Chen, H T; Alexander, C B; Mage, R G
1995-06-15
Normal rabbits preferentially rearrange the 3'-most VH gene, VH1, to encode Igs with VHa allotypes, which constitute the majority of rabbit serum Igs. A gene conversion-like mechanism is employed to diversify the primary Ab repertoire. In mutant Alicia rabbits that derived from a rabbit with VHa2 allotype, the VH1 gene was deleted. Our previous studies showed that the first functional gene (VH4) or VH4-like genes were rearranged in 2- to 8-wk-old homozygous Alicia. The VH1a2-like sequences that were found in splenic mRNA from 6-wk and older Alicia rabbits still had some residues that were typical of VH4. The appearances of sequences resembling that of VH1a2 may have been caused by gene conversions that altered the sequences of the rearranged VH or there may have been rearrangement of upstream VH1a2-like genes later in development. To investigate this further, we constructed a cosmid library and isolated a VH1a2-like gene, VH12-1-6, with a sequence almost identical to VH1a2. This gene had a deleted base in the heptamer of its recombination signal sequence. However, even if this defect diminished or eliminated its ability to rearrange, the a2-like gene could have acted as a donor for gene-conversion-like alteration of rearranged VH genes. Sequence comparisons suggested that this gene or a gene like it could have acted as a donor for gene conversion in mutant Alicia and in normal rabbits.
B lymphocyte selection and age-related changes in VH gene usage in mutant Alicia rabbits.
Zhu, X; Boonthum, A; Zhai, S K; Knight, K L
1999-09-15
Young Alicia rabbits use VHa-negative genes, VHx and VHy, in most VDJ genes, and their serum Ig is VHa negative. However, as Alicia rabbits age, VHa2 allotype Ig is produced at high levels. We investigated which VH gene segments are used in the VDJ genes of a2 Ig-secreting hybridomas and of a2 Ig+ B cells from adult Alicia rabbits. We found that 21 of the 25 VDJ genes used the a2-encoding genes, VH4 or VH7; the other four VDJ genes used four unknown VH gene segments. Because VH4 and VH7 are rarely found in VDJ genes of normal or young Alicia rabbits, we investigated the timing of rearrangement of these genes in Alicia rabbits. During fetal development, VH4 was used in 60-80% of nonproductively rearranged VDJ genes, and VHx and VHy together were used in 10-26%. These data indicate that during B lymphopoiesis VH4 is preferentially rearranged. However, the percentage of productive VHx- and VHy-utilizing VDJ genes increased from 38% at day 21 of gestation to 89% at birth (gestation day 31), whereas the percentage of VH4-utilizing VDJ genes remained at 15%. These data suggest that during fetal development, either VH4-utilizing B-lineage cells are selectively eliminated, or B cells with VHx- and VHy-utilizing VDJ genes are selectively expanded, or both. The accumulation of peripheral VH4-utilizing a2 B cells with age indicates that these B cells might be selectively expanded in the periphery. We discuss the possible selection mechanisms that regulate VH gene segment usage in rabbit B cells during lymphopoiesis and in the periphery.
VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.
Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G
1993-04-01
Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.
Allegrucci, M; Newman, B A; Young-Cooper, G O; Alexander, C B; Meier, D; Kelus, A S; Mage, R G
1990-07-01
Rabbits of the Alicia strain have a mutation (ali) that segregates with the immunoglobulin heavy-chain (lgh) locus and has a cis effect upon the expression of heavy-chain variable-region (VH) genes encoding the a2 allotype. In heterozygous a1/ali or a3/ali rabbits, serum immunoglobulins are almost entirely the products of the normal a1 or a3 allele and only traces of a2 immunoglobulin are detectable. Adult homozygous ali/ali rabbits likewise have normal immunoglobulin levels resulting from increased production of a-negative immunoglobulins and some residual ability to produce the a2 allotype. By contrast, the majority of the immunoglobulins of wild-type a2 rabbits are a2-positive and only a small percentage are a-negative. Genomic DNAs from homozygous mutant and wild-type animals were indistinguishable by Southern analyses using a variety of restriction enzyme digests and lgh probes. However, when digests with infrequently cutting enzymes were analyzed by transverse alternating-field electrophoresis, the ali DNA fragments were 10-15 kilobases smaller than the wild type. These fragments hybridized to probes both for VH and for a region of DNA a few kilobases downstream of the VH genes nearest the joining region. We suggest that this relatively small deletion affects a segment containing 3' VH genes with important regulatory functions, the loss of which leads to the ali phenotype. These results, and the fact that the 3' VH genes rearrange early in B-cell development, indicate that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression.
Perez, M; Pacchiarotti, A; Frontani, M; Pescarmona, E; Caprini, E; Lombardo, G A; Russo, G; Faraggiana, T
2010-03-01
Accurate assessment of the somatic mutational status of clonal immunoglobulin variable region (IgV) genes is relevant in elucidating tumour cell origin in B-cell lymphoma; virgin B cells bear unmutated IgV genes, while germinal centre and postfollicular B cells carry mutated IgV genes. Furthermore, biases in the IgV repertoire and distribution pattern of somatic mutations indicate a possible antigen role in the pathogenesis of B-cell malignancies. This work investigates the cellular origin and antigenic selection in primary cutaneous B-cell lymphoma (PCBCL). We analysed the nucleotide sequence of clonal IgV heavy-chain gene (IgVH) rearrangements in 51 cases of PCBCL (25 follicle centre, 19 marginal zone and seven diffuse large B-cell lymphoma, leg-type) and compared IgVH sequences with their closest germline segment in the GenBank database. Molecular data were then correlated with histopathological features. We showed that all but one of the 51 IgVH sequences analysed exhibited extensive somatic hypermutations. The detected mutation rate ranged from 1.6% to 21%, with a median rate of 9.8% and was independent of PCBCL histotype. Calculation of antigen-selection pressure showed that 39% of the mutated IgVH genes displayed a number of replacement mutations and silent mutations in a pattern consistent with antigenic selection. Furthermore, two segments, VH1-69 (12%) and VH4-59 (14%), were preferentially used in our case series. Data indicate that neoplastic B cells of PBCBL have experienced germinal centre reaction and also suggest that the involvement of IgVH genes is not entirely random in PCBCL and that common antigen epitopes could be pathologically relevant in cutaneous lymphomagenesis.
Directory of Open Access Journals (Sweden)
Borie Dominic C
2006-03-01
Full Text Available Abstract Background The use of porcine cells and organs as a source of xenografts for human patients would vastly increase the donor pool; however, both humans and Old World primates vigorously reject pig tissues due to xenoantibodies that react with the polysaccharide galactose α (1,3 galactose (αGal present on the surface of many porcine cells. We previously examined the xenoantibody response in patients exposed to porcine hepatocytes via treatment(s with bioartficial liver devices (BALs, composed of porcine cells in a support matrix. We determined that xenoantibodies in BAL-treated patients are predominantly directed at porcine αGal carbohydrate epitopes, and are encoded by a small number of germline heavy chain variable region (VH immunoglobulin genes. The studies described in this manuscript were designed to identify whether the xenoantibody responses and the IgVH genes encoding antibodies to porcine hepatocytes in non-human primates used as preclinical models are similar to those in humans. Adult non-immunosuppressed rhesus monkeys (Macaca mulatta were injected intra-portally with porcine hepatocytes or heterotopically transplanted with a porcine liver lobe. Peripheral blood leukocytes and serum were obtained prior to and at multiple time points after exposure, and the immune response was characterized, using ELISA to evaluate the levels and specificities of circulating xenoantibodies, and the production of cDNA libraries to determine the genes used by B cells to encode those antibodies. Results Xenoantibodies produced following exposure to isolated hepatocytes and solid organ liver grafts were predominantly encoded by genes in the VH3 family, with a minor contribution from the VH4 family. Immunoglobulin heavy-chain gene (VH cDNA library screening and gene sequencing of IgM libraries identified the genes as most closely-related to the IGHV3-11 and IGHV4-59 germline progenitors. One of the genes most similar to IGHV3-11, VH3-11cyno, has
Contribution of V(H replacement products in mouse antibody repertoire.
Directory of Open Access Journals (Sweden)
Lin Huang
Full Text Available VH replacement occurs through RAG-mediated recombination between the cryptic recombination signal sequence (cRSS near the 3' end of a rearranged VH gene and the 23-bp RSS from an upstream unrearranged VH gene. Due to the location of the cRSS, VH replacement leaves a short stretch of nucleotides from the previously rearranged VH gene at the newly formed V-D junction, which can be used as a marker to identify VH replacement products. To determine the contribution of VH replacement products to mouse antibody repertoire, we developed a Java-based VH Replacement Footprint Analyzer (VHRFA program and analyzed 17,179 mouse IgH gene sequences from the NCBI database to identify VH replacement products. The overall frequency of VH replacement products in these IgH genes is 5.29% based on the identification of pentameric VH replacement footprints at their V-D junctions. The identified VH replacement products are distributed similarly in IgH genes using most families of VH genes, although different families of VH genes are used differentially. The frequencies of VH replacement products are significantly elevated in IgH genes derived from several strains of autoimmune prone mice and in IgH genes encoding autoantibodies. Moreover, the identified VH replacement footprints in IgH genes from autoimmune prone mice or IgH genes encoding autoantibodies preferentially encode positively charged amino acids. These results revealed a significant contribution of VH replacement products to the diversification of antibody repertoire and potentially, to the generation of autoantibodies in mice.
Diversity and repertoire of IgW and IgM VH families in the newborn nurse shark.
Rumfelt, Lynn L; Lohr, Rebecca L; Dooley, Helen; Flajnik, Martin F
2004-05-06
Adult cartilaginous fish express three immunoglobulin (Ig) isotypes, IgM, IgNAR and IgW. Newborn nurse sharks, Ginglymostoma cirratum, produce 19S (multimeric) IgM and monomeric/dimeric IgM1gj, a germline-joined, IgM-related VH, and very low amounts of 7S (monomeric) IgM and IgNAR proteins. Newborn IgNAR VH mRNAs are diverse in the complementarity-determining region 3 (CDR3) with non-templated nucleotide (N-region) addition, which suggests that, unlike in many other vertebrates, terminal deoxynucleotidyl transferase (TdT) expressed at birth is functional. IgW is present in the lungfish, a bony fish sharing a common ancestor with sharks 460 million years ago, implying that the IgW VH family is as old as the IgM VH family. This nurse shark study examined the IgM and IgW VH repertoire from birth through adult life, and analyzed the phylogenetic relationships of these gene families. IgM and IgW VH cDNA clones isolated from newborn nurse shark primary and secondary lymphoid tissues had highly diverse and unique CDR3 with N-region addition and VDJ gene rearrangement, implicating functional TdT and RAG gene activity. Despite the clear presence of N-region additions, newborn CDR3 were significantly shorter than those of adults. The IgM clones are all included in a conventional VH family that can be classified into five discrete groups, none of which is orthologous to IgM VH genes in other elasmobranchs. In addition, a novel divergent VH family was orthologous to a published monotypic VH horn shark family. IgW VH genes have diverged sufficiently to form three families. IgM and IgW VH serine codons using the potential somatic hypermutation hotspot sequence occur mainly in VH framework 1 (FR1) and CDR1. Phylogenetic analysis of cartilaginous fish and lungfish IgM and IgW demonstrated they form two major ancient gene groups; furthermore, these VH genes generally diversify (duplicate and diverge) within a species. As in ratfish, sandbar and horn sharks, most nurse shark IgM VH
Diversity and repertoire of IgW and IgM VH families in the newborn nurse shark
Directory of Open Access Journals (Sweden)
Dooley Helen
2004-05-01
Full Text Available Abstract Background Adult cartilaginous fish express three immunoglobulin (Ig isotypes, IgM, IgNAR and IgW. Newborn nurse sharks, Ginglymostoma cirratum, produce 19S (multimeric IgM and monomeric/dimeric IgM1gj, a germline-joined, IgM-related VH, and very low amounts of 7S (monomeric IgM and IgNAR proteins. Newborn IgNAR VH mRNAs are diverse in the complementarity-determining region 3 (CDR3 with non-templated nucleotide (N-region addition, which suggests that, unlike in many other vertebrates, terminal deoxynucleotidyl transferase (TdT expressed at birth is functional. IgW is present in the lungfish, a bony fish sharing a common ancestor with sharks 460 million years ago, implying that the IgW VH family is as old as the IgM VH family. This nurse shark study examined the IgM and IgW VH repertoire from birth through adult life, and analyzed the phylogenetic relationships of these gene families. Results IgM and IgW VH cDNA clones isolated from newborn nurse shark primary and secondary lymphoid tissues had highly diverse and unique CDR3 with N-region addition and VDJ gene rearrangement, implicating functional TdT and RAG gene activity. Despite the clear presence of N-region additions, newborn CDR3 were significantly shorter than those of adults. The IgM clones are all included in a conventional VH family that can be classified into five discrete groups, none of which is orthologous to IgM VH genes in other elasmobranchs. In addition, a novel divergent VH family was orthologous to a published monotypic VH horn shark family. IgW VH genes have diverged sufficiently to form three families. IgM and IgW VH serine codons using the potential somatic hypermutation hotspot sequence occur mainly in VH framework 1 (FR1 and CDR1. Phylogenetic analysis of cartilaginous fish and lungfish IgM and IgW demonstrated they form two major ancient gene groups; furthermore, these VH genes generally diversify (duplicate and diverge within a species. Conclusion As in ratfish
Limited number of immunoglobulin VH regions expressed in the mutant rabbit "Alicia".
DiPietro, L A; Short, J A; Zhai, S K; Kelus, A S; Meier, D; Knight, K L
1990-06-01
A unique feature of rabbit Ig is the presence of VH region allotypic specificities. In normal rabbits, more than 80% of circulating immunoglobulin molecules bear the VHa allotypic specificities, al, a2 or a3; the remaining 10% to 20% of immunoglobulin molecules lack VHa allotypic specificities and are designated VHa-. A mutant rabbit designated Alicia, in contrast, has predominantly serum immunoglobulin molecules that lack the VHa allotypic specificities (Kelus and Weiss, Proc. Natl. Acad. Sci. USA 1986. 83: 4883). To study the nature and molecular complexity of VHa- molecules, we cloned and determined the nucleotide sequence of seven cDNA prepared from splenic RNA of an Alicia rabbit. Six of the clones appeared to encode VHa- molecules; the framework regions encoded by these clones were remarkably similar to each other, each having an unusual insertion of four amino acids at position 10. This insertion of four amino acids has been seen in only 2 of 54 sequenced rabbit VH genes. The similarity of the sequences of the six VHa- clones to each other and their dissimilarity to most other VH genes leads us to suggest that the VHa- molecules in Alicia rabbits are derived predominantly from one or a small number of very similar VH genes. Such preferential utilization of a small number of VH genes may explain the allelic inheritance of VH allotypes.
International Nuclear Information System (INIS)
Denis, K.A.; Timson, L.K.; Witte, O.N.
1989-01-01
VH gene utilization in the progeny of long term lymphoid-cultured cells used for reconstitution of severe combined immunodeficient mice under varying conditions was determined. Hybridomas made from the spleens of these animals were evaluated for clonality and donor origin and a panel of 146 independent hybridomas were subsequently examined for VH expression. Hybridomas derived from the spleens of SCID mice reconstituted with fresh cells, used as a control, utilized VH families in proportion to their numerical representation in the genome. However, hybridomas from the spleens of mice reconstituted with long term cultured cells utilized a predominance of the two VH gene families most proximal to JH, characteristic of cells early in B lymphocyte development. Coinjection of thymocytes with cultured fetal liver cells, to provide good levels of T lymphocytes, did not alter this pattern of VH utilization. Irradiation (3 Gy) of the mice before cultured cell injection, which leads to more complete reconstitution of the B cell compartment, was effective in removing this bias in the VH repertoire. Hybridomas derived from these mice expressed their VH genes more in proportion to family size, characteristic of cells later in B lymphocyte development. In this manner, long term lymphoid-cultured cells can be used to study the transitions that occur in VH repertoire expression which appear to be mediated by either B lymphocyte developmental microenvironment or population size
Yin, Ling-Ling; Ruan, Su-Hong; Tian, Yu; Zhao, Kai; Xu, Kai Lin
2015-10-01
To clone the variable region genes of human anti-IL1RAP (IL-1 receptor accessory protein) monoclonal antibodies (McAb) and to construct IL1RAP chimeric antigen receptors (CARs). The VH and VL DNA of IL1RAP single chain antibodies were amplified by RACE and overlap extension PCR from total RNA extracted from 3H6E10 and 10D8A7 hybridoma and ligated into specific IL1RAP single-chain variable fragments (scFv). CD8α transmembrane domain, CD137 intracellular domain, TCR ζ chain, human CD8α signal peptide and scFv-anti-IL1RAP were cloned into plasmid LV-lac. Recombinant lentiviruses were generated by co-transfection of recombinant plasmid LV-lac, pMD2. G, and psPAX2 helper vectors into 293FT packing cells. The VH and VL genes of 2 human anti-IL1RAP McAb were acquired. The 3H6E10 VH and VL genes consisted of 402 bp and 393 bp encoding 134 and 131 aminoacid residues, respectively; 10D8A7 VH and VL genes consisted of 423 bp and 381 bp encoding 141 and 127 amine acid residues, respectively. Recombinant expression vertors LV-3H6E10 scFv-ICD and LV-10D8A7 scFv-ICD (ICD: CD8α transmembrane domain-CD137 intracellular domain-TCR ζ chain) were constructed. The target fragments were demonstrated by sequencing analysis. Recombinant plasmids were transfected into 293FT cells and lentiviral particles were acquired. Human anti-IL1RAP recombinant receptors are constructed successfully and lay a good foundation for the construction of IL1RAP-CAR killer T cell vaccine.
Draft Genome Sequences of the Fish Pathogen Vibrio harveyi Strains VH2 and VH5
DEFF Research Database (Denmark)
Castillo, Daniel; D'Alvise, Paul; Middelboe, Mathias
2015-01-01
Vibrio harveyi is an important marine pathogen that is responsible for vibriosis outbreaks in cultured fish and invertebrates worldwide. Here, we announce the draft genome sequences of V. harveyi strains VH2 and VH5, isolated from farmed juvenile Seriola dumerili during outbreaks of vibriosis...... in Crete, Greece....
Data of evolutionary structure change: 1JOEA-1VH2A [Confc[Archive
Lifescience Database Archive (English)
Full Text Available ID>1VH2 A 1VH2A RDHLE----GVVDV ...>H ---- EEe> ATOM 480 CA ARG A 68 6.679 -2...entryIDChain> RDHLNGDSIEIIDI >H EE> 1VH2 A 1VH2A GHDQP--IPGVS ...e> -- > ATOM 806 CA GLY A 112 3.574 -8
vh@nnlo-v2: new physics in Higgs Strahlung
Harlander, Robert V.; Klappert, Jonas; Liebler, Stefan; Simon, Lukas
2018-05-01
Introducing version 2 of the code vh@nnlo [1], we study the effects of a number of new-physics scenarios on the Higgs-Strahlung process. In particular, the cross section is evaluated within a general 2HDM and the MSSM. While the Drell-Yan-like contributions are consistently taken into account by a simple rescaling of the SM result, the gluon-initiated contribution is supplemented by squark-loop mediated amplitudes, and by the s-channel exchange of additional scalars which may lead to conspicuous interference effects. The latter holds as well for bottom-quark initiated Higgs Strahlung, which is also included in the new version of vh@nnlo. Using an orthogonal rotation of the three Higgs CP eigenstates in the 2HDM and the MSSM, vh@nnlo incorporates a simple means of CP mixing in these models. Moreover, the effect of vector-like quarks in the SM on the gluon-initiated contribution can be studied. Beyond concrete models, vh@nnlo allows to include the effect of higher-dimensional operators on the production of CP-even Higgs bosons. Transverse momentum distributions of the final state Higgs boson and invariant mass distributions of the Vϕ final state for the gluon- and bottom-quark initiated contributions can be studied. Distributions for the Drell-Yan-like component of Higgs Strahlung can be included through a link to MCFM. vh@nnlo can also be linked to FeynHiggs and 2HDMC for the calculation of Higgs masses and mixing angles. It can also read these parameters from an SLHA-file as produced by standard spectrum generators. Throughout the manuscript, we highlight new-physics effects in various numerical examples, both at the inclusive level and for distributions.
DEFF Research Database (Denmark)
Castillo, Daniel; Jun, Jin Woo; D'Alvise, Paul
2015-01-01
Vibrio parahaemolyticus is an important foodborne pathogen responsible for gastroenteritis outbreaks globally. It has also been identified as an important pathogen in aquatic organisms. Here, we report a draft genome sequence of V. parahaemolyticus, strain VH3, isolated from farmed juvenile greater...
Poloidal rotation and the evolution of H-mode and VH-mode profiles
International Nuclear Information System (INIS)
Hinton, F.L.; Staebler, G.M.; Kim, Y.B.
1993-12-01
The physics which determines poloidal rotation, and its role in the development of profiles during H- and VH-modes, is discussed. A simple phenomenological transport model, which incorporates the rvec E x rvec B flow shear suppression of turbulence, is shown to predict profile evolution similar to that observed experimentally during H-mode and VH-mode
Histidine at Position 195 is Essential for Association of Heme-b in Lcp1VH2
Oetermann, Sylvia; Vivod, Robin; Hiessl, Sebastian; Hogeback, Jens; Holtkamp, Michael; Karst, Uwe; Steinbüchel, Alexander
2018-03-01
The latex clearing protein (Lcp) is the key enzyme of polyisoprene degradation in actinomycetes (Yikmis and Steinbüchel in Appl Environ Microbiol 78:4543-4551, https://doi.org/10.1128/AEM.00001-12, 2012). In this study it was shown that Lcp from Gordonia polyisoprenivorans VH2 (Lcp1VH2) harbors a non-covalently bound heme b as cofactor, which was identified by pyridine hemochrome spectra and confirmed by LC/ESI-ToF-MS. It contains iron, most likely in the Fe3+ state. We focused on the characterization of the heme-cofactor, its accessibility with respect to the conformation of Lcp1VH2, and the identification of putative histidine residues involved in the coordination of heme. A change was detectable in UV/Vis-spectra of reduced Lcp1VH2 when imidazole was added, showing that Lcp1VH2 "as isolated" occurs in an open state, directly being accessible for external ligands. In addition, three highly conserved histidines (H195, H200 and H228), presumably acting as ligands coordinating the heme within the heme pocket, were replaced with alanines by site-directed mutagenesis. The effect of these changes on in vivo rubber-mineralization was investigated. The lcp- deletion mutant complemented with the H195A variant of lcp1 VH2 was unable to mineralize poly(cis-1,4-isoprene). In vitro analyses of purified, recombinant Lcp1VH2H195A confirmed the loss of enzyme activity, which could be ascribed to the loss of heme. Hence, H195 is essential for the association of heme-b in the central region of Lcp1VH2.
Histidine at Position 195 is Essential for Association of Heme- b in Lcp1VH2
Oetermann, Sylvia; Vivod, Robin; Hiessl, Sebastian; Hogeback, Jens; Holtkamp, Michael; Karst, Uwe; Steinbüchel, Alexander
2018-05-01
The latex clearing protein (Lcp) is the key enzyme of polyisoprene degradation in actinomycetes (Yikmis and Steinbüchel in Appl Environ Microbiol 78:4543-4551, https://doi.org/10.1128/AEM.00001-12 , 2012). In this study it was shown that Lcp from Gordonia polyisoprenivorans VH2 (Lcp1VH2) harbors a non-covalently bound heme b as cofactor, which was identified by pyridine hemochrome spectra and confirmed by LC/ESI-ToF-MS. It contains iron, most likely in the Fe3+ state. We focused on the characterization of the heme-cofactor, its accessibility with respect to the conformation of Lcp1VH2, and the identification of putative histidine residues involved in the coordination of heme. A change was detectable in UV/Vis-spectra of reduced Lcp1VH2 when imidazole was added, showing that Lcp1VH2 "as isolated" occurs in an open state, directly being accessible for external ligands. In addition, three highly conserved histidines (H195, H200 and H228), presumably acting as ligands coordinating the heme within the heme pocket, were replaced with alanines by site-directed mutagenesis. The effect of these changes on in vivo rubber-mineralization was investigated. The lcp- deletion mutant complemented with the H195A variant of lcp1 VH2 was unable to mineralize poly( cis-1,4-isoprene). In vitro analyses of purified, recombinant Lcp1VH2H195A confirmed the loss of enzyme activity, which could be ascribed to the loss of heme. Hence, H195 is essential for the association of heme- b in the central region of Lcp1VH2.
VH mode accessibility and global H-mode properties in previous and present JET configurations
Energy Technology Data Exchange (ETDEWEB)
Jones, T T.C.; Ali-Arshad, S; Bures, M; Christiansen, J P; Esch, H P.L. de; Fishpool, G; Jarvis, O N; Koenig, R; Lawson, K D; Lomas, P J; Marcus, F B; Sartori, R; Schunke, B; Smeulders, P; Stork, D; Taroni, A; Thomas, P R; Thomsen, K [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking
1994-07-01
In JET VH modes, there is a distinct confinement transition following the cessation of ELMs, observed in a wide variety of tokamak operating conditions, using both NBI and ICRF heating methods. Important factors which influence VH mode accessibility such as magnetic configuration and vessel conditions have been identified. The new JET pumped divertor configuration has much improved plasma shaping control and power and particle exhaust capability and should permit exploitation of plasmas with VH confinement properties over an even wider range of operating regimes, particularly at high plasma current; first H-modes have been obtained in the 1994 JET operating period and initial results are reported. (authors). 7 refs., 6 figs.
Gough, N M; Bernard, O
1981-01-01
To assess the contribution to immunoglobulin heavy chain diversity made by recombination between variable region (VH) genes and joining region (JH) genes, we have determined the sequence of about 2000 nucleotides spanning the rearranged JH gene cluster associated with the VH gene expressed in plasmacytoma HPC76. The active VH76 gene has recombined with the second germ-line JH gene. The region we have studied contains two other JH genes, designated JH3 and JH4. No other JH gene was found withi...
Directory of Open Access Journals (Sweden)
Chen Ming-Shun
2006-01-01
Full Text Available Abstract Background To have an insight into the Mayetiola destructor (Hessian fly genome, we performed an in silico comparative genomic analysis utilizing genetic mapping, genomic sequence and EST sequence data along with data available from public databases. Results Chromosome walking and FISH were utilized to identify a contig of 50 BAC clones near the telomere of the short arm of Hessian fly chromosome X2 and near the avirulence gene vH13. These clones enabled us to correlate physical and genetic distance in this region of the Hessian fly genome. Sequence data from these BAC ends encompassing a 760 kb region, and a fully sequenced and assembled 42.6 kb BAC clone, was utilized to perform a comparative genomic study. In silico gene prediction combined with BLAST analyses was used to determine putative orthology to the sequenced dipteran genomes of the fruit fly, Drosophila melanogaster, and the malaria mosquito, Anopheles gambiae, and to infer evolutionary relationships. Conclusion This initial effort enables us to advance our understanding of the structure, composition and evolution of the genome of this important agricultural pest and is an invaluable tool for a whole genome sequencing effort.
Impurity penetration and transport during VH-mode on DIII-D
International Nuclear Information System (INIS)
Lippmann, S.I.; Evans, T.E.; Jackson, G.L.; West, W.P.
1992-05-01
A new modeling effort is made in order to understand the observed relatively low levels of impurity contamination during the VH-mode phase on DIII-D, as compared to those observed during the H-mode phase of selected discharges. The key element is the inclusion of the real 2-D flux surface geometry in the prediction of impurity penetration of sputtered atoms through the scrape-off layer into the core plasma. Of the elements which determine the impurity content in the plasma: sputtering yield, penetration, and core transport, the penetration through the scrape-off layer is found to be the most determinative factor. The low impurity content in VH-mode is attributed to the development of a scrape-off layer with higher density and temperature properties than those normally obtained in H-mode
DEFF Research Database (Denmark)
Hansen, Tina Østergaard; Lange, Anders Blaabjerg; Barington, Torben
2015-01-01
Rearrangement of the Ig locus occurs in two steps. First, a JH gene is rearranged to a D gene followed by a VH gene rearranging to the DJH rearrangement. By next generation sequencing, we analyzed 9969 unique DJH rearrangements and 5919 unique VHDJH rearrangements obtained from peripheral blood B...... frequently than JH locus distal D genes, whereas VH locus proximal D genes were observed more frequently in nonproductive VHDJH rearrangements. We further demonstrate that the distance between VH, D, and JH gene segments influence their ability to rearrange within the human Ig locus....
Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R
1995-09-01
The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II
Beta limits in H-modes and VH-modes in JET
Energy Technology Data Exchange (ETDEWEB)
Smeulders, P; Hender, T C; Huysmans, G; Marcus, F; Ali-Arshad, S; Alper, B; Balet, B; Bures, M; Deliyanakis, N; Esch, H de; Fshpool, G; Jarvis, O N; Jones, T T.C.; Ketner, W; Koenig, R; Lawson, K; Lomas, P; O` Brien, D; Sadler, G; Stok, D; Stubberfield, P; Thomas, P; Thomen, K; Wesson, J [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking; Nave, M F [Universidade Tecnica, Lisbon (Portugal). Inst. Superior Tecnico
1994-07-01
In Hot-ion H- and VH-modes, the highest achieved beta was about 10% below the Troyon value in the best case of discharge 26087. The operational space of the high beta discharges obtained before March 1992 has been explored as function of the parameters H{sub ITER89P}, {beta}{sub n}, q{sub 95}, I{sub p}. Also, a limiting envelope on the fusion reactivity as a function of the average plasma pressure and beta has been observed with R{sub DD} related to {beta}{sub {phi}}{sup 2}.B{sub {phi}}{sup 4}. MHD stability analysis shows that the JET VH modes at the edge are in the second region for ballooning mode stability. The dependence of ballooning stability and the n=1 external kink on the edge current density is analyzed. (authors). 6 figs., 6 refs.
Steiniger, Sebastian C J; Dunkle, William E; Bammert, Gary F; Wilson, Thomas L; Krishnan, Abhiram; Dunham, Steven A; Ippolito, Gregory C; Bainbridge, Graeme
2014-05-01
Complementarity determining regions (CDR) are responsible for binding antigen and provide substantial diversity to the antibody repertoire, with VH CDR3 of the immunoglobulin variable heavy (VH) domain playing a dominant role. In this study, we examined 1200 unique canine VH and 500 unique variable light (VL) sequences of large and small canine breeds derived from peripheral B cells. Unlike the human and murine repertoire, the canine repertoire is heavily dominated by the Canis lupus familiaris IGHV1 subgroup, evolutionarily closest to the human IGHV3 subgroup. Our studies clearly show that the productive canine repertoire of all analyzed breeds shows similarities to both human and mouse; however, there are distinct differences in terms of VH CDR3 length and amino acid paratope composition. In comparison with the human and murine antibody repertoire, canine VH CDR3 regions are shorter in length than the human counterparts, but longer than the murine VH CDR3. Similar to corresponding human and mouse VH CDR3, the amino acids at the base of the VH CDR3 loop are strictly conserved. For identical CDR positions, there were significant changes in chemical paratope composition. Similar to human and mouse repertoires, the neutral amino acids tyrosine, glycine and serine dominate the canine VH CDR3 interval (comprising 35%) although the interval is nonetheless relatively depleted of tyrosine when compared to human and mouse. Furthermore, canine VH CDR3 displays an overrepresentation of the neutral amino acid threonine and the negatively charged aspartic acid while proline content is similar to that in the human repertoire. In general, the canine repertoire shows a bias towards small, negatively charged amino acids. Overall, this analysis suggests that functional canine therapeutic antibodies can be obtained from human and mouse sequences by methods of speciation and affinity maturation. Copyright © 2014 Elsevier Ltd. All rights reserved.
