current progress concerning the selection of Most

  7. Larvicidal activity of the methanol extract and fractions of the green fruits of Solanum lycocarpum (Solanaceae against the vector Culex quinquefasciatus (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Thamer Matias Pereira

    2014-10-01

    Full Text Available Introduction The larvicidal activity of Solanum lycocarpum against Culex quinquefasciatus is unknown. Methods We evaluated the larvicidal activity of extracts of the green fruits of Solanum lycocarpum against third and fourth instar larvae of C. quinquefasciatus. Results Dichloromethane and ethyl acetate fractions showed the greatest larvicidal effect at 200mg/L (83.3% and 86.7%, respectively. The methanol and dichloromethane, ethyl acetate, and hydromethanolic fractions demonstrated larvicidal effects against C. quinquefasciatus, with LC50 values of 126.24, 75.13, 83.15, and 207.05mg/L, respectively. Conclusions Thus, when considering new drugs with larvicidal activity from natural products, S. lycocarpum fruits may be good candidate sources.

  8. Alelopatia de extratos aquosos de cinamomo (Melia azedarach L. – Meliaceae sobre a germinação e crescimento inicial do tomate (Lycopersicon esculentum Mill. – Solanaceae

    Directory of Open Access Journals (Sweden)

    Lindamir Hernandez Pastorini

    2012-06-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2012v25n3p49   A alelopatia caracteriza-se por efeitos no desenvolvimento das plantas, causados por substâncias químicas que são produzidas e liberadas por outras plantas. O objetivo deste trabalho foi investigar a atividade alelopática de extratos aquosos de folhas frescas e secas e de frutos de cinamomo (Melia azedarach L.- Meliaceae sobre a germinação e crescimento inicial do tomate. Os extratos foram preparados nas concentrações 1, 2 e 4% e caracterizados quanto ao pH e potencial osmótico. Os bioensaios foram constituídos de quatro repetições de 25 sementes de tomate distribuídas em placas de Petri contendo duas folhas de papel germitest, sendo que cada placa recebeu 2mL do extrato correspondente ao tratamento. Para a germinação foram avaliados a porcentagem de germinação (PG, a velocidade de germinação (VG e o índice de velocidade de germinação (IVG. O crescimento inicial foi avaliado pelo comprimento da radícula, do hipocótilo e da folha e pela massa fresca e seca. Todas as concentrações de extratos do cinamomo apresentaram atividade inibitória sobre a germinação e crescimento da radícula, sendo maior o efeito inibitório à medida que aumentava a concentração do extrato. Extratos de folhas secas apresentaram maiores efeitos sobre o tomate. O potencial osmótico e pH dos extratos utilizados apresentaram pouca variação em relação ao controle, indicando que o efeito alelopático se deve a ação dos aleloquimicos presentes nos extratos.

  9. Potential pollinators of tomato, Lycopersicon esculentum (Solanaceae), in open crops and the effect of a solitary bee in fruit set and quality.

    Science.gov (United States)

    Santos, A O R; Bartelli, B F; Nogueira-Ferreira, F H

    2014-06-01

    We identified native bees that are floral visitors and potential pollinators of tomato in Cerrado areas, described the foraging behavior of these species, and verified the influence of the visitation of a solitary bee on the quantity and quality of fruits. Three areas of tomato crops, located in Minas Gerais, Brazil, were sampled between March and November 2012. We collected 185 bees belonging to 13 species. Exomalopsis (Exomalopsis) analis Spinola, 1853 (Hymenoptera: Apidae) was the most abundant. Ten species performed buzz pollination. Apis mellifera L. 1758 (Hymenoptera: Apidae) and Paratrigona lineata (Lepeletier, 1836) (Hymenoptera: Apidae) could also act as pollinators. The fruit set and number of seeds obtained from the pollination treatment by E. analis were higher than those in the control group. Our results allowed the identification of potential tomato pollinators in Cerrado areas and also contributed information regarding the impact of a single species (E. analis) on fruit set and quality. Although most of the visiting bees show the ability for tomato pollination, there is an absence of adequate management techniques, and its usage is difficult with the aim of increasing the crop production, which is the case for E. analis. Species such as Melipona quinquefasciata, P. lineata, and A. mellifera, which are easy to handle, are not used for pollination services. Finally, it is suggested that a combination of different bee species that are able to pollinate the tomato is necessary to prevent the super-exploitation of only a single species for pollination services and to guarantee the occurrence of potential pollinators in the crop area.

  10. Evaluación de diferentes combinaciones fitohormonales en la regeneración de Solanum tuberosum (Solanaceae) Var. Pastusa Suprema a partir de explantes internodales

    National Research Council Canada - National Science Library

    Jenny Paola Jiménez Barreto; Alejandro Chaparro Giraldo; Jennifer Blanco

    2009-01-01

    .... The effect of zeatin riboside (ZR), gibberellic acid (GA3) and naphthalene acetic acid (NAA) phytohormones used in specific combinations was evaluated regarding callus induction and bud regeneration and number per explant...

  11. Evaluación de diferentes combinaciones fitohormonales en la regeneración de solanum tuberosum (solanaceae) var. pastusa suprema a partir de explantes internodales

    OpenAIRE

    Jenny Paola Jiménez Barreto; Alejandro Chaparro Giraldo; Jennifer Blanco

    2009-01-01

    La regeneración de plantas mediante el cultivo de tejidos es un importante componente de la biotecnología que es requerido para procesos tales como la obtención de plantas transgénicas. Se estableció un sistema eficiente de regeneración para la especie Solanum tuberosum L. var. Pastusa Suprema, susceptible de ser transformada genéticamente. Se evaluó el efecto de las fitohormonas zeatina ribósido (ZR), ácido naftalénacetico (ANA) y ácido gibérelico (AG3), utilizadas en combinaciones específic...

  12. Geranyllinalool synthases in solanaceae and other angiosperms constitute an ancient branch of diterpene synthases involved in the synthesis of defensive compounds

    NARCIS (Netherlands)

    Falara, V.; Alba, J.M.; Kant, M.R.; Schuurink, R.C.; Pichersky, E.

