WorldWideScience

Sample records for vhl gene mutation

  1. Endemic polycythemia in Russia: mutation in the VHL gene.

    Science.gov (United States)

    Ang, Sonny O; Chen, Hua; Gordeuk, Victor R; Sergueeva, Adelina I; Polyakova, Lydia A; Miasnikova, Galina Y; Kralovics, Robert; Stockton, David W; Prchal, Josef T

    2002-01-01

    Chuvash polycythemia (CP) is an autosomal recessive condition that is endemic in the Russian mid-Volga River region of Chuvashia. We previously found that CP patients may have increased serum erythropoietin (EPO) levels, ruled out linkage to both the EPO and EPO receptor (EPOR) gene loci, and hypothesized that the defect may lie in the oxygen homeostasis pathway. We now report a study of five multiplex Chuvash families which confirms that CP is associated with significant elevations of serum EPO levels and rules out a location for the CP gene on chromosome 11 as had been reported by other investigators or a mutation of the HIF-1 alpha gene. Using a genome-wide screen, we localized a region on chromosome 3 with a LOD score >2. After sequencing three candidate genes, we identified a C to T transition at nucleotide 598 (an R200W mutation) in the von Hippel-Lindau (VHL) gene. The VHL protein (pVHL) downregulates the alpha subunit of hypoxia-inducible factor 1 (HIF-1 alpha), the main regulator of hypoxia adaptation, by targeting the protein for degradation. In the simplest scenario, disruption of pVHL function causes a failure to degrade HIF-1 alpha resulting in accumulation of HIF-1 alpha, upregulation of downstream target genes such as EPO, and the clinical manifestation of polycythemia. These findings strongly suggest that CP is a congenital disorder of oxygen homeostasis.

  2. [Prenatal exclusion of von Hippel-Lindau syndrome in a Mexican family carrying a novel VHL gene mutation].

    Science.gov (United States)

    Chacón-Camacho, Oscar Francisco; Benitez-Granados, Jesús; Zenteno, Juan Carlos

    2014-03-01

    von Hippel-Lindau (VHL) disease is an autosomal dominant and familial multisystemic syndrome that is caused by the inactivation of the VHL gene and it is characterized by diverse types of high vasculated tumours of benign and malign nature. In this work we describe the clinical characteristics and the prenatal diagnosis of a woman with VHL. Describe the first exclusion prenatal case by DNA analysis of the VHL syndrome in Latinoamerican population. Analysis of a Mexican familial pedigree showed 5 affected subjects with VHL on 3 consecutive generations. The proband was a 7 weeks pregnancy woman who was referred to our service for familiar and personal history of this disease. Maternal DNA was obtained from peripheral blood leukocytes, while fetal DNA was isolated from amniotic liquid cells on the 15th week. The maternal and fetal DNA analysis were done by the Polymerase Chain reaction (PCR) and the direct nucleotide sequence of the VHL gene. A novel mutation (c. 161_168 dup GGAGGCCG) in the VHL gene was identified in maternal DNA. Fetal DNA analysis indicated that the fetus inherited the wild-type allele from the mother. A novel VHL gene mutation was identified in a familial case of the disease, expanding the mutational spectrum in this disorder. The molecular prenatal testing in the affected woman at 15 weeks of gestation, demonstrated that the fetus did nor inherited the mutated allele. To the best of our knowledge, this is the first example of prenatal-molecular exclusion on VHL syndrome in Latinoamerica population.

  3. Identification of 3 novel VHL germ-line mutations in Danish VHL patients

    DEFF Research Database (Denmark)

    Dandanell, Mette; Friis-Hansen, Lennart Jan; Sunde, Lone

    2012-01-01

    von Hippel-Lindau (VHL) disease is a hereditary cancer syndrome in which the patients develop retinal and central nervous system hemangioblastomas, pheochromocytomas and clear-cell renal tumors. The autosomal dominant disease is caused by mutations in the VHL gene.......von Hippel-Lindau (VHL) disease is a hereditary cancer syndrome in which the patients develop retinal and central nervous system hemangioblastomas, pheochromocytomas and clear-cell renal tumors. The autosomal dominant disease is caused by mutations in the VHL gene....

  4. Rare presentation of familial paraganglioma without evidence of mutation in the SDH, RET and VHL genes: towards further genetic heterogeneity.

    Science.gov (United States)

    Persu, Alexandre; Amyere, Mustapha; Gutierrez-Roelens, Ilse; Rustin, Pierre; Sempoux, Christine; Lecouvet, Frédéric E; Van Beers, Bernard E; Horsmans, Yves; De Plaen, Jean-François; MarcHamoir; Vikkula, Miikka

    2009-01-01

    Mutations in genes encoding succinate dehydrogenase and its anchoring subunits (SDH genes) are at the origin of hereditary head and neck paraganglioma (PGL) and a subset of apparently sporadic pheochromocytoma. We describe a family including three patients harbouring bilateral head and neck PGL diagnosed before 25 years of age. Multiple hypervascular hepatic lesions were subsequently discovered in two of them. In both, liver biopsy confirmed the diagnosis of PGL. In addition, in one patient, MRI disclosed multiple target-like lesions of the spine, highly suggestive of metastatic PGL. Family history was compatible with autosomal dominant inheritance with possible maternal imprinting. Combined single-strand conformation polymorphism and heteroduplex analysis followed by sequencing did not show any mutation of the coding parts of SDHB, SDHC, SDHD, RET or VHL genes. Screening of copy number alterations and loss of heterozygosity in the three affected family members showed no deletion or amplification of the SDH, RET and VHL genes. Furthermore, succinate dehydrogenase activity measured in a liver PGL sample was not significantly decreased in the affected patient as compared with controls, underscoring the exclusion of the SDH genes. To our knowledge, this is the first reported family of hereditary head and neck PGL with metastatic dissemination in the liver and the spine. A large body of evidence supports the absence of mutations in SDH, RET and VHL genes, which suggests the existence of a yet unknown gene at the origin of this particular form of familial PGL.

  5. Identification of Somatic Mutations in the von Hippel–Lindau (VHL Gene in a Patient With Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Wen-Chung Wang

    2009-11-01

    Full Text Available One of the known causal molecular events in renal cell carcinoma is somatic mutation in the von Hippel–Lindau (VHL gene. Our study describes a 51-year-old Taiwanese man who had bilateral renal cell carcinoma. The patient underwent radical nephrectomy without postoperative chemotherapy or radiotherapy, and is still alive after renal transplantation without tumor recurrence after > 5 years. To clarify his predisposition for bilateral tumors, we performed molecular genetic analysis of the VHL gene in this study. Polymerase chain reaction–single-strand conformation polymorphism and direct sequencing were performed on DNA of blood samples and paraffin-embedded tumor specimens from this patient. DNA from peripheral blood lymphocytes tested negative for germline mutations. However, there were two heterozygous alleles in the promoter and 3′ untranslated regions of this gene. Nonetheless, the DNA from his tumors showed loss of heterozygosity (LOH in these two loci. In addition to the LOH, we identified some different somatic mutations in his tumor tissues: C287T and G460A in the right-sided tumor, and G244A and G390A in the left-sided tumor. The possible roles of these genetic polymorphisms and point mutations in his renal tumorigenesis are discussed. This report provides new insights into renal cell carcinoma that result from VHL gene alterations in Taiwan.

  6. Novel homozygous VHL mutation in exon 2 is associated with congenital polycythemia but not with cancer.

    Science.gov (United States)

    Lanikova, Lucie; Lorenzo, Felipe; Yang, Chunzhang; Vankayalapati, Hari; Drachtman, Richard; Divoky, Vladimir; Prchal, Josef T

    2013-05-09

    Germline von Hippel-Lindau (VHL) gene mutations underlie dominantly inherited familial VHL tumor syndrome comprising a predisposition for renal cell carcinoma, pheochromocytoma/paraganglioma, cerebral hemangioblastoma, and endolymphatic sac tumors. However, recessively inherited congenital polycythemia, exemplified by Chuvash polycythemia, has been associated with 2 separate 3' VHL gene mutations in exon 3. It was proposed that different positions of loss-of-function VHL mutations are associated with VHL syndrome cancer predisposition and only C-terminal domain-encoding VHL mutations would cause polycythemia. However, now we describe a new homozygous VHL exon 2 mutation of the VHL gene:(c.413C>T):P138L, which is associated in the affected homozygote with congenital polycythemia but not in her, or her-heterozygous relatives, with cancer or other VHL syndrome tumors. We show that VHL(P138L) has perturbed interaction with hypoxia-inducible transcription factor (HIF)1α. Further, VHL(P138L) protein has decreased stability in vitro. Similarly to what was reported in Chuvash polycythemia and some other instances of HIFs upregulation, VHL(P138L) erythroid progenitors are hypersensitive to erythropoietin. Interestingly, the level of RUNX1/AML1 and NF-E2 transcripts that are specifically upregulated in acquired polycythemia vera were also upregulated in VHL(P138L) granulocytes.

  7. Differences in regulation of tight junctions and cell morphology between VHL mutations from disease subtypes

    Directory of Open Access Journals (Sweden)

    Isanova Bella

    2009-07-01

    Full Text Available Abstract Background In von Hippel-Lindau (VHL disease, germline mutations in the VHL tumor suppressor gene cause clear cell renal carcinomas, hemangioblastomas, and pheochromocytomas. The VHL gene product is part of an ubiquitin E3 ligase complex and hypoxia-inducible factor alpha (HIF-α is a key substrate, although additional VHL functions have been described. A genotype-phenotype relationship exists in VHL disease such that specific VHL mutations elicit certain subsets of these tumors. Here, we examine VHL genotype-phenotype correlations at the cellular level, focusing on the regulation of tight junctions and cell morphology. Methods Wild-type and various mutant VHL proteins representing VHL disease subtypes were stably expressed in 3 VHL-negative renal carcinoma cell lines. Using these cell lines, the roles of various VHL-associated cellular functions in regulation of cell morphology were investigated. Results As a whole, type 1 mutants varied greatly from type 2 mutants, demonstrating high levels of HIF-2α, cyclin D1 and α5 integrin, lower p27 levels, and a spindly, fibroblastic cellular appearance. Type 2 mutations demonstrated an epithelial morphology similar to wild-type VHL in the majority of the renal cell lines used. Knockdown of p27 in cells with wild-type VHL led to perturbations of both epithelial morphology and ZO-1 localization to tight junctions. ZO-1 localization correlated well with VHL disease subtypes, with greater mislocalization observed for genotypes associated with a higher risk of renal carcinoma. HIF-2α knockdown in 786-O partially restored ZO-1 localization, but did not restore an epithelial morphology. Conclusion VHL has both HIF-α dependent and HIF-α independent functions in regulating tight junctions and cell morphology that likely impact the clinical phenotypes seen in VHL disease.

  8. The homozygous VHL(D126N) missense mutation is associated with dramatically elevated erythropoietin levels, consequent polycythemia, and early onset severe pulmonary hypertension.

    Science.gov (United States)

    Sarangi, Susmita; Lanikova, Lucie; Kapralova, Katarina; Acharya, Suchitra; Swierczek, Sabina; Lipton, Jeffrey M; Wolfe, Lawrence; Prchal, Josef T

    2014-11-01

    von Hippel-Lindau (VHL) protein is the principal negative regulator of hypoxia sensing mediated by transcription factors. Mutations in exon 3 of the VHL gene lead to Chuvash (VHL(R200W)) and Croatian (VHL(H191D)) polycythemias. Here, we describe an infant of Bangladesh ethnicity with a novel homozygous VHL(D126N) mutation with congenital polycythemia and dramatically elevated erythropoietin (EPO) levels, who developed severe fatal pulmonary hypertension. In contrast to Chuvash polycythemia, erythroid progenitors (BFU-Es) did not reveal a marked EPO hypersensitivity. Further, NF-E2 and RUNX1 transcripts that correlate with BFU-Es EPO hypersensitivity in polycythemic mutations were not elevated. © 2014 Wiley Periodicals, Inc.

  9. VHL and HIF-1α: gene variations and prognosis in early-stage clear cell renal cell carcinoma.

    Science.gov (United States)

    Lessi, Francesca; Mazzanti, Chiara Maria; Tomei, Sara; Di Cristofano, Claudio; Minervini, Andrea; Menicagli, Michele; Apollo, Alessandro; Masieri, Lorenzo; Collecchi, Paola; Minervini, Riccardo; Carini, Marco; Bevilacqua, Generoso

    2014-03-01

    Von Hipple-Lindau gene (VHL) inactivation represents the most frequent abnormality in clear cell renal cell carcinoma (ccRCC). Hypoxia-inducible factor-1α (HIF-1α) expression is regulated by O2 level. In normal O2 conditions, VHL binds HIF-1α and allows HIF-1α proteasomal degradation. A single-nucleotide polymorphism (SNP) has been found located in the oxygen-dependent degradation domain at codon 582 (C1772T, rs11549465, Pro582Ser). In hypoxia, VHL/HIF-1α interaction is abolished and HIF-1α activates target genes in the nucleus. This study analyzes the impact of genetic alterations and protein expression of VHL and the C1772T SNP of HIF-1α gene (HIF-1α) on prognosis in early-stage ccRCC (pT1a, pT1b, and pT2). Mutational analysis of the entire VHL sequence and the genotyping of HIF-1α C1772T SNP were performed together with VHL promoter methylation analysis and loss of heterozygosis (LOH) analysis at (3p25) locus. Data obtained were correlated with VHL and HIF-1α protein expression and with tumor-specific survival (TSS). VHL mutations, methylation status, and LOH were detected in 51, 11, and 12% of cases, respectively. Our results support the association between biallelic alterations and/or VHL silencing with a worse TSS. Moreover, we found a significant association between the HIF-1α C1772C genotype and a worse TSS. The same association was found when testing the presence of HIF-1α protein in the nucleus. Our results highlight the role of VHL/HIF-1α pathway in RCC and support the molecular heterogeneity of early-stage ccRCC. More important, we show the involvement of HIF-1α C1772T SNP in ccRCC progression.

  10. VHL type 2B mutations retain VBC complex form and function.

    Directory of Open Access Journals (Sweden)

    Kathryn E Hacker

    Full Text Available von Hippel-Lindau disease is characterized by a spectrum of hypervascular tumors, including renal cell carcinoma, hemangioblastoma, and pheochromocytoma, which occur with VHL genotype-specific differences in penetrance. VHL loss causes a failure to regulate the hypoxia inducible factors (HIF-1alpha and HIF-2alpha, resulting in accumulation of both factors to high levels. Although HIF dysregulation is critical to VHL disease-associated renal tumorigenesis, increasing evidence points toward gradations of HIF dysregulation contributing to the degree of predisposition to renal cell carcinoma and other manifestations of the disease.This investigation examined the ability of disease-specific VHL missense mutations to support the assembly of the VBC complex and to promote the ubiquitylation of HIF. Our interaction analysis supported previous observations that VHL Type 2B mutations disrupt the interaction between pVHL and Elongin C but maintain partial regulation of HIF. We additionally demonstrated that Type 2B mutant pVHL forms a remnant VBC complex containing the active members ROC1 and Cullin-2 which retains the ability to ubiquitylate HIF-1alpha.Our results suggest that subtypes of VHL mutations support an intermediate level of HIF regulation via a remnant VBC complex. These findings provide a mechanism for the graded HIF dysregulation and genetic predisposition for cancer development in VHL disease.

  11. Small activating RNA induced expression of VHL gene in renal cell carcinoma.

    Science.gov (United States)

    Kang, Moo Rim; Park, Ki Hwan; Lee, Chang Woo; Lee, Myeong Youl; Han, Sang-Bae; Li, Long-Cheng; Kang, Jong Soon

    2018-02-06

    Recent studies have reported that chemically synthesized double-stranded RNAs (dsRNAs), also known as small activating RNA (saRNAs), can specifically induce gene expression by targeting promoter sequences by a mechanism termed RNA activation (RNAa). In the present study, we designed 4 candidate saRNAs targeting the Von Hippel-Lindau (VHL) gene promoter. Among these saRNAs, dsVHL-821 significantly inhibited cell growth by up-regulating VHL at both the mRNA and protein levels in renal cell carcinoma 769-P cells. Functional analysis showed that dsVHL-821 induced apoptosis by increasing p53, decreasing Bcl-xL, activating caspase 3/7 and poly-ADP-ribose polymerase in a dose-dependent manner. Chromatin immunoprecipitation analysis revealed that dsVHL-821 increased the enrichment of Ago2 and RNA polymerase II at the dsVHL-821 target site. In addition, Ago2 depletion significantly suppressed dsVHL-821-induced up-regulation of VHL gene expression and related effects. Single transfection of dsVHL-821 caused long-lasting (14 days) VHL up-regulation. Furthermore, the activation of VHL by dsVHL-821 was accompanied by an increase in dimethylation of histone 3 at lysine 4 (H3K4me2) and acetylation of histone 4 (H4ac) and a decrease in dimethylation of histone 3 at lysine 9 (H3K9me2) and lysine 27 (H3K27me2) in the dsVHL-821 target region. Taken together, these results demonstrate that dsVHL-821, a novel saRNA for VHL, induces the expression of the VHL gene by epigenetic changes, leading to inhibition of cell growth and induction of apoptosis, and suggest that targeted activation of VHL by dsVHL-821 may be explored as a novel treatment of renal cell carcinoma. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. The phenotype of polycythemia due to Croatian homozygous VHL (571C>G:H191D) mutation is different from that of Chuvash polycythemia (VHL 598C>T:R200W).

    Science.gov (United States)

    Tomasic, Nikica Ljubas; Piterkova, Lucie; Huff, Chad; Bilic, Ernest; Yoon, Donghoon; Miasnikova, Galina Y; Sergueeva, Adelina I; Niu, Xiaomei; Nekhai, Sergei; Gordeuk, Victor; Prchal, Josef T

    2013-04-01

    Mutations of VHL (a negative regulator of hypoxia-inducible factors) have position-dependent distinct cancer phenotypes. Only two known inherited homozygous VHL mutations exist and they cause polycythemia: Chuvash R200W and Croatian H191D. We report a second polycythemic Croatian H191D homozygote distantly related to the first propositus. Three generations of both families were genotyped for analysis of shared ancestry. Biochemical and molecular tests were performed to better define their phenotypes, with an emphasis on a comparison with Chuvash polycythemia. The VHL H191D mutation did not segregate in the family defined by the known common ancestors of the two subjects, suggesting a high prevalence in Croatians, but haplotype analysis indicated an undocumented common ancestor ∼six generations ago as the founder of this mutation. We show that erythropoietin levels in homozygous VHL H191D individuals are higher than in VHL R200W patients of similar ages, and their native erythroid progenitors, unlike Chuvash R200W, are not hypersensitive to erythropoietin. This observation contrasts with a report suggesting that polycythemia in VHL R200W and H191D homozygotes is due to the loss of JAK2 regulation from VHL R200W and H191D binding to SOCS1. In conclusion, our studies further define the hematologic phenotype of VHL H191D and provide additional evidence for phenotypic heterogeneity associated with the positional effects of VHL mutations.

  13. VHL Manifestations

    Science.gov (United States)

    ... Us Website References Search Patients / What is VHL? / Manifestations People who have VHL disease may experience tumors ... very important to check regularly for possible VHL manifestations throughout a person’s lifetime. Most of these VHL ...

  14. Cigarette smoking, von Hippel-Lindau gene mutations and sporadic renal cell carcinoma

    NARCIS (Netherlands)

    Dijk, B.A.C. van; Schouten, L.J.; Oosterwijk, E.; Hulsbergen van de; Kaa, C.A.; Kiemeney, L.A.L.M.; Goldbohm, R.A.; Schalken, J.A.; Brandt, P.A. van den

    2006-01-01

    We investigated whether smoking is associated with mutations in the Von Hippel-Lindau (VHL) gene in 337 cases of sporadic renal cell carcinoma (RCC) among 120 852 people followed for 11.3 years; the findings suggest that smoking causes RCC independently of VHL gene mutations. © 2006 Cancer Research.

  15. Role of VEGFA, CXCR4 and VHL mutation in tumour behaviour

    NARCIS (Netherlands)

    Kruizinga, Roeliene

    2014-01-01

    De ziekte van Von Hippel Lindau (VHL) is een zeldzaam kankersyndroom. Patiënten met deze ziekte krijgen zowel goedaardige als kwaadaardige tumoren in verschillende organen. VHL-patiënten hebben een niet goed werkend VHL-eiwit waardoor er meer CXCR4, een chemokine receptor, en VEGFA, een

  16. VHL genetic alteration in CCRCC does not determine de-regulation of HIF, CAIX, hnRNP A2/B1 and osteopontin.

    LENUS (Irish Health Repository)

    Nyhan, Michelle J

    2012-01-31

    BACKGROUND: von Hippel-Lindau (VHL) tumour suppressor gene inactivation is associated with clear cell renal cell carcinoma (CCRCC) development. The VHL protein (pVHL) has been proposed to regulate the expression of several proteins including Hypoxia Inducible Factor-alpha (HIF-alpha), carbonic anhydrase (CA)IX, heterogeneous nuclear ribonucleoprotein (hnRNP) A2\\/B1 and osteopontin. pVHL has been characterized in vitro, however, clinical studies are limited. We evaluated the impact of VHL genetic alterations on the expression of several pVHL protein targets in paired normal and tumor tissue. METHODS: The VHL gene was sequenced in 23 CCRCC patients and VHL transcript levels were evaluated by real-time RT-PCR. Expression of pVHL\\'s protein targets were determined by Western blotting in 17 paired patient samples. RESULTS: VHL genetic alterations were identified in 43.5% (10\\/23) of CCRCCs. HIF-1alpha, HIF-2alpha and CAIX were up-regulated in 88.2% (15\\/17), 100% (17\\/17) and 88.2% (15\\/17) of tumors respectively and their expression is independent of VHL status. hnRNP A2\\/B1 and osteopontin expression was variable in CCRCCs and had no association with VHL genetic status. CONCLUSION: As expression of these proposed pVHL targets can be achieved independently of VHL mutation (and possibly by hypoxia alone), these data suggests that other pVHL targets may be more crucial in renal carcinogenesis.

  17. Pulmonary artery pressure and iron deficiency in patients with upregulation of hypoxia sensing due to homozygous VHL(R200W) mutation (Chuvash polycythemia).

    Science.gov (United States)

    Sable, Craig A; Aliyu, Zakari Y; Dham, Niti; Nouraie, Mehdi; Sachdev, Vandana; Sidenko, Stanislav; Miasnikova, Galina Y; Polyakova, Lydia A; Sergueeva, Adelina I; Okhotin, Daniel J; Bushuev, Vladimir; Remaley, Alan T; Niu, Xiaomei; Castro, Oswaldo L; Gladwin, Mark T; Kato, Gregory J; Prchal, Josef T; Gordeuk, Victor R

    2012-02-01

    Patients with Chuvash polycythemia, (homozygosity for the R200W mutation in the von Hippel Lindau gene (VHL)), have elevated levels of hypoxia inducible factors HIF-1 and HIF-2, often become iron-deficient secondary to phlebotomy, and have elevated estimated pulmonary artery pressure by echocardiography. The objectives of this study were to provide a comprehensive echocardiographic assessment of cardiovascular physiology and to identify clinical, hematologic and cardiovascular risk factors for elevation of tricuspid regurgitation velocity in children and adults with Chuvash polycythemia. This cross-sectional observational study of 120 adult and pediatric VHL(R200W) homozygotes and 31 controls at outpatient facilities in Chuvashia, Russian Federation included echocardiography assessment of pulmonary artery pressure (tricuspid regurgitation velocity), cardiac volume, and systolic and diastolic function, as well as hematologic and clinical parameters. We determined the prevalence and risk factors for elevation of tricuspid regurgitation velocity in this population and its relationship to phlebotomy. The age-adjusted mean ± SE tricuspid regurgitation velocity was higher in VHL(R200W) homozygotes than controls with normal VHL alleles (2.5±0.03 vs. 2.3±0.05 m/sec, P=0.005). The age-adjusted left ventricular diastolic diameter (4.8±0.05 vs. 4.5±0.09 cm, P=0.005) and left atrial diameter (3.4±0.04 vs. 3.2±0.08 cm, P=0.011) were also greater in the VHL(R200W) homozygotes, consistent with increased blood volume, but the elevation in tricuspid regurgitation velocity persisted after adjustment for these variables. Among VHL(R200W) homozygotes, phlebotomy therapy was associated with lower serum ferritin concentration, and low ferritin independently predicted higher tricuspid regurgitation velocity (standardized beta=0.29; P=0.009). Children and adults with Chuvash polycythemia have higher estimated right ventricular systolic pressure, even after adjustment for

  18. Multiple Components of the VHL Tumor Suppressor Complex Are Frequently Affected by DNA Copy Number Loss in Pheochromocytoma

    Directory of Open Access Journals (Sweden)

    David A. Rowbotham

    2014-01-01

    Full Text Available Pheochromocytomas (PCC are rare tumors that arise in chromaffin tissue of the adrenal gland. PCC are frequently inherited through predisposing mutations in genes such as the von Hippel-Lindau (VHL tumor suppressor. VHL is part of the VHL elongin BC protein complex that also includes CUL2/5, TCEB1, TCEB2, and RBX1; in normoxic conditions this complex targets hypoxia-inducible factor 1 alpha (HIF1A for degradation, thus preventing a hypoxic response. VHL inactivation by genetic mechanisms, such as mutation and loss of heterozygosity, inhibits HIF1A degradation, even in the presence of oxygen, and induces a pseudohypoxic response. However, the described <10% VHL mutation rate cannot account for the high frequency of hypoxic response observed. Indeed, little is known about genetic mechanisms disrupting other complex component genes. Here, we show that, in a panel of 171 PCC tumors, 59.6% harbored gene copy number loss (CNL of at least one complex component. CNL significantly reduced gene expression and was associated with enrichment of gene targets controlled by HIF1. Interestingly, we show that VHL-related renal clear cell carcinoma harbored disruption of VHL alone. Our results indicate that VHL elongin BC protein complex components other than VHL could be important for PCC tumorigenesis and merit further investigation.

  19. Prevalence of von Hippel-Lindau gene mutations in sporadic renal cell carcinoma: results from The Netherlands cohort study.

    NARCIS (Netherlands)

    Houwelingen, K.P. van; Dijk, B.A. van; Hulsbergen- van de Kaa, C.A.; Schouten, L.J.; Gorissen, H.; Schalken, J.A.; Brandt, P.A. van den; Oosterwijk, E.

    2005-01-01

    BACKGROUND: Biallelic von Hippel-Lindau (VHL) gene defects, a rate-limiting event in the carcinogenesis, occur in approximately 75% of sporadic clear-cell Renal Cell Carcinoma (RCC). We studied the VHL mutation status in a large population-based case group. METHODS: Cases were identified within the

  20. Elevated homocysteine, glutathione and cysteinylglycine concentrations in patients homozygous for the Chuvash polycythemia VHL mutation

    Science.gov (United States)

    Sergueeva, Adelina I.; Miasnikova, Galina Y.; Okhotin, Daniel J.; Levina, Alla A.; Debebe, Zufan; Ammosova, Tatiana; Niu, Xiaomei; Romanova, Elena A.; Nekhai, Sergei; DiBello, Patricia M.; Jacobsen, Donald W.; Prchal, Josef T.; Gordeuk, Victor R.

    2010-01-01

    In Chuvash polycythemia, homozygous von Hippel-Lindau (VHL) 598C>T leads to increased hypoxia inducible factor-1α and 2α, thromboses and lower systemic blood pressures. Circulating homocysteine, glutathione, γ-glutamyltransferase and cysteinylglycine concentrations were higher in 34 VHL598C>T homozygotes than in 37 normal controls and cysteine was lower. Multivariate analysis showed elevated homocysteine independently associated with higher mean systemic blood pressures and elevated glutathione was associated with lower pressures to a similar degree. Among VHL598C>T homozygotes, homocysteine was elevated with low and normal folate concentrations, consistent with a possible defect in the remethylation pathway. The elevated glutathione and γ-glutamyltranserase levels correlated positively with cysteinylglycine, consistent with possible upregulation of a glutathione synthetic enzyme and γ-glutamyltransferase. Cysteinylglycine correlated inversely with cysteine, consistent with possible reduced cysteinyldipeptidase activity. We conclude that up-regulated hypoxia-sensing may influence multiple steps in thiol metabolism. The effects of the resultant elevated levels of homocysteine and glutathione on systemic blood pressure may largely balance each other out. PMID:18223282

  1. Body Mass Index and von Hippel-Lindau Gene Mutations in Clear-cell Renal Cancer: Results of the Netherlands Cohort Study on Diet and Cancer

    NARCIS (Netherlands)

    Smits, K.M.; Schouten, L.J.; Hudak, E.; Verhage, B.; Dijk, B.A.C. van; Hulsbergen - Kaa, C.A. van de; Goldbohm, R.A.; Oosterwijk, E.; Brandt, P.A. van den

    2010-01-01

    Purpose: Body mass index (BMI) is an important risk factor for clear-cell renal cancer (cc-RCC). A common molecular alteration in cc-RCC is loss-of-function of the von Hippel-Lindau (VHL) gene. We evaluated the association between BMI and VHL mutations in cc-RCC by using data from the Netherlands

  2. A mutation at IVS1 + 5 of the von Hippel-Lindau gene resulting in intron retention in transcripts is not pathogenic in a patient with a tongue cancer?: case report

    Directory of Open Access Journals (Sweden)

    Asakawa Takeshi

    2012-03-01

    Full Text Available Abstract Background Von Hippel-Lindau disease (VHL is a dominantly inherited familial cancer syndrome predisposing the patient to a variety of malignant and benign neoplasms, most frequently hemangioblastoma, renal cell carcinoma, pheochromocytoma, and pancreatic tumors. VHL is caused by mutations of the VHL tumor suppressor gene on the short arm of chromosome 3, and clinical manifestations develop if both alleles are inactivated according to the two-hit hypothesis. VHL mutations are more frequent in the coding region and occur occasionally in the splicing region of the gene. Previously, we reported that the loss of heterozygosity (LOH of the VHL gene is common in squamous cell carcinoma tissues of the tongue. Case Presentation We describe a case of squamous cell carcinoma in the tongue caused by a point mutation in the splicing region of the VHL gene and discuss its association with VHL disease. Sequence analysis of DNA extracted from the tumor and peripheral blood of the patient with squamous cell carcinoma revealed a heterozygous germline mutation (c. 340 + 5 G > C in the splice donor sequence in intron 1 of the VHL gene. RT-PCR analysis of the exon1/intron1 junction in RNA from tumor tissue detected an unspliced transcript. Analysis of LOH using a marker with a heterozygous mutation of nucleotides (G or C revealed a deletion of the mutant C allele in the carcinoma tissues. Conclusions The fifth nucleotide G of the splice donor site of the VHL gene is important for the efficiency of splicing at that site. The development of tongue cancer in this patient was not associated with VHL disease because the mutation occurred in only a single allele of the VHL gene and that allele was deleted in tumor cells.

  3. Somatic mutation analysis of the SDHB, SDHC, SDHD, and RET genes in the clinical assessment of sporadic and hereditary pheochromocytoma.

    Science.gov (United States)

    Weber, Alexander; Hoffmann, Michael M; Neumann, Hartmut P H; Erlic, Zoran

    2012-08-01

    Systemic analysis of somatic mutations of other susceptibility genes in syndromic tumors as well as apparently sporadic tumors in well-characterized specimens is lacking. Its clinical relevance has not been studied. Our objective was to determine the frequency of second allele inactivation in syndromic tumors and determine the frequency and potential clinical impact of somatic mutations and loss of heterozygosity (LOH) of the known susceptibility genes in syndromic and sporadic tumors. Nine tumor specimens from clinically characterized VHL mutation, five from SDHB mutation, four from SDHD mutation, two from RET mutation carriers, and eight from apparently sporadic cases were analyzed. Tumor DNA mutation screening of the SDHx, VHL, and RET genes and LOH analyses of the SDHx and VHL genes were performed. The Yates-corrected chi-squared test was used for comparison of the clinical data and the molecular-genetic results. Second allele inactivation in tumors was identified in 83% of VHL, 80% of SDHB, and 50% of SDHD specimen. High prevalence of VHL (6/6, p=0.024) and SDHB (7/7, p=0.018) somatic mutations has been identified in the sporadic group compared to all others. In the group of the VHL tumors the SDHB somatic events were significantly lower (2/6; p=0.045). In 18/19 (95%) of cases, we were able to demonstrate the presence of at least two concomitant affected susceptibility genes. We conclude that LOH is the most prevalent second allele-inactivating event. SDHB and VHL somatic mutation might play a role in the sporadic forms of tumor development. There is no clinical impact of mutation screening or LOH analysis of tumor specimens.

  4. The VHL-dependent regulation of microRNAs in renal cancer

    Directory of Open Access Journals (Sweden)

    Rawlings Lesley H

    2010-10-01

    Full Text Available Abstract Background The commonest histological type of renal cancer, clear cell renal cell carcinoma (cc RCC, is associated with genetic and epigenetic changes in the von Hippel-Lindau (VHL tumour suppressor. VHL inactivation leads to induction of hypoxia-inducible factors (HIFs and a hypoxic pattern of gene expression. Differential levels of specific microRNAs (miRNAs are observed in several tumours when compared to normal tissue. Given the central role of VHL in renal cancer formation, we examined the VHL-dependent regulation of miRNAs in renal cancer. Methods VHL-dependent miRNA expression in cc RCC was determined by microarray analysis of renal cell line RCC4 with mutated VHL (RCC4-VHL and reintroduced wild-type VHL (RCC4 + VHL. Five miRNAs highly upregulated in RCC4 + VHL and five miRNAs highly downregulated in RCC4 + VHL were studied further, in addition to miR-210, which is regulated by the HIF-VHL system. miRNA expression was also measured in 31 cc RCC tumours compared to adjacent normal tissue. Results A significant increase in miR-210, miR-155 and miR-21 expression was observed in the tumour tissue. miR-210 levels also showed a correlation with a HIF-regulated mRNA, carbonic anhydrase IX (CAIX, and with VHL mutation or promoter methylation. An inverse correlation was observed between miR-210 expression and patient survival, and a putative target of miR-210, iron-sulfur cluster assembly protein (ISCU1/2, shows reciprocal levels of mRNA expression in the tumours. Conclusions We have identified VHL-regulated miRNAs and found that for some the regulation is HIF-dependent and for others it is HIF-independent. This pattern of regulation was also seen in renal cancer tissue for several of these miRNAs (miR-210, miR-155, let-7i and members of the miR-17-92 cluster when compared with normal tissue. miR-210 showed marked increases in expression in renal cancer and levels correlated with patient survival. The inverse correlation between miR-210

  5. Management Strategies and Outcomes for VHL-related Craniospinal Hemangioblastomas

    Directory of Open Access Journals (Sweden)

    Christ Ordookhanian

    2017-08-01

    Full Text Available Hemangioblastomas are rare and benign tumors accounting for less than 2% of all central nervous system (CNS tumors. The vast majority of hemangioblastomas occur sporadically, whereas a small number of cases, especially in younger patients, are associated with Von Hippel–Lindau (VHL syndrome. It is thought that loss of tumor suppressor function of the VHL gene results in stabilization of hypoxia-inducible factor alpha with downstream activation of cellular proliferative and angiogenic genes that promote tumorigenesis. VHL-related hemangioblastomas predominantly occur in the cerebellum and spine. Lesions are often diagnosed on contrast-enhanced craniospinal MRIs, and the diagnosis of VHL occurs through assessment for germline VHL mutations. Surgical resection remains the primary treatment modality for symptomatic or worrisome lesions, with excellent local control rates and neurological outcomes. Stereotactic radiotherapy can be employed in patients who are deemed high risk for surgery, have multiple lesions, or have non-resectable lesions. Given the tendency for development of either new or multiple lesions, close radiographic surveillance is often recommended for asymptomatic lesions.

  6. Carotenoid and vitamin intake, von Hippel-Lindau gene mutations and sporadic renal cell carcinoma.

    NARCIS (Netherlands)

    Dijk, B.A.C. van; Schouten, L.J.; Oosterwijk, E.; Hulsbergen- van de Kaa, C.A.; Kiemeney, L.A.L.M.; Goldbohm, R.A.; Schalken, J.A.; Brandt, P.A. van den

    2008-01-01

    OBJECTIVE: We investigated whether dietary carotenoid and vitamin intake and supplemental vitamin use were inversely associated with RCC risk and with Von Hippel-Lindau (VHL)-gene mutations in clear-cell renal cell carcinoma (RCC). METHODS: The Netherlands Cohort Study on diet and cancer (NLCS)

  7. Carotenoid and vitamin intake, von Hippel-Lindau gene mutations and sporadic renal cell carcinoma

    NARCIS (Netherlands)

    Dijk, B.A.C. van; Schouten, L.J.; Oosterwijk, E.; Hulsbergen van de; Kaa, C.A.; Kiemeney, L.A.L.M.; Goldbohm, R.A.; Schalken, J.A.; Brandt, P.A. van den

    2008-01-01

    Objective: We investigated whether dietary carotenoid and vitamin intake and supplemental vitamin use were inversely associated with RCC risk and with Von Hippel-Lindau (VHL)-gene mutations in clear-cell renal cell carcinoma (RCC). Methods: The Netherlands Cohort Study on diet and cancer (NLCS)

  8. SOMATIC MUTATIONS OF THE VON HIPPEL-LINDAU DISEASE TUMOR-SUPPRESSOR GENE IN NONFAMILIAL CLEAR-CELL RENAL-CARCINOMA

    NARCIS (Netherlands)

    FOSTER, K; PROWSE, A; van den Berg, Anke; FLEMING, S; HULSBEEK, MMF; CROSSEY, PA; RICHARDS, FM; CAIRNS, P; FERGUSONSMITH, MA; BUYS, CHCM; MAHER, ER

    1994-01-01

    Loss of heterozygosity (LOH) studies have suggested that somatic mutations of a tumour suppressor gene or genes on chromosome 3p are a critical event in the pathogenesis of non-familial renal cell carcinoma (RCC). Germline mutations of the von Hippel - Lindau (VHL) disease gene predispose to early

  9. Prevalence of von Hippel-Lindau gene mutations in sporadic renal cell carcinoma: results from the Netherlands cohort study

    Directory of Open Access Journals (Sweden)

    Schalken Jack A

    2005-06-01

    Full Text Available Abstract Background Biallelic von Hippel-Lindau (VHL gene defects, a rate-limiting event in the carcinogenesis, occur in approximately 75% of sporadic clear-cell Renal Cell Carcinoma (RCC. We studied the VHL mutation status in a large population-based case group. Methods Cases were identified within the Netherlands cohort study on diet and cancer, which includes 120,852 men and women. After 11.3 years of follow-up, 337 incident cases with histologically confirmed epithelial cancers were identified. DNA was isolated from paraffin material collected from 51 pathology laboratories and revised by one pathologist, leaving material from 235 cases. VHL mutational status was assessed by SSCP followed by direct sequencing, after testing SSCP as a screening tool in a subsample. Results The number of mutations was significantly higher for clear-cell RCC compared to other histological types. We observed 131 mutations in 114 out of 187 patients (61% with clear-cell RCC. The majority of mutations were truncating mutations (47%. The mean tumor size was 72.7 mm for mutated tumors compared to 65.3 mm for wildtype tumors (p = 0.06. No statistically significant differences were observed for nuclear grade, TNM distribution or stage. In other histological types, we observed 8 mutations in 7 out of 48 patients (15%, 1 mutation in 1 of 6 oncocytoma, 3 mutations in 2 of 7 chromophobe RCC, 2 mutations in 2 of 30 papillary RCC, no mutations in 1 collecting duct carcinoma and 2 mutations in 2 of 4 unclassified RCC. Conclusion VHL mutations were detected in 61% of sporadic clear-cell RCC. VHL mutated and wildtype clear-cell RCC did not differ with respect to most parameters.

  10. A patient with bilateral pheochromocytoma as part of a Von Hippel-Lindau (VHL syndrome type 2C

    Directory of Open Access Journals (Sweden)

    Rinkes Inne

    2007-10-01

    Full Text Available Abstract Background Von Hippel-Lindau (VHL disease is an autosomal dominant inherited disease. It is relatively recent that type 2C was identified as a separate group solely presenting with pheochromocytomas. As an illustration, an interesting case is presented of a pregnant woman with refractory hypertension. It proved to be the first manifestation of bilateral pheochromocytomas. The family history may indicate the diagnosis, but only identification of a germ line mutation in the DNA of a patient will confirm carriership. Case presentation A 27 year pregnant patient with intra uterine growth retardation presented with hypertension and pre-eclampsia. Magnetic resonance imaging revealed bilateral adrenal pheochromocytoma. She underwent laparoscopic adrenelectomy and a missense mutation (Gly93Ser in exon 1 of the VHL gene on chromosome 3 (p25 – p26 was shown in the patient, her father and her daughter confirming the diagnosis of VHL. Conclusion In almost all VHL families molecular genetic analysis of DNA will demonstrate an inherited mutation. Because of the involvement in several organs, periodic clinical evaluation should take place in a well coordinated, multidisciplinary setting. VHL disease can be classified into several subtypes. VHL type 2C patients present with pheochromocytomas without evidence of haemangioblastomas in the central nervous system and/or retina and a low risk of renal cell carcinoma. Therefore, in such families, periodic clinical screening can be focussed on pheochromocytomas.

  11. Familial pheochromocytoma associated with a novel mutation in the von Hippel-Lindau gene

    Energy Technology Data Exchange (ETDEWEB)

    Gross, D.J.; Avishai, N.; Meiner, V.; Abeliovich, D.; Filon, D. [Hadassah Univ. Hospital and the Hebrew Univ.-Hadassah Medical School, Jerusalem (Israel)] [and others

    1996-01-01

    We report a three generation, 25 member kindred with familial pheochromocytoma. Seven subjects of generations I and II had pheochromocytoma, in five of the seven, the tumors were bilateral, and in two of the seven, the tumors were both adrenal and extraadrenal. One patient also had a carotid body chemodectoma, and one patient had a malignant adrenal tumor and abdominal paraganglioma. In the patient with the chemodectoma, a cerebellar hemagioblastoma became manifest 25 yr after his initial diagnosis with pheochromocytoma, leading only then to a clinical diagnosis of von Hippel-Lindau disease (VHL). A mutational analysis of the VHL gene revealed a novel nucleotide 709 G{r_arrow}T transversion present in all affected subjects and in four presymptomatic children. In familial pheochromocytoma the diagnosis of VHL should be considered, even when the formal criteria for diagnosis of the syndrome are lacking. 16 refs., 2 figs.

  12. Playing Tag with HIF: The VHL Story

    Directory of Open Access Journals (Sweden)

    Sherri K. Leung

    2002-01-01

    Full Text Available Inactivation of the von Hippel-Lindau (VHL tumour suppressor gene product pVHL is the cause of inherited VHL disease and is associated with sporadic kidney cancer. pVHL is found in a multiprotein complex with elongins B/C, Cul2, and Rbx1 forming an E3 ubiquitin ligase complex called VEC. This modular enzyme targets the α subunits of hypoxia-inducible factor (HIF for ubiquitin-mediated destruction. Consequently, tumour cells lacking functional pVHL overproduce the products of HIF-target genes such as vascular endothelial growth factor (VEGF, which promotes angiogenesis. This likely accounts for the hypervascular nature of VHL-associated neoplasms. Although pVHL has been linked to the cell-cycle, differentiation, and the regulation of extracellular matrix assembly, microenvironment pH, and tissue invasiveness, this review will focus on the recent insights into the molecular mechanisms governing the E3 ubiquitin ligase function of VEC.

  13. Identification of the Lipodepsipeptide MDN-0066, a Novel Inhibitor of VHL/HIF Pathway Produced by a New Pseudomonas Species.

    Directory of Open Access Journals (Sweden)

    Bastien Cautain

    Full Text Available Throughout recent history, metabolites of microbial origin have had an extraordinary impact on the welfare of humanity. In fact, natural products have largely been--and still are--considered an exceedingly valuable platform for the discovery of new drugs against diverse pathologies. Such value is partly due to their higher complexity and chemical diversity as compared to those of synthetic and combinatorial compounds. Mutations in the Von Hippel-Lindau (vhl gene are responsible for VHL disease, congenital polycythemia, and are found in many sporadic tumor types. The primary cause of morbidity and mortality for these patients arises from progression of Renal Cell Carcinoma (RCC or end-stage renal disease. Inactivation of the Von Hippel-Lindau (vhl tumor suppressor gene arises in the majority of Renal Cell Carcinoma (RCC as well as in other types of cancer and is associated with a high degree of vascularization and poor prognosis. Loss of pVHL function thus represents a pathognomonic molecular defect for therapeutic exploitation. In this study, renal carcinoma cell lines with naturally occurring vhl mutations (RCC4 VA and their genetically matched wild-type vhl (RCC4 VHL counterparts were seeded onto 96-well plates and treated with a collection of 1,040 organic extracts obtained from 130 bacterial strains belonging to at least 25 genera of the phyla Actinobacteria, Firmicutes, Proteobacteria and Bacteroidetes. This strategy allowed us to identify several extracts obtained from bacterial strain F-278,770T, the type strain of the recently proposed new species Pseudomonas granadensis, showing biological activities not associated with previously known bioactive metabolites. The fractionation and structural elucidation of one of these extracts led to the discovery of a new lipodepsipeptide (MDN-0066 with specific toxicity in pVHL deficient cells that is not detectable in cells with pVHL expression rescue. This specific toxicity is associated with

  14. Identification of the Lipodepsipeptide MDN-0066, a Novel Inhibitor of VHL/HIF Pathway Produced by a New Pseudomonas Species.

    Science.gov (United States)

    Cautain, Bastien; de Pedro, Nuria; Schulz, Christian; Pascual, Javier; Sousa, Thiciana da S; Martin, Jesús; Pérez-Victoria, Ignacio; Asensio, Francisco; González, Ignacio; Bills, Gerald F; Reyes, Fernando; Genilloud, Olga; Vicente, Francisca

    2015-01-01

    Throughout recent history, metabolites of microbial origin have had an extraordinary impact on the welfare of humanity. In fact, natural products have largely been--and still are--considered an exceedingly valuable platform for the discovery of new drugs against diverse pathologies. Such value is partly due to their higher complexity and chemical diversity as compared to those of synthetic and combinatorial compounds. Mutations in the Von Hippel-Lindau (vhl) gene are responsible for VHL disease, congenital polycythemia, and are found in many sporadic tumor types. The primary cause of morbidity and mortality for these patients arises from progression of Renal Cell Carcinoma (RCC) or end-stage renal disease. Inactivation of the Von Hippel-Lindau (vhl) tumor suppressor gene arises in the majority of Renal Cell Carcinoma (RCC) as well as in other types of cancer and is associated with a high degree of vascularization and poor prognosis. Loss of pVHL function thus represents a pathognomonic molecular defect for therapeutic exploitation. In this study, renal carcinoma cell lines with naturally occurring vhl mutations (RCC4 VA) and their genetically matched wild-type vhl (RCC4 VHL) counterparts were seeded onto 96-well plates and treated with a collection of 1,040 organic extracts obtained from 130 bacterial strains belonging to at least 25 genera of the phyla Actinobacteria, Firmicutes, Proteobacteria and Bacteroidetes. This strategy allowed us to identify several extracts obtained from bacterial strain F-278,770T, the type strain of the recently proposed new species Pseudomonas granadensis, showing biological activities not associated with previously known bioactive metabolites. The fractionation and structural elucidation of one of these extracts led to the discovery of a new lipodepsipeptide (MDN-0066) with specific toxicity in pVHL deficient cells that is not detectable in cells with pVHL expression rescue. This specific toxicity is associated with apoptosis

  15. Duplication of the VHL and IRAK2 genes in a patient with mental retardation/multiple congenital anomalies, epilepsy and ectomorphic habitus.

    Science.gov (United States)

    Chabchoub, E; Michils, G; Vermeesch, J R; De Cock, P; Lagae, L; Fryns, J P

    2010-01-01

    Partial 3p duplications are very rare. Often they are reported in translocations involving other chromosomes, whereas deletions encompassing the VHL gene in 3p25.3 predispose to Van-Hippel Lindau syndrome. We report here a paternally-inherited microduplication of 3p25.3 detected by array comparative genomic hybridisation (aCGH) in a 17 year-old male patient presenting with mental retardation and multiple congenital anomalies (MR/MCA), epilepsy and ectomorphic habitus. He has no tumour and there is no history of familial cancer. We refined the duplication by Multiplex Ligation-dependent Probe Amplification (MLPA) to a 251 kb region encompassing the VHL and IRAK2 genes. The duplication is likely to be causal. Interestingly, duplication of IRAK2 can cause epilepsy. Disruption of the GHRL gene can explain the ectomorphic habitus. To our knowledge, this is the smallest 3p duplication encompassing the VHL region. Its prognosis is unknown and a long-term follow-up is essential for an early diagnosis of malignancy.

  16. Von Hippel-Lindau disease (vHL)

    DEFF Research Database (Denmark)

    Binderup, Marie Louise Mølgaard; Bisgaard, Søs Marie Luise; Harbud, Vibeke

    2013-01-01

    These clinical guidelines outline the criteria and recommendations for diagnostic and genetic work-up of families suspected of von Hippel-Lindau disease (vHL), as well as recommendations for prophylactic surveillance for vHL patients. The guideline has been composed by the Danish Coordination Group...... for vHL which is comprised of Danish doctors and specialists interested in vHL. The recommendations are based on longstanding clinical experience, Danish original research, and extensive review of the international literature. vHL is a hereditary multi-tumour disease caused by germline mutations...... cell carcinoma), the adrenal glands (pheochromocytoma), the pancreas, as well as in other organs. As many different organs can be affected, several medical specialities often take part in both diagnosis and treatment of manifestations. vHL should be suspected in individuals with a family history...

  17. PRRT2 gene mutations

    Science.gov (United States)

    Gardiner, Alice R.; Bhatia, Kailash P.; Stamelou, Maria; Dale, Russell C.; Kurian, Manju A.; Schneider, Susanne A.; Wali, G.M.; Counihan, Tim; Schapira, Anthony H.; Spacey, Sian D.; Valente, Enza-Maria; Silveira-Moriyama, Laura; Teive, Hélio A.G.; Raskin, Salmo; Sander, Josemir W.; Lees, Andrew; Warner, Tom; Kullmann, Dimitri M.; Wood, Nicholas W.; Hanna, Michael

    2012-01-01

    ABSTRACT Objective: The proline-rich transmembrane protein (PRRT2) gene was recently identified using exome sequencing as the cause of autosomal dominant paroxysmal kinesigenic dyskinesia (PKD) with or without infantile convulsions (IC) (PKD/IC syndrome). Episodic neurologic disorders, such as epilepsy, migraine, and paroxysmal movement disorders, often coexist and are thought to have a shared channel-related etiology. To investigate further the frequency, spectrum, and phenotype of PRRT2 mutations, we analyzed this gene in 3 large series of episodic neurologic disorders with PKD/IC, episodic ataxia (EA), and hemiplegic migraine (HM). Methods: The PRRT2 gene was sequenced in 58 family probands/sporadic individuals with PKD/IC, 182 with EA, 128 with HM, and 475 UK and 96 Asian controls. Results: PRRT2 genetic mutations were identified in 28 out of 58 individuals with PKD/IC (48%), 1/182 individuals with EA, and 1/128 individuals with HM. A number of loss-of-function and coding missense mutations were identified; the most common mutation found was the p.R217Pfs*8 insertion. Males were more frequently affected than females (ratio 52:32). There was a high proportion of PRRT2 mutations found in families and sporadic cases with PKD associated with migraine or HM (10 out of 28). One family had EA with HM and another large family had typical HM alone. Conclusions: This work expands the phenotype of mutations in the PRRT2 gene to include the frequent occurrence of migraine and HM with PKD/IC, and the association of mutations with EA and HM and with familial HM alone. We have also extended the PRRT2 mutation type and frequency in PKD and other episodic neurologic disorders. PMID:23077024

  18. Von Hippel-Lindau disease (vHL)

    DEFF Research Database (Denmark)

    Binderup, Marie Louise Mølgaard; Bisgaard, Søs Marie Luise; Harbud, Vibeke

    2013-01-01

    These clinical guidelines outline the criteria and recommendations for diagnostic and genetic work-up of families suspected of von Hippel-Lindau disease (vHL), as well as recommendations for prophylactic surveillance for vHL patients. The guideline has been composed by the Danish Coordination Group...... for vHL which is comprised of Danish doctors and specialists interested in vHL. The recommendations are based on longstanding clinical experience, Danish original research, and extensive review of the international literature. vHL is a hereditary multi-tumour disease caused by germline mutations...... of the disease, and/or in individuals with a vHL-associated manifestation; i.e. a hemangioblastoma in the retina or the central nervous system, familial or bilateral pheochromocytomas, familial, multiple, or early onset renal cell carcinomas, and in individuals with an endolymphatic sac tumour in the inner ear...

  19. LOSS OF JAK2 REGULATION VIA VHL-SOCS1 E3 UBIQUITIN HETEROCOMPLEX UNDERLIES CHUVASH POLYCYTHEMIA

    Science.gov (United States)

    Russell, Ryan C.; Sufan, Roxana I.; Zhou, Bing; Heir, Pardeep; Bunda, Severa; Sybingco, Stephanie S.; Greer, Samantha N.; Roche, Olga; Heathcote, Samuel A.; Chow, Vinca W.K.; Boba, Lukasz M.; Richmond, Terri D.; Hickey, Michele M.; Barber, Dwayne L.; Cheresh, David A.; Simon, M. Celeste; Irwin, Meredith S.; Kim, William Y.; Ohh, Michael

    2011-01-01

    SUMMARY Chuvash polycythemia (CP) is a rare congenital form of polycythemia caused by homozygous R200W and H191D mutations in the von Hippel-Lindau (VHL) gene whose gene product is the principal negative regulator of hypoxia-inducible factor. However, the molecular mechanisms underlying some of the hallmark features of CP such as hypersensitivity to erythropoietin are unclear. Here, we show that VHL directly binds suppressor of cytokine signalling 1 (SOCS1) to form a heterodimeric E3 ligase that targets phosphorylated (p)JAK2 for ubiquitin-mediated destruction. In contrast, CP-associated VHL mutants have altered affinity for SOCS1 and fail to engage and degrade pJAK2. Systemic administration of a highly selective JAK2 inhibitor, TG101209, reverses the disease phenotype in vhlR200W/R200W knock-in mice, a model that faithfully recapitulates human CP. These results reveal VHL as a SOCS1-cooperative negative regulator of JAK2 and provide compelling biochemical and preclinical evidence for JAK2- targeted therapy in CP patients. PMID:21685897

  20. Loss of JAK2 regulation via a heterodimeric VHL-SOCS1 E3 ubiquitin ligase underlies Chuvash polycythemia.

    Science.gov (United States)

    Russell, Ryan C; Sufan, Roxana I; Zhou, Bing; Heir, Pardeep; Bunda, Severa; Sybingco, Stephanie S; Greer, Samantha N; Roche, Olga; Heathcote, Samuel A; Chow, Vinca W K; Boba, Lukasz M; Richmond, Terri D; Hickey, Michele M; Barber, Dwayne L; Cheresh, David A; Simon, M Celeste; Irwin, Meredith S; Kim, William Y; Ohh, Michael

    2011-06-19

    Chuvash polycythemia is a rare congenital form of polycythemia caused by homozygous R200W and H191D mutations in the VHL (von Hippel-Lindau) gene, whose gene product is the principal negative regulator of hypoxia-inducible factor. However, the molecular mechanisms underlying some of the hallmark abnormalities of Chuvash polycythemia, such as hypersensitivity to erythropoietin, are unclear. Here we show that VHL directly binds suppressor of cytokine signaling 1 (SOCS1) to form a heterodimeric E3 ligase that targets phosphorylated JAK2 (pJAK2) for ubiquitin-mediated destruction. In contrast, Chuvash polycythemia-associated VHL mutants have altered affinity for SOCS1 and do not engage with and degrade pJAK2. Systemic administration of a highly selective JAK2 inhibitor, TG101209, reversed the disease phenotype in Vhl(R200W/R200W) knock-in mice, an experimental model that recapitulates human Chuvash polycythemia. These results show that VHL is a SOCS1-cooperative negative regulator of JAK2 and provide biochemical and preclinical support for JAK2-targeted therapy in individuals with Chuvash polycythemia.

  1. Role of VHL, HIF1A and SDH on the expression of miR-210: Implications for tumoral pseudo-hypoxic fate.

    Science.gov (United States)

    Merlo, Anna; Bernardo-Castiñeira, Cristóbal; Sáenz-de-Santa-María, Inés; Pitiot, Ana S; Balbín, Milagros; Astudillo, Aurora; Valdés, Nuria; Scola, Bartolomé; Del Toro, Raquel; Méndez-Ferrer, Simón; Piruat, José I; Suarez, Carlos; Chiara, María-Dolores

    2017-01-24

    The hypoxia-inducible factor 1α (HIF-1α) and its microRNA target, miR-210, are candidate tumor-drivers of metabolic reprogramming in cancer. Neuroendocrine neoplasms such as paragangliomas (PGLs) are particularly appealing for understanding the cancer metabolic adjustments because of their associations with deregulations of metabolic enzymes, such as succinate dehydrogenase (SDH), and the von Hippel Lindau (VHL) gene involved in HIF-1α stabilization. However, the role of miR-210 in the pathogenesis of SDH-related tumors remains an unmet challenge. Herein is described an in vivo genetic analysis of the role of VHL, HIF1A and SDH on miR-210 by using knockout murine models, siRNA gene silencing, and analyses of human tumors. HIF-1α knockout abolished hypoxia-induced miR-210 expression in vivo but did not alter its constitutive expression in paraganglia. Normoxic miR-210 levels substantially increased by complete, but not partial, VHL silencing in paraganglia of knockout VHL-mice and by over-expression of p76del-mutated pVHL. Similarly, VHL-mutated PGLs, not those with decreased VHL-gene/mRNA dosage, over-expressed miR-210 and accumulate HIF-1α in most tumor cells. Ablation of SDH activity in SDHD-null cell lines or reduction of the SDHD or SDHB protein levels elicited by siRNA-induced gene silencing did not induce miR-210 whereas the presence of SDH mutations in PGLs and tumor-derived cell lines was associated with mild increase of miR-210 and the presence of a heterogeneous, HIF-1α-positive and HIF-1α-negative, tumor cell population. Thus, activation of HIF-1α is likely an early event in VHL-defective PGLs directly linked to VHL mutations, but it is a late event favored but not directly triggered by SDHx mutations. This combined analysis provides insights into the mechanisms of HIF-1α/miR-210 regulation in normal and tumor tissues potentially useful for understanding the pathogenesis of cancer and other diseases sharing similar underpinnings.

  2. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  3. Difference in CXCR4 expression between sporadic and VHL-related hemangioblastoma

    NARCIS (Netherlands)

    Kruizinga, Roeliene C; van Marion, Denise M S; den Dunnen, Wilfred F A; de Groot, Jan C; Hoving, Eelco W; Oosting, Sjoukje F; Timmer-Bosscha, Hetty; Derks, Rosalie P H; Cornelissen, Chantal; van der Luijt, Rob B; Links, Thera P; de Vries, Elisabeth G E; Walenkamp, Annemiek M E

    2016-01-01

    Central nervous system hemangioblastomas occur sporadically and in patients with von Hippel-Lindau (VHL) disease due to a VHL germline mutation. This mutation leads to enhanced transcription of chemokine receptor 4 (CXCR4), its ligand (CXCL12) and vascular endothelial growth factor A (VEGFA). We

  4. Preimplantation genetic diagnosis of Von Hippel-Lindau disease cancer syndrome by combined mutation and segregation analysis

    Directory of Open Access Journals (Sweden)

    Denilce R. Sumita

    2007-03-01

    Full Text Available Von Hippel-Lindau (VHL disease is an autosomal dominant cancer syndrome, associated with the development of tumors and cysts in multiple organ systems, whose expression and age of onset are highly variable. The VHL disease tumor suppressor gene (VHL maps to 3p25-p26 and mutations ranging from a single base change to large deletions have been detected in patients with VHL disease. We developed a single cell PCR protocol for preimplantation genetic diagnosis (PGD of VHL disease to select unaffected embryos on the basis of the detection of the specific mutation and segregation analysis of polymorphic linked markers. Multiplex-nested PCR using single buccal cells of an affected individual were performed in order to test the accuracy and reliability of this single-cell protocol. For each locus tested, amplification efficiency was 83% to 87% and allelic drop-out rates ranged from 12% to 8%. Three VHL disease PGD cycles were performed on cells from a couple with paternal transmission of a 436delC mutation in exon 2 of the VHL gene, leading to the identification of three unaffected embryos. Independent of the mutation present, this general PGD protocol for the diagnosis of VHL disease can be used in families informative for either the D3S1038 or D3S1317 microsatellite markers.

  5. Chemokine receptor CXCR4 downregulated by von Hippel-Lindau tumour suppressor pVHL

    DEFF Research Database (Denmark)

    Staller, Peter; Sulitkova, Jitka; Lisztwan, Joanna

    2003-01-01

    Organ-specific metastasis is governed, in part, by interactions between chemokine receptors on cancer cells and matching chemokines in target organs. For example, malignant breast cancer cells express the chemokine receptor CXCR4 and commonly metastasize to organs that are an abundant source...... regulates CXCR4 expression owing to its capacity to target hypoxia-inducible factor (HIF) for degradation under normoxic conditions. This process is suppressed under hypoxic conditions, resulting in HIF-dependent CXCR4 activation. An analysis of clear cell renal carcinoma that manifests mutation of the VHL...... gene in most cases revealed an association of strong CXCR4 expression with poor tumour-specific survival. These results suggest a mechanism for CXCR4 activation during tumour cell evolution and imply that VHL inactivation acquired by incipient tumour cells early in tumorigenesis confers not only...

  6. Dicty_cDB: VHL444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available library) VHL444 (Link to dictyBase) - - - Contig-U15033-1 VHL444P (Link to Original site) VHL444F 595 VHL444Z...VHL444Z 674 VHL444P 1249 - - Show VHL444 Library VH (Link to library) Clone ID VHL444 (Link to dictyBase)...tsukuba.ac.jp/CSM/VH/VHL4-B/VHL444Q.Seq.d/ Representative seq. ID VHL444P (Link to Original site) Representative...Representative DNA sequence >VHL444 (VHL444Q) /CSM/VH/VHL4-B/VHL444Q.Seq.d/ CACTGTTGGCCTACTGGTATAGTTACA...significant alignments: (bits) Value VHL444 (VHL444Q) /CSM/VH/VHL4-B/VHL444Q.Seq.d/ 2420 0.0 VHN389 (VHN389Q)

  7. MUTATIONS IN THE VHL GENE FRIOM POTASSIUM BROMATE-INDUCED RAT CLEAR CELL RENAL TUMORS

    Science.gov (United States)

    Potassium bromate (KBrO3) is a rat renal carcinogen and a major drinking water disinfection by-product in water disinfected with ozone. Clear cell renal tumors, the most common form of human renal epithelial neoplasm, are rare in animals but are inducible by KBrO3 in F344 rats. ...

  8. Von Hippel-Lindau (VHL inactivation in sporadic clear cell renal cancer: associations with germline VHL polymorphisms and etiologic risk factors.