Allegrucci, M; Young-Cooper, G O; Alexander, C B; Newman, B A; Mage, R G
1991-02-01
The rabbit is unique in having well-defined allotypes in the variable region of the heavy chain. Products of the VHa locus, (with alleles a1, a2, and a3), account for the majority of the serum immunoglobulins. A small percentage of the serum immunoglobulins are a-negative. In 1986, Kelus and Weiss described a mutation that depressed the expression of the Ig VH a2 genes in an a1/a2 rabbit. From this animal the Alicia rabbit strain was developed and the mutation was termed ali. We previously showed, using Southern analysis and the transverse alternating field electrophoresis technique, that the difference between the ali rabbit and normal is a relatively small deletion including some of the most 3' VH genes. The most JH proximal 3' VH1 genes in DNA from normal rabbits of a1, a2 and a3 haplotypes encode a1, a2 and a3 molecules respectively, and it has been suggested that these genes are responsible for allelic inheritance of VHa allotypes. The present study suggests that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression in rabbits because VH gene(s) in this region are the target(s) of preferential VDJ rearrangements. This raises the possibility that mechanisms such as somatic gene conversion and hypermutation are at work to generate the antibody repertoire in this species. Our data support the view that the 3' VH1 gene may be the preferred target for rearrangement in normal rabbits, and for the normal chromosome in heterozygous ali animals. However, homozygous ali rabbits with a deletion that removed the a2-encoding VH1 on both chromosomes do survive, rearrange other VH genes and produce normal levels of immunoglobulins as well as a significant percentage of B cells which bear the a2 allotype. This challenges the view that one VH gene, VH1, is solely responsible for the inheritance pattern of VHa allotypes.
Directory of Open Access Journals (Sweden)
Yew Margaret
2007-03-01
Full Text Available Abstract Background Natural antibodies directed at carbohydrates reject porcine xenografts. They are initially expressed in germline configuration and are encoded by a small number of structurally-related germline progenitors. The transplantation of genetically-modified pig organs prevents hyperacute rejection, but delayed graft rejection still occurs, partly due to humoral responses. IgVH genes encoding induced xenoantibodies are predominantly, not exclusively, derived from germline progenitors in the VH3 family. We have previously identified the immunoglobulin heavy chain genes encoding VH3 xenoantibodies in patients and primates. In this manuscript, we complete the structural analysis of induced xenoantibodies by identifying the IgVH genes encoding the small proportion of VH4 xenoantibodies and the germline progenitors encoding xenoantibody light chains. This information has been used to define the xenoantibody/carbohydrate binding site using computer-simulated modeling. Results The VH4-59 gene encodes antibodies in the VH4 family that are induced in human patients mounting active xenoantibody responses. The light chain of xenoantibodies is encoded by DPK5 and HSIGKV134. The structural information obtained by sequencing analysis was used to create computer-simulated models. Key contact sites for xenoantibody/carbohydrate interaction for VH3 family xenoantibodies include amino acids in sites 31, 33, 50, 57, 58 and the CDR3 region of the IgVH gene. Site-directed mutagenesis indicates that mutations in predicted contact sites alter binding to carbohydrate xenoantigens. Computer-simulated modeling suggests that the CDR3 region directly influences binding. Conclusion Xenoantibodies induced during early and delayed xenograft responses are predominantly encoded by genes in the VH3 family, with a small proportion encoded by VH4 germline progenitors. This restricted group can be identified by the unique canonical structure of the light chain, heavy
Using gene co-expression network analysis to predict biomarkers for chronic lymphocytic leukemia
Directory of Open Access Journals (Sweden)
Borlawsky Tara B
2010-10-01
Full Text Available Abstract Background Chronic lymphocytic leukemia (CLL is the most common adult leukemia. It is a highly heterogeneous disease, and can be divided roughly into indolent and progressive stages based on classic clinical markers. Immunoglobin heavy chain variable region (IgVH mutational status was found to be associated with patient survival outcome, and biomarkers linked to the IgVH status has been a focus in the CLL prognosis research field. However, biomarkers highly correlated with IgVH mutational status which can accurately predict the survival outcome are yet to be discovered. Results In this paper, we investigate the use of gene co-expression network analysis to identify potential biomarkers for CLL. Specifically we focused on the co-expression network involving ZAP70, a well characterized biomarker for CLL. We selected 23 microarray datasets corresponding to multiple types of cancer from the Gene Expression Omnibus (GEO and used the frequent network mining algorithm CODENSE to identify highly connected gene co-expression networks spanning the entire genome, then evaluated the genes in the co-expression network in which ZAP70 is involved. We then applied a set of feature selection methods to further select genes which are capable of predicting IgVH mutation status from the ZAP70 co-expression network. Conclusions We have identified a set of genes that are potential CLL prognostic biomarkers IL2RB, CD8A, CD247, LAG3 and KLRK1, which can predict CLL patient IgVH mutational status with high accuracies. Their prognostic capabilities were cross-validated by applying these biomarker candidates to classify patients into different outcome groups using a CLL microarray datasets with clinical information.
Wu, Leeying; Oficjalska, Katarzyna; Lambert, Matthew; Fennell, Brian J; Darmanin-Sheehan, Alfredo; Ní Shúilleabháin, Deirdre; Autin, Bénédicte; Cummins, Emma; Tchistiakova, Lioudmila; Bloom, Laird; Paulsen, Janet; Gill, Davinder; Cunningham, Orla; Finlay, William J J
2012-01-01
Examination of 1269 unique naive chicken V(H) sequences showed that the majority of positions in the framework (FW) regions were maintained as germline, with high mutation rates observed in the CDRs. Many FW mutations could be clearly related to the modulation of CDR structure or the V(H)-V(L) interface. CDRs 1 and 2 of the V(H) exhibited frequent mutation in solvent-exposed positions, but conservation of common structural residues also found in human CDRs at the same positions. In comparison with humans and mice, the chicken CDR3 repertoire was skewed toward longer sequences, was dominated by small amino acids (G/S/A/C/T), and had higher cysteine (chicken, 9.4%; human, 1.6%; and mouse, 0.25%) but lower tyrosine content (chicken, 9.2%; human, 16.8%; and mouse 26.4%). A strong correlation (R(2) = 0.97) was observed between increasing CDR3 length and higher cysteine content. This suggests that noncanonical disulfides are strongly favored in chickens, potentially increasing CDR stability and complexity in the topology of the combining site. The probable formation of disulfide bonds between CDR3 and CDR1, FW2, or CDR2 was also observed, as described in camelids. All features of the naive repertoire were fully replicated in the target-selected, phage-displayed repertoire. The isolation of a chicken Fab with four noncanonical cysteines in the V(H) that exhibits 64 nM (K(D)) binding affinity for its target proved these constituents to be part of the humoral response, not artifacts. This study supports the hypothesis that disulfide bond-constrained CDR3s are a structural diversification strategy in the restricted germline v-gene repertoire of chickens.
Energy Technology Data Exchange (ETDEWEB)
Wei, X. [Brookhaven National Lab. (BNL), Upton, NY (United States); Braverman, J. [Brookhaven National Lab. (BNL), Upton, NY (United States); Miranda, M. [Brookhaven National Lab. (BNL), Upton, NY (United States); Rosario, M. E. [Brookhaven National Lab. (BNL), Upton, NY (United States); Costantino, C. J. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2015-02-01
This report documents the results of a study to determine the depth-dependent V/H ratios of ground motion response spectra in the free field. The V/H ratios reported herein were developed from a worldwide database of surface and downhole acceleration recordings obtained from 45 vertical array stations. This database was specifically compiled for this project, and includes information from a diversity of active tectonic regions (California, Alaska, Taiwan, Japan), site conditions (rock to soft soil), ground motion intensity levels (PGAs between 0.01 g and 0.50 g), magnitudes (between ML 2.78 and JMA 8.1), epicentral distances (between 3.2 km and 812 km), and source depths (between 1.2 km and 112 km), as well as sensors at surface and at a wide range of depths relevant to the project. To study the significance of the depth effect, V/H ratios from all the records were sorted into a number of depth bins relevant to the project, and statistics (average, standard deviation, coefficient of variation, 16th, 50th, and 84th percentiles) of the V/H ratios within each bin were computed. Similar analyses were repeated, controlling for different site conditions, ground motion intensity levels, array locations, and source depths, to study their relative effect on the V/H ratios. Our findings confirm the importance of the depth effect on the V/H ratios. The research findings in this report can be used to provide guidance on the significance of the depth effect, and the extent to which this effect should be considered in the seismic design of deeply embedded SMR structures and NPP structures in general.
International Nuclear Information System (INIS)
Yetis, H; Altinkok, A; Olutas, M; Kilic, A; Kilic, K; Cetin, O
2006-01-01
Magnetovoltage measurements (V-H curves) were carried out in superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material as a function of current (I), temperature (T), field sweep rate (dH/dt) and field orientation with respect to the transport current. A relative decrease in the dissipation measured in V-H curves was observed as dH/dt is increased, which implies that the time spent to plot the whole cycle has an importance on the evolution of the V-H curves. Thus, it could be possible to observe the relaxation effects in magnetovoltage measurements. In addition, the several significant steps and plateaus in V-H curves evolve depending on the magnitude of the transport current and also dH/dt. These observations were attributed to locking of the flux lines to decrease or increase in size of the easy motion flow channels. The strong hysteresis effects in V-H curves were discussed mainly by means of the flux trapping within the granularity of sample and the different degree of the inhomogeneous flux motion with respect to the sweeping of the external magnetic field up and down
International Nuclear Information System (INIS)
Gilman-Sachs, A.; Roux, K.H.; Horing, W.J.; Dray, S.
1982-01-01
Anti-allotype antisera were produced that identified eight rabbit IgM allotypic specificities, n80, n81, n82, n83, n84, n85, n86, and n87. The n locus Cμ genes controlling these IgM allotypic specificities are closely linked to the a (VH subgroup) locus. The genes controlling these allotypic specificities were found to be in the heavy chain chromosomal region and were assigned to 11 haplotypes present in our rabbit colony. The n locus and a locus genes appeared in the haplotypes in six combinations: a 1 n 81 , a 2 n/sup 81,n87/, a 1 n/sup 80,83/, a 2 n/sup 80,82,87/, a 3 n/sup 81,84,85/ and a 3 n/sup 80,84,86,87/. By radioprecipitation analysis, 70 to 80% of serum IgM reacts with the antiserum directed to each n locus allotypic specificity found encoded in one haplotype; thus, each allotypic specificity of the haplotype is present on the same IgM molecule. When sera from a locus allotype-suppressed homozygous rabbits were tested for expression of each n locus allotypic specificity, n80, n81, and n87 were still expressed, whereas n82, n83, n84, n85, and n86 were not. These data provide direct evidence that some IgM specificities are expressed independently of the a locus (i.e., ''true''), and other s are dependent on the expression of an a locus specificity (i.e., conformational). The expression of the ''true'' allotypic specificities probably reflects genetic control of the germline Cμ gene, and the expression of ''conformationally dependent'' allotypic specificities probably reflects the interaction of VH and Cμ gene segments. This distinction is important and must be recognized when evaluating the genetics and structure of the IgM molecule
DEFF Research Database (Denmark)
Ohm-Laursen, Line; Nielsen, Morten; Larsen, Stine R
2006-01-01
gene (VH) replacement. Safe conclusions require large, well-defined sequence samples and algorithms minimizing stochastic assignment of segments. Two computer programs were developed for analysis of heavy chain joints. JointHMM is a profile hidden Markow model, while JointML is a maximum...
Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie
2013-01-01
This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156
Irons, Richard D; Le, Anh; Bao, Liming; Zhu, Xiongzeng; Ryder, John; Wang, Xiao Qin; Ji, Meirong; Chen, Yan; Wu, Xichun; Lin, Guowei
2009-12-01
The clinical, cytogenetic and molecular features of chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL), a disease previously considered to be rare in Asia, were examined in consecutive series of 70 cases diagnosed by our laboratory over a 30-month period. Clonal abnormalities were observed in 80% of CLL/SLL cases using a combination of conventional cytogenetic and fluorescence in situ hybridization (FISH) analysis. Those involving 14q32/IGH were the most frequent (24 cases), followed by trisomy 12 and 11q abnormalities. IgV(H) gene usage was non-random with over-representation of V(H)4-34, V(H)3-23 and a previously unreported increase in V(H)3-48 gene use. Somatic hypermutation (SHM) of IgV(H) germline sequences was observed in 56.5% of cases with stereotyped patterns of SHM observed in V(H)4-34 heavy chain complimentary-determining (HCDR1) and framework region CFR2 sequences. These findings in a Chinese population suggest subtle geographical differences in IgV(H) gene usage while the remarkably specific pattern of SHM suggest that a relatively limited set of antigens may be involved in the development of this disease worldwide. IgV(H) gene mutation status was a significant predictor of initial survival in CLL/SLL. However, an influence of karyotype on prognosis was not observed.
DEFF Research Database (Denmark)
Lorenzen, Niels; Cupit, P.M.; Secombes, C.J.
2000-01-01
and their neutralising activity was evident. Binding kinetic analyses by plasmon resonance identified differences in the dissociation rate constant (kd) as a possible explanation for the different reactivity levels of the MAbs. The Ig variable heavy (VH) and light (V kappa) domain gene sequences of the three hybridomas...... were compared. The inferred amino acid sequence of the two neutralising antibody VH domains differed by three amino acid residues (97% identity) and only one residue difference was evident in the Vk. domains. In contrast, IP1H3 shared only 38 and 39% identity with the 3F1A2 and 3F1H10 VH domains...... respectively and 49 and 50% identity with the 3F1A2 and 3F1H10 VK domains respectively. The neutralising antibodies were produced by hybridomas originating from the same fusion and the high nucleotide sequence homology of the variable Ig gene regions indicated that the plasma cell partners of the hybridomas...
Analysis of IgG4-positive clones in affected organs of IgG4-related disease.
Kakuchi, Yasushi; Yamada, Kazunori; Ito, Kiyoaki; Hara, Satoshi; Fujii, Hiroshi; Yamagishi, Masakazu; Kawano, Mitsuhiro
2016-11-01
We investigated class switch reaction (CSR) in affected organs and evaluated whether the same or genetically related clones exist in IgG4-RD. We studied three patients with IgG4-RD. Total cellular RNA was extracted from salivary glands and peripheral blood and lung tissue. Activation-induced cytidine deaminase (AID) and immunoglobulin heavy chain third complementarity determining region (IgVH-CDR3) of IgM and IgG4 were detected by reverse transcription polymerase chain reaction (RT-PCR). We analyzed the clonal relationship of infiltrating IgG4-positive cells, as compared with IgM. We determined the existence of common clones among organs and patients. AID was expressed in salivary glands of all patients and lung tissue in one. Closely related IgVH-CDR3 sequences in infiltrating IgG4-positive cells were detected in salivary glands and lung tissue. Identical IgVH-CDR3 sequence between IgM and IgG4 in salivary glands was detected in one patient, indicating CSR in salivary glands. Identical IgVH-CDR3 sequences of IgG4-positive cells were detected between salivary glands and peripheral blood in two patients. Four identical sequences of IgVH-CDR3 existed between patients. Interestingly, one of the four sequences was detected in all patients. Our results demonstrate the existence of common antigen(s) shared by patients with IgG4-RD.
Principles for the organization of gene-sets.
Li, Wentian; Freudenberg, Jan; Oswald, Michaela
2015-12-01
A gene-set, an important concept in microarray expression analysis and systems biology, is a collection of genes and/or their products (i.e. proteins) that have some features in common. There are many different ways to construct gene-sets, but a systematic organization of these ways is lacking. Gene-sets are mainly organized ad hoc in current public-domain databases, with group header names often determined by practical reasons (such as the types of technology in obtaining the gene-sets or a balanced number of gene-sets under a header). Here we aim at providing a gene-set organization principle according to the level at which genes are connected: homology, physical map proximity, chemical interaction, biological, and phenotypic-medical levels. We also distinguish two types of connections between genes: actual connection versus sharing of a label. Actual connections denote direct biological interactions, whereas shared label connection denotes shared membership in a group. Some extensions of the framework are also addressed such as overlapping of gene-sets, modules, and the incorporation of other non-protein-coding entities such as microRNAs. Copyright © 2015 Elsevier Ltd. All rights reserved.
ATLAS searches for VH, HH, VV, V+$\\gamma$/$\\gamma\\gamma$ resonances
AUTHOR|(INSPIRE)INSPIRE-00441490; The ATLAS collaboration
2017-01-01
The discovery of a Higgs boson at the Large Hadron Collider motivates searches for physics beyond the Standard Model in channels involving coupling to the Higgs boson. A search for massive resonances decaying into couples of bosons is described. The considered final states are: $HH$, $VH$, $VV$, $V\\gamma$ and $\\gamma\\gamma$ with $V$ indicating either the $W$ or the $Z$ boson. Final states with different number of leptons or photons and where, in many cases, at least one Higgs decays into a b-quark pair are studied using different jet reconstruction techniques which allow to optimize the signal acceptance for low or high Higgs boson transverse momentum. The most recent diboson resonance searches using LHC Run 2 data are described.
Directory of Open Access Journals (Sweden)
Soe Hee Ann
Full Text Available To assess the serial changes of de novo coronary lesions treated with paclitaxel-coated balloon (PCB using intravascular ultrasound virtual histology (IVUS-VH and fractional flow reserve (FFR.This prospective observational study enrolled 27 patients with coronary artery disease treated with PCB who underwent coronary angiography, IVUS-VH and FFR before, immediately after intervention and at 9 months. 28 de novo lesions were successfully treated with PCB. Angiographic late luminal loss was 0.02 ± 0.27 mm. Mean vessel and lumen areas showed increase at 9 months (12.0 ± 3.5 mm(2 to 13.2 ± 3.9 mm(2, p <0.001; and 5.4 ± 1.2 mm(2 to 6.5 ± 1.8 mm(2, p <0.001, respectively. Although mean plaque area was unchanged (6.6 ± 2.6 mm2 to 6.6 ± 2.4 mm(2, p = 0.269, percent atheroma volume decreased significantly (53.4 ± 7.9% to 49.5 ± 6.4%, p = 0.002. The proportion of plaque compositions including fibrous, fibrofatty, dense calcium and necrotic core by IVUS-VH was unchanged at 9 months. The FFR of the treated lesion was 0.71 ± 0.13 pre-procedure, 0.87 ± 0.06 post-procedure and 0.84 ± 0.06 at follow-up.De novo coronary lesions treated with PCB showed persistent anatomical and physiological patency with plaque redistribution and vessel remodeling without chronic elastic recoil or plaque compositional change during follow-up.
Immunoglobulin Genomics in the Guinea Pig (Cavia porcellus)
Guo, Yongchen; Bao, Yonghua; Meng, Qingwen; Hu, Xiaoxiang; Meng, Qingyong; Ren, Liming; Li, Ning; Zhao, Yaofeng
2012-01-01
In science, the guinea pig is known as one of the gold standards for modeling human disease. It is especially important as a molecular and cellular biology model for studying the human immune system, as its immunological genes are more similar to human genes than are those of mice. The utility of the guinea pig as a model organism can be further enhanced by further characterization of the genes encoding components of the immune system. Here, we report the genomic organization of the guinea pig immunoglobulin (Ig) heavy and light chain genes. The guinea pig IgH locus is located in genomic scaffolds 54 and 75, and spans approximately 6,480 kb. 507 VH segments (94 potentially functional genes and 413 pseudogenes), 41 DH segments, six JH segments, four constant region genes (μ, γ, ε, and α), and one reverse δ remnant fragment were identified within the two scaffolds. Many VH pseudogenes were found within the guinea pig, and likely constituted a potential donor pool for gene conversion during evolution. The Igκ locus mapped to a 4,029 kb region of scaffold 37 and 24 is composed of 349 Vκ (111 potentially functional genes and 238 pseudogenes), three Jκ and one Cκ genes. The Igλ locus spans 1,642 kb in scaffold 4 and consists of 142 Vλ (58 potentially functional genes and 84 pseudogenes) and 11 Jλ -Cλ clusters. Phylogenetic analysis suggested the guinea pig’s large germline VH gene segments appear to form limited gene families. Therefore, this species may generate antibody diversity via a gene conversion-like mechanism associated with its pseudogene reserves. PMID:22761756
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
Comparative modular analysis of gene expression in vertebrate organs
Directory of Open Access Journals (Sweden)
Piasecka Barbara
2012-03-01
Full Text Available Abstract Background The degree of conservation of gene expression between homologous organs largely remains an open question. Several recent studies reported some evidence in favor of such conservation. Most studies compute organs' similarity across all orthologous genes, whereas the expression level of many genes are not informative about organ specificity. Results Here, we use a modularization algorithm to overcome this limitation through the identification of inter-species co-modules of organs and genes. We identify such co-modules using mouse and human microarray expression data. They are functionally coherent both in terms of genes and of organs from both organisms. We show that a large proportion of genes belonging to the same co-module are orthologous between mouse and human. Moreover, their zebrafish orthologs also tend to be expressed in the corresponding homologous organs. Notable exceptions to the general pattern of conservation are the testis and the olfactory bulb. Interestingly, some co-modules consist of single organs, while others combine several functionally related organs. For instance, amygdala, cerebral cortex, hypothalamus and spinal cord form a clearly discernible unit of expression, both in mouse and human. Conclusions Our study provides a new framework for comparative analysis which will be applicable also to other sets of large-scale phenotypic data collected across different species.
Comparative modular analysis of gene expression in vertebrate organs.
Piasecka, Barbara; Kutalik, Zoltán; Roux, Julien; Bergmann, Sven; Robinson-Rechavi, Marc
2012-03-29
The degree of conservation of gene expression between homologous organs largely remains an open question. Several recent studies reported some evidence in favor of such conservation. Most studies compute organs' similarity across all orthologous genes, whereas the expression level of many genes are not informative about organ specificity. Here, we use a modularization algorithm to overcome this limitation through the identification of inter-species co-modules of organs and genes. We identify such co-modules using mouse and human microarray expression data. They are functionally coherent both in terms of genes and of organs from both organisms. We show that a large proportion of genes belonging to the same co-module are orthologous between mouse and human. Moreover, their zebrafish orthologs also tend to be expressed in the corresponding homologous organs. Notable exceptions to the general pattern of conservation are the testis and the olfactory bulb. Interestingly, some co-modules consist of single organs, while others combine several functionally related organs. For instance, amygdala, cerebral cortex, hypothalamus and spinal cord form a clearly discernible unit of expression, both in mouse and human. Our study provides a new framework for comparative analysis which will be applicable also to other sets of large-scale phenotypic data collected across different species.
Cross-organism learning method to discover new gene functionalities.
Domeniconi, Giacomo; Masseroli, Marco; Moro, Gianluca; Pinoli, Pietro
2016-04-01
Knowledge of gene and protein functions is paramount for the understanding of physiological and pathological biological processes, as well as in the development of new drugs and therapies. Analyses for biomedical knowledge discovery greatly benefit from the availability of gene and protein functional feature descriptions expressed through controlled terminologies and ontologies, i.e., of gene and protein biomedical controlled annotations. In the last years, several databases of such annotations have become available; yet, these valuable annotations are incomplete, include errors and only some of them represent highly reliable human curated information. Computational techniques able to reliably predict new gene or protein annotations with an associated likelihood value are thus paramount. Here, we propose a novel cross-organisms learning approach to reliably predict new functionalities for the genes of an organism based on the known controlled annotations of the genes of another, evolutionarily related and better studied, organism. We leverage a new representation of the annotation discovery problem and a random perturbation of the available controlled annotations to allow the application of supervised algorithms to predict with good accuracy unknown gene annotations. Taking advantage of the numerous gene annotations available for a well-studied organism, our cross-organisms learning method creates and trains better prediction models, which can then be applied to predict new gene annotations of a target organism. We tested and compared our method with the equivalent single organism approach on different gene annotation datasets of five evolutionarily related organisms (Homo sapiens, Mus musculus, Bos taurus, Gallus gallus and Dictyostelium discoideum). Results show both the usefulness of the perturbation method of available annotations for better prediction model training and a great improvement of the cross-organism models with respect to the single-organism ones
The evolution of multiple isotypic IgM heavy chain genes in the shark.
Lee, Victor; Huang, Jing Li; Lui, Ming Fai; Malecek, Karolina; Ohta, Yuko; Mooers, Arne; Hsu, Ellen
2008-06-01
The IgM H chain gene organization of cartilaginous fishes consists of 15-200 miniloci, each with a few gene segments (V(H)-D1-D2-J(H)) and one C gene. This is a gene arrangement ancestral to the complex IgH locus that exists in all other vertebrate classes. To understand the molecular evolution of this system, we studied the nurse shark, which has relatively fewer loci, and characterized the IgH isotypes for organization, functionality, and the somatic diversification mechanisms that act upon them. Gene numbers differ slightly between individuals ( approximately 15), but five active IgM subclasses are always present. Each gene undergoes rearrangement that is strictly confined within the minilocus; in B cells there is no interaction between adjacent loci located > or =120 kb apart. Without combinatorial events, the shark IgM H chain repertoire is based on junctional diversity and, subsequently, somatic hypermutation. We suggest that the significant contribution by junctional diversification reflects the selected novelty introduced by RAG in the early vertebrate ancestor, whereas combinatorial diversity coevolved with the complex translocon organization. Moreover, unlike other cartilaginous fishes, there are no germline-joined VDJ at any nurse shark mu locus, and we suggest that such genes, when functional, are species-specific and may have specialized roles. With an entire complement of IgM genes available for the first time, phylogenetic analyses were performed to examine how the multiple Ig loci evolved. We found that all domains changed at comparable rates, but V(H) appears to be under strong positive selection for increased amino acid sequence diversity, and surprisingly, so does Cmicro2.
Jet substructure and probes of CP violation in Vh production
Energy Technology Data Exchange (ETDEWEB)
Godbole, R.M. [Centre for High Energy Physics, Indian Institute of Science,Sir C.V. Raman Road, Bangalore 560012 (India); Miller, D.J. [School of Physics and Astronomy, Scottish Universities Physics Alliance, University of Glasgow,University Avenue, Glasgow G12 8QQ, Scotland (United Kingdom); Mohan, K.A. [Centre for High Energy Physics, Indian Institute of Science,Sir C.V. Raman Road, Bangalore 560012 (India); White, C.D. [School of Physics and Astronomy, Scottish Universities Physics Alliance, University of Glasgow,University Avenue, Glasgow G12 8QQ, Scotland (United Kingdom)
2015-04-20
We analyse the hVV (V=W,Z) vertex in a model independent way using Vh production. To that end, we consider possible corrections to the Standard Model Higgs Lagrangian, in the form of higher dimensional operators which parametrise the effects of new physics. In our analysis, we pay special attention to linear observables that can be used to probe CP violation in the same. By considering the associated production of a Higgs boson with a vector boson (W or Z), we use jet substructure methods to define angular observables which are sensitive to new physics effects, including an asymmetry which is linearly sensitive to the presence of CP odd effects. We demonstrate how to use these observables to place bounds on the presence of higher dimensional operators, and quantify these statements using a log likelihood analysis. Our approach allows one to probe separately the hZZ and hWW vertices, involving arbitrary combinations of BSM operators, at the Large Hadron Collider.
The organic fraction of bubble-generated, accumulation mode Sea Spray Aerosol (SSA
Directory of Open Access Journals (Sweden)
R. L. Modini
2010-03-01
Full Text Available Recent studies have detected a dominant accumulation mode (~100 nm in the Sea Spray Aerosol (SSA number distribution. There is evidence to suggest that particles in this mode are composed primarily of organics. To investigate this hypothesis we conducted experiments on NaCl, artificial SSA and natural SSA particles with a Volatility-Hygroscopicity-Tandem-Differential-Mobility-Analyser (VH-TDMA. NaCl particles were atomiser generated and a bubble generator was constructed to produce artificial and natural SSA particles. Natural seawater samples for use in the bubble generator were collected from biologically active, terrestrially-affected coastal water in Moreton Bay, Australia. Differences in the VH-TDMA-measured volatility curves of artificial and natural SSA particles were used to investigate and quantify the organic fraction of natural SSA particles. Hygroscopic Growth Factor (HGF data, also obtained by the VH-TDMA, were used to confirm the conclusions drawn from the volatility data. Both datasets indicated that the organic fraction of our natural SSA particles evaporated in the VH-TDMA over the temperature range 170–200 °C. The organic volume fraction for 71–77 nm natural SSA particles was 8±6%. Organic volume fraction did not vary significantly with varying water residence time (40 s to 24 h in the bubble generator or SSA particle diameter in the range 38–173 nm. At room temperature we measured shape- and Kelvin-corrected HGF at 90% RH of 2.46±0.02 for NaCl, 2.35±0.02 for artifical SSA and 2.26±0.02 for natural SSA particles. Overall, these results suggest that the natural accumulation mode SSA particles produced in these experiments contained only a minor organic fraction, which had little effect on hygroscopic growth. Our measurement of 8±6% is an order of magnitude below two previous measurements of the organic fraction in SSA particles of comparable sizes. We stress that our results were obtained using coastal seawater and
Louise S. Matheson; Daniel J. Bolland; Peter Chovanec; Felix Krueger; Simon Andrews; Hashem Koohy; Anne E. Corcoran
2017-01-01
V(D)J recombination is essential for the generation of diverse antigen receptor (AgR) repertoires. In B cells, immunoglobulin kappa (Igκ) light chain recombination follows immunoglobulin heavy chain (Igh) recombination. We recently developed the DNA-based VDJ-seq assay for the unbiased quantitation of Igh VH and DH repertoires. Integration of VDJ-seq data with genome-wide datasets revealed that two chromatin states at the recombination signal sequence (RSS) of VH genes are highly predictive o...
Eh-pH diagrams of the V-H2O system at 25,60 and 1000C
International Nuclear Information System (INIS)
Silva, F.T. da; Ogasawara, T.; Cassa, J.C.S.
1987-01-01
Free energies of the formation of vanadium ions in aqueous solutions at elevated temperatures were determined. Eh-pH diagrams at 25 0 C, 60 0 C and 100 0 C at different vanadium concentrations, using microcomputers were calculated and obtained. The effects of temperature and vanadium concentration on the predominance of vanadium species were examined. The Eh-pH diagrams for the V-H 2 O system were evaluated by comparisons with experimental data. (Author) [pt
Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun
2015-01-01
Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Directory of Open Access Journals (Sweden)
Feng-Xia Tian
Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Directory of Open Access Journals (Sweden)
Melissa C Sanchez
2017-06-01
Full Text Available Schistosomiasis is a chronic parasitic disease caused by sexually dimorphic blood flukes of the genus Schistosoma. Praziquantel (PZQ is the only drug widely available to treat the disease but does not kill juvenile parasites. Here we report the use of next generation sequencing to study the transcriptional effect of PZQ on murine hepatic inflammatory, immune and fibrotic responses to Schistosoma mansoni worms and eggs. An initial T helper cell 1 (Th1 response is induced against schistosomes in mice treated with drug vehicle (Vh around the time egg laying begins, followed by a T helper cell 2 (Th2 response and the induction of genes whose action leads to granuloma formation and fibrosis. When PZQ is administered at this time, there is a significant reduction in egg burden yet the hepatic Th1, Th2 and fibrotic responses are still observed in the absence of granuloma formation suggesting some degree of gene regulation may be induced by antigens released from the dying adult worms. Quantitative real-time PCR was used to examine the relative expression of 16 juvenile and adult S. mansoni genes during infection and their response to Vh and PZQ treatment in vivo. While the response of stress genes in adult parasites suggests the worms were alive immediately following exposure to PZQ, they were unable to induce transcription of any of the 9 genes encoding ATP-binding cassette (ABC transporters tested. In contrast, juvenile schistosomes were able to significantly induce the activities of ABCB, C and G family members, underscoring the possibility that these efflux systems play a major role in drug resistance.
Gene organization inside replication domains in mammalian genomes
Zaghloul, Lamia; Baker, Antoine; Audit, Benjamin; Arneodo, Alain
2012-11-01
We investigate the large-scale organization of human genes with respect to "master" replication origins that were previously identified as bordering nucleotide compositional skew domains. We separate genes in two categories depending on their CpG enrichment at the promoter which can be considered as a marker of germline DNA methylation. Using expression data in mouse, we confirm that CpG-rich genes are highly expressed in germline whereas CpG-poor genes are in a silent state. We further show that, whether tissue-specific or broadly expressed (housekeeping genes), the CpG-rich genes are over-represented close to the replication skew domain borders suggesting some coordination of replication and transcription. We also reveal that the transcription of the longest CpG-rich genes is co-oriented with replication fork progression so that the promoter of these transcriptionally active genes be located into the accessible open chromatin environment surrounding the master replication origins that border the replication skew domains. The observation of a similar gene organization in the mouse genome confirms the interplay of replication, transcription and chromatin structure as the cornerstone of mammalian genome architecture.
The chromosomal organization of horizontal gene transfer in bacteria.