    2014-01-01

    Many angiosperm plants, including basal dicots, eudicots, and monocots, emit (E,E)-4,8,12-trimethyltrideca-1,3,7,11-tetraene, which is derived from geranyllinalool, in response to biotic challenge. An Arabidopsis (Arabidopsis thaliana) geranyllinalool synthase (GLS) belonging to the e/f clade of the

  13. Caracterização química e atividade biológica de extratos aquosos de Brunfelsiacuneifolia J.A. Schmidt (Solanaceae

    Directory of Open Access Journals (Sweden)

    A.L.S. SCHNEIDER

    2015-01-01

    Full Text Available RESUMO O gênero Brunfelsia possui ainda poucas informações a respeito de sua composição química ou confirmações científicas de suas propriedades medicinais, apesar do uso na medicina tradicional pelos povos amazônicos. Este trabalho buscou caracterizar a espécie Brunfelsia cuneifolia, cultivada no estado do Rio Grande do Sul, quanto a sua composição química e atividade biológica. Foram obtidos extratos aquosos a quente, a frio, e por ultrassom, a partir de folhas frescas. A caracterização química realizada por CLAE determinou a presença dos compostos fenólicos: ácido ferúlico e rutina, em todos os extratos, sendo as maiores quantidades apresentadas pela extração a frio. A análise por EMAR identificou a fórmula molecular de nove substâncias nos diferentes extratos, incluindo a presença do alcaloide brunfelsamidina em todos os extratos obtidos. Para a atividade biológica, devido à similaridade de resposta e teor nas diferentes formas de extração, foi possível correlacionar a atividade antioxidante, avaliada através da redução do radical DPPH*, com o teor de compostos fenólicos totais obtidos pelo método de Folin-Ciocalteu. A toxicidade dos extratos avaliada pela utilização de Artemia salina revelou ausência de toxidez. Os resultados obtidos são os primeiros apresentados para a caracterização desta espécie, colaborando também para a pesquisa científica acerca dos usos popularmente atribuídos ao gênero.

  14. Identification of miniature inverted-repeat transposable elements (MITEs) and biogenesis of their siRNAs in the Solanaceae: New functional implications for MITEs

    Science.gov (United States)

    Small RNAs regulate the genome by guiding transcriptional and post-transcriptional silencing machinery to specific target sequences, including genes and transposable elements (TEs). Although miniature inverted-repeat transposable elements (MITEs) are closely associated with euchromatic genes, the br...

  15. Impact of gibberelic acid and tebuconazole on formation of the leaf system and functioning of donor – acceptor plant system of solanaceae vegetable crops

    Directory of Open Access Journals (Sweden)

    V. H. Kuryata

    2017-04-01

    Full Text Available We studied the comparable effect of gibberelic acid and tebuconazole on morphogenesis, mesostructure formation and redistribution of flows in sweet peppers and tomatoes. It has been found that the use of gibberelic acid and tebuconazole retardant during budding leads to increased plant productivity due to optimization of the structure and operation of the plants’ leaf apparatus. It was established that both gibberelic and antigibberelic tebuconazole drug stimulated the formation and functioning of the photosynthetic apparatus of peppers and tomatoes, but the mechanisms of this regulation were different. Increased photosynthetic activity of plants under the influence of gibberellin was determined primarily by the formation of more leaves and total leaf surface. When using tebuconazole retardant there was a significant restructuring of the organization of leaf mezostructure: the leaves were thickened by chlorenchyma proliferation, there was an increase in the volume of columnar parenchyma cells and linear dimensions of spongy parenchyma leaf cells. The surface density of leaves significantly increased, the chlorophyll content and nitrogen content (especially protein also increased, compared with control variants and variants using gibberelin. Such a profound restructuring of the photosynthetic apparatus in plants under the actions of tebuconazole led to a significant increase in donor leaves function of peppers and tomatoes, which is an indicator of the growth of net productivity of photosynthesis – the highest among all the variants of the experiment. The results also show that increasing the chlorophyll phytocenotic index was more significant than the increase of leaf index: the tomatoes under the action of tebuconazole had a lower leaf index than in control options, but due to a higher chlorophyll index the crop productivity increased.Since during the fruiting period the costs of assimilates to the growth of vegetative organs are greatly reduced, optimization of photosynthetic apparatus in pepper and tomato plants led to the laying of more fruit per plant and increasing crop yield. The analysis of the mass ratio of the researched vegetative and fruit plants shows that the mass fraction of fruit (an acceptor sphere of plants during fruiting under the action of both drugs increased. Thus in both variants of the experiment both the mass fraction and donor assimilates of leaves were higher. Apart from the main source of assimilates – the processes of photosynthesis, which intensified due to the formation of a larger area of leaf surface (variant with gibberelin or optimization of mesostructure (variant with tebuconazole it is probable that the formation and growth of the embryo occurred in part due to reutilization of carbohydrates from the vegetative plant organs in carpogenesis processes.

  16. The use of antigibberelins with different mechanisms of action on morphogenesis and production process regulation in the plant Solanum melongena (Solanaceae

    Directory of Open Access Journals (Sweden)

    V. G. Kuriata

    2016-03-01

    Full Text Available The influence of antigibberelin on the growth, development and productivity of eggplant was investigated. It was established that the use of tebuconazole and chlormequat chloride is a highly effective tool for regulation of morphogenesis and productivity of eggplant. We found that retardants slowed the growth of plants, and increased the number of leaves and leaf area and dry substance weight of the whole plant. Under the influence of Esfon ethylene producers the inhibition of the growth process was not accompanied by increase of the number, weight and area of leaves.Antigibberelin agents caused the thickening of chlorenchyma and the growth of the columnar cells and cell sizes of spongy parenchyma. Under the action of agents the thickness of the upper and lower epidermis of the leaf increased. As a result of mesostructural and morphometric changes of leaf structure under the influence of retardants the leaf index and specific leaf surface density increased.The growth inhibitory agents increased the chlorophyll content in leaves and caused the growth of chlorophyll index in crops.Retardants reduced the content of sugar and starch in leaves because of their enhanced outflow to fruits, the amount of which was predicted to be greater. Under the influence of Esfon the flow of carbohydrates to the acceptor areas was slower.The use of retardants of triazole and onium origin positively influenced the formation of productivity elements of the culture, which led to increase in the fruit yield. The use of tebuconazole was found to be the most effective.

  17. Withania somnifera chemotype NMITLI 101R significantly increases the efficacy of antileishmanial drugs by generating strong IFN-γ and IL-12 mediated immune responses in Leishmania donovani infected hamsters.