    Directory of Open Access Journals (Sweden)

    Lee E Moore

    2011-10-01

    Full Text Available Renal tumor heterogeneity studies have utilized the von Hippel-Lindau VHL gene to classify disease into molecularly defined subtypes to examine associations with etiologic risk factors and prognosis. The aim of this study was to provide a comprehensive analysis of VHL inactivation in clear cell renal tumors (ccRCC and to evaluate relationships between VHL inactivation subgroups with renal cancer risk factors and VHL germline single nucleotide polymorphisms (SNPs. VHL genetic and epigenetic inactivation was examined among 507 sporadic RCC/470 ccRCC cases using endonuclease scanning and using bisulfite treatment and Sanger sequencing across 11 CpG sites within the VHL promoter. Case-only multivariate analyses were conducted to identify associations between alteration subtypes and risk factors. VHL inactivation, either through sequence alterations or promoter methylation in tumor DNA, was observed among 86.6% of ccRCC cases. Germline VHL SNPs and a haplotype were associated with promoter hypermethylation in tumor tissue (OR = 6.10; 95% CI: 2.28-16.35, p = 3.76E-4, p-global = 8E-5. Risk of having genetic VHL inactivation was inversely associated with smoking due to a higher proportion of wild-type ccRCC tumors [former: OR = 0.70 (0.20-1.31 and current: OR = 0.56 (0.32-0.99; P-trend = 0.04]. Alteration prevalence did not differ by histopathologic characteristics or occupational exposure to trichloroethylene. ccRCC cases with particular VHL germline polymorphisms were more likely to have VHL inactivation through promoter hypermethylation than through sequence alterations in tumor DNA, suggesting that the presence of these SNPs may represent an example of facilitated epigenetic variation (an inherited propensity towards epigenetic variation in renal tissue. A proportion of tumors from current smokers lacked VHL alterations and may represent a biologically distinct clinical entity from inactivated cases.

  9. Gene mutations in hepatocellular adenomas

    DEFF Research Database (Denmark)

    Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

    2015-01-01

    is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

  10. Surveillance in von Hippel-Lindau disease (vHL)

    DEFF Research Database (Denmark)

    Poulsen, Marie Louise Mølgaard; Budtz-Jørgensen, E; Bisgaard, M L

    2010-01-01

    54 living vHL-mutation carriers, risks of intercurrent manifestations in-between surveillance examinations were determined and clinical consequences of surveillance findings evaluated. Current recommendations of annual ophthalmic and abdominal examinations corresponded to acceptably low intercurrent...... for the patient. Also, pre-symptomatic surveillance increased cumulative incidence of clinical vHL diagnosis from 46% to 72% and from 89% to 94% by age 30 and 50 years, respectively. The present results promote optimization of surveillance, expectantly improving clinical vHL outcomes....

  11. MO-DE-207B-05: Predicting Gene Mutations in Renal Cell Carcinoma Based On CT Imaging Features: Validation Using TCGA-TCIA Datasets

    Energy Technology Data Exchange (ETDEWEB)

    Chen, X; Zhou, Z; Thomas, K; Wang, J [UT Southwestern Medical Center, Dallas, TX (United States)

    2016-06-15

    Purpose: The goal of this work is to investigate the use of contrast enhanced computed tomographic (CT) features for the prediction of mutations of BAP1, PBRM1, and VHL genes in renal cell carcinoma (RCC). Methods: For this study, we used two patient databases with renal cell carcinoma (RCC). The first one consisted of 33 patients from our institution (UT Southwestern Medical Center, UTSW). The second one consisted of 24 patients from the Cancer Imaging Archive (TCIA), where each patient is connected by a unique identi?er to the tissue samples from the Cancer Genome Atlas (TCGA). From the contrast enhanced CT image of each patient, tumor contour was first delineated by a physician. Geometry, intensity, and texture features were extracted from the delineated tumor. Based on UTSW dataset, we completed feature selection and trained a support vector machine (SVM) classifier to predict mutations of BAP1, PBRM1 and VHL genes. We then used TCIA-TCGA dataset to validate the predictive model build upon UTSW dataset. Results: The prediction accuracy of gene expression of TCIA-TCGA patients was 0.83 (20 of 24), 0.83 (20 of 24), and 0.75 (18 of 24) for BAP1, PBRM1, and VHL respectively. For BAP1 gene, texture feature was the most prominent feature type. For PBRM1 gene, intensity feature was the most prominent. For VHL gene, geometry, intensity, and texture features were all important. Conclusion: Using our feature selection strategy and models, we achieved predictive accuracy over 0.75 for all three genes under the condition of using patient data from one institution for training and data from other institutions for testing. These results suggest that radiogenomics can be used to aid in prognosis and used as convenient surrogates for expensive and time consuming gene assay procedures.

  12. Hypoxia-inducible factor-2α stabilizes the von Hippel-Lindau (VHL) disease suppressor, Myb-related protein 2.

    Science.gov (United States)

    Okumura, Fumihiko; Joo-Okumura, Akiko; Nakatsukasa, Kunio; Kamura, Takumi

    2017-01-01

    Ubiquitin ligase von Hippel-Lindau tumor suppressor (pVHL) negatively regulates protein levels of hypoxia-inducible factor-α (HIF-α). Loss of pVHL causes HIF-α accumulation, which contributes to the pathogenesis of von Hippel-Lindau (VHL) disease. In contrast, v-Myb avian myeloblastosis viral oncogene homolog-like 2 (MYBL2; B-Myb), a transcription factor, prevents VHL pathogenesis by regulating gene expression of HIF-independent pathways. Both HIF-α and B-Myb are targets of pVHL-mediated polyubiquitination and proteasomal degradation. Here, we show that knockdown of HIF-2α induces downregulation of B-Myb in 786-O cells, which are deficient in pVHL, and this downregulation is prevented by proteasome inhibition. In the presence of pVHL and under hypoxia-like conditions, B-Myb and HIF-2α are both upregulated, and the upregulation of B-Myb requires expression of HIF-2α. We also show that HIF-2α and B-Myb interact in the nucleus, and this interaction is mediated by the central region of HIF-2α and the C-terminal region of B-Myb. These data indicate that oncogenic HIF-2α stabilizes B-Myb to suppress VHL pathogenesis.

  13. Dicty_cDB: VHL663 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHL663 (Link to dictyBase) - - - Contig-U15767-1 VHL663P (Link... to Original site) VHL663F 574 VHL663Z 702 VHL663P 1256 - - Show VHL663 Library VH (Link to library) Clone ID VHL663 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15767-1 Original site URL http://dict...WPDGFKYFFVDNQAGDSESAKSGKNLPIQRDIELNWNGEAYEYSNSNYFPINGQG FNDVSYPV--- ---SYATGKCEPDSSLCNDNNICTIDICVHEGILDGLPQG...ik rqelvgqmvlsifl*itklviqnlpnlvkifqfkeiss*igmekhmniviqitsqltdkv smm*aiq--- ---SYATGKCEPDSSLCNDNNICTIDICVHEGI

  14. Dicty_cDB: VHL434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHL434 (Link to dictyBase) - - - Contig-U16336-1 VHL434P (Link... to Original site) VHL434F 546 VHL434Z 778 VHL434P 1304 - - Show VHL434 Library VH (Link to library) Clone ID VHL434 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16336-1 Original site URL http://dict...EVMSCNKFSSKRIGYLAASQSFNEGTDVIVLATHQIRKDFLS SNQSEAYLALNCLSNICTTDLARELANDILTLLSTQKTHILKRAITVLYKIFLRYPES-- - --...GFDISWASFKIVEVMSCNKFSSKRIGYLAASQSFNEGTDVIVLATHQIRKDFLS SNQSEAYLALNCLSNICTTDLARELANDILTLLSTQKTHILKRAITVLYKIFL

  15. Von Hippel-Lindau disease (vHL)

    DEFF Research Database (Denmark)

    Binderup, Marie Louise Mølgaard; Bisgaard, Søs Marie Luise; Harbud, Vibeke

    2013-01-01

    in the VHL gene. vHL is inherited in an autosomal dominant manner. Predisposed individuals are advised to undergo prophylactic examinations, as they are at lifelong risk of developing multiple cysts and tumours, especially in the cerebellum, the spinal cord, the retina (hemangioblastomas), the kidneys (renal...... are recommended to start in infancy with annual paediatric examinations and ophthalmoscopy until the age of five years. From five to 14 years, annual plasma-metanephrine and plasma-normetanephrine tests, as well as annual hearing examinations are added. Also, an MRI (Magnetic Resonance Imaging) examination....../MRI of the abdomen, e) annual plasma-metanephrine, plasma-normetanephrine, and plasma-chromogranin A tests, and f) annual hearing examination at a department of audiology. It is advised that one doctor takes on the responsibility of coordination of and referral to the many examinations, and the communication...

  16. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  17. Wide spetcrum mutational analysis of metastatic renal cell cancer: a retrospective next generation sequencing approach

    Science.gov (United States)

    Fiorentino, Michelangelo; Gruppioni, Elisa; Massari, Francesco; Giunchi, Francesca; Altimari, Annalisa; Ciccarese, Chiara; Bimbatti, Davide; Scarpa, Aldo; Iacovelli, Roberto; Porta, Camillo; Virinder, Sarhadi; Tortora, Giampaolo; Artibani, Walter; Schiavina, Riccardo; Ardizzoni, Andrea; Brunelli, Matteo; Knuutila, Sakari; Martignoni, Guido

    2017-01-01

    Renal cell cancer (RCC) is characterized by histological and molecular heterogeneity that may account for variable response to targeted therapies. We evaluated retrospectively with a next generation sequencing (NGS) approach using a pre-designed cancer panel the mutation burden of 32 lesions from 22 metastatic RCC patients treated with at least one tyrosine kinase or mTOR inhibitor. We identified mutations in the VHL, PTEN, JAK3, MET, ERBB4, APC, CDKN2A, FGFR3, EGFR, RB1, TP53 genes. Somatic alterations were correlated with response to therapy. Most mutations hit VHL1 (31,8%) followed by PTEN (13,6%), JAK3, FGFR and TP53 (9% each). Eight (36%) patients were wild-type at least for the genes included in the panel. A genotype concordance between primary RCC and its secondary lesion was found in 3/6 cases. Patients were treated with Sorafenib, Sunitinib and Temsirolimus with partial responses in 4 (18,2%) and disease stabilization in 7 (31,8%). Among the 4 partial responders, 1 (25%) was wild-type and 3 (75%) harbored different VHL1 variants. Among the 7 patients with disease stabilization 2 (29%) were wild-type, 2 (29%) PTEN mutated, and single patients (14% each) displayed mutations in VHL1, JAK3 and APC/CDKN2A. Among the 11 non-responders 7 (64%) were wild-type, 2 (18%) were p53 mutated and 2 (18%) VHL1 mutated. No significant associations were found among RCC histotype, mutation variants and response to therapies. In the absence of predictive biomarkers for metastatic RCC treatment, a NGS approach may address single patients to basket clinical trials according to actionable molecular specific alterations. PMID:27741505

  18. From Gene Mutation to Protein Characterization

    Science.gov (United States)

    Moffet, David A.

    2009-01-01

    A seven-week "gene to protein" laboratory sequence is described for an undergraduate biochemistry laboratory course. Student pairs were given the task of introducing a point mutation of their choosing into the well studied protein, enhanced green fluorescent protein (EGFP). After conducting literature searches, each student group chose the…

  19. Development of synchronous VHL syndrome tumors reveals contingencies and constraints to tumor evolution

    DEFF Research Database (Denmark)

    Fisher, Rosalie; Horswell, Stuart; Rowan, Andrew

    2014-01-01

    with a germline VHL mutation. We report that tumors arising in this context are clonally independent and harbour distinct secondary events exemplified by loss of chromosome 3p, despite an identical genetic background and tissue microenvironment. We propose that divergent mutational and copy number anomalies......Background : Genomic analysis of multi-focal renal cell carcinomas from an individual with a germline VHL mutation offers a unique opportunity to study tumor evolution. Results : We perform whole exome sequencing on four clear cell renal cell carcinomas removed from both kidneys of a patient...... are contingent upon the nature of 3p loss of heterozygosity occurring early in tumorigenesis. However, despite distinct 3p events, genomic, proteomic and immunohistochemical analyses reveal evidence for convergence upon the PI3K-AKT-mTOR signaling pathway. Four germline tumors in this young patient...

  20. Gene Mutation in Neonatal Jaundice - Mutations in UGT1A1 and OATP2 Genes.

    Science.gov (United States)

    Min, Jiang; Jie, Luo; Caiyun, Yang; Ying, Lin; Xuefang, Yang

    2016-07-01

    This study evaluated the correlation of UGT1A1, OATP2 gene mutations and hyperbilirubinemia in newborns in Northern China. Gene mutations were analyzed at the 211 locus of UGT1A1 (Gly71Arg) and 388 locus of OATP2 (Asn130Asp). The 226 enrolled infants were divided into high, moderate, and low risk subgroups according to American Academy of Pediatrics guideline. Blood samples of the enrolled infants were collected for the analysis of the PCR-restriction fragment length polymorphism. The genotypes and allele frequencies of the polymorphisms were compared in each group. Both UGT1A1 and OATP2 gene mutations occur more often in high risk group and moderate risk group than in low risk group. The results suggested that Gly71Arg and Asn130Asp mutations in UGT1A1 and OATP2 genes might be involved in the development of hyperbilirubinemia in neonates.

  1. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  2. Childhood Cancer Radiation May Cause Unwanted Gene Mutation in Some

    Science.gov (United States)

    ... 167614.html Childhood Cancer Radiation May Cause Unwanted Gene Mutation in Some That flaw seems to increase risk ... and now researchers say they've found a gene mutation that seems to increase that risk. The researchers ...

  3. Mutation scanning of peach floral genes

    Directory of Open Access Journals (Sweden)

    Wilde H Dayton

    2011-05-01

    Full Text Available Abstract Background Mutation scanning technology has been used to develop crop species with improved traits. Modifications that improve screening throughput and sensitivity would facilitate the targeted mutation breeding of crops. Technical innovations for high-resolution melting (HRM analysis are enabling the clinic-based screening for human disease gene polymorphism. We examined the application of two HRM modifications, COLD-PCR and QMC-PCR, to the mutation scanning of genes in peach, Prunus persica. The targeted genes were the putative floral regulators PpAGAMOUS and PpTERMINAL FLOWER I. Results HRM analysis of PpAG and PpTFL1 coding regions in 36 peach cultivars found one polymorphic site in each gene. PpTFL1 and PpAG SNPs were used to examine approaches to increase HRM throughput. Cultivars with SNPs could be reliably detected in pools of twelve genotypes. COLD-PCR was found to increase the sensitivity of HRM analysis of pooled samples, but worked best with small amplicons. Examination of QMC-PCR demonstrated that primary PCR products for further analysis could be produced from variable levels of genomic DNA. Conclusions Natural SNPs in exons of target peach genes were discovered by HRM analysis of cultivars from a southeastern US breeding program. For detecting natural or induced SNPs in larger populations, HRM efficiency can be improved by increasing sample pooling and template production through approaches such as COLD-PCR and QMC-PCR. Technical advances developed to improve clinical diagnostics can play a role in the targeted mutation breeding of crops.

  4. The Androgen Receptor Gene Mutations Database.

    Science.gov (United States)

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  5. The Androgen Receptor Gene Mutations Database.

    Science.gov (United States)

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). PMID:9399843

  6. VHL loss in renal cell carcinoma leads to up-regulation of CUB domain-containing protein 1 to stimulate PKC{delta}-driven migration.

    Science.gov (United States)

    Razorenova, Olga V; Finger, Elizabeth C; Colavitti, Renata; Chernikova, Sophia B; Boiko, Alexander D; Chan, Charles K F; Krieg, Adam; Bedogni, Barbara; LaGory, Edward; Weissman, Irving L; Broome-Powell, Marianne; Giaccia, Amato J

    2011-02-01

    A common genetic mutation found in clear cell renal cell carcinoma (CC-RCC) is the loss of the von Hippel-Lindau (VHL) gene, which results in stabilization of hypoxia-inducible factors (HIFs), and contributes to cancer progression and metastasis. CUB-domain-containing protein 1 (CDCP1) was shown to promote metastasis in scirrhous and lung adenocarcinomas as well as in prostate cancer. In this study, we established a molecular mechanism linking VHL loss to induction of the CDCP1 gene through the HIF-1/2 pathway in renal cancer. Also, we report that Fyn, which forms a complex with CDCP1 and mediates its signaling to PKCδ, is a HIF-1 target gene. Mechanistically, we found that CDCP1 specifically regulates phosphorylation of PKCδ, but not of focal adhesion kinase or Crk-associated substrate. Signal transduction from CDCP1 to PKCδ leads to its activation, increasing migration of CC-RCC. Furthermore, patient survival can be stratified by CDCP1 expression at the cell surface of the tumor. Taken together, our data indicates that CDCP1 protein might serve as a therapeutic target for CC-RCC.

  7. Parallel Regulation of von Hippel-Lindau Disease by pVHL-Mediated Degradation of B-Myb and Hypoxia-Inducible Factor α

    Science.gov (United States)

    Uematsu, Keiji; Byrne, Stuart D.; Hirano, Mie; Joo-Okumura, Akiko; Nishikimi, Akihiko; Shuin, Taro; Fukui, Yoshinori; Nakatsukasa, Kunio

    2016-01-01

    pVHL, the protein product of the von Hippel-Lindau (VHL) tumor suppressor gene, is a ubiquitin ligase that targets hypoxia-inducible factor α (HIF-α) for proteasomal degradation. Although HIF-α activation is necessary for VHL disease pathogenesis, constitutive activation of HIF-α alone did not induce renal clear cell carcinomas and pheochromocytomas in mice, suggesting the involvement of an HIF-α-independent pathway in VHL pathogenesis. Here, we show that the transcription factor B-Myb is a pVHL substrate that is degraded via the ubiquitin-proteasome pathway and that vascular endothelial growth factor (VEGF)- and/or platelet-derived growth factor (PDGF)-dependent tyrosine 15 phosphorylation of B-Myb prevents its degradation. Mice injected with B-Myb knockdown 786-O cells developed dramatically larger tumors than those bearing control cell tumors. Microarray screening of B-Myb-regulated genes showed that the expression of HIF-α-dependent genes was not affected by B-Myb knockdown, indicating that B-Myb prevents HIF-α-dependent tumorigenesis through an HIF-α-independent pathway. These data indicate that the regulation of B-Myb by pVHL plays a critical role in VHL disease. PMID:27090638

  8. Towards linked open gene mutations data

    Science.gov (United States)

    2012-01-01

    Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives

  9. Hereditary sideroblastic anemia: pathophysiology and gene mutations.

    Science.gov (United States)

    Harigae, Hideo; Furuyama, Kazumichi

    2010-10-01

    Sideroblastic anemia is characterized by anemia with the emergence of ring sideroblasts in the bone marrow. Ring sideroblasts are erythroblasts characterized by iron accumulation in perinuclear mitochondria due to impaired iron utilization. There are two forms of sideroblastic anemia, i.e., inherited and acquired sideroblastic anemia. Inherited sideroblastic anemia is a rare and heterogeneous disease caused by mutations of genes involved in heme biosynthesis, iron-sulfur (Fe-S) cluster biogenesis, or Fe-S cluster transport, and mitochondrial metabolism. The most common inherited sideroblastic anemia is X-linked sideroblastic anemia (XLSA) caused by mutations of the erythroid-specific δ-aminolevulinate synthase gene (ALAS2), which is the first enzyme of heme biosynthesis in erythroid cells. Sideroblastic anemia due to SLC25A38 gene mutations, which is a mitochondrial transporter, is the next most common inherited sideroblastic anemia. Other forms of inherited sideroblastic anemia are very rare, and accompanied by impaired function of organs other than hematopoietic tissue, such as the nervous system, muscle, or exocrine glands due to impaired mitochondrial metabolism. Moreover, there are still significant numbers of cases with genetically undefined inherited sideroblastic anemia. Molecular analysis of these cases will contribute not only to the development of effective treatment, but also to the understanding of mitochondrial iron metabolism.

  10. Homology modeling and molecular dynamics simulation of the HIF2α degradation-related HIF2α-VHL complex.

    Science.gov (United States)

    Dong, Xiaotian; Su, Xiaoru; Yu, Jiong; Liu, Jingqi; Shi, Xiaowei; Pan, Qiaoling; Yang, Jinfeng; Chen, Jiajia; Li, Lanjuan; Cao, Hongcui

    2017-01-01

    Hypoxia-inducible factor 2 alpha (HIF2α), prolyl hydroxylase domain protein 2 (PHD2), and the von Hippel Lindau tumor suppressor protein (pVHL) are three principal proteins in the oxygen-sensing pathway. Under normoxic conditions, a conserved proline in HIF2α is hydroxylated by PHD2 in an oxygen-dependent manner, and then pVHL binds and promotes the degradation of HIF2α. However, the crystal structure of the HIF2α-pVHL complex has not yet been established, and this has limited research on the interaction between HIF and pVHL. Here, we constructed a structural model of a 23-residue HIF2α peptide (528-550)-pVHL-ElonginB-ElonginC complex by using homology modeling and molecular dynamics simulations. We also applied these methods to HIF2α mutants (HYP531PRO, F540L, A530 V, A530T, and G537R) to reveal structural defects that explain how these mutations weaken the interaction with pVHL. Homology modeling and molecular dynamics simulations were used to construct a three-dimensional (3D) structural model of the HIF2α-VHL complex. Subsequently, MolProbity, an active validation tool, was used to analyze the reliability of the model. Molecular mechanics energies combined with the generalized Born and surface area continuum solvation (MM-GBSA) and solvated interaction energy (SIE) methods were used to calculate the binding free energy between HIF2a and pVHL, and the stability of the simulation system was evaluated by using root mean square deviation (RMSD) analysis. We also determined the secondary structure of the system by using the definition of secondary structure of proteins (DSSP) algorithm. Finally, we investigated the structural significance of specific point mutations known to have clinical implications. We established a reliable structural model of the HIF2α-pVHL complex, which is similar to the crystal structure of HIF1α in 1LQB. Furthermore, we compared the structural model of the HIF2α-pVHL complex and the HIF2α (HYP531P, F540L, A530V, A530T, and G537

  11. Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    LYU Tingxia

    2016-08-01

    Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

  12. Splice Site Mutations in the ATP7A Gene

    DEFF Research Database (Denmark)

    Skjørringe, Tina; Tümer, Zeynep; Møller, Lisbeth Birk

    2011-01-01

    Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12...... mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation...

  13. Alcohol consumption and mutations or promoter hypermethylation of the von Hippel-Lindau gene in renal cell carcinoma.

    NARCIS (Netherlands)

    Schouten, L.J.; Dijk, B.A.C. van; Oosterwijk, E.; Engeland, M. van; Hulsbergen- van de Kaa, C.A.; Kiemeney, L.A.L.M.; Goldbohm, R.A.; Kester, A.; Vogel, S de; Schalken, J.A.; Brandt, P.A. van den

    2008-01-01

    Alcohol consumption has been associated with a decreased risk for renal cell cancer in several studies. We investigated whether alcohol is associated with (epi)genetic changes of the von Hippel-Lindau (VHL) gene in renal cell cancer. The Netherlands Cohort Study (NLCS) on Diet and Cancer started in

  14. Alcohol consumption and mutations or promoter hypermethylation of the von Hippel-Lindau gene in renal cell carcinoma

    NARCIS (Netherlands)

    Schouten, L.J.; Dijk, B.A.C.van; Oosterwijk, E.; Engeland, M. van; Hulsbergen - Kaa, C.A. van de; Kiemeney, L.A.L.M.; Goldbohm, R.A.; Kester, A.; Vogel, S. de; Schalken, J.A.; Brandt, P.A. van den

    2008-01-01

    Alcohol consumption has been associated with a decreased risk for renal cell cancer in several studies. We investigated whether alcohol is associated with (epi)genetic changes of the von Hippel-Lindau (VHL) gene in renal cell cancer. The Netherlands Cohort Study (NLCS) on Diet and Cancer started in

  15. Weaver gene 3'UTR novel mutations: Associations with production ...

    African Journals Online (AJOL)

    Weaver gene 3'UTR novel mutations: Associations with production traits and milk composition in dairy goat. ... African Journal of Biotechnology ... Our recent report on a parallel increase in the milk yield of weaver gene mutation suggests that weaver gene is a candidate marker for quantitative traits in farm animals with ...

  16. Characterization of a splice-site mutation in the tumor suppressor gene FLCN associated with renal cancer.

    Science.gov (United States)

    Bartram, Malte P; Mishra, Tripti; Reintjes, Nadine; Fabretti, Francesca; Gharbi, Hakam; Adam, Alexander C; Göbel, Heike; Franke, Mareike; Schermer, Bernhard; Haneder, Stefan; Benzing, Thomas; Beck, Bodo B; Müller, Roman-Ulrich

    2017-05-12

    Renal cell carcinoma is among the most prevalent malignancies. It is generally sporadic. However, genetic studies of rare familial forms have led to the identification of mutations in causative genes such as VHL and FLCN. Mutations in the FLCN gene are the cause of Birt-Hogg-Dubé syndrome, a rare tumor syndrome which is characterized by the combination of renal cell carcinoma, pneumothorax and skin tumors. Using Sanger sequencing we identify a heterozygous splice-site mutation in FLCN in lymphocyte DNA of a patient suffering from renal cell carcinoma. Furthermore, both tumor DNA and DNA from a metastasis are analyzed regarding this mutation. The pathogenic effect of the sequence alteration is confirmed by minigene assays and the biochemical consequences on the protein are examined using TALEN-mediated transgenesis in cultured cells. Here we describe an FLCN mutation in a 55-year-old patient who presented himself with progressive weight loss, bilateral kidney cysts and renal tumors. He and members of his family had a history of recurrent pneumothorax during the last few decades. Histology after tumor nephrectomy showed a mixed kidney cancer consisting of elements of a chromophobe renal cell carcinoma and dedifferentiated small cell carcinoma component. Subsequent FLCN sequencing identified an intronic c.1177-5_-3delCTC alteration that most likely affected the correct splicing of exon 11 of the FLCN gene. We demonstrate skipping of exon 11 to be the consequence of this mutation leading to a shift in the reading frame and the insertion of a premature stop codon. Interestingly, the truncated protein was still expressed both in cell culture and in tumor tissue, though it was strongly destabilized and its subcellular localization differed from wild-type FLCN. Both, altered protein stability and subcellular localization could be partly reversed by blocking proteasomal and lysosomal degradation. Identification of disease-causing mutations in BHD syndrome requires the

  17. Potential value of EUS in pancreatic surveillance of VHL patients

    NARCIS (Netherlands)

    van Asselt, Sophie Josephien; Brouwers, Adrienne H; van Dullemen, Hendrik M; van der Jagt, Eric J; Bongaerts, Alfons H; Koopmans, Klaas P; Kema, Ido; Zonnenberg, Bernard A; Timmers, Henri Jlm; de Herder, Wouter; Sluiter, Wim; de Vries, Elisabeth G E; Links, T P

    Background: Patients with von Hippel-Lindau (VHL) disease are prone to develop pancreatic neuroendocrine tumors (pNETs). However, the best imaging technique for early detection of pNETs in VHL is currently unknown. In a head-to-head comparison, we evaluated endoscopic ultrasound (EUS) and

  18. Mutation analysis of the gene involved in adrenoleukodystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Oost, B.A. van; Ligtenberg, M.J.L. [Univ. Hospital Nijmegen (Netherlands); Kemp, S.; Bolhuis, P.A. [Academic Medical Center, Amsterdam (Netherlands)

    1994-09-01

    A gene responsible for the X-linked genetic disorder adrenoleukodystrophy (ALD) that is characterized by demyelination of the nervous system and adrenocortical insufficiency has been identified by positional cloning. The gene encodes an ATP-binding transporter which is located in the peroxisomal membrane. Deficiency of the gene leads to accumulation of unsaturated very long chain fatty acids due to impaired peroxisomal {beta}-oxidation. A systematic analysis of the open reading frame of the ALD gene unraveled the mutations in 28 different families using reverse transcriptase-PCR followed by direct sequencing. No entire gene deletions or drastic promoter mutations have been detected. Only in one family did the mutation involved multiple exons. The remaining mutations were subtle alterations leading to missense (about 50%) or nonsense mutations, frameshifts or splice acceptor site defects. In one patient a single codon was missing. Mutations affecting a single amino acid were concentrated in the region between the third and fourth putative membrane spanning fragments and in the ATP-binding domain. This overview of mutations aids in the determination of structural and functional important regions and facilitates the screening for mutations in other ALD patients. The detection of mutations in virtually all ALD families tested indicates that the isolated gene is the only gene responsible for ALD located in Xq28.

  19. Usefulness of negative and weak-diffuse pattern of SDHB immunostaining in assessment of SDH mutations in paragangliomas and pheochromocytomas.

    Science.gov (United States)

    Castelblanco, Esmeralda; Santacana, Maria; Valls, Joan; de Cubas, Aguirre; Cascón, Alberto; Robledo, Mercedes; Matias-Guiu, Xavier

    2013-12-01

    This is a confirmatory study about usefulness of SDHB and SDHA immunostaining in assessment of SDH mutations in paragangliomas and pheochromocytomas. Paraganglioma/pheochromocytoma syndrome (PGL/PCC syndrome) consists of different entities, associated with germline mutations in five different genes: SDHD, SDHAF2, SDHC, SDHA and SDHB. It has been suggested that negative immunostaining of SDHB can be taken as an indicator of the presence of a mutation in one of the five SDH genes. We have performed SDHB and SDHA immunohistochemical staining in a series of paragangliomas and pheochromocytomas from 64 patients. The patients had been previously checked for mutations in SDHD, SDHC and SDHB, but also for mutation in RET and VHL. All 14 patients with SDH mutations (9 with SDHB and 5 with SDHD mutations) exhibited negative or weak-diffuse SDHB staining pattern in tumour tissue, whereas cells of the 23 RET mutated and 8 VHL mutated tumours showed a positive SDHB immunostaining. Sixteen of the patients that did not exhibit a mutation in any gene showed positive SDHB immunostaining in tumour tissue, while only three of the patients without mutation exhibited negative staining. All patients exhibited positive pattern of SDHA immunostaining. The results confirm the value of SDHB immunohistochemical status in assessment of germline mutations in PGL/PCC syndrome.

  20. DNA mutation motifs in the genes associated with inherited diseases.

    Science.gov (United States)

    Růžička, Michal; Kulhánek, Petr; Radová, Lenka; Čechová, Andrea; Špačková, Naďa; Fajkusová, Lenka; Réblová, Kamila

    2017-01-01

    Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs) rarely associated with mutations (coldspots) and frequently associated with mutations (hotspots) exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  1. Mutations in the AGXT2L2 gene cause phosphohydroxylysinuria

    NARCIS (Netherlands)

    Veiga-da-Cunha, Maria; Verhoeven-Duif, Nanda M; de Koning, Tom J; Duran, Marinus; Dorland, Bert; Van Schaftingen, Emile

    2013-01-01

    Phosphohydroxylysinuria has been described in two patients with neurological symptoms, but the deficient enzyme or mutated gene has never been identified. In the present work, we tested the hypothesis that this condition is due to mutations in the AGXT2L2 gene, recently shown to encode

  2. Hypertrophic cardiomyopathy clinical phenotype is independent of gene mutation and mutation dosage.

    Science.gov (United States)

    Viswanathan, Shiv Kumar; Sanders, Heather K; McNamara, James W; Jagadeesan, Aravindakshan; Jahangir, Arshad; Tajik, A Jamil; Sadayappan, Sakthivel

    2017-01-01

    Over 1,500 gene mutations are known to cause hypertrophic cardiomyopathy (HCM). Previous studies suggest that cardiac β-myosin heavy chain (MYH7) gene mutations are commonly associated with a more severe phenotype, compared to cardiac myosin binding protein-C (MYBPC3) gene mutations with milder phenotype, incomplete penetrance and later age of onset. Compound mutations can worsen the phenotype. This study aimed to validate these comparative differences in a large cohort of individuals and families with HCM. We performed genome-phenome correlation among 80 symptomatic HCM patients, 35 asymptomatic carriers and 35 non-carriers, using an 18-gene clinical diagnostic HCM panel. A total of 125 mutations were identified in 14 genes. MYBPC3 and MYH7 mutations contributed to 50.0% and 24.4% of the HCM patients, respectively, suggesting that MYBPC3 mutations were the most frequent cause of HCM in our cohort. Double mutations were found in only nine HCM patients (7.8%) who were phenotypically indistinguishable from single-mutation carriers. Comparisons of clinical parameters of MYBPC3 and MYH7 mutants were not statistically significant, but asymptomatic carriers had high left ventricular ejection fraction and diastolic dysfunction when compared to non-carriers. The presence of double mutations increases the risk for symptomatic HCM with no change in severity, as determined in this study subset. The pathologic effects of MYBPC3 and MYH7 were found to be independent of gene mutation location. Furthermore, HCM pathology is independent of protein domain disruption in both MYBPC3 and MYH7. These data provide evidence that MYBPC3 mutations constitute the preeminent cause of HCM and that they are phenotypically indistinguishable from HCM caused by MYH7 mutations.

  3. Crystal Structure of the Cul2-Rbx1-EloBC-VHL Ubiquitin Ligase Complex.

    Science.gov (United States)

    Cardote, Teresa A F; Gadd, Morgan S; Ciulli, Alessio

    2017-06-06

    Cullin RING E3 ubiquitin ligases (CRLs) function in the ubiquitin proteasome system to catalyze the transfer of ubiquitin from E2 conjugating enzymes to specific substrate proteins. CRLs are large dynamic complexes and attractive drug targets for the development of small-molecule inhibitors and chemical inducers of protein degradation. The atomic details of whole CRL assembly and interactions that dictate subunit specificity remain elusive. Here we present the crystal structure of a pentameric CRL2VHL complex, composed of Cul2, Rbx1, Elongin B, Elongin C, and pVHL. The structure traps a closed state of full-length Cul2 and a new pose of Rbx1 in a trajectory from closed to open conformation. We characterize hotspots and binding thermodynamics at the interface between Cul2 and pVHL-EloBC and identify mutations that contribute toward a selectivity switch for Cul2 versus Cul5 recognition. Our findings provide structural and biophysical insights into the whole Cul2 complex that could aid future drug targeting. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  4. Three new BLM gene mutations associated with Bloom syndrome.

    Science.gov (United States)

    Amor-Guéret, Mounira; Dubois-d'Enghien, Catherine; Laugé, Anthony; Onclercq-Delic, Rosine; Barakat, Abdelhamid; Chadli, Elbekkay; Bousfiha, Ahmed Aziz; Benjelloun, Meriem; Flori, Elisabeth; Doray, Bérénice; Laugel, Vincent; Lourenço, Maria Teresa; Gonçalves, Rui; Sousa, Silvia; Couturier, Jérôme; Stoppa-Lyonnet, Dominique

    2008-06-01

    Bloom's syndrome (BS) is a rare autosomal recessive disease predisposing patients to all types of cancers affecting the general population. BS cells display a high level of genetic instability, including a 10-fold increase in the rate of sister chromatid exchanges, currently the only objective criterion for BS diagnosis. We have developed a method for screening the BLM gene for mutations based on direct genomic DNA sequencing. A questionnaire based on clinical information, cytogenetic features, and family history was addressed to physicians prescribing BS genetic screening, with the aim of confirming or guiding diagnosis. We report here four BLM gene mutations, three of which have not been described before. Three of the mutations are frameshift mutations, and the fourth is a nonsense mutation. All these mutations introduce a stop codon, and may therefore be considered to have deleterious biological effect. This approach should make it possible to identify new mutations and to correlate them with clinical information.

  5. Weaver gene 3'UTR novel mutations: Associations with production ...

    African Journals Online (AJOL)

    use

    2011-11-21

    Nov 21, 2011 ... Our recent report on a parallel increase in the milk yield of weaver gene mutation suggests that weaver gene is a candidate marker for ... potential DNA markers of milk production (Shan et al.,. 2002). Thus, weaver gene is an ..... weaver gene that played multiple roles in dairy and wool producing traits.

  6. Inactivation of Vhl in Osteochondral Progenitor Cells Causes High Bone Mass Phenotype and Protects Against Age-Related Bone Loss in Adult Mice

    Science.gov (United States)

    Weng, Tujun; Xie, Yangli; Huang, Junlan; Luo, Fengtao; Yi, Lingxian; He, Qifen; Chen, Di; Chen, Lin

    2014-01-01

    Previous studies have shown that disruption of von Hippel–Lindau gene (Vhl) coincides with activation of hypoxia-inducible factor α (HIFα) signaling in bone cells and plays an important role in bone development, homeostasis, and regeneration. It is known that activation of HIF1α signaling in mature osteoblasts is central to the coupling between angiogenesis and bone formation. However, the precise mechanisms responsible for the coupling between skeletal angiogenesis and osteogenesis during bone remodeling are only partially elucidated. To evaluate the role of Vhl in bone homeostasis and the coupling between vascular physiology and bone, we generated mice lacking Vhl in osteochondral progenitor cells (referred to as Vhl cKO mice) at postnatal and adult stages in a tamoxifen-inducible manner and changes in skeletal morphology were assessed by micro–computed tomography (µCT), histology, and bone histomorphometry. We found that mice with inactivation of Vhl in osteochondral progenitor cells at the postnatal stage largely phenocopied that of mice lacking Vhl in mature osteoblasts, developing striking and progressive accumulation of cancellous bone with increased microvascular density and bone formation. These were accompanied with a significant increase in osteoblast proliferation, upregulation of differentiation marker Runx2 and osteocalcin, and elevated expression of vascular endothelial growth factor (VEGF) and phosphorylation of Smad1/5/8. In addition, we found that Vhl deletion in osteochondral progenitor cells in adult bone protects mice from aging-induced bone loss. Our data suggest that the VHL-mediated signaling in osteochondral progenitor cells plays a critical role in bone remodeling at postnatal/adult stages through coupling osteogenesis and angiogenesis. © 2014 American Society for Bone and Mineral Research. PMID:23999831

  7. DRUMS: a human disease related unique gene mutation search engine.

    Science.gov (United States)

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

  8. Loss of the Birt-Hogg-Dubé gene product folliculin induces longevity in a hypoxia-inducible factor-dependent manner.

    Science.gov (United States)

    Gharbi, Hakam; Fabretti, Francesca; Bharill, Puneet; Rinschen, Markus M; Brinkkötter, Sibylle; Frommolt, Peter; Burst, Volker; Schermer, Bernhard; Benzing, Thomas; Müller, Roman-Ulrich

    2013-08-01

    Signaling through the hypoxia-inducible factor hif-1 controls longevity, metabolism, and stress resistance in Caenorhabditis elegans. Hypoxia-inducible factor (HIF) protein levels are regulated through an evolutionarily conserved ubiquitin ligase complex. Mutations in the VHL gene, encoding a core component of this complex, cause a multitumor syndrome and renal cell carcinoma in humans. In the nematode, deficiency in vhl-1 promotes longevity mediated through HIF-1 stabilization. However, this longevity assurance pathway is not yet understood. Here, we identify folliculin (FLCN) as a novel interactor of the hif-1/vhl-1 longevity pathway. FLCN mutations cause Birt-Hogg-Dubé syndrome in humans, another tumor syndrome with renal tumorigenesis reminiscent of the VHL disease. Loss of the C. elegans ortholog of FLCN F22D3.2 significantly increased lifespan and enhanced stress resistance in a hif-1-dependent manner. F22D3.2, vhl-1, and hif-1 control longevity by a mechanism distinct from insulin-like signaling. Daf-16 deficiency did not abrogate the increase in lifespan mediated by flcn-1. These findings define FLCN as a player in HIF-dependent longevity signaling and connect organismal aging, stress resistance, and regulation of longevity with the formation of renal cell carcinoma. © 2013 John Wiley & Sons Ltd and the Anatomical Society.

  9. Germline mutations of TP53 gene in breast cancer.

    Science.gov (United States)

    Damineni, Surekha; Rao, Vadlamudi Raghavendra; Kumar, Satish; Ravuri, Rajasekar Reddy; Kagitha, Sailaja; Dunna, Nageswara Rao; Digumarthi, Raghunadharao; Satti, Vishnupriya

    2014-09-01

    Germline alterations of the TP53 gene encoding the p53 protein have been observed in the majority of families with the Li-Fraumeni syndrome, a rare dominantly inherited disorder with breast cancer. Genomic DNA samples of 182 breast cancer cases and 186 controls were sequenced for TP53 mutations in the exon 5-9 and intervening introns 5, 7-9. Direct sequencing was done using Applied Biosystem 3730 DNA analyzer. In the present study, we observed nine mutations in the sequenced region, of which five were novel. Hardy-Weinberg equilibrium (HWE) was done for all the mutations; C14181T, T14201G, and G13203A have shown deviation from HWE. High linkage disequilibrium (LD) was observed between C14181T (rs129547788) and T14201G (rs12951053) (r (2) = 0.98.3; D' = 1.00), whereas other observed mutations do not show strong LD with any of the other mutations. None of the intronic mutations has shown significant association with the breast cancer, two exonic mutations G13203A (rs28934578) and A14572G are significantly (P = 0.04, P = 0.007) associated with breast cancer. Germline mutations observed in DNA-binding domain of the gene showed significant association with breast cancer. This study reports five novel germline mutations in the TP53 gene out of which one mutation may confer significant risk to the breast cancer. Mutations in DNA-binding domain of TP53 gene may play role in the early onset and prognosis of breast cancer. The population-based studies of germline mutations in DNA-binding domain of TP53 gene helps in identification of individuals and families who are at risk of developing cancers.

  10. Mutations of the BRAF gene in human cancer

    OpenAIRE

    Davies, H.; Bignell, G.R.; Cox, C.; Stephens, P.; Edkins, S.; Clegg, S.; Teague, J.; Woffendin, H.; Garnett, M.J.; Bottomley, W.; Davis, N.; Dicks, E.; Ewing, R.; Floyd, Y.; Gray, K.

    2002-01-01

    Cancers arise owing to the accumulation of mutations in critical genes that alter normal programmes of cell proliferation, differentiation and death. As the first stage of a systematic genome-wide screen for these genes, we have prioritized for analysis signalling pathways in which at least one gene is mutated in human cancer. The RAS RAF MEK ERK MAP kinase pathway mediates cellular responses to growth signals. RAS is mutated to an oncogenic form in about 15% of human cancer. The three RAF ge...

  11. Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Fernanda Veronese Oliveira

    2014-01-01

    Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

  12. Cilia gene mutations cause atrioventricular septal defects by multiple mechanisms.

    Science.gov (United States)

    Burnicka-Turek, Ozanna; Steimle, Jeffrey D; Huang, Wenhui; Felker, Lindsay; Kamp, Anna; Kweon, Junghun; Peterson, Michael; Reeves, Roger H; Maslen, Cheryl L; Gruber, Peter J; Yang, Xinan H; Shendure, Jay; Moskowitz, Ivan P

    2016-07-15

    Atrioventricular septal defects (AVSDs) are a common severe form of congenital heart disease (CHD). In this study we identified deleterious non-synonymous mutations in two cilia genes, Dnah11 and Mks1, in independent N-ethyl-N-nitrosourea-induced mouse mutant lines with heritable recessive AVSDs by whole-exome sequencing. Cilia are required for left/right body axis determination and second heart field (SHF) Hedgehog (Hh) signaling, and we find that cilia mutations affect these requirements differentially. Dnah11avc4 did not disrupt SHF Hh signaling and caused AVSDs only concurrently with heterotaxy, a left/right axis abnormality. In contrast, Mks1avc6 disrupted SHF Hh signaling and caused AVSDs without heterotaxy. We performed unbiased whole-genome SHF transcriptional profiling and found that cilia motility genes were not expressed in the SHF whereas cilia structural and signaling genes were highly expressed. SHF cilia gene expression predicted the phenotypic concordance between AVSDs and heterotaxy in mice and humans with cilia gene mutations. A two-step model of cilia action accurately predicted the AVSD/heterotaxyu phenotypic expression pattern caused by cilia gene mutations. We speculate that cilia gene mutations contribute to both syndromic and non-syndromic AVSDs in humans and provide a model that predicts the phenotypic consequences of specific cilia gene mutations. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates

    Directory of Open Access Journals (Sweden)

    Soudabeh Heidari

    2013-09-01

    Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.

  14. Mutations of the KISS1 Gene in Disorders of Puberty

    National Research Council Canada - National Science Library

    Silveira, L. G; Noel, S. D; Silveira-Neto, A. P; Abreu, A. P; Brito, V. N; Santos, M. G; Bianco, S. D. C; Kuohung, W; Xu, S; Gryngarten, M; Escobar, M. E; Arnhold, I. J. P; Mendonca, B. B; Kaiser, U. B; Latronico, A. C

    2010-01-01

    ... transmission with incomplete, sex-dependent penetrance (6).Kisspeptin, encoded by the KISS1 gene, is a key gatekeeper of human puberty (8). Loss-of-function mutations of the kisspeptin receptor (GPR54 or KISS1R) cause normosmic IHH (9, 10). Recently, an activating mutation of KISS1R was identified in a girl with CPP, implicating the kisspeptin sys...

  15. Recognizable cerebellar dysplasia associated with mutations in multiple tubulin genes

    NARCIS (Netherlands)

    R. Oegema (Renske); T.D. Cushion (Thomas); I.G. Phelps (Ian G.); S.-K. Chung (Seo-Kyung); J.C. Dempsey (Jennifer C.); S. Collins (Sarah); J.G.L. Mullins (Jonathan G.L.); T. Dudding (Tracy); H. Gill (Harinder); A.J. Green (Andrew J.); W.B. Dobyns (William); G.E. Ishak (Gisele E.); M.I. Rees (Mark); D. Doherty (Dan)

    2015-01-01

    textabstractMutations in alpha- and beta-tubulins are increasingly recognized as a major cause of malformations of cortical development (MCD), typically lissencephaly, pachygyria and polymicrogyria; however, sequencing tubulin genes in large cohorts of MCD patients has detected tubulin mutations in

  16. Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

    2017-01-01

    We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

  17. [Obesity based on mutation of genes involved in energy balance].

    Science.gov (United States)

    Hainerová, I

    2007-01-01

    Within the last decade an intensive research led to an identification of several genes which are involved in a regulation of energy balance. In most cases, carriers of these gene mutations do not exhibit further characteristic phenotypic features except for a severe obesity. Obesity based on mutation of one gene product is called monogenic obesity. Mutations in genes for leptin, leptin receptor, proopiomelanocortin, prohormone convertase 1, melanocortin 4 and 3 receptor disrupt the physiological humoral signalization between peripheral signals and the hypothalamic centres of satiety and hunger. Defects of all above mentioned genes lead to phenotype of abnormal eating behaviour followed by a development of severe early-onset obesity. Mutations of melanocortin 4 receptor gene represent the most common cause of monogenic obesity because they are detected in almost 6 % children with early-onset severe obesity. Mutations of the other genes involved in energy homeostasis are very rare. Although these mutations are sporadic we assume that further research of monogenic forms of obesity might lead to our understanding of physiology and pathophysiology of regulation of the energy homeostasis and eating behaviour. Additionally, they may open new approach to the management of eating behaviour and to the treatment of obesity.

  18. Vhl deletion in osteoblasts boosts cellular glycolysis and improves global glucose metabolism.

    Science.gov (United States)

    Dirckx, Naomi; Tower, Robert J; Mercken, Evi M; Vangoitsenhoven, Roman; Moreau-Triby, Caroline; Breugelmans, Tom; Nefyodova, Elena; Cardoen, Ruben; Mathieu, Chantal; Van der Schueren, Bart; Confavreux, Cyrille B; Clemens, Thomas L; Maes, Christa

    2018-02-12

    The skeleton has emerged as an important regulator of systemic glucose homeostasis, with osteocalcin and insulin representing prime mediators of the interplay between bone and energy metabolism. However, genetic evidence indicates that osteoblasts can influence global energy metabolism through additional, as yet unknown, mechanisms. Here, we report that constitutive or postnatally induced deletion of the hypoxia signaling pathway component von Hippel-Lindau (VHL) in skeletal osteolineage cells of mice led to high bone mass as well as hypoglycemia and increased glucose tolerance, not accounted for by osteocalcin or insulin. In vitro and in vivo data indicated that Vhl-deficient osteoblasts displayed massively increased glucose uptake and glycolysis associated with upregulated HIF-target gene expression, resembling the Warburg effect that typifies cancer cells. Overall, the glucose consumption by the skeleton was increased in the mutant mice, as revealed by 18F-FDG radioactive tracer experiments. Moreover, the glycemia levels correlated inversely with the level of skeletal glucose uptake, and pharmacological treatment with the glycolysis inhibitor dichloroacetate (DCA), which restored glucose metabolism in Vhl-deficient osteogenic cells in vitro, prevented the development of the systemic metabolic phenotype in the mutant mice. Altogether, these findings reveal a novel link between cellular glucose metabolism in osteoblasts and whole-body glucose homeostasis, controlled by local hypoxia signaling in the skeleton.

  19. Evaluation of point mutations in dystrophin gene in Iranian ...

    Indian Academy of Sciences (India)

    [Haghshenas M., Akbari M. T., Zare Karizi S., Khordadpoor Deilamani F., Nafissi S. and Salehi Z. 2016 Evaluation of point mutations in dystrophin gene in Iranian Duchenne .... PCR product (bp). Annealing temperature. Exon 44. CTTGATCCATATGCTTTTACCTGCA. 268. 59. TCCATCACCCTTCAGAACCTGACCT. Exon 50.

  20. Three novel and two known androgen receptor gene mutations ...

    Indian Academy of Sciences (India)

    BALACHANDRAN SARANYA

    Three novel and two known androgen receptor gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. BALACHANDRAN SARANYA1, GUNASEKARAN BHAVANI1, BRINDHA ARUMUGAM1,. MEENA JAYASHANKAR2 and SATHIYAVEDU THYAGARAJAN SANTHIYA1∗.

  1. Cancer Susceptibility Gene Mutations in Individuals With Colorectal Cancer.

    Science.gov (United States)

    Yurgelun, Matthew B; Kulke, Matthew H; Fuchs, Charles S; Allen, Brian A; Uno, Hajime; Hornick, Jason L; Ukaegbu, Chinedu I; Brais, Lauren K; McNamara, Philip G; Mayer, Robert J; Schrag, Deborah; Meyerhardt, Jeffrey A; Ng, Kimmie; Kidd, John; Singh, Nanda; Hartman, Anne-Renee; Wenstrup, Richard J; Syngal, Sapna

    2017-04-01

    Purpose Hereditary factors play an important role in colorectal cancer (CRC) risk, yet the prevalence of germline cancer susceptibility gene mutations in patients with CRC unselected for high-risk features (eg, early age at diagnosis, personal/family history of cancer or polyps, tumor microsatellite instability [MSI], mismatch repair [MMR] deficiency) is unknown. Patients and Methods We recruited 1,058 participants who received CRC care in a clinic-based setting without preselection for age at diagnosis, personal/family history, or MSI/MMR results. All participants underwent germline testing for mutations in 25 genes associated with inherited cancer risk. Each gene was categorized as high penetrance or moderate penetrance on the basis of published estimates of the lifetime cancer risks conferred by pathogenic germline mutations in that gene. Results One hundred five (9.9%; 95% CI, 8.2% to 11.9%) of 1,058 participants carried one or more pathogenic mutations, including 33 (3.1%) with Lynch syndrome (LS). Twenty-eight (96.6%) of 29 available LS CRCs demonstrated abnormal MSI/MMR results. Seventy-four (7.0%) of 1,058 participants carried non-LS gene mutations, including 23 (2.2%) with mutations in high-penetrance genes (five APC, three biallelic MUTYH, 11 BRCA1/2, two PALB2, one CDKN2A, and one TP53), 15 of whom lacked clinical histories suggestive of their underlying mutation. Thirty-eight (3.6%) participants had moderate-penetrance CRC risk gene mutations (19 monoallelic MUTYH, 17 APC*I1307K, two CHEK2). Neither proband age at CRC diagnosis, family history of CRC, nor personal history of other cancers significantly predicted the presence of pathogenic mutations in non-LS genes. Conclusion Germline cancer susceptibility gene mutations are carried by 9.9% of patients with CRC. MSI/MMR testing reliably identifies LS probands, although 7.0% of patients with CRC carry non-LS mutations, including 1.0% with BRCA1/2 mutations.

  2. Mutations in the AXIN1 gene in advanced prostate cancer

    DEFF Research Database (Denmark)

    Yardy, George W; Bicknell, David C; Wilding, Jennifer L

    2009-01-01

    The Wnt signalling pathway directs aspects of embryogenesis and is thought to contribute to maintenance of certain stem cell populations. Disruption of the pathway has been observed in many different tumour types. In bowel, stomach, and endometrial cancer, this is usually due to mutation of genes...... encoding Wnt pathway components APC or beta-catenin. Such mutations are rare in hepatocellular carcinomas and medulloblastomas with Wnt pathway dysfunction, and there, mutation in genes for other Wnt molecules, such as Axin, is more frequently found....

  3. Profiling of Somatic Mutations in Phaeochromocytoma and Paraganglioma by Targeted Next Generation Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    Andrea Luchetti

    2015-01-01

    Full Text Available At least 12 genes (FH, HIF2A, MAX, NF1, RET, SDHA, SDHB, SDHC, SDHD, SDHAF2, TMEM127, and VHL have been implicated in inherited predisposition to phaeochromocytoma (PCC, paraganglioma (PGL, or head and neck paraganglioma (HNPGL and a germline mutation may be detected in more than 30% of cases. Knowledge of somatic mutations contributing to PCC/PGL/HNPGL pathogenesis has received less attention though mutations in HRAS, HIF2A, NF1, RET, and VHL have been reported. To further elucidate the role of somatic mutation in PCC/PGL/HNPGL tumourigenesis, we employed a next generation sequencing strategy to analyse “mutation hotspots” in 50 human cancer genes. Mutations were identified for HRAS (c.37G>C; p.G13R and c.182A>G; p.Q61R in 7.1% (6/85; for BRAF (c.1799T>A; p.V600E in 1.2% (1/85 of tumours; and for TP53 (c.1010G>A; p.R337H in 2.35% (2/85 of cases. Twenty-one tumours harboured mutations in inherited PCC/PGL/HNPGL genes and no HRAS, BRAF, or TP53 mutations occurred in this group. Combining our data with previous reports of HRAS mutations in PCC/PGL we find that the mean frequency of HRAS/BRAF mutations in sporadic PCC/PGL is 8.9% (24/269 and in PCC/PGL with an inherited gene mutation 0% (0/148 suggesting that HRAS/BRAF mutations and inherited PCC/PGL genes mutations might be mutually exclusive. We report the first evidence for BRAF mutations in the pathogenesis of PCC/PGL/HNPGL.

  4. SDH mutations establish a hypermethylator phenotype in paraganglioma.

    Science.gov (United States)

    Letouzé, Eric; Martinelli, Cosimo; Loriot, Céline; Burnichon, Nelly; Abermil, Nasséra; Ottolenghi, Chris; Janin, Maxime; Menara, Mélanie; Nguyen, An Thach; Benit, Paule; Buffet, Alexandre; Marcaillou, Charles; Bertherat, Jérôme; Amar, Laurence; Rustin, Pierre; De Reyniès, Aurélien; Gimenez-Roqueplo, Anne-Paule; Favier, Judith

    2013-06-10

    Paragangliomas are neuroendocrine tumors frequently associated with mutations in RET, NF1, VHL, and succinate dehydrogenase (SDHx) genes. Methylome analysis of a large paraganglioma cohort identified three stable clusters, associated with distinct clinical features and mutational status. SDHx-related tumors displayed a hypermethylator phenotype, associated with downregulation of key genes involved in neuroendocrine differentiation. Succinate accumulation in SDH-deficient mouse chromaffin cells led to DNA hypermethylation by inhibition of 2-OG-dependent histone and DNA demethylases and established a migratory phenotype reversed by decitabine treatment. Epigenetic silencing was particularly severe in SDHB-mutated tumors, potentially explaining their malignancy. Finally, inactivating FH mutations were identified in the only hypermethylated tumor without SDHx mutations. These findings emphasize the interplay between the Krebs cycle, epigenomic changes, and cancer. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    Directory of Open Access Journals (Sweden)

    Maryam Taghdiri

    2017-08-01

    Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  6. A novel aspartoacylase (ASPA) gene mutation in Canavan disease.

    Science.gov (United States)

    Durmaz, Asude Alpman; Akin, Haluk; Onay, Huseyin; Vahabi, Ali; Ozkinay, Ferda

    2012-08-01

    Canavan disease is a severe autosomal recessive leukodystrophy characterized by macrocephaly, ataxia, severe motor and mental retardation, dysmyelination, and progressive spongial atrophy of the brain. The human aspartoacylase (ASPA) gene, which catalyzes the deacetylation of N-acetyl-L-aspartate, is mutated in Canavan disease. In the presented family sequencing analysis for the aspartoacylase gene was performed on the blood samples of the parents as the affected child had died due to Canavan disease. After the mutation was detected, prenatal diagnosis was also performed and heterozygous Y88X mutation was detected in the fetus. In this report, we present a novel mutation Y88X within the aspartoacylase gene in a consanguineous family with an affected child diagnosed as Canavan disease.

  7. a photoreceptor gene mutation in an indigenous black african family ...

    African Journals Online (AJOL)

    prognosis and management. As has been demonstrated here and reported recently," it is already possible to diagnose the presymptomatic gene carrier in southern African families in. August 1999, Vo\\. 89, 0.8 SAMJ which a rhodopsin mutation has been identified as the disease- causing gene. In addition, it is also possible ...

  8. a photoreceptor gene mutation in an indigenous black african family ...

    African Journals Online (AJOL)

    Clearly, within the next decade effective gene therapy for some forms of RD in humans will be possible, bVt once again these will be mutation-specific, so it is essential to identify the retinal disease-causing genes in each and every southern. African RD patient. This research was supported by grants from the RP Foundation.

  9. TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis

    NARCIS (Netherlands)

    Hoffman, T W; van der Vis, J J; van Oosterhout, M F M; van Es, H W; van Kessel, D A; Grutters, J C|info:eu-repo/dai/nl/258116129; van Moorsel, C H M

    2016-01-01

    Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex

  10. Mutation update for the PORCN gene

    DEFF Research Database (Denmark)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo

    2011-01-01

    variants and allows the inclusion of future reports. The database is based on the Leiden Open (source) Variation Database (LOVD) software, and is accessible online at http://www.lovd.nl/porcn. At present, the database contains 106 variants, representing 68 different mutations, scattered along the whole...

  11. Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

    Directory of Open Access Journals (Sweden)

    F.V. Perícole

    2005-09-01

    Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

  12. Splice site mutations in the ATP7A gene.

    Directory of Open Access Journals (Sweden)

    Tina Skjørringe

    Full Text Available Menkes disease (MD is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12 mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations identified in 12 patients with milder phenotypes were predicted to have no significant effect on splicing, which concurs with the presence of wild-type transcript in 7 out of 9 patients investigated in vivo. Both the in silico predictions and the in vivo results support the hypothesis previously suggested by us and others, that the presence of some wild-type transcript is correlated to a milder phenotype.

  13. HFE gene mutations and Wilson's disease in Sardinia.

    Science.gov (United States)

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (Pgene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  14. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about...... in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...... for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone....

  15. RAS gene hot-spot mutations in canine neoplasias.

    Science.gov (United States)

    Richter, A; Murua Escobar, H; Günther, K; Soller, J T; Winkler, S; Nolte, I; Bullerdiek, J

    2005-01-01

    Point mutations in the cellular homologues HRAS, KRAS2, and NRAS of the viral Harvey and Kirsten rat sarcoma virus oncogenes are commonly involved in the onset of malignancies in humans and other species such as dog, mouse, and rat. Most often, three particular hot-spot codons are affected, with one amino acid exchange being sufficient for the induction of tumor growth. While RAS genes have been shown to play an important role in canine tumors such as non-small lung cell carcinomas, data about RAS mutations in canine fibrosarcomas as well as KRAS2 mutations in canine melanomas is sparse. To increase the number of tumors examined, we recently screened 13 canine fibrosarcomas and 11 canine melanomas for point mutations, particularly within the mutational hot spots. The results were compared to the already existing data from other studies about these tumors in dogs.

  16. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

    Directory of Open Access Journals (Sweden)

    Udhaya H Kotecha

    2014-01-01

    Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  17. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene.

    Science.gov (United States)

    Kotecha, Udhaya H; Movva, Sireesha; Sharma, Deepak; Verma, Jyotsna; Puri, Ratna Dua; Verma, Ishwar Chander

    2014-07-01

    Multiple suphphatase deficiency (MSD) is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1). We describe here the mutation analysis of a case of MSD. The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. The patient was compound heterozygote for a c.451A>G (p.K151E) substitution in exon 3 and a single base insertion mutation (c.690_691 InsT) in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  18. SERPINA1 Full-Gene Sequencing Identifies Rare Mutations Not Detected in Targeted Mutation Analysis.

    Science.gov (United States)

    Graham, Rondell P; Dina, Michelle A; Howe, Sarah C; Butz, Malinda L; Willkomm, Kurt S; Murray, David L; Snyder, Melissa R; Rumilla, Kandelaria M; Halling, Kevin C; Highsmith, W Edward

    2015-11-01

    Genetic α-1 antitrypsin (AAT) deficiency is characterized by low serum AAT levels and the identification of causal mutations or an abnormal protein. It needs to be distinguished from deficiency because of nongenetic causes, and diagnostic delay may contribute to worse patient outcome. Current routine clinical testing assesses for only the most common mutations. We wanted to determine the proportion of unexplained cases of AAT deficiency that harbor causal mutations not identified through current standard allele-specific genotyping and isoelectric focusing (IEF). All prospective cases from December 1, 2013, to October 1, 2014, with a low serum AAT level not explained by allele-specific genotyping and IEF were assessed through full-gene sequencing with a direct sequencing method for pathogenic mutations. We reviewed the results using American Council of Medical Genetics criteria. Of 3523 cases, 42 (1.2%) met study inclusion criteria. Pathogenic or likely pathogenic mutations not identified through clinical testing were detected through full-gene sequencing in 16 (38%) of the 42 cases. Rare mutations not detected with current allele-specific testing and IEF underlie a substantial proportion of genetic AAT deficiency. Full-gene sequencing, therefore, has the ability to improve accuracy in the diagnosis of AAT deficiency. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  19. Profiling critical cancer gene mutations in clinical tumor samples.

    Directory of Open Access Journals (Sweden)

    Laura E MacConaill

    2009-11-01

    Full Text Available Detection of critical cancer gene mutations in clinical tumor specimens may predict patient outcomes and inform treatment options; however, high-throughput mutation profiling remains underdeveloped as a diagnostic approach. We report the implementation of a genotyping and validation algorithm that enables robust tumor mutation profiling in the clinical setting.We developed and implemented an optimized mutation profiling platform ("OncoMap" to interrogate approximately 400 mutations in 33 known oncogenes and tumor suppressors, many of which are known to predict response or resistance to targeted therapies. The performance of OncoMap was analyzed using DNA derived from both frozen and FFPE clinical material in a diverse set of cancer types. A subsequent in-depth analysis was conducted on histologically and clinically annotated pediatric gliomas. The sensitivity and specificity of OncoMap were 93.8% and 100% in fresh frozen tissue; and 89.3% and 99.4% in FFPE-derived DNA. We detected known mutations at the expected frequencies in common cancers, as well as novel mutations in adult and pediatric cancers that are likely to predict heightened response or resistance to existing or developmental cancer therapies. OncoMap profiles also support a new molecular stratification of pediatric low-grade gliomas based on BRAF mutations that may have immediate clinical impact.Our results demonstrate the clinical feasibility of high-throughput mutation profiling to query a large panel of "actionable" cancer gene mutations. In the future, this type of approach may be incorporated into both cancer epidemiologic studies and clinical decision making to specify the use of many targeted anticancer agents.

  20. GPR143 gene mutation analysis in pediatric patients with albinism.

    Science.gov (United States)

    Trebušak Podkrajšek, Katarina; Stirn Kranjc, Branka; Hovnik, Tinka; Kovač, Jernej; Battelino, Tadej

    2012-09-01

    X-linked ocular albinism type 1 is difficult to differentiate clinically from other forms of albinism in young patients. X-linked ocular albinism type 1 is caused by mutations in the GPR143 gene, encoding melanosome specific G-protein coupled receptor. Patients typically present with moderately to severely reduced visual acuity, nystagmus, strabismus, photophobia, iris translucency, hypopigmentation of the retina, foveal hypoplasia and misrouting of optic nerve fibers at the chiasm. Following clinical ophthalmological evaluation, GPR143 gene mutational analyses were performed in a cohort of 15 pediatric male patients with clinical signs of albinism. Three different mutations in the GPR143 gene were identified in four patients, including a novel c.886G>A (p.Gly296Arg) mutation occurring "de novo" and a novel intronic c.360 + 5G>A mutation, identified in two related boys. Four patients with X-linked ocular albinism type 1 were identified from a cohort of 15 boys with clinical signs of albinism using mutation detection methods. Genetic analysis offers the possibility of early definitive diagnosis of ocular albinism type 1 in a significant portion of boys with clinical signs of albinism.