Oliveira, Pedro H; Touchon, Marie; Cury, Jean; Rocha, Eduardo P C
2017-10-10
Bacterial adaptation is accelerated by the acquisition of novel traits through horizontal gene transfer, but the integration of these genes affects genome organization. We found that transferred genes are concentrated in only ~1% of the chromosomal regions (hotspots) in 80 bacterial species. This concentration increases with genome size and with the rate of transfer. Hotspots diversify by rapid gene turnover; their chromosomal distribution depends on local contexts (neighboring core genes), and content in mobile genetic elements. Hotspots concentrate most changes in gene repertoires, reduce the trade-off between genome diversification and organization, and should be treasure troves of strain-specific adaptive genes. Most mobile genetic elements and antibiotic resistance genes are in hotspots, but many hotspots lack recognizable mobile genetic elements and exhibit frequent homologous recombination at flanking core genes. Overrepresentation of hotspots with fewer mobile genetic elements in naturally transformable bacteria suggests that homologous recombination and horizontal gene transfer are tightly linked in genome evolution.Horizontal gene transfer (HGT) is an important mechanism for genome evolution and adaptation in bacteria. Here, Oliveira and colleagues find HGT hotspots comprising ~ 1% of the chromosomal regions in 80 bacterial species.
Oppezzo, P; Dighiero, G
2005-01-01
B-CLL cells express CD5 and IgM/IgD and thus have a mantle zone-like phenotype of naive cells, which, in normal conditions express unmutated Ig genes. However, recent studies have shown that 50%-70% of CLL harbour somatic mutations of VH genes, as if they had matured in a lymphoid follicle. Interestingly, the presence or absence of somatic hypermutation (SHM) process is associated with the use of particular VH genes. Particular alleles of the VH1-69 gene and the VH4-39 gene are preferentially expressed in an unmutated form, while VH4-34 or the majority of VH3 family genes frequently contain somatic mutations. The fact that some genes like VH1-69 and VH3-07 recombine this VH segment to particular JH segments and the restricted use of CDR3 sequences by CLLs expressing the VH4-39 gene suggest that the observed differences in BCR structure in B-CLL could result from selection by distinct antigenic epitopes. It is currently unclear whether this putative antigen-driven process could occur prior to leukaemic transformation and/or that the precursors were transformed into leukaemic cells at distinct maturational stages. The mutational profile of Ig genes has been shown to be associated with disease prognosis. These results could favour the idea that CLL could correspond to two different diseases that look alike in morphologic and phenotypic terms. In CLL with mutated Ig genes, the proliferating B cell may have transited through germinal centres, the physiologic site of hypermutation, whereas in CLL with unmutated Ig genes the malignant B cell may derive from a pre-germinal centre naïve B cell. Despite these clinical and molecular differences, recent studies on gene expression profiling of B-CLL cells showed that CLL is characterized by a common gene expression signature that is irrespective of Ig mutational status and differs from other lymphoid cancers and normal lymphoid subpopulations, suggesting that CLL cases share a common mechanism of transformation and/or cell of
Kirshner, Julia; Thulien, Kyle J; Kriangkum, Jitra; Motz, Sarah; Belch, Andrew R; Pilarski, Linda M
2011-02-01
A small percentage of cases of Waldenstrom macroglobulinemia (WM) present with biclonality, defined here as the rearrangement of two distinct VDJ gene segments. Here we investigated the expansion of two clones from a patient with WM expressing molecularly detectable clonotypic gene rearrangements, one V(H)3 and one V(H)4. Biclonality was determined in blood and bone marrow mononuclear cells using real-time quantitative PCR (RQ-PCR). V(H)4 expressing cells but not V(H)3 expressing cells underwent clonal expansion in 3-D culture of reconstructed WM bone marrow. After 3-D culture, secondary culture in a colony forming unit assay, and RQ-PCR, only the V(H)4 clone was shown to harbor a subpopulation with characteristics of cancer stem cells, including proliferative quiescence, self-regeneration, and the ability to generate clonotypic progeny, suggesting that the V(H)4, but not the V(H)3, clone is clinically significant. Enrichment of potential WM stem cells in 3-D cultures holds promise for monitoring their response to treatment and for testing new therapies.
Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization
International Nuclear Information System (INIS)
Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R.
2014-01-01
In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria.
Alkane biosynthesis genes in cyanobacteria and their transcriptional organization
Directory of Open Access Journals (Sweden)
Stephan eKlähn
2014-07-01
Full Text Available In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl-acyl carrier protein reductase (AAR and aldehyde deformylating oxygenase (ADO. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado and sll0209 (aar, that give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313 and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in
Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization
Energy Technology Data Exchange (ETDEWEB)
Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R., E-mail: wolfgang.hess@biologie.uni-freiburg.de [Genetics and Experimental Bioinformatics, Institute of Biology 3, Faculty of Biology, University of Freiburg, Freiburg (Germany)
2014-07-14
In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria.
Directory of Open Access Journals (Sweden)
Radhika Thokala
Full Text Available Adoptive immunotherapy infusing T cells with engineered specificity for CD19 expressed on B- cell malignancies is generating enthusiasm to extend this approach to other hematological malignancies, such as acute myelogenous leukemia (AML. CD123, or interleukin 3 receptor alpha, is overexpressed on most AML and some lymphoid malignancies, such as acute lymphocytic leukemia (ALL, and has been an effective target for T cells expressing chimeric antigen receptors (CARs. The prototypical CAR encodes a VH and VL from one monoclonal antibody (mAb, coupled to a transmembrane domain and one or more cytoplasmic signaling domains. Previous studies showed that treatment of an experimental AML model with CD123-specific CAR T cells was therapeutic, but at the cost of impaired myelopoiesis, highlighting the need for systems to define the antigen threshold for CAR recognition. Here, we show that CARs can be engineered using VH and VL chains derived from different CD123-specific mAbs to generate a panel of CAR+ T cells. While all CARs exhibited specificity to CD123, one VH and VL combination had reduced lysis of normal hematopoietic stem cells. This CAR's in vivo anti-tumor activity was similar whether signaling occurred via chimeric CD28 or CD137, prolonging survival in both AML and ALL models. Co-expression of inducible caspase 9 eliminated CAR+ T cells. These data help support the use of CD123-specific CARs for treatment of CD123+ hematologic malignancies.
Organization and evolution of the rat tyrosine hydroxylase gene
International Nuclear Information System (INIS)
Brown, E.R.; Coker, G.T. III; O'Malley, K.L.
1987-01-01
This report describes the organization of the rat tyrosine hydroxylase (TH) gene and compares its structure with the human phenylalanine hydroxylase gene. Both genes are single copy and contain 13 exons separated by 12 introns. Remarkably, the positions of 10 out 12 intron/exon boundaries are identical for the two genes. These results support the idea that these hydroxylases genes are members of a gene family which has a common evolutionary origin. The authors predict that this ancestral gene would have encoded exons similar to those of TH prior to evolutionary drift to other members of this gene family
The evolution of gene expression levels in mammalian organs
DEFF Research Database (Denmark)
Brawand, David; Soumillon, Magali; Necsulea, Anamaria
2011-01-01
and chromosomes, owing to differences in selective pressures: transcriptome change was slow in nervous tissues and rapid in testes, slower in rodents than in apes and monotremes, and rapid for the X chromosome right after its formation. Although gene expression evolution in mammals was strongly shaped......Changes in gene expression are thought to underlie many of the phenotypic differences between species. However, large-scale analyses of gene expression evolution were until recently prevented by technological limitations. Here we report the sequencing of polyadenylated RNA from six organs across...... ten species that represent all major mammalian lineages (placentals, marsupials and monotremes) and birds (the evolutionary outgroup), with the goal of understanding the dynamics of mammalian transcriptome evolution. We show that the rate of gene expression evolution varies among organs, lineages...
A search engine to identify pathway genes from expression data on multiple organisms
Directory of Open Access Journals (Sweden)
Zambon Alexander C
2007-05-01
Full Text Available Abstract Background The completion of several genome projects showed that most genes have not yet been characterized, especially in multicellular organisms. Although most genes have unknown functions, a large collection of data is available describing their transcriptional activities under many different experimental conditions. In many cases, the coregulatation of a set of genes across a set of conditions can be used to infer roles for genes of unknown function. Results We developed a search engine, the Multiple-Species Gene Recommender (MSGR, which scans gene expression datasets from multiple organisms to identify genes that participate in a genetic pathway. The MSGR takes a query consisting of a list of genes that function together in a genetic pathway from one of six organisms: Homo sapiens, Drosophila melanogaster, Caenorhabditis elegans, Saccharomyces cerevisiae, Arabidopsis thaliana, and Helicobacter pylori. Using a probabilistic method to merge searches, the MSGR identifies genes that are significantly coregulated with the query genes in one or more of those organisms. The MSGR achieves its highest accuracy for many human pathways when searches are combined across species. We describe specific examples in which new genes were identified to be involved in a neuromuscular signaling pathway and a cell-adhesion pathway. Conclusion The search engine can scan large collections of gene expression data for new genes that are significantly coregulated with a pathway of interest. By integrating searches across organisms, the MSGR can identify pathway members whose coregulation is either ancient or newly evolved.
Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M
2008-03-25
Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.
Gene prediction using the Self-Organizing Map: automatic generation of multiple gene models.
Mahony, Shaun; McInerney, James O; Smith, Terry J; Golden, Aaron
2004-03-05
Many current gene prediction methods use only one model to represent protein-coding regions in a genome, and so are less likely to predict the location of genes that have an atypical sequence composition. It is likely that future improvements in gene finding will involve the development of methods that can adequately deal with intra-genomic compositional variation. This work explores a new approach to gene-prediction, based on the Self-Organizing Map, which has the ability to automatically identify multiple gene models within a genome. The current implementation, named RescueNet, uses relative synonymous codon usage as the indicator of protein-coding potential. While its raw accuracy rate can be less than other methods, RescueNet consistently identifies some genes that other methods do not, and should therefore be of interest to gene-prediction software developers and genome annotation teams alike. RescueNet is recommended for use in conjunction with, or as a complement to, other gene prediction methods.
Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies
Directory of Open Access Journals (Sweden)
Kirsten Kehrein
2015-02-01
Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.
Stewart, Alex; Harrison, Joseph S; Regula, Lauren K; Lai, Jonathan R
2013-04-08
Analysis of factors contributing to high affinity antibody-protein interactions provides insight into natural antibody evolution, and guides the design of antibodies with new or enhanced function. We previously studied the interaction between antibody D5 and its target, a designed protein based on HIV-1 gp41 known as 5-Helix, as a model system [Da Silva, G. F.; Harrison, J. S.; Lai, J. R., Biochemistry, 2010, 49, 5464-5472]. Antibody D5 represents an interesting case study because it is derived from the VH1-69 germline segment; this germline segment is characterized by a hydrophobic second heavy chain complementarity determining region (HCDR2) that constitutes the major functional paratope in D5 and several antibodies derived from the same progenitor. Here we explore side chain requirements for affinity and specificity in D5 using phage display. Two D5-based libraries were prepared that contained diversity in all three light chain complementarity determining regions (LCDRs 1-3), and in the third HCDR (HCDR3). The first library allowed residues to vary among a restricted set of six amino acids (Tyr/Ala/Asp/Ser/His/Pro; D5-Lib-I). The second library was designed based on a survey of existing VH1-69 antibody structures (D5-Lib-II). Both libraries were subjected to multiple rounds of selection against 5-Helix, and individual clones characterized. We found that selectants from D5-Lib-I generally had moderate affinity and specificity, while many clones from D5-Lib-II exhibited D5-like properties. Additional analysis of the D5-Lib-II functional population revealed position-specific biases for particular amino acids, many that differed from the identity of those side chains in D5. Together these results suggest that there is some permissiveness for alternative side chains in the LCDRs and HCDR3 of D5, but that replacement with a minimal set of residues is not tolerated in this scaffold for 5-Helix recognition. This work provides novel information about this high
Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary
2014-11-25
The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot
An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...
Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.
Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N
1981-01-01
The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316
Relationship between organization and function of ribosomal genes in Drosophila melanogaster
International Nuclear Information System (INIS)
Karpen, G.H.
1987-01-01
In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional
Gene Transfers Between Distantly Related Organisms
Doolittle, Russell F.
2003-01-01
With the completion of numerous microbial genome sequences, reports of individual gene transfers between distantly related prokaryotes have become commonplace. On the other hand, transfers between prokaryotes and eukaryotes still excite the imagination. Many of these claims may be premature, but some are certainly valid. In this chapter, the kinds of supporting data needed to propose transfers between distantly related organisms and cite some interesting examples are considered.
ORGANIZATION OF THE nif GENES OF THE NONHETEROCYSTOUS CYANOBACTERIUM TRICHODESMIUM SP. IMS101.
Dominic, Benny; Zani, Sabino; Chen, Yi-Bu; Mellon, Mark T; Zehr, Jonathan P
2000-08-26
An approximately 16-kb fragment of the Trichodesmium sp. IMS101 (a nonheterocystous filamentous cyanobacterium) "conventional"nif gene cluster was cloned and sequenced. The gene organization of the Trichodesmium and Anabaena variabilis vegetative (nif 2) nitrogenase gene clusters spanning the region from nif B to nif W are similar except for the absence of two open reading frames (ORF3 and ORF1) in Trichodesmium. The Trichodesmium nif EN genes encode a fused Nif EN polypeptide that does not appear to be processed into individual Nif E and Nif N polypeptides. Fused nif EN genes were previously found in the A. variabilis nif 2 genes, but we have found that fused nif EN genes are widespread in the nonheterocystous cyanobacteria. Although the gene organization of the nonheterocystous filamentous Trichodesmium nif gene cluster is very similar to that of the A. variabilis vegetative nif 2 gene cluster, phylogenetic analysis of nif sequences do not support close relatedness of Trichodesmium and A. variabilis vegetative (nif 2) nitrogenase genes.
Genomic organization of the rat alpha 2u-globulin gene cluster.
McFadyen, D A; Addison, W; Locke, J
1999-05-01
The alpha 2u-globulin are a group of similar proteins, belonging to the lipocalin superfamily of proteins, that are synthesized in a subset of secretory tissues in rats. The many alpha 2u-globulin isoforms are encoded by a multigene family that exhibits extensive homology. Despite a high degree of sequence identity, individual family members show diverse expression patterns involving complex hormonal, tissue-specific, and developmental regulation. Analysis suggests that there are approximately 20 alpha 2u-globulin genes in the rat genome. We have used fluorescence in situ hybridization (FISH) to show that the alpha 2u-globulin genes are clustered at a single site on rat Chromosome (Chr) 5 (5q22-24). Southern blots of rat genomic DNA separated by pulsed field gel electrophoresis indicated that the alpha 2u-globulin genes are contained on two NruI fragments with a total size of 880 kbp. Analysis of three P1 clones containing alpha 2u-globulin genes indicated that the alpha 2u-globulin genes are tandemly arranged in a head-to-tail fashion. The organization of the alpha 2u-globulin genes in the rat as a tandem array of single genes differs from the homologous major urinary protein genes in the mouse, which are organized as tandem arrays of divergently oriented gene pairs. The structure of these gene clusters may have consequences for the proposed function, as a pheromone transporter, for the protein products encoded by these genes.
Differential expressions of putative genes in various floral organs of ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-03
Jun 3, 2009 ... Full Length Research Paper. Differential expressions of putative genes in various floral organs of the Pigeon orchid (Dendrobium crumenatum) using GeneFishing. Faridah, Q. Z.1, 2, Ng, B. Z.3, Raha, A. R.4, Umi, K. A. B.5 and Khosravi, A. R.2*. 1Department of Biology, Faculty Science, University Putra ...
International Nuclear Information System (INIS)
Burrell, K.H.; Osborne, T.H.; Groebner, R.J.; Rettig, C.L.
1993-01-01
VH-mode plasma exhibit energy confinement times up to 2.4 times the DIII-D/JET H-mode scaling relation and up to 3.9 times the value given by ITER89-P L-mode scaling. If this confinement improvement can be exploited in reactor plasmas, smaller prototype reactors with significantly lower unit cost can be produced. Accordingly, understanding and optimizing the confinement improvement is of significant interest. One of the possible explanations for this bulk confinement improvement is stabilization of turbulence by shear in the radial electric field, similar to the present explanation for the confinement improvement at the extreme plasma edge at the L to H transition. Preliminary measurements have shown that the region of the plasma where the electric field gradient is steepest broadens when the plasma goes from H-mode to VH-mode. More recent measurements have confirmed this broadening and have shown that the change in the electric field gradient occurs prior to the change in the thermal transport. In addition, transport analysis shows that the electric field shear increases in the same region between magnetic flux coordinate p=0.6 and 0.9 where the local thermal transport decreases. Furthermore, far infra-red (FIR) scattering measurements have detected density fluctuations in the region around p=0.8 which could be responsible for enhanced transport and which disappear at the time that the electric shear increases. These fluctuations appear as bursts of density fluctuations in the 0.5 to 1.5 MHz range. The time between bursts increases as the electric field shear increases. Once these bursts disappear, the major change in confinement takes place in most discharges. When isolated bursts occur, the heat and angular momentum pulse connected with the burst are detectable on the plasma profile diagnostics. (author) 13 refs., 4 figs
Search for $VH\\rightarrow$ leptons + $b\\bar{b}$ with the ATLAS experiment at the LHC
AUTHOR|(CDS)2079589
The search for a Higgs boson decaying to a $b\\bar{b}$ pair is one of the key analyses ongoing at the ATLAS experiment. Despite being the largest branching ratio decay for a Standard Model Higgs boson, a large dataset is necessary to perform this analysis because of the very large backgrounds affecting the measurement. To discriminate the electroweak $H\\rightarrow b\\bar{b}$ signal from the large QCD backgrounds, the associated production of the Higgs with a $W$ or a $Z$ boson decaying leptonically is used. Different techniques have been proposed to enhance the signal over background ratio in the $VH(b\\bar{b})$ channel, from dedicated kinematic cuts, to a single large radius jet to identify the two collimated $b$'s in the Higgs high transverse momentum regime, to multivariate techniques. The high-$p_{\\mathrm{T}}$ approach, using a large radius jet to identify the $b$'s coming from the Higgs decay, has been tested against an analysis based on kinematic cuts for a dataset of $4.7$ fb$^{-1}$ luminosity at $\\sqrt{s...
Directory of Open Access Journals (Sweden)
Gutiérrez Rodrigo A
2008-09-01
Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant
Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization
Igoshin, Oleg
2011-03-01
Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.
The porcine antibody repertoire: Variations on the textbook theme
Directory of Open Access Journals (Sweden)
John eButler
2012-06-01
Full Text Available The genes encoding the heavy and light chains of swine antibodies are organized in the same manner as in other eutherian mammals. There are ~ 30 VH genes, two functional DH genes and one functional JH gene. There are 14-60 V genes and 5 J segments, >22V genes and at least four JC cassettes. The heavy chain constant regions encode the same repertoire of isotypes common to other eutherian mammals. The piglet models offers advantage over rodent models since the fetal repertoire develops without maternal influences and the precocial nature of their multiple offspring allows the experimenter to control the influences of environmental and maternal factors on repertoire development postnatally. B cell lymphogenesis in swine begins in the fetal yolk sac at 20 days of gestation (DG, moves to the fetal liver at 30 DG and eventually to the bone marrow which dominates until birth (114 DG and to at least 5 weeks postpartum. There is no evidence that the ileal Peyers patches are a site of B cell lymphogenesis or are required for B cell maintenance. Unlike rodents and humans, light chain rearrangement begins first in the lambda locus; kappa rearrangements are not seen until late gestation.Dissimilar to lab rodents and more in the direction of the rabbit, swine utilize a small number of VH genes to form >90% of their pre-immune repertoire. Diversification in response to environmental antigen does not alter this pattern and is achieved by somatic hypermutation (SHM of the same small number of VH genes. The situation for light chains is less-well studied, but certain V and J and V and J are dominant in transcripts. The transcribed and secreted pre-immune antibodies of the fetus include mainly IgM, IgA and IgG3; this last isotype may provide a type of first responder mucosal immunity. Development of functional adaptive immunity is dependent on bacterial PAMPs or PAMPs provided by viral infections, indicating the importance of innate
Zhou, Hufeng; Jin, Jingjing; Zhang, Haojun; Yi, Bo; Wozniak, Michal; Wong, Limsoon
2012-01-01
Pathway data are important for understanding the relationship between genes, proteins and many other molecules in living organisms. Pathway gene relationships are crucial information for guidance, prediction, reference and assessment in biochemistry, computational biology, and medicine. Many well-established databases--e.g., KEGG, WikiPathways, and BioCyc--are dedicated to collecting pathway data for public access. However, the effectiveness of these databases is hindered by issues such as incompatible data formats, inconsistent molecular representations, inconsistent molecular relationship representations, inconsistent referrals to pathway names, and incomprehensive data from different databases. In this paper, we overcome these issues through extraction, normalization and integration of pathway data from several major public databases (KEGG, WikiPathways, BioCyc, etc). We build a database that not only hosts our integrated pathway gene relationship data for public access but also maintains the necessary updates in the long run. This public repository is named IntPath (Integrated Pathway gene relationship database for model organisms and important pathogens). Four organisms--S. cerevisiae, M. tuberculosis H37Rv, H. Sapiens and M. musculus--are included in this version (V2.0) of IntPath. IntPath uses the "full unification" approach to ensure no deletion and no introduced noise in this process. Therefore, IntPath contains much richer pathway-gene and pathway-gene pair relationships and much larger number of non-redundant genes and gene pairs than any of the single-source databases. The gene relationships of each gene (measured by average node degree) per pathway are significantly richer. The gene relationships in each pathway (measured by average number of gene pairs per pathway) are also considerably richer in the integrated pathways. Moderate manual curation are involved to get rid of errors and noises from source data (e.g., the gene ID errors in WikiPathways and
Directory of Open Access Journals (Sweden)
Louise S. Matheson
2017-11-01
Full Text Available V(DJ recombination is essential for the generation of diverse antigen receptor (AgR repertoires. In B cells, immunoglobulin kappa (Igκ light chain recombination follows immunoglobulin heavy chain (Igh recombination. We recently developed the DNA-based VDJ-seq assay for the unbiased quantitation of Igh VH and DH repertoires. Integration of VDJ-seq data with genome-wide datasets revealed that two chromatin states at the recombination signal sequence (RSS of VH genes are highly predictive of recombination in mouse pro-B cells. It is unknown whether local chromatin states contribute to Vκ gene choice during Igκ recombination. Here we adapt VDJ-seq to profile the Igκ VκJκ repertoire and present a comprehensive readout in mouse pre-B cells, revealing highly variable Vκ gene usage. Integration with genome-wide datasets for histone modifications, DNase hypersensitivity, transcription factor binding and germline transcription identified PU.1 binding at the RSS, which was unimportant for Igh, as highly predictive of whether a Vκ gene will recombine or not, suggesting that it plays a binary, all-or-nothing role, priming genes for recombination. Thereafter, the frequency with which these genes recombine was shaped both by the presence and level of enrichment of several other chromatin features, including H3K4 methylation and IKAROS binding. Moreover, in contrast to the Igh locus, the chromatin landscape of the promoter, as well as of the RSS, contributes to Vκ gene recombination. Thus, multiple facets of local chromatin features explain much of the variation in Vκ gene usage. Together, these findings reveal shared and divergent roles for epigenetic features and transcription factors in AgR V(DJ recombination and provide avenues for further investigation of chromatin signatures that may underpin V(DJ-mediated chromosomal translocations.
Directory of Open Access Journals (Sweden)
Young Min Song
2018-03-01
Full Text Available Objective The present study was conducted to investigate the effects of a lipid-coated zinc oxide (ZnO supplement Shield Zn (SZ at the sub-pharmacological concentration on intestinal morphology and gene expression in weanling pigs, with an aim to gain insights into the mechanism of actions for SZ. Methods Forty 22-day-old weanling pigs were fed a nursery diet supplemented with 100 or 2,500 mg Zn/kg with uncoated ZnO (negative control [NC] or positive control [PC], respectively, 100, 200, or 400 mg Zn/kg with SZ for 14 days and their intestinal tissues were taken for histological and molecular biological examinations. The villus height (VH and crypt depth (CD of the intestinal mucosa were measured microscopically following preparation of the tissue specimen; expression of the genes associated with growth and immune function was determined using the real-time quantitative polymerase chain reaction. Results There was no difference in daily gain, gain:feed, and diarrhea score between the SZ group and either of NC and PC. The VH and VH:CD ratio were less for the SZ group vs NC in the jejunum and duodenum, respectively (p<0.05. The jejunal mucosal mRNA levels of insulin-like growth factor (IGF-I and interleukin (IL-10 regressed and tended to regress (p = 0.053 on the SZ concentration with a positive coefficient, respectively, whereas the IL-6 mRNA level regressed on the SZ concentration with a negative coefficient. The mRNA levels of IGF-I, zonula occludens protein-1, tumor necrosis factor-α, IL-6, and IL-10 did not differ between the SZ group and either of NC and PC; the occludin and transforming growth factor-β1 mRNA levels were lower for the SZ group than for PC. Conclusion The present results are interpreted to suggest that dietary ZnO provided by SZ may play a role in intestinal mucosal growth and immune function by modulating the expression of IGF-I, IL-6, and IL-10 genes.
Matheson, Louise S; Bolland, Daniel J; Chovanec, Peter; Krueger, Felix; Andrews, Simon; Koohy, Hashem; Corcoran, Anne E
2017-01-01
V(D)J recombination is essential for the generation of diverse antigen receptor (AgR) repertoires. In B cells, immunoglobulin kappa ( Igκ ) light chain recombination follows immunoglobulin heavy chain ( Igh ) recombination. We recently developed the DNA-based VDJ-seq assay for the unbiased quantitation of Igh VH and DH repertoires. Integration of VDJ-seq data with genome-wide datasets revealed that two chromatin states at the recombination signal sequence (RSS) of VH genes are highly predictive of recombination in mouse pro-B cells. It is unknown whether local chromatin states contribute to Vκ gene choice during Igκ recombination. Here we adapt VDJ-seq to profile the Igκ VκJκ repertoire and present a comprehensive readout in mouse pre-B cells, revealing highly variable Vκ gene usage. Integration with genome-wide datasets for histone modifications, DNase hypersensitivity, transcription factor binding and germline transcription identified PU.1 binding at the RSS, which was unimportant for Igh , as highly predictive of whether a Vκ gene will recombine or not, suggesting that it plays a binary, all-or-nothing role, priming genes for recombination. Thereafter, the frequency with which these genes recombine was shaped both by the presence and level of enrichment of several other chromatin features, including H3K4 methylation and IKAROS binding. Moreover, in contrast to the Igh locus, the chromatin landscape of the promoter, as well as of the RSS, contributes to Vκ gene recombination. Thus, multiple facets of local chromatin features explain much of the variation in Vκ gene usage. Together, these findings reveal shared and divergent roles for epigenetic features and transcription factors in AgR V(D)J recombination and provide avenues for further investigation of chromatin signatures that may underpin V(D)J-mediated chromosomal translocations.
International Nuclear Information System (INIS)
Gohil, P.; Burrell, K.H.; Groebner, R.J.; Osborne, T.H.; Doyle, E.J.; Rettig, C.L.
1993-08-01
Measurements of the radial electric field, E r , with high spatial and high time resolution in H-mode and VH-mode discharges in the DIII-D tokamak have revealed the significant influence of the shear in E r on confinement and transport in these discharges. These measurements are made using the DIII-D Charge Exchange Recombination (CER) System. At the L-H transition in DIII-D plasmas, a negative well-like E r profile develops just within the magnetic separatrix. A region of shear in E r results, which extends 1 to 2 cm into the plasma from the separatrix. At the transition, this region of sheared E r exhibits the greatest increase in impurity ion poloidal rotation velocity and the greatest reduction in plasma fluctuations. A transport barrier is formed in this same region of E x B velocity shear as is signified by large increases in the observed gradients of the ion temperature, the carbon density, the electron temperature and electron density. The development of the region of sheared E r , the increase in impurity ion poloidal rotation, the reduction in plasma turbulence, and the transport barrier all occur simultaneously at the L-H transition. Measurements of the radial electric field, plasma turbulence, thermal transport, and energy confinement have been performed for a wide range of plasma conditions and configurations. The results support the supposition that the progression of improving confinement at the L-H transition, into the H-mode and then into the VH-mode can be explained by the hypothesis of the suppression of plasma turbulence by the increasing penetration of the region of sheared E x B velocity into the plasma interior
Resistance to organic hydroperoxides requires ohr and ohrR genes in Sinorhizobium meliloti
Directory of Open Access Journals (Sweden)
Dufour Virginie
2011-05-01
Full Text Available Abstract Background Sinorhizobium meliloti is a symbiotic nitrogen-fixing bacterium that elicits nodules on roots of host plants Medicago sativa. During nodule formation bacteria have to withstand oxygen radicals produced by the plant. Resistance to H2O2 and superoxides has been extensively studied in S. meliloti. In contrast resistance to organic peroxides has not been investigated while S. meliloti genome encodes putative organic peroxidases. Organic peroxides are produced by plants and are highly toxic. The resistance to these oxygen radicals has been studied in various bacteria but never in plant nodulating bacteria. Results In this study we report the characterisation of organic hydroperoxide resistance gene ohr and its regulator ohrR in S. meliloti. The inactivation of ohr affects resistance to cumene and ter-butyl hydroperoxides but not to hydrogen peroxide or menadione in vitro. The expression of ohr and ohrR genes is specifically induced by organic peroxides. OhrR binds to the intergenic region between the divergent genes ohr and ohrR. Two binding sites were characterised. Binding to the operator is prevented by OhrR oxidation that promotes OhrR dimerisation. The inactivation of ohr did not affect symbiosis and nitrogen fixation, suggesting that redundant enzymatic activity exists in this strain. Both ohr and ohrR are expressed in nodules suggesting that they play a role during nitrogen fixation. Conclusions This report demonstrates the significant role Ohr and OhrR proteins play in bacterial stress resistance against organic peroxides in S. meliloti. The ohr and ohrR genes are expressed in nodule-inhabiting bacteroids suggesting a role during nodulation.
Wang, Genhong; Chen, Yanfei; Zhang, Xiaoying; Bai, Bingchuan; Yan, Hao; Qin, Daoyuan; Xia, Qingyou
2018-06-01
The silkworm, Bombyx mori, is one of the world's most economically important insect. Surveying variations in gene expression among multiple tissue/organ samples will provide clues for gene function assignments and will be helpful for identifying genes related to economic traits or specific cellular processes. To ensure their accuracy, commonly used gene expression quantification methods require a set of stable reference genes for data normalization. In this study, 24 candidate reference genes were assessed in 10 tissue/organ samples of day 3 fifth-instar B. mori larvae using geNorm and NormFinder. The results revealed that, using the combination of the expression of BGIBMGA003186 and BGIBMGA008209 was the optimum choice for normalizing the expression data of the B. mori tissue/organ samples. The most stable gene, BGIBMGA003186, is recommended if just one reference gene is used. Moreover, the commonly used reference gene encoding cytoplasmic actin was the least appropriate reference gene of the samples investigated. The reliability of the selected reference genes was further confirmed by evaluating the expression profiles of two cathepsin genes. Our results may be useful for future studies involving the quantification of relative gene expression levels of different tissue/organ samples in B. mori. © 2018 Wiley Periodicals, Inc.
Gene expression in gut symbiotic organ of stinkbug affected by extracellular bacterial symbiont.
Futahashi, Ryo; Tanaka, Kohjiro; Tanahashi, Masahiko; Nikoh, Naruo; Kikuchi, Yoshitomo; Lee, Bok Luel; Fukatsu, Takema
2013-01-01
The bean bug Riptortus pedestris possesses a specialized symbiotic organ in a posterior region of the midgut, where numerous crypts harbor extracellular betaproteobacterial symbionts of the genus Burkholderia. Second instar nymphs orally acquire the symbiont from the environment, and the symbiont infection benefits the host by facilitating growth and by occasionally conferring insecticide resistance. Here we performed comparative transcriptomic analyses of insect genes expressed in symbiotic and non-symbiotic regions of the midgut dissected from Burkholderia-infected and uninfected R. pedestris. Expression sequence tag analysis of cDNA libraries and quantitative reverse transcription PCR identified a number of insect genes expressed in symbiosis- or aposymbiosis-associated patterns. For example, genes up-regulated in symbiotic relative to aposymbiotic individuals, including many cysteine-rich secreted protein genes and many cathepsin protease genes, are likely to play a role in regulating the symbiosis. Conversely, genes up-regulated in aposymbiotic relative to symbiotic individuals, including a chicken-type lysozyme gene and a defensin-like protein gene, are possibly involved in regulation of non-symbiotic bacterial infections. Our study presents the first transcriptomic data on gut symbiotic organ of a stinkbug, which provides initial clues to understanding of molecular mechanisms underlying the insect-bacterium gut symbiosis and sheds light on several intriguing commonalities between endocellular and extracellular symbiotic associations.