    Science.gov (United States)

    Tripathi, Chandra Dev Pati; Kushawaha, Pramod Kumar; Sangwan, Rajender Singh; Mandal, Chitra; Misra-Bhattacharya, Shailja; Dube, Anuradha

    2017-01-15

    Withania somnifera (L.) Dunal (Solanaceae), commonly known as Ashwagandha, is one of the most important medicinal plant in the traditional Indian medical systems. Pharmacological studies have established that root extracts of W. somnifera contain several bioactive constituents called withanolides. The plant has long been used for its several beneficial properties and recently as an immunomodulator. A combination therapy including a potential and safe immunostimulant with lower doses of effective drug, which can reduce the parasitic burden and simultaneously can produce an enhancement of adaptive immunity, has proven to be significantly a more effective approach than immunotherapy or drug therapy alone. Evaluation of the immunostimulatory effect of W. somnifera chemotype NMITLI 101R when used in combination with ED50 doses of antileishmanial drugs in Leishmania donovani infected hamsters. Infected animals were administered with chemotype 101R(30mg/kg × 15 days) either alone or in combination with ED50 doses of miltefosine (10mg/kg × 5 days), paromomycin (30mg/kg × 5 days) or amphotericin B (0.5mg/kg × 5 days). The treated animals were euthanized on days 30 and 60 post-treatment (p.t.) and checked for parasite clearance, delayed type hypersensitivity (DTH) response, cytokine and inducible nitric oxide synthase levels by real-time PCR, nitric oxide (NO) production, reactive oxygen species (ROS) generation, lymphoproliferative and antibody responses. The group of animals that received 101R and ED50 dose of miltefosine showed optimum inhibition of parasite multiplication (∼98%) by day 60 p.t. followed by the group that received 101R plus paromomycin (∼94%) and 101R plus amphotericin B (∼93%). The efficacy was well supported by the increased inducible NO synthase mRNA transcript, strong IFN-γand IL-12 mediated Th1 immune responses and significantly suppressed levels of Th2 cytokines (IL-4, IL-10 and TGF-β). Additionally, same therapy

  18. 76 FR 9722 - Endangered and Threatened Wildlife and Plants; 12-Month Finding on a Petition To List Solanum...

    Science.gov (United States)

    2011-02-22

    ... Species Description Solanum conocarpum is a dry-forest shrub of the Solanaceae, or tomato, family that may... only species within the Solanaceae family facing this threat. Matabuey (Goetzea elegans) is an example...

  19. Environ: E00732 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00732 Tobacco oil Essential oil Nicotania tabacum [TAX:4097] Solanaceae Tobacco le...af, absolute Essential oils [BR:br08321] Dicot plants: asterids Solanaceae (nightshade family) E00732 Tobacco oil CAS: 8037-19-2 ...

  20. African Journal of Biotechnology - Vol 13, No 43 (2014)

    African Journals Online (AJOL)

    An efficient hairy root culture system for Withania somnifera (L.) Dunal · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. G Sivanandhan, N Selvaraj, A Ganapathi, M Manickavasagam ...

  1. Author Details

    African Journals Online (AJOL)

    Apocynaceae) bark and Xylopia aethiopica (Dunal) A. Rich (Annonaceae) fruits mixtures used in the treatment of diabetes. Abstract PDF · Vol 9, No 7 (2010) - Articles Production of cellulolytic and xylanolytic enzymes by a phytopathogenic Myrothecium ...

  2. Final Environmental Assessment: For the M270 Multiple Launch Rocket System (MLRS) Expanded Training Use Areas at Avon Park Air Force Range, Florida

    Science.gov (United States)

    2005-11-10

    Schinus terebinthifolius Brazilian pepper Solanum viarum Tropical soda apple Syngonium podophyllum Arrowhead vine Tradescantia spathacea Oyster plant...stock has been removed annually from timberland in Highlands County. Of this amount, 47 percent comprised soft hardwood varieties, followed by 27...across types of timber was 38 percent hardwood, 34 percent soft hardwood, and 28 percent pine. In Polk County, the distribution was 79 percent softwood

  3. Effets biocides des alcaloïdes, des saponines et des flavonoïdes extraits de Capsicum frutescens L. (Solanaceae) sur Bemisia tabaci (Gennadius) (Homoptera : Aleyrodidae)

    National Research Council Canada - National Science Library

    Aziz Bouchelta; Abelali Blenzar; Ahmed Boughdad

    2005-01-01

    ... et des flavonoïdes extraits des fruits de Capsicum frutescens L. sur la survie des œufs et des adultes de Bemisia tabaci infestant les plants de tomates, Lycopersicon esculentum Mill. var. Daniella, a été...

  4. Composición química de los aceites esenciales de las hojas de Helicteres guazumifolia (Sterculiaceae, Piper tuberculatum (Piperaceae, Scoparia dulcis (Arecaceae y Solanum subinerme (Solanaceae, recolectadas en Sucre, Venezuela

    Directory of Open Access Journals (Sweden)

    Gabriel Ordaz

    2011-06-01

    Full Text Available Los aceites esenciales son biosintetizados por plantas aromáticas y pueden obtenerse de cualquier órgano de la misma, tienen gran aplicación en la industria farmacéutica, sanitaria, cosmética, agrícola y de alimentos. Los aceites esenciales de las hojas de las plantas Helicteres guazumifolia, Piper tuberculatum, Scoparia dulcis y Solanum subinerme fueron obtenidos mediante hidrodestilación con rendimientos de 0.004, 0.032, 0.016 y 0.005%, respectivamente. La CG/EM permitió identificar la mayoría de los constituyentes de estos aceites esenciales (88.00, 89.80, 87.50 y 89.47%, respectivamente, encontrándose en mayor proporción metabolitos no volátiles de estructura no terpenoidal en H. guazumifolia (30.28%, sesquiterpenoides oxigenados en P. tuberculatum (52.19%, sesquiterpenos en S. dulcis (26.09% y derivados oxigenados de diterpenos en S. subinerme (39.67%. Los constituyentes mayoritarios fueron el diisobutilftalato (13.11% en H. guazumifolia, (--espatulenol (11.37% en P. tuberculatum y el trans-fitol (8.29 y 36.00% para S. dulcis y S. subinerme, respectivamente. El diisooctilftalato fue el constituyente común en los aceites esenciales de todas las especies y los compuestos volátiles trans-pinano, L-linalool, β-ionona, isofitol, neofitadieno, trans-fitol, dibutilftalato y hexadecanoato de metilo, fueron detectados en tres de estas esencias. Esto sugiere que dichas plantas pueden requerir metabolitos secundarios similares para su interacción ecológica, posiblemente debido a factores ambientales comunes.

  5. Anatomía aplicada al diseño de tecnologías de procesamiento mínimo en frutos (bayas) de Vaccinium corymbosum L. (Ericaceae), Solanum lycopersicum L. var. cerasiforme (Solanaceae) y Vitis labrusca L. (Vitaceae)

    OpenAIRE

    Fava, Joaquín

    2012-01-01

    La alta calidad de los frutos es una de las metas principales de la investigación actual en tecnologías postcosecha y de preservación. El diseño del procesamiento mínimo de arándanos, tomates cereza y uvas requiere, entre otros, el conocimiento de las alteraciones estructurales y ultraestructurales de células y tejidos debido a su influencia en las propiedades físico-químicas del fruto. El presente estudio examinó los principales cambios (micro-, ultra- y nano-) estructurales de la pared tang...