  1. Clustered Mutation Signatures Reveal that Error-Prone DNA Repair Targets Mutations to Active Genes.

    Science.gov (United States)

    Supek, Fran; Lehner, Ben

    2017-07-27

    Many processes can cause the same nucleotide change in a genome, making the identification of the mechanisms causing mutations a difficult challenge. Here, we show that clustered mutations provide a more precise fingerprint of mutagenic processes. Of nine clustered mutation signatures identified from >1,000 tumor genomes, three relate to variable APOBEC activity and three are associated with tobacco smoking. An additional signature matches the spectrum of translesion DNA polymerase eta (POLH). In lymphoid cells, these mutations target promoters, consistent with AID-initiated somatic hypermutation. In solid tumors, however, they are associated with UV exposure and alcohol consumption and target the H3K36me3 chromatin of active genes in a mismatch repair (MMR)-dependent manner. These regions normally have a low mutation rate because error-free MMR also targets H3K36me3 chromatin. Carcinogens and error-prone repair therefore redistribute mutations to the more important regions of the genome, contributing a substantial mutation load in many tumors, including driver mutations. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    T. W. Hoffman

    2016-01-01

    Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.

  3. Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

    Directory of Open Access Journals (Sweden)

    Quan Li

    Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

  4. Vhl deletion in renal epithelia causes HIF-1?-dependent, HIF-2?-independent angiogenesis and constitutive diuresis

    OpenAIRE

    Schönenberger, Désirée; Rajski, Michal; Harlander, Sabine; Frew, Ian J

    2016-01-01

    One of the earliest requirements for the formation of a solid tumor is the establishment of an adequate blood supply. Clear cell renal cell carcinomas (ccRCC) are highly vascularized tumors in which the earliest genetic event is most commonly the biallelic inactivation of the VHL tumor suppressor gene, leading to constitutive activation of the HIF-1α and HIF-2α transcription factors, which are known angiogenic factors. However it remains unclear whether either or both HIF-1α or HIF-2α stabili...

  5. DNA mismatch repair preferentially protects genes from mutation.

    Science.gov (United States)

    Belfield, Eric J; Ding, Zhong Jie; Jamieson, Fiona J C; Visscher, Anne M; Zheng, Shao Jian; Mithani, Aziz; Harberd, Nicholas P

    2017-12-12

    Mutation is the source of genetic variation and fuels biological evolution. Many mutations first arise as DNA replication errors. These errors subsequently evade correction by cellular DNA repair, for example, by the well-known DNA mismatch repair (MMR) mechanism. Here, we determine the genome-wide effects of MMR on mutation. We first identify almost 9000 mutations accumulated over five generations in eight MMR-deficient mutation accumulation (MA) lines of the model plant species, Arabidopsis thaliana We then show that MMR deficiency greatly increases the frequency of both smaller-scale insertions and deletions (indels) and of single-nucleotide variant (SNV) mutations. Most indels involve A or T nucleotides and occur preferentially in homopolymeric (poly A or poly T) genomic stretches. In addition, we find that the likelihood of occurrence of indels in homopolymeric stretches is strongly related to stretch length, and that this relationship causes ultrahigh localized mutation rates in specific homopolymeric stretch regions. For SNVs, we show that MMR deficiency both increases their frequency and changes their molecular mutational spectrum, causing further enhancement of the GC to AT bias characteristic of organisms with normal MMR function. Our final genome-wide analyses show that MMR deficiency disproportionately increases the numbers of SNVs in genes, rather than in nongenic regions of the genome. This latter observation indicates that MMR preferentially protects genes from mutation and has important consequences for understanding the evolution of genomes during both natural selection and human tumor growth. © 2018 Belfield et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Mutation prevalence of cerebral cavernous malformation genes in Spanish patients.

    Directory of Open Access Journals (Sweden)

    Rufino Mondéjar

    Full Text Available OBJECTIVE: To study the molecular genetic and clinical features of cerebral cavernous malformations (CCM in a cohort of Spanish patients. METHODS: We analyzed the CCM1, CCM2, and CCM3 genes by MLPA and direct sequencing of exons and intronic boundaries in 94 familial forms and 41 sporadic cases of CCM patients of Spanish extraction. When available, RNA studies were performed seeking for alternative or cryptic splicing. RESULTS: A total of 26 pathogenic mutations, 22 of which predict truncated proteins, were identified in 29 familial forms and in three sporadic cases. The repertoire includes six novel non-sense and frameshift mutations in CCM1 and CCM3. We also found four missense mutations, one of them located at the third NPXY motif of CCM1 and another one that leads to cryptic splicing of CCM1 exon 6. We found four genomic deletions with the loss of the whole CCM2 gene in one patient and a partial loss of CCM1and CCM2 genes in three other patients. Four families had mutations in CCM3. The results include a high frequency of intronic variants, although most of them localize out of consensus splicing sequences. The main symptoms associated to clinical debut consisted of cerebral haemorrhage, migraines and epileptic seizures. The rare co-occurrence of CCM with Noonan and Chiari syndromes and delayed menarche is reported. CONCLUSIONS: Analysis of CCM genes by sequencing and MLPA has detected mutations in almost 35% of a Spanish cohort (36% of familial cases and 10% of sporadic patients. The results include 13 new mutations of CCM genes and the main clinical symptoms that deserves consideration in molecular diagnosis and genetic counselling of cerebral cavernous malformations.

  7. Update of the androgen receptor gene mutations database.

    Science.gov (United States)

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.

  8. Mutation distributions and clinical correlations of PIK3CA gene mutations in breast cancer.

    Science.gov (United States)

    Dirican, Ebubekir; Akkiprik, Mustafa; Özer, Ayşe

    2016-06-01

    Breast cancer (BCa) is the most common cancer and the second cause of death among women. Phosphoinositide 3-kinase (PI3K) signaling pathway has a crucial role in the cellular processes such as cell survival, growth, division, and motility. Moreover, oncogenic mutations in the PI3K pathway generally involve the activation phosphatidylinositol-4,5-bisphosphate 3-kinase-catalytic subunit alpha (PIK3CA) mutation which has been identified in numerous BCa subtypes. In this review, correlations between PIK3CA mutations and their clinicopathological parameters on BCa will be described. It is reported that PIK3CA mutations which have been localized mostly on exon 9 and 20 hot spots are detected 25-40 % in BCa. This relatively high frequency can offer an advantage for choosing the best treatment options for BCa. PIK3CA mutations may be used as biomarkers and have been major focus of drug development in cancer with the first clinical trials of PI3K pathway inhibitors currently in progress. Screening of PIK3CA gene mutations might be useful genetic tests for targeted therapeutics or diagnosis. Increasing data about PIK3CA mutations and its clinical correlations with BCa will help to introduce new clinical applications in the near future.

  9. Glaucoma and Cytochrome P4501B1 Gene Mutations

    Directory of Open Access Journals (Sweden)

    Mukesh Tanwar

    2010-01-01

    Full Text Available Developmental anomalies of the ocular anterior chamber angle may lead to an incomplete development of the structures that form the conventional aqueous outflow pathway. Thus, disorders that present with such dysfunction tend to be associated with glaucoma. Among them, Axenfeld-Rieger (ARS malformation is a rare clinical entity with an estimated prevalence of one in every 200,000 individuals. The changes in eye morphogenesis in ARS are highly penetrant and are associated with 50% risk of development of glaucoma. Mutations in the cytochrome P4501B1 (CYP1B1 gene have been reported to be associated with primary congenital glaucoma and other forms of glaucoma and mutations in pituitary homeobox 2 (PITX2 gene have been identified in ARS in various studies. This case was negative for PITX2 mutations and compound heterozygote for CYP1B1 mutations. Clinical manifestations of this patient include bilateral elevated intraocular pressure (>40 mmHg with increased corneal diameter (>14 mm and corneal opacity. Patient also had iridocorneal adhesions, anteriorly displaced Schwalbe line, anterior insertion of iris, broad nasal bridge and protruding umbilicus. This is the first study from north India reporting CYP1B1 mutations in Axenfeld-Rieger syndrome with bilateral buphthalmos and early onset glaucoma. Result of this study supports the role of CYP1B1 as a causative gene in ASD disorders and its role in oculogenesis.

  10. Mutator gene and hereditary non-polyposis colorectal cancer

    Science.gov (United States)

    de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD

    2008-02-05

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  11. Mutated β-lactam acylase genes

    NARCIS (Netherlands)

    Quax, Wim; Misset, Onno; Laan, Jan-Metske van der; Lenting, Herman B.

    1999-01-01

    New mutant beta -lactam acylases are provided exhibiting altered substrate specificities. These beta -lactam acylases are obtained by expression of a gene encoding said beta -lactam acylase and having an amino acid sequence which differs at least in one amino acid from the wild-type beta -lactam

  12. Mutated β-lactam acylase genes

    NARCIS (Netherlands)

    Quax, Wilhelmus J; Misset, Onno; Van Der Laan, Jan M.; Lenting, Herman BM

    1995-01-01

    New mutant beta -lactam acylases are provided exhibiting altered substrate specificities. These beta -lactam acylases are obtained by expression of a gene encoding said beta -lactam acylase and having an amino acid sequence which differs at least in one amino acid from the wild-type beta -lactam

  13. CARD15 gene mutations in periodontitis

    NARCIS (Netherlands)

    Laine, ML; Murillo, LS; Morre, SA; Winkel, EG; Pena, AS; van Winkelhoff, AJ

    2004-01-01

    Objectives: The CARD15 gene encodes the Nod2 protein, which is involved in intracellular recognition of bacterial products like peptidoglycan, activates inflammation and regulates apoptosis through nuclear factor-kappa B, a transcription factor that plays a central role in the innate immunity. Two

  14. Germline Mutations in DNA Repair Genes in Lung Adenocarcinoma.

    Science.gov (United States)

    Parry, Erin M; Gable, Dustin L; Stanley, Susan E; Khalil, Sara E; Antonescu, Valentin; Florea, Liliana; Armanios, Mary

    2017-11-01

    Although lung cancer is generally thought to be environmentally provoked, anecdotal familial clustering has been reported, suggesting that there may be genetic susceptibility factors. We systematically tested whether germline mutations in eight candidate genes may be risk factors for lung adenocarcinoma. We studied lung adenocarcinoma cases for which germline sequence data had been generated as part of The Cancer Genome Atlas project but had not been previously analyzed. We selected eight genes, ATM serine/threonine kinase gene (ATM), BRCA2, DNA repair associated gene (BRCA2), checkpoint kinase 2 gene (CHEK2), EGFR, parkin RBR E3 ubiquitin protein ligase gene (PARK2), telomerase reverse transcriptase gene (TERT), tumor protein p53 gene (TP53), and Yes associated protein 1 gene (YAP1), on the basis of prior anecdotal association with lung cancer or genome-wide association studies. Among 555 lung adenocarcinoma cases, we detected 14 pathogenic mutations in five genes; they occurred at a frequency of 2.5% and represented an OR of 66 (95% confidence interval: 33-125, p mutations fell most commonly in ATM (50%), followed by TP53, BRCA2, EGFR, and PARK2. Most (86%) of these variants had been reported in other familial cancer syndromes. Another 12 cases (2%) carried ultrarare variants that were predicted to be deleterious by three protein prediction programs; these most frequently involved ATM and BRCA2. A subset of patients with lung adenocarcinoma, at least 2.5% to 4.5%, carry germline variants that have been linked to cancer risk in Mendelian syndromes. The genes fall most frequently in DNA repair pathways. Our data indicate that patients with lung adenocarcinoma, similar to other solid tumors, include a subset of patients with inherited susceptibility. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  15. Influence of some expressive genes mutation on growth and body ...

    African Journals Online (AJOL)

    Seven hundred and fifty one (751) mature local chickens reared in the dense humid forest zone of Cameroon were described to identify expressive genes mutation and their influences on growth and body measurements of birds in the rural environment of three provinces in Cameroon (Center, South and East). The major ...

  16. Retinitis pigmentosa: mutations in a receptor tyrosine kinase gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 26; Issue 1. Clipboard: Retinitis pigmentosa: mutations in a receptor tyrosine kinase gene, MERTK. Arun Kumar. Volume 26 Issue 1 March 2001 pp 3-5. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/jbsc/026/01/0003-0005 ...

  17. High incidence of GJB2 gene mutations among assortatively mating ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 1. High incidence of GJB2 gene mutations among assortatively mating hearing impaired families in Kerala: future implications. Amritkumar Pavithra Justin Margret Jeffrey Jayasankaran Chandru Arabandi Ramesh C. R. Srikumari Srisailapathy. Research Note Volume ...

  18. Mutational landscape of the human Y chromosome-linked genes ...

    Indian Academy of Sciences (India)

    Mutational landscape of the human Y chromosome-linked genes and loci in patients with hypogonadism. Deepali Pathak, Sandeep Kumar Yadav, Leena Rawal and Sher Ali. J. Genet. 94, 677–687. Table 1. Details showing age, sex, karyotype, clinical features and diagnosis results of the patients with H. Hormone profile.

  19. Olaparib Approved for Breast Cancers with BRCA Gene Mutations

    Science.gov (United States)

    The Food and Drug Administration has approved olaparib (Lynparza®) to treat metastatic breast cancers that have inherited mutations in the BRCA1 or BRCA2 genes as well as a companion diagnostic test for selecting candidates for the therapy.

  20. Two novel mutations in ILDR1 gene cause autosomal recessive ...

    Indian Academy of Sciences (India)

    In a recent screening programme on hearing loss (HL), we examined 17 common autosomal recessive nonsyndromic hearing loss (ARNSHL) genes in every consanguineous Ira- nian family with ARNSHL that was referred to our centre. We first screened GJB2 mutations and then utilized a panel of three to four short ...

  1. Splicing aberrations caused by constitutional RB1 gene mutations in ...

    Indian Academy of Sciences (India)

    Skipping of an exon might confer an advantage as this might lead to a protein with residual function rather than an inactive protein. This situation is depicted in. Duchenne muscular dystrophy (DMD) and its milder variant, Becker muscular dystrophy (BMD), caused by mutations in the dystrophin gene (DMD) (Ahn and Kunkel.

  2. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism.

    NARCIS (Netherlands)

    Rauch, A.; Thiel, C.T.; Schindler, D.; Wick, U.; Crow, Y.J.; Ekici, A.B.; Essen, A.J. van; Goecke, T.O.; Al-Gazali, L.; Chrzanowska, K.H.; Zweier, C.; Brunner, H.G.; Becker, K.; Curry, C.J.; Dallapiccola, B.; Devriendt, K.; Dorfler, A.; Kinning, E.; Megarbane, A.; Meinecke, P.; Semple, R.K.; Spranger, S.; Toutain, A.; Trembath, R.C.; Voss, E.; Wilson, L.; Hennekam, R.C.M.; Zegher, F. de; Dorr, H.G.; Reis, A.

    2008-01-01

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss-of-function mutations in the centrosomal pericentrin (PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial dwarfism

  3. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism

    NARCIS (Netherlands)

    Rauch, Anita; Thiel, Christian T.; Schindler, Detlev; Wick, Ursula; Crow, Yanick J.; Ekici, Arif B.; van Essen, Anthonie J.; Goecke, Timm O.; Al-Gazali, Lihadh; Chrzanowska, Krystyna H.; Zweier, Christiane; Brunner, Han G.; Becker, Kristin; Curry, Cynthia J.; Dallapiccola, Bruno; Devriendt, Koenraad; Doerfler, Arnd; Kinning, Esther; Megarbane, Andre; Meinecke, Peter; Semple, Robert K.; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C.; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Doerr, Helmuth-Guenther; Reis, Andre

    2008-01-01

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss- of- function mutations in the centrosomal pericentrin ( PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial

  4. Frequency of mutations in Mediterranean fever gene, with gender ...

    Indian Academy of Sciences (India)

    Familial Mediterranean fever (FMF) is the most common hereditary inflammatory periodic disease, characterized by recurrent episodes of fever, abdominal pain, synovitis and pleurisy. The aim of this study was to determine the frequency and distri- bution of Mediterranean fever (MEFV) gene mutations and to investigate the ...

  5. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations

    NARCIS (Netherlands)

    Sijmons, Rolf H.; Hofstra, Robert M. W.

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive

  6. Mutation burden of rare variants in schizophrenia candidate genes.

    Science.gov (United States)

    Girard, Simon L; Dion, Patrick A; Bourassa, Cynthia V; Geoffroy, Steve; Lachance-Touchette, Pamela; Barhdadi, Amina; Langlois, Mathieu; Joober, Ridha; Krebs, Marie-Odile; Dubé, Marie-Pierre; Rouleau, Guy A

    2015-01-01

    Schizophrenia (SCZ) is a very heterogeneous disease that affects approximately 1% of the general population. Recently, the genetic complexity thought to underlie this condition was further supported by three independent studies that identified an increased number of damaging de novo mutations DNM in different SCZ probands. While these three reports support the implication of DNM in the pathogenesis of SCZ, the absence of overlap in the genes identified suggests that the number of genes involved in SCZ is likely to be very large; a notion that has been supported by the moderate success of Genome-Wide Association Studies (GWAS). To further examine the genetic heterogeneity of this disease, we resequenced 62 genes that were found to have a DNM in SCZ patients, and 40 genes that encode for proteins known to interact with the products of the genes with DNM, in a cohort of 235 SCZ cases and 233 controls. We found an enrichment of private nonsense mutations amongst schizophrenia patients. Using a kernel association method, we were able to assess for association for different sets. Although our power of detection was limited, we observed an increased mutation burden in the genes that have DNM.

  7. MYH Gene Status in Polish FAP Patients without APC Gene Mutations

    Directory of Open Access Journals (Sweden)

    Skrzypczak Marzena

    2006-01-01

    Full Text Available Abstract Familial Adenomatous Polyposis (FAP is an inheritable predisposition for the occurrence of numerous polyps in the large intestine. In about 50% of all patients, the occurrence of the disease is conditioned by heterozygotic mutations of the APC gene. Screening for genetic factors in persons without mutations in the APC gene led to the identification of homozygotic mutations of the MYH gene as the cause of the appearance of the polyposis form which is characterized by recessive heritability and a milder course than in the case of the classic form of the disease. The authors examined 90 persons from the DNA bank of patients with FAP from the Institute of Human Genetics of the Polish Academy of Sciences in Poznań in whom no mutations in the APC gene were detected. Two of the most frequent mutations of the MYH gene (Y165C and G382D were found to be heterozygous in 13% of patients and no other mutations in this gene coding sequence were observed. In the group with heterozygotic occurrence of the mutation in the MYH gene, the disease phenotype was not milder in comparison with the entire examined group and the mean age of the disease manifestation was even lower. This observation allows one to conclude that the employed methods of mutation screening were correct and, in the case of the examined group, the mutation ratio of the MYH gene does not precondition the occurrence of the disease, but it cannot be excluded that it may modify its phenotype. The obtained results indicate that the criteria applied during the process of FAP qualification are more rigorous than those applied in other countries.

  8. Von Hippel-Lindau disease (vHL)

    DEFF Research Database (Denmark)

    Binderup, Marie Louise Mølgaard; Bisgaard, Søs Marie Luise; Harbud, Vibeke

    2013-01-01

    cell carcinoma), the adrenal glands (pheochromocytoma), the pancreas, as well as in other organs. As many different organs can be affected, several medical specialities often take part in both diagnosis and treatment of manifestations. vHL should be suspected in individuals with a family history...

  9. Mutations of the tyrosinase gene produce autosomal recessive ocular albinism

    Energy Technology Data Exchange (ETDEWEB)

    King, R.A.; Summers, C.G.; Oetting, W.S. [Univ. of Minnesota, Minneapolis, MN (United States)] [and others

    1994-09-01

    Albinism has historically been divided into ocular (OA) and oculocutaneous (OCA) types based on the presence or absence of clinically apparent skin and hair involvement in an individual with the ocular features of albinism. The major genes for OCA include the tyrosinase gene in OCA1 and the P gene in OCA2. X-linked and autosomal recessive OA have been described and the responsible genes have not been identified. We now present six Caucasian individuals who have the phenotype of autosomal recessive OA but who have OCA1 as shown by the presence of mutations of the tyrosinase. They had white or very light hair and white skin at birth, and cutaneous pigment developed in the first decade of life. At ages ranging from 1.5-23 years, hair color was dark blond to light brown. The skin had generalized pigment and well developed tan was present on the exposed arm and face skin of four. Iris pigment was present and iris translucency varied. Molecular analysis of the tyrosinase gene, using PCR amplification and direct di-deoxy sequencing showed the following mutations: E398Z/E398Q, P406S/g346a, R402E/T373K, ?/D383N, and H211N/T373K. The homozygous individual was not from a known consanguineous mating. T373K is the most common tyrosinase gene mutation in our laboratory. Three of these mutations are associated with a total loss of tyrosinase activity (g346a splice-site, T373K, and D383N), while four are associated with residual enzyme activity (H211N, R402E, E398Q, and P406S). These studies show that mutations of the tyrosinase gene can produce the phenotype of autosomal recessive OA in an individual who has normal amounts of cutaneous pigment and the ability to tan after birth. This extends the phenotypic range of OCA1 to normal cutaneous pigment after early childhood, and suggest that mutations of the tyrosinase gene account for a significant number of individuals with autosomal recessive OA.

  10. PDCD10 gene mutations in multiple cerebral cavernous malformations.

    Science.gov (United States)

    Cigoli, Maria Sole; Avemaria, Francesca; De Benedetti, Stefano; Gesu, Giovanni P; Accorsi, Lucio Giordano; Parmigiani, Stefano; Corona, Maria Franca; Capra, Valeria; Mosca, Andrea; Giovannini, Simona; Notturno, Francesca; Ciccocioppo, Fausta; Volpi, Lilia; Estienne, Margherita; De Michele, Giuseppe; Antenora, Antonella; Bilo, Leda; Tavoni, Antonietta; Zamponi, Nelia; Alfei, Enrico; Baranello, Giovanni; Riva, Daria; Penco, Silvana

    2014-01-01

    Cerebral cavernous malformations (CCMs) are vascular abnormalities that may cause seizures, intracerebral haemorrhages, and focal neurological deficits. Familial form shows an autosomal dominant pattern of inheritance with incomplete penetrance and variable clinical expression. Three genes have been identified causing familial CCM: KRIT1/CCM1, MGC4607/CCM2, and PDCD10/CCM3. Aim of this study is to report additional PDCD10/CCM3 families poorly described so far which account for 10-15% of hereditary cerebral cavernous malformations. Our group investigated 87 consecutive Italian affected individuals (i.e. positive Magnetic Resonance Imaging) with multiple/familial CCM through direct sequencing and Multiplex Ligation-Dependent Probe Amplification (MLPA) analysis. We identified mutations in over 97.7% of cases, and PDCD10/CCM3 accounts for 13.1%. PDCD10/CCM3 molecular screening revealed four already known mutations and four novel ones. The mutated patients show an earlier onset of clinical manifestations as compared to CCM1/CCM2 mutated patients. The study of further families carrying mutations in PDCD10/CCM3 may help define a possible correlation between genotype and phenotype; an accurate clinical follow up of the subjects would help define more precisely whether mutations in PDCD10/CCM3 lead to a characteristic phenotype.

  11. PDCD10 gene mutations in multiple cerebral cavernous malformations.

    Directory of Open Access Journals (Sweden)

    Maria Sole Cigoli

    Full Text Available Cerebral cavernous malformations (CCMs are vascular abnormalities that may cause seizures, intracerebral haemorrhages, and focal neurological deficits. Familial form shows an autosomal dominant pattern of inheritance with incomplete penetrance and variable clinical expression. Three genes have been identified causing familial CCM: KRIT1/CCM1, MGC4607/CCM2, and PDCD10/CCM3. Aim of this study is to report additional PDCD10/CCM3 families poorly described so far which account for 10-15% of hereditary cerebral cavernous malformations. Our group investigated 87 consecutive Italian affected individuals (i.e. positive Magnetic Resonance Imaging with multiple/familial CCM through direct sequencing and Multiplex Ligation-Dependent Probe Amplification (MLPA analysis. We identified mutations in over 97.7% of cases, and PDCD10/CCM3 accounts for 13.1%. PDCD10/CCM3 molecular screening revealed four already known mutations and four novel ones. The mutated patients show an earlier onset of clinical manifestations as compared to CCM1/CCM2 mutated patients. The study of further families carrying mutations in PDCD10/CCM3 may help define a possible correlation between genotype and phenotype; an accurate clinical follow up of the subjects would help define more precisely whether mutations in PDCD10/CCM3 lead to a characteristic phenotype.

  12. AID-initiated purposeful mutations in immunoglobulin genes.

    Science.gov (United States)

    Goodman, Myron F; Scharff, Matthew D; Romesberg, Floyd E

    2007-01-01

    Exposure brings risk to all living organisms. Using a remarkably effective strategy, higher vertebrates mitigate risk by mounting a complex and sophisticated immune response to counter the potentially toxic invasion by a virtually limitless army of chemical and biological antagonists. Mutations are almost always deleterious, but in the case of antibody diversification there are mutations occurring at hugely elevated rates within the variable (V) and switch regions (SR) of the immunoglobulin (Ig) genes that are responsible for binding to and neutralizing foreign antigens throughout the body. These mutations are truly purposeful. This chapter is centered on activation-induced cytidine deaminase (AID). AID is required for initiating somatic hypermutation (SHM) in the V regions and class switch recombination (CSR) in the SR portions of Ig genes. By converting C --> U, while transcription takes place, AID instigates a cascade of mutational events involving error-prone DNA polymerases, base excision and mismatch repair enzymes, and recombination pathways. Together, these processes culminate in highly mutated antibody genes and the B cells expressing antibodies that have achieved optimal antigenic binding undergo positive selection in germinal centers. We will discuss the biological role of AID in this complex process, primarily in terms of its biochemical properties in relation to SHM in vivo. The chapter also discusses recent advances in experimental methods to characterize antibody dynamics as a function of SHM to help elucidate the role that the AID-induced mutations play in tailoring molecular recognition. The emerging experimental techniques help to address long-standing conundrums concerning evolution-imposed constraints on antibody structure and function.

  13. Mutational analysis of adrenoleukodystrophy (ALD) gene in Japanese ALD patients

    Energy Technology Data Exchange (ETDEWEB)

    Koike, R.; Onodera, O.; Tabe, H. [Miigate Univ. (Japan)] [and others

    1994-09-01

    Recently a putative ALD gene containing a striking homology with peroxisomal membrane protein (PMP70) has been identified. Besides childhood ALD, various clinical phenotypes have been identified with the onset in adolescence or adulthood (adrenomyeloneuropathy (AMN), adult cerebral ALD or cerebello-brainstem dominant type). The different clinical phenotypes occasionally coexist even in the same family. To investigate if there is a correlation between the clinical phenotypes and genotypes of the mutations in the ALD gene, we have analyzed 43 Japanese ALD patients. By Southern blot analysis, we identified non-overlapping deletions of 0.5 kb to 10.4 kb involving the ALD gene in 3 patients with adult onset cerebello-brainstem dominant type. By detailed direct sequence analysis, we found 4 patients who had point mutations in the coding region. An AMN patient had a point mutation leading to {sup 266}Gly{r_arrow}Arg change, and another patient with adult cerebral ALD had a 3 bp deletion resulting in the loss of glutamic acid at codon 291, which is a conserved amino acid both in ALD protein and PMP70. Two patients with childhood ALD had point mutations leading to {sup 507}Gly{r_arrow}Val, and {sup 518}Arg{r_arrow}Gln, respectively. Since amino acids from 507 to 520 are highly conserved as ATP-binding cassette transporter proteins, mutations in this region are expected to result in dramatic changes of the function of this protein. Although there is a tendancy for mutation in childhood ALD to be present within the ATP-binding site motif, we found two adult patients who had large deletions involving the region. Taken together, strong correlation between genotypes and clinical phenotypes is unlikely to exist, and some other modifying factors might well play an important role for the clinical manifestations of ALD.

  14. [Congenital hypofibrinogenemia associated with a novel mutation in FGG gene].

    Science.gov (United States)

    Wang, Yingyu; Ding, Hongxiang; Hao, Xiuping; Zhu, Liqing; Yang, Lihong; Jin, Yanhui; Wang, Mingshan

    2015-06-01

    To identify the genetic mutation underlying congenital hypofibrinogenamia in a Chinese pedigree. Standard coagulation tests including the prothrombin time (PT), activated partial thromboplastin time (APTT), thrombin time (TT), plasminogen activity (PLG:A), D-Dimer (DD) and fibrin degradation products (FDP) were tested with fresh plasma using a STA-R analyzer. The activity of fibrinogen (Fg:C) and fibrinogen antigen (Fg:Ag) were measured respectively with the Clauss method and immunoturbidimetry. All exons and exon-intron boundaries of the fibrinogen Aα-, Bβ-, and γ-chain genes (FGA, FGB and FGG) were amplified by PCR followed by direct sequencing. Suspected mutation was confirmed by reverse sequencing and analyzed with a Swiss-PdbViewer. The PT level in the proband was normal, while the APTT and TT were slightly prolonged. The functional and antigen fibrinogen levels were both significantly reduced (0.91 g/L and 0.95 g/L, respectively). Similar abnormalities were also found in her father, elder sister, son and niece. The coagulant parameters of her mother were all within the normal range. Genetic analysis has reveled a heterozygous A>C change at nucleotide 5864 in exon 7 of γ gene in the proband, predicting a novel Lys232Thr mutation. The proband's father, elder sister, son and niece were all carriers of the same mutation. Protein model analysis indicated that the Lys232Thr mutation did not disrupt the native network of hydrogen bonds, but has changed the mutual electrostatic forces, resulting in increased instability of the protein. The heterozygous Lys232Thr mutation identified in the FGG gene probably underlies the hypofibrinogenemia in this pedigree.

  15. A Novel Mutation in Aspartoacylase Gene; Canavan Disease.

    Science.gov (United States)

    Ashrafi, Mahmoudreza; Tavasoli, Alireza; Katibeh, Pegah; Aryani, Omid; Vafaee-Shahi, Mohammad

    2015-01-01

    Objective Canavan disease (CD) is a type of vacuolating leukodystrophy with autosomal recessive inheritance. Aspartoacylase deficiency results in decrease of myelin biosynthesis, dysmyelination and brain edema. Although CD is a very common in Ashkenazi Jews patients, several cases have been reported from non-Jewish population. This report is based on a homozygous C.202G>A mutation in the ASPA gene identified from an Iranian patient. To our knowledge, this type of mutation has not been reported in non-Jewish population in the literature.

  16. Multiscale mutation clustering algorithm identifies pan-cancer mutational clusters associated with pathway-level changes in gene expression.

    Science.gov (United States)

    Poole, William; Leinonen, Kalle; Shmulevich, Ilya; Knijnenburg, Theo A; Bernard, Brady

    2017-02-01

    Cancer researchers have long recognized that somatic mutations are not uniformly distributed within genes. However, most approaches for identifying cancer mutations focus on either the entire-gene or single amino-acid level. We have bridged these two methodologies with a multiscale mutation clustering algorithm that identifies variable length mutation clusters in cancer genes. We ran our algorithm on 539 genes using the combined mutation data in 23 cancer types from The Cancer Genome Atlas (TCGA) and identified 1295 mutation clusters. The resulting mutation clusters cover a wide range of scales and often overlap with many kinds of protein features including structured domains, phosphorylation sites, and known single nucleotide variants. We statistically associated these multiscale clusters with gene expression and drug response data to illuminate the functional and clinical consequences of mutations in our clusters. Interestingly, we find multiple clusters within individual genes that have differential functional associations: these include PTEN, FUBP1, and CDH1. This methodology has potential implications in identifying protein regions for drug targets, understanding the biological underpinnings of cancer, and personalizing cancer treatments. Toward this end, we have made the mutation clusters and the clustering algorithm available to the public. Clusters and pathway associations can be interactively browsed at m2c.systemsbiology.net. The multiscale mutation clustering algorithm is available at https://github.com/IlyaLab/M2C.

  17. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  18. [Analysis of PCCA and PCCB gene mutations in patients with propionic acidemia].

    Science.gov (United States)

    Chen, Zhanling; Wen, Pengqiang; Wang, Guobing; Hu, Yuhui; Liu, Xiaohong; Chen, Li; Chen, Shuli; Wan, Lisheng; Cui, Dong; Shang, Yue; Li, Chengrong

    2015-02-01

    To analyze PCCA and PCCB gene mutations in 10 Chinese patients with propionic acidemia(PA). Genomic DNA was extracted from peripheral blood leukocytes. The 39 exons and flanking sequences of the PCCA and PCCB genes were amplified with polymerase chain reaction and subjected to direct DNA sequencing. DNA sequencing has revealed that 7 patients have carried a PCCA gene mutation, 2 patients carried PCCB gene mutation and 1 patient carried mutations in both PCCA and PCCB genes. Ten PA mutations were confirmed, including 8 affecting the PCCA gene and 2 affecting the PCCB gene. Three PCCA mutations c.245G>A, IVS15+5del5, c.1288C>T and 2 PCCB mutations c.838insC, c.1087T>C were found for the first time. Among Chinese patients with propionic acidemia patients, their genetic mutations are mainly found on the PCCA gene.

  19. A systematic study of gene mutations in urothelial carcinoma; inactivating mutations in TSC2 and PIK3R1.

    Directory of Open Access Journals (Sweden)

    Gottfrid Sjödahl

    Full Text Available BACKGROUND: Urothelial carcinoma (UC is characterized by frequent gene mutations of which activating mutations in FGFR3 are the most frequent. Several downstream targets of FGFR3 are also mutated in UC, e.g., PIK3CA, AKT1, and RAS. Most mutation studies of UCs have been focused on single or a few genes at the time or been performed on small sample series. This has limited the possibility to investigate co-occurrence of mutations. METHODOLOGY/PRINCIPAL FINDINGS: We performed mutation analyses of 16 genes, FGFR3, PIK3CA, PIK3R1 PTEN, AKT1, KRAS, HRAS, NRAS, BRAF, ARAF, RAF1, TSC1, TSC2, APC, CTNNB1, and TP53, in 145 cases of UC. We show that FGFR3 and PIK3CA mutations are positively associated. In addition, we identified PIK3R1 as a target for mutations. We demonstrate a negative association at borderline significance between FGFR3 and RAS mutations, and show that these mutations are not strictly mutually exclusive. We show that mutations in BRAF, ARAF, RAF1 rarely occurs in UC. Our data emphasize the possible importance of APC signaling as 6% of the investigated tumors either showed inactivating APC or activating CTNNB1 mutations. TSC1, as well as TSC2, that constitute the mTOR regulatory tuberous sclerosis complex were found to be mutated at a combined frequency of 15%. CONCLUSIONS/SIGNIFICANCE: Our data demonstrate a significant association between FGFR3 and PIK3CA mutations in UC. Moreover, the identification of mutations in PIK3R1 further emphasizes the importance of the PI3-kinase pathway in UC. The presence of TSC2 mutations, in addition to TSC1 mutations, underlines the involvement of mTOR signaling in UC.

  20. [Application of gene capture technology on mutation screening of RB1 gene in retinoblastoma patients].

    Science.gov (United States)

    Meng, Q Y; Huang, L Z; Wang, B; Li, X X; Liang, J H

    2017-06-11

    Objectives: To analyze RB1 gene mutation in retinoblastoma (RB) patients using gene capture technology. Methods: Experimental research. The clinical data of 17 RB patients were collected at Department of Ophthalmology, Peking University People's Hospital from June 2010 to Jun 2014. Peripheral blood samples of seventeen RB patients and their parents were collected and genomic DNA were extracted. DNA library from RB patients was mixed with designed gene capture probe of RB1 exons and its flanking sequences. The data were analyzed using bioinformatics software. To avoid the false positive, the abnormal sites were verified using the Sanger sequencing method. Results: Totally, there were 17 RB patients, including 12 males and 5 females, from 0.5 to 23 years old, average ages were (3.2±5.2) years old. Both eyes were involved in 6 patients. The other 11 cases were only one eye was attacked. Four RB patients were found to have germline mutations, among whom 2 had bilateral tumors and 2 had unilateral tumors. 2 novel missense mutations were identified, including 15(th) exon c.1408A>T (p. Ile470Phe) and c.1960G>C (p. Val654Leu) at 19(th) exon. No RB1 mutation was identified in any of their parents. We also identified 2 mutations reported previously. One is c.1030C>T termination mutation at 10(th) exon in a bilateral RB patients and his father, who was diagnosed with unilateral RB. The other is c.371-372delTA frame shift mutation at 3(rd) exon. No mutation was found in their parents. Conclusions: Two novel germline RB1 mutations were found using gene capture technology, which enriched RB1 mutations library.(Chin J Ophthalmol, 2017, 53: 455-459).

  1. Potassium channel gene mutations rarely cause atrial fibrillation

    Directory of Open Access Journals (Sweden)

    Nam Edwin G

    2006-08-01

    Full Text Available Abstract Background Mutations in several potassium channel subunits have been associated with rare forms of atrial fibrillation. In order to explore the role of potassium channels in inherited typical forms of the arrhythmia, we have screened a cohort of patients from a referral clinic for mutations in the channel subunit genes implicated in the arrhythmia. We sought to determine if mutations in KCNJ2 and KCNE1-5 are a common cause of atrial fibrillation. Methods Serial patients with lone atrial fibrillation or atrial fibrillation with hypertension were enrolled between June 1, 2001 and January 6, 2005. Each patient underwent a standardized interview and physical examination. An electrocardiogram, echocardiogram and blood sample for genetic analysis were also obtained. Patients with a family history of AF were screened for mutations in KCNJ2 and KCNE1-5 using automated sequencing. Results 96 patients with familial atrial fibrillation were enrolled. Eighty-three patients had lone atrial fibrillation and 13 had atrial fibrillation and hypertension. Patients had a mean age of 56 years at enrollment and 46 years at onset of atrial fibrillation. Eighty-one percent of patients had paroxysmal atrial fibrillation at enrollment. Unlike patients with an activating mutation in KCNQ1, the patients had a normal QTc interval with a mean of 412 ± 42 ms. Echocardiography revealed a normal mean ejection fraction of 62.0 ± 7.2 % and mean left atrial dimension of 39.9 ± 7.0 mm. A number of common polymorphisms in KCNJ2 and KCNE1-5 were identified, but no mutations were detected. Conclusion Mutations in KCNJ2 and KCNE1-5 rarely cause typical atrial fibrillation in a referral clinic population.

  2. Heterogeneous AVPR2 gene mutations in congenital nephrogenic diabetes insipidus

    Energy Technology Data Exchange (ETDEWEB)

    Wildin, R.S.; Antush, M.J.; Bennett, R.L.; Schoof, J.M.; Scott, C.R. (Univ. of Washington, Seattle, WA (United States))

    1994-08-01

    Mutations in the AVPR2 gene encoding the receptor for arginine vasopressin in the kidney (V2 ADHR) have been reported in patients with congenital nephrogenic diabetes insipidus, a predominantly X-linked disorder of water homeostasis. The authors have used restriction-enzyme analysis and direct DNA sequencing of genomic PCR product to evaluate the AVPR2 gene in 11 unrelated affected males. Each patient has a different DNA sequence variation, and only one matches a previously reported mutation. Cosegregation of the variations with nephrogenic diabetes insipidus was demonstrated for two families, and a de novo mutation was accomplished in one family. All the variations predict frameshifts, truncations, or nonconservative amino acid substitutions in evolutionarily conserved positions in the V2 ADHR and related receptors. Of interest, a 28-bp deletion is found in one patient, while another, unrelated patient has a tandem duplication of the same 28-bp segment, suggesting that both resulted from the same unusual unequal crossing-over mechanism facilitated by 9-mer direct sequence repeats. Since the V2 ADHR is a member of the seven-transmembrane-domain, G-protein-coupled receptor superfamily, the loss-of-function mutations from this study and others provide important clues to the structure-function relationship of this and related receptors. 55 refs., 4 figs., 2 tabs.

  3. Phospholamban Is Downregulated by pVHL-Mediated Degradation through Oxidative Stress in Failing Heart

    Directory of Open Access Journals (Sweden)

    Shunichi Yokoe

    2017-10-01

    Full Text Available The E3 ubiquitin ligase, von Hippel–Lindau (VHL, regulates protein expression by polyubiquitination. Although the protein VHL (pVHL was reported to be involved in the heart function, the underlying mechanism is unclear. Here, we show that pVHL was upregulated in hearts from two types of genetically dilated cardiomyopathy (DCM mice models. In comparison with the wild-type mouse, both DCM mice models showed a significant reduction in the expression of phospholamban (PLN, a potent inhibitor of sarco(endoplasmic reticulum Ca2+-ATPase, and enhanced interaction between pVHL and PLN. To clarify whether pVHL is involved in PLN degradation in failing hearts, we used carbonylcyanide m-chlorophenylhydrazone (CCCP, a mitochondrial membrane potential (MMP-lowering reagent, to mimic the heart failure condition in PLN-expressing HEK293 cells and found that CCCP treatment resulted in PLN degradation and increased interaction between PLN and pVHL. However, these effects were reversed with the addition of N-acetyl-l-cysteine. Furthermore, the co-transfection of VHL and PLN in HEK293 cells decreased PLN expression under oxidative stress, whereas knockdown of VHL increased PLN expression both under normal and oxidative stress conditions. Together, we propose that oxidative stress upregulates pVHL expression to induce PLN degradation in failing hearts.

  4. Three faces of recombination activating gene 1 (RAG1) mutations.

    Science.gov (United States)

    Patiroglu, Turkan; Akar, Himmet Haluk; Van Der Burg, Mirjam

    2015-12-01

    Severe combined immune deficiency (SCID) is a group of genetic disorder associated with development of T- and/or B-lymphocytes. Recombination-activating genes (RAG1/2) play a critical role on VDJ recombination process that leads to the production of a broad T-cell receptor (TCR) and B-cell receptor (BCR) repertoire in the development of T and B cells. RAG1/2 genes mutations result in various forms of primary immunodeficiency, ranging from classic SCID to Omenn syndrome (OS) to atypical SCID with such as granuloma formation and autoimmunity. Herein, we reported 4 patients with RAG1 deficiency: classic SCID was seen in two patients who presented with recurrent pneumonia and chronic diarrhoea, and failure to thrive. OS was observed in one patient who presented with chronic diarrhoea, skin rash, recurrent lower respiratory infections, and atypical SCID was seen in one patient who presented with Pyoderma gangrenosum (PG) and had novel RAG1 mutation.

  5. FAM20A Gene Mutation: Amelogenesis or Ectopic Mineralization?

    OpenAIRE

    Guilhem Lignon; Fleur Beres; Mickael Quentric; Stephan Rouzière; Raphael Weil; Muriel De La Dure-Molla; Adrien Naveau; Renata Kozyraki; Arnaud Dessombz; Ariane Berdal

    2017-01-01

    Background and objective: FAM20A gene mutations result in enamel renal syndrome (ERS) associated with amelogenesis imperfecta (AI), nephrocalcinosis, gingival fibromatosis, and impaired tooth eruption. FAM20A would control the phosphorylation of enamel peptides and thus enamel mineralization. Here, we characterized the structure and chemical composition of unerupted tooth enamel from ERS patients and healthy subjects. Methods: Tooth sections were analyzed by Scanning Electron Microscopy (S...

  6. Co-inheritance of novel ATRX gene mutation and globin (α & β) gene mutations in transfusion dependent beta-thalassemia patients.

    Science.gov (United States)

    Al-Nafie, Awatif N; Borgio, J Francis; AbdulAzeez, Sayed; Al-Suliman, Ahmed M; Qaw, Fuad S; Naserullah, Zaki A; Al-Jarrash, Sana; Al-Madan, Mohammed S; Al-Ali, Rudaynah A; AlKhalifah, Mohammed A; Al-Muhanna, Fahad; Steinberg, Martin H; Al-Ali, Amein K

    2015-06-01

    α-Thalassemia X-linked mental retardation syndrome is a rare inherited intellectual disability disorder due to mutations in the ATRX gene. In our previous study of the prevalence of β-thalassemia mutations in the Eastern Province of Saudi Arabia, we confirmed the widespread coinheritance of α-thalassemia mutation. Some of these subjects have a family history of mental retardation, the cause of which is unknown. Therefore, we investigated the presence or absence of mutations in the ATRX gene in these patients. Three exons of the ATRX gene and their flanking regions were directly sequenced. Only four female transfusion dependent β-thalassemia patients were found to be carriers of a novel mutation in the ATRX gene. Two of the ATRX gene mutations, c.623delA and c.848T>C were present in patients homozygous for IVS I-5(G→C) and homozygous for Cd39(C → T) β-thalassemia mutation, respectively. While the other two that were located in the intronic region (flanking regions), were present in patients homozygous for Cd39(C → T) β-thalassemia mutation. The two subjects with the mutations in the coding region had family members with mental retardation, which suggests that the novel frame shift mutation and the missense mutation at coding region of ATRX gene are involved in ATRX syndrome. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. ERK5/BMK1 Is a Novel Target of the Tumor Suppressor VHL: Implication in Clear Cell Renal Carcinoma12

    Science.gov (United States)

    Arias-González, Laura; Moreno-Gimeno, Inmaculada; del Campo, Antonio Rubio; Serrano-Oviedo, Leticia; Valero, María Llanos; Esparís-Ogando, Azucena; de la Cruz-Morcillo, Miguel Ángel; Melgar-Rojas, Pedro; García-Cano, Jesús; Cimas, Francisco José; Hidalgo, María José Ruiz; Prado, Alfonso; Callejas-Valera, Juan Luis; Nam-Cha, Syong Hyun; Giménez-Bachs, José Miguel; Salinas-Sánchez, Antonio S; Pandiella, Atanasio; del Peso, Luis; Sánchez-Prieto, Ricardo

    2013-01-01

    Extracellular signal-regulated kinase 5 (ERK5), also known as big mitogen-activated protein kinase (MAPK) 1, is implicated in a wide range of biologic processes, which include proliferation or vascularization. Here, we show that ERK5 is degraded through the ubiquitin-proteasome system, in a process mediated by the tumor suppressor von Hippel-Lindau (VHL) gene, through a prolyl hydroxylation-dependent mechanism. Our conclusions derive from transient transfection assays in Cos7 cells, as well as the study of endogenous ERK5 in different experimental systems such as MCF7, HMEC, or Caki-2 cell lines. In fact, the specific knockdown of ERK5 in pVHL-negative cell lines promotes a decrease in proliferation and migration, supporting the role of this MAPK in cellular transformation. Furthermore, in a short series of fresh samples from human clear cell renal cell carcinoma, high levels of ERK5 correlate with more aggressive and metastatic stages of the disease. Therefore, our results provide new biochemical data suggesting that ERK5 is a novel target of the tumor suppressor VHL, opening a new field of research on the role of ERK5 in renal carcinomas. PMID:23730213

  8. ERK5/BMK1 Is a Novel Target of the Tumor Suppressor VHL: Implication in Clear Cell Renal Carcinoma

    Directory of Open Access Journals (Sweden)

    Laura Arias-González

    2013-06-01

    Full Text Available Extracellular signal-regulated kinase 5 (ERK5, also known as big mitogen-activated protein kinase (MAPK 1, is implicated in a wide range of biologic processes, which include proliferation or vascularization. Here, we show that ERK5 is degraded through the ubiquitin-proteasome system, in a process mediated by the tumor suppressor von Hippel-Lindau (VHL gene, through a prolyl hydroxylation-dependent mechanism. Our conclusions derive from transient transfection assays in Cos7 cells, as well as the study of endogenous ERK5 in different experimental systems such as MCF7, HMEC, or Caki-2 cell lines. In fact, the specific knockdown of ERK5 in pVHL-negative cell lines promotes a decrease in proliferation and migration, supporting the role of this MAPK in cellular transformation. Furthermore, in a short series of fresh samples from human clear cell renal cell carcinoma, high levels of ERK5 correlate with more aggressive and metastatic stages of the disease. Therefore, our results provide new biochemical data suggesting that ERK5 is a novel target of the tumor suppressor VHL, opening a new field of research on the role of ERK5 in renal carcinomas.

  9. Driver Gene Mutations in Stools of Colorectal Carcinoma Patients Detected by Targeted Next-Generation Sequencing.

    Science.gov (United States)

    Armengol, Gemma; Sarhadi, Virinder K; Ghanbari, Reza; Doghaei-Moghaddam, Masoud; Ansari, Reza; Sotoudeh, Masoud; Puolakkainen, Pauli; Kokkola, Arto; Malekzadeh, Reza; Knuutila, Sakari

    2016-07-01

    Detection of driver gene mutations in stool DNA represents a promising noninvasive approach for screening colorectal cancer (CRC). Amplicon-based next-generation sequencing (NGS) is a good option to study mutations in many cancer genes simultaneously and from a low amount of DNA. Our aim was to assess the feasibility of identifying mutations in 22 cancer driver genes with Ion Torrent technology in stool DNA from a series of 65 CRC patients. The assay was successful in 80% of stool DNA samples. NGS results showed 83 mutations in cancer driver genes, 29 hotspot and 54 novel mutations. One to five genes were mutated in 75% of cases. TP53, KRAS, FBXW7, and SMAD4 were the top mutated genes, consistent with previous studies. Of samples with mutations, 54% presented concomitant mutations in different genes. Phosphatidylinositol 3-kinase/mitogen-activated protein kinase pathway genes were mutated in 70% of samples, with 58% having alterations in KRAS, NRAS, or BRAF. Because mutations in these genes can compromise the efficacy of epidermal growth factor receptor blockade in CRC patients, identifying mutations that confer resistance to some targeted treatments may be useful to guide therapeutic decisions. In conclusion, the data presented herein show that NGS procedures on stool DNA represent a promising tool to detect genetic mutations that could be used in the future for diagnosis, monitoring, or treating CRC. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  10. Mutation profile of BBS genes in Iranian patients with Bardet-Biedl syndrome: genetic characterization and report of nine novel mutations in five BBS genes.

    Science.gov (United States)

    Fattahi, Zohreh; Rostami, Parvin; Najmabadi, Amin; Mohseni, Marzieh; Kahrizi, Kimia; Akbari, Mohammad Reza; Kariminejad, Ariana; Najmabadi, Hossein

    2014-07-01

    Bardet-Biedl syndrome (BBS) is a rare ciliopathy disorder that is clinically and genetically heterogeneous with 18 known genes. This study was performed to characterize responsible genes and mutation spectrum in a cohort of 14 Iranian families with BBS. Sanger sequencing of the most commonly mutated genes (BBS1, BBS2 and BBS10) accounting for ∼50% of BBS patients determined mutations only in BBS2, including three novel mutations. Next, three of the remaining patients were subjected to whole exome sequencing with 96% at 20 × depth of coverage that revealed novel BBS4 mutation. Observation of no mutation in the other patients represents the possible presence of novel genes. Screening of the remaining patients for six other genes (BBS3, BBS4, BBS6, BBS7, BBS9 and BBS12) revealed five novel mutations. This result represents another indication for the genetic heterogeneity of BBS and extends the mutational spectrum of the disease by introducing nine novel mutations in five BBS genes. In conclusion, although BBS1 and BBS10 are among the most commonly mutated genes in other populations like Caucasian, these two seem not to have an important role in Iranian patients. This suggests that a different strategy in molecular genetics diagnostic approaches in Middle Eastern countries such as Iran should be considered.

  11. Multiple gene mutations, not the type of mutation, are the modifier of left ventricle hypertrophy in patients with hypertrophic cardiomyopathy.

    Science.gov (United States)

    Zou, Yubao; Wang, Jizheng; Liu, Xuan; Wang, Yilu; Chen, Yi; Sun, Kai; Gao, Shuo; Zhang, Channa; Wang, Zhimin; Zhang, Yin; Feng, Xinxing; Song, Ying; Wu, Yajie; Zhang, Hongju; Jia, Lei; Wang, Hu; Wang, Dong; Yan, Chaowu; Lu, Minjie; Zhou, Xianliang; Song, Lei; Hui, Rutai

    2013-06-01

    Genotype-phenotype correlation of hypertrophic cardiomyopathy (HCM) has been challenging because of the genetic and clinical heterogeneity. To determine the mutation profile of Chinese patients with HCM and to correlate genotypes with phenotypes, we performed a systematic mutation screening of the eight most commonly mutated genes encoding sarcomere proteins in 200 unrelated Chinese adult patients using direct DNA sequencing. A total of 98 mutations were identified in 102 mutation carriers. The frequency of mutations in MYH7, MYBPC3, TNNT2 and TNNI3 was 26.0, 18.0, 4.0 and 3.5 % respectively. Among the 200 genotyped HCM patients, 83 harbored a single mutation, and 19 (9.5 %) harbored multiple mutations. The number of mutations was positively correlated with the maximum wall thickness. We found that neither particular gene nor specific mutation was correlated to clinical phenotype. In summary, the frequency of multiple mutations was greater in Chinese HCM patients than in the Caucasian population. Multiple mutations in sarcomere protein may be a risk factor for left ventricular wall thickness.

  12. HFE gene mutations and iron status of Brazilian blood donors

    Directory of Open Access Journals (Sweden)

    P.C.J.L. Santos

    2010-01-01

    Full Text Available Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542 were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018 and a 83.65% decrease (P = 0.007 in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001 and the HFE 63HD plus DD genotype (55.84%, P = 0.021. In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  13. Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

    Science.gov (United States)

    Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

    2013-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Progression inference for somatic mutations in cancer

    Directory of Open Access Journals (Sweden)

    Leif E. Peterson

    2017-04-01

    Full Text Available Computational methods were employed to determine progression inference of genomic alterations in commonly occurring cancers. Using cross-sectional TCGA data, we computed evolutionary trajectories involving selectivity relationships among pairs of gene-specific genomic alterations such as somatic mutations, deletions, amplifications, downregulation, and upregulation among the top 20 driver genes associated with each cancer. Results indicate that the majority of hierarchies involved TP53, PIK3CA, ERBB2, APC, KRAS, EGFR, IDH1, VHL, etc. Research into the order and accumulation of genomic alterations among cancer driver genes will ever-increase as the costs of nextgen sequencing subside, and personalized/precision medicine incorporates whole-genome scans into the diagnosis and treatment of cancer.

  15. Mutations in the netrin-1 gene cause congenital mirror movements.

    Science.gov (United States)

    Méneret, Aurélie; Franz, Elizabeth A; Trouillard, Oriane; Oliver, Thomas C; Zagar, Yvrick; Robertson, Stephen P; Welniarz, Quentin; Gardner, R J MacKinlay; Gallea, Cécile; Srour, Myriam; Depienne, Christel; Jasoni, Christine L; Dubacq, Caroline; Riant, Florence; Lamy, Jean-Charles; Morel, Marie-Pierre; Guérois, Raphael; Andreani, Jessica; Fouquet, Coralie; Doulazmi, Mohamed; Vidailhet, Marie; Rouleau, Guy A; Brice, Alexis; Chédotal, Alain; Dusart, Isabelle; Roze, Emmanuel; Markie, David

    2017-09-25

    Netrin-1 is a secreted protein that was first identified 20 years ago as an axon guidance molecule that regulates midline crossing in the CNS. It plays critical roles in various tissues throughout development and is implicated in tumorigenesis and inflammation in adulthood. Despite extensive studies, no inherited human disease has been directly associated with mutations in NTN1, the gene coding for netrin-1. Here, we have identified 3 mutations in exon 7 of NTN1 in 2 unrelated families and 1 sporadic case with isolated congenital mirror movements (CMM), a disorder characterized by involuntary movements of one hand that mirror intentional movements of the opposite hand. Given the diverse roles of netrin-1, the absence of manifestations other than CMM in NTN1 mutation carriers was unexpected. Using multimodal approaches, we discovered that the anatomy of the corticospinal tract (CST) is abnormal in patients with NTN1-mutant CMM. When expressed in HEK293 or stable HeLa cells, the 3 mutated netrin-1 proteins were almost exclusively detected in the intracellular compartment, contrary to WT netrin-1, which is detected in both intracellular and extracellular compartments. Since netrin-1 is a diffusible extracellular cue, the pathophysiology likely involves its loss of function and subsequent disruption of axon guidance, resulting in abnormal decussation of the CST.

  16. Screening of sarcomere gene mutations in young athletes with abnormal findings in electrocardiography: identification of a MYH7 mutation and MYBPC3 mutations.

    Science.gov (United States)

    Kadota, Chika; Arimura, Takuro; Hayashi, Takeharu; Naruse, Taeko K; Kawai, Sachio; Kimura, Akinori

    2015-10-01

    There is an overlap between the physiological cardiac remodeling associated with training in athletes, the so-called athlete's heart, and mild forms of hypertrophic cardiomyopathy (HCM), the most common hereditary cardiac disease. HCM is often accompanied by unfavorable outcomes including a sudden cardiac death in the adolescents. Because one of the initial signs of HCM is abnormality in electrocardiogram (ECG), athletes may need to monitor for ECG findings to prevent any unfavorable outcomes. HCM is caused by mutations in genes for sarcomere proteins, but there is no report on the systematic screening of gene mutations in athletes. One hundred and two genetically unrelated young Japanese athletes with abnormal ECG findings were the subjects for the analysis of four sarcomere genes, MYH7, MYBPC3, TNNT2 and TNNI3. We found that 5 out of 102 (4.9%) athletes carried mutations: a heterozygous MYH7 Glu935Lys mutation, a heterozygous MYBPC3 Arg160Trp mutation and another heterozygous MYBPC3 Thr1046Met mutation, all of which had been reported as HCM-associated mutations, in 1, 2 and 2 subjects, respectively. This is the first study of systematic screening of sarcomere gene mutations in a cohort of athletes with abnormal ECG, demonstrating the presence of sarcomere gene mutations in the athlete's heart.

  17. Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa

    Science.gov (United States)

    Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.

    2015-01-01

    Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133

  18. BSE case associated with prion protein gene mutation.

    Directory of Open Access Journals (Sweden)

    Jürgen A Richt

    2008-09-01

    Full Text Available Bovine spongiform encephalopathy (BSE is a transmissible spongiform encephalopathy (TSE of cattle and was first detected in 1986 in the United Kingdom. It is the most likely cause of variant Creutzfeldt-Jakob disease (CJD in humans. The origin of BSE remains an enigma. Here we report an H-type BSE case associated with the novel mutation E211K within the prion protein gene (Prnp. Sequence analysis revealed that the animal with H-type BSE was heterozygous at Prnp nucleotides 631 through 633. An identical pathogenic mutation at the homologous codon position (E200K in the human Prnp has been described as the most common cause of genetic CJD. This finding represents the first report of a confirmed case of BSE with a potential pathogenic mutation within the bovine Prnp gene. A recent epidemiological study revealed that the K211 allele was not detected in 6062 cattle from commercial beef processing plants and 42 cattle breeds, indicating an extremely low prevalence of the E211K variant (less than 1 in 2000 in cattle.

  19. Cystic fibrosis gene mutations: evaluation and assessment of disease severity

    Directory of Open Access Journals (Sweden)

    Vallières E

    2014-10-01

    Full Text Available Emilie Vallières, Joseph Stuart ElbornCystic Fibrosis and Airways Microbiology Research Group, Queens University Belfast, Belfast, UKAbstract: The cystic fibrosis transmembrane regulator (CFTR gene encodes an ion channel transporter, the CFTR protein. Since its identification in 1989, more than 1,900 sequence variants have been reported, resulting in a wide spectrum of clinical phenotypes. Cystic fibrosis (CF is associated with many CFTR mutants and there is a continuum of disease severity observed. Recent advances in fundamental research have increased our understanding of the consequent molecular defect arising from CF mutations. This knowledge has resulted in the development of CF-specific therapies, targeting either the genetic or the molecular defect. CF care, previously focused on symptom control, is therefore moving toward a "stratified" or "precision" therapeutic approach. This review outlines normal CFTR physiology, the proposed pathologic mechanism underlying CF associated-lung injury, classification of CF mutations, and the CF-specific therapies recently approved or in clinical trials.Keywords: cystic fibrosis, gene mutations, disease severity, evaluation, assessment

  20. Muscle pathology in 31 patients with calpain 3 gene mutations..

    Science.gov (United States)

    Nadaj-Pakleza, Aleksandra A; Dorobek, M; Nestorowicz, K; Ryniewicz, B; Szmidt-Sałkowska, E; Kamińska, A M

    2013-01-01

    At present, more than 20 different forms of limb-girdle muscular dystrophies (LGMDs) are known (at least 7 autosomal dominant and 14 autosomal recessive). Although these different forms show some typical phenotypic characteristics, the existing clinical overlap makes their differential diagnosis difficult. Limb-girdle muscular dystrophy type 2 (LGMD2A) is the most prevalent LGMD in many European as well as Brazilian communities and is caused by mutations in the gene CAPN3. Laboratory testing, such as calpain immunohistochemistry and Western-blot analysis, is not totally reliable, since up to 20% of molecularly confirmed LGMD2A show normal content of calpain 3 and a third of LGMD2A biopsies have normal calpain 3 proteo-lytic activity in the muscle. Thus, genetic testing is considered as the only reliable diagnostic criterion in LGMD2A. In an attempt to find a correlation between genotype and muscle pathology in limb-girdle muscular dystrophy 2A we performed histopathological investigation of a group of 31 patients subdivided according to the type of pathologic CAPN3 gene mutation. In all biopsies typical features of muscular dystrophy such as fiber necrosis and regeneration, variation in fiber size and fibrosis were noted. Lobulated fibers were often encountered in the muscle biopsies of LGMD2A patients. Such fibers were more frequent in patients with 550delA mutation. These findings may be helpful in establishing diagnostic strategies in LGMD.

  1. LNDriver: identifying driver genes by integrating mutation and expression data based on gene-gene interaction network.

    Science.gov (United States)

    Wei, Pi-Jing; Zhang, Di; Xia, Junfeng; Zheng, Chun-Hou

    2016-12-23

    Cancer is a complex disease which is characterized by the accumulation of genetic alterations during the patient's lifetime. With the development of the next-generation sequencing technology, multiple omics data, such as cancer genomic, epigenomic and transcriptomic data etc., can be measured from each individual. Correspondingly, one of the key challenges is to pinpoint functional driver mutations or pathways, which contributes to tumorigenesis, from millions of functional neutral passenger mutations. In this paper, in order to identify driver genes effectively, we applied a generalized additive model to mutation profiles to filter genes with long length and constructed a new gene-gene interaction network. Then we integrated the mutation data and expression data into the gene-gene interaction network. Lastly, greedy algorithm was used to prioritize candidate driver genes from the integrated data. We named the proposed method Length-Net-Driver (LNDriver). Experiments on three TCGA datasets, i.e., head and neck squamous cell carcinoma, kidney renal clear cell carcinoma and thyroid carcinoma, demonstrated that the proposed method was effective. Also, it can identify not only frequently mutated drivers, but also rare candidate driver genes.