Directory of Open Access Journals (Sweden)
Fengxi Yang
Full Text Available Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms
Proudhon, D; Wei, J; Briat, J; Theil, E C
1996-03-01
Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may
UFO: an Arabidopsis gene involved in both floral meristem and floral organ development.
Levin, J Z; Meyerowitz, E M
1995-05-01
We describe the role of the UNUSUAL FLORAL ORGANS (UFO) gene in Arabidopsis floral development based on a genetic and molecular characterization of the phenotypes of nine ufo alleles. UFO is required for the proper identity of the floral meristem and acts in three different aspects of the process that distinguishes flowers from shoots. UFO is involved in establishing the whorled pattern of floral organs, controlling the determinacy of the floral meristem, and activating the APETALA3 and PISTILLATA genes required for petal and stamen identity. In many respects, UFO acts in a manner similar to LEAFY, but the ufo mutant phenotype also suggests an additional role for UFO in defining boundaries within the floral primordia or controlling cell proliferation during floral organ growth. Finally, genetic interactions that prevent flower formation and lead to the generation of filamentous structures implicate UFO as a member of a new, large, and diverse class of genes in Arabidopsis necessary for flower formation.
Functional evolution of ADAMTS genes: Evidence from analyses of phylogeny and gene organization
Directory of Open Access Journals (Sweden)
Van Meir Erwin G
2005-02-01
Full Text Available Abstract Background The ADAMTS (A Disintegrin-like and Metalloprotease with Thrombospondin motifs proteins are a family of metalloproteases with sequence similarity to the ADAM proteases, that contain the thrombospondin type 1 sequence repeat motifs (TSRs common to extracellular matrix proteins. ADAMTS proteins have recently gained attention with the discovery of their role in a variety of diseases, including tissue and blood disorders, cancer, osteoarthritis, Alzheimer's and the genetic syndromes Weill-Marchesani syndrome (ADAMTS10, thrombotic thrombocytopenic purpura (ADAMTS13, and Ehlers-Danlos syndrome type VIIC (ADAMTS2 in humans and belted white-spotting mutation in mice (ADAMTS20. Results Phylogenetic analysis and comparison of the exon/intron organization of vertebrate (Homo, Mus, Fugu, chordate (Ciona and invertebrate (Drosophila and Caenorhabditis ADAMTS homologs has elucidated the evolutionary relationships of this important gene family, which comprises 19 members in humans. Conclusions The evolutionary history of ADAMTS genes in vertebrate genomes has been marked by rampant gene duplication, including a retrotransposition that gave rise to a distinct ADAMTS subfamily (ADAMTS1, -4, -5, -8, -15 that may have distinct aggrecanase and angiogenesis functions.
Representing virus-host interactions and other multi-organism processes in the Gene Ontology.
Foulger, R E; Osumi-Sutherland, D; McIntosh, B K; Hulo, C; Masson, P; Poux, S; Le Mercier, P; Lomax, J
2015-07-28
The Gene Ontology project is a collaborative effort to provide descriptions of gene products in a consistent and computable language, and in a species-independent manner. The Gene Ontology is designed to be applicable to all organisms but up to now has been largely under-utilized for prokaryotes and viruses, in part because of a lack of appropriate ontology terms. To address this issue, we have developed a set of Gene Ontology classes that are applicable to microbes and their hosts, improving both coverage and quality in this area of the Gene Ontology. Describing microbial and viral gene products brings with it the additional challenge of capturing both the host and the microbe. Recognising this, we have worked closely with annotation groups to test and optimize the GO classes, and we describe here a set of annotation guidelines that allow the controlled description of two interacting organisms. Building on the microbial resources already in existence such as ViralZone, UniProtKB keywords and MeGO, this project provides an integrated ontology to describe interactions between microbial species and their hosts, with mappings to the external resources above. Housing this information within the freely-accessible Gene Ontology project allows the classes and annotation structure to be utilized by a large community of biologists and users.
Directory of Open Access Journals (Sweden)
Heffer Alison
2011-03-01
Full Text Available Abstract Background Tremendous progress has been made in the field of evo-devo through comparisons of related genes from diverse taxa. While the vast number of species in nature precludes a complete analysis of the molecular evolution of even one single gene family, this would not be necessary to understand fundamental mechanisms underlying gene evolution if experiments could be designed to systematically sample representative points along the path of established phylogenies to trace changes in regulatory and coding gene sequence. This isolation of homologous genes from phylogenetically diverse, representative species can be challenging, especially if the gene is under weak selective pressure and evolving rapidly. Results Here we present an approach - Rapid Isolation of Gene Homologs across Taxa (RIGHT - to efficiently isolate specific members of gene families. RIGHT is based upon modification and a combination of degenerate polymerase chain reaction (PCR and gene-specific amplified fragment length polymorphism (AFLP. It allows targeted isolation of specific gene family members from any organism, only requiring genomic DNA. We describe this approach and how we used it to isolate members of several different gene families from diverse arthropods spanning millions of years of evolution. Conclusions RIGHT facilitates systematic isolation of one gene from large gene families. It allows for efficient gene isolation without whole genome sequencing, RNA extraction, or culturing of non-model organisms. RIGHT will be a generally useful method for isolation of orthologs from both distant and closely related species, increasing sample size and facilitating the tracking of molecular evolution of gene families and regulatory networks across the tree of life.
DEFF Research Database (Denmark)
Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth
2009-01-01
With the availability of the genome sequence of the filamentous fungus Aspergillus niger, the use of targeted genetic modifications has become feasible. This, together with the fact that A. niger is well established industrially, makes this fungus an attractive micro-organism for creating a cell...... factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...... the acl gene. Additionally, the total amount of organic acids produced in the deletion strain was significantly increased. Genome-scale stoichiometric metabolic model predictions can be used for identifying gene targets. Deletion of the acl led to increased succinic acid production by A. niger....
Directory of Open Access Journals (Sweden)
Xiaoni Zhang
2018-04-01
Full Text Available Dianthus is a large genus containing many species with high ornamental economic value. Extensive breeding strategies permitted an exploration of an improvement in the quality of cultivated carnation, particularly in flowers. However, little is known on the molecular mechanisms of flower development in carnation. Here, we report the identification and description of MADS-box genes in carnation (DcaMADS with a focus on those involved in flower development and organ identity determination. In this study, 39 MADS-box genes were identified from the carnation genome and transcriptome by the phylogenetic analysis. These genes were categorized into four subgroups (30 MIKCc, two MIKC*, two Mα, and five Mγ. The MADS-box domain, gene structure, and conserved motif compositions of the carnation MADS genes were analysed. Meanwhile, the expression of DcaMADS genes were significantly different in stems, leaves, and flower buds. Further studies were carried out for exploring the expression of DcaMADS genes in individual flower organs, and some crucial DcaMADS genes correlated with their putative function were validated. Finally, a new expression pattern of DcaMADS genes in flower organs of carnation was provided: sepal (three class E genes and two class A genes, petal (two class B genes, two class E genes, and one SHORT VEGETATIVE PHASE (SVP, stamen (two class B genes, two class E genes, and two class C, styles (two class E genes and two class C, and ovary (two class E genes, two class C, one AGAMOUS-LIKE 6 (AGL6, one SEEDSTICK (STK, one B sister, one SVP, and one Mα. This result proposes a model in floral organ identity of carnation and it may be helpful to further explore the molecular mechanism of flower organ identity in carnation.
Zhang, Xiaoni; Wang, Qijian; Yang, Shaozong; Lin, Shengnan; Bao, Manzhu; Bendahmane, Mohammed; Wu, Quanshu; Wang, Caiyun; Fu, Xiaopeng
2018-04-04
Dianthus is a large genus containing many species with high ornamental economic value. Extensive breeding strategies permitted an exploration of an improvement in the quality of cultivated carnation, particularly in flowers. However, little is known on the molecular mechanisms of flower development in carnation. Here, we report the identification and description of MADS-box genes in carnation ( DcaMADS ) with a focus on those involved in flower development and organ identity determination. In this study, 39 MADS-box genes were identified from the carnation genome and transcriptome by the phylogenetic analysis. These genes were categorized into four subgroups (30 MIKC c , two MIKC*, two Mα, and five Mγ). The MADS-box domain, gene structure, and conserved motif compositions of the carnation MADS genes were analysed. Meanwhile, the expression of DcaMADS genes were significantly different in stems, leaves, and flower buds. Further studies were carried out for exploring the expression of DcaMADS genes in individual flower organs, and some crucial DcaMADS genes correlated with their putative function were validated. Finally, a new expression pattern of DcaMADS genes in flower organs of carnation was provided: sepal (three class E genes and two class A genes), petal (two class B genes, two class E genes, and one SHORT VEGETATIVE PHASE ( SVP )), stamen (two class B genes, two class E genes, and two class C), styles (two class E genes and two class C), and ovary (two class E genes, two class C, one AGAMOUS-LIKE 6 ( AGL6 ), one SEEDSTICK ( STK ), one B sister , one SVP , and one Mα ). This result proposes a model in floral organ identity of carnation and it may be helpful to further explore the molecular mechanism of flower organ identity in carnation.
Expression map of a complete set of gustatory receptor genes in chemosensory organs of Bombyx mori.
Guo, Huizhen; Cheng, Tingcai; Chen, Zhiwei; Jiang, Liang; Guo, Youbing; Liu, Jianqiu; Li, Shenglong; Taniai, Kiyoko; Asaoka, Kiyoshi; Kadono-Okuda, Keiko; Arunkumar, Kallare P; Wu, Jiaqi; Kishino, Hirohisa; Zhang, Huijie; Seth, Rakesh K; Gopinathan, Karumathil P; Montagné, Nicolas; Jacquin-Joly, Emmanuelle; Goldsmith, Marian R; Xia, Qingyou; Mita, Kazuei
2017-03-01
Most lepidopteran species are herbivores, and interaction with host plants affects their gene expression and behavior as well as their genome evolution. Gustatory receptors (Grs) are expected to mediate host plant selection, feeding, oviposition and courtship behavior. However, due to their high diversity, sequence divergence and extremely low level of expression it has been difficult to identify precisely a complete set of Grs in Lepidoptera. By manual annotation and BAC sequencing, we improved annotation of 43 gene sequences compared with previously reported Grs in the most studied lepidopteran model, the silkworm, Bombyx mori, and identified 7 new tandem copies of BmGr30 on chromosome 7, bringing the total number of BmGrs to 76. Among these, we mapped 68 genes to chromosomes in a newly constructed chromosome distribution map and 8 genes to scaffolds; we also found new evidence for large clusters of BmGrs, especially from the bitter receptor family. RNA-seq analysis of diverse BmGr expression patterns in chemosensory organs of larvae and adults enabled us to draw a precise organ specific map of BmGr expression. Interestingly, most of the clustered genes were expressed in the same tissues and more than half of the genes were expressed in larval maxillae, larval thoracic legs and adult legs. For example, BmGr63 showed high expression levels in all organs in both larval and adult stages. By contrast, some genes showed expression limited to specific developmental stages or organs and tissues. BmGr19 was highly expressed in larval chemosensory organs (especially antennae and thoracic legs), the single exon genes BmGr53 and BmGr67 were expressed exclusively in larval tissues, the BmGr27-BmGr31 gene cluster on chr7 displayed a high expression level limited to adult legs and the candidate CO 2 receptor BmGr2 was highly expressed in adult antennae, where few other Grs were expressed. Transcriptional analysis of the Grs in B. mori provides a valuable new reference for
Barozai, Muhammad Younas Khan; Bashir, Farrukh; Muzaffar, Shafia; Afzal, Saba; Behlil, Farida; Khan, Muzaffar
2014-10-15
To study the life processes of all eukaryotes, yeast (Saccharomyces cerevisiae) is a significant model organism. It is also one of the best models to study the responses of genes at transcriptional level. In a living organism, gene expression is changed by chemical stresses. The genes that give response to chemical stresses will provide good source for the strategies in engineering and formulating mechanisms which are chemical stress resistant in the eukaryotic organisms. The data available through microarray under the chemical stresses like lithium chloride, lactic acid, weak organic acids and tomatidine were studied by using computational tools. Out of 9335 yeast genes, 388 chemical stress responding genes were identified and characterized under different chemical stresses. Some of these are: Enolases 1 and 2, heat shock protein-82, Yeast Elongation Factor 3, Beta Glucanase Protein, Histone H2A1 and Histone H2A2 Proteins, Benign Prostatic Hyperplasia, ras GTPase activating protein, Establishes Silent Chromatin protein, Mei5 Protein, Nondisjunction Protein and Specific Mitogen Activated Protein Kinase. Characterization of these genes was also made on the basis of their molecular functions, biological processes and cellular components. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Narasimha V. Hegde
2016-12-01
Full Text Available Antibiotics are widely used in chicken production for therapeutic purposes, disease prevention and growth promotion, and this may select for drug resistant microorganisms known to spread to humans through consumption of contaminated food. Raising chickens on an organic feed regimen, without the use of antibiotics, is increasingly popular with the consumers. In order to determine the effects of diet regimen on antibiotic resistant genes in the gut microbiome, we analyzed the phylotypes and identified the antimicrobial resistant genes in chicken, grown under conventional and organic dietary regimens. Phylotypes were analyzed from DNA extracted from fecal samples from chickens grown under these dietary conditions. While gut microbiota of chicken raised in both conventional and organic diet exhibited the presence of DNA from members of Proteobacteria and Bacteroidetes, organic diet favored the growth of members of Fusobacteria. Antimicrobial resistance genes were identified from metagenomic libraries following cloning and sequencing of DNA fragments from fecal samples and selecting for the resistant clones (n=340 on media containing different concentrations of eight antibiotics. The antimicrobial resistant genes exhibited diversity in their host distribution among the microbial population and expressed more in samples from chicken grown on a conventional diet at higher concentrations of certain antimicrobials than samples from chicken grown on organic diet. Further studies will elucidate if this phenomena is widespread and whether the antimicrobial resistance is indeed modulated by diet. This may potentially assist in defining strategies for intervention to reduce the prevalence and dissemination of antibiotic resistance genes in the production environment.
Identification of novel genes associated with renal tertiary lymphoid organ formation in aging mice
Huang, Yuan; Caputo, Christina R.; Noordmans, Gerda A.; Yazdani, Saleh; Monteiro, Luiz Henrique; van den Born, Jaap; van Goor, Harry; Heeringa, Peter; Korstanje, Ron; Hillebrands, Jan-Luuk
2014-01-01
A hallmark of aging-related organ deterioration is a dysregulated immune response characterized by pathologic leukocyte infiltration of affected tissues. Mechanisms and genes involved are as yet unknown. To identify genes associated with aging-related renal infiltration, we analyzed kidneys from
International Nuclear Information System (INIS)
Moore, L.M.; Byers, F.M. Jr.; Broxton, D.E.
1989-06-01
A thin-section operator-variance test was given to the 2 junior authors, petrographers, by the senior author, a statistician, using 16 thin sections cut from core plugs drilled by the US Geological Survey from drill hole USW VH-2 standard (HCQ) drill core. The thin sections are samples of Topopah Spring devitrified rhyolite tuff from four textural zones, in ascending order: (1) lower nonlithophysal, (2) lower lithopysal, (3) middle nonlithophysal, and (4) upper lithophysal. Drill hole USW-VH-2 is near the center of the Crater Flat, about 6 miles WSW of the Yucca Mountain in Exploration Block. The original thin-section labels were opaqued out with removable enamel and renumbered with alpha-numeric labels. The sliders were then given to the petrographer operators for quantitative thin-section modal (point-count) analysis of cryptocrystalline, spherulitic, granophyric, and void textures, as well as phenocryst minerals. Between operator variance was tested by giving the two petrographers the same slide, and within-operator variance was tested by the same operator the same slide to count in a second test set, administered at least three months after the first set. Both operators were unaware that they were receiving the same slide to recount. 14 figs., 6 tabs
Chavez-Alvarez, Rocio; Chavoya, Arturo; Mendez-Vazquez, Andres
2014-01-01
DNA microarrays and cell cycle synchronization experiments have made possible the study of the mechanisms of cell cycle regulation of Saccharomyces cerevisiae by simultaneously monitoring the expression levels of thousands of genes at specific time points. On the other hand, pattern recognition techniques can contribute to the analysis of such massive measurements, providing a model of gene expression level evolution through the cell cycle process. In this paper, we propose the use of one of such techniques--an unsupervised artificial neural network called a Self-Organizing Map (SOM)-which has been successfully applied to processes involving very noisy signals, classifying and organizing them, and assisting in the discovery of behavior patterns without requiring prior knowledge about the process under analysis. As a test bed for the use of SOMs in finding possible relationships among genes and their possible contribution in some biological processes, we selected 282 S. cerevisiae genes that have been shown through biological experiments to have an activity during the cell cycle. The expression level of these genes was analyzed in five of the most cited time series DNA microarray databases used in the study of the cell cycle of this organism. With the use of SOM, it was possible to find clusters of genes with similar behavior in the five databases along two cell cycles. This result suggested that some of these genes might be biologically related or might have a regulatory relationship, as was corroborated by comparing some of the clusters obtained with SOMs against a previously reported regulatory network that was generated using biological knowledge, such as protein-protein interactions, gene expression levels, metabolism dynamics, promoter binding, and modification, regulation and transport of proteins. The methodology described in this paper could be applied to the study of gene relationships of other biological processes in different organisms.
Librado, Pablo; Rozas, Julio
2013-01-01
Animal olfactory systems have a critical role for the survival and reproduction of individuals. In insects, the odorant-binding proteins (OBPs) are encoded by a moderately sized gene family, and mediate the first steps of the olfactory processing. Most OBPs are organized in clusters of a few paralogs, which are conserved over time. Currently, the biological mechanism explaining the close physical proximity among OBPs is not yet established. Here, we conducted a comprehensive study aiming to gain insights into the mechanisms underlying the OBP genomic organization. We found that the OBP clusters are embedded within large conserved arrangements. These organizations also include other non-OBP genes, which often encode proteins integral to plasma membrane. Moreover, the conservation degree of such large clusters is related to the following: 1) the promoter architecture of the confined genes, 2) a characteristic transcriptional environment, and 3) the chromatin conformation of the chromosomal region. Our results suggest that chromatin domains may restrict the location of OBP genes to regions having the appropriate transcriptional environment, leading to the OBP cluster structure. However, the appropriate transcriptional environment for OBP and the other neighbor genes is not dominated by reduced levels of expression noise. Indeed, the stochastic fluctuations in the OBP transcript abundance may have a critical role in the combinatorial nature of the olfactory coding process.
Franzen, Julia; Menzel, Ralph; Höss, Sebastian; Claus, Evelyn; Steinberg, Christian E W
2012-03-01
River water quality is strongly influenced by their sediments and their associated pollutants. To assess the toxic potential of sediments, sediment toxicity tests require reliable control sediments, potentially including formulated control sediments as one major option. Although some standardization has been carried out, one critical issue still remains the quality of sediment organic matter (SOM). Organic carbon not only binds hydrophobic contaminants, but may be a source of mild toxicity, even if the SOM is essentially uncontaminated. We tested two different sources of organic carbon and the mixture of both (Sphagnum peat (P) and one commercial humic substances preparation-HuminFeed(®), HF) in terms of life trait variables and expression profiles of selected life performance and stress genes of the nematode Caenorhabditis elegans. In synchronous cultures, gene expression profiling was done after 6 and 48 h, respectively. The uncontaminated Sphagnum P reduced growth, but increased numbers of offspring, whereas HF did not significantly alter life trait variables. The 6 h expression profile showed most of the studied stress genes repressed, except for slight to strong induction in cyp-35B1 (all exposures), gst-38 (only mixture), and small hsp-16 genes (all exposures). After 48 h, the expression of almost all studied genes increased, particularly genes coding for antioxidative defense, multiple xenobiotic resistance, vitellogenin-like proteins, and genes regulating lifespan. Overall, even essentially uncontaminated SOM may induce several modes of action on the molecular level in C. elegans which may lead to false results if testing synthetic xenobiotics. This contribution is a plea for a strict standardization of the SOM quality in formulated sediments and to check for corresponding effects in other model sediment organisms, especially if using molecular toxicity endpoints.
Directory of Open Access Journals (Sweden)
Kouji Satoh
Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.
Cellular Repair of DNA–DNA Cross-Links Induced by 1,2,3,4-Diepoxybutane
Directory of Open Access Journals (Sweden)
Lisa N. Chesner
2017-05-01
Full Text Available Xenobiotic-induced interstrand DNA–DNA cross-links (ICL interfere with transcription and replication and can be converted to toxic DNA double strand breaks. In this work, we investigated cellular responses to 1,4-bis-(guan-7-yl-2,3-butanediol (bis-N7G-BD cross-links induced by 1,2,3,4-diepoxybutane (DEB. High pressure liquid chromatography electrospray ionization tandem mass spectrometry (HPLC-ESI+-MS/MS assays were used to quantify the formation and repair of bis-N7G-BD cross-links in wild-type Chinese hamster lung fibroblasts (V79 and the corresponding isogenic clones V-H1 and V-H4, deficient in the XPD and FANCA genes, respectively. Both V-H1 and V-H4 cells exhibited enhanced sensitivity to DEB-induced cell death and elevated bis-N7G-BD cross-links. However, relatively modest increases of bis-N7G-BD adduct levels in V-H4 clones did not correlate with their hypersensitivity to DEB. Further, bis-N7G-BD levels were not elevated in DEB-treated human clones with defects in the XPA or FANCD2 genes. Comet assays and γ-H2AX focus analyses conducted with hamster cells revealed that ICL removal was associated with chromosomal double strand break formation, and that these breaks persisted in V-H4 cells as compared to control cells. Our findings suggest that ICL repair in cells with defects in the Fanconi anemia repair pathway is associated with aberrant re-joining of repair-induced double strand breaks, potentially resulting in lethal chromosome rearrangements.
From genes to milk: genomic organization and epigenetic regulation of the mammary transcriptome.
Lemay, Danielle G; Pollard, Katherine S; Martin, William F; Freeman Zadrowski, Courtneay; Hernandez, Joseph; Korf, Ian; German, J Bruce; Rijnkels, Monique
2013-01-01
Even in genomes lacking operons, a gene's position in the genome influences its potential for expression. The mechanisms by which adjacent genes are co-expressed are still not completely understood. Using lactation and the mammary gland as a model system, we explore the hypothesis that chromatin state contributes to the co-regulation of gene neighborhoods. The mammary gland represents a unique evolutionary model, due to its recent appearance, in the context of vertebrate genomes. An understanding of how the mammary gland is regulated to produce milk is also of biomedical and agricultural importance for human lactation and dairying. Here, we integrate epigenomic and transcriptomic data to develop a comprehensive regulatory model. Neighborhoods of mammary-expressed genes were determined using expression data derived from pregnant and lactating mice and a neighborhood scoring tool, G-NEST. Regions of open and closed chromatin were identified by ChIP-Seq of histone modifications H3K36me3, H3K4me2, and H3K27me3 in the mouse mammary gland and liver tissue during lactation. We found that neighborhoods of genes in regions of uniquely active chromatin in the lactating mammary gland, compared with liver tissue, were extremely rare. Rather, genes in most neighborhoods were suppressed during lactation as reflected in their expression levels and their location in regions of silenced chromatin. Chromatin silencing was largely shared between the liver and mammary gland during lactation, and what distinguished the mammary gland was mainly a small tissue-specific repertoire of isolated, expressed genes. These findings suggest that an advantage of the neighborhood organization is in the collective repression of groups of genes via a shared mechanism of chromatin repression. Genes essential to the mammary gland's uniqueness are isolated from neighbors, and likely have less tolerance for variation in expression, properties they share with genes responsible for an organism's survival.
Zhang, Wei-wei; Sun, Kun; Cheng, Shuang; Sun, Li
2008-10-01
Vibrio harveyi is an important marine pathogen that can infect a number of aquaculture species. V. harveyi degQ (degQ(Vh)), the gene encoding a DegQ homologue, was cloned from T4, a pathogenic V. harveyi strain isolated from diseased fish. DegQ(Vh) was closely related to the HtrA family members identified in other Vibrio species and could complement the temperature-sensitive phenotype of an Escherichia coli strain defective in degP. Expression of degQ(Vh) in T4 was modulated by temperature, possibly through the sigma(E)-like factor. Enzymatic analyses demonstrated that the recombinant DegQ(Vh) protein expressed in and purified from E. coli was an active serine protease whose activity required the integrity of the catalytic site and the PDZ domains. The optimal temperature and pH of the recombinant DegQ(Vh) protein were 50 degrees C and pH 8.0. A vaccination study indicated that the purified recombinant DegQ(Vh) was a protective immunogen that could confer protection upon fish against infection by V. harveyi. In order to improve the efficiency of DegQ(Vh) as a vaccine, a genetic construct in the form of the plasmid pAQ1 was built, in which the DNA encoding the processed DegQ(Vh) protein was fused with the DNA encoding the secretion region of AgaV, an extracellular beta-agarase. The E. coli strain harboring pAQ1 could express and secrete the chimeric DegQ(Vh) protein into the culture supernatant. Vaccination of fish with viable E. coli expressing chimeric degQ(Vh) significantly (P < 0.001) enhanced the survival of fish against V. harveyi challenge, which was possibly due to the relatively prolonged exposure of the immune system to the recombinant antigen produced constitutively, albeit at a gradually decreasing level, by the carrier strain.
Ren, Licheng; Wang, Yang; Shi, Minglei; Wang, Xiaoning; Yang, Zhong; Zhao, Zhihu
2012-01-01
Chromatin loops play important roles in the dynamic spatial organization of genes in the nucleus. Growing evidence has revealed that the multivalent functional zinc finger protein CCCTC-binding factor (CTCF) is a master regulator of genome spatial organization, and mediates the ubiquitous chromatin loops within the genome. Using circular chromosome conformation capture (4C) methodology, we discovered that CTCF may be a master organizer in mediating the spatial organization of the kcnq5 gene l...
Nackerdien, Zeena E; Keynan, Alexander; Bassler, Bonnie L; Lederberg, Joshua; Thaler, David S
2008-02-27
The light-emitting Vibrios provide excellent material for studying the interaction of cellular communication with growth rate because bioluminescence is a convenient marker for quorum sensing. However, the use of bioluminescence as a marker is complicated because bioluminescence itself may affect growth rate, e.g. by diverting energy. The marker effect was explored via growth rate studies in isogenic Vibrio harveyi (Vh) strains altered in quorum sensing on the one hand, and bioluminescence on the other. By hypothesis, growth rate is energy limited: mutants deficient in quorum sensing grow faster because wild type quorum sensing unleashes bioluminescence and bioluminescence diverts energy. Findings reported here confirm a role for bioluminescence in limiting Vh growth rate, at least under the conditions tested. However, the results argue that the bioluminescence is insufficient to explain the relationship of growth rate and quorum sensing in Vh. A Vh mutant null for all genes encoding the bioluminescence pathway grew faster than wild type but not as fast as null mutants in quorum sensing. Vh quorum sensing mutants showed altered growth rates that do not always rank with their relative increase or decrease in bioluminescence. In addition, the cell-free culture fluids of a rapidly growing Vibrio parahaemolyticus (Vp) strain increased the growth rate of wild type Vh without significantly altering Vh's bioluminescence. The same cell-free culture fluid increased the bioluminescence of Vh quorum mutants. The effect of quorum sensing on Vh growth rate can be either positive or negative and includes both bioluminescence-dependent and independent components. Bioluminescence tends to slow growth rate but not enough to account for the effects of quorum sensing on growth rate.
Directory of Open Access Journals (Sweden)
Zeena E Nackerdien
2008-02-01
Full Text Available The light-emitting Vibrios provide excellent material for studying the interaction of cellular communication with growth rate because bioluminescence is a convenient marker for quorum sensing. However, the use of bioluminescence as a marker is complicated because bioluminescence itself may affect growth rate, e.g. by diverting energy.The marker effect was explored via growth rate studies in isogenic Vibrio harveyi (Vh strains altered in quorum sensing on the one hand, and bioluminescence on the other. By hypothesis, growth rate is energy limited: mutants deficient in quorum sensing grow faster because wild type quorum sensing unleashes bioluminescence and bioluminescence diverts energy. Findings reported here confirm a role for bioluminescence in limiting Vh growth rate, at least under the conditions tested. However, the results argue that the bioluminescence is insufficient to explain the relationship of growth rate and quorum sensing in Vh. A Vh mutant null for all genes encoding the bioluminescence pathway grew faster than wild type but not as fast as null mutants in quorum sensing. Vh quorum sensing mutants showed altered growth rates that do not always rank with their relative increase or decrease in bioluminescence. In addition, the cell-free culture fluids of a rapidly growing Vibrio parahaemolyticus (Vp strain increased the growth rate of wild type Vh without significantly altering Vh's bioluminescence. The same cell-free culture fluid increased the bioluminescence of Vh quorum mutants.The effect of quorum sensing on Vh growth rate can be either positive or negative and includes both bioluminescence-dependent and independent components. Bioluminescence tends to slow growth rate but not enough to account for the effects of quorum sensing on growth rate.
Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.
Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc
2006-02-01
Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.
Directory of Open Access Journals (Sweden)
Vaiman Daniel
2005-05-01
Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological
Genomic sequence and organization of two members of a human lectin gene family
International Nuclear Information System (INIS)
Gitt, M.A.; Barondes, S.H.
1991-01-01
The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family
Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M
1993-11-01
A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.
Speiser, Daniel I; Pankey, M Sabrina; Zaharoff, Alexander K; Battelle, Barbara A; Bracken-Grissom, Heather D; Breinholt, Jesse W; Bybee, Seth M; Cronin, Thomas W; Garm, Anders; Lindgren, Annie R; Patel, Nipam H; Porter, Megan L; Protas, Meredith E; Rivera, Ajna S; Serb, Jeanne M; Zigler, Kirk S; Crandall, Keith A; Oakley, Todd H
2014-11-19
Tools for high throughput sequencing and de novo assembly make the analysis of transcriptomes (i.e. the suite of genes expressed in a tissue) feasible for almost any organism. Yet a challenge for biologists is that it can be difficult to assign identities to gene sequences, especially from non-model organisms. Phylogenetic analyses are one useful method for assigning identities to these sequences, but such methods tend to be time-consuming because of the need to re-calculate trees for every gene of interest and each time a new data set is analyzed. In response, we employed existing tools for phylogenetic analysis to produce a computationally efficient, tree-based approach for annotating transcriptomes or new genomes that we term Phylogenetically-Informed Annotation (PIA), which places uncharacterized genes into pre-calculated phylogenies of gene families. We generated maximum likelihood trees for 109 genes from a Light Interaction Toolkit (LIT), a collection of genes that underlie the function or development of light-interacting structures in metazoans. To do so, we searched protein sequences predicted from 29 fully-sequenced genomes and built trees using tools for phylogenetic analysis in the Osiris package of Galaxy (an open-source workflow management system). Next, to rapidly annotate transcriptomes from organisms that lack sequenced genomes, we repurposed a maximum likelihood-based Evolutionary Placement Algorithm (implemented in RAxML) to place sequences of potential LIT genes on to our pre-calculated gene trees. Finally, we implemented PIA in Galaxy and used it to search for LIT genes in 28 newly-sequenced transcriptomes from the light-interacting tissues of a range of cephalopod mollusks, arthropods, and cubozoan cnidarians. Our new trees for LIT genes are available on the Bitbucket public repository ( http://bitbucket.org/osiris_phylogenetics/pia/ ) and we demonstrate PIA on a publicly-accessible web server ( http://galaxy-dev.cnsi.ucsb.edu/pia/ ). Our new
Directory of Open Access Journals (Sweden)
Jill A. McKay
2016-10-01
Full Text Available Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or “programme”, the fetus for its anticipated post-natal environment. The mechanisms responsible for these programming events are poorly understood but are likely to involve gene expression changes. Folate is essential for normal fetal development and inadequate maternal folate supply during pregnancy has long term adverse effects for offspring. We tested the hypothesis that folate depletion during pregnancy alters offspring programming through altered gene expression. Female C57BL/6J mice were fed diets containing 2 mg or 0.4 mg folic acid/kg for 4 weeks before mating and throughout pregnancy. At 17.5 day gestation, genome-wide gene expression was measured in male fetal livers and placentas. In the fetal liver, 989 genes were expressed differentially (555 up-regulated, 434 down-regulated in response to maternal folate depletion, with 460 genes expressed differentially (250 up-regulated, 255 down-regulated in the placenta. Only 25 differentially expressed genes were common between organs. Maternal folate intake during pregnancy influences fetal gene expression in a highly organ specific manner which may reflect organ-specific functions.