  6. Impacto dos nutrientes N e K e de açúcares solúveis sobre populações de Diabrotica speciosa (Germar (Coleoptera, Chrysomelidae e Agrotis ipsilon (Hüfnagel (Lepidoptera, Noctuidae na cultura da batata, Solanum tuberosum L. (Solanaceae Impact of the nutrients N and K and soluble sugars on Diabrotica speciosa (Germar (Coleoptera, Chrysomelidae and Agrotis ipsilon (Hüfnagel (Lepidoptera, Noctuidae populations in potato crops, Solanum tuberosum L. (Solanaceae

    Directory of Open Access Journals (Sweden)

    Edson Henrique de Azeredo

    2004-03-01

    Full Text Available Foi estudada a ocorrência de Diabrotica speciosa (Germar, 1824 (Coleoptera, Chrysomelidae e de Agrotis ipsilon (Hüfnagel, 1767 (Lepidoptera, Noctuidae em plantas de batata, cultivares Achat e Monalisa, influenciadas por dosagens de nitrogênio e potássio, e teor mínimo de açúcares solúveis. Os seguintes parâmetros foram avaliados: concentração de nutrientes minerais e açúcar em folha verde, folha senescente, folha em abcisão, haste, tubérculo e planta total usando extratos de infusão em etanol 80%. A maior infestação por larvas de D. speciosa foi na cultivar Monalisa a 150 kg.ha-1 de N + K com 27,03% a PThe occurrence of Diabrotica speciosa (Germar, 1824 and Agrotis ipsilon (Hüfnagel, 1767 on the potato cultivars Achat and Monalisa, influenced by nitrogen and potassium dosage, and minimum theor of soluble sugars, was studied. The following parameters were evaluated: concentration of mineral nutrient and sugar in green leaf, senescent leaf, leaf in abscission, stem, tubercle and total plant using extracts of infusion in ethanol 80%. The largest infestation of D. speciosa larvae was on Monalisa cultivar at 150 kg.ha-1 of N + K with 27.03% at P< 0,05. It was observed that the effect of the dosage of N + K in the increment of the concentration of soluble sugars increased the damages in the tubercles and stems by A. ipsilon. The infestation by these species increased to 58.82% on the Monalisa cultivar, when the nitrogen dosage increased from zero to 150 kg.ha-1, in the absence of potassium. On the other hand, high dosage of K reduced the damages by A. ipsilon on Monalisa cultivar. However, it did not influence the storage of soluble sugar. The results indicated that in Achat cultivar the accumulated soluble sugar was reduced, probably sensibilized by elevation of potassic fertilization dosing, differing from Monalisa cultivar, in which the influence was by nitrogen dosing.

  7. Insectes ravageurs du piment Capsicum chinense Jacq ...

    African Journals Online (AJOL)

    SARAH

    30 sept. 2015 ... (Solanaceae) à Port-Bouët (Abidjan-Côte d'Ivoire) : Pratiques de lutte par les pesticides chimiques. 8667. Insectes ravageurs du piment Capsicum chinense. Jacq. (Solanaceae) à Port-Bouët (Abidjan-Côte d'Ivoire) : Pratiques de lutte par les pesticides chimiques. AKESSE E. N.1*, OUALI-N'GORAN S-W.

  8. Author Details

    African Journals Online (AJOL)

    Obute, GC. Vol 5, No 9 (2006) - Articles Cytogenetic studies on some Nigerian species of Solanum L. (Solanaceae) Abstract PDF · Vol 5, No 13 (2006) - Articles Cytogenetic studies on some Nigerian species of Solanum L. (Solanaceae) Abstract PDF · Vol 6, No 21 (2007) - Articles Targeted mutagenesis in Vigna ...

  9. Drug: D09221 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hinense [TAX:112883] Same as: E00323 Solanaceae (nightshade family) Lycium leaf; Standards for non-pharmacopoeial crude drugs... Crude drugs [BR:br08305] Dicot plants: asterids Solanaceae (nightshade family) D09221 Lycium leaf PubChem: 96025901 ...

  10. 1205-IJBCS-Article-Hounnankpon Yedomo

    African Journals Online (AJOL)

    hp

    Reissantia indica, Uvaria chamae et Mallotus oppositifolius. Le peuplement ligneux (dbh ≥ 10 cm) compte 10 espèces, avec un indice de diversité de Shannon de 2,4 bits .... Lnph GC Memecylon afzelii G. Don. Melastomataceae. 1. mPh GC Monodora myristica (Gaertn.) Dunal. Annonaceae. 1 mph GC Monodora tenuifolia ...

  11. RAPD inheritance and diversity in pawpaw (Asimina triloba)

    Science.gov (United States)

    Hongwen Huang; Desmond R. Layne; Thomas L. Kubisiak

    2000-01-01

    Twelve, 10-base primers amplified a total of 20 intense and easily scorable polymorphic bands in an interspecific cross of PPFl-5 pawpaw (Asimina triloba (L.) Dunal.) x RET (Asimina reticulata Shuttlew.). In this cross, all bands scored were present in, and inherited from, the A. triloba ...

  12. Molecular Characterization of Cultivated Pawpaw (Asimina triloba) Using RAPD Markers

    Science.gov (United States)

    Hongwen Huang; Desmond R. Layne; Thomas L. Kubisiak

    2003-01-01

    Thirty-four extant pawpaw [Asimina triloba (L.) Dunal] cultivars and advanced selections representing a large portion of the gene pool of cultivated pawpaws were investigated using 71 randomly amplified polymorphic DNA (RAPD) markers to establish genetic identities and evaluate genetic relatedness. All 34 cultivated pawpaws were uniquely...

  13. Efficacy of standardised herbal extracts in type 1 diabetes - an ...

    African Journals Online (AJOL)

    In the present study, the hypoglycemic activity of Withania somnifera Dunal, Allium sativum Linn., Gymnema sylvestre (Retz.) Schult, Ferula foetida (Bunge.) Reg. and Murraya koenigii (L.) Spreng. extracts have been studied in an experimental model of type 1 diabetes. Type 1 diabetes was induced in albino rats by a single ...

  14. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 46 of 46 ... Vol 2, No 1 (1999), Extraction Of Aluminum By Ammonium Acetate And Chloride Salts In Soils Of Niger Delta Of Nigeria, Abstract ... No 1 (1999), Field trial of aqueous and petroleum ether extracts of Monodora myristica (gaertn) dunal and Jatropha curcas l. for the control of okra flea beetles, Podagrica spp.

  15. morphological descriptors and micro satellite diversity among scarlet ...