  2. Simultaneous mutation detection of three homoeologous genes in wheat by High Resolution Melting analysis and Mutation Surveyor®

    Directory of Open Access Journals (Sweden)

    Vincent Kate

    2009-12-01

    Full Text Available Abstract Background TILLING (Targeting Induced Local Lesions IN Genomes is a powerful tool for reverse genetics, combining traditional chemical mutagenesis with high-throughput PCR-based mutation detection to discover induced mutations that alter protein function. The most popular mutation detection method for TILLING is a mismatch cleavage assay using the endonuclease CelI. For this method, locus-specific PCR is essential. Most wheat genes are present as three similar sequences with high homology in exons and low homology in introns. Locus-specific primers can usually be designed in introns. However, it is sometimes difficult to design locus-specific PCR primers in a conserved region with high homology among the three homoeologous genes, or in a gene lacking introns, or if information on introns is not available. Here we describe a mutation detection method which combines High Resolution Melting (HRM analysis of mixed PCR amplicons containing three homoeologous gene fragments and sequence analysis using Mutation Surveyor® software, aimed at simultaneous detection of mutations in three homoeologous genes. Results We demonstrate that High Resolution Melting (HRM analysis can be used in mutation scans in mixed PCR amplicons containing three homoeologous gene fragments. Combining HRM scanning with sequence analysis using Mutation Surveyor® is sensitive enough to detect a single nucleotide mutation in the heterozygous state in a mixed PCR amplicon containing three homoeoloci. The method was tested and validated in an EMS (ethylmethane sulfonate-treated wheat TILLING population, screening mutations in the carboxyl terminal domain of the Starch Synthase II (SSII gene. Selected identified mutations of interest can be further analysed by cloning to confirm the mutation and determine the genomic origin of the mutation. Conclusion Polyploidy is common in plants. Conserved regions of a gene often represent functional domains and have high sequence

  3. Molecular basis of human CD36 gene mutations.

    Science.gov (United States)

    Rać, Monika Ewa; Safranow, Krzysztof; Poncyljusz, Wojciech

    2007-01-01

    CD36 is a transmembrane glycoprotein of the class B scavenger receptor family. The CD36 gene is located on chromosome 7 q11.2 and is encoded by 15 exons. Defective CD36 is a likely candidate gene for impaired fatty acid metabolism, glucose intolerance, atherosclerosis, arterial hypertension, diabetes, cardiomyopathy, Alzheimer disease, and modification of the clinical course of malaria. Contradictory data concerning the effects of antiatherosclerotic drugs on CD36 expression indicate that further investigation of the role of CD36 in the development of atherosclerosis may be important for the prevention and treatment of this disease. This review summarizes current knowledge of CD36 gene structure, splicing, and mutations and the molecular, metabolic, and clinical consequences of these phenomena.

  4. Common filaggrin gene mutations and risk of cervical cancer

    DEFF Research Database (Denmark)

    Bager, Peter; Wohlfahrt, Jan; Sørensen, Erik

    2015-01-01

    mutations, R501X and 2282del4, using blood from the Copenhagen Hospital Biobank, Denmark. Controls (n = 8050) were genotyped in previous population-based studies. Information on cervical cancer, mortality and emigration were obtained from national registers. Odds ratios (OR) were estimated by logistic......BACKGROUND: As carriers of filaggrin gene (FLG) mutations may have a compromised cervical mucosal barrier against human papillomavirus infection, our primary objective was to study their risk of cervical cancer. METHODS: We genotyped 586 cervical cancer patients for the two most common FLG...... regression with adjustment for age at blood sampling, and weighted by the genotype-specific inverse probability of death between diagnosis and sampling. Hazard ratios (HR) were estimated by Cox regression with time since diagnosis as underlying time, and with adjustment for age at diagnosis...

  5. Data mining approach to predict BRCA1 gene mutation

    Directory of Open Access Journals (Sweden)

    Olegas Niakšu

    2013-09-01

    Full Text Available Breast cancer is the most frequent women cancer form and one of the leading mortality causes among women around the world. Patients with pathological mutation of a BRCA gene have 65% lifelong breast cancer probability. It is known that such patients have different cause of illness. In this study, we have proposed a new approach for the prediction of BRCA mutation carriers by methodically applying knowledge discovery steps and utilizing data mining methods. An alternative BRCA risk assessment model has been created utilizing decision tree classifier model. The biggest challenge was a very small size and imbalanced nature of the initial dataset, which have been collected by clinicians during 4 years of clinical trial. Iterative optimization of initial dataset, optimal algorithms selection and their parameterization have resulted in higher classifier model performance, with acceptable prediction accuracy for the clinical usage. In this study, three data mining problems have been analyzed using eleven data mining algorithms.

  6. 40 CFR 798.5300 - Detection of gene mutations in somatic cells in culture.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true Detection of gene mutations in somatic....5300 Detection of gene mutations in somatic cells in culture. (a) Purpose. Mammalian cell culture systems may be used to detect mutations induced by chemical substances. Widely used cell lines include...

  7. Identification of Gene Mutations and Fusion Genes in Patients with Sézary Syndrome.

    Science.gov (United States)

    Prasad, Aparna; Rabionet, Raquel; Espinet, Blanca; Zapata, Luis; Puiggros, Anna; Melero, Carme; Puig, Anna; Sarria-Trujillo, Yaris; Ossowski, Stephan; Garcia-Muret, Maria P; Estrach, Teresa; Servitje, Octavio; Lopez-Lerma, Ingrid; Gallardo, Fernando; Pujol, Ramon M; Estivill, Xavier

    2016-07-01

    Sézary syndrome is a leukemic form of cutaneous T-cell lymphoma with an aggressive clinical course. The genetic etiology of the disease is poorly understood, with chromosomal abnormalities and mutations in some genes being involved in the disease. The goal of our study was to understand the genetic basis of the disease by looking for driver gene mutations and fusion genes in 15 erythrodermic patients with circulating Sézary cells, 14 of them fulfilling the diagnostic criteria of Sézary syndrome. We have discovered genes that could be involved in the pathogenesis of Sézary syndrome. Some of the genes that are affected by somatic point mutations include ITPR1, ITPR2, DSC1, RIPK2, IL6, and RAG2, with some of them mutated in more than one patient. We observed several somatic copy number variations shared between patients, including deletions and duplications of large segments of chromosome 17. Genes with potential function in the T-cell receptor signaling pathway and tumorigenesis were disrupted in Sézary syndrome patients, for example, CBLB, RASA2, BCL7C, RAMP3, TBRG4, and DAD1. Furthermore, we discovered several fusion events of interest involving RASA2, NFKB2, BCR, FASN, ZEB1, TYK2, and SGMS1. Our work has implications for the development of potential therapeutic approaches for this aggressive disease. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.

    Science.gov (United States)

    Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle

    2016-10-01

    Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.

  9. Systematic analysis of somatic mutations impacting gene expression in 12 tumour types

    Science.gov (United States)

    Ding, Jiarui; McConechy, Melissa K.; Horlings, Hugo M.; Ha, Gavin; Chun Chan, Fong; Funnell, Tyler; Mullaly, Sarah C.; Reimand, Jüri; Bashashati, Ali; Bader, Gary D.; Huntsman, David; Aparicio, Samuel; Condon, Anne; Shah, Sohrab P.

    2015-01-01

    We present a novel hierarchical Bayes statistical model, xseq, to systematically quantify the impact of somatic mutations on expression profiles. We establish the theoretical framework and robust inference characteristics of the method using computational benchmarking. We then use xseq to analyse thousands of tumour data sets available through The Cancer Genome Atlas, to systematically quantify somatic mutations impacting expression profiles. We identify 30 novel cis-effect tumour suppressor gene candidates, enriched in loss-of-function mutations and biallelic inactivation. Analysis of trans-effects of mutations and copy number alterations with xseq identifies mutations in 150 genes impacting expression networks, with 89 novel predictions. We reveal two important novel characteristics of mutation impact on expression: (1) patients harbouring known driver mutations exhibit different downstream gene expression consequences; (2) expression patterns for some mutations are stable across tumour types. These results have critical implications for identification and interpretation of mutations with consequent impact on transcription in cancer. PMID:26436532

  10. Angelman Syndrome Due to UBE3A Gene Mutation.

    Science.gov (United States)

    Goswami, Jyotindra Narayan; Sahu, Jitendra Kumar; Singhi, Pratibha

    2017-12-18

    A 12-y-old boy presented with developmental delay, autism, epilepsy, limb tremors and behavioral problems which posed a diagnostic challenge. Though his clinical profile and electroencephalogram were suggestive of Angelman syndrome, initial genetic tests were unyielding. Exome sequencing revealed a previously unreported mutation of Ubiquitin Protein Ligase E3A (UBE3A) gene, confirming the diagnosis of Angelman syndrome. The case is aimed to sensitize pediatricians about Angelman syndrome and to highlight the role of sequential investigations in establishing the diagnosis.

  11. Mutations within the MGC4607 gene cause cerebral cavernous malformations.

    Science.gov (United States)

    Denier, C; Goutagny, S; Labauge, P; Krivosic, V; Arnoult, M; Cousin, A; Benabid, A L; Comoy, J; Frerebeau, P; Gilbert, B; Houtteville, J P; Jan, M; Lapierre, F; Loiseau, H; Menei, P; Mercier, P; Moreau, J J; Nivelon-Chevallier, A; Parker, F; Redondo, A M; Scarabin, J M; Tremoulet, M; Zerah, M; Maciazek, J; Tournier-Lasserve, E

    2004-02-01

    Cerebral cavernous malformations (CCM) are hamartomatous vascular malformations characterized by abnormally enlarged capillary cavities without intervening brain parenchyma. They cause seizures and focal neurological deficits due to cerebral hemorrhages. CCM loci have already been assigned to chromosomes 7q (CCM1), 7p (CCM2), and 3q (CCM3) and have been identified in 40%, 20%, and 40%, respectively, of families with CCM. Loss-of-function mutations have been identified in CCM1/KRIT1, the sole CCM gene identified to date. We report here the identification of MGC4607 as the CCM2 gene. We first reduced the size of the CCM2 interval from 22 cM to 7.5 cM by genetic linkage analysis. We then hypothesized that large deletions might be involved in the disorder, as already reported in other hamartomatous conditions, such as tuberous sclerosis or neurofibromatosis. We performed a high-density microsatellite genotyping of this 7.5-cM interval to search for putative null alleles in 30 unrelated families, and we identified, in 2 unrelated families, null alleles that were the result of deletions within a 350-kb interval flanked by markers D7S478 and D7S621. Additional microsatellite and single-nucleotide polymorphism genotyping showed that these two distinct deletions overlapped and that both of the two deleted the first exon of MGC4607, a known gene of unknown function. In both families, one of the two MGC4607 transcripts was not detected. We then identified eight additional point mutations within MGC4607 in eight of the remaining families. One of them led to the alteration of the initiation codon and five of them to a premature termination codon, including one nonsense, one frameshift, and three splice-site mutations. All these mutations cosegregated with the disease in the families and were not observed in 192 control chromosomes. MGC4607 is so far unrelated to any known gene family. Its implication in CCMs strongly suggests that it is a new player in vascular morphogenesis.

  12. Genetic syndromes caused by mutations in epigenetic genes.

    Science.gov (United States)

    Berdasco, María; Esteller, Manel

    2013-04-01

    The orchestrated organization of epigenetic factors that control chromatin dynamism, including DNA methylation, histone marks, non-coding RNAs (ncRNAs) and chromatin-remodeling proteins, is essential for the proper function of tissue homeostasis, cell identity and development. Indeed, deregulation of epigenetic profiles has been described in several human pathologies, including complex diseases (such as cancer, cardiovascular and neurological diseases), metabolic pathologies (type 2 diabetes and obesity) and imprinting disorders. Over the last decade it has become increasingly clear that mutations of genes involved in epigenetic mechanism, such as DNA methyltransferases, methyl-binding domain proteins, histone deacetylases, histone methylases and members of the SWI/SNF family of chromatin remodelers are linked to human disorders, including Immunodeficiency Centromeric instability Facial syndrome 1, Rett syndrome, Rubinstein-Taybi syndrome, Sotos syndrome or alpha-thalassemia/mental retardation X-linked syndrome, among others. As new members of the epigenetic machinery are described, the number of human syndromes associated with epigenetic alterations increases. As recent examples, mutations of histone demethylases and members of the non-coding RNA machinery have recently been associated with Kabuki syndrome, Claes-Jensen X-linked mental retardation syndrome and Goiter syndrome. In this review, we describe the variety of germline mutations of epigenetic modifiers that are known to be associated with human disorders, and discuss the therapeutic potential of epigenetic drugs as palliative care strategies in the treatment of such disorders.

  13. Mutation analysis of ATP7B gene in Turkish Wilson disease patients: identification of five novel mutations.

    Science.gov (United States)

    Simsek Papur, Ozlenen; Akman, Sezin Asik; Cakmur, Raif; Terzioglu, Orhan

    2013-04-01

    Wilson disease is an autosomal recessive disorder of copper metabolism caused by mutations in the ATP7B gene that encodes a P-type copper transporting ATPase. The aim of this study was to screen and detect mutations of the ATP7B gene in unrelated Turkish Wilson disease patients (n = 46) and control group (n = 52). Mutations were screened and detected by DNA sequencing. 30 out of 46 patients had mutations. 24 different Wilson disease related mutations were identified in those patients. The distribution of mutations in ATP7B gene was as follow: 17 missense, 3 nonsense, 1 silent, 3 frameshift (1 insertion, 2 deletion). None of them were not found in the control group. Five out of 24 mutations were found to be novel. Four of them were missense (c.2363C > T, c.3106G > A, c.3451C > T, c.3733C > A). The last one was deletion (c.3111delC). 10 single nucleotide polymorphisms (SNPs) given in the literature were found in both control and patients groups. Moreover one new polymorphism in exon 18 (c.3727G > A) not reported previously was discovered in both groups. It was striking that most of the mutations were found in exons 8, 12-14. This is the first study covering Turkish Wilson disease patients and control groups for mutation screening in all the coding regions of ATP7B gene by DNA sequencing method and adding five new mutations and one polymorphism into the HUGO Wilson disease mutation database. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. Epidural Analgesia with Ropivacaine during Labour in a Patient with a SCN5A Gene Mutation

    Directory of Open Access Journals (Sweden)

    A. L. M. J. van der Knijff-van Dortmont

    2016-01-01

    Full Text Available SCN5A gene mutations can lead to ion channel defects which can cause cardiac conduction disturbances. In the presence of specific ECG characteristics, this mutation is called Brugada syndrome. Many drugs are associated with adverse events, making anesthesia in patients with SCN5A gene mutations or Brugada syndrome challenging. In this case report, we describe a pregnant patient with this mutation who received epidural analgesia using low dose ropivacaine and sufentanil during labour.

  15. Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

    Science.gov (United States)

    Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

    2015-05-01

    This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

  16. NPHS1 gene mutations confirm congenital nephrotic syndrome in four Brazilian cases: A novel mutation is described.

    Science.gov (United States)

    Guaragna, Mara S; Cleto, Thaís Lira; Souza, Marcela Lopes; Lutaif, Anna Cristina G B; de Castro, Luiz Cláudio Gonçalves; Penido, Maria Goretti Moreira Guimarães; Maciel-Guerra, Andréa T; Belangero, Vera M S; Guerra-Junior, Gil; De Mello, Maricilda P

    2016-09-01

    Autosomal recessive mutations in NPHS1 gene are a common cause of congenital nephrotic syndrome (CNS). The disorder is characterized by massive proteinuria that manifests in utero or in the neonatal period during the first 3 months of life. NPHS1 encodes nephrin, a member of the immunoglobulin family of cell adhesion molecules and the main protein expressed at the renal slit diaphragm. Currently, there are approximately 250 mutations described in the NPHS1 gene distributed among all nephrin domains. The main objective of this study was to perform the analysis of the NPHS1 gene in patients with congenital nephrotic syndrome in order to determine the molecular cause of the disease. Direct sequencing of NPHS1 gene in four children was performed. Each patient was heterozygous for two pathogenic mutations disclosing the molecular cause of the disease in 100% of the cases. We identified six different mutations, consisting of one in-frame deletion, one frameshift, and four missense substitutions. The p.Val736Met mutation that is described here for the first time was considered pathogenic by different mutation predictive algorithms. Regardless of the type of mutation, three patients had a bad outcome and died Despite the small size of the cohort, this study contributed to the increasing number of deleterious mutations in the NPHS1 gene by describing a new mutation. Also, since we identified NPHS1 pathogenic mutations as the cause of the disease in all cases analyzed, it might be a frequent cause of CNS in the South Eastern region of Brazil, although the analysis of a larger sample is required to obtain more indicative epidemiological data. © 2015 Asian Pacific Society of Nephrology.

  17. Cytogenetic Profile and Gene Mutations of Childhood Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Nawaf Alkhayat

    2017-07-01

    Full Text Available Background: Childhood acute lymphoblastic leukemia (ALL is characterized by recurrent genetic aberrations. The identification of those abnormalities is clinically important because they are considered significant risk-stratifying markers. Aims: There are insufficient data of cytogenetic profiles in Saudi Arabian patients with childhood ALL leukemia. We have examined a cohort of 110 cases of ALL to determine the cytogenetic profiles and prevalence of FLT3 mutations and analysis of the more frequently observed abnormalities and its correlations to other biologic factors and patient outcomes and to compare our results with previously published results. Materials and methods: Patients —We reviewed all cases from 2007 to 2016 with an established diagnosis of childhood ALL. Of the 110 patients, 98 were B-lineage ALL and 12 T-cell ALL. All the patients were treated by UKALL 2003 protocol and risk stratified according previously published criteria. Cytogenetic analysis —Chromosome banding analysis and fluorescence in situ hybridization were used to detect genetic aberrations. Analysis of FLT3 mutations —Bone marrow or blood samples were screened for FLT3 mutations (internal tandem duplications, and point mutations, D835 using polymerase chain reaction methods. Result: Cytogenetic analysis showed chromosomal anomalies in 68 out of 102 cases with an overall incidence 66.7%. The most frequent chromosomal anomalies in ALL were hyperdiploidy, t(9;22, t(12;21, and MLL gene rearrangements. Our data are in accordance with those published previously and showed that FLT3 mutations are not common in patients with ALL (4.7% and have no prognostic relevance in pediatric patients with ALL. On the contrary, t(9;22, MLL gene rearrangements and hypodiploidy were signs of a bad prognosis in childhood ALL with high rate of relapse and shorter overall survival compared with the standard-risk group ( P  = .031.The event-free survival was also found to be worse ( P

  18. Autosomal dominant hereditary spastic paraplegia: Novel mutations in the REEP1 gene (SPG31

    Directory of Open Access Journals (Sweden)

    Epplen Joerg T

    2008-07-01

    Full Text Available Abstract Background Mutations in the SPG4 gene (spastin and in the SPG3A gene (atlastin account for the majority of 'pure' autosomal dominant form of hereditary spastic paraplegia (HSP. Recently, mutations in the REEP1 gene were identified to cause autosomal dominant HSP type SPG31. The purpose of this study was to determine the prevalence of REEP1 mutations in a cohort of 162 unrelated Caucasian index patients with 'pure' HSP and a positive family history (at least two persons per family presented symptoms. Methods 162 patients were screened for mutations by, both, DHPLC and direct sequencing. Results Ten mutations were identified in the REEP1 gene, these included eight novel mutations comprising small insertions/deletions causing frame shifts and subsequently premature stop codons, one nonsense mutation and one splice site mutation as well as two missense mutations. Both missense mutations and the splice site mutation were not identified in 170 control subjects. Conclusion In our HSP cohort we found pathogenic mutations in 4.3% of cases with autosomal dominant inheritance. Our results confirm the previously observed mutation range of 3% to 6.5%, respectively, and they widen the spectrum of REEP1 mutations.

  19. Preimplantational genetic diagnosis and mutation detection in a family with duplication mutation of DMD gene.

    Science.gov (United States)

    Ye, Yinghui; Yu, Ping; Yong, Jing; Zhang, Ting; Wei, Xiaoming; Qi, Ming; Jin, Fan

    2014-01-01

    Duchenne muscular dystrophy (DMD) is an X-linked recessive neuromuscular disease caused by mutation in the DMD gene. A 38-year-old woman was referred to our hospital with her son who was diagnosed with DMD. Multiplex PCR failed to detect DMD mutations in the affected child. The female carrier underwent preimplantation genetic diagnosis by linkage analysis and gender determination. Eight embryos were biopsied after in vitro fertilization. Two healthy embryos determined both as females (E1 and E3) were transferred. Although the paternal allele was absent in E3, it was considered to be a result of allele dropout for the STR-49 marker. Surprisingly, a female and a male baby were delivered at 38 gestational weeks, suggesting that E3 was a male embryo with the allele dropout occurring at the SRY gene. Exon 2 duplication was detected in the DMD patient and the carrier mother using next-generation sequencing and multiple ligation-dependent probe amplification. Next, we verified the duplication of exon 2 by real-time PCR, using a special primer at 3' of intron 1, very close to exon 2. Finally, we confirmed that both newborns inherited the normal allele, using quantitative real-time PCR and linkage analysis. © 2014 S. Karger AG, Basel.

  20. Mutation analysis of the Fanconi Anemia Gene FACC

    Energy Technology Data Exchange (ETDEWEB)

    Verlander, P.C.; Lin, J.D.; Udono, M.U.; Zhang, Q.; Auerbach, A.D. (Rockefeller Univ., New York, NY (United States)); Gibson, R.A.; Mathew, C.G. (Guy' s Hospital, London (United Kingdom))

    1994-04-01

    Fanconi anemia (FA) is a genetically heterogeneous autosomal recessive disorder characterized by a unique hypersensitivity of cells to DNA cross-linking agents; a gene for complementation group C (FACC) has recently been cloned. The authors have amplified FACC exons with their flanking intron sequences from genomic DNA from 174 racially and ethnically diverse families in the International Fanconi Anemia Registry and have screened for mutations by using SSCP analysis. They have identified eight different variants in 32 families; three were detected in exon 1, one in exon 4, one in intron 4, two in exon 6, and one in exon 14. Two of the eight variants, in seven families, did not segregate with the disease allele in multiplex families, suggesting that these variants represented benign polymorphisms. Disease-associated mutations in FACC were detected in a total of 25 (14.4%) of 174 families screened. The most frequent mutations were IVS4 + 4 A [yields] T (intron 4; 12 families) and 322delG (exon 1; 9 families). Other, less common mutations include Q13X in exon 1, R185X and D195V in exon 6, and L554P in exon 14. The polymorphisms were S26F in exon 1 and G139E in exon 4. All patients in the study with 322delG, Q13X, R185X, and D195V are of northern or eastern European or southern Italian ancestry, and 18 of 19 have a mild form of the disease, while the 2 patients with L554P, both from the same family, have a severe phenotype. All 19 patients with IVS4 + 4 A [yields] T have Jewish ancestry and have a severe phenotype. 19 refs., 1 fig., 3 tabs.

  1. RAI1 gene mutations: mechanisms of Smith–Magenis Syndrome

    Directory of Open Access Journals (Sweden)

    Falco M

    2017-11-01

    Full Text Available Mariateresa Falco,1,* Sonia Amabile,1,* Fabio Acquaviva2 1Department of Molecular Medicine and Medical Biotechnology, University of Naples “Federico II”, Naples, Italy; 2Department of Translational Medical Sciences (DISMET, Section of Pediatric Clinical Genetics, University of Naples “Federico II”, Naples, Italy *These authors contributed equally to this work Abstract: Smith–Magenis syndrome (SMS; OMIM #182290 is a complex genetic disorder characterized by distinctive physical features, developmental delay, cognitive impairment, and a typical behavioral phenotype. SMS is caused by interstitial 17p11.2 deletions, encompassing multiple genes and including the retinoic acid-induced 1 gene (RAI1, or by mutations in RAI1 itself. About 10% of all the SMS patients, in fact, carry an RAI1 mutation responsible for the phenotype. RAI1 (OMIM *607642 is a dosage-sensitive gene expressed in many tissues and highly conserved among species. Over the years, several studies have demonstrated that RAI1 (or its homologs in animal models acts as a transcriptional factor implicated in embryonic neurodevelopment, neuronal differentiation, cell growth and cell cycle regulation, bone and skeletal development, lipid and glucose metabolisms, behavioral functions, and circadian activity. Patients with RAI1 pathogenic variants show some phenotypic differences when compared to those carrying the typical deletion. They usually have lower incidence of hypotonia and less cognitive impairment than those with 17p11.2 deletions but more frequently show the behavioral characteristics of the syndrome and overeating issues. These differences reflect the primary pathogenetic role of RAI1 without the pathogenetic contribution of the other genes included in the typical 17p11.2 deletion. The better comprehension of physiological roles of RAI1, its molecular co-workers and interactors, and its contribution in determining the typical SMS phenotype will certainly open a new path

  2. Mutation analysis of the HBB gene in selected Bangladeshi beta-thalassemic individuals: presence of rare mutations.

    Science.gov (United States)

    Ibn Ayub, Mustak; Moosa, Mahdi Muhammad; Sarwardi, Golam; Khan, Waqar; Khan, Haseena; Yeasmin, Sabina

    2010-06-01

    Bangladesh has a large number of thalassemic patients. However, no extensive analysis of the mutations in the HBB gene of thalassemic patients has been previously carried out. We have conducted a systematic research to reveal thalassemia mutations in the Bangladeshi population. In this preliminary analysis of 587 bp of the HBB gene in selected thalassemic individuals, some rare mutations in world perspective have been found to be significantly high in the Bangladeshi population, together with the common mutations for thalassemia. A 587-bp segment of the HBB gene from 32 chromosomes of 16 beta-thalassemic individuals was analyzed for molecular characterization of the disease. Splice junction mutation IVS-I-5 was found to be the most common. The analysis also revealed some rare mutations HBB: c.-80T>C, HBB: c. 92G>C, HBB: c-92C>G, which are not prevalent in geographically adjacent populations. This is a first of this kind of study in the Bangladeshi population. Although the small sample size makes it difficult to make any population genetics inference, this study can be regarded as the seminal research for a large-scale study to determine the complete mutation profile underlying thalassemia in the Bangladeshi population. The complete mutation profile will provide invaluable strategies (e.g., prenatal diagnosis and genetic counseling) for better management of thalassemia in the Bangladeshi population.

  3. Exome mutation burden predicts clinical outcome in ovarian cancer carrying mutated BRCA1 and BRCA2 genes

    DEFF Research Database (Denmark)

    Birkbak, Nicolai Juul; Kochupurakkal, Bose; Gonzalez-Izarzugaza, Jose Maria

    2013-01-01

    Reliable biomarkers predicting resistance or sensitivity to anti-cancer therapy are critical for oncologists to select proper therapeutic drugs in individual cancer patients. Ovarian and breast cancer patients carrying germline mutations in BRCA1 or BRCA2 genes are often sensitive to DNA damaging...... drugs and relative to non-mutation carriers present a favorable clinical outcome following therapy. Genome sequencing studies have shown a high number of mutations in the tumor genome in patients carrying BRCA1 or BRCA2 mutations (mBRCA). The present study used exome-sequencing and SNP 6 array data...... had either germlines or somatic mutations of BRCA1 or BRCA2 genes. The results revealed that the Nmut was significantly lower in the chemotherapy-resistant mBRCA HGSOC defined by progression within 6 months after completion of first line platinum-based chemotherapy. We found a significant association...

  4. Phenotype and clinical course in a family with a new de novo Twinkle gene mutation

    DEFF Research Database (Denmark)

    Jeppesen, Tina Dysgaard; Schwartz, M.; Colding-Jorgensen, E.

    2008-01-01

    The Twinkle gene product is important for mtDNA replication. Only a few reports have investigated the clinically effect of mutations in this gene. We describe a new de novo mutation (1110C > A) in the PEO1 gene in a mother and her two sons. The mother had progressive ophthalmoplegia, limb weakness...

  5. Interaction between Mutations and Regulation of Gene Expression during Development of de novo Antibiotic Resistance

    NARCIS (Netherlands)

    Händel, N.; Schuurmans, J.M.; Feng, Y.; Brul, S.; ter Kuile, B.H.

    2014-01-01

    Bacteria can become resistant not only by horizontal gene transfer or other forms of exchange of genetic information, but also de novo by adaptation at the gene expression level and through DNA mutations. The interrelationship between changes in gene expression and DNA mutations during acquisition

  6. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  7. The heterozygote advantage of the Chuvash polycythemia VHLR200W mutation may be protection against anemia.

    Science.gov (United States)

    Miasnikova, Galina Y; Sergueeva, Adelina I; Nouraie, Mehdi; Niu, Xiaomei; Okhotin, Daniel J; Polyakova, Lydia A; Ganz, Tomas; Prchal, Josef T; Gordeuk, Victor R

    2011-09-01

    The germ-line loss-of-function VHL(R200W) mutation is common in Chuvashia, Russia and occurs in other parts of the world. VHL(R200W) homozygotes have elevated hypoxia inducible factor (HIF)-1 and HIF-2 levels, increased hemoglobin concentration, propensity to thrombosis and early mortality. Because the mutation persists from an ancient origin, we hypothesized that there is a heterozygote advantage. Thirty-four VHL(R200W) heterozygotes and 44 controls over 35 years of age from Chuvashia, Russia were studied. Anemia was defined as hemoglobin less than 130 g/L in men and less than 120 g/L in women. Mild anemia was present in 15% of VHL(R200W) heterozygotes and 34% of controls without a mutated VHL allele. By multivariate logistic regression, the odds of anemia were reduced an estimated 5.6-fold in the VHL(R200W) heterozygotes compared to controls (95% confidence interval 1.4-22.7; P=0.017). In conclusion, heterozygosity for VHL(R200W) may provide protection from anemia; such protection could explain the persistence of this mutation.

  8. Prevalence, birth incidence, and penetrance of von Hippel-Lindau disease (vHL) in Denmark

    DEFF Research Database (Denmark)

    Binderup, Marie Louise Mølgaard; Galanakis, Michael Carter Bisgaard; Budtz-Jørgensen, Esben

    2017-01-01

    . We further used national health registers to identify individuals who fulfilled the clinical diagnostic vHL criteria based on their registered diagnostic codes, but had not been diagnosed with vHL. We also assessed the medical histories of first-degree relatives to identify familial cases. This study...

  9. Concomitant K- and N-ras gene point mutations in clonal murine lymphoma.

    OpenAIRE

    Diamond, L E; Guerrero, I; Pellicer, A

    1988-01-01

    We have surveyed a panel of induced murine lymphomas for c-ras gene mutations. The K-ras gene seems to be preferentially activated in our system, and there are at least two examples of concomitant K- and N-ras gene mutations in the same tumor. This indicates that in some cases additional ras mutations may contribute to tumorigenesis and is evidence for a role of ras activation in tumor progression.

  10. [The genotype-phenotype correlation of MYH7 gene G15391A mutation and MYBPC3 gene G12101A mutation in familial hypertrophic cardiomyopathy].

    Science.gov (United States)

    WANG, Hu; ZOU, Yu-bao; WANG, Ji-zheng; SONG, Lei; SUN, Kai; SONG, Xiao-dong; WANG, Xiao-jian; ZHANG, Chan-na; HUI, Ru-tai

    2008-12-01

    To reveal genotype-phenotype correlation of disease-causing gene mutations in Chinese hypertrophic cardiomyopathy (HCM) pedigree. Peripheral venous blood samples were collected from two Chinese HCM families and 120 healthy subjects were recruited as normal control. The full encoding exons and flanking sequences of the cardiac troponin T gene (TNNT2), beta-myosin heavy chain gene (MYH7) and myosin binding protein C gene (MYBPC3) were amplified with the polymerase chain reaction method, DNA sequencing was used to detect the mutation. In ZZJ family, mutation G12101A was identified in exon 21 of MYBPC3 gene in 4 family members [the arginine (R) converted to histidine (H)]. In this pedigree, three out of eight family members were diagnosed as HCM and with a penetrance of 75%. In FHL family, mutation G15391A was identified in exon 23 of MYH7 gene in 3 family members [the glutamic acid (E) converted to lysine (K)]. In this pedigree, three out of six family members were diagnosed as HCM and with a penetrance of 100%. Echocardiography showed obstruction of left ventricular outflow tract in two out of the three HCM patients. Our results showed that the G12101A mutation of MYBPC3 gene is the causal mutation of familial HCM with mild phenotype. The G15391A mutation of MYH7 gene is the causal mutation of familial HCM with malignant phenotype and a penetrance of 100%. Screening mutations in the MYH7 gene should be viewed as a reasonable procedure in obstructive HCM patients.

  11. Mutation profiling of 19 candidate genes in acute myeloid leukemia suggests significance of DNMT3A mutations.

    Science.gov (United States)

    Shin, Sang-Yong; Lee, Seung-Tae; Kim, Hee-Jin; Cho, Eun Hae; Kim, Jong-Won; Park, Silvia; Jung, Chul Won; Kim, Sun-Hee

    2016-08-23

    We selected 19 significantly-mutated genes in AMLs, including FLT3, DNMT3A, NPM1, TET2, RUNX1, CEBPA, WT1, IDH1, IDH2, NRAS, ASXL1, SETD2, PTPN11, TP53, KIT, JAK2, KRAS, BRAF and CBL, and performed massively parallel sequencing for 114 patients with acute myeloid leukemias, mainly including those with normal karyotypes (CN-AML). More than 80% of patients had at least one mutation in the genes tested. DNMT3A mutation was significantly associated with adverse outcome in addition to conventional risk stratification such as the European LeukemiaNet (ELN) classification. We observed clinical usefulness of mutation testing on multiple target genes and the association with disease subgroups, clinical features and prognosis in AMLs.

  12. High frequency of additional gene mutations in acute myeloid leukemia with MLL partial tandem duplication: DNMT3A mutation is associated with poor prognosis.

    Science.gov (United States)

    Kao, Hsiao-Wen; Liang, D Cherng; Kuo, Ming-Chung; Wu, Jin-Hou; Dunn, Po; Wang, Po-Nan; Lin, Tung-Liang; Shih, Yu-Shu; Liang, Sung-Tzu; Lin, Tung-Huei; Lai, Chen-Yu; Lin, Chun-Hui; Shih, Lee-Yung

    2015-10-20

    The mutational profiles of acute myeloid leukemia (AML) with partial tandem duplication of mixed-lineage leukemia gene (MLL-PTD) have not been comprehensively studied. We studied 19 gene mutations for 98 patients with MLL-PTD AML to determine the mutation frequency and clinical correlations. MLL-PTD was screened by reverse-transcriptase PCR and confirmed by real-time quantitative PCR. The mutational analyses were performed with PCR-based assays followed by direct sequencing. Gene mutations of signaling pathways occurred in 63.3% of patients, with FLT3-ITD (44.9%) and FLT3-TKD (13.3%) being the most frequent. 66% of patients had gene mutations involving epigenetic regulation, and DNMT3A (32.7%), IDH2 (18.4%), TET2 (18.4%), and IDH1 (10.2%) mutations were most common. Genes of transcription pathways and tumor suppressors accounted for 23.5% and 10.2% of patients. RUNX1 mutation occurred in 23.5% of patients, while none had NPM1 or double CEBPA mutation. 90.8% of MLL-PTD AML patients had at least one additional gene mutation. Of 55 MLL-PTD AML patients who received standard chemotherapy, age older than 50 years and DNMT3A mutation were associated with inferior outcome. In conclusion, gene mutations involving DNA methylation and activated signaling pathway were common co-existed gene mutations. DNMT3A mutation was a poor prognostic factor in MLL-PTD AML.

  13. [Analysis common gene mutation spots of 127 non-syndromic deafness natients in Guangxi Drovince].

    Science.gov (United States)

    Liu, Shuixia; Xu, Liang; Chen, Bowen; Liu, Min; Qu, Shenghong; Liang, Jianping; Tang, Fengzhu; Shi, Min; Peng, Lu; Jing, Yan; Li, Fengti; Liang, Youqiong

    2015-11-01

    To investigate the mutation characteristics of common deafness gene from 127 non-syndromic hearing loss patients in Guangxi province. Deafness-related gene mutations detection kit was used to detect 15 mutation sites in four deafness-associated genes, and a total of 127 hearing impaired patients were tested. The samples that could not be diagnosed with DNA microarray were subjected to PCR and sequenced to detect other mutations. Among the 127 patients with non-syndromic deafness, the total mutation rate is 8.66% (11/127), including GJB2 235delC homozygous in 3 cases (2.36%), 235delC single heterozygous mutation in 2 cases (1.57%), GJB2 235delC and 109 A > G mutations in 2 cases (1.57%); SLC26A4 1229C > T homozygous in 1 case (0.79%), IVS7-2A > G, IVS11 + 47T > C and 15448insC mutaion in 2 cases (1.57%); mitochondrial 12S rRNA gene mutations were not detected. The result indicates that GJB2 and SLC26A4 were the main genes in this study, and the mutation rate is significantly lower than the national average level. Three new mutations (SLC26A4 IVS11 + 47T > C,1548insC and GJB2 109A > G) were found. There may be rare mutations among sites or genes associated with deafness in Guangxi.

  14. Interlocus gene conversion events introduce deleterious mutations into at least 1% of human genes associated with inherited disease.

    Science.gov (United States)

    Casola, Claudio; Zekonyte, Ugne; Phillips, Andrew D; Cooper, David N; Hahn, Matthew W

    2012-03-01

    Establishing the molecular basis of DNA mutations that cause inherited disease is of fundamental importance to understanding the origin, nature, and clinical sequelae of genetic disorders in humans. The majority of disease-associated mutations constitute single-base substitutions and short deletions and/or insertions resulting from DNA replication errors and the repair of damaged bases. However, pathological mutations can also be introduced by nonreciprocal recombination events between paralogous sequences, a phenomenon known as interlocus gene conversion (IGC). IGC events have thus far been linked to pathology in more than 20 human genes. However, the large number of duplicated gene sequences in the human genome implies that many more disease-associated mutations could originate via IGC. Here, we have used a genome-wide computational approach to identify disease-associated mutations derived from IGC events. Our approach revealed hundreds of known pathological mutations that could have been caused by IGC. Further, we identified several dozen high-confidence cases of inherited disease mutations resulting from IGC in ∼1% of all genes analyzed. About half of the donor sequences associated with such mutations are functional paralogous genes, suggesting that epistatic interactions or differential expression patterns will determine the impact upon fitness of specific substitutions between duplicated genes. In addition, we identified thousands of hitherto undescribed and potentially deleterious mutations that could arise via IGC. Our findings reveal the extent of the impact of interlocus gene conversion upon the spectrum of human inherited disease.

  15. Novel SDHB and TMEM127 Mutations in Patients with Pheochromocytoma/Paraganglioma Syndrome.

    Science.gov (United States)

    Patócs, Attila; Lendvai, Nikoletta K; Butz, Henriett; Liko, Istvan; Sapi, Zoltan; Szucs, Nikolette; Toth, Geza; Grolmusz, Vince K; Igaz, Peter; Toth, Miklos; Rácz, Károly

    2016-10-01

    Pheochromocytomas (Pheo) and paragangliomas (PGL) are rare tumors, with heterogeneous genetic background. In up to 30 % of all, apparently sporadic Pheo/PGL cases germline mutations can be identified in one of the 15 genes representing genetic susceptibility for Pheo/PGL. Malignancy is rare but it frequently associates with SDHB mutations. Our aim was to determine the prevalence of germline SDHx, SDHAF2, MAX and TMEM127 mutations in Hungarian patients with apparently sporadic Pheo/PGLs. Mutation screening of the SDHx, SDHAF2, MAX and TMEM127 genes was performed in 82 Hungarian patients with apparently sporadic Pheo/PGL using PCR and bidirectional Sanger sequencing. Disease-causing germline mutations were identified in 11 patients, of which 4 SDHB and 2 TMEM127 mutations were novel. Earlier development of Pheo/PGL, more malignant phenotype and multiple tumors were observed in genetically positive cases especially in those with SDHB mutations. The presence of bilateral or multiple tumors was the most predictive for identification of a pathogenic mutation. Together with cases harboring germline RET, VHL and NF1 mutations, Hungarian patients with Pheo/PGL exhibit a heterogeneous mutation spectrum, indicating that all of the Pheo/PGL susceptibility genes should be tested. Novel genotype-phenotype associations revealed by our study may contribute to improvement of diagnostic approaches and may help to achieve a better clinical follow up for patients with Pheo/PGL.

  16. Identification of gene mutation in patients with osteogenesis imperfect using high resolution melting analysis.

    Science.gov (United States)

    Wang, Jianhai; Ren, Xiuzhi; Bai, Xue; Zhang, Tianke; Wang, Yi; Li, Keqiu; Li, Guang

    2015-08-26

    Osteogenesis imperfecta (OI), a congenital bone disorder, is caused by mutations in COL1A1 and COL1A2 genes, leading to deficiency of type I collagen. The high resolution melting (HRM) analysis has been used for detecting mutations, polymorphisms and epigenetic alteration in double-stranded DNAs. This study was to evaluate the potential application of HRM analysis for identifying gene mutations in patients with OI. This study included four children with OI and their parents and fifty normal people as controls. Blood samples were collected for HRM analysis of PCR-amplified exons and flanking DNA sequences of COL1A1 and COL1A2 genes. Direct gene sequencing was performed to validate HRM-identified gene mutations. As compared to controls, HRM analysis of samples form children with OI showed abnormal melting curves in exons 11 and 33-34 of the COL1A1 gene and exons 19 and 48 of the COL1A2 gene, which indicates the presence of heterozygous mutations in COL1A1 and COL1A2 genes. In addition to two known mutations in the COL1A2 gene, c.982G > A and c.3197G > T, sequencing analysis identified two novel mutations in the COL1A1 gene, c.2321delC and c.768dupC mutations, which function as premature stop codons. These results support future studies of applying HRM analysis as a diagnostic approach for OI.

  17. Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

    Science.gov (United States)

    Kim, Myeong Hee; Kang, So Young; Lee, Woo In

    2017-05-01

    The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations.

  18. Frameshift mutations in coding repeats of protein tyrosine phosphatase genes in colorectal tumors with microsatellite instability.

    Science.gov (United States)

    Korff, Sebastian; Woerner, Stefan M; Yuan, Yan P; Bork, Peer; von Knebel Doeberitz, Magnus; Gebert, Johannes

    2008-11-10

    Protein tyrosine phosphatases (PTPs) like their antagonizing protein tyrosine kinases are key regulators of signal transduction thereby assuring normal control of cellular growth and differentiation. Increasing evidence suggests that mutations in PTP genes are associated with human malignancies. For example, mutational analysis of the tyrosine phosphatase (PTP) gene superfamily uncovered genetic alterations in about 26% of colorectal tumors. Since in these studies tumors have not been stratified according to genetic instability status we hypothesized that colorectal tumors characterized by high-level of microsatellite instability (MSI-H) might show an increased frequency of frameshift mutations in those PTP genes that harbor long mononucleotide repeats in their coding region (cMNR). Using bioinformatic analysis we identified 16 PTP candidate genes with long cMNRs that were examined for genetic alterations in 19 MSI-H colon cell lines, 54 MSI-H colorectal cancers, and 17 MSI-H colorectal adenomas. Frameshift mutations were identified only in 6 PTP genes, of which PTPN21 show the highest mutation frequency at all in MSI-H tumors (17%). Although about 32% of MSI-H tumors showed at least one affected PTP gene, and cMNR mutation rates in PTPN21, PTPRS, and PTPN5 are higher than the mean mutation frequency of MNRs of the same length, mutations within PTP genes do not seem to play a common role in MSI tumorigenesis, since no cMNR mutation frequency reached statistical significance and therefore, failed prediction as a Positive Selective Target Gene.

  19. Clinical characteristics and prognosis of acute myeloid leukemia associated with DNA-methylation regulatory gene mutations.

    Science.gov (United States)

    Ryotokuji, Takeshi; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kurosawa, Saiko; Kobayashi, Yutaka; Kawata, Eri; Tajika, Kenji; Gomi, Seiji; Kanda, Junya; Kobayashi, Anna; Omori, Ikuko; Marumo, Atsushi; Fujiwara, Yusuke; Yui, Shunsuke; Terada, Kazuki; Fukunaga, Keiko; Hirakawa, Tsuneaki; Arai, Kunihito; Kitano, Tomoaki; Kosaka, Fumiko; Tamai, Hayato; Nakayama, Kazutaka; Wakita, Satoshi; Fukuda, Takahiro; Inokuchi, Koiti

    2016-09-01

    In recent years, it has been reported that the frequency of DNA-methylation regulatory gene mutations - mutations of the genes that regulate gene expression through DNA methylation - is high in acute myeloid leukemia. The objective of the present study was to elucidate the clinical characteristics and prognosis of acute myeloid leukemia with associated DNA-methylation regulatory gene mutation. We studied 308 patients with acute myeloid leukemia. DNA-methylation regulatory gene mutations were observed in 135 of the 308 cases (43.8%). Acute myeloid leukemia associated with a DNA-methylation regulatory gene mutation was more frequent in older patients (Pgene mutation was an unfavorable prognostic factor for overall survival in the whole cohort (P=0.0018), in patients aged ≤70 years, in patients with intermediate cytogenetic risk, and in FLT3-ITD-negative patients (P=0.0409). Among the patients with DNA-methylation regulatory gene mutations, 26.7% were found to have two or more such mutations and prognosis worsened with increasing number of mutations. In multivariate analysis DNA-methylation regulatory gene mutation was an independent unfavorable prognostic factor for overall survival (P=0.0424). However, patients with a DNA-methylation regulatory gene mutation who underwent allogeneic stem cell transplantation in first remission had a significantly better prognosis than those who did not undergo such transplantation (P=0.0254). Our study establishes that DNA-methylation regulatory gene mutation is an important unfavorable prognostic factor in acute myeloid leukemia. Copyright© Ferrata Storti Foundation.

  20. Mutation analysis of the AATF gene in breast cancer families

    Directory of Open Access Journals (Sweden)

    Nikkilä Jenni

    2009-12-01

    Full Text Available Abstract Background About 5-10% of breast cancer is due to inherited disease predisposition. Many previously identified susceptibility factors are involved in the maintenance of genomic integrity. AATF plays an important role in the regulation of gene transcription and cell proliferation. It induces apoptosis by associating with p53. The checkpoint kinases ATM/ATR and CHEK2 interact with and phosphorylate AATF, enhancing its accumulation and stability. Based on its biological function, and direct interaction with several known breast cancer risk factors, AATF is a good candidate gene for being involved in heritable cancer susceptibility. Methods Here we have screened the entire coding region of AATF in affected index cases from 121 Finnish cancer families for germline defects, using conformation sensitive gel electrophoresis and direct sequencing. Results Altogether seven different sequence changes were observed, one missense variant and six intronic ones. Based on the in silico analyses of these sequence alterations, as well as their occurrence in cases and controls, none of them, however, were predicted to be pathogenic. Conclusions To our knowledge, this is the first study reporting the mutation screening of the AATF gene in familial breast cancer cases. No evidence for the association with breast cancer was observed.

  1. Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene

    DEFF Research Database (Denmark)

    Xu, H; Wu, X R; Wewer, U M

    1994-01-01

    The classic murine muscular dystrophy strain, dy, was first described almost 40 years ago. We have identified the molecular basis of an allele of dy, called dy2J, by detecting a mutation in the laminin alpha 2 chain gene--the first identified mutation in laminin-2. The G to A mutation in a splice...

  2. IDENTIFY CANCER DRIVER GENES THROUGH SHARED MENDELIAN DISEASE PATHOGENIC VARIANTS AND CANCER SOMATIC MUTATIONS.

    Science.gov (United States)

    Ma, Meng; Wang, Changchang; Glicksberg, Benjamin S; Schadt, Eric E; Li, Shuyu D; Chen, Rong

    2017-01-01

    Genomic sequencing studies in the past several years have yielded a large number of cancer somatic mutations. There remains a major challenge in delineating a small fraction of somatic mutations that are oncogenic drivers from a background of predominantly passenger mutations. Although computational tools have been developed to predict the functional impact of mutations, their utility is limited. In this study, we applied an alternative approach to identify potentially novel cancer drivers as those somatic mutations that overlap with known pathogenic mutations in Mendelian diseases. We hypothesize that those shared mutations are more likely to be cancer drivers because they have the established molecular mechanisms to impact protein functions. We first show that the overlap between somatic mutations in COSMIC and pathogenic genetic variants in HGMD is associated with high mutation frequency in cancers and is enriched for known cancer genes. We then attempted to identify putative tumor suppressors based on the number of distinct HGMD/COSMIC overlapping mutations in a given gene, and our results suggest that ion channels, collagens and Marfan syndrome associated genes may represent new classes of tumor suppressors. To elucidate potentially novel oncogenes, we identified those HGMD/COSMIC overlapping mutations that are not only highly recurrent but also mutually exclusive from previously characterized oncogenic mutations in each specific cancer type. Taken together, our study represents a novel approach to discover new cancer genes from the vast amount of cancer genome sequencing data.

  3. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands

    NARCIS (Netherlands)

    Lombardi, M. P.; Redeker, E. J.; Defesche, J. C.; Kamerling, S. W.; Trip, M. D.; Mannens, M. M.; Havekes, L. M.; Kastelein, J. J.

    2000-01-01

    Mutations in the LDL receptor are responsible for familial hypercholesterolemia (FH). At present, more than 600 mutations of the LDL receptor gene are known to underlie FH. However, the array of mutations varies considerably in different populations. Therefore, the delineation of essentially all LDL

  4. Metastatic Pheochromocytoma/Paraganglioma Related to Primary Tumor Development in Childhood or Adolescence: Significant Link to SDHB Mutations

    Science.gov (United States)

    King, Kathryn S.; Prodanov, Tamara; Kantorovich, Vitaly; Fojo, Tito; Hewitt, Jacqueline K.; Zacharin, Margaret; Wesley, Robert; Lodish, Maya; Raygada, Margarita; Gimenez-Roqueplo, Anne-Paule; McCormack, Shana; Eisenhofer, Graeme; Milosevic, Dragana; Kebebew, Electron; Stratakis, Constantine A.; Pacak, Karel

    2011-01-01

    Purpose To present data on the high rate of SDHB mutations in patients with metastatic pheochromocytoma/paraganglioma whose initial tumor presentation began in childhood or adolescence. Patients and Methods From 2000 to 2010, 263 patients with pheochromocytoma/paraganglioma were evaluated through the National Institutes of Health (NIH), Bethesda, MD. Of the 263 patients, 125 patients were found to have metastatic disease; of these 125 patients, 32 patients presented with a tumor before 20 years of age. An additional 17 patients presented with a tumor before 20 years of age but demonstrated no development of metastatic disease. Genetic testing for mutations in the VHL, MEN, and SDHB/C/D genes was performed on patients without previously identified genetic mutations. Results Of the 32 patients who presented with metastatic disease and had their primary tumor in childhood or adolescence, sequence analysis of germline DNA showed SDHB mutations in 23 patients (71.9%), SDHD mutations in three patients (9.4%), VHL mutations in two patients (6.3%), and an absence of a known mutation in four patients (12.5%). The majority of these 32 patients (78.1%) presented with primary tumors in an extra-adrenal location. Conclusion The majority of patients with metastatic pheochromocytoma/paraganglioma who presented with a primary tumor in childhood/adolescence had primary extra-adrenal tumors and harbored SDHB mutations. Except for primary tumors located in the head and neck where SDHD genetic testing is advised, we recommend that patients who present with metastatic pheochromocytoma/paraganglioma with primary tumor development in childhood or adolescence undergo SDHB genetic testing before they undergo testing for other gene mutations, unless clinical presentation or family history suggests a different mutation. PMID:21969497

  5. Triple A syndrome: two novel mutations in the AAAS gene.

    Science.gov (United States)

    Thümmler, Susanne; Huebner, Angela; Baechler-Sadoul, Elisabeth

    2009-01-01

    Triple A syndrome is a rare disease of autosomal recessive inheritance. It was first described in 1978. The typical triad includes adrenocorticotrophic-hormone-resistant glucocorticoid insufficiency, reduced or absent tearing (alacrima) and achalasia. But clinical symptoms can be extremely heterogeneous and of variable clinically expression. This report describes a 7-year-old boy with a 1 year history of fatigue and muscle weakness. Physical examination showed skin and mucosal hyperpigmentation, and hormonal analysis revealed isolated glucocorticoid function. Medical history was marked by megaoesophagus and achalasia. The absence of tears when crying had been noted since birth. In the presence of the classical triad, triple A syndrome was diagnosed. Clinical diagnosis was confirmed by molecular analysis of the AAAS gene on chromosome 12q13. The novel compound heterozygous mutation c.1304delA and c.1292-1294delTTCinsA was found.

  6. Mutations in Exons 9 and 13 of KIT Gene Are Rare Events in Gastrointestinal Stromal Tumors

    Science.gov (United States)

    Lasota, Jerzy; Wozniak, Agnieszka; Sarlomo-Rikala, Maarit; Rys, Janusz; Kordek, Radzislaw; Nassar, Aziza; Sobin, Leslie H.; Miettinen, Markku

    2000-01-01

    Gastrointestinal stromal tumors (GISTs), the most common mesenchymal tumors of the gastrointestinal tract, typically express the KIT protein. Activating mutations in the juxtamembrane domain (exon 11) of the c-kit gene have been shown in a subset of GISTs. These mutations lead into ligand-independent activation of the tyrosine kinase of c-kit, and have a transforming effect in vitro. Several groups have studied the clinical implication of the c-kit mutation status of exon 11 in GISTs and a possible relationship between c-kit mutations and malignant behavior has been established. Recently, a 1530ins6 mutation in exon 9 and missense mutations, 1945A>G in exon 13 of the c-kit gene were reported. The frequency and clinical importance of these findings are unknown. In this study we evaluated 200 GISTs for the presence of mutations in exons 9 and 13 of c-kit. Six cases revealed 1530ins6 mutation in exon 9 and two cases 1945A>G mutation in exon 13. All tumors with mutations in exon 9 and 13 lacked mutations in exon 11 of c-kit. None of the analyzed tumors had more than one type of c-kit mutation. All but one of the eight tumors with mutations in exon 9 or 13 of the c-kit gene were histologically and clinically malignant. All four of six cases with exon 9 mutation of which location of primary tumor was known, were small intestinal, suggesting that this type of mutation could preferentially occur in small intestinal tumors. Exon 9 and 13 mutations seem to be rare, and they cover only a small portion (8%) of the balance of GISTs that do not have mutations in exon 11 of c-kit. This finding indicates that other genetic alterations may activate c-kit in GISTs, or that KIT is not activated by mutations in all cases. PMID:11021812

  7. The role of the ND5 gene in LHON: characterization of a new, heteroplasmic LHON mutation.

    Science.gov (United States)

    Mayorov, Vladimir; Biousse, Valerie; Newman, Nancy J; Brown, Michael D

    2005-11-01

    Leber's hereditary optic neuropathy (LHON) causes central vision loss from bilateral optic neuropathy. Although 13 mitochondrial DNA (mtDNA) mutations are strongly associated with LHON, only three account for roughly 90% of cases and thus are found in multiple independent LHON families. The remaining LHON mutations are rare. Here, we describe the clinical and genetic characterization of a new LHON mtDNA mutation. The 12848T mutation alters a highly conserved amino acid in the ND5 complex I gene, is not found in controls, and is heteroplasmic. Despite ND5 being the largest of the mtDNA complex I genes, ND5 mutations are quite rare in LHON.

  8. Dynamic changes of driver genes' mutations across clinical stages in nine cancer types.

    Science.gov (United States)

    Li, Xia

    2016-07-01

    The driver genes play critical roles for tumorigenesis, and the number of identified driver genes reached plateau. But how they act during different cancer development stages is lack of knowledge. We investigated 138 driver genes' mutation changes across clinical stages using 3,477 cases in nine cancer types from the Cancer Genome Atlas (TCGA) and constructed their temporal order relationships. We also examined the codon changes for the widely mutated TP53 and PIK3CA in tumor stages. Combinations of one to three driver genes specifically dominated in each cancer. Across the clinical stages, we categorized three patterns for the behaviors of driver genes' mutation changes in the nine cancer types: recurrently mutated in all the stages and triggering other mutations; certain mutations lost meanwhile other mutations emerged; mutations dominated across entire stages, while other mutations gradually appeared or disappeared. We observed different codon changes dominated in different stages and revealed mutations recurrently occurring on the hotspot regions of the coding sequence may be the core factor for driver genes' tumorigenesis. Our results highlighted the dynamic changes of oncogenesis roles in different clinical stages and suggested different diagnostic decision making according to the clinical stages of patients. © 2016 The Author. Cancer Medicine published by John Wiley & Sons Ltd.

  9. Spectrum of mismatch repair gene mutations and clinical presentation of Hispanic individuals with Lynch syndrome.

    Science.gov (United States)

    Sunga, Annette Y; Ricker, Charité; Espenschied, Carin R; Castillo, Danielle; Melas, Marilena; Herzog, Josef; Bannon, Sarah; Cruz-Correa, Marcia; Lynch, Patrick; Solomon, Ilana; Gruber, Stephen B; Weitzel, Jeffrey N

    2017-04-01

    Lynch syndrome (LS), the most common hereditary colorectal cancer syndrome, is caused by mismatch repair (MMR) gene mutations. However, data about MMR mutations in Hispanics are limited. This study aims to describe the spectrum of MMR mutations in Hispanics with LS and explore ancestral origins. This case series involved an IRB-approved retrospective chart review of self-identified Hispanic patients (n = 397) seen for genetic cancer risk assessment at four collaborating academic institutions in California, Texas, and Puerto Rico who were evaluated by MMR genotyping and/or tumor analysis. A literature review was conducted for all mutations identified. Of those who underwent clinical genetic testing (n = 176), 71 had MMR gene mutations. Nine mutations were observed more than once. One third (3/9) of recurrent mutations and two additional mutations (seen only once) were previously reported in Spain, confirming the influence of Spanish ancestry on MMR mutations in Hispanic populations. The recurrent mutations identified (n = 9) included both previously reported mutations as well as unique mutations not in the literature. This is the largest report of Hispanic MMR mutations in North America; however, a larger sample and haplotype analyses are needed to better understand recurrent MMR mutations in Hispanic populations. Copyright © 2017. Published by Elsevier Inc.

  10. Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population

    DEFF Research Database (Denmark)

    Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos

    2016-01-01

    Lynch syndrome caused by constitutional mismatch‑repair defects is one of the most common hereditary cancer syndromes with a high risk for colorectal, endometrial, ovarian and urothelial cancer. Lynch syndrome is caused by mutations in the mismatch repair (MMR) genes i.e., MLH1, MSH2, MSH6 and PMS2....... After 20 years of genetic counseling and genetic testing for Lynch syndrome, we have compiled the mutation spectrum in Sweden with the aim to provide a population-based perspective on the contribution from the different MMR genes, the various types of mutations and the influence from founder mutations....... Mutation data were collected on a national basis from all laboratories involved in genetic testing. Mutation analyses were performed using mainly Sanger sequencing and multiplex ligation-dependent probe amplification. A total of 201 unique disease-predisposing MMR gene mutations were identified in 369...

  11. Mutation analysis of the WFS1 gene in seven Danish Wolfram syndrome families; four new mutations identified

    DEFF Research Database (Denmark)

    Hansen, Lars; Eiberg, Hans Rudolf Lytchoff; Barrett, Timothy

    2005-01-01

    Wolfram syndrome (WS) is a neuro-degenerative autosomal recessive (AR) disorder (OMIM #222300) caused by mutations in the WFS1 gene on 4p16.1. More than 120 mutations have been identified in WFS1 associated with AR WS, as well as autosomal dominant nonsyndromic low-frequency sensorineural hearing....... In contrast, diabetes insipidus was present in two subjects only. Various degrees and types of hearing impairment were diagnosed in six individuals and cataract was observed in five subjects.......Wolfram syndrome (WS) is a neuro-degenerative autosomal recessive (AR) disorder (OMIM #222300) caused by mutations in the WFS1 gene on 4p16.1. More than 120 mutations have been identified in WFS1 associated with AR WS, as well as autosomal dominant nonsyndromic low-frequency sensorineural hearing...

  12. D816 mutation of the KIT gene in core binding factor acute myeloid leukemia is associated with poorer prognosis than other KIT gene mutations.

    Science.gov (United States)

    Yui, Shunsuke; Kurosawa, Saiko; Yamaguchi, Hiroki; Kanamori, Heiwa; Ueki, Toshimitsu; Uoshima, Nobuhiko; Mizuno, Ishikazu; Shono, Katsuhiro; Usuki, Kensuke; Chiba, Shigeru; Nakamura, Yukinori; Yanada, Masamitsu; Kanda, Junya; Tajika, Kenji; Gomi, Seiji; Fukunaga, Keiko; Wakita, Satoshi; Ryotokuji, Takeshi; Fukuda, Takahiro; Inokuchi, Koiti

    2017-10-01

    The clinical impact of KIT mutations in core binding factor acute myeloid leukemia (CBF-AML) is still unclear. In the present study, we analyzed the prognostic significance of each KIT mutation (D816, N822K, and other mutations) in Japanese patients with CBF-AML. We retrospectively analyzed 136 cases of CBF-AML that had gone into complete remission (CR). KIT mutations were found in 61 (45%) of the patients with CBF-AML. D816, N822K, D816 and N822K, and other mutations of the KIT gene were detected in 29 cases (21%), 20 cases (15%), 7 cases (5%), and 5 cases (4%), respectively. The rate of relapse-free survival (RFS) and overall survival (OS) in patients with D816 and with both D816 and N822K mutations was significantly lower than in patients with other or with no KIT mutations (RFS: p mutation was associated with a significantly worse prognosis. In a further multivariate analysis of RFS and OS, D816 mutation was found to be an independent risk factor for significantly poorer prognosis. In the present study, we were able to establish that, of all KIT mutations, D816 mutation alone is an unfavorable prognostic factor.

  13. Low load for disruptive mutations in autism genes and their biased transmission

    Science.gov (United States)

    Iossifov, Ivan; Levy, Dan; Allen, Jeremy; Ye, Kenny; Ronemus, Michael; Lee, Yoon-ha; Yamrom, Boris; Wigler, Michael

    2015-01-01

    We previously computed that genes with de novo (DN) likely gene-disruptive (LGD) mutations in children with autism spectrum disorders (ASD) have high vulnerability: disruptive mutations in many of these genes, the vulnerable autism genes, will have a high likelihood of resulting in ASD. Because individuals with ASD have lower fecundity, such mutations in autism genes would be under strong negative selection pressure. An immediate prediction is that these genes will have a lower LGD load than typical genes in the human gene pool. We confirm this hypothesis in an explicit test by measuring the load of disruptive mutations in whole-exome sequence databases from two cohorts. We use information about mutational load to show that lower and higher intelligence quotients (IQ) affected individuals can be distinguished by the mutational load in their respective gene targets, as well as to help prioritize gene targets by their likelihood of being autism genes. Moreover, we demonstrate that transmission of rare disruptions in genes with a lower LGD load occurs more often to affected offspring; we show transmission originates most often from the mother, and transmission of such variants is seen more often in offspring with lower IQ. A surprising proportion of transmission of these rare events comes from genes expressed in the embryonic brain that show sharply reduced expression shortly after birth. PMID:26401017

  14. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure......The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...

  15. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  16. [Analysis of PAX6 gene mutations in a Chinese family affected with congenital aniridia].

    Science.gov (United States)

    Chen, Jing; Zhu, Jianfang

    2016-08-01

    To investigate the mutation of PAX6 gene in a Chinese family affected with congenital aniridia. Blood samples were drawn from family members, and DNA was analyzed by direct sequencing. A heterozygous mutation (c.151 G>A) was identified in the PAX6 gene in the proband and other patients from the family. The same mutation was not found among unaffected family members and 160 unrelated healthy controls. A novel mutation in the PAX6 gene has been identified in a Chinese family affected with aniridia.

  17. Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Diaz-Llopis Manuel

    2011-10-01

    Full Text Available Abstract Background Usher Syndrome type II (USH2 is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP. Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin.

  18. Clinical course of cone dystrophy caused by mutations in the RPGR gene

    NARCIS (Netherlands)

    A.A.H.J. Thiadens (Alberta); G.G. Soerjoesing (Gyan); R.J. Florijn; A.G. Tjiam; A.I. Hollander (Anneke); L.I. van den Born (Ingeborgh); F.C.C. Riemslag (Frans); A.A.B. Bergen (Arthur); C.C.W. Klaver (Caroline)

    2011-01-01

    textabstractBackground: Mutations in the RPGR gene predominantly cause rod photoreceptor disorders with a large variability in clinical course. In this report, we describe two families with mutations in this gene and cone involvement. Methods: We investigated an X-linked cone dystrophy family (1)

  19. Clinical course of cone dystrophy caused by mutations in the RPGR gene

    NARCIS (Netherlands)

    Thiadens, A.A.H.J.; Soerjoesing, G.G.; Florijn, R.J.; Tjiam, A.G.; Hollander, A.I. den; Born, L.I. van den; Riemslag, F.C.; Bergen, A.A.B.; Klaver, C.C.