McKay, Jill A; Xie, Long; Adriaens, Michiel; Evelo, Chris T; Ford, Dianne; Mathers, John C
2016-10-22
Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or "programme", the fetus for its anticipated post-natal environment. The mechanisms responsible for these programming events are poorly understood but are likely to involve gene expression changes. Folate is essential for normal fetal development and inadequate maternal folate supply during pregnancy has long term adverse effects for offspring. We tested the hypothesis that folate depletion during pregnancy alters offspring programming through altered gene expression. Female C57BL/6J mice were fed diets containing 2 mg or 0.4 mg folic acid/kg for 4 weeks before mating and throughout pregnancy. At 17.5 day gestation, genome-wide gene expression was measured in male fetal livers and placentas. In the fetal liver, 989 genes were expressed differentially (555 up-regulated, 434 down-regulated) in response to maternal folate depletion, with 460 genes expressed differentially (250 up-regulated, 255 down-regulated) in the placenta. Only 25 differentially expressed genes were common between organs. Maternal folate intake during pregnancy influences fetal gene expression in a highly organ specific manner which may reflect organ-specific functions.
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
DEFF Research Database (Denmark)
Nørgaard, Caroline Holm; Jakobsen, Lasse Hjort; Gentles, Andrew J.
2018-01-01
. Our hypothesis is that by segregating CLL according to BAGS, we can identify subtypes with prognostic implications in support of pathogenetic value of BAGS. Microarray-based gene-expression samples from eight independent CLL cohorts (1,024 untreated patients) were BAGS-stratified into pre-BI, pre...... subtype resistance towards rituximab and cyclophosphamide varied for rituximab, whereas all subtypes were sensitive to cyclophosphamide. This study supports our hypothesis that BAGS-subtyping may be of tangible prognostic and pathogenetic value for CLL patients.......Diagnostic and prognostic evaluation of chronic lymphocytic leukemia (CLL) involves blood cell counts, immunophenotyping, IgVH mutation status, and cytogenetic analyses. We generated B-cell associated gene-signatures (BAGS) based on six naturally occurring B-cell subsets within normal bone marrow...
The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys
Directory of Open Access Journals (Sweden)
Anna V. Shchennikova
2018-01-01
Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.
Energy Technology Data Exchange (ETDEWEB)
Fournier, Marcia V.; Martin, Katherine J.; Kenny, Paraic A.; Xhaja, Kris; Bosch, Irene; Yaswen, Paul; Bissell, Mina J.
2006-02-08
To understand how non-malignant human mammary epithelial cells (HMEC) transit from a disorganized proliferating to an organized growth arrested state, and to relate this process to the changes that occur in breast cancer, we studied gene expression changes in non-malignant HMEC grown in three-dimensional cultures, and in a previously published panel of microarray data for 295 breast cancer samples. We hypothesized that the gene expression pattern of organized and growth arrested mammary acini would share similarities with breast tumors with good prognoses. Using Affymetrix HG-U133A microarrays, we analyzed the expression of 22,283 gene transcripts in two HMEC cell lines, 184 (finite life span) and HMT3522 S1 (immortal non-malignant), on successive days post-seeding in a laminin-rich extracellular matrix assay. Both HMECs underwent growth arrest in G0/G1 and differentiated into polarized acini between days 5 and 7. We identified gene expression changes with the same temporal pattern in both lines. We show that genes that are significantly lower in the organized, growth arrested HMEC than in their proliferating counterparts can be used to classify breast cancer patients into poor and good prognosis groups with high accuracy. This study represents a novel unsupervised approach to identifying breast cancer markers that may be of use clinically.
DEFF Research Database (Denmark)
Dziegiel, M; Nielsen, L K; Andersen, P S
1995-01-01
A novel phage display system has been developed for PCR amplification and cloning of the Fab fragments of human immunoglobulin genes. Using this system, we have cloned an antibody from a mouse-human hybridoma cell line directed against the erythrocyte antigen rhesus D. Intact erythrocytes were used...... for absorption of the Fab phages. Soluble Fab fragments produced from the cloned material showed identical performance to the parental antibody in agglutination assays. Gel filtration confirmed that the Fab fragment consists of a kappa-Fd heterodimer. The successful use of intact cells for selection of specific...... Fab phages demonstrates that it is possible to by-pass purification of the antigen of interest. Comparison with published germline sequences demonstrated that the immunoglobulin coding regions had the highest homology to the VH 1.9III and V kappa Hum kappa v325 germline genes, respectively....
Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.
Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun
2012-01-01
The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.
Directory of Open Access Journals (Sweden)
Ouali Ahmed
2008-04-01
Full Text Available Abstract Background The superfamily of serine proteinase inhibitors (serpins is involved in numerous fundamental biological processes as inflammation, blood coagulation and apoptosis. Our interest is focused on the SERPINA3 sub-family. The major human plasma protease inhibitor, α1-antichymotrypsin, encoded by the SERPINA3 gene, is homologous to genes organized in clusters in several mammalian species. However, although there is a similar genic organization with a high degree of sequence conservation, the reactive-centre-loop domains, which are responsible for the protease specificity, show significant divergences. Results We provide additional information by analyzing the situation of SERPINA3 in the bovine genome. A cluster of eight genes and one pseudogene sharing a high degree of identity and the same structural organization was characterized. Bovine SERPINA3 genes were localized by radiation hybrid mapping on 21q24 and only spanned over 235 Kilobases. For all these genes, we propose a new nomenclature from SERPINA3-1 to SERPINA3-8. They share approximately 70% of identity with the human SERPINA3 homologue. In the cluster, we described an original sub-group of six members with an unexpected high degree of conservation for the reactive-centre-loop domain, suggesting a similar peptidase inhibitory pattern. Preliminary expression analyses of these bovSERPINA3s showed different tissue-specific patterns and diverse states of glycosylation and phosphorylation. Finally, in the context of phylogenetic analyses, we improved our knowledge on mammalian SERPINAs evolution. Conclusion Our experimental results update data of the bovine genome sequencing, substantially increase the bovSERPINA3 sub-family and enrich the phylogenetic tree of serpins. We provide new opportunities for future investigations to approach the biological functions of this unusual subset of serine proteinase inhibitors.
DEFF Research Database (Denmark)
Durkin, M E; Wewer, U M; Chung, A E
1995-01-01
of the mouse entactin gene closely corresponds to the organization of the polypeptide into distinct structural and functional domains. The two amino-terminal globular domains are encoded by three exons each. Single exons encode the two protease-sensitive, O-glycosylated linking regions. The six EGF......Entactin is a widespread basement membrane protein of 150 kDa that binds to type IV collagen and laminin. The complete exon-intron structure of the mouse entactin gene has been determined from lambda genomic DNA clones. The gene spans at least 65 kb and contains 20 exons. The exon organization...
Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J
2013-05-01
FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.
Directory of Open Access Journals (Sweden)
Moorman Stephen J
2005-05-01
Full Text Available Abstract Background Little is known about the affect of microgravity on gene expression, particularly in vivo during embryonic development. Using transgenic zebrafish that express the gfp gene under the influence of a β-actin promoter, we examined the affect of simulated-microgravity on GFP expression in the heart, notochord, eye, somites, and rohon beard neurons. We exposed transgenic zebrafish to simulated-microgravity for different durations at a variety of developmental times in an attempt to determine periods of susceptibility for the different developing organ systems. Results The developing heart had a period of maximum susceptibility between 32 and 56 hours after fertilization when there was an approximately 30% increase in gene expression. The notochord, eye, somites, and rohon beard neurons all showed periods of susceptibility occurring between 24 and 72 hours after fertilization. In addition, the notochord showed a second period of susceptibility between 8 and 32 hours after fertilization. Interestingly, all organs appeared to be recovering by 80 hours after fertilization despite continued exposure to simulated-microgravity. Conclusion These results support the idea that exposure to microgravity can cause changes in gene expression in a variety of developing organ systems in live embryos and that there are periods of maximum susceptibility to the effects.
Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis
DEFF Research Database (Denmark)
Ladefoged, Søren; Christiansen, Gunna
1994-01-01
of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...
Genetic organization of the unc-22 IV gene and the adjacent region in Caenorhabditis elegans.
Rogalski, T M; Baillie, D L
1985-01-01
The genetic organization of the region immediately adjacent to the unc-22 IV gene in Caenorhabditis elegans has been studied. We have identified twenty essential genes in this interval of approximately 1.5-map units on Linkage Group IV. The mutations that define these genes were positioned by recombination mapping and complementation with several deficiencies. With few exceptions, the positions obtained by these two methods agreed. Eight of the twenty essential genes identified are represented by more than one allele. Three possible internal deletions of the unc-22 gene have been located by intra-genic mapping. In addition, the right end point of a deficiency or an inversion affecting the adjacent genes let-56 and unc-22 has been positioned inside the unc-22 gene.
Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo
2012-01-01
Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.
Directory of Open Access Journals (Sweden)
Christiane Rodriguez Gutierrez Madalena
Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867
Directory of Open Access Journals (Sweden)
Lei Gao
Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Engineered Bovine Antibodies in the Development of Novel Therapeutics, Immunomodulators and Vaccines
Directory of Open Access Journals (Sweden)
Madhuri Koti
2014-05-01
Full Text Available Some bovine antibodies across all classes are unique, such as the CDR3 of the variable heavy-domain (VH CDR3, which is exceptionally long (up to 66 amino acids, unlike most conventional antibodies where the VH CDR3 loops range from 10 to 25 amino acids. The exceptionally long VH CDR3 is encoded by unusually long germline IGHD genes together with insertion of novel “a” nucleotide rich conserved short nucleotide sequence (CSNS specifically at the IGH V-D junction. Such an exceptionally long VH CDR3 confers unique “knob and stalk” structural architecture where the knob, formed by intra-VH CDR3 disulfide bridges, is separated by 20 Å solvent exposed stalk composed of anti-parallel beta strands. The substitution of the knob with cytokines, such as, erythropoietin and granulocyte colony stimulating factor 3 (granulocyte colony stimulating factor, results in expression of functional fusion proteins with enhanced pharmacokinetics. The beta stranded stalk can be substituted with other rigid structures, for example, repeat alpha helices to form coiled-coil that mimics the beta-stranded stalk and, thus, opens opportunities for insertion of this structure in the CDRs of antibodies across species. Given the versatility of such a structural platform in bovine antibody VH CDR3, it provides the opportunity for the development of new generation of diagnostics, therapeutics, vaccines and immunomodulating drugs.
Identification of novel genes associated with renal tertiary lymphoid organ formation in aging mice.
Huang, Yuan; Caputo, Christina R; Noordmans, Gerda A; Yazdani, Saleh; Monteiro, Luiz Henrique; van den Born, Jaap; van Goor, Harry; Heeringa, Peter; Korstanje, Ron; Hillebrands, Jan-Luuk
2014-01-01
A hallmark of aging-related organ deterioration is a dysregulated immune response characterized by pathologic leukocyte infiltration of affected tissues. Mechanisms and genes involved are as yet unknown. To identify genes associated with aging-related renal infiltration, we analyzed kidneys from aged mice (≥20 strains) for infiltrating leukocytes followed by Haplotype Association Mapping (HAM) analysis. Immunohistochemistry revealed CD45+ cell clusters (predominantly T and B cells) in perivascular areas coinciding with PNAd+ high endothelial venules and podoplanin+ lymph vessels indicative of tertiary lymphoid organs. Cumulative cluster size increased with age (analyzed at 6, 12 and 20 months). Based on the presence or absence of clusters in male and female mice at 20 months, HAM analysis revealed significant associations with loci on Chr1, Chr2, Chr8 and Chr14 in male mice, and with loci on Chr4, Chr7, Chr13 and Chr14 in female mice. Wisp2 (Chr2) showed the strongest association (P = 5.00×10(-137)) in male mice; Ctnnbip1 (P = 6.42×10(-267)) and Tnfrsf8 (P = 5.42×10(-245)) (both on Chr4) showed the strongest association in female mice. Both Wisp2 and Ctnnbip1 are part of the Wnt-signaling pathway and the encoded proteins were expressed within the tertiary lymphoid organs. In conclusion, this study revealed differential lymphocytic infiltration and tertiary lymphoid organ formation in aged mouse kidneys across different inbred mouse strains. HAM analysis identified candidate genes involved in the Wnt-signaling pathway that may be causally linked to tertiary lymphoid organ formation.
Directory of Open Access Journals (Sweden)
Taro Tsujimura
2015-01-01
Full Text Available Despite the well-documented role of remote enhancers in controlling developmental gene expression, the mechanisms that allocate enhancers to genes are poorly characterized. Here, we investigate the cis-regulatory organization of the locus containing the Tfap2c and Bmp7 genes in vivo, using a series of engineered chromosomal rearrangements. While these genes lie adjacent to one another, we demonstrate that they are independently regulated by distinct sets of enhancers, which in turn define non-overlapping regulatory domains. Chromosome conformation capture experiments reveal a corresponding partition of the locus in two distinct structural entities, demarcated by a discrete transition zone. The impact of engineered chromosomal rearrangements on the topology of the locus and the resultant gene expression changes indicate that this transition zone functionally organizes the structural partition of the locus, thereby defining enhancer-target gene allocation. This partition is, however, not absolute: we show that it allows competing interactions across it that may be non-productive for the competing gene, but modulate expression of the competed one. Altogether, these data highlight the prime role of the topological organization of the genome in long-distance regulation of gene expression.
Nagel, Rebecca; Kirschbaum, Frank; Tiedemann, Ralph
2017-03-01
In mormyrid weakly electric fish, the electric organ discharge (EOD) is used for species recognition, orientation and prey localization. Produced in the muscle-derived adult electric organ, the EOD exhibits a wide diversity across species in both waveform and duration. While certain defining EOD characteristics can be linked to anatomical features of the electric organ, many factors underlying EOD differentiation are yet unknown. Here, we report the differential expression of 13 Kv1 voltage-gated potassium channel genes, two inwardly rectifying potassium channel genes, two previously studied sodium channel genes and an ATPase pump in two sympatric species of the genus Campylomormyrus in both the adult electric organ and skeletal muscle. Campylomormyrus compressirostris displays a basal EOD, largely unchanged during development, while C. tshokwe has an elongated, putatively derived discharge. We report an upregulation in all Kv1 genes in the electric organ of Campylomormyrus tshokwe when compared to both skeletal muscle and C. compressirostris electric organ. This pattern of upregulation in a species with a derived EOD form suggests that voltage-gated potassium channels are potentially involved in the diversification of the EOD signal among mormyrid weakly electric fish.
Sundström, Jens; Engström, Peter
2002-07-01
The Norway spruce MADS-box genes DAL11, DAL12 and DAL13 are phylogenetically related to the angiosperm B-function MADS-box genes: genes that act together with A-function genes in specifying petal identity and with C-function genes in specifying stamen identity to floral organs. In this report we present evidence to suggest that the B-gene function in the specification of identity of the pollen-bearing organs has been conserved between conifers and angiosperms. Expression of DAL11 or DAL12 in transgenic Arabidopsis causes phenotypic changes which partly resemble those caused by ectopic expression of the endogenous B-genes. In similar experiments, flowers of Arabidopsis plants expressing DAL13 showed a different homeotic change in that they formed ectopic anthers in whorls one, two or four. We also demonstrate the capacity of the spruce gene products to form homodimers, and that DAL11 and DAL13 may form heterodimers with each other and with the Arabidopsis B-protein AP3, but not with PI, the second B-gene product in Arabidopsis. In situ hybridization experiments show that the conifer B-like genes are expressed specifically in developing pollen cones, but differ in both temporal and spatial distribution patterns. These results suggest that the B-function in conifers is dual and is separated into a meristem identity and an organ identity function, the latter function possibly being independent of an interaction with the C-function. Thus, even though an ancestral B-function may have acted in combination with C to specify micro- and megasporangia, the B-function has evolved differently in conifers and angiosperms.
Li, Hui; Liu, Qian; Zhang, Qingli; Qin, Erjun; Jin, Chuan; Wang, Yu; Wu, Mei; Shen, Guangshuang; Chen, Chengbin; Song, Wenqin; Wang, Chunguo
2017-01-01
The curd is a specialized organ and the most important product organ of cauliflower (Brassica oleracea L. var. botrytis). However, the mechanism underlying the regulation of curd formation and development remains largely unknown. In the present study, a novel homologous gene containing the Organ Size Related (OSR) domain, namely, CDAG1 (Curd Development Associated Gene 1) was identified in cauliflower. Quantitative analysis indicated that CDAG1 showed significantly higher transcript levels in young tissues. Functional analysis demonstrated that the ectopic overexpression of CDAG1 in Arabidopsis and cauliflower could significantly promote organ growth and result in larger organ size and increased biomass. Organ enlargement was predominantly due to increased cell number. In addition, 228 genes involved in the CDAG1-mediated regulatory network were discovered by transcriptome analysis. Among these genes, CDAG1 was confirmed to inhibit the transcriptional expression of the endogenous OSR genes, ARGOS and ARL, while a series of ethylene-responsive transcription factors (ERFs) were found to increased expression in 35S:CDAG1 transgenic Arabidopsis plants. This implies that CDAG1 may function in the ethylene-mediated signal pathway. These findings provide new insight into the function of OSR genes, and suggest potential applications of CDAG1 in breeding high-yielding crops. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Kamenetsky, Rina; Faigenboim, Adi; Shemesh Mayer, Einat; Ben Michael, Tomer; Gershberg, Chen; Kimhi, Sagie; Esquira, Itzhak; Rohkin Shalom, Sarit; Eshel, Dani; Rabinowitch, Haim D; Sherman, Amir
2015-01-22
Garlic is cultivated and consumed worldwide as a popular condiment and green vegetable with medicinal and neutraceutical properties. Garlic cultivars do not produce seeds, and therefore, this plant has not been the subject of either classical breeding or genetic studies. However, recent achievements in fertility restoration in a number of genotypes have led to flowering and seed production, thus enabling genetic studies and breeding in garlic. A transcriptome catalogue of fertile garlic was produced from multiplexed gene libraries, using RNA collected from various plant organs, including inflorescences and flowers. Over 32 million 250-bp paired-end reads were assembled into an extensive transcriptome of 240,000 contigs. An abundant transcriptome assembled separately from 102,000 highly expressed contigs was annotated and analyzed for gene ontology and metabolic pathways. Organ-specific analysis showed significant variation of gene expression between plant organs, with the highest number of specific reads in inflorescences and flowers. Analysis of the enriched biological processes and molecular functions revealed characteristic patterns for stress response, flower development and photosynthetic activity. Orthologues of key flowering genes were differentially expressed, not only in reproductive tissues, but also in leaves and bulbs, suggesting their role in flower-signal transduction and the bulbing process. More than 100 variants and isoforms of enzymes involved in organosulfur metabolism were differentially expressed and had organ-specific patterns. In addition to plant genes, viral RNA of at least four garlic viruses was detected, mostly in the roots and cloves, whereas only 1-4% of the reads were found in the foliage leaves. The de novo transcriptome of fertile garlic represents a new resource for research and breeding of this important crop, as well as for the development of effective molecular markers for useful traits, including fertility and seed production
Chromosomal organization of adrenergic receptor genes
International Nuclear Information System (INIS)
Yang-Feng, T.L.; Xue, Feiyu; Zhong, Wuwei; Cotecchia, S.; Frielle, T.; Caron, M.G.; Lefkowitz, R.J.; Francke, U.
1990-01-01
The adrenergic receptors (ARs) (subtypes α 1 , α 2 , β 1 , and β 2 ) are a prototypic family of guanine nucleotide binding regulatory protein-coupled receptors that mediate the physiological effects of the hormone epinephrine and the neurotransmitter norepinephrine. The authors have previously assigned the genes for β 2 -and α 2 -AR to human chromosomes 5 and 10, respectively. By Southern analysis of somatic cell hybrids and in situ chromosomal hybridization, they have now mapped the α 1 -AR gene to chromosome 5q32→q34, the same position as β 2 -AR, and the β 1 -AR gene to chromosome 10q24→q26, the region where α 2 -AR, is located. In mouse, both α 2 -and β 1 -AR genes were assigned to chromosome 19, and the α 1 -AR locus was localized to chromosome 11. Pulsed field gel electrophoresis has shown that the α 1 -and β 2 -AR genes in humans are within 300 kilobases (kb) and the distance between the α 2 - and β 1 -AR genes is <225 kb. The proximity of these two pairs of AR genes and the sequence similarity that exists among all the ARs strongly suggest that they are evolutionarily related. Moreover, they likely arose from a common ancestral receptor gene and subsequently diverged through gene duplication and chromosomal duplication to perform their distinctive roles in mediation the physiological effects of catecholamines. The AR genes thus provide a paradigm for understanding the evolution of such structurally conserved yet functionally divergent families off receptor molecules
DEFF Research Database (Denmark)
Durkin, M E; Gautam, M; Loechel, F
1996-01-01
We have determined the structural organization of the human and mouse genes that encode the laminin beta2 chain (s-laminin), an essential component of the basement membranes of the neuromuscular synapse and the kidney glomerulus. The human and mouse genes have a nearly identical exon-intron organ......We have determined the structural organization of the human and mouse genes that encode the laminin beta2 chain (s-laminin), an essential component of the basement membranes of the neuromuscular synapse and the kidney glomerulus. The human and mouse genes have a nearly identical exon...
Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization
Ray, J. Christian J; Igoshin, Oleg A.
2012-01-01
Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903
Organization and post-transcriptional processing of focal adhesion kinase gene
Directory of Open Access Journals (Sweden)
Enslen Hervé
2006-08-01
Full Text Available Abstract Background Focal adhesion kinase (FAK is a non-receptor tyrosine kinase critical for processes ranging from embryo development to cancer progression. Although isoforms with specific molecular and functional properties have been characterized in rodents and chicken, the organization of FAK gene throughout phylogeny and its potential to generate multiple isoforms are not well understood. Here, we study the phylogeny of FAK, the organization of its gene, and its post-transcriptional processing in rodents and human. Results A single orthologue of FAK and the related PYK2 was found in non-vertebrate species. Gene duplication probably occurred in deuterostomes after the echinoderma embranchment, leading to the evolution of PYK2 with distinct properties. The amino acid sequence of FAK and PYK2 is conserved in their functional domains but not in their linker regions, with the absence of autophosphorylation site in C. elegans. Comparison of mouse and human FAK genes revealed the existence of multiple combinations of conserved and non-conserved 5'-untranslated exons in FAK transcripts suggesting a complex regulation of their expression. Four alternatively spliced coding exons (13, 14, 16, and 31, previously described in rodents, are highly conserved in vertebrates. Cis-regulatory elements known to regulate alternative splicing were found in conserved alternative exons of FAK or in the flanking introns. In contrast, other reported human variant exons were restricted to Homo sapiens, and, in some cases, other primates. Several of these non-conserved exons may correspond to transposable elements. The inclusion of conserved alternative exons was examined by RT-PCR in mouse and human brain during development. Inclusion of exons 14 and 16 peaked at the end of embryonic life, whereas inclusion of exon 13 increased steadily until adulthood. Study of various tissues showed that inclusion of these exons also occurred, independently from each other, in a
Directory of Open Access Journals (Sweden)
Ye Ai
Full Text Available According to the floral organ development ABC model, B class genes specify petal and stamen identification. In order to study the function of B class genes in flower development of Tagetes erecta, five MADS-box B class genes were identified and their expression and putative functions were studied. Sequence comparisons and phylogenetic analyses indicated that there were one PI-like gene-TePI, two euAP3-like genes-TeAP3-1 and TeAP3-2, and two TM6-like genes-TeTM6-1 and TeTM6-2 in T. erecta. Strong expression levels of these genes were detected in stamens of the disk florets, but little or no expression was detected in bracts, receptacles or vegetative organs. Yeast hybrid experiments of the B class proteins showed that TePI protein could form a homodimer and heterodimers with all the other four B class proteins TeAP3-1, TeAP3-2, TeTM6-1 and TeTM6-2. No homodimer or interaction was observed between the euAP3 and TM6 clade members. Over-expression of five B class genes of T. erecta in Nicotiana rotundifolia showed that only the transgenic plants of 35S::TePI showed altered floral morphology compared with the non-transgenic line. This study could contribute to the understanding of the function of B class genes in flower development of T. erecta, and provide a theoretical basis for further research to change floral organ structures and create new materials for plant breeding.
Pleurodeles Waltl Humoral Immune Response under Spaceflight Conditions
Bascove, Matthieu; Touche, Nadege; Frippiat, Jean-Pol
2008-06-01
The immune system is an important regulatory mechanism affected by spaceflights. In a previous work, we performed a first study of the humoral immune response induced by the immunization of Pleurodeles waltl during a 5 months stay onboard the Mir space station. This analysis indicated that heavy-chain variable domains of specific IgM are encoded by genes of the VHII and VHVI families. However, the contributions of these two families to IgM heavy-chains are different in flown animals [1]. To better understand this immune response modification, we have now determined how individual VH genes have been used to build specific IgM binding sites in animals immunized on earth or in space. This new study revealed quantitative and qualitative modifications in VH genes expression. These data confirm that a spaceflight might affect the humoral response.
Levin, J Z; Fletcher, J C; Chen, X; Meyerowitz, E M
1998-06-01
In a screen to identify novel genes required for early Arabidopsis flower development, we isolated four independent mutations that enhance the Ufo phenotype toward the production of filamentous structures in place of flowers. The mutants fall into three complementation groups, which we have termed FUSED FLORAL ORGANS (FFO) loci. ffo mutants have specific defects in floral organ separation and/or positioning; thus, the FFO genes identify components of a boundary formation mechanism(s) acting between developing floral organ primordia. FFO1 and FFO3 have specific functions in cauline leaf/stem separation and in first- and third-whorl floral organ separation, with FFO3 likely acting to establish and FFO1 to maintain floral organ boundaries. FFO2 acts at early floral stages to regulate floral organ number and positioning and to control organ separation within and between whorls. Plants doubly mutant for two ffo alleles display additive phenotypes, indicating that the FFO genes may act in separate pathways. Plants doubly mutant for an ffo gene and for ufo, lfy, or clv3 reveal that the FFO genes play roles related to those of UFO and LFY in floral meristem initiation and that FFO2 and FFO3 may act to control cell proliferation late in inflorescence development.
1980-12-01
process. Organizational Behavior and Human Performance , 6, 573-592, 1971. Vroom , V.H. Organizational choice: A study of pre- and post- decision...processes. Organizational Behavior and Human Performance . 1, 212-225. 1966. Vroom , V.H. and Deci, E.L. The stability of post-decision dissonance: A follow...delay of incentive on actual performance and satisfaction . This suggests that organizations should act to reduce or eliminate delays of incentive of more
Directory of Open Access Journals (Sweden)
Haibo Zhang
2015-06-01
Full Text Available This study was conducted to determine the effects of different levels of crude protein (CP supplements to the diet of early-weaned yaks on their growth performance, intestinal development, and immune response. Forty 3-month-old weaned yaks were selected and assigned to four dietary groups (Control, 17, 19 and 21% CP. Dietary CP supplements had a significant effect on average daily gain (ADG, crypt depth (CD (duodenum, jejunum and ileum, villous height (VH (duodenum, jejunum and ileum and CD/VH (jejunum and ileum. Average daily gain, CD (duodenum, jejunum and ileum and VH (ileum showed quadratic increases as the dietary CP increased, whereas CD/VH (jejunum and ileum ratios showed quadratic decreases. Blood urea nitrogen (BUN, glucose (GLU, immunoglobulin G (IgG, IgM, interleukin-1 (IL-1, IL-2, tumor necrosis factor (TNF-α, and interferon (IFN-γ concentrations increased significantly, whereas albumin (ALB, alanine aminotransferase (ALT and aspartate aminotransferase (AST decreased significantly with dietary CP supplements. Dietary CP supplements significantly increased the concentrations of IL-6, TNF-α, IFN-γ and the nuclear factor of activated T cell transcription factor (NFAT for gene expression. As the dietary CP supplements increased, IL-6, IFN-γ and NF-AT gene expression showed quadratic increases. These results showed that the appropriate dietary CP supplementation improved the growth performance and intestinal development of earlyweaned yaks and thus that the CP supplements were beneficial and enhanced the humoral immunity response of yaks.
I Have a Dream: Organic Movements Include Gene Manipulation to Improve Sustainable Farming
Directory of Open Access Journals (Sweden)
Gerhart U. Ryffel
2017-03-01
Full Text Available Several papers in a Special Issue of Sustainability have recently discussed various aspects to evaluate whether organic farming and gene manipulation are compatible. A special emphasis was given to new plant breeding techniques (NPBTs. These new approaches allow the most predictable genetic alterations of crop plants in ways that the genetically modified plant is identical to a plant generated by conventional breeding. The articles of the Special Issue present the arguments pro and contra the inclusion of the plants generated by NPBTs in organic farming. Organic movements have not yet made a final decision whether some of these techniques should be accepted or banned. In my view these novel genetically manipulated (GM crops could be used in such a way as to respect the requirements for genetically manipulated organisms (GMOs formulated by the International Federation of Organic Movements (IFOAM. Reviewing the potential benefits of disease-resistant potatoes and bananas, it seems possible that these crops support organic farming. To this end, I propose specific requirements that the organic movements should proactively formulate as their standards to accept specific GM crops.
Enokizono, Mikako; Aida, Noriko; Niwa, Tetsu; Osaka, Hitoshi; Naruto, Takuya; Kurosawa, Kenji; Ohba, Chihiro; Suzuki, Toshifumi; Saitsu, Hirotomo; Goto, Tomohide; Matsumoto, Naomichi
2017-05-15
Little is known regarding neuroimaging-genotype correlations in Joubert syndrome (JBTS). To elucidate one of these correlations, we investigated the neuroimaging findings of JBTS patients with C5orf42 mutations. Neuroimaging findings in five JBTS patients with C5orf42 mutations were retrospectively assessed with regard to the infratentorial and supratentorial structures on T1-magnetization prepared rapid gradient echo (MPRAGE), T2-weighted images, and color-coded fractional anisotropy (FA) maps; the findings were compared to those in four JBTS patients with mutations in other genes (including three with AHI1 and one with TMEM67 mutations). In C5orf42-mutant patients, the infratentorial magnetic resonance (MR) images showed normal or minimally thickened and minimally elongated superior cerebellar peduncles (SCP), normal or minimally deepened interpeduncular fossa (IF), and mild vermian hypoplasia (VH). However, in other patients, all had severe abnormalities in the SCP and IF, and moderate to marked VH. Supratentorial abnormalities were found in one individual in other JBTS. In JBTS with all mutations, color-coded FA maps showed the absence of decussation of the SCP (DSCP). The morphological neuroimaging findings in C5orf42-mutant JBTS were distinctly mild and made diagnosis difficult. However, the absence of DSCP on color-coded FA maps may facilitate the diagnosis of JBTS. Copyright © 2017 Elsevier B.V. All rights reserved.
Unthan, Simon; Baumgart, Meike; Radek, Andreas; Herbst, Marius; Siebert, Daniel; Brühl, Natalie; Bartsch, Anna; Bott, Michael; Wiechert, Wolfgang; Marin, Kay; Hans, Stephan; Krämer, Reinhard; Seibold, Gerd; Frunzke, Julia; Kalinowski, Jörn; Rückert, Christian; Wendisch, Volker F; Noack, Stephan
2015-02-01
For synthetic biology applications, a robust structural basis is required, which can be constructed either from scratch or in a top-down approach starting from any existing organism. In this study, we initiated the top-down construction of a chassis organism from Corynebacterium glutamicum ATCC 13032, aiming for the relevant gene set to maintain its fast growth on defined medium. We evaluated each native gene for its essentiality considering expression levels, phylogenetic conservation, and knockout data. Based on this classification, we determined 41 gene clusters ranging from 3.7 to 49.7 kbp as target sites for deletion. 36 deletions were successful and 10 genome-reduced strains showed impaired growth rates, indicating that genes were hit, which are relevant to maintain biological fitness at wild-type level. In contrast, 26 deleted clusters were found to include exclusively irrelevant genes for growth on defined medium. A combinatory deletion of all irrelevant gene clusters would, in a prophage-free strain, decrease the size of the native genome by about 722 kbp (22%) to 2561 kbp. Finally, five combinatory deletions of irrelevant gene clusters were investigated. The study introduces the novel concept of relevant genes and demonstrates general strategies to construct a chassis suitable for biotechnological application. © 2014 The Authors. Biotechnology Journal published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. This is an open access article under the terms of the Creative Commons Attribution-Non-Commercial-NoDerivs Licence, which permits use and distribution in any medium, provided the original work is properly cited, the use is non- commercial and no modifications or adaptations are made.