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    section Oliganthes, Dunal Bitter. The scarlet eggplant (S. aethiopicum L) comprises of four groups (Gilo, Shum, Aculeatum and ..... 3= Yellow orange, 4= Deep orange, 5= Fired red, 6= Poppy red, 7= Scarlet red, 8= Brown, 9= Black. 9. Fruit cross section. 1= Circular (no grooves), 3= Elliptic, no grooves, 5= Few grooves, ...

  16. Antimicrobial and physico-chemical effects of essential oils on ...

    African Journals Online (AJOL)

    The objectives were to study the effect of two essential oils extracted from local plants Xylopia aethiopica (Dunal) A.Rich. and Pimenta racemosa (Mill.) ... Methodology and Results: At the first level, essential oils were extracted from the leaves of plants and the minimum inhibitory concentration (MIC) of each one was detected ...

  17. phytochemical and antimicrobial properties of solanum macranthum ...

    African Journals Online (AJOL)

    MR J.O. OLAYEMI

    1Department of Pharmacognosy, University of Ibadan, Ibadan, Nigeria. 2Department of Chemistry, University of Ibadan, Ibadan, Nigeria. Accepted 15 September, 2011. Extracts of leaves, stem bark, roots and fruits of Solanum macranthum Dunal were subjected to preliminary phytochemical screening for the presence of ...

  18. Determination of Amino Acids in Medicinal Plants from Southern ...

    African Journals Online (AJOL)

    Methods: The plant samples (Jutuki, Zizyphus obtusifolia A.Gray; Jito, Forchammeria watsonii Rose;. Barchata, Lycium berlandieri Dunal; Citabaro, Vallesia glabra Link; Mangle Rojo, Rhizophora mangle L and Tatachinole, Tournefortia hartwegiana Steud) were dehydrated at room temperature and ground to a fine powder.

  19. C:\\Users\\HP Pro 2000\\Desktop\\SORO DRAMANE.xps

    African Journals Online (AJOL)

    HP Pro 2000

    de l'extrait de poudre et de l'huile essentielle de Xylopia aethiopica (Dunal) A. Rich. (Annonaceae) sur Fusarium oxysporum f. sp Radicis-lycopersici (Forl), champignon parasite des cultures de tomate. E.J.S.R.. 39 (2) : 279 - 288. Tanaka H., Hattori H., Oh-Uchi T., Sato M.,. Yamaguchi R., Sako M. and Y. Tateishi. 2008.

  20. Determination of Amino Acids in Medicinal Plants from Southern ...

    African Journals Online (AJOL)

    Purpose: To analyze the amino acid contents of some plants used in traditional medicine in Southern Sonora, Mexico by using high performance liquid chromatography (HPLC). Methods: The plant samples (Jutuki, Zizyphus obtusifolia A.Gray; Jito, Forchammeria watsonii Rose; Barchata, Lycium berlandieri Dunal; Citabaro, ...

  1. Comparative studies on the anti-inflammatory and analgesic activity ...

    African Journals Online (AJOL)

    USER

    2010-05-17

    May 17, 2010 ... The berry of Solanum aculeastrum Dunal. is used for treating diseases such as rheumatism, gonorrhea, breast cancer and other inflammatory-related ailments in South Africa. The aqueous extracts of the fresh, dried and boiled berries at doses of 1 and 10 mg/kg body weight was evaluated for anti-.

  2. Comparative studies on the anti-inflammatory and analgesic activity ...

    African Journals Online (AJOL)

    The berry of Solanum aculeastrum Dunal. is used for treating diseases such as rheumatism, gonorrhea, breast cancer and other inflammatory-related ailments in South Africa. The aqueous extracts of the fresh, dried and boiled berries at doses of 1 and 10 mg/kg body weight was evaluated for antiinflammatory and ...

  3. African Journal of Biotechnology - Vol 13, No 6 (2014)

    African Journals Online (AJOL)

    Ashwagandha (Withania somnifera L. Dunal) crop as affected by the application of farm yard manure (FYM) and inorganic phosphorus in typic Torripsamment of Hisar · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. V Goel, BS Duhan, 743-748 ...

  4. Histochemical localization of cytokinin oxidase/dehydrogenase ...

    African Journals Online (AJOL)

    Withania somnifera (L.) Dunal is a promising herb that has been used as both traditional and modern therapeutic agent by virtue of its bioactive compounds especially withanolides. Earlier in vitro studies revealed the relation between cytokinin (CK) level and biogeneration of withanolides. The information on the cytokinin ...

  5. African Journal of Biotechnology - Vol 11, No 98 (2012)

    African Journals Online (AJOL)

    Development and optimization of hairy root culture systems in Withania somnifera (L.) Dunal for withaferin-A production · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ananthapadmanaban Saravanakumar, Abubakker Aslam, Appakan Shajahan ...

  6. Short Communication: Antigonorrheal Activities of Some ...

    African Journals Online (AJOL)

    The in vitro antigonorrheal activity of the seeds of Acacia nilotica (L.) willd.ex Del, the stem bark of Croton macrostachyus Del., the roots of Cucumis pustulatus Naud.ex Hook. f, the roots of Foeniculum vulgare Miller, and leaves of Withania sommnifera (L.) Dunal were studied using the agar dilution method. Different ...

  7. Phytochemical and antimicrobial properties of Solanum macranthum ...

    African Journals Online (AJOL)

    Extracts of leaves, stem bark, roots and fruits of Solanum macranthum Dunal were subjected to preliminary phytochemical screening for the presence of plant secondary metabolites and in vitro antibacterial and antifungal studies respectively. The results of the preliminary investigation revealed the presence of alkaloids, the ...

  8. QTL list: SpRg-4a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT74933 Solanum lycopersicum Solanaceae SpRg-4a In vitro plant regeneraion Regeneration... percentage concerning shoot regeneration 2 ... Chr04 50.24 4.94 ... 10.1186/1471-2229-11-140 22014149

  9. QTL list: SpRg-7 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT74946 Solanum lycopersicum Solanaceae SpRg-7 In vitro plant regeneraion Regeneration... percentage concerning shoot regeneration 2 ... Chr07 13.44 5.47 ... 10.1186/1471-2229-11-140 22014149

  10. The Colletotrichum boninense species complex

    NARCIS (Netherlands)

    Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Johnston, P.R.; Weir, B.S.; Tan, Y.P.; Shivas, R.G.; Crous, P.W.