    2011-01-01

    BACKGROUND: Mutations in the RPGR gene predominantly cause rod photoreceptor disorders with a large variability in clinical course. In this report, we describe two families with mutations in this gene and cone involvement. METHODS: We investigated an X-linked cone dystrophy family (1) with 25

  20. Mutation analysis of codons 345 and 347 of rhodopsin gene in ...

    Indian Academy of Sciences (India)

    http://www.ias.ac.in/article/fulltext/jgen/080/02/0111-0116 ... Abstract. More than 100 mutations have been reported till date in the rhodopsin gene in patients with retinitis pigmentosa. The present study was undertaken to detect the reported rhodopsin gene point mutations in Indian retinitis pigmentosa patients. We looked for ...

  1. Fanconi Anemia Gene Mutations Are Not Involved in Sporadic Wilms Tumor

    NARCIS (Netherlands)

    Adank, Muriel A.; Segers, Heidi; van Mil, Saskia E.; van Helsdingen, Yvette M.; Ameziane, Najim; van den Ouweland, Ans M. W.; Wagner, Anja; Meijers-Heijboer, Hanne; Kool, Marcel; de Kraker, Jan; Waisfisz, Quinten; van den Heuvel-Eibrink, Marry M.

    2010-01-01

    Bi-allelic germline mutations of the Fancom anemia (FA) genes, PALB2/FANCN and BRCA2/FANCD1, have been reported in a few Wilms tumor (WT) patients with an atypical FA phenotype Therefore, we screened a random cohort of 47 Dutch WT cases for germline mutations in these two FA-genes by DNA sequencing

  2. When Is Risk Highest for Women with Breast Cancer Gene Mutations?

    Science.gov (United States)

    ... Is Risk Highest for Women With Breast Cancer Gene Mutations? Study narrows down peak times, possibly aiding in ... 2017 (HealthDay News) -- For women who have genetic mutations that increase ... at what age those gene flaws are most likely to cause trouble. Knowing ...

  3. Study of the effect of HFE gene mutations on iron overload in ...

    African Journals Online (AJOL)

    Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...

  4. Study of the effect of HFE gene mutations on iron overload in ...

    African Journals Online (AJOL)

    Manal Michel Wilson

    2015-03-04

    Mar 4, 2015 ... Abstract Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in b-thalassemia patients and carriers remains contro- versial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in.

  5. K-ras gene mutation as an early prognostic marker of colon cancer.

    Science.gov (United States)

    Szpon, Łukasz; Stal, Aleksander; Zawadzki, Marcin; Lis-Nawara, Anna; Kielan, Wojciech; Grzebieniak, Zygmunt

    2016-01-01

    Due to increased colorectal cancer incidence there is a necessity of seeking new both prognostic and prediction factors that will allow to evolve new diagnostic tests. K-ras gene seems to be such a factor and its mutations are considered to be an early marker of progression of colorectal cancer. The aim of the study was to find a correlation between K-ras gene mutation in patients with diagnosed colorectal cancer and selected clinical parameters. A total of 104 patients (41 women and 63 men) with diagnosed colorectal cancer were included in this study. The average age of male group was 68.3 and in female group - 65.9. Samples were taken from paraffine blocks with tissue from diagnosed patients and K-ras gene mutation were identified. Afterwards the statistical analysis was made seeking the correlation between K-ras gene mutation incidence and clinical TNM staging system, tumour localisation, histological type, sex, age. K-ras gene mutations were detected in 20.1% of all colorectal cancers. Significantly higher rate of K-ras gene mutations were diagnosed among patients classified at stage I (40%), stage IIC (50%) and stage IV (50%) according to the TNM classification. The results of our study are compatible with other studies and indicate the correlation between K-ras gene mutation and colorectal cancer incidence. Identification of K-ras gene mutation may complement other diagnostic methods at early stage of colorectal cancer.

  6. GJB2 and GJB6 gene mutations found in Indian probands with ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 88; Issue 3. GJB2 and GJB6 gene mutations found in Indian probands ... Genetically caused deafness is a common trait affecting one in 1000 children and is predominantly inherited in an autosomal-recessive fashion. Several mutations in the GJB2 gene and a deletion of 342 ...

  7. Mutational analysis of the GLA gene in Mexican families with Fabry ...

    Indian Academy of Sciences (India)

    BIANCA ETHEL

    Future studies should aim to establish genotype–phenotype correlations for mutations in the GLA gene to gain a bet- ter understanding of the molecular aetiology and to facili- tate personalized treatment for FD. In conclusion, this study identified GLA gene mutations in 42 of 65 relatives of seven. Mexican probands with FD.

  8. Mutation of the planar cell polarity gene VANGL1 in adolescent idiopathic scoliosis

    DEFF Research Database (Denmark)

    Andersen, Malene Rask; Farooq, Muhammad; Rasmussen, Karen Koefoed

    2017-01-01

    STUDY DESIGN: Mutation analysis of a candidate disease gene in a cohort of patients with moderate to severe Adolescent idiopathic scoliosis (AIS). OBJECTIVE: To investigate if damaging mutations in the planar cell polarity gene VANGL1 could be identified in AIS patients. SUMMARY OF BACKGROUND DATA...

  9. Mutations in the beta-tropomyosin (TPM2) gene - a rare cause of nemaline myopathy

    NARCIS (Netherlands)

    Donner, Kati; Ollikainen, Miina; Ridanpää, Maaret; Christen, Hans-Jürgen; Goebel, Hans H.; de Visser, Marianne; Pelin, Katarina; Wallgren-Pettersson, Carina

    2002-01-01

    Nemaline myopathy is a clinically and genetically heterogeneous muscle disorder. In the nebulin gene we have detected a number of autosomal recessive mutations. Both autosomal dominant and recessive mutations have been detected in the genes for alpha -actin and alpha -tropomyosin 3. A recessive

  10. ABCG5/G8 gene is associated with hypercholesterolemias without mutation in candidate genes and noncholesterol sterols.

    Science.gov (United States)

    Lamiquiz-Moneo, Itziar; Baila-Rueda, Lucía; Bea, Ana M; Mateo-Gallego, Rocío; Pérez-Calahorra, Sofía; Marco-Benedí, Victoria; Martín-Navarro, Antonio; Ros, Emilio; Cofán, Montserrat; Rodríguez-Rey, José Carlos; Pocovi, Miguel; Cenarro, Ana; Civeira, Fernando

    Approximately 20% to 40% of clinically defined familial hypercholesterolemia (FH) cases do not show a causative mutation in candidate genes (mutation-negative FH), and some of them may have a polygenic origin. The aim of this work was to study the prevalence of ABCG5/G8 genetic variants in mutation-negative FH, as defects in these genes relate to intestinal hyperabsorption of cholesterol and thus ABCG5/G8 variants could explain in part the mechanism of hypercholesterolemia. We sequenced the ABCG5/G8 genes in 214 mutation-negative FH and 97 controls. Surrogate markers of cholesterol absorption (5α-cholestanol, β-sitosterol, campesterol, stigmasterol, and sitostanol) were quantified by high-performance liquid chromatography-tandem mass spectrometry in both studied groups. We found 8 mutation-negative FH patients (3.73%) with a pathogenic mutation in ABCG5/G8 genes. We observed significantly higher concentration of surrogate markers of cholesterol absorption in mutation-negative FH than in controls. In addition, we found significantly higher concentrations of cholesterol absorption markers in mutation-negative FH with ABCG5/G8 defects than in mutation-negative, ABCG5/G8-negative FH. A gene score reflecting the number of common single nucleotide variants associated with hypercholesterolemia was significantly higher in cases than in controls (P = .032). Subjects with a gene score above the mean had significantly higher 5α-cholestanol and stigmasterol than those with a lower gene score. Mutation-negative FH subjects accumulate an excess of rare and common gene variations in ABCG5/G8 genes. This variation is associated with increased intestinal absorption of cholesterol, as determined by surrogate makers, suggesting that these loci contribute to hypercholesterolemia by enhancing intestinal cholesterol absorption. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  11. Spectrum of LDLR gene mutations, including a novel mutation causing familial hypercholesterolaemia, in North-western Greece.

    Science.gov (United States)

    Diakou, Maria; Miltiadous, George; Xenophontos, Stavroulla L; Manoli, Panayiotis; Cariolou, Marios A; Elisaf, Moses

    2011-10-01

    Familial Hypercholesterolaemia (FH) is a clinical syndrome characterised by elevated serum low-density lipoprotein (LDL) cholesterol, by tendon xanthomata and clinical manifestations of ischaemic heart disease in early life. Typically, it results from mutations in the low-density lipoprotein receptor (LDLR) gene. Furthermore, there are 3 additional genetic disorders that cause clinical syndromes that mimic FH. These are: 1) familial ligand-defective apolipoprotein (apo)-B (FLDH), 2) familial hypercholesterolaemia type 3 (FH3) and 3) autosomal recessive hypercholesterolaemia (ARH). The aim of this study was to elaborate the impact of the above genetic disorders in Greek patients with a clinical diagnosis of FH. In this study, we assessed the contribution of the LDLR, Apo B, ARH and PCSK9 genes in the expression of FH in North-western Greece. Two hundred and fifty-four (254) probands with a clinical diagnosis of FH were included in the study. One hundred and sixty-nine (169) patients had one of the following LDLR gene mutations: 81T>G, 1775G>A, 517T>C, 858C>A, 1352T>C, 1285G>A, 761A>C, 1195G>A, 1646G>A and a deletion mutation g.387-410del24 in exon 4. We sequenced the Apo B, ARH and PCSK9 genes in 40, randomly selected patients, from the 85 patients with no identified LDLR gene defects. In these 40, randomly selected patients, with the exception of benign single nucleotide polymorphisms, no functional mutations were identified for all the above mentioned sequenced genes. Our results reveal substantial genetic heterogeneity for FH in North-western Greece with at least ten LDLR gene mutations present in the study population. One of these mutations although quite rare is reported here for the first time in the scientific literature. The detection of these mutations is important as they may be used to design multiplex detection assays for large scale population screening programmes to facilitate primary and secondary prevention of cardiovascular disease in the region

  12. A novel splicing mutation in GALT gene causing Galactosemia in Ecuadorian family.

    Science.gov (United States)

    De Lucca, M; Barba, C; Casique, L

    2017-07-01

    Classic Galactosemia (OMIM 230400) is an autosomal recessive disorder of galactose metabolism caused by mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. This disease caused by the inability to metabolize galactose is potentially life-threatening but its pathophysiology has not been clearly defined. GALT gene presents high allelic heterogeneity and around 336 variations have been identified. Here, we report the case of a patient with Classic Galactosemia who was detected during a neonatal screening in Ecuador. Molecular study revealed a mutation in GALT gene intron 1, c.82+3A>G in homozygous condition, this mutation has not been previously reported. This gene variation was not found in any of the 119 healthy Ecuadorian individuals used as control. Furthermore, the mutation was the only alteration detected in the propositus's GALT after sequencing all exons and introns of this gene. In silico modeling predicted that the mutation was pathogenic. Copyright © 2017. Published by Elsevier B.V.

  13. Association of PAX2 and Other Gene Mutations with the Clinical Manifestations of Renal Coloboma Syndrome.

    Science.gov (United States)

    Okumura, Toshiya; Furuichi, Kengo; Higashide, Tomomi; Sakurai, Mayumi; Hashimoto, Shin-Ichi; Shinozaki, Yasuyuki; Hara, Akinori; Iwata, Yasunori; Sakai, Norihiko; Sugiyama, Kazuhisa; Kaneko, Shuichi; Wada, Takashi

    2015-01-01

    Renal coloboma syndrome (RCS) is characterized by renal anomalies and optic nerve colobomas. PAX2 mutations contribute to RCS. However, approximately half of the patients with RCS have no mutation in PAX2 gene. To investigate the incidence and effects of mutations of PAX2 and 25 candidate genes, patient genes were screened using next-generation sequence analysis, and candidate mutations were confirmed using Sanger sequencing. The correlation between mutations and clinical manifestation was evaluated. Thirty patients, including 26 patients (two families of five and two, 19 sporadic cases) with RCS, and 4 optic nerve coloboma only control cases were evaluated in the present study. Six PAX2 mutations in 21 probands [28%; two in family cohorts (n = 5 and n = 2) and in 4 out of 19 patients with sporadic disease] including four novel mutations were confirmed using Sanger sequencing. Moreover, four other sequence variants (CHD7, SALL4, KIF26B, and SIX4) were also confirmed, including a potentially pathogenic novel KIF26B mutation. Kidney function and proteinuria were more severe in patients with PAX2 mutations than in those without the mutation. Moreover, the coloboma score was significantly higher in patients with PAX2 gene mutations. Three out of five patients with PAX2 mutations had focal segmental glomerulosclerosis (FSGS) diagnosed from kidney biopsies. The results of this study identify several new mutations of PAX2, and sequence variants in four additional genes, including a novel potentially pathogenic mutation in KIF26B, which may play a role in the pathogenesis of RCS.

  14. PTRH2 gene mutation causes progressive congenital skeletal muscle pathology.

    Science.gov (United States)

    Doe, Jinger; Kaindl, Angela M; Jijiwa, Mayumi; de la Vega, Michelle; Hu, Hao; Griffiths, Genevieve S; Fontelonga, Tatiana M; Barraza, Pamela; Cruz, Vivian; Van Ry, Pam; Ramos, Joe W; Burkin, Dean J; Matter, Michelle L

    2017-04-15

    Peptidyl-tRNA hydrolase 2 (PTRH2) regulates integrin-mediated pro-survival and apoptotic signaling. PTRH2 is critical in muscle development and regulates myogenic differentiation. In humans a biallelic mutation in the PTRH2 gene causes infantile-onset multisystem disease with progressive muscle weakness. We report here that the Ptrh2 knockout mouse model recapitulates the progressive congenital muscle pathology observed in patients. Ptrh2 null mice demonstrate multiple degenerating and regenerating muscle fibers, increased central nuclei, elevated creatine kinase activity and endomysial fibrosis. This progressive muscle pathology resembles the muscular dystrophy phenotype in humans and mice lacking the α7 integrin. We demonstrate that in normal muscle Ptrh2 associates in a complex with the α7β1 integrin at the sarcolemma and Ptrh2 expression is decreased in α7 integrin null muscle. Furthermore, Ptrh2 expression is altered in skeletal muscle of classical congenital muscular dystrophy mouse models. Ptrh2 levels were up-regulated in dystrophin deficient mdx muscle, which correlates with the elevated levels of the α7β1 integrin observed in mdx muscle and Duchenne muscular dystrophy patients. Similar to the α7 integrin, Ptrh2 expression was decreased in laminin-α2 dyW null gastrocnemius muscle. Our data establishes a PTRH2 mutation as a novel driver of congenital muscle degeneration and identifies a potential novel target to treat muscle myopathies. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Splicing aberrations caused by constitutional RB1 gene mutations in ...

    Indian Academy of Sciences (India)

    Analysis of RB1 mRNA from blood leukocytes of patients with retinoblastoma identified the effects of mutations involving consensus splice site, exonic substitution and whole-exon deletions identified in genomic DNA of these patients. In addition, this study identified mutations in cases in which no mutations were detectable ...

  16. [Clinical Characteristics and Gene Mutations of Gilbert Syndrome Complicated with Myeloproliferative Neoplasm].

    Science.gov (United States)

    Li, Xing-Xin; Shi, Jun; Huang, Zhen-Dong; Shao, Ying-Qi; Nie, Neng; Zhang, Jing; Ge, Mei-Li; Huang, Jin-Bo; Zheng, Yi-Zhou

    2017-04-01

    To investigate the clinical characteristics and gene mutations of patients with Gilbert syndrome complicated with myeloproliferative neoplasms (MPN). Peripheral blood samples from 1 patient with Gilbert syndrome complicated with MPN and his son were collected to analyse all exon mutations of UGT1A1 gene. The patient with leukocytosis, thrombocythemia, mild anemia and positive JAK2/V617F mutation was initially diagnosed as MPN. The hyperbilirubinemia suggested concurrent disease. Further gene evaluation disclosed a insertion mutation in the (TA)6TAA box, and a missense mutation(G→A) at 211 bp of exon 1, corresponding to the deficiency in the bilirubin-conjugating enzyme uridine-diphosphoglucuronosyl transferase1A1 (UGT1A1). His son only carried some polymorphism mutation without manifestation of this disease. It is a first report case of MPN complicated with Gilbert syndrome that can highlight the differential diagnosis for hyperbilirubinemia.

  17. Rare mutations of the DMBT1 gene in human astrocytic gliomas

    DEFF Research Database (Denmark)

    Mueller, Wolf; Mollenhauer, Jan; Stockhammer, Florian

    2002-01-01

    The Deleted in Malignant Brain Tumors 1 gene (DMBT1) has been proposed as a tumor suppressor gene candidate in human brain tumors, based on the observation of homozygous deletions affecting the DMBT1 region or part of the gene. In order to support this hypothesis, we performed a mutational analysis...... of the entire coding region of DMBT1, employing SSCP analysis and direct DNA sequencing in a series of 79 astrocytic gliomas. Five somatic mutations were detected. Two mutations, one of which resulted in an amino acid exchange, occurred in glioblastomas. One pilocytic astrocytoma carried two missense mutations...... and another pilocytic astrocytoma contained a somatic mutation, not affecting the presumed protein. In addition, 21 of the 27 single nucleotide polymorphisms identified in this study have not been recognized previously. The data indicate, that small mutations are not a frequent finding in gliomas....

  18. A missense mutation (Q279R in the Fumarylacetoacetate Hydrolase gene, responsible for hereditary tyrosinemia, acts as a splicing mutation

    Directory of Open Access Journals (Sweden)

    Baklouti Faouzi

    2001-06-01

    Full Text Available Abstract Background Tyrosinemia type I, the most severe disease of the tyrosine catabolic pathway is caused by a deficiency in fumarylacetoacetate hydrolase (FAH. A patient showing few of the symptoms associated with the disease, was found to be a compound heterozygote for a splice mutation, IVS6-1g->t, and a putative missense mutation, Q279R. Analysis of FAH expression in liver sections obtained after resection for hepatocellular carcinoma revealed a mosaic pattern of expression. No FAH was found in tumor regions while a healthy region contained enzyme-expressing nodules. Results Analysis of DNA from a FAH expressing region showed that the expression of the protein was due to correction of the Q279R mutation. RT-PCR was used to assess if Q279R RNA was produced in the liver cells and in fibroblasts from the patient. Normal mRNA was found in the liver region where the mutation had reverted while splicing intermediates were found in non-expressing regions suggesting that the Q279R mutation acted as a splicing mutation in vivo. Sequence of transcripts showed skipping of exon 8 alone or together with exon 9. Using minigenes in transfection assays, the Q279R mutation was shown to induce skipping of exon 9 when placed in a constitutive splicing environment. Conclusion These data suggest that the putative missense mutation Q279R in the FAH gene acts as a splicing mutation in vivo. Moreover FAH expression can be partially restored in certain liver cells as a result of a reversion of the Q279R mutation and expansion of the corrected cells.

  19. Frequencies of the Common Mefv Gene Mutations in Adiyaman, Southeast Anatolia, Turkey

    Directory of Open Access Journals (Sweden)

    Korkmaz D. T.

    2014-12-01

    Full Text Available Familial Mediterranean fever (FMF is an autosomal recessive disorder characterized by fever and serosal inflammation. The reasons for the disorder are mutations in the Mediterranean fever (MEFV gene; the most common of which are M694V, M680I, M694I and V726A. In this study, we aimed to screen these common mutations of the MEFV gene and then determine the prevalence of FMF according to these mutations in Adıyaman, Southeast Anatolia, Turkey. Seven hundred and sixty-seven healthy individuals from the region of Adıyaman participated in the study. Polymerase chain reaction-amplification refractory mutation system (PCR-ARMS methods were used to determine the common mutations of the MEFV gene. Twenty-six (3.9% individuals had only one mutation in the MEFV gene, 25 individuals were heterozygous and one person was homozygous for the V726A mutation (0.15%. In the present study, the V726A mutation (50.0% was the most frequent, followed by M694V (38.5%, M680I (7.7% and M694I (3.8%. It was seen that the carrier rate was very low and the prevalence of FMF was 0.15%, according to the common mutations of the MEFV gene in Adıyaman, Southeast Anatolia, Turkey.

  20. Compound EGFR mutation is frequently detected with co-mutations of actionable genes and associated with poor clinical outcome in lung adenocarcinoma.

    Science.gov (United States)

    Kim, Eun Young; Cho, Eun Na; Park, Heae Surng; Hong, Ji Young; Lim, Seri; Youn, Jong Pil; Hwang, Seung Yong; Chang, Yoon Soo

    2016-01-01

    Compound EGFR mutations, defined as double or multiple mutations in the EGFR tyrosine kinase domain, are frequently detected with advances in sequencing technology but its clinical significance is unclear. This study analyzed 61 cases of EGFR mutation positive lung adenocarcinoma using next-generation sequencing (NGS) based repeated deep sequencing panel of 16 genes that contain actionable mutations and investigated clinical implication of compound EGFR mutations. Compound EGFR mutation was detected in 15 (24.6%) of 61 cases of EGFR mutation-positive lung adenocarcinoma. The majority (12/15) of compound mutations are combination of the atypical mutation and typical mutations such as exon19 deletion, L858R or G719X substitutions, or exon 20 insertion whereas 3 were combinations of rare atypical mutations. The patients with compound mutation showed shorter overall survival than those with simple mutations (83.7 vs. 72.8 mo; P = 0.020, Breslow test). Among the 115 missense mutations discovered in the tested genes, a few number of actionable mutations were detected irrelevant to the subtype of EGFR mutations, including ALK rearrangement, BCL2L11 intron 2 deletion, KRAS c.35G>A, PIK3CA c.1633G>A which are possible target of crizotinib, BH3 mimetics, MEK inhibitors, and PI3K-tyrosine kinase inhibitors, respectively. 31 missense mutations were detected in the cases with simple mutations whereas 84 in those with compound mutation, showing that the cases with compound missense mutation have higher burden of missense mutations (P = 0.001, independent sample t-test). Compound EGFR mutations are detected at a high frequency using NGS-based repeated deep sequencing. Because patients with compound EGFR mutations showed poor clinical outcomes, they should be closely monitored during follow-up.

  1. Additive effect of mutations in LDLR and PCSK9 genes on the phenotype of familial hypercholesterolemia.

    Science.gov (United States)

    Pisciotta, Livia; Priore Oliva, Claudio; Cefalù, Angelo Baldassare; Noto, Davide; Bellocchio, Antonella; Fresa, Raffaele; Cantafora, Alfredo; Patel, Dilip; Averna, Maurizio; Tarugi, Patrizia; Calandra, Sebastiano; Bertolini, Stefano

    2006-06-01

    Patients homozygous or compound heterozygous for LDLR mutations or double heterozygous for LDLR and apo B R3500Q mutation have higher LDL-C levels, more extensive xanthomatosis and more severe premature coronary disease (pCAD) than simple heterozygotes for mutations in either these genes or for missense mutations in PCSK9 gene. It is not known whether combined mutations in LDLR and PKCS9 are associated with such a severe phenotype. We sequenced Apo B and PCSK9 genes in two patients with the clinical diagnosis of homozygous FH who were heterozygous for LDLR gene mutations. Proband Z.P. (LDL-C 13.39 mmol/L and pCAD) was heterozygous for an LDLR mutation (p.E228K) inherited from her father (LDL-C 8.07 mmol/L) and a PCSK9 mutation (p.R496W) from her mother (LDL-C 5.58 mmol/L). Proband L.R. and her sister (LDL-C 11.51 and 10.47 mmol/L, xanthomatosis and carotid atherosclerosis) were heterozygous for an LDLR mutation (p.Y419X) inherited from their mother (LDL-C 6.54 mmol/L) and a PCSK9 mutation (p.N425S) probably from their deceased father. The LDL-C levels in double heterozygotes of these two families were 56 and 44% higher than those found in simple heterozygotes for the two LDLR mutations, respectively. The two PCSK9 mutations are novel and were not found in 110 controls and 80 patients with co-dominant hypercholesterolemia. These observations indicate that rare missense mutations of PCSK9 may worsen the clinical phenotype of patients carrying LDLR mutations.

  2. Mutational analysis of the PLCE1 gene in steroid resistant nephrotic syndrome.

    Science.gov (United States)

    Boyer, Olivia; Benoit, Geneviève; Gribouval, Olivier; Nevo, Fabien; Pawtowski, Audrey; Bilge, Ilmay; Bircan, Zelal; Deschênes, Georges; Guay-Woodford, Lisa M; Hall, Michelle; Macher, Marie-Alice; Soulami, Kenza; Stefanidis, Constantinos J; Weiss, Robert; Loirat, Chantal; Gubler, Marie-Claire; Antignac, Corinne

    2010-07-01

    Mutations in the PLCE1 gene encoding phospholipase C epsilon 1 (PLCepsilon1) have been recently described in patients with early onset nephrotic syndrome (NS) and diffuse mesangial sclerosis (DMS). In addition, two cases of PLCE1 mutations associated with focal segmental glomerulosclerosis (FSGS) and later NS onset have been reported. In order to better assess the spectrum of phenotypes associated with PLCE1 mutations, mutational analysis was performed in a worldwide cohort of 139 patients (95 familial cases belonging to 68 families and 44 sporadic cases) with steroid resistant NS presenting at a median age of 23.0 months (range 0-373). Homozygous or compound heterozygous mutations were identified in 33% (8/24) of DMS cases. PLCE1 mutations were found in 8% (6/78) of FSGS cases without NPHS2 mutations. Nine were novel mutations. No clear genotype-phenotype correlation was observed, with either truncating or missense mutations detected in both DMS and FSGS, and leading to a similar renal evolution. Surprisingly, three unaffected and unrelated individuals were also found to carry the homozygous mutations identified in their respective families. PLCE1 is a major gene of DMS and is mutated in a non-negligible proportion of FSGS cases without NPHS2 mutations. Although additional variants in 19 candidate genes (16 other PLC genes, BRAF,IQGAP1 and NPHS1) were not identified, it is speculated that other modifier genes or environmental factors may play a role in the renal phenotype variability observed in individuals bearing PLCE1 mutations. This observation needs to be considered in the genetic counselling offered to patients.

  3. Investigation of NKX2.5 gene mutations in congenital heart defects in an Indian population.

    Science.gov (United States)

    Ketharnathan, Sarada; Koshy, Teena; Sethuratnam, Rajan; Paul, Solomon; Venkatesan, Vettriselvi

    2015-10-01

    Mutations in the NKX2.5 gene, a cardiac transcription factor, have been implicated in various types of congenital heart defects (CHD) and it is known that optimal expression levels of this gene are crucial for proper cardiogenesis. However, most of the mutations have been identified in cases of syndromic CHD, and the functional significance of other mutations in this gene has not been studied. We describe in this study the mutational and expression analysis of the NKX2.5 gene in nonsyndromic CHD patients. In this study, exon 1 of the NKX2.5 gene was sequenced from 50 probands with sporadic CHD and 50 healthy volunteers. NKX2.5 gene expression levels in blood and cardiac tissue samples were analyzed by reverse transcriptase polymerase chain reaction (RT-PCR) in the probands. No new mutations were identified; however, a previously reported variant A63G (rs2277923) was found to be present at significantly higher levels in the CHD population than in the control group. Changes in expression between the blood and tissue samples were seen in 37 out of the 50 CHD patients. Multiple factors, in addition to NKX2.5 gene mutations, may cause CHDs. NKX2.5 gene mutations may be mosaic in nature, therefore warranting investigation in both blood and tissue samples.

  4. Mutations in the sarcomere gene MYH7 in Ebstein anomaly.

    Science.gov (United States)

    Postma, Alex V; van Engelen, Klaartje; van de Meerakker, Judith; Rahman, Thahira; Probst, Susanne; Baars, Marieke J H; Bauer, Ulrike; Pickardt, Thomas; Sperling, Silke R; Berger, Felix; Moorman, Antoon F M; Mulder, Barbara J M; Thierfelder, Ludwig; Keavney, Bernard; Goodship, Judith; Klaassen, Sabine

    2011-02-01

    Ebstein anomaly is a rare congenital heart malformation characterized by adherence of the septal and posterior leaflets of the tricuspid valve to the underlying myocardium. An association between Ebstein anomaly with left ventricular noncompaction (LVNC) and mutations in MYH7 encoding β-myosin heavy chain has been shown; in this report, we have screened for MYH7 mutations in a cohort of probands with Ebstein anomaly in a large population-based study. Mutational analysis in a cohort of 141 unrelated probands with Ebstein anomaly was performed by next-generation sequencing and direct DNA sequencing of MYH7. Heterozygous mutations were identified in 8 of 141 samples (6%). Seven distinct mutations were found; 5 were novel and 2 were known to cause hypertrophic cardiomyopathy. All mutations except for 1 3-bp deletion were missense mutations; 1 was a de novo change. Mutation-positive probands and family members showed various congenital heart malformations as well as LVNC. Among 8 mutation-positive probands, 6 had LVNC, whereas among 133 mutation-negative probands, none had LVNC. The frequency of MYH7 mutations was significantly different between probands with and without LVNC accompanying Ebstein anomaly (PMYH7 mutation in the pedigrees of 3 of the probands, 1 of which also included another individual with Ebstein anomaly. Ebstein anomaly is a congenital heart malformation that is associated with mutations in MYH7. MYH7 mutations are predominantly found in Ebstein anomaly associated with LVNC and may warrant genetic testing and family evaluation in this subset of patients.

  5. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    Science.gov (United States)

    Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

  6. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    Directory of Open Access Journals (Sweden)

    Luis Cisneros

    Full Text Available Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1 Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]; and 2 genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational

  7. Transmission of the P250R mutation of the FGFR3 gene in four generations with highly variable phenotype

    DEFF Research Database (Denmark)

    Hove, Hanne Buciek; Dunø, Morten; Daugaard-Jensen, Jette

    Transmission of the P250R mutation of the FGFR3 gene in four generations with highly variable phenotype.......Transmission of the P250R mutation of the FGFR3 gene in four generations with highly variable phenotype....

  8. A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

    Directory of Open Access Journals (Sweden)

    NING Huibin

    2017-01-01

    Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

  9. Polymorphism analysis and new JAG1 gene mutations of Alagille syndrome in Mexican population☆

    Science.gov (United States)

    Vázquez-Martínez, Edgar Ricardo; Varela-Fascinetto, Gustavo; García-Delgado, Constanza; Rodríguez-Espino, Benjamín Antonio; Sánchez-Boiso, Adriana; Valencia-Mayoral, Pedro; Heller-Rosseau, Solange; Pelcastre-Luna, Erika Lisselly; Zenteno, Juan C.; Cerbón, Marco; Morán-Barroso, Verónica Fabiola

    2013-01-01

    Alagille syndrome is a multisystem disorder with an autosomic dominant pattern of inheritance that affects the liver, heart, eyes, kidneys, skeletal system and presents characteristic facial features. Mutations of the JAG1 gene have been identified in 20–89% of the patients with Alagille syndrome, this gene encodes for a ligand that activates the Notch signaling pathway. In the present study we analyzed 9 Mexican patients with Alagille syndrome who presented the clinical criteria for the classical presentation of the disease. By using the denaturing high performance liquid chromatography mutation analysis we were able to identify different mutations in 7 of the patients (77.77%), importantly, we found 5 novel mutations in JAG1 gene. The allelic frequency distribution of 13 polymorphisms in Mexican population is also reported. The overall results demonstrated an expanding mutational spectrum of JAG1 gene in the Mexican population. PMID:25606387

  10. Limited heterogeneity of known driver gene mutations among the metastases of individual patients with pancreatic cancer.

    Science.gov (United States)

    Makohon-Moore, Alvin P; Zhang, Ming; Reiter, Johannes G; Bozic, Ivana; Allen, Benjamin; Kundu, Deepanjan; Chatterjee, Krishnendu; Wong, Fay; Jiao, Yuchen; Kohutek, Zachary A; Hong, Jungeui; Attiyeh, Marc; Javier, Breanna; Wood, Laura D; Hruban, Ralph H; Nowak, Martin A; Papadopoulos, Nickolas; Kinzler, Kenneth W; Vogelstein, Bert; Iacobuzio-Donahue, Christine A

    2017-03-01

    The extent of heterogeneity among driver gene mutations present in naturally occurring metastases-that is, treatment-naive metastatic disease-is largely unknown. To address this issue, we carried out 60× whole-genome sequencing of 26 metastases from four patients with pancreatic cancer. We found that identical mutations in known driver genes were present in every metastatic lesion for each patient studied. Passenger gene mutations, which do not have known or predicted functional consequences, accounted for all intratumoral heterogeneity. Even with respect to these passenger mutations, our analysis suggests that the genetic similarity among the founding cells of metastases was higher than that expected for any two cells randomly taken from a normal tissue. The uniformity of known driver gene mutations among metastases in the same patient has critical and encouraging implications for the success of future targeted therapies in advanced-stage disease.

  11. FAM20A Gene Mutation: Amelogenesis or Ectopic Mineralization?

    Science.gov (United States)

    Lignon, Guilhem; Beres, Fleur; Quentric, Mickael; Rouzière, Stephan; Weil, Raphael; De La Dure-Molla, Muriel; Naveau, Adrien; Kozyraki, Renata; Dessombz, Arnaud; Berdal, Ariane

    2017-01-01

    Background and objective:FAM20A gene mutations result in enamel renal syndrome (ERS) associated with amelogenesis imperfecta (AI), nephrocalcinosis, gingival fibromatosis, and impaired tooth eruption. FAM20A would control the phosphorylation of enamel peptides and thus enamel mineralization. Here, we characterized the structure and chemical composition of unerupted tooth enamel from ERS patients and healthy subjects. Methods: Tooth sections were analyzed by Scanning Electron Microscopy (SEM), Energy Dispersive Spectroscopy (EDS), X-Ray Diffraction (XRD), and X-Ray Fluorescence (XRF). Results: SEM revealed that prisms were restricted to the inner-most enamel zones. The bulk of the mineralized matter covering the crown was formed by layers with varying electron-densities organized into lamellae and micronodules. Tissue porosity progressively increased at the periphery, ending with loose and unfused nanonodules also observed in the adjoining soft tissues. Thus, the enamel layer covering the dentin in all ERS patients (except a limited layer of enamel at the dentino-enamel junction) displayed an ultrastructural globular pattern similar to one observed in ectopic mineralization of soft tissue, notably in the gingiva of Fam20a knockout mice. XRD analysis confirmed the existence of alterations in crystallinity and composition (vs. sound enamel). XRF identified lower levels of calcium and phosphorus in ERS enamel. Finally, EDS confirmed the reduced amount of calcium in ERS enamel, which appeared similar to dentin. Conclusion: This study suggests that, after an initial normal start to amelogenesis, the bulk of the tissue covering coronal dentin would be formed by different mechanisms based on nano- to micro-nodule aggregation. This evocated ectopic mineralization process is known to intervene in several soft tissues in FAM20A gene mutant.

  12. FAM20A Gene Mutation: Amelogenesis or Ectopic Mineralization?

    Directory of Open Access Journals (Sweden)

    Guilhem Lignon

    2017-05-01

    Full Text Available Background and objective:FAM20A gene mutations result in enamel renal syndrome (ERS associated with amelogenesis imperfecta (AI, nephrocalcinosis, gingival fibromatosis, and impaired tooth eruption. FAM20A would control the phosphorylation of enamel peptides and thus enamel mineralization. Here, we characterized the structure and chemical composition of unerupted tooth enamel from ERS patients and healthy subjects.Methods: Tooth sections were analyzed by Scanning Electron Microscopy (SEM, Energy Dispersive Spectroscopy (EDS, X-Ray Diffraction (XRD, and X-Ray Fluorescence (XRF.Results: SEM revealed that prisms were restricted to the inner-most enamel zones. The bulk of the mineralized matter covering the crown was formed by layers with varying electron-densities organized into lamellae and micronodules. Tissue porosity progressively increased at the periphery, ending with loose and unfused nanonodules also observed in the adjoining soft tissues. Thus, the enamel layer covering the dentin in all ERS patients (except a limited layer of enamel at the dentino-enamel junction displayed an ultrastructural globular pattern similar to one observed in ectopic mineralization of soft tissue, notably in the gingiva of Fam20a knockout mice. XRD analysis confirmed the existence of alterations in crystallinity and composition (vs. sound enamel. XRF identified lower levels of calcium and phosphorus in ERS enamel. Finally, EDS confirmed the reduced amount of calcium in ERS enamel, which appeared similar to dentin.Conclusion: This study suggests that, after an initial normal start to amelogenesis, the bulk of the tissue covering coronal dentin would be formed by different mechanisms based on nano- to micro-nodule aggregation. This evocated ectopic mineralization process is known to intervene in several soft tissues in FAM20A gene mutant.

  13. Analysis of catechol-O-methyltransferase gene mutation and identification of new pathogenic gene for paroxysmal kinesigenic dyskinesia.

    Science.gov (United States)

    Gu, Chengzhi; Li, Jia; Zhu, Lianhai; Lu, Zhenhui; Huang, Huaiyu

    2016-03-01

    We aimed to analyze the mutation site and frequency of catechol-O-methyltransferase (COMT) gene, to explore the relationship between COMT genotype and phenotype, and to find new pathogenic genes for paroxysmal kinesigenic dyskinesia (PKD). PKD patients who were treated from December 2011 to January 2014 were selected and subjected to genetic testing in the exon region of COMT. Two patients and one intrafamilial healthy control were subjected to exome sequencing using whole exome capture in combination with high-throughput sequencing to find candidate pathogenic gene sites. The results were verified by Sanger sequencing. A total of 11 familial PKD patients from 4 families and 9 sporadic patients without family history were included. Pathogenic c.634dupC(p.P220fsX7) mutation of COMT gene was found in 7 familial PKD patients and3 sporadic patients. Mutated COMT gene carriers suffered from PKD earlier (average age of onset: 11.61 ± 2.33 vs 16.21 ± 2.58, P = 0.001) with symmetric symptoms in most cases, while the mutation-negative group only showed unilateral symptoms (P = 0.001). The mutation-positive group also had more daily attacks (P = 0.038). Carbamazepine worked for all mutation-positive patients (10/10, 100%), but only for a part of mutation-negative patients (3/10, 30.0%). About 90000 single nucleotide polymorphisms and 2000 insertion-deletion polymorphisms were detected in each of the three samples. c.737C → T(p.T246 M) mutation of POC1B gene was a new pathogenic site for a selected family. COMT gene mutation, which was the pathogenesis of most familial PKD patients and a part of sporadic patients, predicted the response to carbamazepine. POC1B may be a novel pathogenic gene for PKD.

  14. Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

    Directory of Open Access Journals (Sweden)

    Matei Irina

    2001-08-01

    Full Text Available Abstract Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP positive and negative gastric carcinomas (GCs. Methods We analyzed 50 gastric carcinomas (GCs for mutations in the BLM poly(A tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases but not in any of the MMP negative GCs (0/35 cases. The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %, BAX (27%, hMSH6 (20%,hMSH3 (13%, CBL (13%, IGFIIR (7%, RECQL (0% and WRN (0%. Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors.

  15. Mutation Yield of a 34-Gene Solid Tumor Panel in Community-Based Tumor Samples.

    Science.gov (United States)

    Sanders, Heather; Qu, Kevin; Li, Hairong; Ma, Lin; Barlan, Cindy; Zhang, Xi; Prentice, James; Wolfson, David; Crossley, Beryl; Sferruzza, Anthony; Sninsky, John; Ross, David; Grupe, Andrew; Catanese, Joseph; Hantash, Feras; Waldman, Frederic

    2016-06-01

    Several targeted therapies have been approved for treatment of solid tumors. Identification of gene mutations that indicate response to these therapies is rapidly progressing. A 34-gene next-generation sequencing (NGS) panel, developed and validated by us, was evaluated to detect additional mutations in community-based cancer specimens initially sent to our reference laboratory for routine molecular testing. Consecutive de-identified clinical specimens (n = 121) from melanoma cases (n = 31), lung cancer cases (n = 27), colorectal cancer cases (n = 33), and breast cancer cases (n = 30) were profiled by NGS, and the results were compared with routine molecular testing. Upon initial mutation testing, 20 % (24/121) were positive. NGS detected ≥1 additional mutation not identified by routine testing in 74 % of specimens (90/121). Of the specimens with additional mutations, 16 harbored mutations in National Comprehensive Cancer Network guideline genes. These various additional mutations were in gene regions not routinely covered, in genes not routinely tested, and/or present at low allele frequencies. Moreover, NGS yielded no false negatives. Overall, NGS detected mutations in 59 % of the genes (20/34) included in the panel, 75 % of which (15/20) were detected in multiple tumor types. Mutations in TP53 were found in 51 % of tumors tested (62/121). Mutations in at least one other (non-TP53) gene present in the panel were detected in 64 % of cases (77/121). This assay provides improved breadth and sensitivity for profiling clinically relevant genes in these prevalent solid tumor types.

  16. TP53 GENE MUTATIONS – FROM GUARDIAN OF THE GENOME TO ONCOGENE

    Directory of Open Access Journals (Sweden)

    Petar Babović

    2010-03-01

    Full Text Available TP53 tumor suppressor gene mutations are the most frequent genetic alterations in human cancer affecting a specific gene. The occurrence of TP53 mutations is considerably influenced by cancer-initiating events, such as DNA damage, the aftermath of which is the promotion of cancer development through the loss of anti-proliferative activities, including apoptosis and cellular senescence. Over 27.000 TP53 gene mutations have been discovered and found in more than 50% of human cancers. The most frequent alterations are the point mutations with a single base substitution in gene segment encoding for DNA-binding domaine of p53 molecule, leading to the production of mutant protein that differs from the wild-type protein by one amino acid (missense mutations usually causing the change in tertiary structure of gene product, thus preventing p53 to bind to DNA and activate transcription of target genes. The result of the mutations may also be the proteins with new, abnormal functions, and the ability to modulate expression of genes responsible for neoangiogenesis, resistance to chemotherapeutics and prevention of tumor initiation and promotion. In such circumstances, not only the mutant TP53 loses its tumor suppressive function, but acquires oncogenic potential and becomes an active participant in the neoplastic transformation of the cell.Vast heterogeneity of mutations and methodological approaches in p53 status assessment represent the main difficulties in rapid and effective integration of basic p53 research into clinical practice.

  17. TET2 gene mutation is unfavorable prognostic factor in cytogenetically normal acute myeloid leukemia patients with NPM1+ and FLT3-ITD - mutations.

    Science.gov (United States)

    Tian, Xiaopeng; Xu, Yang; Yin, Jia; Tian, Hong; Chen, Suning; Wu, Depei; Sun, Aining

    2014-07-01

    Cytogenetically normal acute myeloid leukemia (cn-AML) is a group of heterogeneous diseases. Gene mutations are increasingly used to assess the prognosis of cn-AML patients and guide risk-adapted treatment. In the present study, we analyzed the molecular genetics characteristics of 373 adult cn-AML patients and explored the relationship between TET2 gene mutations or different genetic mutation patterns and prognosis. We found that 16.1 % of patients had TET2 mutations, 31.6 % had FLT3 internal tandem duplications (ITDs), 6.2 % had FLT3 tyrosine kinase domain mutations, 2.4 % had c-KIT mutations, 37.8 % had NPM1 mutations, 11.3 % had WT1 mutations, 5.9 % had RUNX1 mutations, 11.5 % had ASXL1 mutations, 3.8 % had MLL-PTDs, 7.8 % had IDH1 mutations, 7.8 % had NRAS mutations, 12.3 % had IDH2 mutations, 1.6 % had EZH2 mutations, and 14.7 % had DNMT3A mutations, while none had CBL mutations. Gene mutations were detected in 76.94 % (287/373) of all patients. In the NPM1m(+) patients, those with TET2 mutations were associated with a shorter median overall survival (OS) as compared to TET2 wild-type (wt) patients (9.9 vs. 27.0 months, respectively; P = 0.023); Interestingly, the TET2 mutation was identified as an unfavorable prognostic factor and was closely associated with a shorter median OS as compared to TET2-wt (9.5 vs. 32.2 months, respectively; P = 0.013) in the NPM1m(+)/FLT3-ITDm(-) patient group. Thus, identification of TET2 combined with classic NPM1 and FLT3-ITD mutations allowed us to stratify cn-AML into distinct subtypes.

  18. [Two novel mutations of FBN1 gene in the patients with MFS among Han population].

    Science.gov (United States)

    Chen, Qing-Quan; Wu, Yan-An; Huang, Xiao-Li; Chen, Tong; Huang, Yi; Chen, Fa-Lin; Chen, Fa-Wen

    2010-01-01

    To detect the mutations of fibrillin-1 (FBN1) gene in the patients with Marfan syndrome (MFS), polymerase chain reaction (PCR) and denaturing high-performance liquid chromatography (DHPLC) were conducted to screen for the mutations in FBN1 gene. Sequence analyses were carried out when the DNA amplification fragments of the DHPLC elution profiles showed difference from the corresponding normal elution profile. Two novel mutations were detected in two families with MFS, respectively. One was a multiplex mutation in exon 55 containing a deletion mutation c.6862_6871delGGCTGTGTAG (p.Gly2288MetfsX109), a synonymous mutation (c.6861A>G) and an intronic mutation c.[6871+1_6871+11delGTAAGAGGATC; 6871+34dupCATCAGAAGTGACAGTGGACA], and the other was a missense mutation in exon 20 c.2462G>A (p.Cys821Tyr). The results indicated that the deletion mutation c.[6862_6871delGGCTGT GTAG; 6871+1_6871+11delGTAAGAGGATC] (p.Gly2288MetfsX109) and the missense mutation c.2462G>A (p.Cys821Tyr) of FBN1 gene may cause the two family patients with MFS respectively.

  19. Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

    Energy Technology Data Exchange (ETDEWEB)

    Poussaint, T.Y. [Dept. of Radiology, Children' s Hospital, Boston, MA (United States); Fox, J.W.; Walsh, C.A. [Program in Biological and Biomedical Sciences, Harvard Medical School, Boston, MA (United States); Dept. of Neurology, Beth Israel Deaconess Medical Center, Harvard Institutes of Medicine, Boston, MA (United States); Dobyns, W.B. [Department of Human Genetics, The University of Chicago, Chicago, IL (United States); Radtke, R. [Division of Neurology, Duke University Medical Center, Durham, NC (United States); Scheffer, I.E.; Berkovic, S.F. [Department of Neurology, University of Melbourne, Austin and Repatriation Medical Centre, Heidelberg (Australia); Barnes, P.D. [Department of Radiology, Children' s Hospital and Harvard Medical School, Boston, MA (United States); Huttenlocher, P.R. [Department of Pediatrics, University of Chicago, Chicago, Illinois (United States)

    2000-11-01

    Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

  20. Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation: A case report.

    Science.gov (United States)

    Li, Tao; Zhang, Zhao-Jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-Nan; Liu, Hong-Yan; Wang, Hong-Dan; Wu, Dong; Lou, Gui-Yu; Wang, Xin; Zhang, Chao-Yang; Liao, Shi-Xiu

    2017-12-01

    Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  1. Varying Intolerance of Gene Pathways to Mutational Classes Explain Genetic Convergence across Neuropsychiatric Disorders.

    Science.gov (United States)

    Shohat, Shahar; Ben-David, Eyal; Shifman, Sagiv

    2017-02-28

    Genetic susceptibility to intellectual disability (ID), autism spectrum disorder (ASD), and schizophrenia (SCZ) often arises from mutations in the same genes, suggesting that they share common mechanisms. We studied genes with de novo mutations in the three disorders and genes implicated in SCZ by genome-wide association study (GWAS). Using biological annotations and brain gene expression, we show that mutation class explains enrichment patterns more than specific disorder. Genes with loss-of-function mutations and genes with missense mutations were associated with different pathways across disorders. Conversely, gene expression patterns were specific for each disorder. ID genes were preferentially expressed in the cortex; ASD genes were expressed in the fetal cortex, cerebellum, and striatum; and genes associated with SCZ were expressed in the adolescent cortex. Our study suggests that convergence across neuropsychiatric disorders stems from common pathways that are consistently vulnerable to genetic variations but that spatiotemporal activity of genes contributes to specific phenotypes. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. ACAN Gene Mutations in Short Children Born SGA and Response to Growth Hormone Treatment.

    Science.gov (United States)

    van der Steen, Manouk; Pfundt, Rolph; Maas, Stephan J W H; Bakker-van Waarde, Willie M; Odink, Roelof J; Hokken-Koelega, Anita C S

    2017-05-01

    Some children born small for gestational age (SGA) show advanced bone age (BA) maturation during growth hormone (GH) treatment. ACAN gene mutations have been described in children with short stature and advanced BA. To determine the presence of ACAN gene mutations in short SGA children with advanced BA and assess the response to GH treatment. BA assessment in 290 GH-treated SGA children. ACAN sequencing in 29 children with advanced BA ≥0.5 years compared with calendar age. Four of 29 SGA children with advanced BA had an ACAN gene mutation (13.8%). Mutations were related to additional characteristics: midface hypoplasia (P = 0.003), joint problems (P = 0.010), and broad great toes (P = 0.003). Children with one or fewer additional characteristic had no mutation. Of children with two additional characteristics, 50% had a mutation. Of children with three additional characteristics, 100% had a mutation. All GH-treated children with a mutation received gonadotropin-releasing hormone analog (GnRHa) treatment for 2 years from onset of puberty. At adult height, one girl was 5 cm taller than her mother and one boy was 8 cm taller than his father with the same ACAN gene mutation. This study expands the differential diagnosis of genetic variants in children born SGA and proposes a clinical scoring system for identifying subjects most likely to have an ACAN gene mutation. ACAN sequencing should be considered in children born SGA with persistent short stature, advanced BA, and midface hypoplasia, joint problems, or broad great toes. Our findings suggest that children with an ACAN gene mutation benefit from GH treatment with 2 years of GnRHa.

  3. Mutations in genes involved in nonsense mediated decay ameliorate the phenotype of sel-12 mutants with amber stop mutations in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Aubert Sylvie

    2009-03-01

    Full Text Available Abstract Background Presenilin proteins are part of a complex of proteins that can cleave many type I transmembrane proteins, including Notch Receptors and the Amyloid Precursor Protein, in the middle of the transmembrane domain. Dominant mutations in the human presenilin genes PS1 and PS2 lead to Familial Alzheimer's disease. Mutations in the Caenorhabditis elegans sel-12 presenilin gene cause a highly penetrant egg-laying defect due to reduction of signalling through the lin-12/Notch receptor. Mutations in six spr genes (for suppressor of presenilin are known to strongly suppress sel-12. Mutations in most strong spr genes suppress sel-12 by de-repressing the transcription of the largely functionally equivalent hop-1 presenilin gene. However, how mutations in the spr-2 gene suppress sel-12 is unknown. Results We show that spr-2 mutations increase the levels of sel-12 transcripts with Premature translation Termination Codons (PTCs in embryos and L1 larvae. mRNA transcripts from sel-12 alleles with PTCs undergo degradation by a process known as Nonsense Mediated Decay (NMD. However, spr-2 mutations do not appear to affect NMD. Mutations in the smg genes, which are required for NMD, can restore sel-12(PTC transcript levels and ameliorate the phenotype of sel-12 mutants with amber PTCs. However, the phenotypic suppression of sel-12 by smg genes is nowhere near as strong as the effect of previously characterized spr mutations including spr-2. Consistent with this, we have identified only two mutations in smg genes among the more than 100 spr mutations recovered in genetic screens. Conclusion spr-2 mutations do not suppress sel-12 by affecting NMD of sel-12(PTC transcripts and appear to have a novel mechanism of suppression. The fact that mutations in smg genes can ameliorate the phenotype of sel-12 alleles with amber PTCs suggests that some read-through of sel-12(amber alleles occurs in smg backgrounds.

  4. Mutations in genes involved in nonsense mediated decay ameliorate the phenotype of sel-12 mutants with amber stop mutations in Caenorhabditis elegans.

    Science.gov (United States)

    Gontijo, Alisson M; Aubert, Sylvie; Roelens, Ingele; Lakowski, Bernard

    2009-03-20

    Presenilin proteins are part of a complex of proteins that can cleave many type I transmembrane proteins, including Notch Receptors and the Amyloid Precursor Protein, in the middle of the transmembrane domain. Dominant mutations in the human presenilin genes PS1 and PS2 lead to Familial Alzheimer's disease. Mutations in the Caenorhabditis elegans sel-12 presenilin gene cause a highly penetrant egg-laying defect due to reduction of signalling through the lin-12/Notch receptor. Mutations in six spr genes (for suppressor of presenilin) are known to strongly suppress sel-12. Mutations in most strong spr genes suppress sel-12 by de-repressing the transcription of the largely functionally equivalent hop-1 presenilin gene. However, how mutations in the spr-2 gene suppress sel-12 is unknown. We show that spr-2 mutations increase the levels of sel-12 transcripts with Premature translation Termination Codons (PTCs) in embryos and L1 larvae. mRNA transcripts from sel-12 alleles with PTCs undergo degradation by a process known as Nonsense Mediated Decay (NMD). However, spr-2 mutations do not appear to affect NMD. Mutations in the smg genes, which are required for NMD, can restore sel-12(PTC) transcript levels and ameliorate the phenotype of sel-12 mutants with amber PTCs. However, the phenotypic suppression of sel-12 by smg genes is nowhere near as strong as the effect of previously characterized spr mutations including spr-2. Consistent with this, we have identified only two mutations in smg genes among the more than 100 spr mutations recovered in genetic screens. spr-2 mutations do not suppress sel-12 by affecting NMD of sel-12(PTC) transcripts and appear to have a novel mechanism of suppression. The fact that mutations in smg genes can ameliorate the phenotype of sel-12 alleles with amber PTCs suggests that some read-through of sel-12(amber) alleles occurs in smg backgrounds.

  5. [Determination of K-ras gene mutation in colorectal cancer tissue by capillary electrophoresis].

    Science.gov (United States)

    Shi, Dongqin; Wang, Rong; Xie, Hua; Tian, Wei; Jia, Zhengping; Guo, Jiankui

    2013-06-01

    The codons 12/13 of K-ras genomic DNA from 76 colorectal cancer tissues and normal tissues were amplified by PCR. The amplified 152 samples were purified, denatured, and then detected using capillary electrophoresis (CE)-laser induced fluorescence (LIF) with single-strand conformation polymorphism (SSCP). The abnormal samples were further confirmed by direct-sequencing. The 30 patients of the 76 colorectal cancer patients were found gene mutation, of which the results of base G --> A point mutation were confirmed by the gene sequence. To detect K-ras gene mutation that has important role in clinical forecast, diagnosis, therapy and prognosis, the CE-LIF with SSCP was applied for detecting K-ras gene. It becomes a promising tool to analyse K-ras gene mutation in the clinical diagnosis and therapy of colorectal cancer tissue.

  6. Human Papillomavirus 16 E6 Contributes HIF-1α Induced Warburg Effect by Attenuating the VHL-HIF-1α Interaction

    Directory of Open Access Journals (Sweden)

    Yi Guo

    2014-05-01

    Full Text Available Cervical cancer is still one of the leading causes of cancer deaths in women worldwide, especially in the developing countries. It is a major metabolic character of cancer cells to consume large quantities of glucose and derive more energy by glycolysis even in the presence of adequate oxygen, which is called Warburg effect that can be exaggerated by hypoxia. The high risk subtype HPV16 early oncoprotein E6 contributes host cell immortalization and transformation through interacting with a number of cellular factors. Hypoxia-inducible factor 1α (HIF-1α, a ubiquitously expressed transcriptional regulator involved in induction of numerous genes associated with angiogenesis and tumor growth, is highly increased by HPV E6. HIF-1α is a best-known target of the von Hippel-Lindau tumor suppressor (VHL as an E3 ligase for degradation. In the present work, we found that HPV16 E6 promotes hypoxia induced Warburg effect through hindering the association of HIF-1α and VHL. This disassociation attenuates VHL-mediated HIF-1α ubiquitination and causes HIF-1α accumulation. These results suggest that oncoprotein E6 plays a major role in the regulation of Warburg effect and can be a valuable therapeutic target for HPV-related cancer.

  7. LHON/MELAS overlap syndrome associated with a mitochondrial MTND1 gene mutation.

    Science.gov (United States)

    Blakely, Emma L; de Silva, Rajith; King, Andrew; Schwarzer, Verena; Harrower, Tim; Dawidek, Gervase; Turnbull, Douglass M; Taylor, Robert W

    2005-05-01

    Pathogenic point mutations in the mitochondrial MTND1 gene have previously been described in association with two distinct clinical phenotypes -- Leber hereditary optic neuropathy (LHON) and mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS). Here we report the first heteroplasmic mitochondrial DNA (mtDNA) point mutation (3376G>A) in the MTND1 gene associated with an overlap syndrome comprising the clinical features of both LHON and MELAS. Muscle histochemistry revealed subtle mitochondrial abnormalities, while biochemical analysis showed an isolated complex I deficiency. Our findings serve to highlight the growing importance of mutations in mitochondrial complex I structural genes in MELAS and its associated overlap syndromes.

  8. The application of finite state machine in modeling and control of gene mutation process.

    Science.gov (United States)

    Gao, Rui; Hu, Wensong; Tarn, Tzyh-Jong

    2013-12-01

    This paper extends our previous study on discrete events system formulations of DNA hybridization, and focuses discussions on metabolism and gene mutation in molecular biology. Finite state machine (FSM) theory is extensively applied to represent key concepts and analyzes the processes related to the biological phenomena mentioned above. The goal is to mathematically represent and interpret the process of gene mutation and the effects on structures of protein macro molecule caused by gene mutation. We hope the proposed model will provide a foothold for introducing the information science and the control theory tools in molecular biology.

  9. Novel heterozygous nonsense mutation of the OPTN gene segregating in a Danish family with ALS

    DEFF Research Database (Denmark)

    Tümer, Zeynep; Bertelsen, Birgitte; Gredal, Ole

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder. About 10% of ALS cases are familial (FALS) and the genetic defect is known only in approximately 20%-30% of these cases. The most common genetic cause of ALS is SOD1 (superoxide dismutase 1) mutation. Very recently......, mutations of the optineurin gene (OPTN), which is involved in open-angle glaucoma, were identified in 3 Japanese patients/families with ALS, and subsequently in a few FALS patients of European descent. We found a heterozygous nonsense mutation (c.493C>T, p.Gln165X, exon 6) in the OPTN gene in a Danish...... patient with ALS, and the mutation segregated from his affected father. The p.Gln165X mutation could not be detected in 1070 healthy Danish controls, in 1000 Danish individuals with metabolic phenotypes or in 64 sporadic ALS (SALS) cases. The p.Gln165X mutation described in this study is the first...

  10. Prevalence of HFE and TFR2 gene mutation in 118 Ligurian rheumatic patients.

    Science.gov (United States)

    Rovetta, G; Monteforte, P; Buffrini, L; Grignolo, M C; Franchin, F

    2004-12-01

    HFE gene is associated to haemochromatosis, an inherited autosomal recessive disorder responsible of an overload of iron in intestine, liver, pancreas, heart, cutis and joints. Articular and periarticular calcifications may occur. H63D mutation may play a role in the pathogenesis of rheumatoid arthritis. DNA of 118 consecutive patients (28 males, 90 females, mean age 58.5+/-13.44) living in Liguria and affected by different rheumatic diseases was examined to evaluate the presence of HFE mutations. Analysis data showed that in 45% (53/118) of patients almost one mutation of HFE gene was present and the presence of H63D mutation in the rheumatic patients was particularly elevated. Data obtained in this study have permitted to reveal that 25 patients of 53 (47.1%) with 1 of 11 HFE mutations suffered from symptomatic or silent chondrocalcinosis. The conclusion is drawn that this mutation may be correlated to various rheumatic diseases.

  11. Targeted resequencing for analysis of clonal composition of recurrent gene mutations in chronic lymphocytic leukaemia

    DEFF Research Database (Denmark)

    Jethwa, Alexander; Hüllein, Jennifer; Stolz, Tatjana

    2013-01-01

    Recurrent gene mutations contribute to the pathogenesis of chronic lymphocytic leukaemia (CLL). We developed a next-generation sequencing (NGS) platform to determine the genetic profile, intratumoural heterogeneity, and clonal structure of two independent CLL cohorts. TP53, SF3B1, and NOTCH1 were...... most frequently mutated (16.3%, 16.9%, 10.7%). We found evidence for subclonal mutations in 67.5% of CLL cases with mutations of cancer consensus genes. We observed selection of subclones and found initial evidence for convergent mutations in CLL. Our data suggest that assessment of (sub......)clonal structure may need to be integrated into analysis of the mutational profile in CLL....

  12. Mutations and polymorphism in bottlenose dolphin (Tursiops truncatus, Montagu 1821) albumin gene: First identification of mutations responsible for inherited bisalbuminemia.

    Science.gov (United States)

    Gili, Claudia; Bonsembiante, Federico; Beffagna, Giorgia; Mazzariol, Sandro; Gelain, Maria Elena

    2017-10-01

    Hereditary bisalbuminemia is an asymptomatic and heterozygous condition in a range of species characterized by the presence of two serum albumin fractions with different electrophoretic mobility resulting in a bicuspid pattern on serum electrophoresis. Bisalbuminemia has been diagnosed by electrophoresis in two bottlenose dolphin (Tursiops truncatus) families, but causative mutations and the inheritance pattern have not been identified. The aims of this work are: to investigate polymorphisms of the bottlenose dolphin albumin gene and to identify mutations causative of bisalbuminemia; to identify the inheritance pattern in two bottlenose dolphin families. Coding regions of the albumin gene were screened for mutations in 15 bottlenose dolphins kept under human care from two distinct families. Eighteen albumin mutations (three synonymous and 15 non-synonymous) were identified. Two non-synonymous variations co-segregated with bisalbuminemic phenotype: p.Phe146Leu in exon 4 and p.Tyr163His in exon 5. The amino acid change in exon 5 was associated with the secondary and/or tertiary structure variation of the protein and has been reported as causative of bisalbuminemia in humans. Pedigree analysis of the dolphin families showed an autosomal codominant inheritance pattern. In this work, the mutations potentially responsible for bisalbuminemia were identified and confirmed the autosomal codominant trait in bottlenose dolphins. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Hybrid curation of gene-mutation relations combining automated extraction and crowdsourcing.

    Science.gov (United States)

    Burger, John D; Doughty, Emily; Khare, Ritu; Wei, Chih-Hsuan; Mishra, Rajashree; Aberdeen, John; Tresner-Kirsch, David; Wellner, Ben; Kann, Maricel G; Lu, Zhiyong; Hirschman, Lynette

    2014-01-01

    This article describes capture of biological information using a hybrid approach that combines natural language processing to extract biological entities and crowdsourcing with annotators recruited via Amazon Mechanical Turk to judge correctness of candidate biological relations. These techniques were applied to extract gene- mutation relations from biomedical abstracts with the goal of supporting production scale capture of gene-mutation-disease findings as an open source resource for personalized medicine. The hybrid system could be configured to provide good performance for gene-mutation extraction (precision ∼82%; recall ∼70% against an expert-generated gold standard) at a cost of $0.76 per abstract. This demonstrates that crowd labor platforms such as Amazon Mechanical Turk can be used to recruit quality annotators, even in an application requiring subject matter expertise; aggregated Turker judgments for gene-mutation relations exceeded 90% accuracy. Over half of the precision errors were due to mismatches against the gold standard hidden from annotator view (e.g., incorrect EntrezGene identifier or incorrect mutation position extracted), or incomplete task instructions (e.g., the need to exclude nonhuman mutations). The hybrid curation model provides a readily scalable cost-effective approach to curation, particularly if coupled with expert human review to filter precision errors. We plan to generalize the framework and make it available as open source software. http://www.mitre.org/publications/technical-papers/hybrid-curation-of-gene-mutation-relations-combining-automated. © The Author(s) 2014. Published by Oxford University Press.