TRL1 gene expression in tomato (Solanum lycopersicum) floral organs after γ-irradiation
International Nuclear Information System (INIS)
Bondarenco, V.S.; Barbacar, N.I.
2009-01-01
The article describes the expression patterns of a novel RAD16-like TRL1 (tomato RAD16-like 1) gene in the floral organs of tomato during anther meiosis and mature flower stages. The data on the induction of the TRL1 expression as a result of γ-irradiation is discussed. (authors)
A plant-like proton-pump partnership in the malaria parasite
International Nuclear Information System (INIS)
Allen, R.J.W.; Saliba, K.J.; Zissis, S.; Kirk, K.
2001-01-01
Full text: The 'intraerythrocytic' form of the human malaria parasite. Plasmodium falciparum contains an acidic 'digestive vacuole' which is believed to be the main site of haemoglobin degradation, and the major site of action of many antimalarial drugs. The mechanism/s by which this organelle is acidified have not been investigated. In plant cells, the internal acidic vacuole has on its membrane two types of H + -pumps which contribute to the generation of an acidic pH: a vacuolar-type H + -ATPase (V-H + -ATPase) and a vacuolar H + -pyrophosphatase (V-H + -PPase). The presence of a V-H + -ATPase on the digestive vacuole membrane of P. falciparum has been demonstrated by immuno-electron microscopy (J. Biol. Chem. (2000) 275: 34353-34358) but its functional activity on this organelle has not been demonstrated. Two V-H + -PPase genes have been shown to be expressed in the intraerythrocytic stage of the P. falciparum parasite (Mol. Biochem. Parasitol. (2001) 114: 183-195); however, immunological methods failed to detect either on the parasite digestive vacuole. In this study we use a combination of NMR spectroscopy and fluorescence techniques to show that (i) P. falciparum contains low levels of pyrophosphate, and (ii) that both ATP and pyrophosphate are able to energise the acidification of the parasite's digestive vacuole. We propose that, like many plant cells the digestive vacuole of P. falciparum parasites has, on its membrane, a V-H + -PPase as well as a V-H + -ATPaSe, and that both pumps contribute to the pH regulation of this organelle
Chowdhary, Surabhi; Kainth, Amoldeep S; Gross, David S
2017-12-15
Three-dimensional (3D) chromatin organization is important for proper gene regulation, yet how the genome is remodeled in response to stress is largely unknown. Here, we use a highly sensitive version of chromosome conformation capture in combination with fluorescence microscopy to investigate Heat Shock Protein ( HSP ) gene conformation and 3D nuclear organization in budding yeast. In response to acute thermal stress, HSP genes undergo intense intragenic folding interactions that go well beyond 5'-3' gene looping previously described for RNA polymerase II genes. These interactions include looping between upstream activation sequence (UAS) and promoter elements, promoter and terminator regions, and regulatory and coding regions (gene "crumpling"). They are also dynamic, being prominent within 60 s, peaking within 2.5 min, and attenuating within 30 min, and correlate with HSP gene transcriptional activity. With similarly striking kinetics, activated HSP genes, both chromosomally linked and unlinked, coalesce into discrete intranuclear foci. Constitutively transcribed genes also loop and crumple yet fail to coalesce. Notably, a missense mutation in transcription factor TFIIB suppresses gene looping, yet neither crumpling nor HSP gene coalescence is affected. An inactivating promoter mutation, in contrast, obviates all three. Our results provide evidence for widespread, transcription-associated gene crumpling and demonstrate the de novo assembly and disassembly of HSP gene foci. Copyright © 2017 American Society for Microbiology.
Zhao, D; Yang, M; Solava, J; Ma, H
1999-09-01
Normal flower development likely requires both specific and general regulators. We have isolated an Arabidopsis mutant ask1-1 (for -Arabidopsis skp1-like1-1), which exhibits defects in both vegetative and reproductive development. In the ask1-1mutant, rosette leaf growth is reduced, resulting in smaller than normal rosette leaves, and internodes in the floral stem are shorter than normal. Examination of cell sizes in these organs indicates that cell expansion is normal in the mutant, but cell number is reduced. In the mutant, the numbers of petals and stamens are reduced, and many flowers have one or more petals with a reduced size. In addition, all mutant flowers have short stamen filaments. Furthermore, petal/stamen chimeric organs are found in many flowers. These results indicate that the ASK1 gene affects the size of vegetative and floral organs. The ask1 floral phenotype resembles somewhat that of the Arabidopsis ufo mutants in that both genes affect whorls 2 and 3. We therefore tested for possible interactions between ASK1 and UFO by analyzing the phenotypes of ufo-2 ask1-1 double mutant plants. In these plants, vegetative development is similar to that of the ask1-1 single mutant, whereas the floral defects are more severe than those in either single mutant. Interior to the first whorl, the double mutant flowers have more sepals or sepal-like organs than are found in ufo-2, and less petals than ask1-1. Our results suggest that ASK1 interacts with UFO to control floral organ identity in whorls 2 and 3. This is very intriguing because ASK1 is very similar in sequence to the yeast SKP1 protein and UFO contains an F-box, a motif known to interact with SKP1 in yeast. Although the precise mechanism of ASK1 and UFO action is unknown, our results support the hypothesis that these two proteins physically interact in vivo. Copyright 1999 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Helen L Ramsden
2015-01-01
Full Text Available Neural circuits in the medial entorhinal cortex (MEC encode an animal's position and orientation in space. Within the MEC spatial representations, including grid and directional firing fields, have a laminar and dorsoventral organization that corresponds to a similar topography of neuronal connectivity and cellular properties. Yet, in part due to the challenges of integrating anatomical data at the resolution of cortical layers and borders, we know little about the molecular components underlying this organization. To address this we develop a new computational pipeline for high-throughput analysis and comparison of in situ hybridization (ISH images at laminar resolution. We apply this pipeline to ISH data for over 16,000 genes in the Allen Brain Atlas and validate our analysis with RNA sequencing of MEC tissue from adult mice. We find that differential gene expression delineates the borders of the MEC with neighboring brain structures and reveals its laminar and dorsoventral organization. We propose a new molecular basis for distinguishing the deep layers of the MEC and show that their similarity to corresponding layers of neocortex is greater than that of superficial layers. Our analysis identifies ion channel-, cell adhesion- and synapse-related genes as candidates for functional differentiation of MEC layers and for encoding of spatial information at different scales along the dorsoventral axis of the MEC. We also reveal laminar organization of genes related to disease pathology and suggest that a high metabolic demand predisposes layer II to neurodegenerative pathology. In principle, our computational pipeline can be applied to high-throughput analysis of many forms of neuroanatomical data. Our results support the hypothesis that differences in gene expression contribute to functional specialization of superficial layers of the MEC and dorsoventral organization of the scale of spatial representations.
Laparoscopic and vaginal approaches to hysterectomy in the obese.
Bogani, Giorgio; Cromi, Antonella; Serati, Maurizio; Di Naro, Edoardo; Casarin, Jvan; Pinelli, Ciro; Uccella, Stefano; Leone Roberti Maggiore, Umberto; Marconi, Nicola; Ghezzi, Fabio
2015-06-01
The aim of the study was to compare surgery-related outcomes between laparoscopic (LH) and vaginal (VH) hysterectomy, performed for benign uterine disease (other than pelvic organs prolapse) in obese women. Data of consecutive obese (BMI≥30) patients undergoing LH and VH, between 2000 and 2013, were compared using a propensity-matched analysis. One hundred propensity-matched patient pairs (200 patients) undergoing LH (n=100) and VH (n=100) represented the study group. Baseline demographic characteristics were similar between groups. Patients undergoing LH experienced similar operative time (87.5 (25-360) vs. 85 (25-240)min; p=0.28), slightly lower blood loss (100 (10-3200) vs. 150 (10-800)ml; p=0.006) and shorter length of hospital stay (1 (1-5) vs. 2 (1-5) days; p<0.001) than women undergoing VH. There was no statistically significant difference between LH and VH in complication rate (3% for VH vs. 10% for LH; OR: 3.4; 95%CI: 0.95-13.5; p=0.08). At multivariable analysis complication rates increased as BMI increase (OR: 1.01 (1.00-1.02) for 1-unit increase in BMI; p=0.05). Independently, LH correlated with reduced hospital stay (OR: 0.63 (95%CI: 0.49-0.82); p=0.001) and complication rates (OR: 0.91 (95%CI: 0.85-0.97); p=0.01). In obese women affected by benign uterine disease LH and VH should not be denied on the basis of the mere BMI, per se. In this setting, LH upholds effectiveness of VH, improving postoperative outcomes. However, complication rate increases as BMI increase, regardless surgical route. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Tolstrup, Cæcilie Krogsgaard; Husby, Karen Ruben; Lose, Gunnar; Kopp, Tine Iskov; Viborg, Petra Hall; Kesmodel, Ulrik Schiøler; Klarskov, Niels
2018-03-01
This study compares vaginal hysterectomy with uterosacral ligament suspension (VH) with the Manchester-Fothergill procedure (MP) for treating pelvic organ prolapse (POP) in the apical compartment. Our matched historical cohort study is based on data from four Danish databases and the corresponding electronic medical records. Patients with POP surgically treated with VH (n = 295) or the MP (n = 295) in between 2010 and 2014 were matched for age and preoperative POP stage in the apical compartment. The main outcome was recurrent or de novo POP in any compartment. Secondary outcomes were recurrent or de novo POP in each compartment and complications. The risk of recurrent or de novo POP in any compartment was higher after VH (18.3%) compared with the MP (7.8%) (Hazard ratio, HR = 2.5, 95% confidence interval (CI): 1.3-4.8). Recurrence in the apical compartment occurred in 5.1% after VH vs. 0.3% after the MP (hazard ratio (HR) = 10.0, 95% confidence interval (CI) 1.3-78.1). In the anterior compartment, rates of recurrent or de novo POP were 11.2% after VH vs. 4.1% after the MP (HR = 3.5, 95% CI 1.4-8.7) and in the posterior compartment 12.9% vs. 4.7% (HR = 2.6, 95% CI 1.3-5.4), respectively. There were more perioperative complications (2.7 vs. 0%, p = 0.007) and postoperative intra-abdominal bleeding (2 vs. 0%, p = 0.03) after VH. This study shows that the MP is superior to VH; if there is no other indication for hysterectomy, the MP should be preferred to VH for surgical treatment of POP in the apical compartment.
Lin, Katherine I; Tam, Constantine S; Keating, Michael J; Wierda, William G; O'Brien, Susan; Lerner, Susan; Coombes, Kevin R; Schlette, Ellen; Ferrajoli, Alessandra; Barron, Lynn L; Kipps, Thomas J; Rassenti, Laura; Faderl, Stefan; Kantarjian, Hagop; Abruzzo, Lynne V
2009-04-02
Although immunoglobulin V(H) mutation status (IgV(H) MS) is prognostic in patients with chronic lymphocytic leukemia (CLL) who are treated with alkylating agents or single-agent fludarabine, its significance in the era of chemoimmunotherapy is not known. We determined the IgV(H) somatic mutation status (MS) in 177 patients enrolled in a phase 2 study of fludarabine, cyclophosphamide, and rituximab (FCR) and in 127 patients treated with subsequent chemoimmunotherapy protocols. IgV(H) MS did not impact significantly on the complete remission (CR) rate of patients receiving FCR or related regimens. However, CR duration was significantly shorter in patients with CLL that used unmutated IgV(H) than those whose CLL used mutated IgV(H) (TTP 47% vs 82% at 6 years, P IgV(H) MS emerged as the only determinant of remission duration (hazard ratio 3.8, P IgV(H) status.
Directory of Open Access Journals (Sweden)
Ye Ai
Full Text Available Tagetes erecta is an important commercial plant of Asteraceae family. The male sterile (MS and male fertile (MF two-type lines of T. erecta have been utilized in F1 hybrid production for many years, but no report has been made to identify the genes that specify its male sterility that is caused by homeotic conversion of floral organs. In this study, transcriptome assembly and digital gene expression profiling were performed to generate expression profiles of MS and MF plants. A cDNA library was generated from an equal mixture of RNA isolated from MS and MF flower buds (1 mm and 4 mm in diameter. Totally, 87,473,431 clean tags were obtained and assembled into 128,937 transcripts among which 65,857 unigenes were identified with an average length of 1,188 bp. About 52% of unigenes (34,176 were annotated in Nr, Nt, Pfam, KOG/COG, Swiss-Prot, KO (KEGG Ortholog database and/or GO. Taking the above transcriptome as reference, 125 differentially expressed genes were detected in both developmental stages of MS and MF flower buds. MADS-box genes were presumed to be highly related to male sterility in T. erecta based on histological and cytological observations. Twelve MADS-box genes showed significantly different expression levels in flower buds 4 mm in diameter, whereas only one gene expressed significantly different in flower buds 1 mm in diameter between MS and MF plants. This is the first transcriptome analysis in T. erecta and will provide a valuable resource for future genomic studies, especially in flower organ development and/or differentiation.
Gerzova, Lenka; Babak, Vladimir; Sedlar, Karel; Faldynova, Marcela; Videnska, Petra; Cejkova, Darina; Jensen, Annette Nygaard; Denis, Martine; Kerouanton, Annaelle; Ricci, Antonia; Cibin, Veronica; Österberg, Julia; Rychlik, Ivan
2015-01-01
One of the recent trends in animal production is the revival of interest in organic farming. The increased consumer interest in organic animal farming is mainly due to concerns about animal welfare and the use of antibiotics in conventional farming. On the other hand, providing animals with a more natural lifestyle implies their increased exposure to environmental sources of different microorganisms including pathogens. To address these concerns, we determined the abundance of antibiotic resistance and diversity within fecal microbiota in pigs kept under conventional and organic farming systems in Sweden, Denmark, France and Italy. The abundance of sul1, sul2, strA, tet(A), tet(B) and cat antibiotic resistance genes was determined in 468 samples by real-time PCR and the fecal microbiota diversity was characterized in 48 selected samples by pyrosequencing of V3/V4 regions of 16S rRNA. Contrary to our expectations, there were no extensive differences between the abundance of tested antibiotic resistance genes in microbiota originating from organic or conventionally housed pigs within individual countries. There were also no differences in the microbiota composition of organic and conventional pigs. The only significant difference was the difference in the abundance of antibiotic resistance genes in the samples from different countries. Fecal microbiota in the samples originating from southern European countries (Italy, France) exhibited significantly higher antibiotic resistance gene abundance than those from northern parts of Europe (Denmark, Sweden). Therefore, the geographical location of the herd influenced the antibiotic resistance in the fecal microbiota more than farm's status as organic or conventional.
Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R
1994-05-01
Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.
Peyer, Suzanne M; Pankey, M Sabrina; Oakley, Todd H; McFall-Ngai, Margaret J
2014-02-01
The squid Euprymna scolopes has evolved independent sets of tissues capable of light detection, including a complex eye and a photophore or 'light organ', which houses the luminous bacterial symbiont Vibrio fischeri. As the eye and light organ originate from different embryonic tissues, we examined whether the eye-specification genes, pax6, eya, six, and dac, are shared by these two organs, and if so, whether they are regulated in the light organ by symbiosis. We obtained sequences of the four genes with PCR, confirmed orthology with phylogenetic analysis, and determined that each was expressed in the eye and light organ. With in situ hybridization (ISH), we localized the gene transcripts in developing embryos, comparing the patterns of expression in the two organs. The four transcripts localized to similar tissues, including those associated with the visual system ∼1/4 into embryogenesis (Naef stage 18) and the light organ ∼3/4 into embryogenesis (Naef stage 26). We used ISH and quantitative real-time PCR to examine transcript expression and differential regulation in postembryonic light organs in response to the following colonization conditions: wild-type, luminescent V. fischeri; a mutant strain defective in light production; and as a control, no symbiont. In ISH experiments light organs showed down regulation of the pax6, eya, and six transcripts in response to wild-type V. fischeri. Mutant strains also induced down regulation of the pax6 and eya transcripts, but not of the six transcript. Thus, luminescence was required for down regulation of the six transcript. We discuss these results in the context of symbiont-induced light-organ development. Our study indicates that the eye-specification genes are expressed in light-interacting tissues independent of their embryonic origin and are capable of responding to bacterial cues. These results offer evidence for evolutionary tinkering or the recruitment of eye development genes for use in a light
The Manchester procedure versus vaginal hysterectomy in the treatment of uterine prolapse
DEFF Research Database (Denmark)
Tolstrup, Cæcilie Krogsgaard; Lose, Gunnar; Klarskov, Niels
2017-01-01
INTRODUCTION AND HYPOTHESIS: Uterine prolapse is a common health problem and the number of surgical procedures is increasing. No consensus regarding the surgical strategy for repair of uterine prolapse exists. Vaginal hysterectomy (VH) is the preferred surgical procedure worldwide, but uterus......-intervention rate, complications and operative outcomes. METHODS: We systematically searched Embase, PubMed, the Cochrane databases, Clinicaltrials and Clinical trials register using the MeSh terms "uterine prolapse", "uterus prolapse", "vaginal prolapse" "pelvic organ prolapse", "prolapsed uterus", "Manchester...... procedure" and "vaginal hysterectomy". No limitations regarding language, study design or methodology were applied. In total, nine studies published from 1966 to 2014 comparing the MP to VH were included. RESULTS: The anatomical recurrence rate for the middle compartment was 4-7 % after VH, whereas...
Lejon, David P H; Nowak, Virginie; Bouko, Sabrina; Pascault, Noémie; Mougel, Christophe; Martins, Jean M F; Ranjard, Lionel
2007-09-01
A molecular fingerprinting assay was developed to assess the diversity of copA genes, one of the genetic determinants involved in bacterial resistance to copper. Consensus primers of the copA genes were deduced from an alignment of sequences from proteobacterial strains. A PCR detection procedure was optimized for bacterial strains and allowed the description of a novel copA genetic determinant in Pseudomonas fluorescens. The copA DNA fingerprinting procedure was optimized for DNA directly extracted from soils differing in their physico-chemical characteristics and in their organic status (SOS). Particular copA genetic structures were obtained for each studied soil and a coinertia analysis with soil physico-chemical characteristics revealed the strong influence of pH, soil texture and the quality of soil organic matter. The molecular phylogeny of copA gene confirmed that specific copA genes clusters are specific for each SOS. Furthermore, this study demonstrates that this approach was sensitive to short-term responses of copA gene diversity to copper additions to soil samples, suggesting that community adaptation is preferentially controlled by the diversity of the innate copA genes rather than by the bioavailability of the metal.
Feldmesser, Ester; Rosenwasser, Shilo; Vardi, Assaf; Ben-Dor, Shifra
2014-01-01
Background The advent of Next Generation Sequencing technologies and corresponding bioinformatics tools allows the definition of transcriptomes in non-model organisms. Non-model organisms are of great ecological and biotechnological significance, and consequently the understanding of their unique metabolic pathways is essential. Several methods that integrate de novo assembly with genome-based assembly have been proposed. Yet, there are many open challenges in defining genes, particularly whe...
Singh, Kshetrimayum Manisana; Saha, Saurav; Gupta, Braj Bansh Prasad
2017-08-01
Arylalkylamine N-acetyltransferase (AANAT) activity, aanat gene expression and melatonin production have been reported to exhibit prominent circadian rhythm in the pineal organ of most species of fish. Three types of aanat genes are expressed in fish, but the fish pineal organ predominantly expresses aanat2 gene. Increase and decrease in daylength is invariably associated with increase and decrease in temperature, respectively. But so far no attempt has been made to delineate the role of photoperiod and temperature in regulation of the circadian rhythm of aanat2 gene expression in the pineal organ of any fish with special reference to seasons. Therefore, we studied effects of various lighting regimes (12L-12D, 16L-8D, 8L-16D, LL and DD) at a constant temperature (25°C) and effects of different temperatures (15°, 25° and 35°C) under a common photoperiod 12L-12D on circadian rhythm of aanat2 gene expression in the pineal organ of Clarias gariepinus during summer and winter seasons. Aanat2 gene expression in fish pineal organ was studied by measuring aanat2 mRNA levels using Real-Time PCR. Our findings indicate that the pineal organ of C. gariepinus exhibits a prominent circadian rhythm of aanat2 gene expression irrespective of photoperiods, temperatures and seasons, and the circadian rhythm of aanat2 gene expression responds differently to different photoperiods and temperatures in a season-dependent manner. Existence of circadian rhythm of aanat2 gene expression in pineal organs maintained in vitro under 12L-12D and DD conditions as well as a free running rhythm of the gene expression in pineal organ of the fish maintained under LL and DD conditions suggest that the fish pineal organ possesses an endogenous circadian oscillator, which is entrained by light-dark cycle. Copyright © 2017 Elsevier B.V. All rights reserved.
Structure and Chromosomal Organization of Yeast Genes Regulated by Topoisomerase II.
Joshi, Ricky S; Nikolaou, Christoforos; Roca, Joaquim
2018-01-03
Cellular DNA topoisomerases (topo I and topo II) are highly conserved enzymes that regulate the topology of DNA during normal genome transactions, such as DNA transcription and replication. In budding yeast, topo I is dispensable whereas topo II is essential, suggesting fundamental and exclusive roles for topo II, which might include the functions of the topo IIa and topo IIb isoforms found in mammalian cells. In this review, we discuss major findings of the structure and chromosomal organization of genes regulated by topo II in budding yeast. Experimental data was derived from short (10 min) and long term (120 min) responses to topo II inactivation in top-2 ts mutants. First, we discuss how short term responses reveal a subset of yeast genes that are regulated by topo II depending on their promoter architecture. These short term responses also uncovered topo II regulation of transcription across multi-gene clusters, plausibly by common DNA topology management. Finally, we examine the effects of deactivated topo II on the elongation of RNA transcripts. Each study provides an insight into the particular chromatin structure that interacts with the activity of topo II. These findings are of notable clinical interest as numerous anti-cancer therapies interfere with topo II activity.
Directory of Open Access Journals (Sweden)
Anibal Pacheco
2017-08-01
Full Text Available Previous studies in rats have demonstrated that chronic restraint stress triggers anhedonia, depressive-like behaviors, anxiety and a reduction in dendritic spine density in hippocampal neurons. In this study, we compared the effect of repeated stress on the expression of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA and N-methyl-D-aspartate (NMDA receptor subunits in dorsal and ventral hippocampus (VH. Adult male Sprague-Dawley rats were randomly divided into control and stressed groups, and were daily restrained in their motion (2.5 h/day during 14 days. We found that chronic stress promotes an increase in c-Fos mRNA levels in both hippocampal areas, although it was observed a reduction in the immunoreactivity at pyramidal cell layer. Furthermore, Arc mRNAs levels were increased in both dorsal and VH, accompanied by an increase in Arc immunoreactivity in dendritic hippocampal layers. Furthermore, stress triggered a reduction in PSD-95 and NR1 protein levels in whole extract of dorsal and VH. Moreover, a reduction in NR2A/NR2B ratio was observed only in dorsal pole. In synaptosomal fractions, we detected a rise in NR1 in dorsal hippocampus (DH. By indirect immunofluorescence we found that NR1 subunits rise, especially in neuropil areas of dorsal, but not VH. In relation to AMPA receptor (AMPAR subunits, chronic stress did not trigger any change, either in dorsal or ventral hippocampal areas. These data suggest that DH is more sensitive than VH to chronic stress exposure, mainly altering the expression of NMDA receptor (NMDAR subunits, and probably favors changes in the configuration of this receptor that may influence the function of this area.
Li, Fubin; Yan, Yi; Pieretti, Joyce; Feldman, Danielle A; Eckhardt, Laurel A
2010-11-15
Somatic hypermutation (SHM), coupled with Ag selection, provides a mechanism for generating Abs with high affinity for invading pathogens. Class-switch recombination (CSR) ensures that these Abs attain pathogen-appropriate effector functions. Although the enzyme critical to both processes, activation-induced cytidine deaminase, has been identified, it remains unclear which cis-elements within the Ig loci are responsible for recruiting activation-induced cytidine deaminase and promoting its activity. Studies showed that Ig gene-transcription levels are positively correlated with the frequency of SHM and CSR, making the intronic, transcriptional enhancer Eμ a likely contributor to both processes. Tests of this hypothesis yielded mixed results arising, in part, from the difficulty in studying B cell function in mice devoid of Eμ. In Eμ's absence, V(H) gene assembly is dramatically impaired, arresting B cell development. The current study circumvented this problem by modifying the murine Igh locus through simultaneous insertion of a fully assembled V(H) gene and deletion of Eμ. The behavior of this allele was compared with that of a matched allele carrying the same V(H) gene but with Eμ intact. Although IgH transcription was as great or greater on the Eμ-deficient allele, CSR and SHM were consistently, but modestly, reduced relative to the allele in which Eμ remained intact. We conclude that Eμ contributes to, but is not essential for, these complex processes and that its contribution is not as a transcriptional enhancer but, rather, is at the level of recruitment and/or activation of the SHM/CSR machinery.
Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N
1995-02-15
The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.
Nanthini, Jayaram; Ong, Su Yean; Sudesh, Kumar
2017-09-10
Rubber materials have greatly contributed to human civilization. However, being a polymeric material does not decompose easily, it has caused huge environmental problems. On the other hand, only few bacteria are known to degrade rubber, with studies pertaining them being intensively focusing on the mechanism involved in microbial rubber degradation. The Streptomyces sp. strain CFMR 7, which was previously confirmed to possess rubber-degrading ability, was subjected to whole genome sequencing using the single molecule sequencing technology of the PacBio® RS II system. The genome was further analyzed and compared with previously reported rubber-degrading bacteria in order to identify the potential genes involved in rubber degradation. This led to the interesting discovery of three homologues of latex-clearing protein (Lcp) on the chromosome of this strain, which are probably responsible for rubber degrading activities. Genes encoding oxidoreductase α-subunit (oxiA) and oxidoreductase β-subunit (oxiB) were also found downstream of two lcp genes which are located adjacent to each other. In silico analysis reveals genes that have been identified to be involved in the microbial degradation of rubber in the Streptomyces sp. strain CFMR 7. This is the first whole genome sequence of a clear-zone-forming natural rubber- degrading Streptomyces sp., which harbours three Lcp homologous genes with the presence of oxiA and oxiB genes compared to the previously reported Gordonia polyisoprenivorans strain VH2 (with two Lcp homologous genes) and Nocardia nova SH22a (with only one Lcp gene). Copyright © 2017 Elsevier B.V. All rights reserved.
Meyfour, Anna; Pooyan, Paria; Pahlavan, Sara; Rezaei-Tavirani, Mostafa; Gourabi, Hamid; Baharvand, Hossein; Salekdeh, Ghasem Hosseini
2017-12-01
One of the main goals of Chromosome-Centric Human Proteome Project is to identify protein evidence for missing proteins (MPs). Here, we present a case study of the role of Y chromosome genes in organ development and how to overcome the challenges facing MPs identification by employing human pluripotent stem cell differentiation into cells of different organs yielding unprecedented biological insight into adult silenced proteins. Y chromosome is a male-specific sex chromosome which escapes meiotic recombination. From an evolutionary perspective, Y chromosome has preserved 3% of ancestral genes compared to 98% preservation of the X chromosome based on Ohno's law. Male specific region of Y chromosome (MSY) contains genes that contribute to central dogma and govern the expression of various targets throughout the genome. One of the most well-known functions of MSY genes is to decide the male-specific characteristics including sex, testis formation, and spermatogenesis, which are majorly formed by ampliconic gene families. Beyond its role in sex-specific gonad development, MSY genes in coexpression with their X counterparts, as single copy and broadly expressed genes, inhibit haplolethality and play a key role in embryogenesis. The role of X-Y related gene mutations in the development of hereditary syndromes suggests an essential contribution of sex chromosome genes to development. MSY genes, solely and independent of their X counterparts and/or in association with sex hormones, have a considerable impact on organ development. In this Review, we present major recent findings on the contribution of MSY genes to gonad formation, spermatogenesis, and the brain, heart, and kidney development and discuss how Y chromosome proteome project may exploit developmental biology to find missing proteins.
Li R.; Visser, H.M.
2010-01-01
Chemotherapy and hormonal therapy as adjuvant systemic therapies to inhibit breast cancer recurrence are not necessary for each patient. In Veer's paper "Gene expression profiling predicts clinical outcome of breast cancer" (Nature 2002, PMID: 11823860), they introduced a method based on DNA
Directory of Open Access Journals (Sweden)
Agata Jedrzejuk
2012-01-01
Full Text Available In situ PCR is a technique that allows specific nucleic acid sequences to be detected in individual cells and tissues. In situ PCR and IS-RT-PCR are elegant techniques that can increase both sensitivity and throughput, but they are, at best, only semiquantitative; therefore, it is desirable first to ascertain the expression pattern by conventional means to establish the suitable conditions for each probe. In plants, in situ RT-PCR is widely used in the expression localisation of specific genes, including MADS-box and other function-specific genes or housekeeping genes in floral buds and other organs. This method is especially useful in small organs or during early developmental stages when the separation of particular parts is impossible. In this paper, we compared three different labelling and immunodetection methods by using in situ RT-PCR in Rosa hybrida flower buds and leaves. As target genes, we used the abundant β-actin and RhFUL gene, which is expressed only in the leaves and petals/sepals of flower buds. We used digoxygenin-11-dUTP, biotin-11-dUTP, and fluorescein-12-dUTP-labelled nucleotides and antidig-AP/ streptavidin-fluorescein-labelled antibodies. All of the used methods gave strong, specific signal and all of them may be used in localization of gene expression on tissue level in rose organs.
Energy Technology Data Exchange (ETDEWEB)
Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))
1991-10-01
Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.
Harb, Moustapha
2016-07-09
Organic micro-pollutants (OMPs) are contaminants of emerging concern in wastewater treatment due to the risk of their proliferation into the environment, but their impact on the biological treatment process is not well understood. The purpose of this study is to examine the effects of the presence of OMPs on the core microbial populations of wastewater treatment. Two nanofiltration-coupled membrane bioreactors (aerobic and anaerobic) were subjected to the same operating conditions while treating synthetic municipal wastewater spiked with OMPs. Microbial community dynamics, gene expression levels, and antibiotic resistance genes were analyzed using molecular-based approaches. Results showed that presence of OMPs in the wastewater feed had a clear effect on keystone bacterial populations in both the aerobic and anaerobic sludge while also significantly impacting biodegradation-associated gene expression levels. Finally, multiple antibiotic-type OMPs were found to have higher removal rates in the anaerobic MBR, while associated antibiotic resistance genes were lower.
Harb, Moustapha; Wei, Chunhai; Wang, Nan; Amy, Gary L.; Hong, Pei-Ying
2016-01-01
Organic micro-pollutants (OMPs) are contaminants of emerging concern in wastewater treatment due to the risk of their proliferation into the environment, but their impact on the biological treatment process is not well understood. The purpose of this study is to examine the effects of the presence of OMPs on the core microbial populations of wastewater treatment. Two nanofiltration-coupled membrane bioreactors (aerobic and anaerobic) were subjected to the same operating conditions while treating synthetic municipal wastewater spiked with OMPs. Microbial community dynamics, gene expression levels, and antibiotic resistance genes were analyzed using molecular-based approaches. Results showed that presence of OMPs in the wastewater feed had a clear effect on keystone bacterial populations in both the aerobic and anaerobic sludge while also significantly impacting biodegradation-associated gene expression levels. Finally, multiple antibiotic-type OMPs were found to have higher removal rates in the anaerobic MBR, while associated antibiotic resistance genes were lower.
Directory of Open Access Journals (Sweden)
Corinne eSidler
2013-10-01
Full Text Available Deterioration of the immune system (immunosenescence with age is associated with an increased susceptibility to infection, autoimmune disease and cancer, and reduced responsiveness to vaccination. Immunosenescence entails a reduced supply of naïve T cells from the thymus and increased specialization of peripheral T cell clones. Both thymic involution and peripheral T cell homeostasis are thought to involve cellular senescence. In order to analyze this at the molecular level, we studied gene expression profiles, epigenetic status and genome stability in the thymus and spleen of 1-month, 4-month and 18-month-old Long Evans rats. In the thymus, altered gene expression, DNA and histone hypomethylation, increased genome instability and apoptosis were observed in 18-month-old animals compared to 1- and 4-month-old animals. In the spleen, alterations in gene expression and epigenetic regulation occurred already by the age of 4 months compared to 1 month and persisted in 18-month-old compared to 1-month-old rats. In both organs, these changes were accompanied by the altered composition of resident T cell populations. Our study suggests that both senescence and apoptosis may be involved in altered organ function.