    2012-01-01

    Although only recently described, Colletotrichum boninense is well established in literature as an anthracnose pathogen or endophyte of a diverse range of host plants worldwide. It is especially prominent on members of Amaryllidaceae, Orchidaceae, Proteaceae and Solanaceae. Reports from literature

  11. Zebrafish bioassay-guided microfractionation identifies anticonvulsant steroid glycosides from the Philippine medicinal plant Solanum torvum

    National Research Council Canada - National Science Library

    Challal, Soura; Buenafe, Olivia E M; Queiroz, Emerson F; Maljevic, Snezana; Marcourt, Laurence; Bock, Merle; Kloeti, Werner; Dayrit, Fabian M; Harvey, Alan L; Lerche, Holger; Esguerra, Camila V; de Witte, Peter A M; Wolfender, Jean-Luc; Crawford, Alexander D

    2014-01-01

    .... To identify anticonvulsant secondary metabolites, we performed an in vivo, zebrafish-based screen of medicinal plants used in Southeast Asia for the treatment of seizures. Solanum torvum Sw. (Solanaceae...

  12. Next Generation Sequencing Bulk Segregant Analysis of Potato Support that Differential Flux into the Cholesterol and Stigmasterol Metabolite Pools Is Important for Steroidal Glycoalkaloid Content

    DEFF Research Database (Denmark)

    Kaminski, Kacper Piotr; Kørup, Kirsten; Andersen, Mathias Neumann

    2016-01-01

    Potatoes and other Solanaceae species produce biologically active secondary metabolites called steroidal glycoalkaloids (GAs) which have antimicrobial, fungicidal, antiviral and insecticidal properties. GAs are, however, also toxic to animals and humans. Compared to wild species of potato...

  13. Antidiabetic activity of water extract of Solanum trilobatum (Linn.) in ...

    African Journals Online (AJOL)

    Solanaceae), a medicinal plant widely used in the traditional Ayurveda and Siddha systems of medicine for the treatment of diabetes mellitus was evaluated in the alloxan monohydrate induced diabetic model. Graded doses of the water extract were ...

  14. QTL list: SpRg-8 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available entage concerning shoot regeneration 2 ... Chr08 46.37 3.84 ... 10.1186/1471-2229-11-140 22014149 ... QT74952 Solanum lycopersicum Solanaceae SpRg-8 In vitro plant regeneraion Bud perc

  15. Marker list: QM337475 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AATCCATGAATGAGAGC West Virginia 700 x Hawaii 7996 ... Chr06 ... 10.1007/s10681-010-0125-z ... ... QM337475 Solanum lycopersicum Solanaceae SLM6-53 SSR CCCGCAATTTTAATAGTATAACCAA CGG

  16. Download this PDF file

    African Journals Online (AJOL)

    AJTCAM

    Garcinia kola were ineffective. Introduction ... preparation of the later include Citrus aurantifolia (lime) juice, Citrus aurantium (Orombo igun) and. Aframomum .... Mimosoide- Fabaceae. Fruits. Garcinia kola Heckel. Clusiaceae. Fruits. Nicotiana tabacum Linn. Solanaceae. Whole plant. Securidaca longepedinculata Fres.

  17. A Methanol Extract of Brugmansia arborea Affects the Reinforcing and Motor Effects of Morphine and Cocaine in Mice

    National Research Council Canada - National Science Library

    Bracci, Antonio; Daza-Losada, Manuel; Aguilar, Maria; De Feo, Vincenzo; Miñarro, José; Rodríguez-Arias, Marta

    2013-01-01

    Previous reports have shown that several of the effects of morphine, including the development of tolerance and physical withdrawal symptoms, are reduced by extracts of Brugmansia arborea (L.) Lagerheim (Solanaceae) (B. arborea...

  18. Cloning and characterization of two novel purple pepper genes ...

    African Journals Online (AJOL)

    Capsicum annuum L.) CHS and F3H genes were amplified using the reverse transcriptase polymerase chain reaction based on the conserved sequence information of some Solanaceae plants and known highly homologous pepper ESTs.

  19. ORF Alignment: NC_003295 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_003295 gi|17545851 >1xjhA 4 62 266 325 7e-15 ... emb|CAD14834.1| PUTATIVE REDOX REGULATED MOLECULA... ... PUTATIVE REDOX REGULATED MOLECULAR CHAPERONE ... HEAT-SHOCK-LIKE PROTEIN [Ralstonia solanacea

  20. Parafomoria fumanae sp. n., a new stem miner on Fumana procumbens (Lepidoptera: Nepticulidae

    Directory of Open Access Journals (Sweden)

    Aleš Laštůvka

    2005-01-01

    Full Text Available Parafomoria fumanae sp. n. is described from southern France. The new species is similar to Parafomoria ladaniphila (Mendes, 1910, but very close to P. cistivora (Peyerimhoff, 1871 and P. helianthemella (Herrich-Schäffer, 1860 after its genital morphology. It differs especially by the characters on valvae, tegumen, uncus and aedeagus. Its larva is a stem miner of Fumana procumbens (Dunal Gr. et Godr., the species is the first stem miner in the genus Parafomoria van Nieukerken, 1983.

  1. Withania Somnifera L Root Extract Ameliorates Toxin Induced Cytotoxicity

    OpenAIRE

    R. Maheswari; P.Manisha

    2015-01-01

    In this study the use of plants for medicinal purpose used locally in the treatment of various diseases and we examined for their antioxidant activity. Therefore, the present investigation is part of continuing programme related to the biochemical screening of local plants used in Ancient Indian Medicine, Ayurveda, Siddha and Yunani. An Aqueous root extract of Withania Somnifera (L.) Dunal (Ashwagandha) was evaluated for its protective effect (antioxidant effect) against Cypermethrin (CM) tox...

  2. Phytochemical diversity in ashwagandha (Withania somnifera)

    OpenAIRE

    D. H. Sukanya; A.N. Lokesha; Gayatri Datta; K. Himabindu

    2011-01-01

    (Abstract selected from presentation in National Conference on Biodiversity of Medicinal and Aromatic Plants: Collection, Characterization and Utilization, held at Anand, India during November 24-25, 2010)   Ashwagandha (Withania somnifera Dunal) is an important commercial medicinal crop, which is considered as an alternate to Ginseng. It is a superior class herb with multiple benefits. Fruits, leaves and seeds of the plant have been used for ages in Ayurveda. The root has been used m...

  3. Effects of Ashwagandha (roots of Withania somnifera) on neurodegenerative diseases.

    Science.gov (United States)

    Kuboyama, Tomoharu; Tohda, Chihiro; Komatsu, Katsuko

    2014-01-01

    Neurodegenerative diseases commonly induce irreversible destruction of central nervous system (CNS) neuronal networks, resulting in permanent functional impairments. Effective medications against neurodegenerative diseases are currently lacking. Ashwagandha (roots of Withania somnifera Dunal) is used in traditional Indian medicine (Ayurveda) for general debility, consumption, nervous exhaustion, insomnia, and loss of memory. In this review, we summarize various effects and mechanisms of Ashwagandha extracts and related compounds on in vitro and in vivo models of neurodegenerative diseases such as Alzheimer's disease and spinal cord injury.