  14. Frameshift mutations in coding repeats of protein tyrosine phosphatase genes in colorectal tumors with microsatellite instability

    Directory of Open Access Journals (Sweden)

    Bork Peer

    2008-11-01

    Full Text Available Abstract Background Protein tyrosine phosphatases (PTPs like their antagonizing protein tyrosine kinases are key regulators of signal transduction thereby assuring normal control of cellular growth and differentiation. Increasing evidence suggests that mutations in PTP genes are associated with human malignancies. For example, mutational analysis of the tyrosine phosphatase (PTP gene superfamily uncovered genetic alterations in about 26% of colorectal tumors. Since in these studies tumors have not been stratified according to genetic instability status we hypothesized that colorectal tumors characterized by high-level of microsatellite instability (MSI-H might show an increased frequency of frameshift mutations in those PTP genes that harbor long mononucleotide repeats in their coding region (cMNR. Results Using bioinformatic analysis we identified 16 PTP candidate genes with long cMNRs that were examined for genetic alterations in 19 MSI-H colon cell lines, 54 MSI-H colorectal cancers, and 17 MSI-H colorectal adenomas. Frameshift mutations were identified only in 6 PTP genes, of which PTPN21 show the highest mutation frequency at all in MSI-H tumors (17%. Conclusion Although about 32% of MSI-H tumors showed at least one affected PTP gene, and cMNR mutation rates in PTPN21, PTPRS, and PTPN5 are higher than the mean mutation frequency of MNRs of the same length, mutations within PTP genes do not seem to play a common role in MSI tumorigenesis, since no cMNR mutation frequency reached statistical significance and therefore, failed prediction as a Positive Selective Target Gene.

  15. Genetic screening of the FLCN gene identify six novel variants and a Danish founder mutation

    DEFF Research Database (Denmark)

    Rossing, Maria; Albrechtsen, Anders; Skytte, Anne-Bine

    2017-01-01

    Pathogenic germline mutations in the folliculin (FLCN) tumor suppressor gene predispose to Birt-Hogg-Dubé (BHD) syndrome, a rare disease characterized by the development of cutaneous hamartomas (fibrofolliculomas), multiple lung cysts, spontaneous pneumothoraces and renal cell cancer. In this study...... families exhibited the c.1062+2T>G mutation. Combined single nucleotide polymorphism array-haplotype analysis showed that these families share a 3-Mb genomic fragment containing the FLCN gene, revealing that the c.1062+2T>G mutation is a Danish founder mutation. On the basis of in silico prediction...... and functional splicing assays, we classify the 16 identified variants in the FLCN gene as follows: nine as pathogenic, one as likely pathogenic, three as likely benign and three as polymorphisms. In conclusion, the study describes the FLCN mutation spectrum in Danish BHD patients, and contributes to a better...

  16. Identification of a novel mutation of the CPO gene in a Japanese hereditary coproporphyria family.

    Science.gov (United States)

    Susa, S; Daimon, M; Kondo, H; Kondo, M; Yamatani, K; Sasaki, H

    1998-11-16

    Hereditary coproporphyria (HCP) is an autosomal dominant disease characterized by a deficiency of coproporphyrinogen oxidase (CPO) caused by a mutation in the CPO gene. Only 11 mutations of the gene have been reported in HCP patients. We report another mutation in a Japanese family. Polymerase chain reaction-single strand conformational polymorphism and direct sequence analyses demonstrated a C to T substitution in exon 1 of the CPO gene at nucleotide position 85, which lies in the putative presequence for targeting to mitochondria. This mutation changes the codon for glutamine to a termination codon at amino acid position 29. MaeI restriction analysis showed two other carriers in the family. The C-T mutation is located within a recently proposed putative alternative translation initiation codon (TIC-1), supporting that TIC-1 is the real TIC rather than TIC-2.

  17. Mutations in the SLC3A1 transporter gene in cystinuria

    Energy Technology Data Exchange (ETDEWEB)

    Pras, E.; Raben, N.; Aksentijevich, I. [National Heart, Lung, and Blood Institute, Bethesda, MD (United States)] [and others

    1995-06-01

    Cystinuria is an autosomal recessive disease characterized by the development of kidney stones. Guided by the identification of the SLC3A1 amino acid-transport gene on chromosome 2, we recently established genetic linkage of cystinuria to chromosome 2p in 17 families, without evidence for locus heterogeneity. Other authors have independently identified missense mutations in SLC3A1 in cystinuria patients. In this report we describe four additional cystinuria-associated mutations in this gene: a frameshift, a deletion, a transversion inducing a critical amino acid change, and a nonsense mutation. The latter stop codon was found in all of eight Ashkenazi Jewish carrier chromosomes examined. This report brings the number of disease-associated mutations in this gene to 10. We also assess the frequency of these mutations in our 17 cystinuria families. 24 refs., 4 figs., 1 tab.

  18. A novel mutation in the HSPD1 gene in a patient with hereditary spastic paraplegia

    DEFF Research Database (Denmark)

    Hansen, Jakob; Svenstrup, Kirsten; Ang, Debbie

    2007-01-01

    A mutation in the HSPD1 gene has previously been associated with an autosomal dominant form of spastic paraplegia in a French family. HSPD1 encodes heat shock protein 60, a molecular chaperone involved in folding and quality control of mitochondrial proteins. In the present work we have investiga......A mutation in the HSPD1 gene has previously been associated with an autosomal dominant form of spastic paraplegia in a French family. HSPD1 encodes heat shock protein 60, a molecular chaperone involved in folding and quality control of mitochondrial proteins. In the present work we have...... investigated 23 Danish index patients with hereditary spastic paraplegia (HSP) for mutations in the HSPD1 gene. One patient was found to be heterozygous for a c.1381C > G missense mutation encoding the mutant heat shock protein 60 p.Gln461Glu. The mutation was also present in two unaffected brothers...

  19. Characterization of mutations in the gene doublecortin in patients with double cortex syndrome.

    Science.gov (United States)

    Gleeson, J G; Minnerath, S R; Fox, J W; Allen, K M; Luo, R F; Hong, S E; Berg, M J; Kuzniecky, R; Reitnauer, P J; Borgatti, R; Mira, A P; Guerrini, R; Holmes, G L; Rooney, C M; Berkovic, S; Scheffer, I; Cooper, E C; Ricci, S; Cusmai, R; Crawford, T O; Leroy, R; Andermann, E; Wheless, J W; Dobyns, W B; Walsh, C A

    1999-02-01

    Mutations in the X-linked gene doublecortin, which encodes a protein with no dear structural homologues, are found in pedigrees in which affected females show "double cortex" syndrome (DC; also known as subcortical band heterotopia or laminar heterotopia) and affected males show X-linked lissencephaly. Mutations in doublecortin also cause sporadic DC in females. To determine the incidence of doublecortin mutations in DC, we investigated a cohort of eight pedigrees and 47 sporadic patients with DC for mutations in the doublecortin open reading frame as assessed by single-stranded conformational polymorphism analysis. Mutations were identified in each of the eight DC pedigrees (100%), and in 18 of the 47 sporadic DC patients (38%). Identified mutations were of two types, protein truncation mutations and single amino acid substitution mutations. However, pedigrees with DC displayed almost exclusively single amino acid substitution mutations, suggesting that patients with these mutations may have less of a reproductive disadvantage versus those patients with protein truncation mutations. Single amino acid substitution mutations were tightly clustered in two regions of the open reading frame, suggesting that these two regions are critical for the function of the Doublecortin protein.

  20. AIRE gene mutations and autoantibodies to interferon omega in patients with chronic hypoparathyroidism without APECED.

    Science.gov (United States)

    Cervato, Sara; Morlin, Luca; Albergoni, Maria Paola; Masiero, Stefano; Greggio, Nella; Meossi, Cristiano; Chen, Shu; del Pilar Larosa, Maria; Furmaniak, Jadwiga; Rees Smith, Bernard; Alimohammadi, Mohammad; Kämpe, Olle; Valenzise, Mariella; Betterle, Corrado

    2010-11-01

    To assess autoimmune regulator (AIRE) gene mutations, class II HLA haplotypes, and organ- or non-organ-specific autoantibodies in patients with chronic hypoparathyroidism (CH) without associated Addison's disease (AD) or chronic candidiasis (CC). Twenty-four patients who had CH without AD or CC were included in the study. AIRE gene mutations in all 14 exons were studied using PCR in 24 patients, 105 healthy controls and 15 first-degree relatives of CH patients with AIRE mutations. Human leucocyte antigens (HLA) were determined for all 24 patients and 105 healthy controls. Autoantibodies to a range of antigens including NACHT leucine-rich-repeat protein-5 (NALP5) and interferon omega (IFNω) were tested in all 24 patients. AIRE gene mutations were found in 6 of 24 (25%) patients, all females, and this was significantly higher (P AIRE mutations found in healthy controls (2/105). Three patients (12·5%) had homozygous AIRE mutations characteristic of Autoimmune-Poly-Endocrinopathy-Candidiasis-Ectodermal-Dystrophy and all three were also positive for IFNω-autoantibodies. Three patients (12·5%) had heterozygous AIRE mutations; two of these were novel mutations. One of the patients with heterozygous AIRE mutations was positive for both NACHT leucine-rich-repeat protein 5 and IFNω autoantibodies. Heterozygous AIRE mutations were found in 10 of 15 first-degree relatives of CH patients with AIRE mutations, although none was affected by CH. Class II HLA haplotypes were not statistically different in patients with CH compared to healthy controls. Analysis of AIRE gene mutations together with serum autoantibody profile should be helpful in the assessment of patients with CH, in particular young women with associated autoimmune diseases. © 2010 Blackwell Publishing Ltd.

  1. The mutational spectrum of HRAS, KRAS, NRAS and FGFR3 genes in bladder cancer.

    Science.gov (United States)

    Ouerhani, Slah; Elgaaied, Amel Ben Ammar

    Bladder cancer is one of the most common cancers worldwide. A number of genetic and epigenetic alterations have been identified in bladder tumorigenesis, including activating mutations in fibroblast growth factor receptor 3 (FGFR3) and RAS family genes. In this study, we have analysed the mutational spectrum of FGFR3 and RAS genes (HRAS, NRAS and KRAS). We have also studied the relationship between mutations. A total of 234 patients with different stages and grades were included in the present study (58 superficial low-grade, 53 superficial high-grade and 123 muscle-invasive tumours). Mutations in exons 1 and 2 of HRAS, KRAS and NRAS genes were screened by PCR and direct sequencing. The hot spot mutations in exons 7, 10 and 15 of the FGFR3 oncogene were studied by multiplex PCR and the SNaP-shot protocol. Overall, 8.97% (21/234) of samples were mutant for one of the RAS genes. Among these mutations 47.61% were detected in KRAS, 33.33% in HRAS and only 19.04% most frequent RAS mutations were KRAS p.G12C and p.G12D. The correlation between RAS mutations and tumour subgroups does not report a statistical significant association (p=0.876). The FGFR3 mutations were detected in 31.19% (73/234) of bladder tumours and were associated with low stages and grades. The study of relationship between RAS and FGFR3 genes revealed that FGFR3 mutations were mutually exclusive with RAS ones (p=10(-4)). In conclusion we retain that activated RAS and FGFR3 do not appear to be drivers in bladder cancer but the mutually exclusive relationship between RAS and FGFR3 mutations indicates a possible clonal advantage of modified signaling via a common pathway.

  2. Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases

    Directory of Open Access Journals (Sweden)

    He Xin

    2013-01-01

    Full Text Available Abstract The human c-mpl gene (MPL plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations.

  3. Further Evidence of Mutational Heterogeneity of the XPC Gene in Tunisian Families: A Spectrum of Private and Ethnic Specific Mutations

    Directory of Open Access Journals (Sweden)

    Mariem Ben Rekaya

    2013-01-01

    Full Text Available Xeroderma Pigmentosum (XP is a rare recessive autosomal cancer prone disease, characterized by UV hypersensitivity and early appearance of cutaneous and ocular malignancies. We investigated four unrelated patients suspected to be XP-C. To confirm linkage to XPC gene, genotyping and direct sequencing of XPC gene were performed. Pathogenic effect of novel mutations was confirmed by reverse Transciptase PCR. Mutation screening revealed the presence of two novel mutations g.18246G>A and g.18810G>T in the XPC gene (NG_011763.1. The first is present in one patient XP50NEF, but the second is present in three unrelated patients (XP16KEB, XP28SFA, and XP45GB. These 3 patients are from three different cities of Southern Tunisia and bear the same haplotype, suggesting a founder effect. Reverse Transciptase PCR revealed the absence of the XPC mRNA. In Tunisia, as observed in an other severe genodermatosis, the mutational spectrum of XP-C group seems to be homogeneous with some clusters of heterogeneity that should be taken into account to improve molecular diagnosis of this disease.

  4. Sporadic Nonautoimmune Neonatal Hyperthyroidism Due to A623V Germline Mutation in the Thyrotropin Receptor Gene

    Science.gov (United States)

    Ağladıoğlu, Sebahat Yılmaz; Ceylaner, Serdar; Çetinkaya, Semra; Baş, Veysel Nijat; Peltek Kendirici, Havva Nur

    2010-01-01

    Neonatal hyperthyroidism is a rare disorder and occurs in two forms. An autoimmune form is associated with maternal Graves' disease, resulting from transplacental passage of maternal thyroid−stimulating antibodies and a nonautoimmune form is caused by gain of function mutations in the thyrotropin receptor (TSHR) gene. Thyrotoxicosis caused by germline mutations in the TSHR gene may lead to a variety of clinical consequences. To date, 55 activating mutations of the TSHR gene have been documented. Fourteen cases with sporadic activating TSHR germline mutations have been described. Here we report a male infant with nonautoimmune hyperthyroidism due to an activating germline TSHR mutation (A623V), whose clinical picture started in the newborn period with severe hyperthyroidism. His parents did not have the same mutation. This mutation had been previously detected as a somatic mutation in patients with toxic adenomas. This is the first report of a sporadic case of nonautoimmune congenital hyperthyroidism associated with A623V mutation. Conflict of interest:None declared. PMID:21274318

  5. Mutations in genes encoding PI3K-AKT and MAPK signaling define anogenital papillary hidradenoma.

    Science.gov (United States)

    Pfarr, Nicole; Sinn, Hans-Peter; Klauschen, Frederick; Flechtenmacher, Christa; Bockmayr, Michael; Ridinger, Kathrin; von Winterfeld, Moritz; Warth, Arne; Lorenz, Katja; Budczies, Jan; Penzel, Roland; Lennerz, Jochen K; Endris, Volker; Weichert, Wilko; Stenzinger, Albrecht

    2016-02-01

    Papillary hidradenoma (a.k.a. hidradenoma papilliferum) is a benign tumor of the anogenital region that almost exclusively arises in middle-aged Caucasian women. These tumors may recur and rare cases of malignant development have been reported. The genetic basis of papillary hidradenoma is currently unknown. Hence, we employed targeted high-coverage next generation sequencing interrogating 50 cancer-related genes and conventional Sanger sequencing to investigate the mutational landscape in a cohort of 15 cases. Additionally, we analyzed the HPV status of these tumors. Thirteen cases (87%) harbored mutations in cancer-related genes. Recurrent mutations in PIK3CA and AKT1 were present in 10 of the cases (67%). One PIK3CA mutated case had a concomitant STK11 mutation. Three cases harbored mutually exclusive mutations in BRAF, APC and ERBB4. The remaining two cases showed no mutations. None of the cases harbored DNA of human papilloma virus. Our results also provide evidence that--just as BRAF V600E mutations in hyperplastic polyps and benign nevi- a mutated driver gene does not imply malignant behavior per se but may set the basis for malignant transformation. The latter point may explain why rare cases of papillary hidradenoma have been reported to take a malignant course. Lastly, our genetic data may suggest treatment avenues beyond conventional surgery for some of these tumors. © 2015 Wiley Periodicals, Inc.

  6. An Undergraduate Laboratory Class Using CRISPR/Cas9 Technology to Mutate Drosophila Genes

    Science.gov (United States)

    Adame, Vanesa; Chapapas, Holly; Cisneros, Marilyn; Deaton, Carol; Deichmann, Sophia; Gadek, Chauncey; Lovato, TyAnna L.; Chechenova, Maria B.; Guerin, Paul; Cripps, Richard M.

    2016-01-01

    CRISPR/Cas9 genome editing technology is used in the manipulation of genome sequences and gene expression. Because of the ease and rapidity with which genes can be mutated using CRISPR/Cas9, we sought to determine if a single-semester undergraduate class could be successfully taught, wherein students isolate mutants for specific genes using…

  7. Mutational analysis of the BRCA1 gene in 30 Czech ovarian cancer ...

    Indian Academy of Sciences (India)

    Unknown

    Ovarian cancer is one of the most severe of oncological diseases. Inherited mutations in cancer susceptibility genes play a causal role in 5–10% of newly diagnosed tumours. BRCA1 and BRCA2 gene alterations are found in the major- ity of these cases. The aim of this study was to analyse the BRCA1 gene in the ovarian ...

  8. Aberrant transmembrane signal transduction in Dictyostelium cells expressing a mutated ras gene

    NARCIS (Netherlands)

    Haastert, Peter J.M. van; Kesbeke, Fanja; Reymond, Christophe D.; Firtel, Richard A.; Luderus, Eva; Driel, Roel van

    1987-01-01

    Dictyostelium discoideum cells contain a single ras gene (Dd-ras) that is highly homologous to mammalian ras genes. Cell transformation with a vector carrying a ras gene with a (glycine → threonine) missense mutation at position 12 causes an altered morphogenesis. Extracellular cAMP signals regulate

  9. Confirmation of the mitochondrial ND1 gene mutation G3635A as a primary LHON mutation.

    Science.gov (United States)

    Yang, Juhua; Zhu, Yihua; Tong, Yi; Chen, Lu; Liu, Lijuan; Zhang, Zhiqiang; Wang, Xiaoyan; Huang, Dinggou; Qiu, Wentong; Zhuang, Shuliu; Ma, Xu

    2009-08-14

    We report the clinical and genetic characterization of two Chinese LHON families who do not carry the primary LHON-mutations. Mitochondrial genome sequence analysis revealed the presence of a homoplasmic ND1 G3635A mutation in both families. In Family LHON-001, 31 other variants belonging to the East Asian haplogroup R11a were identified and in Family LHON-019, 37 other variants belonging to the East Asian haplogroup D4g were determined. The ND1 G3635A mutation changes the conversed serine110 residue to asparagine. This mutation has been previously described in a single Russian LHON family and has been suggested to contribute to increased LHON expressivity. In addition, a mutation in cytochrome c oxidase subunit II at C7868T (COII/L95F) may act in synergy with G3635A, increasing LHON expressivity in Family LHON-001, which had a higher level of LHON penetrance than Family LHON-019. In summary, the G3635A mutation is confirmed as a rare primary pathogenic mutation for LHON.

  10. [Screening and analysis of the mutations on beta-myosin heavy chain gene in 3 Chinese families with hypertrophic cardiomyopathy].

    Science.gov (United States)

    Feng, Xiu-li; Fan, Xin-ping; Yang, Zhong-wei; Yang, Fu-hui

    2011-02-01

    To detect gene mutations on beta-myosin heavy chain gene MYH7 in 3 Chinese families with hypertrophic cardiomyopathy (HCM), and to analyze the correlation between genotype and phenotype. A denaturing high-performance liquid chromatography (DHPLC) and sequencing mutation screening of the exons (exon3-23) coding for MYH7 gene were performed in 3 Chinese families with HCM. In this study, we identified several mutations in MYH7. A mutation of Thr441Met previously reported in a patient with Laing distal myopathy was first identified in one Chinese pedigree. This study illustrated the high frequency of mutation in MYH7 gene in Chinese HCM families. Different mutations and carriers of the MYH7 gene present phenotypic heterogeneity. Mutation screening and analysis in HCM family could therefore facilitate the early HCM diagnosis and would be helpful for the prediction, prevention and early treatment of HCM linked with MYH7 gene mutation.

  11. Germline deleterious mutations in genes other than BRCA2 are infrequent in male breast cancer.

    Science.gov (United States)

    Fostira, Florentia; Saloustros, Emmanouil; Apostolou, Paraskevi; Vagena, Andromahi; Kalfakakou, Despoina; Mauri, Davide; Tryfonopoulos, Dimitrios; Georgoulias, Vassileios; Yannoukakos, Drakoulis; Fountzilas, Georgios; Konstantopoulou, Irene

    2018-01-15

    Male breast cancer (MBC) is a rare cancer entity, with mutations in BRCA1 and BRCA2 genes accounting for ~ 10% of patients. Multiple-gene sequencing has already entered clinical practice for female breast cancer, whereas the performance of panel testing in MBC has not been studied extensively. Therefore, the aim of this study was to evaluate the clinical utility of panel testing for MBC, by the largest gene panel used so far, through investigation of patients deriving from a population with known founder effects. Genomic DNA from one hundred and two Greek MBC patients, unselected for age and family history, was used to prepare libraries which capture the entire coding regions of 94 cancer genes. Loss-of-function (LoF) mutations were found in 12.7% of the cases, distributed in six genes: BRCA2, ATM, BRCA1, CHEK2, PMS2, and FANCL. BRCA2 mutations were the most frequent, followed by ATM mutations, accounting for 6.9 and 2%, respectively, while mutations in other genes were detected in single cases. Age at diagnosis or family history was not predictive of mutation status. Beyond mutations in established breast cancer predisposing genes, LoF mutations in PMS2 and FANCL among MBC patients are reported here for the first time. Our findings, using the largest gene panel for MBC patients so far, indicate that BRCA testing should be the primary concern for MBC patients. Until sufficient evidence arises from larger studies, multiple-gene panels may be of limited benefit for MBC and their families, at least for MBC patients of specific descent.

  12. PIN1 gene overexpression and beta-catenin gene mutation/expression in hepatocellular carcinoma and their significance.

    Science.gov (United States)

    Wang, Hui; Zhang, Jinxiang; Feng, Wei; Zhang, Shu; Liang, Huifang; Wang, Yang; Zheng, Qichang; Li, Zhuoya

    2007-02-01

    The evolution of hepatocellular carcinoma (HCC) is a compound process which involves many kinds of genes and transductional pathways. The expression of the peptidyl-proplyl-isomerase PIN1 gene, the mutation in exon 3 of beta-catenin and its correspondent abnormal expression and their roles in the hepatocellular carcinogeneisis were investigated. Among 29 pair cases of HCC and non-carcinoma tissues, the expression of PIN1 gene was detected by immunochemical staining. Mutations in exon 3 of beta-catenin gene and differential expression of beta-catenin gene were investigated by the methods of PCR-SSCP, direct sequencing and immunohistochemical technique as well. The results indicated: (1) 44.8% (13/29) cases of HCC presented higher level of PIN1 gene expression than non-cancerous tissues (chi2=32.63, Pexpression in non-cancerous tissues; (2) 58.6% (17/29) HCC tissues showed beta-catenin protein accumulation in cytoplasm and nucleus. 46.2% (6/13) HCC tissues indicated beta-catenin protein accumulation with higher level of PIN1 expression, while 53.8% (7/13) HCC tissues indicated beta-catenin protein accumulation with lower level or trace of PIN1 expression (chi2=0.00, P>0.05); (3) 24.1% (7/29) of primary tumor lesions carried gene mutations in exon 3 of beta-catenin, and accompanied by beta-catenin protein accumulation. There was no mutation in non-cancerous tissues. All the mutation presented in tissues with low level of PIN1 expression. There was no mutation of beta-catenin gene in tissues with high PIN1 expression level (chi2=58.12, Pexpression could promote hepatocellular carcinogenesis via a way different from beta-catenin gene mutation.

  13. Leveraging Distant Relatedness to Quantify Human Mutation and Gene-Conversion Rates

    NARCIS (Netherlands)

    Palamara, Pier Francesco; Francioli, Laurent C; Wilton, Peter R; Genovese, Giulio; Gusev, Alexander; Finucane, Hilary K; Sankararaman, Sriram; Sunyaev, Shamil R; de Bakker, Paul I W; Wakeley, John; Pe'er, Itsik; Price, Alkes L

    2015-01-01

    The rate at which human genomes mutate is a central biological parameter that has many implications for our ability to understand demographic and evolutionary phenomena. We present a method for inferring mutation and gene-conversion rates by using the number of sequence differences observed in

  14. Mutations in the S gene region of hepatitis B virus genotype D in ...

    Indian Academy of Sciences (India)

    The gene region of the hepatitis B virus (HBV) is responsible for the expression of surface antigens and includes the 'a'-determinant region. Thus, mutation(s) in this region would afford HBV variants a distinct survival advantage, permitting the mutant virus to escape from the immune system. The aim of this study was to ...

  15. A mutation in the HSD11B2 gene in a family with apparent mineralocorticoid excess

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, R.C.; Harbison, M.D.; Wei, J.Q. [New York Hospital-Cornell Medical Center, NY (United States)] [and others

    1995-07-01

    A mutation in the HSD11B2 gene has been discovered in a consanguineous Iranian family with three sibs suffering from Apparent Mineralocorticoid Excess (AME). Sequence data demonstrate a C to T transition resulting in an R337C mutation. 9 refs., 2 figs., 3 tabs.

  16. Association Between Factor V Leiden Gene Mutation and Systemic Involvement in Behcet's Disease

    Directory of Open Access Journals (Sweden)

    Filiz Cebeci

    2009-03-01

    Full Text Available Background and Design: Behcet’s disease is a chronic, multisystem inflammatory disease of unknown origin characterized mainly by recurrent oral aphthous ulceration, genital ulceration, skin lesions and uveitis. Thrombophilic defects, such as factor V Leiden (FVL gene mutation may play a role in the pathogenesis of thrombosis in Behcet’s disease (BD. Recently, an association of FVL mutation with thrombosis and ocular involvement in BD has been reported. The object of this present study was to investigate an association between systemic involvement and the presence of the FVL gene mutation in BD patients.Material and Method: One-hundred six patients with BD and 70 healthy subjects were included in the study. FVL gene mutation was determined by polymerase chain reaction.Results: The FVL mutation was detected in 20.8% of the BD patients (22/106 compared with 8.5% of the control subjects (6/71. The difference was not statistically significant (p=0.027. Systemic involvement were observed in 45 (42.4% patients. No statistically significant association was found between patients with systemic involvement (26.7% and without systemic involvement (16.4% with respect to FVL gene mutation (p=0.197. All of the patients and controls tested positive were heterozygous for the mutation.Conclusion: Further studies in larger patients series with systemic involvement are needed to determine the prevalence of this mutation in BD with systemic involvement.

  17. Comprehensive and accurate mutation scanning of the CFTR gene by two-dimensional DNA electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hofstra, RMW; Scheffer, H; Uitterlinden, AG; Mullaart, E; Buys, CHCM; Vijg, J

    1996-01-01

    The large number of possible disease causing mutations in the 27 exons of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has severely limited direct diagnosis of cystic fibrosis (CF) patients and carriers by mutation detection. Here we show that in principle testing for

  18. Carriers of filaggrin gene (FLG) mutations avoid professional exposure to irritants in adulthood

    DEFF Research Database (Denmark)

    Bandier, Josefine; Ross-Hansen, Katrine; Carlsen, Berit C

    2013-01-01

    Loss-of-function mutations in the filaggrin gene (FLG) are associated with xerosis, atopic dermatitis, and early onset of hand eczema. Irritant exposure is a risk factor for occupational hand eczema, and FLG mutations increase the risk of occupational irritant contact dermatitis on the hands in h...

  19. GJB2 and mitochondrial A1555G gene mutations in nonsyndromic ...

    Indian Academy of Sciences (India)

    This study aimed to assess mutations in GJB2 gene (connexin 26), as well as A1555G mitochondrial mutation in both the patients with profound genetic nonsyndromic hearing loss and healthy controls. Ninety-five patients with profound hearing loss (>90 dB) and 67 healthy controls were included. All patients had genetic ...

  20. Mutations in rpoB and katG genes of multidrug resistant ...

    African Journals Online (AJOL)

    Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...

  1. Novel nonsense mutation of BRCA2 gene in a Moroccan man with ...

    African Journals Online (AJOL)

    10]. BRCA2 mutations account for a significant proportion in both man breast cancer cases with or without a family history of the disease. [11, 12]. We report here a novel nonsense mutation of BRCA2 gene in a Moroccan man with breast cancer ...

  2. H63D mutation in HFE gene is common in Indians and is associated ...

    Indian Academy of Sciences (India)

    inated in a Celtic population in central Europe and spread west and north by population movement. There are ... mutation with the C282Y mutation is a known risk factor for iron overload (Pointon et al. 2000) The H63D ... gene causally associated with the disease may aid in resolv- ing its single or multiple origins within a ...

  3. Mutations in genes encoding subunits of RNA polymerases I and III cause Treacher Collins syndrome.

    NARCIS (Netherlands)

    Dauwerse, J.G.; Dixon, J.; Seland, S.; Ruivenkamp, C.A.; Haeringen, A. van; Hoefsloot, L.H.; Peters, D.J.; Boers, A.C.; Daumer-Haas, C.; Maiwald, R.; Zweier, C.; Kerr, B.; Cobo, A.M.; Toral, J.F.; Hoogeboom, A.J.M.; Lohmann, D.R.; Hehr, U.; Dixon, M.J.; Breuning, M.H.; Wieczorek, D.

    2011-01-01

    We identified a deletion of a gene encoding a subunit of RNA polymerases I and III, POLR1D, in an individual with Treacher Collins syndrome (TCS). Subsequently, we detected 20 additional heterozygous mutations of POLR1D in 252 individuals with TCS. Furthermore, we discovered mutations in both

  4. Mutations in the Gene PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions

    NARCIS (Netherlands)

    Lee, Hsien-Yang; Huang, Yong; Bruneau, Nadine; Roll, Patrice; Roberson, Elisha D. O.; Hermann, Mark; Quinn, Emily; Maas, James; Edwards, Robert; Ashizawa, Tetsuo; Baykan, Betul; Bhatia, Kailash; Bressman, Susan; Bruno, Michiko K.; Brunt, Ewout R.; Caraballo, Roberto; Echenne, Bernard; Fejerman, Natalio; Frucht, Steve; Gurnett, Christina A.; Hirsch, Edouard; Houlden, Henry; Jankovic, Joseph; Lee, Wei-Ling; Lynch, David R.; Mohammed, Shehla; Mueller, Ulrich; Nespeca, Mark P.; Renner, David; Rochette, Jacques; Rudolf, Gabrielle; Saiki, Shinji; Soong, Bing-Wen; Swoboda, Kathryn J.; Tucker, Sam; Wood, Nicholas; Hanna, Michael; Bowcock, Anne M.; Szepetowski, Pierre; Fu, Ying-Hui; Ptacek, Louis J.

    Paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC) is an episodic movement disorder with autosomal-dominant inheritance and high penetrance, but the causative genetic mutation is unknown. We have now identified four truncating mutations involving the gene PRRT2 in the vast

  5. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  6. [An update on epigenetic regulator gene mutations and pathogenesis of myelodysplastic syndromes].

    Science.gov (United States)

    Wang, Jie-Yu; Xiao, Zhi-Jian

    2011-10-01

    The myelodysplastic syndrome (MDS) is a group of heterogeneous clonal disorders. So far, the etiology and pathogenesis of MDS is poorly understood. Recently, more and more epigenetic regulator gene such as TET2, ASXL1, EZH2, DNMT3A and UTX mutations were detected in patients with MDS: TET2 may convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (hmC). TET2 is the most frequently mutated gene in MDS known so far and it may act as tumor-suppressor gene. ASXL1 belongs to the enhancer of trithorax and Polycomb (ETP) gene group. MDS phenotypes may be caused not only by loss-of-function of ASXL1 but also by gain-of-function mutations, overexpression of this gene and so on. EZH2 is a kind of histone methyltransferase. EZH2 is frequently over-expressed in a wide variety of cancerous tissue types, which reveals it has oncogenic activity. While, defined mutations resulted in dysfunction of histone methyltransferase activity, suggesting that EZH2 acts as a tumor suppressor for myeloid malignancies. DNMT3A belongs to the DNA methyltransferases (DNMT) gene family. It may be correlated with abnormal methylation status in patients with MDS. UTX coding protein is a histone demethylase, and UTX can affect cell proliferation as well as cell fate decision. Inactivating UTX mutations are found in multiple cancer types recently. These gene mutations may play key roles in the pathogenesis of MDS, which are summarized in this review.

  7. Mutation analysis of the NRXN1 gene in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Onay H

    2016-12-01

    Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.

  8. [Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

    Science.gov (United States)

    Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

    2017-10-02

    Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

  9. Analysis of KRAS and NRAS Gene Mutations in Arab Asian Children With Acute Leukemia: High Frequency of RAS Mutations in Acute Lymphoblastic Leukemia.

    Science.gov (United States)

    Al-Kzayer, Lika'a Fasih Y; Sakashita, Kazuo; Al-Jadiry, Mazin Faisal; Al-Hadad, Salma Abbas; Ghali, Hasanein Habeeb; Uyen, Le T N; Liu, Tingting; Matsuda, Kazuyuki; Abdulkadhim, Jaafar M H; Al-Shujairi, Tariq Abadi; Matti, Zead Ismael I K; Sughayer, Maher A; Rihani, Rawad; Madanat, Faris F; Inoshita, Toshi; Kamata, Minoru; Koike, Kenichi

    2015-12-01

    KRAS and NRAS gene mutations are frequently observed in childhood leukemia. The objective of this study was to determine the frequency of RAS mutations and the association between RAS mutations and other genetic aberrations in Arab Asian children with acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML). Diagnostic samples of 485 patients (RAS mutations were detected in 86/318 (27%) of ALL cases and 35/167 (21%) of AML cases. The frequency of NRAS mutation was similar to that of KRAS mutation in ALL. Two RAS mutations were detected in nine patients. Among 264 Iraqi patients with ALL, RAS mutation was significantly associated with lower initial white blood cell count. Of 57 patients with chimeric transcripts, only two patients with either TEL-AML1 or E2A-PBX1 had KRAS mutation. The frequency of NRAS mutation was four times higher than that of KRAS mutation in AML. FAB-M4 and M5 subsets were associated with RAS mutation. Among 134 Iraqi patients with AML, 18 patients had RAS mutations and other genetic aberrations. In particular, 9 of 25 (36%) with MLL-rearrangement had RAS mutations. The prevalence of oncogenic RAS mutations was higher among Arab Asian children than in other countries. RAS mutations in AML were found to coexist with other genetic aberrations, particularly MLL rearrangement. © 2015 Wiley Periodicals, Inc.

  10. Sequence analysis of tyrosinase gene in ocular and oculocutaneous albinism patients: introducing three novel mutations.

    Science.gov (United States)

    Khordadpoor-Deilamani, Faravareh; Akbari, Mohammad Taghi; Karimipoor, Morteza; Javadi, Gholamreza

    2015-01-01

    Albinism is a heterogeneous genetic disorder of melanin synthesis that results in hypopigmented eyes (in patients with ocular albinism) or hair, skin, and eyes (in individuals with oculocutaneous albinism). It is associated with decreased visual acuity, nystagmus, strabismus, and photophobia. The tyrosinase gene is known to be involved in both oculocutaneous albinism and autosomal recessive ocular albinism. In this study, we aimed to screen the mutations in the TYR gene in the nonsyndromic OCA and autosomal recessive ocular albinism patients from Iran. The tyrosinase gene was examined in 23 unrelated patients with autosomal recessive ocular albinism or nonsyndromic OCA using DNA sequencing and bioinformatics analysis. TYR gene mutations were identified in 14 (app. 60%) albinism patients. We found 10 mutations, 3 of which were novel. No mutation was found in our ocular albinism patients, but one of them was heterozygous for the p.R402Q polymorphism.

  11. p16 gene mutations in Barrett's esophagus in gastric metaplasia - intestinal metaplasia - dysplasia - adenocarcinoma sequence

    National Research Council Canada - National Science Library

    Mokrowiecka, A; Wierzchniewska-Ławska, A; Smolarz, B; Romanowicz-Makowska, H; Małecka-Panas, E

    2012-01-01

    ...: In the present study two p16 gene mutations (A148T and I49S) analysis with PCR- RFLP method have been performed in oesophageal biopsy specimen in 33 patients with Barrett's gastric metaplasia (GM...

  12. Hepatocarcinogenesis in mice with beta-catenin and Ha-ras gene mutations

    National Research Council Canada - National Science Library

    Harada, Naomoto; Oshima, Hiroko; Katoh, Masahiro; Tamai, Yositaka; Oshima, Masanobu; Taketo, Makoto M

    2004-01-01

    .... Here we report that hepatocellular carcinoma develops at the 100% incidence in mice with simultaneous mutations in the beta-catenin and H-ras genes that are introduced by adenovirus-mediated Cre expression...

  13. Mutations in the S gene region of hepatitis B virus genotype D in ...

    Indian Academy of Sciences (India)

    DNA-negative control groups were also used. These serums were selected from patients who are not been vaccinated and were not under drug therapy for. HBV, thus permitting the identification of S gene mutations with real biological effects.

  14. Seven mutations in the human insulin gene linked to permanent neonatal/infancy-onset diabetes mellitus

    DEFF Research Database (Denmark)

    Colombo, Carlo; Porzio, Ottavia; Liu, Ming

    2008-01-01

    Permanent neonatal diabetes mellitus (PNDM) is a rare disorder usually presenting within 6 months of birth. Although several genes have been linked to this disorder, in almost half the cases documented in Italy, the genetic cause remains unknown. Because the Akita mouse bearing a mutation...... in the Ins2 gene exhibits PNDM associated with pancreatic beta cell apoptosis, we sequenced the human insulin gene in PNDM subjects with unidentified mutations. We discovered 7 heterozygous mutations in 10 unrelated probands. In 8 of these patients, insulin secretion was detectable at diabetes onset...... of endoplasmic reticulum stress, and with increased apoptosis. Similarly transfected INS-1E insulinoma cells had diminished viability compared with those expressing WT proinsulin. In conclusion, we find that mutations in the insulin gene that promote proinsulin misfolding may cause PNDM....

  15. Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

    Science.gov (United States)

    Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

    2006-01-01

    To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

  16. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers

    Directory of Open Access Journals (Sweden)

    Hai Hu

    2017-10-01

    Full Text Available Abstract Background Multiple primary cancers (MPC have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. Methods We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. Results We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Conclusion Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  17. Dystrophin gene mutation location and the risk of cognitive impairment in Duchenne muscular dystrophy.

    Directory of Open Access Journals (Sweden)

    Peter J Taylor

    Full Text Available BACKGROUND: A significant component of the variation in cognitive disability that is observed in Duchenne muscular dystrophy (DMD is known to be under genetic regulation. In this study we report correlations between standardised measures of intelligence and mutational class, mutation size, mutation location and the involvement of dystrophin isoforms. METHODS AND RESULTS: Sixty two male subjects were recruited as part of a study of the cognitive spectrum in boys with DMD conducted at the Sydney Children's Hospital (SCH. All 62 children received neuropsychological testing from a single clinical psychologist and had a defined dystrophin gene (DMD mutation; including DMD gene deletions, duplications and DNA point mutations. Full Scale Intelligence Quotients (FSIQ in unrelated subjects with the same mutation were found to be highly correlated (r = 0.83, p = 0.0008, in contrast to results in previous publications. In 58 cases (94% it was possible to definitively assign a mutation as affecting one or more dystrophin isoforms. A strong association between the risk of cognitive disability and the involvement of groups of DMD isoforms was found. In particular, improvements in the correlation of FSIQ with mutation location were identified when a new classification system for mutations affecting the Dp140 isoform was implemented. SIGNIFICANCE: These data represent one of the largest studies of FSIQ and mutational data in DMD patients and is among the first to report on a DMD cohort which has had both comprehensive mutational analysis and FSIQ testing through a single referral centre. The correlation between FSIQ results with the location of the dystrophin gene mutation suggests that the risk of cognitive deficit is a result of the cumulative loss of central nervous system (CNS expressed dystrophin isoforms, and that correct classification of isoform involvement results in improved estimates of risk.

  18. Potential Pitfalls of SDH Immunohistochemical Detection in Paragangliomas and Phaeochromocytomas Harbouring Germline SDHx Gene Mutation.

    Science.gov (United States)

    Santi, Raffaella; Rapizzi, Elena; Canu, Letizia; Ercolino, Tonino; Baroni, Gianna; Fucci, Rossella; Costa, Giuseppe; Mannelli, Massimo; Nesi, Gabriella

    2017-02-01

    Germline mutations in any of the succinate dehydrogenase (SDH) genes result in destabilization of the SDH protein complex and loss of SDHB expression at immunohistochemistry. SDHA is lost together with SDHB in SDHA-mutated tumours, but its expression is retained in tumours with other SDH mutations. We investigated whether SDHA/SDHB immunohistochemistry is able to identify SDH-related tumours in a retrospective case series of phaeochromocytomas (PCCs) and paragangliomas (PGLs). SDHA and SDHB immunostaining was performed in 13 SDH gene-mutated tumours (SDHB: n=3; SDHC: n=1; SDHD: n=9) and 16 wild-type tumours. Protein expression by western blot analysis and enzymatic activity were also assessed. Tumours harbouring SDH gene mutations demonstrated a significant reduction in enzymatic activity and protein expression when compared to wild-type tumours. SDHB immunostaining detected 76.9% of SDH mutated PCCs/PGLs (3/3 SDHB-mutated samples; 1/1 SDHC-mutated sample; 6/9 SDHD-mutated samples). In three SDHD-related tumours with the same mutation (p.Pro81Leu), positive (n=2) or weakly diffuse (n=1) SDHB staining was observed. All wild-type PCCs/PGLs exhibited SDHB immunoreactivity, while immunostaining for SDHA was positive in 93.8% cases and weakly diffuse in one (6.2%). SDHA protein expression was preserved in all tumours with mutations. SDHA and SDHB immunohistochemistry should be interpreted with caution, due to possible false-positive or false-negative results, and ideally in the setting of quality assurance provided by molecular testing. In SDHD mutation, weak non-specific cytoplasmic staining occurs commonly, and this pattern of staining can be difficult to interpret with certainty. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  19. Mosaic mutations of the LIS1 gene cause subcortical band heterotopia.

    Science.gov (United States)

    Sicca, F; Kelemen, A; Genton, P; Das, S; Mei, D; Moro, F; Dobyns, W B; Guerrini, R

    2003-10-28

    Subcortical band heterotopia (SBH) is a neuronal migration disorder. DCX mutations are responsible for almost all familial cases, 80% of sporadic female cases, and 25% of sporadic male cases of SBH, and are associated with more severe gyral and migration abnormality over the anterior brain regions. Somatic mosaicism has previously been hypothesized in a patient with posteriorly predominant SBH and a mutation of the LIS1 gene, which is usually mutated in patients with severe lissencephaly. The authors identified mosaic mutations of LIS1 in two patients (Patients 1 and 2) with predominantly posterior SBH. After ruling out DCX mutations, the authors performed sequencing of the LIS1 gene in lymphocyte DNA. Because sequence peaks in both patients were suggestive of mosaic mutations, they followed up with denaturing high-pressure liquid chromatography analysis on blood and hair root DNA and compared the areas of heteroduplex and homoduplex peaks. A third patient showing the same mutation as Patient 2 but with no evidence of mosaicism was used for comparing the phenotype of mosaic vs full mutation. The two patients with posterior SBH harbored a missense (Arg241Pro) and a nonsense (R8X) mosaic mutation of LIS1. The rate of mosaicism in Patient 1 was 18% in the blood and 21% in the hair roots, whereas in Patient 2 it was 24% and 31% in the same tissues. The patient with a full R8X mutation of LIS1 had severe lissencephaly. Subcortical band heterotopia can occur with mosaic mutations of the LIS1 gene. Mutation analysis of LIS1, using highly sensitive techniques such as denaturing high-pressure liquid chromatography, should be considered for patients with posteriorly predominant subcortical band heterotopia and pachygyria.

  20. Mutation analysis of HSFY gene by DNA sequencing in Turkish men with idiopathic infertility

    OpenAIRE

    Semerci, C Nur; Alataş, Erkan; Sılan, Fatma; N. Lale, Şatıroğlu Tufan; Dodurga, Yavuz; Şatıroğlu, Hakan

    2016-01-01

    INTRODUCTION: In this study we planned to HSFY gene mutations in Turkish infertile men with azoospermia, oligospermia and/or poor motility/morphology. METHODS: From three distinct medical centers, 41 Turkish infertile men were contributed to this study. The patients had no endocrine or obstructive causes of spermatogenic failure and no Y microdeletion, and had normal karyotype were included the study. Mutation analysis of the HSFY gene was performed by DNA sequencing. RESULTS: No varian...

  1. Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients.

    Science.gov (United States)

    Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan

    2014-05-15

    Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.

  2. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  3. A novel null homozygous mutation confirms CACNA2D2 as a gene mutated in epileptic encephalopathy.

    Directory of Open Access Journals (Sweden)

    Tommaso Pippucci

    Full Text Available Contribution to epileptic encephalopathy (EE of mutations in CACNA2D2, encoding α2δ-2 subunit of Voltage Dependent Calcium Channels, is unclear. To date only one CACNA2D2 mutation altering channel functionality has been identified in a single family. In the same family, a rare CELSR3 polymorphism also segregated with disease. Involvement of CACNA2D2 in EE is therefore not confirmed, while that of CELSR3 is questionable. In a patient with epilepsy, dyskinesia, cerebellar atrophy, psychomotor delay and dysmorphic features, offspring to consanguineous parents, we performed whole exome sequencing (WES for homozygosity mapping and mutation detection. WES identified extended autozygosity on chromosome 3, containing two novel homozygous candidate mutations: c.1295delA (p.Asn432fs in CACNA2D2 and c.G6407A (p.Gly2136Asp in CELSR3. Gene prioritization pointed to CACNA2D2 as the most prominent candidate gene. The WES finding in CACNA2D2 resulted to be statistically significant (p = 0.032, unlike that in CELSR3. CACNA2D2 homozygous c.1295delA essentially abolished α2δ-2 expression. In summary, we identified a novel null CACNA2D2 mutation associated to a clinical phenotype strikingly similar to the Cacna2d2 null mouse model. Molecular and statistical analyses together argued in favor of a causal contribution of CACNA2D2 mutations to EE, while suggested that finding in CELSR3, although potentially damaging, is likely incidental.

  4. ABCD1 Gene Mutations in Chinese Patients with ALD

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2005-08-01

    Full Text Available Thirty-two different ABCD1 mutations were identified by direct sequencing of polymerase chain reaction products in 34 unrelated Chinese X-linked adrenoleukodystrophy (ALD patients examined at Peking University First Hospital, Beijing, PRC.

  5. γ-Secretase Gene Mutations in Familial Acne Inversa

    National Research Council Canada - National Science Library

    Baoxi Wang; Wei Yang; Wen Wen; Jing Sun; Bin Su; Bo Liu; Donglai Ma; Dan Lv; Yaran Wen; Tao Qu; Min Chen; Miao Sun; Yan Shen; Xue Zhang

    2010-01-01

    .... We studied six Chinese families with features of AI as well as additional skin lesions on back, face, nape, and waist and found independent loss-of-function mutations in PSENEN , PSEN1 , or NCSTN...

  6. Molecular screening of the LPCAT1 gene in patients with retinitis pigmentosa without defined mutations in known retinitis pigmentosa genes.

    Science.gov (United States)

    Wu, Juan; Wang, Hong-Ting; Huang, Xiu-Feng; Lei, Xin-Lan; Lu, Qin-Kang; Jin, Zi-Bing

    2015-10-01

    Retinitis pigmentosa (RP) is an inherited retinopathy, which affects the photoreceptors in the retina. Lysophosphatidylcholine acyltransferase (LPCAT) is a critical phospholipid biosynthesis enzyme, which promotes the conversion of lysophosphatidylcholine into phosphatidylcholine in the remodeling pathway of PC biosynthesis. A previous study reported a homozygous insertion in the LPCAT1 gene in mice exhibiting retinal degeneration (rd11). However, whether genetic mutations in LPCAT1 predispose individuals to RP remains to be elucidated. Therefore, the aim of the present study was to investigate whether LPCAT1 mutations exist in patients with RP. A total of 50 unrelated patients diagnosed with either a sporadic or recessive inheritance pattern of RP were recruited in the present study. All of the patients were comprehensively screened for genes associated with the predisposition of RP, and no pathogenic mutations were identified. Reverse transcription-polymerase chain reaction and Sanger sequencing were performed to investigate the coding regions and exon‑intron boundaries of the LPCAT1 gene in the recruited patients. In total, three genetic variations in the coding regions, which lead to amino acid changes, were identified. Although two of these mutations were predicted to be pathogenic, co‑segregation analysis in the pedigrees excluded these as disease‑causing mutations. In addition, the LPCAT1 gene was screen in a panel of RP patients who exhibited no identifiable mutations in any of the known RP‑associated genes. No disease‑causing mutations in the LPCAT1 gene were identified, indicating that LPCAT1 either does not confer a genetic predisposition to RP, or that the incidence of mutations in LPCAT1 is particularly rare in patients with RP.

  7. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  8. Selective testing for calreticulin gene mutations in patients with splanchnic vein thrombosis: A prospective cohort study.

    Science.gov (United States)

    Poisson, Johanne; Plessier, Aurélie; Kiladjian, Jean-Jacques; Turon, Fanny; Cassinat, Bruno; Andreoli, Annalisa; De Raucourt, Emmanuelle; Goria, Odile; Zekrini, Kamal; Bureau, Christophe; Lorre, Florence; Cervantes, Francisco; Colomer, Dolors; Durand, François; Garcia-Pagan, Juan-Carlos; Casadevall, Nicole; Valla, Dominique-Charles; Rautou, Pierre-Emmanuel; Marzac, Christophe

    2017-09-01

    Myeloproliferative neoplasms (MPN) are the leading cause of splanchnic vein thrombosis (SVT). Janus kinase 2 gene (JAK2) V617F mutations are found in 80 to 90% of patients with SVT and MPN. Mutations of the calreticulin (CALR) gene have also been reported. However, as their prevalence ranges from 0 to 2%, the utility of routine testing is questionable. This study aimed to identify a group of patients with SVT at high risk of harboring CALR mutations and thus requiring this genetic testing. CALR, JAK2 V617F and thrombopoietin receptor gene (MPL) mutations were analysed in a test cohort that included 312 patients with SVT. Criteria to identify patients at high risk of CALR mutations in this test cohort was used and evaluated in a validation cohort that included 209 patients with SVT. In the test cohort, 59 patients had JAK2 V617F , five had CALR and none had MPL mutations. Patients with CALR mutations had higher spleen height and platelet count than patients without these mutations. All patients with CALR mutations had a spleen height ⩾16cm and platelet count >200×10 9 /L. These criteria had a positive predictive value of 56% (5/9) and a negative predictive value of 100% (0/233) for the identification of CALR mutations. In the validation cohort, these criteria had a positive predictive value of 33% (2/6) and a negative predictive value of 99% (1/96). CALR mutations should be tested in patients with SVT, a spleen height ⩾16cm, platelet count >200×10 9 /L, and no JAK2 V617F . This strategy avoids 96% of unnecessary CALR mutations testing. Lay summary: Mutations of the CALR gene are detected in 0 to 2% of patients with SVT, thus the utility of systematic CALR mutation testing to diagnose MPN is questionable. This study demonstrates that CALR mutations testing can be restricted to patients with SVT, a spleen height ⩾16cm, a platelet count >200×10 9 /L, and no JAK2 V617F . This strategy avoids 96% of unnecessary CALR mutations testing. Copyright © 2017 European

  9. Point Mutations Effects on Charge Transport Properties of the Tumor-Suppressor Gene p53

    Science.gov (United States)

    Roemer, Rudolf A.; Shih, Chi-Tin; Roche, Stephan

    2008-03-01

    We report on a theoretical study of point mutations effects on charge transfer properties in the DNA sequence of the tumor-suppressor p53 gene. On the basis of effective tight-binding models which simulate hole propagation along the DNA, a statistical analysis of mutation-induced charge transfer modifications is performed. In contrast to non-cancerous mutations, mutation hotspots tend to result in significantly weaker changes of transmission properties. This suggests that charge transport could play a significant role for DNA-repairing deficiency yielding carcinogenesis.

  10. [Analyses of coding sequence point mutation and polymorphism of TGFBI gene in Chinese patients with keratoconus].

    Science.gov (United States)

    GUAN, Tao; MA, Zhang-wei; DING, Shi-ping

    2011-04-01

    To investigate the point mutations and polymorphisms of transforming growth factor beta-induced gene (TGFBI) in Chinese patients with keratoconus and discuss the relationship between the feature of gene mutations and single nucleotide polymorphisms of TGFBI gene and keratoconus. Polymerase chain reaction single strand conformation polymorphism and DNA direct sequencing were performed in 30 keratoconus cases and 30 healthy controls. All 17 exons of the TGFBI gene were analyzed for point mutations and single nucleotide polymorphisms. Totally two heterozygous nucleotide changes were identified in exon 12 of the TGFBI gene. The codon 535 is changed from GGA to TGA in 1 patient, leading to a substitution of glycine to a stop codon at the protein level (G535X). The codon 540 is changed from TTT to TTC in 2 patients and 1 control individual, resulting in a nonsense mutation (F54F), and is a single nucleotide polymorphism of the gene. Mutation and polymorphisms of the TGFBI gene were detected in Chinese patients with keratoconus in this study. The results suggest that TGFBI gene might play an important role in the pathogenesis of keratoconus.

  11. Mutational analysis of EGFR and related signaling pathway genes in lung adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4.

    Directory of Open Access Journals (Sweden)

    Jenifer L Marks

    2007-05-01

    Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.

  12. Multigene panel analysis identified germline mutations of DNA repair genes in breast and ovarian cancer.

    Science.gov (United States)

    Hirotsu, Yosuke; Nakagomi, Hiroshi; Sakamoto, Ikuko; Amemiya, Kenji; Oyama, Toshio; Mochizuki, Hitoshi; Omata, Masao

    2015-09-01

    Approximately 5-10% of all breast and/or ovarian cancer cases are considered as inherited. BRCA1 and BRCA2 tumor suppressor genes account for a high penetrance of hereditary cases, but familial cases without mutations in these genes can also occur. Despite their low penetrance, other hereditary cancer-related genes are known to be associated with breast and ovarian cancer risk. However, the extent to which these genes prevail in breast and ovarian cancer remains to be elucidated. To estimate the frequency of mutations in these predisposition genes, we analyzed the germline mutations of 25 hereditary cancer-related genes in 155 patients using targeted next-generation sequencing. These subjects included 11 BRCA1/2 mutation-positive cases and 144 negative cases. Of these, three patients (1.9%) had pathogenic mutations in ATM, MRE11A, or MSH6, all of which have a central role in DNA repair and the mismatch repair pathway. The MSH6 splice-site mutation (IVS6+1G>T) was predicted to be pathogenic, as demonstrated by in vitro and immunohistochemical analyses. These results suggested deficiencies in cellular DNA repair functions result in the development of breast and ovarian cancer.

  13. [A novel mutation of the PAX6 gene in a Chinese family with aniridia].

    Science.gov (United States)

    Kang, Yang; Yuan, Hui-ping; Li, Xue; Li, Qing-jun; Wu, Qiong; Hu, Qi

    2010-08-01

    The PAX6 gene encodes a transcriptional regulator involved in oculogenesis and other developmental processes such as aniridia, a congenital condition characterized by the underdevelopment of the iris of eyes. The function of the PAX6 gene in these two conditions is still poorly defined. The purpose of this study is to identify the mutation of the PAX6 gene in a Chinese family with aniridia. Two aniridia patients collected from the family underwent full ophthalmologic examination. Genomic DNA was prepared from venous leukocytes of the two patients and five healthy individuals in the family, and 100 unrelated healthycontrols. Exons 4-13 and their immediate flanking sequences of the PAX6 gene was analyzed by PCR amplification, direct sequencing, and single-strand conformation polymorphism(SSCP). The sequencing result revealed a novel PAX6 mutation in the two patients. It was a heterozygous mutation (IVS10+1G>A) at the boundary of exon 10 and intron 10. The mutation was also detected by SSCP analysis. It was not detected in the healthy relatives and unrelated controls. Aniridia is an autosomal dominant inheritable disease. A novel PAX6 gene mutation has been identified in the Northeastern Chinese family with aniridia. The genetic analysis suggested that this novel mutation in the PAX6 gene is capable of causing the classic aniridia phenotype.

  14. Novel mutations in SKIV2L and TTC37 genes in Malaysian children with trichohepatoenteric syndrome.

    Science.gov (United States)

    Lee, Way Seah; Teo, Kai Ming; Ng, Ruey Terng; Chong, Sze Yee; Kee, Boon Pin; Chua, Kek Heng

    2016-07-15

    Trichohepatoenteric syndrome (THES) is a rare autosomal recessive disorder that is classically associated with intractable diarrhea with an onset within the first few months of life. Herein, we investigated and reported novel mutations in two causal genes in 3 Malaysian cases. Genomic DNA was extracted from peripheral blood obtained from patients in two Malaysian Chinese families. The exons of SKIV2L and TTC37 genes were amplified and sequenced by bi-directional sequencing to identify the point mutations within the coding sequence. Three Chinese boys from two families with characteristic features and clinical course were diagnosed with THES. In family-1, two point mutations were identified in the SKIV2L gene (c.1891G>A and c.3187C>T). In family-2, a single-nucleotide duplication (c.3426dupA) was found in the TTC37 gene. These mutations cause the production of abnormal non-functional gene product leading to the clinical manifestations in the patients. We reported three point mutations, which have not been previously described in other patients with THES in SKIV2L and TTC37 genes, including one nonsense, one frameshift, and one missense mutations. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer

    Directory of Open Access Journals (Sweden)

    Maija Wolf

    2005-01-01

    Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.

  16. Meta-analysis of clinical characteristics of 299 carriers of LMNA gene mutations : do lamin A/C mutations portend a high risk of sudden death?

    NARCIS (Netherlands)

    de Voogt, WG; van der Kooi, AJ; van Tintelen, JP; Bonne, G; Ben Yaou, R; Duboc, D; Rossenbacker, T; Heidbuchel, H; de Visser, M; Crijns, HJGM; Pinto, YM; van Berlo, Jop H.

    This study evaluated common clinical characteristics of patients with lamin A/C gene mutations that cause either isolated dilated cardiornyopathy or dilated cardiomyopathy in association with skeletal muscular dystrophy. We pooled clinical data of all published carriers of lamin A/C gene mutations

  17. Analysis of mutations in the cystic fibrosis transmembrane regulator (CFTR gene in patients with obstructive azoospermia

    Directory of Open Access Journals (Sweden)

    Andrea L.F. Bernardino

    2003-01-01

    Full Text Available Congenital bilateral absence of the vas deferens (CBAVD accounts for 1%-2% of sterility in men. A high incidence of mutations, as well as the involvement of the 5T variant of the T tract length in intron 8 of the cystic fibrosis conductance regulator (CFTR gene, have been previously described in males with CBAVD. Herein we report the screening for mutations and for the 5T variant of the CFTR gene in 17 patients with CBAVD and three others with non-CABVD obstructive azoospermia. In the CBAVD group, three patients (15% were compound heterozygotes for mutations, and five patients (25% had a mutation in one allele and the 5T variant in the other; the 5T variant was also present in two other patients, one of them being homozygous. The most frequent mutation was DF508, present on five chromosomes (12.5%. A novel missense mutation (A399D was detected in a Japanese CBVAD patient. Our results yield further evidence for a strong association between male obstructive azoospermia caused by CBAVD and mutation/5T variant in the CFTR gene. The search for CFTR mutations in such patients is thus recommended for genetic counseling of couples who undergo assisted fertilization due to CBAVD.

  18. [Phenotype-genotype correlation in mutations of the gonadotrophin receptor gene in women].

    Science.gov (United States)

    Touraine, P

    2010-05-01

    Different mutations have been described in LH and FSH genes as well as in their receptors. These mutations are either activating (gain of function), or inhibiting (loss of function). Activating mutations are expressed as a dominant trait, thus in the heterozygous state, whereas inhibiting mutations are only expressed when both alleles bear the mutation. Inactivating mutations of FSH receptor gene, in women, are associated with primary ovarian insufficiency. Inactivating mutations of LH receptor gene have also been described, most often in XX patients whose families also include cases of male pseudohermaphrodism. Clinically, these women suffer from primary amenorrhea but with normal development of breasts and the hair system. Infertility is constant. LH blood levels are increased, estradiol blood levels are those encountered at the beginning of the follicular phase (50-70 pg/ml). The discovery of these mutations allows a better understanding of some genotypes and is helpful in advancing our knowledge of these receptors. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  19. A cancer-predisposing "hot spot" mutation of the fumarase gene creates a dominant negative protein.

    Science.gov (United States)

    Lorenzato, Annalisa; Olivero, Martina; Perro, Mario; Brière, Jean Jacques; Rustin, Pierre; Di Renzo, Maria Flavia

    2008-02-15

    The Fumarase (Fumarate Hydratase, FH) is a tumor suppressor gene whose germline heterozygous mutations predispose to hereditary leiomyomatosis and renal cell cancer (HLRCC). The FH gene encodes an enzyme of the Krebs cycle, functioning as a homotetramer and catalyzing the hydration of fumarate to malate. Among the numerous FH mutations reported so far, the R190H missense mutation is the most frequent in HLRCC patients. Here we show the functional analyses of the R190H, in comparison to the better characterized E319Q mutation. We first expressed wild-type and mutated proteins in FH deficient human skin fibroblasts, using lentiviral vectors. The wild-type transgene was able to restore the FH enzymatic activity in cells, while the R190H- and E319Q-FH were not. More interestingly, when the same transgenes were expressed in normal, FH-proficient cells, only the R190H-FH reduced the endogenous FH enzymatic activity. By enforcing the expression of equal amount of wild-type and R190H-FH in the same cell, we showed that the mutated FH protein directly inhibited enzymatic activity by nearly abrogating the FH homotetramer formation. These data demonstrate the dominant negative effect of the R190H missense mutation in the FH gene and suggest that the FH tumor-suppressing activity might be impaired in cells carrying a heterozygous mutation. (c) 2007 Wiley-Liss, Inc.

  20. DNMT3A GENE POINT MUTATIONS DETECTION IN ACUTE MYELOID LEUKEMIA PATIENTS USING SEQUENCING TECHNIQUE

    Directory of Open Access Journals (Sweden)

    A. V. Vinogradov

    2015-01-01

    Full Text Available Aim: to estimate the frequency of DNMT3A gene exons 18–26 point mutations in acute myeloid leukemia (AML patients (pts using target automatic sequencing technique.Material and Methods. Bone marrow and peripheral blood samples were obtained from 34 AML pts aged 21 to 64, who were treated in Sverdlovsk Regional Hematological Centre (Ekaterinburg during the period 2012–2014. Distribution of the pts according to FAB-classification was as follows: AML M0 – 3, M1 – 1, M2 – 12, M3 – 3, M4 – 10, M5 – 2, M6 – 1, M7 – 1, blastic plasmacytoid dendritic cell neoplasm – 1. Total RNA was extracted from leukemic cells and subjected to reverse transcription. DNMT3A gene exons 18–26 were amplified by PCR. Detection of mutations in DNMT3A gene was performed by direct sequencing. Sequencing was realized using an automatic genetic analyzer ABI Prism 310.Results. The average frequency of functionally significant point mutations in DNMT3A gene exons 18– 26 among the treated AML pts was 5.9%. They were detected in morphological subgroups M2 and M4(according to WHO classification. The average frequency of DNMT3A gene exons 18–26 point mutations among the AML M2 and M4 pts without chromosomal aberrations and TP53 gene point mutations was 14.3%. In both cases there were samples in which DNMT3A gene mutations were accompanied by molecular lesions of NPM1, KRAS and WT1 genes. AML pts with DNMT3A gene exons 18–26 point mutations characterized by poor response to standard chemotherapeutic regimens and unfavorable prognosis.