Directory of Open Access Journals (Sweden)
Gayane Grigoryan
2016-01-01
Full Text Available Early life adversaries have a profound impact on the developing brain structure and functions that persist long after the original traumatic experience has vanished. One of the extensively studied brain structures in relation to early life stress has been the hippocampus because of its unique association with cognitive processes of the brain. While the entire hippocampus shares the same intrinsic organization, it assumes different functions in its dorsal and ventral sectors (DH and VH, resp., based on different connectivity with other brain structures. In the present review, we summarize the differences between DH and VH and discuss functional and structural effects of prenatal stress in the two sectors, with the realization that much is yet to be explored in understanding the opposite reactivity of the DH and VH to stressful stimulation.
Costa, Michael A.; Collins, R. Eric; Anterola, Aldwin M.; Cochrane, Fiona C.; Davin, Laurence B.; Lewis, Norman G.
2003-01-01
The Arabidopsis genome sequencing in 2000 gave to science the first blueprint of a vascular plant. Its successful completion also prompted the US National Science Foundation to launch the Arabidopsis 2010 initiative, the goal of which is to identify the function of each gene by 2010. In this study, an exhaustive analysis of The Institute for Genomic Research (TIGR) and The Arabidopsis Information Resource (TAIR) databases, together with all currently compiled EST sequence data, was carried out in order to determine to what extent the various metabolic networks from phenylalanine ammonia lyase (PAL) to the monolignols were organized and/or could be predicted. In these databases, there are some 65 genes which have been annotated as encoding putative enzymatic steps in monolignol biosynthesis, although many of them have only very low homology to monolignol pathway genes of known function in other plant systems. Our detailed analysis revealed that presently only 13 genes (two PALs, a cinnamate-4-hydroxylase, a p-coumarate-3-hydroxylase, a ferulate-5-hydroxylase, three 4-coumarate-CoA ligases, a cinnamic acid O-methyl transferase, two cinnamoyl-CoA reductases) and two cinnamyl alcohol dehydrogenases can be classified as having a bona fide (definitive) function; the remaining 52 genes currently have undetermined physiological roles. The EST database entries for this particular set of genes also provided little new insight into how the monolignol pathway was organized in the different tissues and organs, this being perhaps a consequence of both limitations in how tissue samples were collected and in the incomplete nature of the EST collections. This analysis thus underscores the fact that even with genomic sequencing, presumed to provide the entire suite of putative genes in the monolignol-forming pathway, a very large effort needs to be conducted to establish actual catalytic roles (including enzyme versatility), as well as the physiological function(s) for each member
Directory of Open Access Journals (Sweden)
Yupei Jin
Full Text Available The dioecious relic Cercidiphyllum japonicum is one of two species of the sole genus Cercidiphyllum, with a tight inflorescence lacking an apparent perianth structure. In addition, its systematic place has been much debated and, so far researches have mainly focused on its morphology and chloroplast genes. In our investigation, we identified 10 floral organ identity genes, including four A-class, three B-class, two C-class and one D-class. Phylogenetic analyses showed that all ten genes are grouped with Saxifragales plants, which confirmed the phylogenetic place of C. japonicum. Expression patterns of those genes were examined by quantitative reverse transcriptase PCR, with some variations that did not completely coincide with the ABCDE model, suggesting some subfunctionalization. As well, our research supported the idea that thebract actually is perianth according to our morphological and molecular analyses in Cercidiphyllum japonicum.
Jin, Yupei; Wang, Yubing; Zhang, Dechun; Shen, Xiangling; Liu, Wen; Chen, Faju
2017-01-01
The dioecious relic Cercidiphyllum japonicum is one of two species of the sole genus Cercidiphyllum, with a tight inflorescence lacking an apparent perianth structure. In addition, its systematic place has been much debated and, so far researches have mainly focused on its morphology and chloroplast genes. In our investigation, we identified 10 floral organ identity genes, including four A-class, three B-class, two C-class and one D-class. Phylogenetic analyses showed that all ten genes are grouped with Saxifragales plants, which confirmed the phylogenetic place of C. japonicum. Expression patterns of those genes were examined by quantitative reverse transcriptase PCR, with some variations that did not completely coincide with the ABCDE model, suggesting some subfunctionalization. As well, our research supported the idea that thebract actually is perianth according to our morphological and molecular analyses in Cercidiphyllum japonicum.
Himeno, Misako; Neriya, Yutaro; Minato, Nami; Miura, Chihiro; Sugawara, Kyoko; Ishii, Yoshiko; Yamaji, Yasuyuki; Kakizawa, Shigeyuki; Oshima, Kenro; Namba, Shigetou
2011-09-01
Abnormal flowers are often induced by infection of certain plant pathogens, e.g. phytoplasma, but the molecular mechanisms underlying these malformations have remained poorly understood. Here, we show that infection with OY-W phytoplasma (Candidatus Phytoplasma asteris, onion yellows phytoplasma strain, line OY-W) affects the expression of the floral homeotic genes of petunia plants in an organ-specific manner. Upon infection with OY-W phytoplasma, floral morphological changes, including conversion to leaf-like structures, were observed in sepals, petals and pistils, but not in stamens. As the expression levels of homeotic genes differ greatly between floral organs, we examined the expression levels of homeotic genes in each floral organ infected by OY-W phytoplasma, compared with healthy plants. The expression levels of several homeotic genes required for organ development, such as PFG, PhGLO1 and FBP7, were significantly downregulated by the phytoplasma infection in floral organs, except the stamens, suggesting that the unique morphological changes caused by the phytoplasma infection might result from the significant decrease in expression of some crucial homeotic genes. Moreover, the expression levels of TER, ALF and DOT genes, which are known to participate in floral meristem identity, were significantly downregulated in the phytoplasma-infected petunia meristems, implying that phytoplasma would affect an upstream signaling pathway of floral meristem identity. Our results suggest that phytoplasma infection may have complex effects on floral development, resulting in the unique phenotypes that were clearly distinct from the mutant flower phenotypes produced by the knock-out or the overexpression of certain homeotic genes. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Schnitzler Christine E
2012-12-01
Full Text Available Abstract Background Calcium-activated photoproteins are luciferase variants found in photocyte cells of bioluminescent jellyfish (Phylum Cnidaria and comb jellies (Phylum Ctenophora. The complete genomic sequence from the ctenophore Mnemiopsis leidyi, a representative of the earliest branch of animals that emit light, provided an opportunity to examine the genome of an organism that uses this class of luciferase for bioluminescence and to look for genes involved in light reception. To determine when photoprotein genes first arose, we examined the genomic sequence from other early-branching taxa. We combined our genomic survey with gene trees, developmental expression patterns, and functional protein assays of photoproteins and opsins to provide a comprehensive view of light production and light reception in Mnemiopsis. Results The Mnemiopsis genome has 10 full-length photoprotein genes situated within two genomic clusters with high sequence conservation that are maintained due to strong purifying selection and concerted evolution. Photoprotein-like genes were also identified in the genomes of the non-luminescent sponge Amphimedon queenslandica and the non-luminescent cnidarian Nematostella vectensis, and phylogenomic analysis demonstrated that photoprotein genes arose at the base of all animals. Photoprotein gene expression in Mnemiopsis embryos begins during gastrulation in migrating precursors to photocytes and persists throughout development in the canals where photocytes reside. We identified three putative opsin genes in the Mnemiopsis genome and show that they do not group with well-known bilaterian opsin subfamilies. Interestingly, photoprotein transcripts are co-expressed with two of the putative opsins in developing photocytes. Opsin expression is also seen in the apical sensory organ. We present evidence that one opsin functions as a photopigment in vitro, absorbing light at wavelengths that overlap with peak photoprotein light
Mundell, Nathan A; Beier, Kevin T; Pan, Y Albert; Lapan, Sylvain W; Göz Aytürk, Didem; Berezovskii, Vladimir K; Wark, Abigail R; Drokhlyansky, Eugene; Bielecki, Jan; Born, Richard T; Schier, Alexander F; Cepko, Constance L
2015-08-01
Current limitations in technology have prevented an extensive analysis of the connections among neurons, particularly within nonmammalian organisms. We developed a transsynaptic viral tracer originally for use in mice, and then tested its utility in a broader range of organisms. By engineering the vesicular stomatitis virus (VSV) to encode a fluorophore and either the rabies virus glycoprotein (RABV-G) or its own glycoprotein (VSV-G), we created viruses that can transsynaptically label neuronal circuits in either the retrograde or anterograde direction, respectively. The vectors were investigated for their utility as polysynaptic tracers of chicken and zebrafish visual pathways. They showed patterns of connectivity consistent with previously characterized visual system connections, and revealed several potentially novel connections. Further, these vectors were shown to infect neurons in several other vertebrates, including Old and New World monkeys, seahorses, axolotls, and Xenopus. They were also shown to infect two invertebrates, Drosophila melanogaster, and the box jellyfish, Tripedalia cystophora, a species previously intractable for gene transfer, although no clear evidence of transsynaptic spread was observed in these species. These vectors provide a starting point for transsynaptic tracing in most vertebrates, and are also excellent candidates for gene transfer in organisms that have been refractory to other methods. © 2015 Wiley Periodicals, Inc.
Frost, Julianty; Galdeano, Carles; Soares, Pedro; Gadd, Morgan S.; Grzes, Katarzyna M.; Ellis, Lucy; Epemolu, Ola; Shimamura, Satoko; Bantscheff, Marcus; Grandi, Paola; Read, Kevin D.; Cantrell, Doreen A.; Rocha, Sonia; Ciulli, Alessio
2016-11-01
Chemical strategies to using small molecules to stimulate hypoxia inducible factors (HIFs) activity and trigger a hypoxic response under normoxic conditions, such as iron chelators and inhibitors of prolyl hydroxylase domain (PHD) enzymes, have broad-spectrum activities and off-target effects. Here we disclose VH298, a potent VHL inhibitor that stabilizes HIF-α and elicits a hypoxic response via a different mechanism, that is the blockade of the VHL:HIF-α protein-protein interaction downstream of HIF-α hydroxylation by PHD enzymes. We show that VH298 engages with high affinity and specificity with VHL as its only major cellular target, leading to selective on-target accumulation of hydroxylated HIF-α in a concentration- and time-dependent fashion in different cell lines, with subsequent upregulation of HIF-target genes at both mRNA and protein levels. VH298 represents a high-quality chemical probe of the HIF signalling cascade and an attractive starting point to the development of potential new therapeutics targeting hypoxia signalling.
Optimization and in Vivo Validation of Peptide Vectors Targeting the LDL Receptor.
Jacquot, Guillaume; Lécorché, Pascaline; Malcor, Jean-Daniel; Laurencin, Mathieu; Smirnova, Maria; Varini, Karine; Malicet, Cédric; Gassiot, Fanny; Abouzid, Karima; Faucon, Aude; David, Marion; Gaudin, Nicolas; Masse, Maxime; Ferracci, Géraldine; Dive, Vincent; Cisternino, Salvatore; Khrestchatisky, Michel
2016-12-05
Active targeting and delivery to pathophysiological organs of interest is of paramount importance to increase specific accumulation of therapeutic drugs or imaging agents while avoiding systemic side effects. We recently developed a family of new peptide ligands of the human and rodent LDL receptor (LDLR), an attractive cell-surface receptor with high uptake activity and local enrichment in several normal or pathological tissues (Malcor et al., J. Med. Chem. 2012, 55 (5), 2227). Initial chemical optimization of the 15-mer, all natural amino acid compound 1/VH411 (DSGL[CMPRLRGC] c DPR) and structure-activity relationship (SAR) investigation led to the cyclic 8 amino acid analogue compound 22/VH445 ([cMPRLRGC] c ) which specifically binds hLDLR with a K D of 76 nM and has an in vitro blood half-life of ∼3 h. Further introduction of non-natural amino acids led to the identification of compound 60/VH4106 ([(d)-"Pen"M"Thz"RLRGC] c ), which showed the highest K D value of 9 nM. However, this latter analogue displayed the lowest in vitro blood half-life (∼1.9 h). In the present study, we designed a new set of peptide analogues, namely, VH4127 to VH4131, with further improved biological properties. Detailed analysis of the hLDLR-binding kinetics of previous and new analogues showed that the latter all displayed very high on-rates, in the 10 6 s -1. M -1 range, and off-rates varying from the low 10 -2 s -1 to the 10 -1 s -1 range. Furthermore, all these new analogues showed increased blood half-lives in vitro, reaching ∼7 and 10 h for VH4129 and VH4131, respectively. Interestingly, we demonstrate in cell-based assays using both VH445 and the most balanced optimized analogue VH4127 ([cM"Thz"RLRG"Pen"] c ), showing a K D of 18 nM and a blood half-life of ∼4.3 h, that its higher on-rate correlated with a significant increase in both the extent of cell-surface binding to hLDLR and the endocytosis potential. Finally, intravenous injection of tritium-radiolabeled 3 H-VH
SEP-class genes in Prunus mume and their likely role in floral organ development.
Zhou, Yuzhen; Xu, Zongda; Yong, Xue; Ahmad, Sagheer; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang
2017-01-13
Flower phylogenetics and genetically controlled development have been revolutionised during the last two decades. However, some of these evolutionary aspects are still debatable. MADS-box genes are known to play essential role in specifying the floral organogenesis and differentiation in numerous model plants like Petunia hybrida, Arabidopsis thaliana and Antirrhinum majus. SEPALLATA (SEP) genes, belonging to the MADS-box gene family, are members of the ABCDE and quartet models of floral organ development and play a vital role in flower development. However, few studies of the genes in Prunus mume have yet been conducted. In this study, we cloned four PmSEPs and investigated their phylogenetic relationship with other species. Expression pattern analyses and yeast two-hybrid assays of these four genes indicated their involvement in the floral organogenesis with PmSEP4 specifically related to specification of the prolificated flowers in P. mume. It was observed that the flower meristem was specified by PmSEP1 and PmSEP4, the sepal by PmSEP1 and PmSEP4, petals by PmSEP2 and PmSEP3, stamens by PmSEP2 and PmSEP3 and pistils by PmSEP2 and PmSEP3. With the above in mind, flower development in P. mume might be due to an expression of SEP genes. Our findings can provide a foundation for further investigations of the transcriptional factors governing flower development, their molecular mechanisms and genetic basis.
Directory of Open Access Journals (Sweden)
J. Mala
2017-06-01
Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.
VH-92A Presidential Helicopter (VH-92A)
2015-12-01
provide safe, reliable, and timely transportation for the President, Vice President, Foreign Heads of State, and other official parties as directed by...the Director of the White House Military Office. Presidential helicopter transportation requirements are executed by Marine Helicopter Squadron One...Review Jul 2016 Jul 2016 Jan 2017 Jul 2016 Milestone C Jan 2019 Jan 2019 Jul 2019 Jan 2019 IOT &E Complete Mar 2020 Mar 2020 Sep 2020 Mar 2020 IOC Jul
Multiple organ gigantism caused by mutation in VmPPD gene in blackgram (Vigna mungo).
Naito, Ken; Takahashi, Yu; Chaitieng, Bubpa; Hirano, Kumi; Kaga, Akito; Takagi, Kyoko; Ogiso-Tanaka, Eri; Thavarasook, Charaspon; Ishimoto, Masao; Tomooka, Norihiko
2017-03-01
Seed size is one of the most important traits in leguminous crops. We obtained a recessive mutant of blackgram that had greatly enlarged leaves, stems and seeds. The mutant produced 100% bigger leaves, 50% more biomass and 70% larger seeds though it produced 40% less number of seeds. We designated the mutant as multiple-organ-gigantism ( mog ) and found the mog phenotype was due to increase in cell numbers but not in cell size. We also found the mog mutant showed a rippled leaf ( rl ) phenotype, which was probably caused by a pleiotropic effect of the mutation. We performed a map-based cloning and successfully identified an 8 bp deletion in the coding sequence of VmPPD gene, an orthologue of Arabidopsis PEAPOD ( PPD ) that regulates arrest of cell divisions in meristematic cells . We found no other mutations in the neighboring genes between the mutant and the wild type. We also knocked down GmPPD genes and reproduced both the mog and rl phenotypes in soybean. Controlling PPD genes to produce the mog phenotype is highly valuable for breeding since larger seed size could directly increase the commercial values of grain legumes.
Directory of Open Access Journals (Sweden)
Zhang Binbin
2017-01-01
Full Text Available To elucidate the effects of exogenous salicylic acid (SA treatment on the cold resistance of peach flower, the floral organs of two peach cultivars were treated with 20 mg/L SA and stored at 0°C for observation and sample collection. Water application was the control. After a treatment period, the anther relative water content of the control and SA-treated flowers decreased. The extent of the reduction was greater in the control, suggesting that the SA treatment significantly helped to maintain the anther water content of peach. Analysis of the stigma relative electric conductivity revealed that the SA treatment prevented membrane injury during the low temperature treatment. Additionally, we measured CBF gene expression at low temperature in the petal, stigma and ovary. The expression was markedly upregulated in the cold-treated floral organs. CBF gene expression after SA treatment was higher than in the control when cold conditions continued. These results suggest that the effects of SA on ameliorating the freezing injury to peach floral organs and on enhancing cold tolerance may be associated with the induction of CBF gene.
GoGene: gene annotation in the fast lane.
Plake, Conrad; Royer, Loic; Winnenburg, Rainer; Hakenberg, Jörg; Schroeder, Michael
2009-07-01
High-throughput screens such as microarrays and RNAi screens produce huge amounts of data. They typically result in hundreds of genes, which are often further explored and clustered via enriched GeneOntology terms. The strength of such analyses is that they build on high-quality manual annotations provided with the GeneOntology. However, the weakness is that annotations are restricted to process, function and location and that they do not cover all known genes in model organisms. GoGene addresses this weakness by complementing high-quality manual annotation with high-throughput text mining extracting co-occurrences of genes and ontology terms from literature. GoGene contains over 4,000,000 associations between genes and gene-related terms for 10 model organisms extracted from more than 18,000,000 PubMed entries. It does not cover only process, function and location of genes, but also biomedical categories such as diseases, compounds, techniques and mutations. By bringing it all together, GoGene provides the most recent and most complete facts about genes and can rank them according to novelty and importance. GoGene accepts keywords, gene lists, gene sequences and protein sequences as input and supports search for genes in PubMed, EntrezGene and via BLAST. Since all associations of genes to terms are supported by evidence in the literature, the results are transparent and can be verified by the user. GoGene is available at http://gopubmed.org/gogene.
Directory of Open Access Journals (Sweden)
Libia Sanz
2016-07-01
Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.
Gene expression disruptions of organism versus organ in Drosophila species hybrids.
Directory of Open Access Journals (Sweden)
Daniel J Catron
2008-08-01
Full Text Available Hybrid dysfunctions, such as sterility, may result in part from disruptions in the regulation of gene expression. Studies of hybrids within the Drosophila simulans clade have reported genes expressed above or below the expression observed in their parent species, and such misexpression is associated with male sterility in multigenerational backcross hybrids. However, these studies often examined whole bodies rather than testes or had limited replication using less-sensitive but global techniques. Here, we use a new RNA isolation technique to re-examine hybrid gene expression disruptions in both testes and whole bodies from single Drosophila males by real-time quantitative RT-PCR. We find two early-spermatogenesis transcripts are underexpressed in hybrid whole-bodies but not in assays of testes alone, while two late-spermatogenesis transcripts seem to be underexpressed in both whole-bodies and testes alone. Although the number of transcripts surveyed is limited, these results provide some support for a previous hypothesis that the spermatogenesis pathway in these sterile hybrids may be disrupted sometime after the expression of the early meiotic arrest genes.
Directory of Open Access Journals (Sweden)
Tianquan Yang
Full Text Available The LATERAL ORGAN BOUNDARIES DOMAIN (LBD gene family has been well-studied in Arabidopsis and play crucial roles in the diverse growth and development processes including establishment and maintenance of boundary of developmental lateral organs. In this study we identified and characterized 38 LBD genes in Lotus japonicus (LjLBD and 57 LBD genes in Medicago truncatula (MtLBD, both of which are model legume plants that have some specific development features absent in Arabidopsis. The phylogenetic relationships, their locations in the genome, genes structure and conserved motifs were examined. The results revealed that all LjLBD and MtLBD genes could be distinctly divided into two classes: Class I and II. The evolutionary analysis showed that Type I functional divergence with some significantly site-specific shifts may be the main force for the divergence between Class I and Class II. In addition, the expression patterns of LjLBD genes uncovered the diverse functions in plant development. Interestingly, we found that two LjLBD proteins that were highly expressed during compound leaf and pulvinus development, can interact via yeast two-hybrid assays. Taken together, our findings provide an evolutionary and genetic foundation in further understanding the molecular basis of LBD gene family in general, specifically in L. japonicus and M. truncatula.
Genetic mapping of 14 avirulence genes in an EU-B04 × 1639 progeny of Venturia inaequalis.
Broggini, Giovanni A L; Bus, Vincent G M; Parravicini, Gabriella; Kumar, Satish; Groenwold, Remmelt; Gessler, Cesare
2011-02-01
Durable resistance to apple scab (Venturia inaequalis (Cke) Wint; anamorph Spilocaea pomi Fries) is one of the major goals of apple (Malus) breeding programs. Since current scab resistance breeding is heavily reliant on genes with gene-for-gene relationships, a good understanding of the genetic basis of host-pathogen interactions needs to be developed for this strategy to be successful. While the genomic organization of apple scab resistance genes has been studied extensively, little is known about the avirulence genes in the pathogen. The progeny of a cross of European V. inaequalis race (1) isolate EU-B04 and race (1,2,8,9) isolate 1639 was used to generate a genetic map based on microsatellite and AFLP markers, and investigated for inheritance of avirulence traits on 20 Malus accessions representing 17 scab resistance genes. The accessions comprised scab differential hosts (0), (1), (2), (8), and (9), and hosts carrying known as well as not previously reported secondary resistance genes, including some identified in crosses that have resistant accessions 'Geneva', 'Dolgo', Malus baccata jackii, M. micromalus, or 'Antonovka' in their pedigree. The latter genes appear to be narrow spectrum genes that showed gene-for-gene relationships as a segregation ratio of Avr:avr=1:1 was observed on 12 accessions, while a ratio of 3:1 was observed on five accessions and a ratio of 7:1 on one host. All progenies were shown to be pathogenic, as all of them were able to infect hosts (0) and (1). A genetic map consisting of 15 major linkage groups (LGs) and spanning 972cM was generated with the aid of 156 markers. The map position of 12 avirulence traits was determined: eight avirulence genes mapped into two separate clusters (1: AvrVdg2, AvrVv1, AvrVu1, AvrVrjrd; and 2: AvrVu2, AvrVh3.2, AvrVs1, AvrVu4), while four avirulence genes (AvrRvi8, AvrVv2, AvrVt57 and AvrVsv) mapped to different LGs. AvrRvi2 and AvrRvi9 also are genetically linked, but showed an interaction with Avr
Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping
2013-01-01
Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172
Lee, Kyu-Ho; Ruby, Edward G.
1992-01-01
Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both lu...
Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.
Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K
1989-01-01
The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.
International Nuclear Information System (INIS)
Tannous, J.; El Khoury, R.; El Khoury, A.; Lteif, R.; Snini, S.; Lippi, Y.; Oswald, I.; Olivier, P.; Atoui, A.
2014-01-01
Patulin is a polyketide-derived mycotoxin produced by numerous filamentous fungi. Among them, Penicillium expansum is by far the most problematic species. This fungus is a destructive phytopathogen capable of growing on fruit, provoking the blue mold decay of apples and producing significant amounts of patulin. The biosynthetic pathway of this mycotoxin is chemically well-characterized, but its genetic bases remain largely unknown with only few characterized genes in less economic relevant species. The present study consisted of the identification and positional organization of the patulin gene cluster in P. expansum strain NRRL 35695. Several amplification reactions were performed with degenerative primers that were designed based on sequences from the orthologous genes available in other species. An improved genome Walking approach was used in order to sequence the remaining adjacent genes of the cluster. RACE-PCR was also carried out from mRNAs to determine the start and stop codons of the coding sequences. The patulin gene cluster in P. expansum consists of 15 genes in the following order: patH, patG, patF, patE, patD, patC, patB, patA, patM, patN, patO, patL, patI, patJ, and patK. These genes share 60–70% of identity with orthologous genes grouped differently, within a putative patulin cluster described in a non-producing strain of Aspergillus clavatus. The kinetics of patulin cluster genes expression was studied under patulin-permissive conditions (natural apple-based medium) and patulin-restrictive conditions (Eagle's minimal essential medium), and demonstrated a significant association between gene expression and patulin production. In conclusion, the sequence of the patulin cluster in P. expansum constitutes a key step for a better understanding of themechanisms leading to patulin production in this fungus. It will allow the role of each gene to be elucidated, and help to define strategies to reduce patulin production in apple-based products
Cuong, Do Manh; Arasu, Mariadhas Valan; Jeon, Jin; Park, Yun Ji; Kwon, Soon-Jae; Al-Dhabi, Naif Abdullah; Park, Sang Un
2017-12-01
Carotenoids, found in the fruit and different organs of bitter melon ( Momordica charantia ), have attracted great attention for their potential health benefits in treating several major chronic diseases. Therefore, study related to the identification and quantification of the medically important carotenoid metabolites is highly important for the treatment of various disorderes. The present study involved in the identification and quantification of the various carotenoids present in the different organs of M. charantia and the identification of the genes responsible for the accumulation of the carotenoids with respect to the transcriptome levels were investigated. In this study, using the transcriptome database of bitter melon, a partial-length cDNA clone encoding geranylgeranyl pyrophosphate synthase ( McGGPPS2 ), and several full-length cDNA clones encoding geranylgeranyl pyrophosphate synthase ( McGGPPS1 ), zeta-carotene desaturase ( McZDS ), lycopene beta-cyclase ( McLCYB ), lycopene epsilon cyclases ( McLCYE1 and McLCYE2 ), beta-carotene hydroxylase ( McCHXB ), and zeaxanthin epoxidase ( McZEP ) were identified in bitter melon . The expression levels of the mRNAs encoding these eight putative biosynthetic enzymes, as well as the accumulation of lycopene, α-carotene, lutein, 13Z-β-carotene, E-β-carotene, 9Z-β-carotene, β-cryptoxanthin, zeaxanthin, antheraxanthin, and violaxanthin were investigated in different organs from M. charantia as well as in the four different stages of its fruit maturation. Transcripts were found to be constitutively expressed at high levels in the leaves where carotenoids were also found at the highest levels . Collectively, these results indicate that the putative McGGPPS2, McZDS, McLCYB, McLCYE1, McLCYE2, and McCHXB enzymes might be key factors in controlling carotenoid content in bitter melon . In conclusion, the over expression of the carotenoid biosynthetic genes from M. charantia crops to increase the yield of these
Directory of Open Access Journals (Sweden)
Zhanchao Cheng
2017-05-01
Full Text Available Mini chromosome maintenance 1, agamous, deficiens, and serum response factor (MADS-box genes are transcription factors which play fundamental roles in flower development and regulation of floral organ identity. However, till date, identification and functions of MADS-box genes remain largely unclear in Phyllostachys edulis. In view of this, we performed a whole-genome survey and identified 34 MADS-box genes in P. edulis, and based on phylogeny, they were classified as MIKCC, MIKC∗, Mα, and Mβ. The detailed analysis about gene structure and motifs, phylogenetic classification, comparison of gene divergence and duplication are provided. Interestingly, expression patterns for most genes were found similar to those of Arabidopsis and rice, indicating that the well-established ABCDE model can be applied to P. edulis. Moreover, we overexpressed PheMADS15, an AP1-like gene, in Arabidopsis, and found that the transgenic plants have early flowering phenotype, suggesting that PheMADS15 might be a regulator of flowering transition in P. edulis. Taken together, this study provides not only insightful comprehension but also useful information for understanding the functions of MADS-box genes in P. edulis.
Directory of Open Access Journals (Sweden)
Carlos Saavedra
2017-11-01
Full Text Available Growth rate is one of the most important traits from the point of view of individual fitness and commercial production in mollusks, but its molecular and physiological basis is poorly known. We have studied differential gene expression related to differences in growth rate in adult individuals of the commercial marine clam Ruditapes decussatus. Gene expression in the gills and the digestive gland was analyzed in 5 fast-growing and five slow-growing animals by means of an oligonucleotide microarray containing 14,003 probes. A total of 356 differentially expressed genes (DEG were found. We tested the hypothesis that differential expression might be concentrated at the growth control gene core (GCGC, i.e., the set of genes that underlie the molecular mechanisms of genetic control of tissue and organ growth and body size, as demonstrated in model organisms. The GCGC includes the genes coding for enzymes of the insulin/insulin-like growth factor signaling pathway (IIS, enzymes of four additional signaling pathways (Raf/Ras/Mapk, Jnk, TOR, and Hippo, and transcription factors acting at the end of those pathways. Only two out of 97 GCGC genes present in the microarray showed differential expression, indicating a very little contribution of GCGC genes to growth-related differential gene expression. Forty eight DEGs were shared by both organs, with gene ontology (GO annotations corresponding to transcription regulation, RNA splicing, sugar metabolism, protein catabolism, immunity, defense against pathogens, and fatty acid biosynthesis. GO term enrichment tests indicated that genes related to growth regulation, development and morphogenesis, extracellular matrix proteins, and proteolysis were overrepresented in the gills. In the digestive gland overrepresented GO terms referred to gene expression control through chromatin rearrangement, RAS-related small GTPases, glucolysis, and energy metabolism. These analyses suggest a relevant role of, among others
Molecular organization of the 5S rDNA gene type II in elasmobranchs.
Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian
2016-01-01
The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.
Walch, S. P.; Bauschlicher, C. W., Jr.
1983-04-01
Calculations are performed for the predicted ground states of TiH(4-phi), VH(5-delta), CrH(6-sigma-plus), MnH(7-sigma-plus), Fett(4,6-delta) and NiH(2-delta). For FeH both the 6-delta and 4-delta states are studied, since both are likely candidates for the ground state. The ground state symmetries are predicted based on a combination of atomic coupling arguments and coupling of 4s(2)3d(n) and 4s(1)3d(n+1) terms in the molecular system. Electron correlation is included by a CASSCF/CI (SD) treatment. The CASSCF includes near-degeneracy effects, while correlation of the 3d electrons in included at the CI level.
Yi, Go-Eun; Robin, Arif Hasan Khan; Yang, Kiwoung; Park, Jong-In; Kang, Jong-Goo; Yang, Tae-Jin; Nou, Ill-Sup
2015-07-20
Glucosinolates are anti-carcinogenic, anti-oxidative biochemical compounds that defend plants from insect and microbial attack. Glucosinolates are abundant in all cruciferous crops, including all vegetable and oilseed Brassica species. Here, we studied the expression of glucosinolate biosynthesis genes and determined glucosinolate contents in the edible organs of a total of 12 genotypes of Brassica oleracea: three genotypes each from cabbage, kale, kohlrabi and cauliflower subspecies. Among the 81 genes analyzed by RT-PCR, 19 are transcription factor-related, two different sets of 25 genes are involved in aliphatic and indolic biosynthesis pathways and the rest are breakdown-related. The expression of glucosinolate-related genes in the stems of kohlrabi was remarkably different compared to leaves of cabbage and kale and florets of cauliflower as only eight genes out of 81 were expressed in the stem tissues of kohlrabi. In the stem tissue of kohlrabi, only one aliphatic transcription factor-related gene, Bol036286 (MYB28) and one indolic transcription factor-related gene, Bol030761 (MYB51), were expressed. The results indicated the expression of all genes is not essential for glucosinolate biosynthesis. Using HPLC analysis, a total of 16 different types of glucosinolates were identified in four subspecies, nine of them were aliphatic, four of them were indolic and one was aromatic. Cauliflower florets measured the highest number of 14 glucosinolates. Among the aliphatic glucosinolates, only gluconapin was found in the florets of cauliflower. Glucoiberverin and glucobrassicanapin contents were the highest in the stems of kohlrabi. The indolic methoxyglucobrassicin and aromatic gluconasturtiin accounted for the highest content in the florets of cauliflower. A further detailed investigation and analyses is required to discern the precise roles of each of the genes for aliphatic and indolic glucosinolate biosynthesis in the edible organs.