  4. Efeito alelopático de folhas de Solanum lycocarpum A. St.-Hil. (Solanaceae na germinação e crescimento de Sesamum indicum L. (Pedaliaceae sob diferentes temperaturas Allelopathic effect of Solanum lycocarpum A. St.-Hil. leaves on the germination and growth of Sesamum indicum L.(Pedaliaceae under different temperatures

    Directory of Open Access Journals (Sweden)

    Sarah C. Caldas Oliveira

    2004-09-01

    Full Text Available Alelopatia pode ser definida como o efeito maléfico ou benéfico que uma planta exerce sobre a outra por meio de compostos químicos liberados no ambiente. Diversas espécies do gênero Solanum apresentam evidências de propriedades alelopáticas. S. lycocarpum A. St.-Hil (lobeira é espécie de ampla distribuição em ambientes perturbados do Cerrado. No presente trabalho foram investigados efeitos alelopáticos de extratos de folhas de lobeira na germinação e no crescimento do gergelim (Sesamum indicum L.. Extratos aquosos das folhas foram preparados nas concentrações de 1%, 2%, 3%, 4% e 5% (p/v. A osmolaridade dos extratos foi medida e soluções de polietileno glicol (PEG 6000, de osmolaridade similar, foram preparadas para avaliar possíveis efeitos osmóticos dos extratos aquosos. Nos testes de germinação, as sementes de gergelim foram colocadas em placas de Petri forradas com papel de filtro com a solução a ser testada e observadas a cada 8h. Para os experimemtos de crescimento, sementes de gergelim foram germinadas em água e posteriormente dispostas para crescimento nos extratos. Após 5 dias, foram medidos os comprimentos da parte aérea e radicular das plântulas. Todos os experimentos foram conduzidos a 22 ºC, 30 ºC e 38 ºC. Observou-se que os extratos de folhas não afetaram a germinabilidade, mas aumentaram o tempo médio de germinação em uma relação próxima à dose-dependente, nas três temperaturas. Quanto ao crescimento, a parte radicular foi a mais afetada pelos extratos aquosos, apresentando redução no tamanho, necroses, ausência de pêlos absorventes e formação de raízes laterais. Os efeitos dos extratos no crescimento das plântulas foram mais evidentes a 38 ºC. Os experimentos conduzidos com soluções de PEG 6000 mostraram que os efeitos observados na presença dos extratos não são de natureza osmótica.Allelopathy should be defined as any stimulatory or inhibitory effect by one plant on another through production of chemical compounds released into the environment. Several Solanum species have shown some allelopathic property. S. lycocarpum islargely distributed on disturbed areas of the Brazilian Cerrado. In the present study the effects of aqueous extracts of S. lycocarpum leaves on the germination and growth of Sesanum indicum L. (sesame were investigated. Aqueous leaf extracts at concentrations of 1%, 2%, 3%, 4%, and 5% (w/v were prepared. The osmolarity of the extracts were measured and solutions of polyethylene glycol (PEG 6000 of similar osmolarity were prepared to evaluate osmotic effects of the extracts on sesame germination and growth. The experiments were carried out on petri dishes lined by two layers of filter paper plus the solutions to be tested. For the germination experiments the number of germinated seeds was checked every 8h. For the growth experiments sesame seeds were previously germinated in water and disposed to grow in the extracts. After five days of incubation the root and shoot length of the seedlings was measured. All the experiments were performed at 22 ºC, 30 ºC and 38 ºC. The extracts did not affect the germinability but increased the average germination time in a dose-dependent manner at the three temperatures. The root growth was more affected by the extracts, showing tip-necrosis, absence of root hairs, and formation of secondary roots. These effects were more evident at 38 ºC. Using PEG 6000 it was shown that the observed effects were not due to osmotic properties of the leaf extracts.

  5. Transport of contaminants from energy-process-waste leachates through subsurface soils and soil components: laboratory experiments

    Energy Technology Data Exchange (ETDEWEB)

    Wangen, L.E.; Stallings, E.A.; Walker, R.D.

    1982-08-01

    The subsurface transport and attenuation of inorganic contaminants common to a variety of energy process waste leachates are being studied using laboratory column methods. Anionic species currently being emphasized are As, B, Mo, and Se. Transport of the cations Cd and Ni is also being studied. The solid adsorbents consist of three soil mineral components (silica sand, kaolinite, and goethite), and four subsurface soils (a dunal sand, an oxidic sandy clay loam, an acidic clay loam, and an alkaline clay loam). Breakthrough patterns of these species from packed soil columns are followed by monitoring eluent concentrations vs time under carefully controlled laboratory conditions. This report describes the experimental methods being used, the results of preliminary batch adsorption studies, and the results of column experiments completed through calendar year 1981. Using column influent concentrations of about 10 mg/l, adsorption (mmoles/100 g) has been determined from the eluent volume corresponding to 50% breakthrough. On silica sand, kaolinite, dunal sand, and goethite, respectively, these are 2.0 x 10/sup -4/, 0.020, 0.013, and 0.31 for cadmium, 4.4 x 10/sup -4/, 0.039, 0.020, and 0.98 for nickel. On kaolinite, dunal sand, and goethite, respectively, adsorption values (mmoles/100 g) are As (0.24, 0.019, and 20.5), B (0.041, 0.0019, and 1.77), Mo (0.048, 0.0010, and 5.93), and Se (0.029, 0.00048, and 1.30). Arsenic is the most highly adsorbed contaminant species and goethite has the largest adsorption capacity of the adsorbents.

  6. Effect of Xylopia aethiopica aqueous extract on antioxidant properties of refrigerated Roma tomato variety packaged in low density polyethylene bags

    OpenAIRE

    Babarinde, Grace Oluwakemi; Adegoke, Gabriel O.

    2013-01-01

    Effects of Xylopia aethiopica (Dunal) A. Richard aqueous extract on the antioxidants of matured tomato fruits at red stage were investigated at 13 ± 2 °C and 80 ± 5 % relative humidity. A sample treated with sodium bicarbonate and untreated samples were included. Samples packaged in low density polyethylene (30 μm thickness) bags were analysed at intervals of 5 days. The treatments revealed statistically significant differences in ascorbic acid content of stored tomato fruits. Fruits treated ...

  7. Niebla ceruchis from Laguna Figueroa: dimorphic spore morphology and secondary compounds localized in pycnidia and apothecia

    Science.gov (United States)

    Enzien, M.; Margulis, L.