  1. [Mutations in sarcomeric genes MYH7, MYBPC3, TNNT2, TNNI3, and TPM1 in patients with hypertrophic cardiomyopathy].

    Science.gov (United States)

    García-Castro, Mónica; Coto, Eliecer; Reguero, Julián R; Berrazueta, José R; Alvarez, Victoria; Alonso, Belén; Sainz, Rocío; Martín, María; Morís, Cesar

    2009-01-01

    Mutation of a sarcomeric gene is the most frequent cause of hypertrophic cardiomyopathy. For each such gene, however, previous studies have reported a range of different mutation frequencies, and clinical manifestations have been highly heterogeneous, both of which limit the use of genetic information in clinical practice. Our aim was to determine the frequency of mutations in the sarcomeric genes MYH7, MYBPC3, TNNT2, TNNI3, and TPM1 in a cohort of Spanish patients with hypertrophic cardiomyopathy. We used sequencing to analyze the coding regions of these five genes in 120 patients (29% with a family history) and investigated how the patient phenotype varied with the gene mutated. In total, 32 patients were found to have mutations: 10 in MYH7 (8%), 20 in MYBPC3 (16%), 2 in TNNT2, 1 in TPM1 and none in TNNI3. Overall, 61% of mutations had not been described before. Two patients had two mutations (i.e., double mutants). There was no difference in the mean age at diagnosis or the extent of the hypertrophy between those with MYH7 mutations and those with MYBPC3 mutations. Some 26% of patients had a mutation in one of the five sarcomeric genes investigated. More than half of the mutations had not been described before. The MYBPC3 gene was the most frequently mutated, followed by MYH7. No phenotypic differences were observed between carriers of the various mutations, which makes it difficult to use genetic information to stratify risk in these patients.

  2. A high frequency of distinct ATM gene mutations in ataxia-telangiectasia

    Energy Technology Data Exchange (ETDEWEB)

    Wright, J.; Teraoka, S.; Concannon, P. [Univ. of Washington School of Medicine, Seattle, WA (United States)] [and others

    1996-10-01

    The clinical features of the autosomal recessive disorder ataxia-telangiectasia (AT) include a progressive cerebellar ataxia, hypersensitivity to ionizing radiation, and an increased susceptibility to malignancies. Epidemiological studies have suggested that AT heterozygotes may also be at increased risk for malignancy, possibly as a consequence of radiation exposure. A gene mutated in AT patients (ATM) has recently been isolated, making mutation screening in both patients and the general population possible. Because of the relatively large size of the ATM gene, the design of screening programs will depend on the types and distribution of mutations in the general population. In this report, we describe 30 mutations identified in a panel of unrelated AT patients and controls. Twenty-five of the 30 were distinct, and most patients were compound heterozygotes. The most frequently detected mutation was found in three different families and had previously been reported in five others. This corresponds to a frequency of 8% of all reported ATM mutations. Twenty-two of the alterations observed would be predicted to lead to protein truncation at sites scattered throughout the molecule. Two fibroblast cell lines, which displayed normal responses to ionizing radiation, also proved to be heterozygous for truncation mutations of ATM. These observations suggest that the carrier frequency of ATM mutations may be sufficiently high to make population screening practical. However, such screening may need to be done prospectively, that is, by searching for new mutations rather than by screening for just those already identified in AT families. 33 refs., 1 fig., 1 tab.

  3. Germline and somatic mutations in the MTOR gene in focal cortical dysplasia and epilepsy

    DEFF Research Database (Denmark)

    Møller, Rikke S; Weckhuysen, Sarah; Chipaux, Mathilde

    2016-01-01

    OBJECTIVE: To assess the prevalence of somatic MTOR mutations in focal cortical dysplasia (FCD) and of germline MTOR mutations in a broad range of epilepsies. METHODS: We collected 20 blood-brain paired samples from patients with FCD and searched for somatic variants using deep-targeted gene panel...... sequencing. Germline mutations in MTOR were assessed in a French research cohort of 93 probands with focal epilepsies and in a diagnostic Danish cohort of 245 patients with a broad range of epilepsies. Data sharing among collaborators allowed us to ascertain additional germline variants in MTOR. RESULTS: We...... frontal lobe epilepsy. CONCLUSIONS: Our data illustrate the increasingly important role of somatic mutations of the MTOR gene in FCD and germline mutations in the pathogenesis of focal epilepsy syndromes with and without brain malformation or macrocephaly....

  4. Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Upadhyaya, M.; Osborn, M.; Maynard, J.; Harper, P. [Institute of Medical Genetics, Cardiff, Wales (United Kingdom)

    1996-07-26

    Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detected in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.

  5. Mutations in the medium chain acyl-CoA dehydrogenase (MCAD) gene

    DEFF Research Database (Denmark)

    Tanaka, K; Yokota, I; Coates, P M

    1992-01-01

    of 172 unrelated patients each representing an independent pedigree, a total of 8 different mutations have been identified. Among them, a single prevalent mutation, 985A-->G, was found in 90% of 344 variant alleles. 985A-->G causes glutamate substitution for lysine-304 in the mature MCAD subunit, which...... causes impairment of tetramer assembly and instability of the protein. Three of 7 rarer mutations have been identified in a few unrelated patients, while the remaining 4 have each been found in only a single pedigree. In addition to tabulating the mutations, the acyl-CoA dehydrogenase gene family......, the structure of the MCAD gene and the evolution of 985A-->G mutation are briefly discussed....

  6. Novel and heteroplasmic mutations in mitochondrial tRNA genes in Brugada syndrome.

    Science.gov (United States)

    Fallah Tafti, Mahsasadat; Khatami, Mehri; Rezaei, Shiva; Heidari, Mohammad Mehdi; Hadadzadeh, Mehdi

    2017-10-05

    Brugada syndrome (BrS) is a rare cardiac arrhythmia characterized by sudden death associated with electrocardiogram patterns characterized by incomplete right bundle-branch block and ST-segment elevations in the anterior precordial leads. This syndrome predominantly is seen in younger males with structurally normal hearts. Mitochondrial variants particularly mt-tRNA mutations, are hot spots that lead to cardiological disorders. Previous studies have shown that mutations in mitochondrial tRNA genes play an important causal or modifying role in BrS. The present study aims to evaluate the involvement of mitochondrial tRNA genes in arrhythmogenic BrS. In this study, 40 Iranian patients were investigated for the presence of the mutations in 6 mitochondrial tRNA genes (tRNA Ile, Met, Gln, Asn, Ala and Trp) by PCR-SSCP analysis. There were 4 mutations in tRNA genes, that for first time, were found in Brugada patients and these mutations were not in controls. Three of them were heteroplasmic and located in tRNAGln (T4377A) and tRNAMet (G4407A and C4456T) which were assessed as pathogenic mutations. A homoplasmic variant (5580T > C) in tRNATrp gene was located within the junction region between tRNATrp and tRNAAla genes. This mutation may disturb the processing of mt-tRNATrp. The results of this study suggest that mutations in mitochondrial tRNA genes might lead to deficiencies in translational process of critical proteins of the respiratory chain and potentially lead to BrS in Iranian subjects.

  7. Mutational analysis of the extracellular Ca{sup 2+}-sensing receptor gene in human parathyroid tumors

    Energy Technology Data Exchange (ETDEWEB)

    Hosokawa, Yoshitaka; Arnold, A. [Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States); Pollak, M.R.; Brown, E.M. [Brigham and Women`s Hospital, Boston, MA (United States)

    1995-10-01

    Despite recent progress, such as the identification of PRAD1/cyclin D1 as a parathyroid oncogene, it is likely that many genes involved in the molecular pathogenesis of parathyroid tumors remain unknown. Individuals heterozygous for inherited mutations in the extracellular Ca{sup 2+}-sensing receptor gene that reduce its biological activity exhibit a disorder termed familial hypocalciuric hypercalcemia or familial benign hypercalcemia, which is characterized by reduced responsiveness of parathyroid and kidney to calcium and by PTH-dependent hypercalcemia. Those who are homozygous for such mutations present with neonatal severe hyperparathyroidism and have marked parathroid hypercellularity. Thus, the Ca{sup 2+}-sensing receptor gene is a candidate parathyroid tumor suppressor gene, with inactivating mutations plausibly explaining set-point abnormalities in the regulation of both parathyroid cellular proliferation and PTH secretion by extracellular Ca{sup 2+} similar to those seen in hyperparathyroidism. Using a ribonuclease A protection assay that has detected multiple mutations in the Ca{sup 2+}-sensing receptor gene in familial hypocalciuric hypercalcemia and covers more than 90% of its coding region, we sought somatic mutations in this gene in a total of 44 human parathyroid tumors (23 adenomas, 4 carcinomas, 5 primary hyperplasias, and 12 secondary hyperplasias). No such mutations were detected in these 44 tumors. Thus, our studies suggest that somatic mutation of the Ca{sup 2+}-sensing receptor gene does not commonly contribute to the pathogenesis of sporadic parathyroid tumors. As such, PTH set-point dysfunction in parathroid tumors may well be secondary to other clonal proliferative defects and/or mutations in other components of the extracellular Ca{sup 2+}-sensing pathway. 29 refs., 2 figs.

  8. Update on Novel CCM Gene Mutations in Patients with Cerebral Cavernous Malformations.

    Science.gov (United States)

    Scimone, Concetta; Bramanti, Placido; Alafaci, Concetta; Granata, Francesca; Piva, Francesco; Rinaldi, Carmela; Donato, Luigi; Greco, Federica; Sidoti, Antonina; D'Angelo, Rosalia

    2017-02-01

    Cerebral cavernous malformations (CCMs) are lesions affecting brain microvessels. The pathogenesis is not clearly understood. Conventional classification criterion is based on genetics, and thus, familial and sporadic forms can be distinguished; however, classification of sporadic cases with multiple lesions still remains uncertain. To date, three CCM causative genes have been identified: CCM1/KRIT1, CCM2/MGC4607 and CCM3/PDCD10. In our previous mutation screening, performed in a cohort of 95 Italian patients, with both sporadic and familial cases, we identified several mutations in CCM genes. This study represents further molecular screening in a cohort of 19 Italian patients enrolled by us in the few last years and classified into familial, sporadic and sporadic with multiple lesions cases. Direct sequencing and multiplex ligation-dependent probe amplification (MLPA) analysis were performed to detect point mutations and large genomic rearrangements, respectively. Effects of detected mutations and single-nucleotide polymorphisms (SNPs) were evaluated by an in silico approach and by western blot analysis. A novel nonsense mutation in CCM1 and a novel missense mutation in CCM2 were detected; moreover, several CCM2 gene polymorphisms in sporadic CCM patients were reported. We believe that these data enrich the mutation spectrum of CCM genes, which is useful for genetic counselling to identify both familial and sporadic CCM cases, as early as possible.

  9. Keratin 1 gene mutation detected in epidermal nevus with epidermolytic hyperkeratosis.

    Science.gov (United States)

    Tsubota, Akiko; Akiyama, Masashi; Sakai, Kaori; Goto, Maki; Nomura, Yukiko; Ando, Satomi; Abe, Masataka; Sawamura, Daisuke; Shimizu, Hiroshi

    2007-06-01

    Since 1994, four cases of epidermal nevus with epidermolytic hyperkeratosis (EH) caused by keratin 10 gene mutations have been reported, although no keratin 1 (K1) gene mutation has yet been reported. We detected a K1 gene (KRT1) mutation in epidermal nevus with EH in a 10-year-old Japanese male. The patient showed well-demarcated verrucous, hyperkeratotic plaques mainly on the trunk, covering 15% of the entire body surface. No hyperkeratosis was seen on the palms or soles. He had no family history of skin disorders. His lesional skin showed typical granular degeneration and, ultrastructurally, clumped keratin filaments were observed in the upper epidermis. Direct sequence analysis of genomic DNA extracted from lesional skin revealed a heterozygous 5' donor splice site mutation c.591+2T>A in KRT1. This mutation was not detected in genomic DNA samples from the patient's peripheral blood leukocytes or those of other family members. The identical splice mutation was previously reported in a family with palmoplantar keratoderma and mild ichthyosis, and was demonstrated to result in a 22 amino-acid deletion p.Val175_Lys196del in the H1 and 1A domains of K1. To our knowledge, the present patient is the first reported case of epidermal nevus associated with EH caused by a K1 gene mutation in a mosaic pattern.

  10. A mutation in the mitochondrial fission gene Dnm1l leads to cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Houman Ashrafian

    2010-06-01

    Full Text Available Mutations in a number of genes have been linked to inherited dilated cardiomyopathy (DCM. However, such mutations account for only a small proportion of the clinical cases emphasising the need for alternative discovery approaches to uncovering novel pathogenic mutations in hitherto unidentified pathways. Accordingly, as part of a large-scale N-ethyl-N-nitrosourea mutagenesis screen, we identified a mouse mutant, Python, which develops DCM. We demonstrate that the Python phenotype is attributable to a dominant fully penetrant mutation in the dynamin-1-like (Dnm1l gene, which has been shown to be critical for mitochondrial fission. The C452F mutation is in a highly conserved region of the M domain of Dnm1l that alters protein interactions in a yeast two-hybrid system, suggesting that the mutation might alter intramolecular interactions within the Dnm1l monomer. Heterozygous Python fibroblasts exhibit abnormal mitochondria and peroxisomes. Homozygosity for the mutation results in the death of embryos midway though gestation. Heterozygous Python hearts show reduced levels of mitochondria enzyme complexes and suffer from cardiac ATP depletion. The resulting energy deficiency may contribute to cardiomyopathy. This is the first demonstration that a defect in a gene involved in mitochondrial remodelling can result in cardiomyopathy, showing that the function of this gene is needed for the maintenance of normal cellular function in a relatively tissue-specific manner. This disease model attests to the importance of mitochondrial remodelling in the heart; similar defects might underlie human heart muscle disease.

  11. Combined Vhlh and Pten Mutation Causes Genital Tract Cystadenoma and Squamous Metaplasia▿

    Science.gov (United States)

    Frew, Ian J.; Minola, Andrea; Georgiev, Strahil; Hitz, Manuela; Moch, Holger; Richard, Stéphane; Vortmeyer, Alexander O.; Krek, Wilhelm

    2008-01-01

    Patients with von Hippel-Lindau (VHL) disease develop tumors in a range of tissues, but existing mouse models of Vhlh mutation have failed to reproduce these lesions. Epididymal cystadenomas arise frequently in VHL patients, but VHL mutation alone is believed to be insufficient for tumor formation, implying a requirement for cooperating mutations in epididymal pathogenesis. Here we show that epididymal cystadenomas from VHL patients frequently also lack expression of the PTEN tumor suppressor and display activation of phosphatidylinositol 3-kinase (PI3K) pathway signaling. Strikingly, while conditional inactivation of either Vhlh or Pten in epithelia of the mouse genital tract fails to produce a tumor phenotype, their combined deletion causes benign genital tract tumors with regions of squamous metaplasia and cystadenoma. The latter are histologically identical to lesions found in VHL patients. Importantly, these lesions are characterized by expansion of basal stem cells, high levels of expression and activity of HIF1α and HIF2α, and dysregulation of PI3K signaling. Our studies suggest a model for cooperative tumor suppression in which inactivation of PTEN facilitates epididymal cystadenoma genesis initiated by loss of VHL. PMID:18474617

  12. DGGE based whole-gene mutation scanning of the dystrophlin gene in Duchenne and Becker muscular dystrophy patients

    NARCIS (Netherlands)

    Hofstra, RMW; Mulder, IM; Vossen, R; de Koning-Gans, PAM; Kraak, M; Ginjaar, IB; van der Hout, AH; Bakker, E; Buys, CHCM; van Essen, AJ; den Dunnen, JT

    2004-01-01

    Duchenne and Becker muscular dystrophy (DMD and BMD) are caused by mutations in the dystrophin gene. Large rearrangements in the gene are found in about two,thirds of DMD patients, with similar to60% carrying deletions and 5-10% carrying duplications. Most of the remaining 30-35% of patients are

  13. Gene Targeted Mice with Conditional Knock-In (-Out) of NMDAR Mutations.

    Science.gov (United States)

    Sprengel, Rolf; Eltokhi, Ahmed; Single, Frank N

    2017-01-01

    For the genetic alterations of NMDA receptor (NMDAR) properties like Ca2+-permeability or voltage-dependent gating in mice and for the experimental analysis of nonsense or missense mutations that were identified in human patients, single nucleotide mutations have to be introduced into the germ line of mice (Burnashev and Szepetowski, Curr Opin Pharmacol 20:73-82, 2015; Endele et al., Nat Genet 42:1021-1026, 2010). This can be done with very high precision by the well-established method of gene replacement, which makes use of homologous recombination in pluripotent embryonic stem (ES) cells of mice. The homologous recombination at NMDAR subunit genes (Grin; for glutamate receptor ionotropic NMDAR subtype) has to be performed by targeting vectors, also called replacement vectors. The targeting vector should encode part of the gene for the NMDAR subunit, the NMDAR mutation, and a removable selection maker. In these days, the targeting vector can be precisely designed using DNA sequences from public databases. The assembly of the vector is then done from isogenic NMDAR gene fragments cloned in bacterial artificial chromosomes (BACs) using "high fidelity" long-range PCR reactions. During these PCR reactions, the NMDAR mutations are introduced into the cloned NMDAR gene fragments of the targeting vector. Finally, the targeting vector is used for homologous recombination in mouse ES cells. Positive ES cell clones which have the correct mutation have to be selected and are then used for blastocyst injection to generate chimeric mice that hopefully transmit the Grin gene targeted ES cells to their offspring. In the first offspring generation of the founder (F1), some animals will be heterozygous for the targeted NMDAR gene mutation. In order to regulate the expression of NMDAR mutations, it is important to keep the targeted NMDAR mutation under conditional control. Here, we describe a general method how those conditionally controlled NMDAR mutations can be engraved into

  14. Heteroduplex analysis of the dystrophin gene: application to point mutation and carrier detection.

    Science.gov (United States)

    Prior, T W; Papp, A C; Snyder, P J; Sedra, M S; Western, L M; Bartolo, C; Moxley, R T; Mendell, J R

    1994-03-01

    Approximately one-third of the Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, we identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. We conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing.

  15. Mutations of the SBDS gene are present in most patients with Shwachman-Diamond syndrome.

    Science.gov (United States)

    Woloszynek, Jill R; Rothbaum, Robert J; Rawls, Amy S; Minx, Patrick J; Wilson, Richard K; Mason, Philip J; Bessler, Monica; Link, Daniel C

    2004-12-01

    Shwachman-Diamond Syndrome (SDS) is a rare multisystem disorder characterized by exocrine pancreatic insufficiency, bone marrow dysfunction, and metaphyseal chondrodysplasia. Recent studies show that mutations of SBDS, a gene of unknown function, are present in the majority of patients with SDS. In the present study, we show that most, but not all, patients classified based on rigorous clinical criteria as having SDS had compound heterozygous mutations of SBDS. Full-length SBDS protein was not detected in leukocytes of SDS patients with the most common SBDS mutations, consistent with a loss-of-function mechanism. In contrast, SBDS protein was expressed at normal levels in SDS patients without SBDS mutations. These data confirm the absence of SBDS mutations in this subgroup of patients and suggest that SDS is a genetically heterogeneous disorder. The presence (or absence) of SBDS mutations may define subgroups of patients with SDS who share distinct clinical features or natural history.

  16. Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)

    1994-03-01

    Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.

  17. Mitochondrial DNA mutations in respiratory complex-I in never-smoker lung cancer patients contribute to lung cancer progression and associated with EGFR gene mutation.

    Science.gov (United States)

    Dasgupta, Santanu; Soudry, Ethan; Mukhopadhyay, Nitai; Shao, Chunbo; Yee, John; Lam, Stephan; Lam, Wan; Zhang, Wei; Gazdar, Adi F; Fisher, Paul B; Sidransky, David

    2012-06-01

    Mitochondrial DNA (mtDNA) mutations were reported in different cancers. However, the nature and role of mtDNA mutation in never-smoker lung cancer patients including patients with epidermal growth factor receptor (EGFR) and KRAS gene mutation are unknown. In the present study, we sequenced entire mitochondrial genome (16.5 kb) in matched normal and tumors obtained from 30 never-smoker and 30 current-smoker lung cancer patients, and determined the mtDNA content. All the patients' samples were sequenced for KRAS (exon 2) and EGFR (exon 19 and 21) gene mutation. The impact of forced overexpression of a respiratory complex-I gene mutation was evaluated in a lung cancer cell line. We observed significantly higher (P = 0.006) mtDNA mutation in the never-smokers compared to the current-smoker lung cancer patients. MtDNA mutation was significantly higher (P = 0.026) in the never-smoker Asian compared to the current-smoker Caucasian patients' population. MtDNA mutation was significantly (P = 0.007) associated with EGFR gene mutation in the never-smoker patients. We also observed a significant increase (P = 0.037) in mtDNA content among the never-smoker lung cancer patients. The majority of the coding mtDNA mutations targeted respiratory complex-I and forced overexpression of one of these mutations resulted in increased in vitro proliferation, invasion, and superoxide production in lung cancer cells. We observed a higher prevalence and new relationship between mtDNA alterations among never-smoker lung cancer patients and EGFR gene mutation. Moreover, a representative mutation produced strong growth effects after forced overexpression in lung cancer cells. Signature mtDNA mutations provide a basis to develop novel biomarkers and therapeutic strategies for never-smoker lung cancer patients. Copyright © 2011 Wiley Periodicals, Inc.

  18. A bacterial model for expression of mutations in the human ornithine transcarbamylase (OTC) gene

    Energy Technology Data Exchange (ETDEWEB)

    Tuchman, M.; McCann, M.T.; Qureshi, A.A. [Univ. of Minnesota, Mineapolis (United States)

    1994-09-01

    OTC is a mitochondrial enzyme catalyzing the formation of citrulline from carbamyl phosphate and ornithine. X-linked deficiency of OTC is the most prevalent genetic defect of ureagenesis. Mutations and polymorphisms in the OTC gene identified in deficient patients have indicated the occurrence of many family-specific, unique alleles. Due to the low frequency of recurrent mutations, distinguishing between deleterious mutations and polymorphisms is difficult. Using a human OTC gene containing plasmid driven by a tac promoter, we have devised a simple and efficient method for expressing mutations in the mature human OTC enzyme. To demonstrate this method, PCR engineered site-directed mutagenesis was employed to generated cDNA fragments which contained either the R151Q or R277W known mutations found in patients with neonatal and late-onset OTC deficiency, respectively. The normal allele for each mutation was also generated by an identical PCR procedure. Digestion with Bgl II- and Sty I-generated mutant and normal replacement cassettes containing the respective mutant and wild type sequences. Upon transformation of JM109 E.coli cells, OTC enzymatic activity was measured at log and stationary phases of growth using a radiochromatographic method. The R141Q mutation abolished enzymatic activity (<0.02% of normal), whereas the R277W mutation expressed partial activity (2.3% of normal). In addition, a PCR-generated mutation, A280V, resulted in 73% loss of catalytic activity. This OTC expression system is clinically applicable for distinguishing between mutations and polymorphisms, and it can be used to investigate the effects of mutations on various domains of the OTC gene.

  19. Mutational profile of KIT and PDGFRA genes in gastrointestinal stromal tumors in Peruvian samples

    Directory of Open Access Journals (Sweden)

    José Buleje

    2015-02-01

    Full Text Available Introduction: Gastrointestinal stromal tumors (GISTs are mesenchymal neoplasms usually caused by somatic mutations in the genes KIT (c-KIT or PDGFRA. Mutation characterization has become an important exam for GIST patients because it is useful in predicting the response to the inhibitors of receptor tyrosine kinase (RTK. Objectives: The aim of this study was to determine the frequency of KIT and PDGFRA mutations in 25 GIST samples collected over two years at two national reference hospitals in Peru. There were 21 samples collected from the Instituto Nacional de Enfermedades Neoplásicas (INEN, national cancer center and 4 samples collected from Hospital A. Loayza. Methods and materials: In this retrospective study, we performed polymerase chain reaction (PCR amplification and deoxyribonucleic acid (DNA sequencing of KIT (exons 9, 11, 13, and 17 and PDGFRA (exons 12 and 18 genes in 20 FFPE (formalin-fixed, paraffin-embedded and 5 frozen GIST samples. Results: We report 21 mutations, including deletions, duplications, and missense, no mutations in 2 samples, and 2 samples with no useful DNA for further analysis. Eighty-six percent of these mutations were located in exon 11 of KIT, and 14 % were located in exon 18 of PDGFRA. Conclusions: Our study identified mutations in 21 out of 25 GIST samples from 2 referential national hospitals in Peru, and the mutation proportion follows a global tendency observed from previous studies (i.e., the majority of samples presented KIT mutations followed by a minor percentage of PDGFRA mutations. This study presents the first mutation data of the KIT and PDGFRA genes from Peruvian individuals with GIST.

  20. Frameshift Mutations of AKAP9 Gene in Gastric and Colorectal Cancers with High Microsatellite Instability.

    Science.gov (United States)

    Jo, Yun Sol; Kim, Min Sung; Yoo, Nam Jin; Lee, Sug Hyung

    2016-07-01

    A-kinase-anchoring protein 9 (AKAP9) coordinates the cellular location and function of protein kinase A. AKAP9 plays an important role in centrosome duplication, cell cycle progression and maintenance of cell membrane integrity, alterations of which contribute to tumorigenesis. Somatic mutations of AKAP9 gene have been detected in many cancers including gastric (GC) and colorectal cancers (CRC), but the mutation status with respect to microsatellite instability (MSI) has not been reported. In a public database, we found that AKAP9 gene had mononucleotide repeats in the coding sequences that might be mutation targets in the cancers with MSI. We analyzed the mutations in 79 GCs and 124 CRCs including high MSI (MSI-H) and microsatellite stable/low MSI (MSS/MSI-L) cases by single-strand conformation polymorphism analysis and DNA sequencing. Overall, we found AKAP9 frameshift mutations in 4 (11.7 %) GCs and 20 (17.7 %) CRCs with MSI-H (24/113), but not in MSS/MSI-L cancers (0/90) (p < 0.001). In addition, we analyzed intratumoral heterogeneity (ITH) of AKAP9 frameshift mutations in 16 CRCs and found that five CRCs (31.3 %) harbored regional ITH of the AKAP9 frameshift mutations. Our data indicate that AKAP9 gene harbors not only somatic frameshift mutations but also mutational ITH, which together may be features of GC and CRC with MSI-H. Our results also suggest that regional mutation analysis is needed for a better evaluation of mutation status in these tumors to overcome ITH.

  1. Multi-layered mutation in hedgehog-related genes in Gorlin syndrome may affect the phenotype.

    Directory of Open Access Journals (Sweden)

    Shoko Onodera

    Full Text Available Gorlin syndrome is a genetic disorder of autosomal dominant inheritance that predisposes the affected individual to a variety of disorders that are attributed largely to heterozygous germline patched1 (PTCH1 mutations. PTCH1 is a hedgehog (Hh receptor as well as a repressor, mutation of which leads to constitutive activation of Hh pathway. Hh pathway encompasses a wide variety of cellular signaling cascades, which involve several molecules; however, no associated genotype-phenotype correlations have been reported. Recently, mutations in Suppressor of fused homolog (SUFU or PTCH2 were reported in patients with Gorlin syndrome. These facts suggest that multi-layered mutations in Hh pathway may contribute to the development of Gorlin syndrome. We demonstrated multiple mutations of Hh-related genes in addition to PTCH1, which possibly act in an additive or multiplicative manner and lead to Gorlin syndrome. High-throughput sequencing was performed to analyze exome sequences in four unrelated Gorlin syndrome patient genomes. Mutations in PTCH1 gene were detected in all four patients. Specific nucleotide variations or frameshift variations of PTCH1 were identified along with the inferred amino acid changes in all patients. We further filtered 84 different genes which are closely related to Hh signaling. Fifty three of these had enough coverage of over ×30. The sequencing results were filtered and compared to reduce the number of sequence variants identified in each of the affected individuals. We discovered three genes, PTCH2, BOC, and WNT9b, with mutations with a predicted functional impact assessed by MutationTaster2 or PolyPhen-2 (Polymorphism Phenotyping v2 analysis. It is noticeable that PTCH2 and BOC are Hh receptor molecules. No significant mutations were observed in SUFU. Multi-layered mutations in Hh pathway may change the activation level of the Hh signals, which may explain the wide phenotypic variability of Gorlin syndrome.

  2. Suppression of different classes of somatic mutations in Arabidopsis by vir gene-expressing Agrobacterium strains.

    Science.gov (United States)

    Shah, Jasmine M; Ramakrishnan, Anantha Maharasi; Singh, Amit Kumar; Ramachandran, Subalakshmi; Unniyampurath, Unnikrishnan; Jayshankar, Ajitha; Balasundaram, Nithya; Dhanapal, Shanmuhapreya; Hyde, Geoff; Baskar, Ramamurthy

    2015-08-26

    Agrobacterium infection, which is widely used to generate transgenic plants, is often accompanied by T-DNA-linked mutations and transpositions in flowering plants. It is not known if Agrobacterium infection also affects the rates of point mutations, somatic homologous recombinations (SHR) and frame-shift mutations (FSM). We examined the effects of Agrobacterium infection on five types of somatic mutations using a set of mutation detector lines of Arabidopsis thaliana. To verify the effect of secreted factors, we exposed the plants to different Agrobacterium strains, including wild type (Ach5), its derivatives lacking vir genes, oncogenes or T-DNA, and the heat-killed form for 48 h post-infection; also, for a smaller set of strains, we examined the rates of three types of mutations at multiple time-points. The mutation detector lines carried a non-functional β-glucuronidase gene (GUS) and a reversion of mutated GUS to its functional form resulted in blue spots. Based on the number of blue spots visible in plants grown for a further two weeks, we estimated the mutation frequencies. For plants co-cultivated for 48 h with Agrobacterium, if the strain contained vir genes, then the rates of transversions, SHRs and FSMs (measured 2 weeks later) were lower than those of uninfected controls. In contrast, co-cultivation for 48 h with any of the Agrobacterium strains raised the transposition rates above control levels. The multiple time-point study showed that in seedlings co-cultivated with wild type Ach5, the reduced rates of transversions and SHRs after 48 h co-cultivation represent an apparent suppression of an earlier short-lived increase in mutation rates (peaking for plants co-cultivated for 3 h). An increase after 3 h co-cultivation was also seen for rates of transversions (but not SHR) in seedlings exposed to the strain lacking vir genes, oncogenes and T-DNA. However, the mutation rates in plants co-cultivated for longer times with this strain subsequently

  3. A Novel Mutation inERCC8Gene Causing Cockayne Syndrome.

    Science.gov (United States)

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  4. Molecular Analysis of CYP21A2 Gene Mutations among Iraqi Patients with Congenital Adrenal Hyperplasia

    Directory of Open Access Journals (Sweden)

    Ruqayah G. Y. Al-Obaidi

    2016-01-01

    Full Text Available Congenital adrenal hyperplasia is a group of autosomal recessive disorders. The most frequent one is 21-hydroxylase deficiency. Analyzing CYP21A2 gene mutations was so far not reported in Iraq. This work aims to analyze the spectrum and frequency of CYP21A2 mutations among Iraqi CAH patients. Sixty-two children were recruited from the Pediatric Endocrine Consultation Clinic, Children Welfare Teaching Hospital, Baghdad, Iraq, from September 2014 till June 2015. Their ages ranged between one day and 15 years. They presented with salt wasting, simple virilization, or pseudoprecocious puberty. Cytogenetic study was performed for cases with ambiguous genitalia. Molecular analysis of CYP21A2 gene was done using the CAH StripAssay (ViennaLab Diagnostics for detection of 11 point mutations and >50% of large gene deletions/conversions. Mutations were found in 42 (67.7% patients; 31 (50% patients were homozygotes, 9 (14.5% were heterozygotes, and 2 (3.2% were compound heterozygotes with 3 mutations, while 20 (32.3% patients had none of the tested mutations. The most frequently detected mutations were large gene deletions/conversions found in 12 (19.4% patients, followed by I2Splice and Q318X in 8 (12.9% patients each, I172N in 5 (8.1% patients, and V281L in 4 (6.5% patients. Del 8 bp, P453S, and R483P were each found in one (1.6% and complex alleles were found in 2 (3.2%. Four point mutations (P30L, Cluster E6, L307 frameshift, and R356W were not identified in any patient. In conclusion, gene deletions/conversions and 7 point mutations were recorded in varying proportions, the former being the commonest, generally similar to what was reported in regional countries.

  5. A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia

    Energy Technology Data Exchange (ETDEWEB)

    Stoilov, I.; Kilpatrick, M.W.; Tsipouras, P. [Univ. of Connecticut Health Center, Farmington, CT (United States)

    1995-01-02

    Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Futhermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3. 27 refs., 2 figs.

  6. Novel mutation of aspartoacylase gene in a Turkish patient with Canavan disease.

    Science.gov (United States)

    Unalp, Aycan; Altiok, Ender; Uran, Nedret; Oztürk, Aysel; Yüksel, Sirin

    2008-06-01

    Canavan disease is a neurodegenerative disease with autosomal recessive inheritance. Although this disease is prevalant among Ashkenazi Jewish population, several cases have been reported from all over the world. Canavan disease is caused by a genetic mutation in aspartoacylase gene. We have identified a novel mutation, a homozygous C432+1G>A mutation, in a 10-month-old boy who has a typical Canavan phenotype (without macrocephaly) accompanied by typical brain magnetic resonance imaging (MRI), magnetic resonance spectroscopy (MRS) and diffusion magnetic resonance findings. The patient's mother was found to be heterozygous for this mutation. We believe that future studies of aspartoacylase gene in various ethnic groups could lead to a better understanding of Canavan's pathophysiology and gene therapy.

  7. Congenital goitrous primary hypothyroidism in two German families caused by novel thyroid peroxidase (TPO) gene mutations.

    Science.gov (United States)

    Altmann, K; Hermanns, P; Mühlenberg, R; Fricke-Otto, S; Wentzell, R; Pohlenz, J

    2013-06-01

    Congenital hypothyroidism occurs with a prevalence of approximately 1:3 500. Defects in thyroid hormone synthesis which lead to goitrous hypothyroidism account for 10-15% of these cases. Several genetic defects have been characterized and mutations in the thyroid peroxidase (TPO) gene are the most common cause for dyshormonogenesis.So far, more than 80 mutations in the TPO gene have been described, resulting in a variable decrease in TPO bioactivity. Clinically TPO defects manifest with congenital primary goitrous hypothyroidism.We here present 2 children with congenital primary hypothyroidism, who were identified to have compound heterozygous TPO mutations. They both shared the same novel mutation in the TPO gene (C756R) in exon 13. One case presented with an apparently dominant inheritance of thyroid dyshormonogenesis. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.

  8. [Mutation analysis of KRT10 gene in a patient with bullous congenital ichthyosiform erythroderma].

    Science.gov (United States)

    Zhang, Shi-de; Liu, Jing-jing; Tian, Wei; Zhao, Zheng-juan; Zhao, Jing-jun

    2011-08-01

    To investigate the gene mutation in one sporadic case of bullous congenital ichthyosiform erythroderma (BCIE), and to explore the relationship between the genotype and phenotype. DNA was extracted from the blood samples of the patient with BCIE, unaffected members of the pedigree, and 50 unrelated healthy controls. PCR was used to amplify the hot spot fragment of keratin 1 (KRT1) and keratin 10 (KRT10) gene. The PCR products were directly sequenced to detect the mutations. A heterozygous 467G>A mutation was found in the patient, resulting in the substitution of arginine (R) by histidine (H) in codon 156 (R156H) in the 1A domain of the KRT10 protein but not in the healthy individuals from the family and the 50 unrelated individuals. The mutation of 467G>A in exon 1 of KRT10 gene identified may play a major role in the pathogenic mechanism of this case of BCIE.

  9. A novel missense mutation of the DDHD1 gene associated with juvenile amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Chujun Wu

    2016-12-01

    Full Text Available Background: Juvenile amyotrophic lateral sclerosis (jALS is a rare form of ALS with an onset age of less than 25 years and is frequently thought to be genetic in origin. DDHD1 gene mutations have been reported to be associated with the SPG28 subtype of autosomal recessive HSP but have never been reported in jALS patients.Methods: Gene screens for the causative genes of ALS, HSP and CMT using next-generation sequencing (NGS technologies were performed on a jALS patient. Sanger sequencing was used to validate identified variants and perform segregation analysis.Results: We identified a novel c.1483A>G (p.Met495Val homozygous missense mutation of the DDHD1 gene in the jALS patient. All of his parents and young bother were heterozygous for this mutation. The mutation was not found in 800 Chinese control subjects or the data of dbSNP, ExAC and 1000G.Conclusion: The novel c.1483A>G (p.Met495Val missense mutation of the DDHD1 gene could be a causative mutation of autosomal recessive jALS.

  10. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    Science.gov (United States)

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  11. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    Science.gov (United States)

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  12. [The prognostic value of kcnq1 gene mutations in patients after myocardial infarction].

    Science.gov (United States)

    Olszak-Waśkiewicz, Marlena; Kramarz, Elżbieta

    Ion channel gene mutations are risk factors for SCD. To assess the prognostic value of A2753831C, C2505734T, C2505846A, G2753881A, T2755854C and T2755875G mutations in the KCNQ1 gene in patients after MI. The study group of 100 patients after MI was divided into two groups: patients with mutations (n=23) and patients without mutations (n=77). The subjects underwent physical examinations, laboratory tests, ECG, Holter ECG and echocardiography. The examinations were repeated every 12 months. Cardiac events including deaths occurred during the observation period. The mean observation time was 8 ± 4,3 years. KCNQ1 gene mutations were found in 23 subjects and were four times more frequent in men than in women. Parameters such as QRS ≥ 110 ms, QTc ≥ 440 ms, VEBs ≥ 100 per 24 hours, nsVT and LVEF ≤40% showed statistically significant differences between the group of patients who died and the group of patients who survived. LVEF ≤ 40% and VEBs ≥ 100/24 h were the factors that correlated the most with deaths. KCNQ1 gene mutations, PQ interval ≥ 200ms and QTd ≥ 60ms had no impact on death. The occurrence of KCNQ1 gene mutations in patients after MI is higher in men than in women. The presence of KCNQ1 gene mutations is not an additional risk factor for increased mortality in patients after MI. LVEF ≤40% and VES ≥100/24 h have a significant prognostic value in predicting deaths in patients after MI.

  13. FGFR3 mutations and the skin: report of a patient with a FGFR3 gene mutation, acanthosis nigricans, hypochondroplasia and hyperinsulinemia and review of the literature

    DEFF Research Database (Denmark)

    Blomberg, M; Jeppesen, E M; Skovby, F

    2010-01-01

    Fibroblast growth factor receptor 3 (FGFR3) gene mutations in the germline are well-known causes of skeletal syndromes. Somatic FGFR3 mutations have been found in malignant neoplasms and more recently in several cutaneous elements. We present a 14-year-old girl with mild hypochondroplasia who...... developed acanthosis nigricans. The report of a K650Q mutation in the FGFR3 gene in a similar case prompted us to conduct a point mutation analysis. The K650Q mutation was confirmed, but in contrast to the previous case, we additionally report findings of hyperinsulinemia. In the recent literature......, an increasing number of different cutaneous elements have been found to harbor mutations of FGFR3, suggesting that FGFR3 plays a role in the pathogenesis of these elements. We review the present literature, describing studies in which FGFR3 mutations have been investigated in skin lesions: primarily seborrheic...

  14. Familial hypertrophic cardiomyopathy owing to double heterozygosity for a 403Arg--> Trp mutation in exon 13 of the MYH7 gene and a novel mutation, 453Arg--> His, in exon 14 of the MYH7 gene: A case report.

    Science.gov (United States)

    Haluza, R; Halouzková, S; Buncek, M; Smíd, O; Kvasnicka, J

    2001-01-01

    An unusual clinical history of a 23-year-old male proband with obstructive hypertrophic cardiomyopathy associated with a rare genotype is presented. Genetic analysis of the proband found evidence for two distinct mutations of the MYH7 gene (the gene coding for the beta-myosin heavy chain): 403Arg--> Trp in exon 13 and a novel mutation, 453Arg--> His, in exon 14. A heterozygous site mutation was identified in exon 13 in the proband's father but no mutation site was found in his mother. Thus, the novel mutation in exon 14 is a de novo mutation.

  15. Familial hypertrophic cardiomyopathy owing to double heterozygosity for a 403Arg→ Trp mutation in exon 13 of the MYH7 gene and a novel mutation, 453Arg→ His, in exon 14 of the MYH7 gene: A case report

    Science.gov (United States)

    Haluza, Radovan; Halouzková, Štěpánka; Bunček, Martin; Šmíd, Ondřej; Kvasnička, Jiří

    2001-01-01

    An unusual clinical history of a 23-year-old male proband with obstructive hypertrophic cardiomyopathy associated with a rare genotype is presented. Genetic analysis of the proband found evidence for two distinct mutations of the MYH7 gene (the gene coding for the beta-myosin heavy chain): 403Arg→ Trp in exon 13 and a novel mutation, 453Arg→ His, in exon 14. A heterozygous site mutation was identified in exon 13 in the proband’s father but no mutation site was found in his mother. Thus, the novel mutation in exon 14 is a de novo mutation. PMID:20428263

  16. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  17. Association between loss-of-function mutations in the filaggrin gene and self-reported food allergy and alcohol sensitivity

    DEFF Research Database (Denmark)

    Linneberg, Allan René; Fenger, Runa V; Husemoen, Lise Lotte Nystrup

    2013-01-01

    Loss-of-function mutations of the filaggrin (FLG) gene cause an impaired skin barrier and increase the risk of atopic dermatitis. Interestingly, FLG mutations have also been found to be associated with a high risk of peanut allergy....

  18. Tumor RAS Gene Expression Levels Are Influenced by the Mutational Status of RAS Genes and Both Upstream and Downstream RAS Pathway Genes.

    Science.gov (United States)

    Stephens, Robert M; Yi, Ming; Kessing, Bailey; Nissley, Dwight V; McCormick, Frank

    2017-01-01

    The 3 human RAS genes play pivotal roles regulating proliferation, differentiation, and survival in normal cells and become mutated in 15% to 20% of all human tumors and amplified in many others. In this report, we examined data from The Cancer Genome Atlas to investigate the relationship between RAS gene mutational status and messenger RNA expression. We show that all 3 RAS genes exhibit increased expression when they are mutated in a context-dependent manner. In the case of KRAS, this increase is manifested by a larger proportional increase in KRAS4A than KRAS4B, although both increase significantly. In addition, the mutational status of RAS genes can be associated with expression changes in other RAS genes, with most of these cases showing decreased expression. The mutational status associations with expression are recapitulated in cancer cell lines. Increases in expression are mediated by both copy number variation and contextual differences, including mutational status of epidermal growth factor receptor (EGFR) and BRAF. These findings potentially reveal an adaptive response during tumor evolution that is dependent on the mutational status of proximal genes in the RAS pathway and cellular context. Cell contextual differences in these adaptations may influence therapeutic responsiveness and alternative resistance mechanisms.

  19. Screening of RET gene mutations in Chinese patients with medullary thyroid carcinoma and their relatives.

    Science.gov (United States)

    Wang, Junyi; Zhang, Bin; Liu, Wensheng; Zhang, Yongxia; Di, Xuebing; Yang, Yanmei; Yan, Dangui

    2016-01-01

    The rearranged during transfection (RET) gene is a proto-oncogene; active mutations frequently occur in medullary thyroid carcinoma (MTC). This study investigated the spectrum of germline RET mutations and clinical features in Chinese hereditary MTC patients. A total of 53 family members from 11 different hereditary MTC families were recruited for detection of RET exon 8, 10, 11, 13, 14, 15, and 16 mutations, in genomic DNA from peripheral blood leucocytes using polymerase chain reaction (PCR) and direct DNA sequencing. Of the 53 participants, eight different germline RET mutations were detected in 37 individuals. These RET mutations were distributed in exons 10, 11, 13, and 16. The most frequent RET mutation was localized at exon 11 codon 634 (67.6 %; 25/37) and the most prevalent mutation was C634R (37.8 %; 14/37). The most frequent phenotype was multiple endocrine neoplasia type 2A (MEN2A). The incidences of MTC, pheochromocytoma, and hyperparathyroidism in the MEN2A patients were 100, 36.4 and 18.2 %, respectively. The phenotype of families with Y606C or L790F mutation was categorized as familial medullary thyroid carcinoma. Moreover, one proband was identified with multiple endocrine neoplasia type 2B and carried a de novo mutation of M918T. Two families with C618S/Y mutation were categorized as unclassified multiple endocrine neoplasia type 2. Our results further substantiate that most germline mutations of the RET proto-oncogene were localized at codon 634 in Chinese hereditary MTC patients and carriers. RET mutation at codon 634 was always associated to the phenotype of MEN2A. Screening of RET mutations should be probably limited to exons 10, 11, 13 and 16 initially to be cost-effective in China.

  20. Mutation analysis of BRCA1 and BRCA2 genes in Iranian high risk breast cancer families.

    Science.gov (United States)

    Pietschmann, Andrea; Mehdipour, Parvin; Mehdipour, Parvin; Atri, Morteza; Hofmann, Wera; Hosseini-Asl, S Said; Scherneck, Siegfried; Mundlos, Stefan; Peters, Hartmut

    2005-08-01

    Germline mutations in either BRCA1 or BRCA2 genes are responsible for the majority of hereditary breast and ovarian cancers. At present, over thousand distinct BRCA1 and BRCA2 mutations have been identified. Specific mutations are found to be common within particular populations, resulting from genetic founder effects. To investigate the contribution of germline mutations in these two genes to inherited breast cancer in Iran, we performed BRCA1/BRCA2 mutation analyses in ten Iranian high risk breast cancer families. This is the first study analysing the complete coding sequences of both genes that concerns the Iranian population. BRCA1/BRCA2 mutation detection included sequencing of the coding and the 3' and 5' untranslated regions. To detect large genomic rearrangements in the BRCA1 gene semi-quantitative multiplex PCR was performed. Two pathogenic mutations in the BRCA2 gene were detected: a novel deletion c.4415_4418delAGAA and a previously described insertion c.6033_6034insGT. In addition, one intronic variation g.5075-53C > T and a deletion/insertion g.*381_389del9ins29 in the 3' untranslated region of BRCA1 were found in two of the investigated families. Both sequence alterations were absent in an age matched Iranian control group. The BRCA2 homozygous variation p.N372H, previously associated with an increased risk for developing breast cancer, was not identified in this study. We did not detect large genomic rearrangements in BRCA1 in patients tested negatively for disease causing mutations in both genes by standard sequencing. At present, the BRCA2 mutations c.4415_4418delAGAA and c.6033_6034insGT have not been identified in any investigated population except the Iranian. Whether both mutations are specific for the Iranian population or a special subgroup remains to be investigated in larger studies. The absence of BRCA1 mutations in the analysed families may suggest that penetrance or prevalence of BRCA1 mutations may be lower in Iran.

  1. [The study of gene mutations in unknown refractory viral infection and primary hemophagocytic lymphohistiocytosis].

    Science.gov (United States)

    Tong, Chun-Rong; Liu, Hong-Xing; Xie, Jian-Jun; Wang, Fang; Cai, Peng; Wang, Hui; Zhu, Juan; Teng, Wen; Zhang, Xian; Yang, Jun-Fang; Zhang, Ya-Li; Fei, Xin-Hong; Zhao, Jie; Yin, Yu-Ming; Wu, Tong; Wang, Jing-Bo; Sun, Yuan; Liu, Rong; Shi, Xiao-Dong; Lu, Dao-Pei

    2011-04-01

    To study the type and corresponding clinical characteristics of primary hemophagocytic lymphohistiocytosis (HLH) associated immune gene mutations in the refractory virus infection or HLH of unknown causes. From December 2009 to July 2010, the patients with refractory virus infection or HLH of unknown causes were screened for the primary HLH associated immune genes mutations by DNA sequence analysis, including PRF1, UNC13D, STX11, STXBP2, SH2D1A and XIAP. The clinical characteristics and outcomes were followed up. Totally 25 patients with refractory virus infection or HLH of unknown causes were investigated for the 6 genes and 13 cases were found carrying gene mutations, composing of 6 of PRF1 mutation, 3 of UNC13D, and each one of STX11, XIAP, SH2D1A and STXBP2, respectively. Among the 13 cases with gene mutations, 5 suffered from Epstein-Barr virus associated HLH (EBV-HLH), 1 human herpes virus 7 associated HLH (HHV7-HLH), 1 HLH without causes, 4 chronic activated EB virus infection (CAEBV) with 1 progressing to Hodgkin's lymphoma carrying abnormal chromosome of t(15;17) (q22;q25) and hyperdiploid, 2 EBV associated lymphoma. Among the other 12 patients without gene mutation, 4 suffered from EBV-HLH with 1 progressing to peripheral T lymphoma, 8 suffered from CAEBV. Primary HLH associated immune gene mutations are critical causes of refractory virus infection of unknown causes, most patients manifest as HLH, some cases appear in CAEBV and EBV associated lymphoma. DNA sequence analysis is helpful to early diagnosis and correct decision-making for treatment.

  2. A novel start codon mutation of the MERTK gene in a patient with retinitis pigmentosa.

    Science.gov (United States)

    Jinda, Worapoj; Poungvarin, Naravat; Taylor, Todd D; Suzuki, Yutaka; Thongnoppakhun, Wanna; Limwongse, Chanin; Lertrit, Patcharee; Suriyaphol, Prapat; Atchaneeyasakul, La-Ongsri

    2016-01-01

    Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of inherited retinal degenerations characterized by progressive loss of photoreceptor cells and RPE functions. More than 70 causative genes are known to be responsible for RP. This study aimed to identify the causative gene in a patient from a consanguineous family with childhood-onset severe retinal dystrophy. To identify the defective gene, whole exome sequencing was performed. Candidate causative variants were selected and validated using Sanger sequencing. Segregation analysis of the causative gene was performed in additional family members. To verify that the mutation has an effect on protein synthesis, an expression vector containing the first ten amino acids of the mutant protein fused with the DsRed2 fluorescent protein was constructed and transfected into HEK293T cells. Expression of the fusion protein in the transfected cells was measured using fluorescence microscopy. By filtering against public variant databases, a novel homozygous missense mutation (c.3G>A) localized in the start codon of the MERTK gene was detected as a potentially pathogenic mutation for autosomal recessive RP. The c.3G>A mutation cosegregated with the disease phenotype in the family. No expression of the first ten amino acids of the MerTK mutant fused with the DsRed2 fluorescent protein was detected in HEK293T cells, indicating that the mutation affects the translation initiation site of the gene that may lead to loss of function of the MerTK signaling pathway. We report a novel missense mutation (c.3G>A, p.0?) in the MERTK gene that causes severe vision impairment in a patient. Taken together with previous reports, our results expand the spectrum of MERTK mutations and extend our understanding of the role of the MerTK protein in the pathogenesis of retinitis pigmentosa.

  3. Hypomorphic mutations identified in the candidate Leber congenital amaurosis gene CLUAP1.

    Science.gov (United States)

    Soens, Zachry T; Li, Yuanyuan; Zhao, Li; Eblimit, Aiden; Dharmat, Rachayata; Li, Yumei; Chen, Yiyun; Naqeeb, Mohammed; Fajardo, Norma; Lopez, Irma; Sun, Zhaoxia; Koenekoop, Robert K; Chen, Rui

    2016-10-01

    Leber congenital amaurosis (LCA) is an early-onset form of retinal degeneration. Six of the 22 known LCA genes encode photoreceptor ciliary proteins. Despite the identification of 22 LCA genes, the genetic basis of ~30% of LCA patients remains unknown. We sought to investigate the cause of disease in the remaining 30% by examining cilia-associated genes. Whole-exome sequencing was performed on an LCA cohort of 212 unsolved probands previously screened for mutations in known retinal-disease genes. Immunohistochemistry using mouse retinas was used to confirm protein localization and zebrafish were used to perform rescue experiments. A homozygous nonsynonymous mutation was found in a single proband in CLUAP1, a gene required for ciliogenesis and cilia maintenance. Cluap1 knockout zebrafish exhibit photoreceptor cell death as early as 5 days after fertilization, and rescue experiments revealed that our proband's mutation is significantly hypomorphic. Consistent with the knowledge that CLUAP1 plays an important role in cilia function and that cilia are critical to photoreceptor function, our results indicate that hypomorphic mutations in CLUAP1 can result in dysfunctional photoreceptors without systemic abnormalities. This is the first report linking mutations in CLUAP1 to human disease and establishes CLUAP1 as a candidate LCA gene.Genet Med 18 10, 1044-1051.

  4. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  5. TPO gene mutations associated with thyroid carcinoma: Case report and literature review.

    Science.gov (United States)

    Zhu, Hong; Peng, Yi-Gen; Ma, Shao-Gang; Liu, Hong

    2015-01-01

    The thyroperoxidase (TPO) genetic variants in thyroid carcinoma is scarcely reported. We report on a pedigree of thyroid papillary carcinoma and hypoechoic thyroid nodules with the TPO gene mutations. The compound heterozygotic mutations of the TPO gene (c.2268-2269 insT and c.2090 G>A) in two patients with congenital goiters hypothyroidism were demonstrated. Fifteen family members of the proband and 105 control individuals were enrolled. The participants underwent clinical examination and molecular screening for TPO mutation. The hypoechoic thyroid nodules underwent fine needle aspiration biopsy. The mutation c.2268-2269 insT was detected in the four family members with normal thyroid hormone levels. The other two members harbored the c.2090 G>A mutation. The heterozygotes had degeneratively hypoechoic thyroid nodules. The control individuals showed no mutation. The maternal grandfather developed a multifocal papillary thyroid carcinoma with lymph gland and nerve invasion in the left lobe of the thyroid gland. The maternal grandfather harbored the TPO c.2268-2269 insT mutation but without BRAFV600E mutation. Malignant cells were not observed in other members by fine needle aspiration biopsy. TPO genetic variants may be associated with thyroid carcinoma and hypoechoic thyroid nodules in a few cases. Long-term follow-up in the pedigree with congenital goiter is reasonable.

  6. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé

    2006-10-01

    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  7. Mutations in the MESP2 Gene Cause Spondylothoracic Dysostosis/Jarcho-Levin Syndrome

    Science.gov (United States)

    Cornier, Alberto S.; Staehling-Hampton, Karen; Delventhal, Kym M.; Saga, Yumiko; Caubet, Jean-Francois; Sasaki, Nobuo; Ellard, Sian; Young, Elizabeth; Ramirez, Norman; Carlo, Simon E.; Torres, Jose; Emans, John B.; Turnpenny, Peter D.; Pourquié, Olivier

    2008-01-01

    Spondylothoracic dysostosis (STD), also known as Jarcho-Levin syndrome (JLS), is an autosomal-recessive disorder characterized by abnormal vertebral segmentation and defects affecting spine formation, with complete bilateral fusion of the ribs at the costovertebral junction producing a “crab-like” configuration of the thorax. The shortened spine and trunk can severely affect respiratory function during early childhood. The condition is prevalent in the Puerto Rican population, although it is a panethnic disorder. By sequencing a set of candidate genes involved in mouse segmentation, we identified a recessive E103X nonsense mutation in the mesoderm posterior 2 homolog (MESP2) gene in a patient, of Puerto Rican origin and from the Boston area, who had been diagnosed with STD/JLS. We then analyzed 12 Puerto Rican families with STD probands for the MESP2 E103X mutation. Ten patients were homozygous for the E103X mutation, three patients were compound heterozygous for a second nonsense mutation, E230X, or a missense mutation, L125V, which affects a conserved leucine residue within the bHLH region. Thus, all affected probands harbored the E103X mutation. Our findings suggest a founder-effect mutation in the MESP2 gene as a major cause of the classical Puerto Rican form of STD/JLS. PMID:18485326

  8. Mutations of the SH3BP2 gene in 2 families of cherubism.

    Science.gov (United States)

    Tuna, Elif Bahar; Shimizu, Takehiko; Seymen, Figen; Yildirim, Mine; Gencay, Koray; Maeda, Takahide

    2012-01-01

    Cherubism is a rare autosomal dominant syndrome characterized by abnormal bone tissue in the lower part of the face. Mutations in the gene coding for SH3BP2 have been identified in about 80% of people with cherubism. The aim of this study was to determine whether a mutation in the SH3BP2 gene was the molecular basis of cherubism in two unrelated families. Two cases of the aggressive form of Cherubism were described in two Turkish families with extensive bilateral swelling in the mandible, typical pathological features and familial history. Genomic DNA was extracted from six affected and three unaffected individuals from two families, and mutations in the SH3BP2 were detected by PCR, and direct DNA sequencing was carried out. In the first family, a missense mutation Arg415Gln was found in exon 9 of the SH3BP2 in all affected individuals. The unaffected individuals did not have this mutation. In the second family, another missense mutation Pro418Thr was identified in exon 9 of the SH3BP2 in the patient and his mother with cherubism. We detected the point mutations in the SH3BP2 gene in the patients with multiple affected individuals. Genotype-phenotype association studies in individuals with cherubism are necessary to provide important knowledge about molecular mechanisms of the disease.

  9. R102W mutation in the RS1 gene responsible for retinoschisis and recurrent glaucoma

    Directory of Open Access Journals (Sweden)

    Xiu-Feng Huang

    2014-02-01

    Full Text Available AIM: To identify the mutations in RS1 gene associated with typical phenotype of X-linked juvenile retinoschisis (XLRS and a rare condition of concomitant glaucoma.METHODS: Complete ophthalmic examinations were performed in the proband. The coding regions of the RS1 gene that encode retinoschisin were amplified by polymerase chain reaction and directly sequenced.RESULTS: The proband showed a typical phenotype of XLRS with large peripheral retinal schisis in both eyes, involving the macula and combined with foveal cystic change, reducing visual acuity. A typical phenotype of recurrent glaucoma with high intraocular pressure (IOP and reduced visual field was also demonstrated with the patient. Mutation analysis of RS1 gene revealed R102W (c.304C>T mutations in the affected male, and his mother was proved to be a carrier with the causative mutation and another synonymous polymorphism (c.576C>CT.CONCLUSION: We identified the genetic variations of a Chinese family with typical phenotype of XLRS and glaucoma. The severe XLRS phenotypes associated with R102W mutations reveal that the mutation determines a notable alteration in the function of the retinoschisin protein. Identification of the disease-causing mutation is beneficial for future clinical references.

  10. A novel frameshift mutation in the lipoprotein lipase gene is rescued by alternative messenger RNA splicing.

    Science.gov (United States)

    Laurie, Andrew D; Kyle, Campbell V

    Type I hyperlipoproteinemia, manifesting as chylomicronemia and severe hypertriglyceridemia, is a rare autosomal recessive disorder usually caused by mutations in the lipoprotein lipase gene (LPL). We sought to determine whether mutations in LPL could explain the clinical indications of a patient presenting with pancreatitis and hypertriglyceridemia. Coding regions of LPL were amplified by polymerase chain reaction and analyzed by nucleotide sequencing. The LPL messenger RNA transcript was also analyzed to investigate whether alternative splicing was occurring. The patient was homozygous for the mutation c.767_768insTAAATATT in exon 5 of the LPL gene. This mutation is predicted to result in either a truncated nonfunctional LPL, or alternatively a new 5' donor splice site may be used, resulting in a full-length LPL with an in-frame deletion of 3 amino acids. Analysis of messenger RNA from the patient showed that the new splice site is used in vivo. Homozygosity for a mutation in the LPL gene was consistent with the clinical findings. Use of the new splice site created by the insertion mutation rescues an otherwise damaging frameshift mutation, resulting in expression of an almost full-length LPL that is predicted to be partially functional. The patient therefore has a less severe form of type I hyperlipoproteinemia than would be expected if she lacked any functional LPL. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  11. Mutational landscape of the human Y chromosome-linked genes ...

    Indian Academy of Sciences (India)

    linked genes (2–8 rounds of duplication), DYZ1 arrays (495–6201copies) and differential expression of , and in the patients' blood were observed. Present work demonstrates the organizational vulnerability of several Y-linked genes ...

  12. Iranian hereditary hemochromatosis patients: Baseline characteristics, laboratory data and gene mutations

    Science.gov (United States)

    Zamani, Farhad; Bagheri, Zohreh; Bayat, Maryam; Fereshtehnejad, Seyed-Mohammad; Basi, Ali; Najmabadi, Hossein; Ajdarkosh, Hossein

    2012-01-01

    Summary Background Hereditary hemochromatosis (HH) is the most common autosomal recessive disorder in white people, characterized by highly abnormal uptake of iron from the gastrointestinal tracts. Recently, mutation studies have focused to detect the genes responsible for HH. Material/Methods In this cross-sectional study, 12 HH patients were recruited, who were referred to Firoozgar Hospital, Tehran, Iran. In addition to the clinical assessments, a complete laboratory evaluation, imaging modalities, histopathologic assessment, atomic absorption spectrophotometry and gene mutation study were performed. The genetic study for HFE gene mutation was examined for all of the patients since 2006, while non-HFE mutation was conducted since December 2010 (only for 1 of them). Results Twelve patients were evaluated consisting of 11 men and 1 woman, with the mean age of 39.58±12.68 yr. The average of atomic iron loads was 13.25±4.83-fold higher than normal standards. Four patients had heterozygotic mutation of H63D (33.3%). There was no significant difference in either the iron load of liver (P=0.927) and heart (P=0.164) or serum concentration of ferritin (P=0.907) and TIBC (P=0.937) between the HFE-mutant and without HFE mutation HH cases. Conclusions In contrast to other studies, C282Y mutation was not detected in any of our Iranian HH patients. Heterozygotic mutations of H63D (HFE) and TFR2 (non-HFE) genes were found to be more common in these patients. Similar to previous reports, these mutations were not found to be significantly associated with severity of presentation in HH patients. PMID:23018356

  13. BRCA1 and BRCA2 Gene Mutations Screening In Sporadic Breast Cancer Patients In Kazakhstan.

    Directory of Open Access Journals (Sweden)

    Ainur R. Akilzhanova

    2013-05-01

    Full Text Available Background: A large number of distinct mutations in the BRCA1 and BRCA2 genes have been reported worldwide, but little is known regarding the role of these inherited susceptibility genes in breast cancer risk among Kazakhstan women. Aim: To evaluate the role of BRCA1/2 mutations in Kazakhstan women presenting with sporadic breast cancer. Methods: We investigated the distribution and nature of polymorphisms in BRCA1 and BRCA2 entire coding regions in 156 Kazakhstan sporadic breast cancer cases and 112 age-matched controls using automatic direct sequencing. Results: We identified 22 distinct variants, including 16 missense mutations and 6 polymorphisms in BRCA1/2 genes. In BRCA1, 9 missense mutations and 3 synonymous polymorphisms were observed. In BRCA2, 7 missense mutations and 3 polymorphisms were detected. There was a higher prevalence of observed mutations in Caucasian breast cancer cases compared to Asian cases (p<0.05; higher frequencies of sequence variants were observed in Asian controls. No recurrent or founder mutations were observed in BRCA1/2 genes. There were no statistically significant differences in age at diagnosis, tumor histology, size of tumor, and lymph node involvement between women with breast cancer with or without the BRCA sequence alterations. Conclusions: Considering the majority of breast cancer cases are sporadic, the present study will be helpful in the evaluation of the need for the genetic screening of BRCA1/2 mutations and reliable genetic counseling for Kazakhstan sporadic breast cancer patients. Evaluation of common polymorphisms and mutations and breast cancer risk in families with genetic predisposition to breast cancer is ongoing in another current investigation. 

  14. Genetic mosaicism of a frameshift mutation in the RET gene in a family with Hirschsprung disease.

    Science.gov (United States)

    Müller, Charlotte M; Haase, Michael G; Kemnitz, Ivonne; Fitze, Guido

    2014-05-10

    Mutations and polymorphisms in the RET gene are a major cause of Hirschsprung disease (HSCR). Theoretically, all true heterozygous patients with a new manifestation of a genetically determined disease must have parents with a genetic mosaicism of some extent. However, no genetic mosaicism has been described for the RET gene in HSCR yet. Therefore, we analyzed families with mutations in the RET gene for genetic mosaicism in the parents of the patients. Blood samples were taken from patients with HSCR and their families/parents to sequence the RET coding region. Among 125 families with HSCR, 33 families with RET mutations were analyzed. In one family, we detected a frameshift mutation due to a loss of one in a row of four cytosines in codon 117/118 of the RET gene (c.352delC) leading to a frameshift mutation in the protein (p.Leu118Cysfs*105) that affected two siblings. In the blood sample of the asymptomatic father we found a genetic mosaicism of this mutation which was confirmed in two independent samples of saliva and hair roots. Quantification of peak-heights and comparison with different mixtures of normal and mutated plasmid DNA suggested that the mutation occurred in the early morula stadium of the founder, between the 4- and 8-cell stages. We conclude that the presence of a RET mutation leading to loss of one functional allele in 20 to 25% of the cells is not sufficient to cause HSCR. The possibility of a mosaicism has to be kept in mind during genetic counseling for inherited diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Mutation analysis of COL4A3 and COL4A4 genes in a Chinese ...

    Indian Academy of Sciences (India)

    Autosomal dominant Alport syndrome (ADAS) accounts for 5% of all cases of Alport syndrome (AS), a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family.Mutationsin COL4A3 and COL4A4 genes were reported to be associated with ADAS. In this study, clinical ...

  16. Identification of mutations in Iranian patientsв€™ DAX-1 gene with X ...

    African Journals Online (AJOL)

    Mahdieh Davoodnejad

    2016-07-21

    Jul 21, 2016 ... NR0B1 gene, DSS (dosage sensitive sex)-AHC vital region on the X-gene 1. Subjects and methods: In the present study, the (dosage-sensitive, sex reversal, adrenal hypopla- sia congenital, important region on ..... effect of L262Q on DAX1 protein and pathogenesis of AHC. A de novo deletion mutation is a ...

  17. Exome Analyses of Long QT Syndrome Reveal Candidate Pathogenic Mutations in Calmodulin-Interacting Genes

    Science.gov (United States)

    Nakagawa, Hidewaki; Ozaki, Kouichi; Miya, Fuyuki; Satake, Wataru; Toda, Tatsushi; Miyamoto, Yoshihiro; Fujimoto, Akihiro; Suzuki, Yutaka; Kubo, Michiaki; Tsunoda, Tatsuhiko; Shimizu, Wataru; Tanaka, Toshihiro

    2015-01-01

    Long QT syndrome (LQTS) is an arrhythmogenic disorder that can lead to sudden death. To date, mutations in 15 LQTS-susceptibility genes have been implicated. However, the genetic cause for approximately 20% of LQTS patients remains elusive. Here, we performed whole-exome sequencing analyses on 59 LQTS and 61 unaffected individuals in 35 families and 138 unrelated LQTS cases, after genetic screening of known LQTS genes. Our systematic analysis of familial cases and subsequent verification by Sanger sequencing identified 92 candidate mutations in 88 genes for 23 of the 35 families (65.7%): these included eleven de novo, five recessive (two homozygous and three compound heterozygous) and seventy-three dominant mutations. Although no novel commonly mutated gene was identified other than known LQTS genes, protein-protein interaction (PPI) network analyses revealed ten new pathogenic candidates that directly or indirectly interact with proteins encoded by known LQTS genes. Furthermore, candidate gene based association studies using an independent set of 138 unrelated LQTS cases and 587 controls identified an additional novel candidate. Together, mutations in these new candidates and known genes explained 37.1% of the LQTS families (13 in 35). Moreover, half of the newly identified candidates directly interact with calmodulin (5 in 11; comparison with all genes; p=0.042). Subsequent variant analysis in the independent set of 138 cases identified 16 variants in the 11 genes, of which 14 were in calmodulin-interacting genes (87.5%). These results suggest an important role of calmodulin and its interacting proteins in the pathogenesis of LQTS. PMID:26132555

  18. Profile of TP53 gene mutations in sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Bornholdt, Jette; Suitiala, Tuula

    2010-01-01

    Genetic alterations underlying the development of the cancer of the nose and paranasal sinuses (sinonasal cancer, SNC), a rare cancer that can be included in the group of head and neck cancers, are still largely unknown. We recently reported that TP53 mutations are a common feature of SNC, with a...

  19. Two novel missense mutations in bovine ATGL gene and their ...

    African Journals Online (AJOL)

    Adipose triglyceride lipase (ATGL) as a triglyceride-specific lipase, plays a key role in the triglyceride liposis mobilization of fat tissue. In this study, based on the pyrosequencing technology, two novel missense mutations were identified, which were 3289 G>C in exon 6 bringing E277Q and 3514 A>T in exon 7 bringing ...

  20. RET gene mutations and polymorphisms in medullary thyroid ...

    Indian Academy of Sciences (India)

    Further, 39 family members of seven index cases were analysed, wherein four of the seven index cases showed identical mutations, in 13 of 25 family members. We also examined ... D Saranath1. Molecular Medicine, Reliance Life Sciences Pvt Ltd, Dhirubhai Ambani Life Sciences Center, Navi Mumbai 400 701, India ...

  1. Frequency of mutations in Mediterranean fever gene, with gender ...

    Indian Academy of Sciences (India)

    phenotype correlations in a Turkish population. Salih Coskun, Serkan Kurtgöz, Ece Keskin, Ferah Sönmez and Gökay Bozkurt. J. Genet. 94, 629–635. Table 1. Whole data of genotype–phenotype correlations of M694V mutations. M694V/ ...

  2. Oncological implications of RET gene mutations in Hirschsprung's disease

    NARCIS (Netherlands)

    Sijmons, RH; Hofstra, RMW; Wijburg, FA; Links, TP; Zwierstra, RP; Vermey, A; Aronson, DC; Tan-Sindhunata, G; Brouwers-Smalbraak, GJ; Maas, SM; Buys, CHCM

    1998-01-01

    Background-Germline mutations of the RET proto-oncogene identical to those found in the tumour predisposition syndrome multiple endocrine neoplasia type 2A (MEN2A), were detected in 2.5-5% of sporadic and familial cases of Hirschsprung's disease. Some patients with Hirschsprung's disease may

  3. Glutaric acidemia type II: gene structure and mutations of the electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) gene.

    Science.gov (United States)

    Goodman, Stephen I; Binard, Robert J; Woontner, Michael R; Frerman, Frank E

    2002-01-01

    Glutaric acidemia type II is a human inborn error of metabolism which can be due to defects in either subunit of electron transfer flavoprotein (ETF) or in ETF:ubiquinone oxidoreductase (ETF:QO), but few disease-causing mutations have been described. The ETF:QO gene is located on 4q33, and contains 13 exons. Primers to amplify these exons are presented, together with mutations identified by molecular analysis of 20 ETF:QO-deficient patients. Twenty-one different disease-causing mutations were identified on 36 of the 40 chromosomes.

  4. Mutations of the tyrosinase gene in Indo-Pakistani patients with type I (tyrosinase-deficient) oculocutaneous albinsm (OCA)

    Energy Technology Data Exchange (ETDEWEB)

    Tripathi, R.K.; Droetto, S.; Strunk, K.M.; Holmes, S.A.; Spritz, R.A. (Univ. of Wisconsin, Madison, WI (United States)); Bundey, S.; Musarella, M.A.

    1993-12-01

    Oculocutaneous albinism (OCA) is a group of autosomal recessive disorders characterized by deficient synthesis of melanin pigment. Type I (tyrosinase-deficient) OCA results from mutations of the tyrosinase gene (TYR gene) encoding tyrosinase, the enzyme that catalyzes the first two steps of melanin biosynthesis. Mutations of the TYR gene have been identified in a large number of patients, most of Caucasian ethnic origin, with various forms of type I OCA. The authors present an analysis of the TYR gene in eight Indo-Pakistani patients with type I OCA. The authors describe four novel TYR gene mutations and a fifth mutation previously observed in a Caucasian patient. 16 refs., 6 figs.

  5. Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    Directory of Open Access Journals (Sweden)

    M Syaifudin

    2006-07-01

    Full Text Available Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis after deoxyribonucleic acid (DNA damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. p53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pairchanges (point mutations, which result in amino acid substitutionsor truncated forms of the P53 protein, and are widely distributedthroughout the evolutionarily conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular

  6. OncoSimulR: genetic simulation with arbitrary epistasis and mutator genes in asexual populations.

    Science.gov (United States)

    Diaz-Uriarte, Ramon

    2017-06-15

    OncoSimulR implements forward-time genetic simulations of biallelic loci in asexual populations with special focus on cancer progression. Fitness can be defined as an arbitrary function of genetic interactions between multiple genes or modules of genes, including epistasis, restrictions in the order of accumulation of mutations, and order effects. Mutation rates can differ among genes, and can be affected by (anti)mutator genes. Also available are sampling from simulations (including single-cell sampling), plotting the genealogical relationships of clones and generating and plotting fitness landscapes. Implemented in R and C ++, freely available from BioConductor for Linux, Mac and Windows under the GNU GPL license. Version 2.5.9 or higher available from: http://www.bioconductor.org/packages/devel/bioc/html/OncoSimulR.html . GitHub repository at: https://github.com/rdiaz02/OncoSimul. ramon.diaz@iib.uam.es. Supplementary data are available at Bioinformatics online.

  7. A mutation in the MATP gene causes the cream coat colour in the horse

    Directory of Open Access Journals (Sweden)

    Guérin Gérard

    2003-01-01

    Full Text Available Abstract In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our data suggest that the causal mutation, a G to A transition, is localised in exon 2 of the MATP gene leading to an aspartic acid to asparagine substitution in the encoded protein. This conserved mutation was also described in mice and humans, but not in medaka.

  8. A mutation in the MATP gene causes the cream coat colour in the horse.

    Science.gov (United States)

    Mariat, Denis; Taourit, Sead; Guérin, Gérard

    2003-01-01

    In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our data suggest that the causal mutation, a G to A transition, is localised in exon 2 of the MATP gene leading to an aspartic acid to asparagine substitution in the encoded protein. This conserved mutation was also described in mice and humans, but not in medaka.

  9. Novel CHST6 gene mutations in 2 unrelated cases of macular corneal dystrophy.

    Science.gov (United States)

    Patel, Dhara A; Harocopos, George J; Chang, Shu-Hong; Vora, Smita C; Lubniewski, Anthony J; Huang, Andrew Jw

    2011-06-01

    To investigate the possible mutations in the carbohydrate sulfotransferase 6 (CHST6) gene of 2 unrelated cases of macular corneal dystrophy (MCD) and to report atypical stromal deposits in one of them. Corneal tissues were stained with antisulfated keratan sulfate (KS), antitransforming growth factor beta 1-induced protein (TGFBIp), thioflavin-T, alcian blue, and Masson trichrome. Sequencing was performed to identify potential mutations in the CHST6 gene and the fourth and twelfth exons of the TGFBI gene. Alcian blue staining revealed the presence of multiple subepithelial and intrastromal mucopolysaccharide deposits, confirming the diagnosis of MCD in both cases. Immunofluorescence staining in case 1 revealed the presence of sulfated KS only in the keratocytes and select endothelial cells, consistent with MCD type IA. Preferential expression of sulfated KS was observed in keratocytes and extracellular stromal matrix in case 2, consistent with MCD type II. Atypical subepithelial and superficial stromal deposits were observed in case 1, which stained positively with alcian blue, eosin, Masson trichrome, and thioflavin-T indicating the presence of hyaline and amyloid materials. CHST6 gene sequencing revealed 2 heterozygous mutations in case 1 (a p.Arg211Gln and a novel mutation of p.Arg177Gly) and a novel homozygous mutation of p.Pro186Arg in case 2. No mutations were found in exons 4 or 12 of the TGFBI gene in case 1. Secondary hyalinosis and amyloidosis occur in a case of MCD type IA with a novel p.Arg177Gly mutation in CHST6. A novel p.Pro186Arg mutation in CHST6 is associated with MCD type II in an African American.

  10. Clinical and Prognostic Profiles of Cardiomyopathies Caused by Mutations in the Troponin T Gene.

    Science.gov (United States)

    Ripoll-Vera, Tomás; Gámez, José María; Govea, Nancy; Gómez, Yolanda; Núñez, Juana; Socías, Lorenzo; Escandell, Ángela; Rosell, Jorge

    2016-02-01

    Mutations in the troponin T gene (TTNT2) have been associated in small studies with the development of hypertrophic cardiomyopathy characterized by a high risk of sudden death and mild hypertrophy. We describe the clinical course of patients carrying mutations in this gene. We analyzed the clinical characteristics and prognosis of patients with mutations in the TNNT2 gene who were seen in an inherited cardiac disease unit. Of 180 families with genetically studied cardiomyopathies, 21 families (11.7%) were identified as having mutations in TNNT2: 10 families had Arg92Gln, 5 had Arg286His, 3 had Arg278Cys, 1 had Arg92Trp, 1 had Arg94His, and 1 had Ile221Thr. Thirty-three additional genetic carriers were identified through family assessment. The study included 54 genetic carriers: 56% were male, and the mean average age was 41 ± 17 years. There were 33 cases of hypertrophic cardiomyopathy, 9 of dilated cardiomyopathy, and 1 of noncompaction cardiomyopathy, and maximal myocardial thickness was 18.5 ± 6mm. Ventricular dysfunction was present in 30% of individuals and a history of sudden death in 62%. During follow-up, 4 patients died and 14 (33%) received a defibrillator (8 probands, 6 relatives). Mean survival was 54 years. Carriers of Arg92Gln had early disease development, high penetrance, a high risk of sudden death, a high rate of defibrillator implantation, and a high frequency of mixed phenotype. Mutations in the TNNT2 gene were more common in this series than in previous studies. The clinical and prognostic profiles depended on the mutation present. Carriers of the Arg92Gln mutation developed hypertrophic or dilated cardiomyopathy and had a significantly worse prognosis than those with other mutations in TNNT2 or other sarcomeric genes. Copyright © 2015 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  11. Mutation survey of known LCA genes and loci in the Saudi Arabian population.

    Science.gov (United States)

    Li, Yumei; Wang, Hui; Peng, Jianlan; Gibbs, Richard A; Lewis, Richard Alan; Lupski, James R; Mardon, Graeme; Chen, Rui

    2009-03-01

    The purpose of this study was to perform a comprehensive survey of all known Leber congenital amaurosis (LCA) genes and loci in a collection of 37 consanguineous LCA families from Saudi Arabia. Direct PCR and sequencing were used to screen 13 known LCA genes (GUCY2D, CRX, RPE65, TULP1, AIPL1, CRB1, RPGRIP1, LRAT, RDH12, IMPDH1, CEP290, RD3, LCA5). In addition, families without mutations identified were further screened with STR markers around these 13 known LCA genes and two loci. Disease-causing mutations were identified in nine of the 37 families: five in TULP1, two in CRB1, one in RPE65, and one in GUCY2D. Mutations in known genes only accounted for 24% of the Saudi families--much less than what has been observed in the European population (65%). Phenotype-genotype analysis was carried out to investigate the LCA disease penetrance for all families whose mutations identified. All identified mutations were found to segregate perfectly with the disease phenotype. On the other hand, severity of the disease varies for different patients carrying the same mutation and even within the same family. Furthermore, based on homozygosity mapping with both STR and SNP markers, one family is likely to map to the LCA3 locus. These results underscore the importance of studying LCA disease families from different ethnic backgrounds to identify additional novel LCA disease genes. Furthermore, perfect segregation between mutation and disease indicates that LCA is fully penetrant. However, phenotypic variations among patients carrying the same mutation suggest that at least some of the variations in the clinical phenotype is due to modification from the genetic background, environment, or other factors.

  12. Molecular analysis of mutations in the CSB (ERCC6) gene in patients with Cockayne syndrome.

    Science.gov (United States)

    Mallery, D L; Tanganelli, B; Colella, S; Steingrimsdottir, H; van Gool, A J; Troelstra, C; Stefanini, M; Lehmann, A R

    1998-01-01

    Cockayne syndrome is a multisystem sun-sensitive genetic disorder associated with a specific defect in the ability to perform transcription-coupled repair of active genes after UV irradiation. Two complementation groups (CS-A and CS-B) have been identified, and 80% of patients have been assigned to the CS-B complementation group. We have analyzed the sites of the mutations in the CSB gene in 16 patients, to determine the spectrum of mutations in this gene and to see whether the nature of the mutation correlates with the type and severity of the clinical symptoms. In nine of the patients, the mutations resulted in truncated products in both alleles, whereas, in the other seven, at least one allele contained a single amino acid change. The latter mutations were confined to the C-terminal two-thirds of the protein and were shown to be inactivating by their failure to restore UV-irradiation resistance to hamster UV61 cells, which are known to be defective in the CSB gene. Neither the site nor the nature of the mutation correlated with the severity of the clinical features. Severe truncations were found in different patients with either classical or early-onset forms of the disease.

  13. A "dose" effect of mutations in the GBA gene on Parkinson's disease phenotype.

    Science.gov (United States)

    Thaler, Avner; Gurevich, Tanya; Bar Shira, Anat; Gana Weisz, Mali; Ash, Elissa; Shiner, Tamara; Orr-Urtreger, Avi; Giladi, Nir; Mirelman, Anat

    2017-03-01

    Mutations in the GBA gene are associated with Parkinson's disease (PD). A definite description of the clinical characteristics of PD patients who are compound heterozygotes or homozygotes for mutations in the GBA gene (GD-PD) requires further elucidation. We assessed motor, cognitive, olfactory and autonomic functions as well as demographic data and medical history in a cohort of Ashkenazi Jewish PD patients who were screened for seven common mutations in the GBA gene. We then compared three groups of patients (matched for age and disease duration) who were distinguished by their GBA mutation status, idiopathic PD (iPD), GBA heterozygote PD (GBA-PD) and GD-PD. Out of a total of 1050 AJ PD patients screened, 12 were found to be either homozygotes or compound heterozygotes for mutations in the GBA gene. These patients had an earlier age of onset, more severe motor impairment, poorer cognition and lower olfactory scores. They also had a higher prevalence of REM sleep behavior disorder and higher frequencies of hallucinations compared to both GBA-PD and iPD. The severity of PD phenotype is related to the burden of GBA mutations with GD-PD patients manifesting a more severe phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Mutations of the ANG gene in French patients with sporadic amyotrophic lateral sclerosis.

    Science.gov (United States)

    Paubel, Agathe; Violette, Jeremy; Amy, Maïté; Praline, Julien; Meininger, Vincent; Camu, William; Corcia, Philippe; Andres, Christian R; Vourc'h, Patrick

    2008-10-01

    Mutations in the angiogenin gene, ANG, have been associated recently with familial and sporadic forms of amyotrophic lateral sclerosis (ALS). However, the cellular and molecular mechanisms that link ANG, a multidomain protein, to ALS are still unknown. To assess the frequency of ANG gene mutations in 855 French patients with sporadic ALS. We analyzed by direct sequencing the full coding region of the ANG gene in a cohort of French patients with sporadic ALS. The clinical characteristics of patients carrying ANG mutations are detailed. French ALS Study Group. Patients A total of 855 patients with sporadic ALS. Results of genetic analyses. We observed a previously identified mutation (pI46V) in 2 patients with ALS without a known family link and found a novel mutation (pR121H) in 1 patient who developed ALS with rapid progression. We did not observe an association between patients with ALS and the rs11701 polymorphism, as previously reported in certain ALS populations of other ethnic origins. Overall, our findings support the implication of ANG gene mutations as a rare but widespread cause of ALS.

  15. Association of MTHFR gene C677T mutation with diabetic peripheral neuropathy and diabetic retinopathy.

    Science.gov (United States)

    Yigit, Serbulent; Karakus, Nevin; Inanir, Ahmet

    2013-01-01

    Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications. Methylenetetrahydrofolate reductase (MTHFR) gene variants have been associated with vasculopathy that has been linked to diabetic neuropathy. The aim of the present study was to investigate the possible association between MTHFR gene C677T mutation and DPN and evaluate if there is an association with clinical features in a relatively large cohort of Turkish patients. The study included 230 patients affected by DPN and 282 healthy controls. Genomic DNA was isolated and genotyped using the polymerase chain reaction-based restriction fragment length polymorphism assay for the MTHFR gene C677T mutation. The genotype and allele frequencies of the C677T mutation showed statistically significant differences between the patients with DPN and the controls (p=0.003 and p=0.002, respectively). After the patients with DPN were stratified according to clinical and demographic characteristics, a significant association was observed between the C677T mutation and history of retinopathy (p=0.039). A high association between the MTHFR gene C677T mutation and DPN was observed in the present study. In addition, history of retinopathy was associated with the MTHFR C677T mutation in patients with DPN.

  16. A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

    Science.gov (United States)

    Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

    2015-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

  17. Mutations in the desmoglein 1 gene in five Pakistani families with striate palmoplantar keratoderma

    Science.gov (United States)

    Dua-Awereh, Martha B.; Shimomura, Yutaka; Kraemer, Liv; Wajid, Muhammad; Christiano, Angela M.

    2012-01-01

    Summary Background Striate palmoplantar keratoderma (SPPK; OMIM #148700) is a rare autosomal dominant genodermatosis characterized by linear hyperkeratosis on the digits and hyperkeratosis on the palms and soles. SPPK is known to be caused by heterozygous mutations in either the desmoglein 1 (DSG1), desmoplakin (DSP), or keratin 1 (KRT1) genes. Objective To define the molecular basis of SPPK in five Pakistani families showing a clear autosomal dominant inheritance pattern of SPPK. Methods Based on previous reports of DSG1 mutations in SPPK, we performed direct sequencing of the DSG1 gene of all five families. Results Mutation analysis resulted in the identification of one recurrent mutation (p.R26X) and four novel mutations (c.Ivs4-2A>G, c.515C>T, c.Ivs9-3C>G, and c.1399delA) in the DSG1 gene. Each mutation is predicted to cause haploinsufficiency of DSG1 protein. Conclusion The results of our study further underscore the significance of the desmoglein gene family in diseases of epidermal integrity. PMID:19157795

  18. TP53 and FGFR3 Gene Mutation Assessment in Urine: Pilot Study for Bladder Cancer Diagnosis.

    Science.gov (United States)

    Noel, Nicolas; Couteau, Jerome; Maillet, Geraldine; Gobet, Françoise; D'Aloisio, Françoise; Minier, Christophe; Pfister, Christian

    2015-09-01

    To assess, in a prospective clinical research study, a new non-invasive and reliable test to accurately detect tumor protein 53 (TP53) and fibroblast growth factor receptor-3 (FGFR3) mutations in cells in urine. TP53 mutations were analyzed using the functional analysis of separated allele in yeast (FASAY) method, which allows functional analysis of the P53 protein, and FGFR3 mutations were assessed with the SNaPshot system, detecting the eight most frequent point-mutations of this gene. Chi-square test or Fisher's exact test were used to compare TP53 and FGFR3 mutations in the tumors according to tumor stage and grade. TP53 and FGFR3 mutations in bladder tumors increased and decreased respectively with increasing tumor stage and cellular grade (pFGFR3 mutations were observed in 76 tumors. The sensitivity for the detection of this type of mutation in urine was 46%, the specificity was 81%, the positive predictive value was 94% and the negative predictive value was 37%. Our original data confirmed the feasibility of TP53 and FGFR3 mutation detection in urine sediment. These measurements, together with urine cytology, may increase tumor detection. The sensitivity of the TP53/FGFR3 phenotype test in the urine was less than 50% and was not able to replace standard cystoscopy in the diagnosis of bladder tumors. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  19. Spectrum and prevalence of FP/TMEM127 gene mutations in pheochromocytomas and paragangliomas.

    Science.gov (United States)

    Yao, Li; Schiavi, Francesca; Cascon, Alberto; Qin, Yuejuan; Inglada-Pérez, Lucia; King, Elizabeth E; Toledo, Rodrigo A; Ercolino, Tonino; Rapizzi, Elena; Ricketts, Christopher J; Mori, Luigi; Giacchè, Mara; Mendola, Antonella; Taschin, Elisa; Boaretto, Francesca; Loli, Paola; Iacobone, Maurizio; Rossi, Gian-Paolo; Biondi, Bernadette; Lima-Junior, José Viana; Kater, Claudio E; Bex, Marie; Vikkula, Miikka; Grossman, Ashley B; Gruber, Stephen B; Barontini, Marta; Persu, Alexandre; Castellano, Maurizio; Toledo, Sergio P A; Maher, Eamonn R; Mannelli, Massimo; Opocher, Giuseppe; Robledo, Mercedes; Dahia, Patricia L M

    2010-12-15

    Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P = 2.7 × 10(-4)) and/or with familial disease (5 of 20 samples; P = .005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P = .54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Germline mutations of FP/TMEM127 were associated with pheochromocytoma but

  20. ANALYSIS OF MUTATIONS IN KRAS AND BRAF GENES IN COLORECTAL CANCER IN RUSSIAN PATIENTS

    Directory of Open Access Journals (Sweden)

    E. E. Pisareva

    2016-01-01

    Full Text Available Mutations in KRAS and BRAF genes in 80 colorectal cancer (CRC samples from Russian patients were tested using two methods: 1 allele-specific real-time PCR (as-rt PCR and 2 wild-type blocking PCR with Sanger sequencing (WTBS. Material and methods. Sections of fresh frozen or formalin-fixed paraffin embedded tumor tissue from 80 patients were used in the study. Tumor tissue content was determined on H&E stained sections. Samples were first tested by as-rtPCR for common mutations of the KRAS gene (G12C, G12S, G12R, G12V, G12D, G12A, G13D and mutations BRAFV600E. After that samples were evaluated in PCR with oligonucleotide blocking amplification of wild-type DNA for enrichment with mutant allele followed by Sanger sequencing of the PCR DNA (WTBS method. Results. In 5 (6.3 % cases samples had low tumor tissue content (<20 %. In reconstruction experiments both methods detected 1–5 % mutant allele. Mutations of KRAS and BRAF genes were found in 37 (46 % and 3 (3.8 % of the clinical cases, respectively. Classification in to wild-type and mutant samples by both methods was in agreement in 79 (98.8 % cases. A single case with rare mutation KRASG13R was detected by WTBS, but was missed by as-rtPCR since this mutation is not included in the test. Of note, KRAS mutations were detected by both tests in two cases with low tumor content. Two cases were found with multiple mutations: one with KRASG12V and G13D, and one with KRASG13D and BRAFV600E. Conclusion. The frequency of mutations in CRC was 46 % for mutations in the KRAS gene, and 3.8 % for the BRAF. We showed 98.8% agreement in KRAS mutation detection by sensitive Sanger sequencing and as-rt PCR. The data on the frequencies of mutations are in agreement with studies in other countries. This in the first study to discover CRC case with multiple mutations KRASG13D and BRAFV600E.

  1. A de-novo STXBP1 gene mutation in a patient showing the Rett syndrome phenotype.

    Science.gov (United States)

    Romaniello, Romina; Saettini, Francesco; Panzeri, Elena; Arrigoni, Filippo; Bassi, Maria T; Borgatti, Renato

    2015-03-25

    This study reports on a 9-year-old girl who developed West syndrome and showed clinical features fulfilling the main revised diagnostic criteria for typical Rett syndrome (hand washing, severe cognitive impairment with absence of language, ataxic gait, progressive scoliosis and autistic features). Mutation analyses for methyl-CpG-binding protein 2 (MECP2), cyclin-dependent kinase-like 5 (CDKL5/STK9), ARX and Forkhead box G1 (FOXG1) genes were carried out, with negative results. A known de-novo c.1217G>A missense mutation in exon 14 leading to the substitution of a conserved residue, p.R406H in domain3b of the syntaxin-binding protein 1 (STXBP1) gene, was detected. The STXBP1 gene encodes the syntaxin-binding protein 1, a neuron-specific protein involved in synaptic vesicle release at both glutaminergic and GABAergic synapses. This function is also affected by MECP2 gene mutations, which are known to lead to a decrease in glutamate and GABA receptors' density. It is possible to speculate that the impairment in synaptic plasticity represents the pathogenic link between MECP2 and STXBP1 gene mutations. On reviewing the clinical features of the reported patients with the same mutation in the STXBP1 gene, it has been observed that poor eye contact, tremour, dyskinesia, head/hand stereotypies and both cognitive and motor progressive deterioration are common symptoms, although never considered as indicative of a Rett syndrome phenotype. In conclusion, the case described here suggests a relationship between the Rett syndrome and the STXBP1 gene not described so far, making the search for STXBP1 gene mutations advisable in patients with Rett syndrome and early onset of epilepsy. Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.

  2. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

    Directory of Open Access Journals (Sweden)

    Paulo Lisboa Bittencourt

    2009-01-01

    Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  3. DeepGene: an advanced cancer type classifier based on deep learning and somatic point mutations.

    Science.gov (United States)

    Yuan, Yuchen; Shi, Yi; Li, Changyang; Kim, Jinman; Cai, Weidong; Han, Zeguang; Feng, David Dagan

    2016-12-23

    With the developments of DNA sequencing technology, large amounts of sequencing data have become available in recent years and provide unprecedented opportunities for advanced association studies between somatic point mutations and cancer types/subtypes, which may contribute to more accurate somatic point mutation based cancer classification (SMCC). However in existing SMCC methods, issues like high data sparsity, small volume of sample size, and the application of simple linear classifiers, are major obstacles in improving the classification performance. To address the obstacles in existing SMCC studies, we propose DeepGene, an advanced deep neural network (DNN) based classifier, that consists of three steps: firstly, the clustered gene filtering (CGF) concentrates the gene data by mutation occurrence frequency, filtering out the majority of irrelevant genes; secondly, the indexed sparsity reduction (ISR) converts the gene data into indexes of its non-zero elements, thereby significantly suppressing the impact of data sparsity; finally, the data after CGF and ISR is fed into a DNN classifier, which extracts high-level features for accurate classification. Experimental results on our curated TCGA-DeepGene dataset, which is a reformulated subset of the TCGA dataset containing 12 selected types of cancer, show that CGF, ISR and DNN all contribute in improving the overall classification performance. We further compare DeepGene with three widely adopted classifiers and demonstrate that DeepGene has at least 24% performance improvement in terms of testing accuracy. Based on deep learning and somatic point mutation data, we devise DeepGene, an advanced cancer type classifier, which addresses the obstacles in existing SMCC studies. Experiments indicate that DeepGene outperforms three widely adopted existing classifiers, which is mainly attributed to its deep learning module that is able to extract the high level features between combinatorial somatic point mutations and

  4. Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures

    Science.gov (United States)

    Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

    2014-01-01

    High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5–13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known.     We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations. PMID:24879340

  5. Common Mediterranean Fever (MEFV Gene Mutations Associated with Ankylosing Spondylitis in Turkish Population

    Directory of Open Access Journals (Sweden)

    Serbulent Yigit

    2012-01-01

    Full Text Available Ankylosing spondylitis (AS is a common inflammatory rheumatic disease. Mediterranean fever (MEFV gene, which has already been identified as being responsible for familial Mediterranean fever (FMF, is also a suspicious gene for AS because of the clinical association of these two diseases. The aim of this study was to explore the frequency and clinical significance of MEFV gene mutations (M694V, M680I, V726A, E148Q and P369S in a cohort of Turkish patients with AS. Genomic DNAs of 103 AS patients and 120 controls were isolated and genotyped using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods. There was a statistically significant difference of the MEFV gene mutation carrier rates between AS patients and healthy controls (p = 0.004, OR: 2.5, 95% CI: 1.32–4.76. This association was also observed in allele frequencies (p = 0.005, OR: 2.3, 95% CI: 1.27–4.2. A relatively higher frequency was observed for M694V mutation in AS patients than controls (10.7% versus 4.2% , p = 0.060. There were no significant differences between MEFV mutation carriers and non-carriers with respect to the clinical and demographic characteristics. The results of this study suggest that MEFV gene mutations are positively associated with a predisposition to develop AS.

  6. Mutations in the Motile Cilia Gene DNAAF1 Are Associated with Neural Tube Defects in Humans.

    Science.gov (United States)

    Miao, Chunyue; Jiang, Qian; Li, Huili; Zhang, Qin; Bai, Baoling; Bao, Yihua; Zhang, Ting

    2016-10-13

    Neural tube defects (NTDs) are severe malformations of the central nervous system caused by complex genetic and environmental factors. Among genes involved in NTD, cilia-related genes have been well defined and found to be essential for the completion of neural tube closure (NTC). We have carried out next-generation sequencing on target genes in 373 NTDs and 222 healthy controls, and discovered eight disease-specific rare mutations in cilia-related gene DNAAF1 DNAAF1 plays a central role in cytoplasmic preassembly of distinct dynein-arm complexes, and is expressed in some key tissues involved in neural system development, such as neural tube, floor plate, embryonic node, and brain ependyma epithelial cells in zebrafish and mouse. Therefore, we evaluated the expression and functions of mutations in DNAAF1 in transfected cells to analyze the potential correlation of these mutants to NTDs in humans. One rare frameshift mutation (p.Gln341Argfs*10) resulted in significantly diminished DNAAF1 protein expression, compared to the wild type. Another mutation, p.Lys231Gln, disrupted cytoplasmic preassembly of the dynein-arm complexes in cellular assay. Furthermore, results from NanoString assay on mRNA from NTD samples indicated that DNAAF1 mutants altered the expression level of NTC-related genes. Altogether, these findings suggest that the rare mutations in DNAAF1 may contribute to the susceptibility for NTDs in humans. Copyright © 2016 Miao et al.

  7. Mutations in the Motile Cilia Gene DNAAF1 Are Associated with Neural Tube Defects in Humans

    Directory of Open Access Journals (Sweden)

    Chunyue Miao

    2016-10-01

    Full Text Available Neural tube defects (NTDs are severe malformations of the central nervous system caused by complex genetic and environmental factors. Among genes involved in NTD, cilia-related genes have been well defined and found to be essential for the completion of neural tube closure (NTC. We have carried out next-generation sequencing on target genes in 373 NTDs and 222 healthy controls, and discovered eight disease-specific rare mutations in cilia-related gene DNAAF1. DNAAF1 plays a central role in cytoplasmic preassembly of distinct dynein-arm complexes, and is expressed in some key tissues involved in neural system development, such as neural tube, floor plate, embryonic node, and brain ependyma epithelial cells in zebrafish and mouse. Therefore, we evaluated the expression and functions of mutations in DNAAF1 in transfected cells to analyze the potential correlation of these mutants to NTDs in humans. One rare frameshift mutation (p.Gln341Argfs*10 resulted in significantly diminished DNAAF1 protein expression, compared to the wild type. Another mutation, p.Lys231Gln, disrupted cytoplasmic preassembly of the dynein-arm complexes in cellular assay. Furthermore, results from NanoString assay on mRNA from NTD samples indicated that DNAAF1 mutants altered the expression level of NTC-related genes. Altogether, these findings suggest that the rare mutations in DNAAF1 may contribute to the susceptibility for NTDs in humans.

  8. [An overview of oculocutaneous albinism: TYR gene mutations in five Colombian individuals].

    Science.gov (United States)

    Sanabria, Diana; Groot, Helena; Guzmán, Julio; Lattig, María Claudia

    2012-06-01

    Oculocutaneus albinism is a pigment-related inherited disorder characterized by hypopigmentation of the skin, hair and eyes, foveal hypoplasia and low vision. To date, 230 mutations in the TYR gene have been reported as responsible for oculocutaneus albinism type 1 worldwide. TYR gene encodes the enzyme tyrosinase involved in the metabolic pathway of melanin synthesis. Mutations were identified in the TYR gene as responsible for oculocutaneous albinism type 1 in five Colombian individuals, and a new ophthalmic system was tested that corrected visual defects and symptoms in a patient with oculocutaneous albinism. Samples were taken from 5 individuals, four of whom belong to a single family, along with a fifth individual not related to the family. Five exons in the TYR gene were sequenced to search for the gene carriers in the family and in the non-related individual. In addition, clinical ophthalmological evaluation and implementation of an new oculo-visual system was undertaken. A G47D and 1379delTT mutation was identified in the family. The unrelated individual carried a compound heterozygote for the G47D and D42N mutations. The oculo-visual corrective system was able to increase visual acuity and to diminish the nystagmus and photophobia. This is the first study in Colombia where albinism mutations are reported. The methods developed will enable future molecular screening studies in Colombian populations.

  9. MYH7 gene mutation in myosin storage myopathy and scapulo-peroneal myopathy.

    Science.gov (United States)

    Pegoraro, Elena; Gavassini, Bruno F; Borsato, Carlo; Melacini, Paola; Vianello, Andrea; Stramare, Roberto; Cenacchi, Giovanna; Angelini, Corrado

    2007-04-01

    In order to characterize, at the clinical, molecular and imaging level, myopathies due to MYH7 gene mutations, MYH7 gene analysis was conducted by RT-PCR/SSCP/sequencing in two patients diagnosed with myosin storage myopathy and 17 patients diagnosed with scapulo-peroneal myopathy of unknown etiology. MYH7 gene studies revealed the 5533C>T mutation (Arg1845Trp) in both myosin storage myopathy and in 2 of the 17 scapulo-peroneal patients studied. 5533C>T segregation analysis in the mutation carrier families identified 11 additional patients. The clinical spectrum in our cohort of patients included asymptomatic hyperCKemia, scapulo-peroneal myopathy and proximal and distal myopathy with muscle hypertrophy. Muscle MRI identified a unique pattern in the posterior compartment of the thigh, characterized by early involvement of the biceps femoris and semimembranosus, with relative sparing of the semitendinosus. Muscle biopsy revealed hyaline bodies in only half of biopsied patients (2/4). In conclusion, phenotypic and histopathological variability may underlie MYH7 gene mutation and the absence of hyaline bodies in muscle biopsies does not rule out MYH7 gene mutations.

  10. Mutation spectrum of six genes in Chinese phenylketonuria patients obtained through next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Ying Gu

    Full Text Available BACKGROUND: The identification of gene variants plays an important role in the diagnosis of genetic diseases. METHODOLOGY/PRINCIPAL FINDINGS: To develop a rapid method for the diagnosis of phenylketonuria (PKU and tetrahydrobiopterin (BH4 deficiency, we designed a multiplex, PCR-based primer panel to amplify all the exons and flanking regions (50 bp average of six PKU-associated genes (PAH, PTS, GCH1, QDPR, PCBD1 and GFRP. The Ion Torrent Personal Genome Machine (PGM System was used to detect mutations in all the exons of these six genes. We tested 93 DNA samples from blood specimens from 35 patients and their parents (32 families and 26 healthy adults. Using strict bioinformatic criteria, this sequencing data provided, on average, 99.14% coverage of the 39 exons at more than 70-fold mean depth of coverage. We found 23 previously documented variants in the PAH gene and six novel mutations in the PAH and PTS genes. A detailed analysis of the mutation spectrum of these patients is described in this study. CONCLUSIONS/SIGNIFICANCE: These results were confirmed by Sanger sequencing. In conclusion, benchtop next-generation sequencing technology can be used to detect mutations in monogenic diseases and can detect both point mutations and indels with high sensitivity, fidelity and throughput at a lower cost than conventional methods in clinical applications.

  11. Common Mediterranean Fever (MEFV) Gene Mutations Associated with Ankylosing Spondylitis in Turkish Population

    Science.gov (United States)

    Yigit, Serbulent; Inanir, Ahmet; Karakus, Nevin; Kesici, Esra; Bozkurt, Nihan

    2012-01-01

    Ankylosing spondylitis (AS) is a common inflammatory rheumatic disease. Mediterranean fever (MEFV) gene, which has already been identified as being responsible for familial Mediterranean fever (FMF), is also a suspicious gene for AS because of the clinical association of these two diseases. The aim of this study was to explore the frequency and clinical significance of MEFV gene mutations (M694V, M680I, V726A, E148Q and P369S) in a cohort of Turkish patients with AS. Genomic DNAs of 103 AS patients and 120 controls were isolated and genotyped using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) methods. There was a statistically significant difference of the MEFV gene mutation carrier rates between AS patients and healthy controls (p = 0.004, OR: 2.5, 95% CI: 1.32–4.76). This association was also observed in allele frequencies (p = 0.005, OR: 2.3, 95% CI: 1.27–4.2). A relatively higher frequency was observed for M694V mutation in AS patients than controls (10.7% versus 4.2% , p = 0.060). There were no significant differences between MEFV mutation carriers and non-carriers with respect to the clinical and demographic characteristics. The results of this study suggest that MEFV gene mutations are positively associated with a predisposition to develop AS. PMID:22960328

  12. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    Directory of Open Access Journals (Sweden)

    Jose Miguel Moreno-Ortiz

    2016-01-01

    Full Text Available Background. Lynch Syndrome (LS is characterized by germline mutations in the DNA mismatch repair (MMR genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC, and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del and c.1852_1853delinsGC (p.K618A in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.

  13. Prevalence and clinical association of gene mutations through multiplex mutation testing in patients with NSCLC: results from the ETOP Lungscape Project.

    Science.gov (United States)

    Kerr, K M; Dafni, U; Schulze, K; Thunnissen, E; Bubendorf, L; Hager, H; Finn, S; Biernat, W; Vliegen, L; Losa, J H; Marchetti, A; Cheney, R; Warth, A; Speel, E-J; Blackhall, F; Monkhorst, K; Jantus Lewintre, E; Tischler, V; Clark, C; Bertran-Alamillo, J; Meldgaard, P; Gately, K; Wrona, A; Vandenberghe, P; Felip, E; De Luca, G; Savic, S; Muley, T; Smit, E F; Dingemans, A-M C; Priest, L; Baas, P; Camps, C; Weder, W; Polydoropoulou, V; Geiger, T R; Kammler, R; Sumiyoshi, T; Molina, M A; Shames, D S; Stahel, R A; Peters, S

    2018-01-01

    Reported prevalence of driver gene mutations in non-small-cell lung cancer (NSCLC) is highly variable and clinical correlations are emerging. Using NSCLC biomaterial and clinical data from the European Thoracic Oncology Platform Lungscape iBiobank, we explore the epidemiology of mutations and association to clinicopathologic features and patient outcome (relapse-free survival, time-to-relapse, overall survival). Clinically annotated, resected stage I-III NSCLC FFPE tissue was assessed for gene mutation using a microfluidics-based multiplex PCR platform. Mutant-allele detection sensitivity is >1% for most of the ∼150 (13 genes) mutations covered in the multiplex test. Multiplex testing has been carried out in 2063 (76.2%) of the 2709 Lungscape cases (median follow-up 4.8 years). FFPE samples mostly date from 2005 to 2008, yet recently extracted DNA quality and quantity was generally good. Average DNA yield/case was 2.63 µg; 38 cases (1.4%) failed QC and were excluded from study; 95.1% of included cases allowed the complete panel of mutations to be tested. Most common were KRAS, MET, EGFR and PIK3CA mutations with overall prevalence of 23.0%, 6.8%, 5.4% and 4.9%, respectively. KRAS and EGFR mutations were significantly more frequent in adenocarcinomas: PIK3CA in squamous cell carcinomas. MET mutation prevalence did not differ between histology groups. EGFR mutations were found predominantly in never smokers; KRAS in current/former smokers. For all the above mutations, there was no difference in outcome between mutated and non-mutated cases. Archival FFPE NSCLC material is adequate for multiplex mutation analysis. In this large, predominantly European, clinically annotated stage I-III NSCLC cohort, none of the mutations characterized showed prognostic significance.

  14. Novel point mutations in the steroid sulfatase gene in patients with X-linked ichthyosis: transfection analysis using the mutated genes.

    Science.gov (United States)

    Oyama, N; Satoh, M; Iwatsuki, K; Kaneko, F

    2000-06-01

    X-linked ichthyosis is caused by steroid sulfatase deficiency which results from abnormalities in its coding gene. The majority of X-linked ichthyosis patients ( approximately 90%) have complete or partial deletions of the steroid sulfatase gene. In this study, we examined the mutations of the steroid sulfatase gene in two unrelated X-linked ichthyosis patients without complete deletion of the gene. Polymerase chain reaction-single-strand conformation polymorphism and direct sequencing analyses showed that each patient has a different single base pair substitution within exon 8 encoding the C-terminal half of the steroid sulfatase polypeptide. Both mutations resulted in the transversion of functional amino acids: a G-->C substitution at nucleotide 1344, causing a predicted change of a glycine to an arginine, and a C-->T substitution at nucleotide 1371, causing a change from a glutamine to a stop codon. In vitro steroid sulfatase cDNA expression using site-directed mutagenesis revealed that these mutations are in fact pathogenic and reflect the levels of steroid sulfatase enzyme activities in each of the X-linked ichthyosis patients.

  15. The role of sarcomere gene mutations in patients with idiopathic dilated cardiomyopathy

    DEFF Research Database (Denmark)

    Møller, Daniel Vega; Andersen, Paal Skytt; Hedley, Paula

    2009-01-01

    We investigated a Danish cohort of 31 unrelated patients with idiopathic dilated cardiomyopathy (IDC), to assess the role that mutations in sarcomere protein genes play in IDC. Patients were genetically screened by capillary electrophoresis single strand conformation polymorphism and subsequently...... by bidirectional DNA sequencing of conformers in the coding regions of MYH7, MYBPC3, TPM1, ACTC, MYL2, MYL3, TNNT2, CSRP3 and TNNI3. Eight probands carried disease-associated genetic variants (26%). In MYH7, three novel mutations were found; in MYBPC3, one novel variant and two known mutations were found...... DCM as well as one case with left ventricular non-compaction. Disease-causing sarcomere gene mutations were found in about one-quarter of IDC patients, and seem to play an important role in the causation of the disease. The genetics is as complex as seen in HCM. Thus, our data suggest that a genetic...

  16. Nonfamilial Juvenile Polyposis Syndrome with Exon 5 Novel Mutation in SMAD 4 Gene

    Directory of Open Access Journals (Sweden)

    Amna Ahmed

    2017-01-01

    Full Text Available Juvenile polyposis syndrome (JPS is a rare autosomal dominant hereditary disorder, characterized by multiple juvenile polyps in the gastrointestinal tract and an increased risk of colorectal cancer. JPS is most frequently caused by mutations in the SMAD4 or BMPR1A genes. Herein, we report a child with juvenile polyposis syndrome (JPS with a novel mutation in the SMAD4 gene. An 8-year-old boy presented with recurrent rectal bleeding and was found to have multiple polyps in the entire colon. The histology of the resected polyps was consistent with juvenile polyps. Subsequent genetic screening revealed a novel mutation in SMAD4, exon 5 (p.Ser144Stop. To the best of our knowledge, this mutation has not been reported before. Offering genotypic diagnosis for patients with JPS is an important step for strategic plan of management.

  17. Mutation Profile of the CDH23 Gene in 56 Probands with Usher Syndrome Type I

    Science.gov (United States)

    Oshima, A.; Jaijo, T.; Aller, E.; Millan, J.M.; Carney, C.; Usami, S.; Moller, C.; Kimberling, W.J.

    2008-01-01

    Mutations in the human gene encoding cadherin 23 (CDH23) cause Usher syndrome type 1D (USH1D) and nonsyndromic hearing loss. Individuals with Usher syndrome type I have profound congenital deafness, vestibular areflexia and usually begin to exhibit signs of RP in early adolescence. In the present study, we carried out the mutation analysis in all 69 exons of the CDH23 gene in 56 Usher type 1 probands already screened for mutations in MYO7A. A total of 18 of 56 subjects (32.1%) were observed to have one or two CDH23 variants that are presumed to be pathologic. Twenty one different pathologic genome variants were observed of which 15 were novel. Out of a total of 112 alleles, 31 (27.7%) were considered pathologic. Based on our results it is estimated that about 20% of patients with Usher syndrome type I have CDH23 mutations. PMID:18429043

  18. Rapid identification of HBB gene mutations by high-resolution melting analysis.

    Science.gov (United States)

    Shih, Hung-Chang; Er, Tze-Kiong; Chang, Tien-Jye; Chang, Ya-Sian; Liu, Ta-Chih; Chang, Jan-Gowth

    2009-11-01

    This study was undertaken to identify HBB gene mutation. Herein we evaluated high-resolution melting analysis in the identification of HBB mutations. We have successfully established a diagnostic strategy for identifying HBB gene mutations including c.-78A>G, c.-79A>G, c.2T>G, c.79_80insT, c.84_85insC, c.123_124insT, c.125_128delTCTT, c.130 G>T, c.170G>A, c.216_217ins A and c.316-197 C>T from wild-type DNA using HRM analysis. The results of HRM analysis were confirmed by direct DNA sequencing. In summary, we report that HRM analysis is an appealing technique for the identification of HBB mutations. We also believe that HRM can be used as a method for prenatal diagnosis of beta-thalassemia.

  19. Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

    DEFF Research Database (Denmark)

    Christiansen, L; Ged, C; Hombrados, I

    1999-01-01

    , confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...... improves the genetic diagnosis of fPCT and HEP, thereby facilitating the detection of familial UROD deficient patients as well as the discrimination between familial and sporadic PCT cases.......The two porphyrias, familial porphyria cutanea tarda (fPCT) and hepatoerythropoietic porphyria (HEP), are associated with mutations in the gene encoding the enzyme uroporphyrinogen decarboxylase (UROD). Several mutations, most of which are private, have been identified in HEP and fPCT patients...

  20. A novel mutation in the leptin gene (W121X in an Egyptian family

    Directory of Open Access Journals (Sweden)

    Inas Mazen

    2014-01-01

    Full Text Available Congenital leptin deficiency is a rare recessively inherited condition due to homozygous mutations in the LEP gene. To date, only nine mutations have been identified in the LEP gene (p.L72S, p.N103K, p.R105W, p.H118L, p.S141C, c.104_106delTCA, c.135del3bp, c.398delG and c.481_482delCT. In this study we present a novel homozygous nonsense mutation (W121X in LEP in a twelve year old obese male and his severely obese sister. As this disorder is treatable with recombinant leptin, it is intriguing to report a novel homozygous nonsense mutation in LEP in two obese children of consanguineous parents. These patients showed features in accordance with leptin deficiency.

  1. The interplay of mutations and electronic properties in disease-related genes

    Science.gov (United States)

    Shih, Chi-Tin; Wells, Stephen A.; Hsu, Ching-Ling; Cheng, Yun-Yin; Römer, Rudolf A.

    2012-02-01

    Electronic properties of DNA are believed to play a crucial role in many phenomena in living organisms, for example the location of DNA lesions by base excision repair (BER) glycosylases and the regulation of tumor-suppressor genes such as p53 by detection of oxidative damage. However, the reproducible measurement and modelling of charge migration through DNA molecules at the nanometer scale remains a challenging and controversial subject even after more than a decade of intense efforts. Here we show, by analysing 162 disease-related genes from a variety of medical databases with a total of almost 20,000 observed pathogenic mutations, a significant difference in the electronic properties of the population of observed mutations compared to the set of all possible mutations. Our results have implications for the role of the electronic properties of DNA in cellular processes, and hint at the possibility of prediction, early diagnosis and detection of mutation hotspots.

  2. Alleged Detrimental Mutations in the SMPD1 Gene in Patients with Niemann-Pick Disease

    Directory of Open Access Journals (Sweden)

    Cosima Rhein

    2015-06-01

    Full Text Available Loss-of-function mutations in the sphingomyelin phosphodiesterase 1 (SMPD1 gene are associated with decreased catalytic activity of acid sphingomyelinase (ASM and are the cause of the autosomal recessive lysosomal storage disorder Niemann-Pick disease (NPD types A and B. Currently, >100 missense mutations in SMPD1 are listed in the Human Gene Mutation Database. However, not every sequence variation in SMPD1 is detrimental and gives rise to NPD. We have analysed several alleged SMPD1 missense mutations mentioned in a recent publication and found them to be common variants of SMPD1 that give rise to normal in vivo and in vitro ASM activity. (Comment on Manshadi et al. Int. J. Mol. Sci. 2015, 16, 6668–6676.

  3. Two Mutations in Surfactant Protein C Gene Associated with Neonatal Respiratory Distress

    Directory of Open Access Journals (Sweden)

    Anna Tarocco

    2015-01-01

    Full Text Available Multiple mutations of surfactant genes causing surfactant dysfunction have been described. Surfactant protein C (SP-C deficiency is associated with variable clinical manifestations ranging from neonatal respiratory distress syndrome to lethal lung disease. We present an extremely low birth weight male infant with an unusual course of respiratory distress syndrome associated with two mutations in the SFTPC gene: C43-7G>A and 12T>A. He required mechanical ventilation for 26 days and was treated with 5 subsequent doses of surfactant with temporary and short-term efficacy. He was discharged at 37 weeks of postconceptional age without any respiratory support. During the first 16 months of life he developed five respiratory infections that did not require hospitalization. Conclusion. This mild course in our patient with two mutations is peculiar because the outcome in patients with a single SFTPC mutation is usually poor.

  4. Nocturnal frontal lobe epilepsy caused by a mutation in the GATOR1 complex gene NPRL3.

    Science.gov (United States)

    Korenke, Georg-Christoph; Eggert, Marlene; Thiele, Holger; Nürnberg, Peter; Sander, Thomas; Steinlein, Ortrud K

    2016-03-01

    Mutations in NPRL3, one of three genes that encode proteins of the mTORC1-regulating GATOR1 complex, have recently been reported to cause cortical dysplasia with focal epilepsy. We have now analyzed a multiplex epilepsy family by whole exome sequencing and identified a frameshift mutation (NM_001077350.2; c.1522delG; p.E508Rfs*46) within exon 13 of NPRL3. This truncating mutation causes an epilepsy phenotype characterized by early childhood onset of mainly nocturnal frontal lobe epilepsy. The penetrance in our family was low (three affected out of six mutation carriers), compared to families with either ion channel- or DEPDC5-associated familial nocturnal frontal lobe epilepsy. The absence of apparent structural brain abnormalities suggests that mutations in NPRL3 are not necessarily associated with focal cortical dysplasia but might be able to cause epilepsy by different, yet unknown pathomechanisms. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  5. The background puzzle: how identical mutations in the same gene lead to different disease symptoms.

    Science.gov (United States)

    Kammenga, Jan E

    2017-10-01

    Identical disease-causing mutations can lead to different symptoms in different people. The reason for this has been a puzzling problem for geneticists. Differential penetrance and expressivity of mutations has been observed within individuals with different and similar genetic backgrounds. Attempts have been made to uncover the underlying mechanisms that determine differential phenotypic effects of identical mutations through studies of model organisms. From these studies evidence is accumulating that to understand disease mechanism or predict disease prevalence, an understanding of the influence of genetic background is as important as the putative disease-causing mutations of relatively large effect. This review highlights current insights into phenotypic variation due to gene interactions, epigenetics and stochasticity in model organisms, and discusses their importance for understanding the mutational effect on disease symptoms. © 2017 Federation of European Biochemical Societies.

  6. Identification of mutations in Iranian patients’ DAX-1 gene with X-linked adrenal hypoplasia congenital

    Directory of Open Access Journals (Sweden)

    Mahdieh Davoodnejad

    2017-04-01

    Conclusion: Both mentioned mutations are located at crucial and functional region DAX1 protein. They are detected in the C-terminal region of DAX1 protein which is involved by the conserved amino acid chain as well as transcriptional silencing domain. By considering other investigation, mutations in this region probably lead to produce a misfolded protein. Consequently, the misfolded protein would not work influentially in order to inhibit some gene expression. As a result, our findings will expand the variety of DAX1 mutations. On the other hand, it is revealed that these mutations play a key role in the pathogenesis of AHC, thus, recognizing these new mutations will facilitate the patients prognosis producer as well as raising the clinical knowledge about this rare disease.

  7. I171V germline mutation in the NBS1 gene significantly increases risk of breast cancer.

    Science.gov (United States)

    Roznowski, Krzysztof; Januszkiewicz-Lewandowska, Danuta; Mosor, Maria; Pernak, Monika; Litwiniuk, Maria; Nowak, Jerzy

    2008-07-01

    Nijmegen Breakage Syndrome (NBS) is a rare autosomal, recessive disease caused by homozygous mutations in the NBS1 gene. The most common deletion of 5 bp (657del5) in exon 6, which affects mostly the population of Central Europe is observed. Among the typical features of this disorder is that NBS patients experience a high incidence of lymphoid malignancies as well. An increased risk of solid tumors development for 657del5 carriers was the reason to investigate the role of NBS1 gene as a susceptible one for the breast cancer. The purpose of this work is to identify mutations in all 16 exons of the NBS1 gene in the group of the patients with diagnosed breast cancer and the control group of healthy individuals. In the group of 270 women with breast cancer, seven cases of mutated NBS1 gene were revealed. In the subgroup presenting mutated NBS1 gene, the mutation I171V in 5th exon occurred in five cases. It is the first such a discovery concerning breast cancer patients because this mutation had been previously observed only in the course of lymphoid or hematological malignancies. The rate of I171V mutation in the group of breast cancer patients was significantly higher than in the controls (OR: 9.42; 95% CI: 1.09-81.05; P = 0.02). The conclusion is that heterozygous germline mutation I171V in NBS1 gene is a significant risk factor for breast cancer development. It concerns especially the women whose first degree relatives had a previously diagnosed breast cancer (OR: 6.00; 95% CI: 0.98-38.07; P = 0.04). The histopathological and clinical features of breast cancer with I171V mutation suggest accumulation of the negative prognostic factors. The treatment's results however were unexpectedly satisfactory, that is why further investigations are necessary to assess the role of I171V mutation in NBS1 gene as a prognostic and predictive factor for breast cancer.

  8. Generalized pustular psoriasis in infant with heterozygous mutation in the IL36RN gene successfully treated with infliximab

    DEFF Research Database (Denmark)

    Glerup, Mia; Herlin, Troels; Veirum, Jens Erik

    or DITRA genetic testing for IL1RN and IL36RN gene mutations was initiated. The girl was found to be heterozygous for a mutation in the IL36RN gene (exon 5, c 338C>T p Ser113Leu) whereas the IL1RN gene (mutated in DIRA patients) was normal. Additionally, a heterozygous mutation in the NLRP3 gene was also......Generalized pustular psoriasis in infant with heterozygous mutation in the IL36RN gene successfully treated with infliximab.M. Glerup1, J.E. Veirum1, L. Iversen2, M. Christiansen3, T. Herlin1.Departments of 1Pediatrics and 2Dermatology, and 3Clinical Immunology, Aarhus University Hospital, Denmark...... Background: Homozygous missense mutation in the IL36RN gene resulting in deficiency of interleukin-36-receptor antagonist (DITRA) is phenotypically presented as severe generalized pustular psoriasis starting in early childhood. Compound heterozygous cases have been described with the same DITRA phenotype...

  9. [Screening of the gene mutation in D-loop region of mitochondrial DNA in oral squamous cell carcinoma].

    Science.gov (United States)

    Sun, Yang; Yuan, Rong-tao; Chen, Wan-tao; Bu, Ling-xue; Jia, Mu-yun

    2013-05-01

    To investigate the gene mutation in D-loop region of mitochondrial DNA (mtDNA) in oral squamous cell carcinoma (OSCC) tissue and to explore the role of the gene mutation in D-loop region in the OSCC tumorigenesis. mtDNA was obtained from cancer, paracancerous and normal mucosa tissues of thirty patients with OSCC. The D-loop regions of mtDNA were amplified with PCR, sequencing and then analyzed by Chromas software and BLAST to identify the mutation site. Mutation in the D-loop region was found in eight cases, with the mutation rate of 27%. There were nine mutations totally, including one point mutation, two base deletions, three insertion mutations, three heterozygous mutations. In these mutations, base deletions were different from each other and heterozygous mutations had no same mutation form, while the three insertion mutations were same, the insertion of base C. One case had T/A heterozygous mutation and base C insertion at the same time. There were mutations in mtDNA D-loop in OSCC, but the relationship between occurrence of OSCC and mutation of mtDNA needs further study.

  10. Mutations du gene de la filamine et syndromes malformatifs | Koffi ...

    African Journals Online (AJOL)

    Toutefois, il est démontré que l'absence ou le déficit en filamine, ou la perte de fonction de la filamine est à l'origine de ces anomalies malformatives. La recherche de mutations dans le gène de la filamine est donc un examen qui vient compléter le bilan diagnostique à réaliser en matière de malformation congénitale.

  11. Paraganglioma of the carotid body: treatment strategy and SDH-gene mutations.

    Science.gov (United States)

    Fruhmann, J; Geigl, J B; Konstantiniuk, P; Cohnert, T U

    2013-05-01

    The aim of the present study was to review treatment results in patients with paraganglioma (PGL) of the neck presenting as carotid body tumour, long-term follow-up and relevance of genetic testing for succinate dehydrogenase (SDH)-gene mutations. Retrospective analysis of prospectively collected data and prospective genetic analysis. Over a 25-year period (1987-2011) 50 patients were operated for 63 PGLs of the neck. Pre-, intra- and postoperative findings were analysed. Sanger sequencing was performed for genetic testing of SDH-gene mutations (SDH B, SDHC and SDHD). Fifty patients underwent resection of 63 PGLs (62 benign, one malignant) without mortality. Eight patients underwent preoperative embolisation. Vascular surgical procedures were required in 15 operations (15/63 = 23.8%). Nerve lesions occurred after 13 operations (13/63 = 20.6%) and were associated with large tumours. A total of 44 patients are alive after a mean follow-up of 9.8 years. In 40 patients 17 SDH-gene mutations were detected (17/40 = 42.5%): 14 SDHD mutations, two SDHB mutations and one rare SDHC mutation. Surgery for PGL is recommended. All PGL patients should be screened for SDH mutations because it impacts the individual follow-up strategy. Whereas all PGL patients require annual ultrasound control, mutation carriers and family members with proven mutations should in addition be regularly examined by magnetic resonance imaging (MRI) of head, neck, thorax, abdomen and pelvis. Copyright © 2013 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

  12. Location and type of mutation in the LIS1 gene do not predict phenotypic severity.

    Science.gov (United States)

    Uyanik, G; Morris-Rosendahl, D J; Stiegler, J; Klapecki, J; Gross, C; Berman, Y; Martin, P; Dey, L; Spranger, S; Korenke, G C; Schreyer, I; Hertzberg, C; Neumann, T E; Burkart, P; Spaich, C; Meng, M; Holthausen, H; Adès, L; Seidel, J; Mangold, E; Buyse, G; Meinecke, P; Schara, U; Zeschnigk, C; Muller, D; Helland, G; Schulze, B; Wright, M L; Kortge-Jung, S; Hehr, A; Bogdahn, U; Schuierer, G; Kohlhase, J; Aigner, L; Wolff, G; Hehr, U; Winkler, J

    2007-07-31

    Lissencephaly is a neuronal migration disorder leading to absent or reduced gyration and a broadened but poorly organized cortex. The most common form of lissencephaly is isolated, referred as classic or type 1 lissencephaly. Type 1 lissencephaly is mostly associated with a heterozygous deletion of the entire LIS1 gene, whereas intragenic heterozygous LIS1 mutations or hemizygous DCX mutations in males are less common. Eighteen unrelated patients with type 1 lissencephaly were clinically and genetically assessed. In addition, patients with subcortical band heterotopia (n = 1) or lissencephaly with cerebellar hypoplasia (n = 2) were included. Fourteen new and seven previously described LIS1 mutations were identified. We observed nine truncating mutations (nonsense, n = 2; frameshift, n = 7), six splice site mutations, five missense mutations, and one in-frame deletion. Somatic mosaicism was assumed in three patients with partial subcortical band heterotopia in the occipital-parietal lobes or mild pachygyria. We report three mutations in exon 11, including a frameshift which extends the LIS1 protein, leading to type 1 lissencephaly and illustrating the functional importance of the