    1988-01-01

    During and after the floods of 1979-80 Niebla ceruchis growing epiphytically on Lycium brevipes was one of the dominant aspects of the vegetation in the coastal dunal complex bordering the microbial mats at Laguna Figueroa, Baja California Norte, Mexico. The lichen on denuded branches of Lycium was far more extensively distributed than Lycium lacking lichen. Unusual traits of this Niebla ceruchis strain, namely localization of lichen compounds in the mycobiont reproductive structures (pycnidia and apothecia) and simultaneous presence of bilocular and quadrilocular ascospores, are reported. The abundance of this coastal lichen cover at the microbial mat site has persisted through April 1988.

  8. Chemical constituents of essential oils from the leaves and stem barks of four Vietnamese species of Fissistigma (Annonaceae).

    Science.gov (United States)

    Thang, Tran D; Luu, Hoang V; Dung, Vo C; Tuan, Nguyen N; Hung, Nguyen H; Dai, Do N; Ogunwande, Isiaka A

    2014-01-01

    Chemical profiles of essential oils from four Fissistigma species: Fissistigma bracteolatum Chatt., Fissistigma villosissimum Merr., Fissistigma latifolium (Dunal) Merr. and Fissistigma glaucescens (Hance) Merr. were analysed by gas chromatography-flame ionisation detector and gas chromatography-mass spectrometry. Fissistigma essential oils consist mainly of sesquiterpenes (48.7-83.8%), monoterpenes (3.2-30.9%) and fatty acids (0.5-33.4%). Data on the essential oil composition of F. villosissimum, F. latifolium and F. glaucescens are reported for the first time.

  9. Frugivoria e dispersão de sementes pelo lagarto teiú Tupinambis merianae (Reptilia: Teiidae Frugivory and seed dispersal by the tegu lizard Tupinambis merianae Reptilia: Teiidae

    Directory of Open Access Journals (Sweden)

    Everaldo Rodrigo de Castro

    2004-01-01

    Full Text Available Os lagartos teiús possuem uma dieta generalista, podendo agir como importantes dispersores de sementes em florestas semidecíduas do sudeste do Brasil. Foram estudadas a frugivoria e a dispersão de sementes de lagartos teiús usando animais em cativeiro, através da oferta de frutos de uma floresta semidecídua. Frutos de trinta espécies vegetais foram oferecidos aos lagartos em cativeiro, com diâmetro variando de 0,81 a 10,0 cm. Não foram encontradas diferenças estatísticas na germinação entre as sementes que passaram pelo trato digestivo do lagarto e as controle de Eugenia uniflora (chi²= 0.69, P>0.50, Genipa americana (chi²= 6.4, P>0.975, Cereus peruvianus (chi²= 0.018, P>0.10, e Solanum viarum (chi²= 6.23, P>0.975. O tempo de retenção da semente no tubo digestivo do teiú variou de 22 a 23 h para Solanum lycocarpum e 43 a 44 h para Syagrus romanzoffiana. Nossos resultados indicam que o lagarto teiú tem potencial para agir como um importante dispersor de sementes nos trópicos.Tegu lizards have a generalist diet and may play an important role as seed dispersers in semideciduous forests in south-east Brazil. We studied the frugivory and seed dispersal of tegu lizards using captive animals and offering wild fruits from a semideciduous forest. Thirty fruit species were eaten by the lizards in captivity, ranging from 0.81 to 10.0 cm (fruit diameter. Even large fruit adapted to dispersal by large mammals were swallowed (ex. Syagrus oleracea. There were no statistical differences in seed germination between seeds that passed through the lizard gut and the control in Eugenia uniflora (chi2 = 0.69, P>0.50, Genipa americana (chi2 = 6.4, P>0.975, Cereus peruvianus (chi2 = 0.018, P>0.10, and Solanum viarum (chi2 = 6.23, P>0.975. Seed retention time in the tegu gut ranged from 2224 h (Solanum lycocarpum to 4344 h (for Syagrus romanzoffiana. Our results indicate that tegu lizards have a potential to be an important seed dispersers in the

  10. Fine mapping of two major QTLs conferring resistance to powdery mildew in tomato

    NARCIS (Netherlands)

    Faino, L.; Azizinia, S.; Houshyani Hassanzadeh, B.; Verzaux, E.C.; Ercolano, M.R.; Visser, R.G.F.; Bai, Y.

    2012-01-01

    Tomato (Solanum lycopersicum) is the most cultivated crop in the Solanaceae family and is a host for Oidium neolycopersici, the cause agent of powdery mildew disease. In wild species of tomato, genes (Ol-1–Ol-6) for monogenic resistance have been identified. Moreover, three quantitative resistance

  11. Bello et al (9)

    African Journals Online (AJOL)

    Timade VENTURE

    Eds.) The ecology and taxonomy of the Solanaceae. Academic Press, London. Gbile, Z.O. 1985. Taxonomic studies in the. Nigerian species of Solanum Linn. 1. Studies of the generic and infrageneric statuses. Nigerian J. Sci.19 (1 & 2): 57-61.

  12. (DIPTERA: AGROMYZIDAE) AS A CONTROLLER OF OROBANCHE

    African Journals Online (AJOL)

    Zuammenarbeit, D-70593 Stuttgart, Germany. 3 Ministry of Agriculture, Crop Protection ... constrain the production of many crops, particularly in the Leguminosae and. Solanaceae families in Ethiopia (Parker and ..... Investigation of the dipteran Phytomyza orobanchia Kali. as a controller of parasitic phanerogams of the ...

  13. QTL list: FA11_Extended length [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT89626 Solanum lycopersicum Solanaceae FA11_Extended length fatty acid content regulation of fatty acid profile of acylsugars 4 C2_At2g14260 ... Chr11 51.5 ... 10.1007/s11032-014-0110-7 ...

  14. Combining ability and genetic analysis of fruit and leaf yield in ...

    African Journals Online (AJOL)

    Gboma eggplant (Solanum macrocapon L.) of the family Solanaceae is an important fruit and leafy indigenous vegetable in Africa. Despite the numerous nutritional, medicinal and economic benefits derived from the crop, little is known about the genetic parameters governing the inheritance and combining ability of the ...

  15. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75072 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germin...ation rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr08 72.6-87.8 2.32 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  16. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75236 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean... germination rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr04 41.0-54.1 2.83 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  17. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75163 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt I_mean germ...ination rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr12 48.9-54.5 3.45 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  18. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75075 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germin...ation rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr12 49.5-63.0 2.54 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  19. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75151 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt I_mean germ...ination rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr04 68.2-85.0 2.94 ... 10.1111/j.1365-3040.2011.02463.x 22074055

  20. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT75355 Solanum lycopersicum Solanaceae ... Seed quality_high-temperature stress High-temperature stress I_mea...n germination rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr01 61.7-65.7 2.79 ... 10.1111/j.1365-3040.2011.02463.x 22074055