Directory of Open Access Journals (Sweden)
Go-Eun Yi
2015-07-01
Full Text Available Glucosinolates are anti-carcinogenic, anti-oxidative biochemical compounds that defend plants from insect and microbial attack. Glucosinolates are abundant in all cruciferous crops, including all vegetable and oilseed Brassica species. Here, we studied the expression of glucosinolate biosynthesis genes and determined glucosinolate contents in the edible organs of a total of 12 genotypes of Brassica oleracea: three genotypes each from cabbage, kale, kohlrabi and cauliflower subspecies. Among the 81 genes analyzed by RT-PCR, 19 are transcription factor-related, two different sets of 25 genes are involved in aliphatic and indolic biosynthesis pathways and the rest are breakdown-related. The expression of glucosinolate-related genes in the stems of kohlrabi was remarkably different compared to leaves of cabbage and kale and florets of cauliflower as only eight genes out of 81 were expressed in the stem tissues of kohlrabi. In the stem tissue of kohlrabi, only one aliphatic transcription factor-related gene, Bol036286 (MYB28 and one indolic transcription factor-related gene, Bol030761 (MYB51, were expressed. The results indicated the expression of all genes is not essential for glucosinolate biosynthesis. Using HPLC analysis, a total of 16 different types of glucosinolates were identified in four subspecies, nine of them were aliphatic, four of them were indolic and one was aromatic. Cauliflower florets measured the highest number of 14 glucosinolates. Among the aliphatic glucosinolates, only gluconapin was found in the florets of cauliflower. Glucoiberverin and glucobrassicanapin contents were the highest in the stems of kohlrabi. The indolic methoxyglucobrassicin and aromatic gluconasturtiin accounted for the highest content in the florets of cauliflower. A further detailed investigation and analyses is required to discern the precise roles of each of the genes for aliphatic and indolic glucosinolate biosynthesis in the edible organs.
Khan, Madiha; Ragni, Laura; Tabb, Paul; Salasini, Brenda C; Chatfield, Steven; Datla, Raju; Lock, John; Kuai, Xiahezi; Després, Charles; Proveniers, Marcel; Yongguo, Cao; Xiang, Daoquan; Morin, Halima; Rullière, Jean-Pierre; Citerne, Sylvie; Hepworth, Shelley R; Pautot, Véronique
2015-11-01
In the model plant Arabidopsis (Arabidopsis thaliana), endogenous and environmental signals acting on the shoot apical meristem cause acquisition of inflorescence meristem fate. This results in changed patterns of aerial development seen as the transition from making leaves to the production of flowers separated by elongated internodes. Two related BEL1-like homeobox genes, PENNYWISE (PNY) and POUND-FOOLISH (PNF), fulfill this transition. Loss of function of these genes impairs stem cell maintenance and blocks internode elongation and flowering. We show here that pny pnf apices misexpress lateral organ boundary genes BLADE-ON-PETIOLE1/2 (BOP1/2) and KNOTTED-LIKE FROM ARABIDOPSIS THALIANA6 (KNAT6) together with ARABIDOPSIS THALIANA HOMEOBOX GENE1 (ATH1). Inactivation of genes in this module fully rescues pny pnf defects. We further show that BOP1 directly activates ATH1, whereas activation of KNAT6 is indirect. The pny pnf restoration correlates with renewed accumulation of transcripts conferring floral meristem identity, including FD, SQUAMOSA PROMOTER-BINDING PROTEIN LIKE genes, LEAFY, and APETALA1. To gain insight into how this module blocks flowering, we analyzed the transcriptome of BOP1-overexpressing plants. Our data suggest a central role for the microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE-microRNA172 module in integrating stress signals conferred in part by promotion of jasmonic acid biosynthesis. These data reveal a potential mechanism by which repression of lateral organ boundary genes by PNY-PNF is essential for flowering. © 2015 American Society of Plant Biologists. All Rights Reserved.
Gene expression analysis after low dose ionising radiation exposure of the developing organism
International Nuclear Information System (INIS)
Abderrafi Benotmane, M.
2007-01-01
Measuring gene expression using microarrays is relevant to many areas of biology and medicine, such as follow up of developmental stages and diseases onset, and treatment study. Since there can be tens of thousands of distinct probes on an array, each micro array experiment can accomplish the equivalent number of genetic tests in parallel. Arrays have therefore dramatically accelerated many types of investigations. For example, microarrays can be used to identify stress response genes by comparing gene expression in challenged versus normal cells. In the Molecular and Cellular Biology lab (MCB), the micro array experiments are performed within the Genomic Platform, fully equipped to analyse either the behaviour of bacteria during long space flight, the effect of low dose ionising radiation on the developing organism in mice, or the human individual radiation sensitivity. For the low dose effect, two main stages of development are of interest; 1) the gastrula stage at which ionizing radiation can induce several malformations. 2) the organogenesis. During brain development, epidemiological studies of the atomic bomb survivors of Hiroshima/Nagasaki showed increased risk of mental retardation in children of women exposed between weeks 8-15 of pregnancy or at a lower extend between weeks 15 to 25
Hu, H M; Chuang, C K; Lee, M J; Tseng, T C; Tang, T K
2000-11-01
We previously reported two novel testis-specific serine/threonine kinases, Aie1 (mouse) and AIE2 (human), that share high amino acid identities with the kinase domains of fly aurora and yeast Ipl1. Here, we report the entire intron-exon organization of the Aie1 gene and analyze the expression patterns of Aie1 mRNA during testis development. The mouse Aie1 gene spans approximately 14 kb and contains seven exons. The sequences of the exon-intron boundaries of the Aie1 gene conform to the consensus sequences (GT/AG) of the splicing donor and acceptor sites of most eukaryotic genes. Comparative genomic sequencing revealed that the gene structure is highly conserved between mouse Aie1 and human AIE2. However, much less homology was found in the sequence outside the kinase-coding domains. The Aie1 locus was mapped to mouse chromosome 7A2-A3 by fluorescent in situ hybridization. Northern blot analysis indicates that Aie1 mRNA likely is expressed at a low level on day 14 and reaches its plateau on day 21 in the developing postnatal testis. RNA in situ hybridization indicated that the expression of the Aie1 transcript was restricted to meiotically active germ cells, with the highest levels detected in spermatocytes at the late pachytene stage. These findings suggest that Aie1 plays a role in spermatogenesis.
International Nuclear Information System (INIS)
Nett, Jason Michael
2010-01-01
We present here the search for Standard Model VH → VWW → lll + E T (missing energy due to neutrinos) production, where V is a W or Z weak vector boson, which uses up to 5.9 fb -1 of integrated luminosity. This analysis has recently added to the CDF high-mass Higgs group three new signal topologies characterized by a tri-lepton signature, which are chosen to isolate the VH → VWW associated production signals in the three-lepton signature. As such, we define three new regions for a WH analysis, a ZH 1-jet analysis, and a ZH (ge) 2-jet analysis with which we expect to contribute an additional ∼ 5.8% (for m H = 165 GeV) acceptance to the current H → WW dilepton analysis. The ZH trilepton regions are defined by events passing a Z-boson selection: events having at least one lepton pairing (among three possible pairings) with opposite sign, same flavor, and a dilepton invariant mass within (76.0, 106.0) GeV - a ± 15 GeV window around the Z-boson mass. The WH trilepton region is then defined as the set of trilepton events that are complement to those chosen by the Z-boson selection. These three new event topologies make a substantial contribution to the H → WW group result. As a measure of the sensitivity of this search, we compute the median expected limit on the at 95% confidence level ('C.L.') on the production cross section (effectively the rate of production) for a Standard Model Higgs boson and report the result as a ratio to the theoretical production cross section. An observed limit ratio of one or less at a given mass would rule out the production of a Standard Model Higgs boson at that mass with 95% confidence. At m H = 165 GeV, the WH analysis expected limits reach 7.2 times the standard model cross section; the ZH 1-jet analysis is set at 29 times the expected standard model cross section; the ZH (ge) 2-jet analysis is set at 9.9 times the expected standard model cross section; and the combined trilepton analysis is set at 4.9 times the expected
Combining ability estimates for earliness in cotton leaf curl virus resistant inbred parents
International Nuclear Information System (INIS)
Baloch, M.J.; Baloch, Q.B.
2005-01-01
Four female cotton leaf curl virus-resistant resistant (cclv) parents consisting of advance strains and commercial varieties (VH-137, FH-901, CRIS-467 and Cyto-51) and four male parents, all clcv resistant Punjab varieties (FH-945, CIM-707, CIM-473 and FH-1000) were mated in a cross classification Design-II fashion. The results show that genetic variances due to additive genes were higher than the dominant variances, yet both types of variances were substantial, implying that significant improvement could reliably be made from segregating populations. The general combining ability (gca) estimates by and large suggested that for improvement in the appearance of first white flower and 1st sympodial branch node number, parents FH-945 and VH-137 whereas for 1st effective boll setting, parents FH-1000 and FH-901 and for percent of open bolls at 120 days after planting, parents CIM-707 and CRIS-467 may be given preference. However, for hybrid cotton development regarding earliness, hybrids CRIS-467 x CIM-707, VH-137 x FH-945 and Cyto-51 x FH-1000 may be chosen. (author)
Feldmesser, Ester; Rosenwasser, Shilo; Vardi, Assaf; Ben-Dor, Shifra
2014-02-22
The advent of Next Generation Sequencing technologies and corresponding bioinformatics tools allows the definition of transcriptomes in non-model organisms. Non-model organisms are of great ecological and biotechnological significance, and consequently the understanding of their unique metabolic pathways is essential. Several methods that integrate de novo assembly with genome-based assembly have been proposed. Yet, there are many open challenges in defining genes, particularly where genomes are not available or incomplete. Despite the large numbers of transcriptome assemblies that have been performed, quality control of the transcript building process, particularly on the protein level, is rarely performed if ever. To test and improve the quality of the automated transcriptome reconstruction, we used manually defined and curated genes, several of them experimentally validated. Several approaches to transcript construction were utilized, based on the available data: a draft genome, high quality RNAseq reads, and ESTs. In order to maximize the contribution of the various data, we integrated methods including de novo and genome based assembly, as well as EST clustering. After each step a set of manually curated genes was used for quality assessment of the transcripts. The interplay between the automated pipeline and the quality control indicated which additional processes were required to improve the transcriptome reconstruction. We discovered that E. huxleyi has a very high percentage of non-canonical splice junctions, and relatively high rates of intron retention, which caused unique issues with the currently available tools. While individual tools missed genes and artificially joined overlapping transcripts, combining the results of several tools improved the completeness and quality considerably. The final collection, created from the integration of several quality control and improvement rounds, was compared to the manually defined set both on the DNA and
Role of Hoxc genes in the development of the limb integumentary organ (nail, claw, or hoof).
Lasierra, Maria Angeles Ros; Fernández-Guerrero, Marc; Delisle, Lucille; Yakushiji-Kaminatsui, Nayuta; Darbellay, Fabrice; Pérez-Gómez, Rocío; Duboule, Denis
2018-04-01
The developing vertebrate limb has long proved as an excellent system for studying the mechanisms involved in pattern formation and morphogenesis and more recently in transcriptional regulation and morphological evolution. To elucidate the stage-specific expression profiles of the components of the developing limb, we have generated the temporal transcriptome of the limb progenitors and of the overlying ectoderm separately. Our study has uncovered a collinear activation of Hoxc genes in the limb ectoderm that we have validated by in situ hybridization. However, while members of the HoxA and HoxD clusters show complex and dynamic patterns of expression during limb development that correlate with the morphology of the different limb segments, no specific function for the HoxC or HoxB clusters has been identified ( 1 - 3 ). To investigate the function of Hoxc genes in the limb ectoderm, we have reexamined the HoxC cluster null mice. Remarkably, and despite exhibiting normal terminal phalanges, these mice didn't form claws (anonychia). Morphological and immunohistochemical analysis identified a failure in the differentiation of the main components of the nail/claw organ. To unravel the transcriptional regulation of Hoxc genes in the limb ectoderm, we used the ATACseq technique. Using this approach, we identified two putative regulatory regions which activity was tested in mouse transgenic enhancer assays. It is currently considered that Hox genes have played a key role in the evolution of morphological traits, probably associated with changes in their regulatory landscapes ( 4 ). Given that the form and size of the distal limb integumentary organ (nail, claw or hoof) correlates with that of the distal phalanx and that the development of hooves was a major innovation in the evolution of a cursorial lifestyle, we are also exploring the possible implication of Hoxc genes in the nail/claw/hoof transition. This abstract is from the Experimental Biology 2018 Meeting. There
Directory of Open Access Journals (Sweden)
Hui Yang
2017-03-01
Full Text Available Plant-specific ( genes play critical roles in various plant growth and development processes. However, the number and characteristics of genes in soybean [ (L. Merr.] remain unknown. Here, we identified 90 homologous genes in the soybean genome that phylogenetically clustered into two classes (I and II. The majority of the genes were evenly distributed across all 20 soybean chromosomes, and 77 (81.11% of them were detected in segmental duplicated regions. Furthermore, the exon–intron organization and motif composition for each were analyzed. A close phylogenetic relationship was identified between the soybean genes and 41 previously reported genes of different plants in the same group, providing insights into their putative functions. Expression analysis indicated that more than half of the genes were expressed, with the two gene classes showing differential tissue expression characteristics; in addition, they were differentially induced by biotic and abiotic stresses. To further explore the functions of genes in soybean, was selected for functional characterization. GmLBD12 was mainly localized to the nucleus and showed high expression in root and seed tissues. Overexpressing in (L. Heynh resulted in increases in lateral root (LR number and plant height. Quantitative real-time polymerase chain reaction (qRT-PCR analysis demonstrated that was induced by drought, salt, cold, indole acetic acid (IAA, abscisic acid (ABA, and salicylic acid SA treatments. This study provides the first comprehensive analysis of the soybean gene family and a valuable foundation for future functional studies of genes.
2011-01-01
Background Biomineralization is a process encompassing all mineral containing tissues produced within an organism. One of the most dynamic examples of this process is the formation of the mollusk shell, comprising a variety of crystal phases and microstructures. The organic component incorporated within the shell is said to dictate this architecture. However general understanding of how this process is achieved remains ambiguous. The mantle is a conserved organ involved in shell formation throughout molluscs. Specifically the mantle is thought to be responsible for secreting the protein component of the shell. This study employs molecular approaches to determine the spatial expression of genes within the mantle tissue to further the elucidation of the shell biomineralization. Results A microarray platform was custom generated (PmaxArray 1.0) from the pearl oyster Pinctada maxima. PmaxArray 1.0 consists of 4992 expressed sequence tags (ESTs) originating from mantle tissue. This microarray was used to analyze the spatial expression of ESTs throughout the mantle organ. The mantle was dissected into five discrete regions and analyzed for differential gene expression with PmaxArray 1.0. Over 2000 ESTs were determined to be differentially expressed among the tissue sections, identifying five major expression regions. In situ hybridization validated and further localized the expression for a subset of these ESTs. Comparative sequence similarity analysis of these ESTs revealed a number of the transcripts were novel while others showed significant sequence similarities to previously characterized shell related genes. Conclusions This investigation has mapped the spatial distribution for over 2000 ESTs present on PmaxArray 1.0 with reference to specific locations of the mantle. Expression profile clusters have indicated at least five unique functioning zones in the mantle. Three of these zones are likely involved in shell related activities including formation of nacre
Gong, Qian; Li, Chang-ying; Chang, Ji-wu; Zhu, Tie-hong
2012-06-01
To screen monoclonal antibodies to amylin from a constructed human phage antibody library and identify their antigenic specificity and combining activities. The heavy chain Fd fragment and light chain of human immunoglobulin genes were amplified from peripheral blood lymphocytes of healthy donors using RT-PCR, and then inserted into phagemid pComb3XSS to generate a human phage antibody library. The insertion of light chain or heavy chain Fd genes were identified by PCR after the digestion of Sac I, Xba I, Xho Iand Spe I. One of positive clones was analyzed by DNA sequencing. The specific anti-amylin clones were screened from antibody library against human amylin antigens and then the positive clones were determined by Phage-ELISA analysis. A Fab phage antibody library with 0.8×10(8); members was constructed with the efficacy of about 70%. DNA sequence analysis indicated V(H); gene belonged to V(H);3 gene family and V(λ); gene belonged to the V(λ); gene family. Using human amylin as panning antigen, specific anti-amylin Fab antibodies were enriched by screening the library for three times. Phage-ELISA assay showed the positive clones had very good specificity to amylin antigen. The successful construction of a phage antibody library and the identification of anti-amylin Fab antibodies provide a basis for further study and preparation of human anti-amylin antibodies.
van Ommen, M M; van Beilen, M; Cornelissen, F W; Smid, H G O M; Knegtering, H; Aleman, A; van Laar, T
2016-06-01
Little is known about visual hallucinations (VH) in psychosis. We investigated the prevalence and the role of bottom-up and top-down processing in VH. The prevailing view is that VH are probably related to altered top-down processing, rather than to distorted bottom-up processing. Conversely, VH in Parkinson's disease are associated with impaired visual perception and attention, as proposed by the Perception and Attention Deficit (PAD) model. Auditory hallucinations (AH) in psychosis, however, are thought to be related to increased attention. Our retrospective database study included 1119 patients with non-affective psychosis and 586 controls. The Community Assessment of Psychic Experiences established the VH rate. Scores on visual perception tests [Degraded Facial Affect Recognition (DFAR), Benton Facial Recognition Task] and attention tests [Response Set-shifting Task, Continuous Performance Test-HQ (CPT-HQ)] were compared between 75 VH patients, 706 non-VH patients and 485 non-VH controls. The lifetime VH rate was 37%. The patient groups performed similarly on cognitive tasks; both groups showed worse perception (DFAR) than controls. Non-VH patients showed worse attention (CPT-HQ) than controls, whereas VH patients did not perform differently. We did not find significant VH-related impairments in bottom-up processing or direct top-down alterations. However, the results suggest a relatively spared attentional performance in VH patients, whereas face perception and processing speed were equally impaired in both patient groups relative to controls. This would match better with the increased attention hypothesis than with the PAD model. Our finding that VH frequently co-occur with AH may support an increased attention-induced 'hallucination proneness'.
De Tiège, Alexis; Van de Peer, Yves; Braeckman, Johan; Tanghe, Koen B
2017-11-22
Although classical evolutionary theory, i.e., population genetics and the Modern Synthesis, was already implicitly 'gene-centred', the organism was, in practice, still generally regarded as the individual unit of which a population is composed. The gene-centred approach to evolution only reached a logical conclusion with the advent of the gene-selectionist or gene's eye view in the 1960s and 1970s. Whereas classical evolutionary theory can only work with (genotypically represented) fitness differences between individual organisms, gene-selectionism is capable of working with fitness differences among genes within the same organism and genome. Here, we explore the explanatory potential of 'intra-organismic' and 'intra-genomic' gene-selectionism, i.e., of a behavioural-ecological 'gene's eye view' on genetic, genomic and organismal evolution. First, we give a general outline of the framework and how it complements the-to some extent-still 'organism-centred' approach of classical evolutionary theory. Secondly, we give a more in-depth assessment of its explanatory potential for biological evolution, i.e., for Darwin's 'common descent with modification' or, more specifically, for 'historical continuity or homology with modular evolutionary change' as it has been studied by evolutionary developmental biology (evo-devo) during the last few decades. In contrast with classical evolutionary theory, evo-devo focuses on 'within-organism' developmental processes. Given the capacity of gene-selectionism to adopt an intra-organismal gene's eye view, we outline the relevance of the latter model for evo-devo. Overall, we aim for the conceptual integration between the gene's eye view on the one hand, and more organism-centred evolutionary models (both classical evolutionary theory and evo-devo) on the other.
2017-10-01
these unusual antibodies can effectively be displayed on the cell surface. 5 Additionally, we successfully prepared cDNA from lymphocytes derived...from cow peripheral blood, spleen, and lymph nodes, amplified this cDNA by PCR with VH gene specific primers, and this “library” has been cloned into
Bende, R. J.; Aarts, W. M.; Pals, S. T.; van Noesel, C. J. M.
2002-01-01
In this study we describe alternative splicing of somatically mutated immunoglobulin (Ig) variable heavy chain (V-H) genes in three distinct primary B cell non-Hodgkin's lymphomas (B-NHL). In two V4-34 expressing lymphomas, ie a post-germinal center type B cell chronic lymphocytic leukemia (B-CLL)
Visualizing conserved gene location across microbe genomes
Shaw, Chris D.
2009-01-01
This paper introduces an analysis-based zoomable visualization technique for displaying the location of genes across many related species of microbes. The purpose of this visualizatiuon is to enable a biologist to examine the layout of genes in the organism of interest with respect to the gene organization of related organisms. During the genomic annotation process, the ability to observe gene organization in common with previously annotated genomes can help a biologist better confirm the structure and function of newly analyzed microbe DNA sequences. We have developed a visualization and analysis tool that enables the biologist to observe and examine gene organization among genomes, in the context of the primary sequence of interest. This paper describes the visualization and analysis steps, and presents a case study using a number of Rickettsia genomes.
Directory of Open Access Journals (Sweden)
Jianli Wang
2018-01-01
Full Text Available Auxin response factors (ARFs have been reported to play vital roles during plant growth and development. In order to reveal specific functions related to vegetative organs in grasses, an in-depth study of the ARF gene family was carried out in switchgrass (Panicum virgatum L., a warm-season C4 perennial grass that is mostly used as bioenergy and animal feedstock. A total of 47 putative ARF genes (PvARFs were identified in the switchgrass genome (2n = 4x = 36, 42 of which were anchored to the seven pairs of chromosomes and found to be unevenly distributed. Sixteen PvARFs were predicted to be potential targets of small RNAs (microRNA160 and 167. Phylogenetically speaking, PvARFs were divided into seven distinct subgroups based on the phylogeny, exon/intron arrangement, and conserved motif distribution. Moreover, 15 pairs of PvARFs have different temporal-spatial expression profiles in vegetative organs (2nd, 3rd, and 4th internode and leaves, which implies that different PvARFs have specific functions in switchgrass growth and development. In addition, at least 14 pairs of PvARFs respond to naphthylacetic acid (NAA treatment, which might be helpful for us to study on auxin response in switchgrass. The comprehensive analysis, described here, will facilitate the future functional analysis of ARF genes in grasses.
International Nuclear Information System (INIS)
Carrascosa, Patricia; Baronio, Mariano; Capunay, Carlos; Lopez, Elba Martin; Vallejos, Javier; Borghi, Mario; Sueldo, Carlos; Papier, Sergio
2008-01-01
Objective: To compare the efficacy of multidetector CT virtual hysterosalpingography (MDCT-VH) with conventional X-ray hysterosalpingography (HSG) in the evaluation of patients with diagnosis of infertility. Methods: Sixty patients with diagnosis of infertility scheduled to perform a HSG, were evaluated with 16-row (n = 50) and 64-row (n = 10) MDCT-VH. In 35 patients the examination was performed without a tenaculum. The HSGs were carried out using standard technique. The HSG and MDCT-VH findings were compared. The duration for both examinations and patient discomfort were documented. The sensitivity and specificity of MDCT-VH for the detection of uterine pathology and tubal obstruction were calculated using the exact binomial method. Agreement between the two methods was assessed by the Cohen's kappa method (k). Results: The mean duration for MDCT-VH (16 and 64-rows) was 5 ± 3 min, whereas for HSG was 28 ± 3. The MDCT-VH without a tenaculum was the procedure with less patient discomfort. Sensitivity, specificity and inter-method agreement for the detection of uterine pathology were 100%, 92% and k = 0.92 for 16-row MDCT-VH and 100%, 100% and k = 1 for 64-row MDCT-VH, respectively. Sensitivity and specificity for detection of tubal obstruction were 80% and 80% for 16-row MDCT-VH and 100% and 100% for 64-row MDCT-VH, respectively; inter-method agreement for the visualization of the tubes was k = 0.54 for 16-row MDCT-VH and k = 1 for 64-row MDCT-VH. Conclusion: This study demonstrated the feasibility of evaluating the female reproductive system by MDCT-VH. 64-Row MDCT-VH could be an alternative diagnostic technique in the infertility workup algorithm. A larger study is in progress to validate these encouraging results
Energy Technology Data Exchange (ETDEWEB)
Carrascosa, Patricia [Diagnostico Maipu, Av. Maipu 1668, Vicente Lopez B1602ABQ, Buenos Aires (Argentina)], E-mail: patriciacarrascosa@diagnosticomaipu.com.ar; Baronio, Mariano [CEGYR, Viamonte 1438, Capital Federal C1055ABB (Argentina); Capunay, Carlos; Lopez, Elba Martin; Vallejos, Javier [Diagnostico Maipu, Av. Maipu 1668, Vicente Lopez B1602ABQ, Buenos Aires (Argentina); Borghi, Mario; Sueldo, Carlos; Papier, Sergio [CEGYR, Viamonte 1438, Capital Federal C1055ABB (Argentina)
2008-09-15
Objective: To compare the efficacy of multidetector CT virtual hysterosalpingography (MDCT-VH) with conventional X-ray hysterosalpingography (HSG) in the evaluation of patients with diagnosis of infertility. Methods: Sixty patients with diagnosis of infertility scheduled to perform a HSG, were evaluated with 16-row (n = 50) and 64-row (n = 10) MDCT-VH. In 35 patients the examination was performed without a tenaculum. The HSGs were carried out using standard technique. The HSG and MDCT-VH findings were compared. The duration for both examinations and patient discomfort were documented. The sensitivity and specificity of MDCT-VH for the detection of uterine pathology and tubal obstruction were calculated using the exact binomial method. Agreement between the two methods was assessed by the Cohen's kappa method (k). Results: The mean duration for MDCT-VH (16 and 64-rows) was 5 {+-} 3 min, whereas for HSG was 28 {+-} 3. The MDCT-VH without a tenaculum was the procedure with less patient discomfort. Sensitivity, specificity and inter-method agreement for the detection of uterine pathology were 100%, 92% and k = 0.92 for 16-row MDCT-VH and 100%, 100% and k = 1 for 64-row MDCT-VH, respectively. Sensitivity and specificity for detection of tubal obstruction were 80% and 80% for 16-row MDCT-VH and 100% and 100% for 64-row MDCT-VH, respectively; inter-method agreement for the visualization of the tubes was k = 0.54 for 16-row MDCT-VH and k = 1 for 64-row MDCT-VH. Conclusion: This study demonstrated the feasibility of evaluating the female reproductive system by MDCT-VH. 64-Row MDCT-VH could be an alternative diagnostic technique in the infertility workup algorithm. A larger study is in progress to validate these encouraging results.
Genomic analysis of Xenopus organizer function
Directory of Open Access Journals (Sweden)
Suhai Sándor
2006-06-01
Full Text Available Abstract Background Studies of the Xenopus organizer have laid the foundation for our understanding of the conserved signaling pathways that pattern vertebrate embryos during gastrulation. The two primary activities of the organizer, BMP and Wnt inhibition, can regulate a spectrum of genes that pattern essentially all aspects of the embryo during gastrulation. As our knowledge of organizer signaling grows, it is imperative that we begin knitting together our gene-level knowledge into genome-level signaling models. The goal of this paper was to identify complete lists of genes regulated by different aspects of organizer signaling, thereby providing a deeper understanding of the genomic mechanisms that underlie these complex and fundamental signaling events. Results To this end, we ectopically overexpress Noggin and Dkk-1, inhibitors of the BMP and Wnt pathways, respectively, within ventral tissues. After isolating embryonic ventral halves at early and late gastrulation, we analyze the transcriptional response to these molecules within the generated ectopic organizers using oligonucleotide microarrays. An efficient statistical analysis scheme, combined with a new Gene Ontology biological process annotation of the Xenopus genome, allows reliable and faithful clustering of molecules based upon their roles during gastrulation. From this data, we identify new organizer-related expression patterns for 19 genes. Moreover, our data sub-divides organizer genes into separate head and trunk organizing groups, which each show distinct responses to Noggin and Dkk-1 activity during gastrulation. Conclusion Our data provides a genomic view of the cohorts of genes that respond to Noggin and Dkk-1 activity, allowing us to separate the role of each in organizer function. These patterns demonstrate a model where BMP inhibition plays a largely inductive role during early developmental stages, thereby initiating the suites of genes needed to pattern dorsal tissues
Brewer, Matt T; Xiong, Nalee; Anderson, Kristi L; Carlson, Steve A
2013-08-01
To assess antimicrobial resistance and transfer of virulence genes facilitated by subtherapeutic concentrations of antimicrobials in swine intestines. 20 anesthetized pigs experimentally inoculated with donor and recipient bacteria. 4 recipient pathogenic bacteria (Salmonella enterica serotype Typhimurium, Yersinia enterocolitica, Shigella flexneri, or Proteus mirabilis) were incubated with donor bacteria in the presence of subinhibitory concentrations of 1 of 16 antimicrobials in isolated ligated intestinal loops in swine. Donor Escherichia coli contained transferrable antimicrobial resistance or virulence genes. After coincubations, intestinal contents were removed and assessed for pathogens that acquired new antimicrobial resistance or virulence genes following exposure to the subtherapeutic concentrations of antimicrobials. 3 antimicrobials (apramycin, lincomycin, and neomycin) enhanced transfer of an antimicrobial resistance plasmid from commensal E coli organisms to Yersinia and Proteus organisms, whereas 7 antimicrobials (florfenicol, hygromycin, penicillin G, roxarsone, sulfamethazine, tetracycline, and tylosin) exacerbated transfer of an integron (Salmonella genomic island 1) from Salmonella organisms to Yersinia organisms. Sulfamethazine induced the transfer of Salmonella pathogenicity island 1 from pathogenic to nonpathogenic Salmonella organisms. Six antimicrobials (bacitracin, carbadox, erythromycin, sulfathiazole, tiamulin, and virginiamycin) did not mediate any transfer events. Sulfamethazine was the only antimicrobial implicated in 2 types of transfer events. 10 of 16 antimicrobials at subinhibitory or subtherapeutic concentrations augmented specific antimicrobial resistance or transfer of virulence genes into pathogenic bacteria in isolated intestinal loops in swine. Use of subtherapeutic antimicrobials in animal feed may be associated with unwanted collateral effects.
Piscor, Diovani; Centofante, Liano; Parise-Maltempi, Patricia Pasquali
2017-09-01
Genus Astyanax is well distributed in Neotropical freshwater environments and its taxonomic position is uncertain, as is the case with other Characidae genera allocated in the group incertae sedis. This study aimed to analyse the karyotype of different populations of Astyanax fasciatus (Corumbataí River basin) using Giemsa staining, C-band technique, and fluorescence in situ hybridization for the H3 histone and 5S rRNA genes, in addition we describe for the first time the chromosomal organization of H3 histone and 5S rRNAgenes in A. marionae (ParaguayRiver basin). Chromosomes of three A. fasciatus populations were analysed (two with 2n = 50 and one with 2n = 48) and the heterochromatin was organized in two forms (blocks with blurred boundaries and distinct blocks). H3 histone and 5S rRNA genes were observed in all the three populations of A. fasciatus on two chromosome pairs (one metacentric chromosome showing H3 histone and 5S rRNA gene clusters). In A. marionae (2n = 48), H3 histone and 5S rRNA genes were observed in one acrocentric chromosome pair (different pairs). Further, differences between karyotypes and heterochromatin, as well as the chromosomal organization of H3 histone and 5S rRNA genes in Astyanax species, focussing on chromosome evolution in the group are discussed.
Apoptosis Gene Information System--AGIS.
Sakharkar, Kishore R; Clement, Marie V; Chow, Vincent T K; Pervaiz, Shazib
2006-05-01
Genes implicated in apoptosis have great relevance to biology, medicine and oncology. Here, we describe a unique resource, Apoptosis Gene Information System (AGIS) that provides data for over 2400 genes involved directly or indirectly, in apoptotic pathways of more than 350 different organisms. The organization of this information system is based on the principle of one-gene, one record. AGIS will be updated on a six monthly basis as new information becomes available. AGIS can be accessed at: http://www.cellfate.org/AGIS/.
Viral hepatitis in Latin America and the Caribbean: a public health challenge
Directory of Open Access Journals (Sweden)
Núria Díez-Padrisa
2013-10-01
Full Text Available Viral hepatitis (VH is an emergent concern in public health agendas worldwide. More than one million people die annually from hepatitis and 57% and 78% of global cirrhosis and hepatocellular carcinoma cases, respectively, are caused by VH. The burden of disease caused by hepatitis in Latin America and the Caribbean (LAC is high. Data on hepatitis has been collected in several countries, but more accurate and comparable studies are needed. Hepatitis B vaccination and screening of donated blood are routine practices in the region. However, integrated policies covering prevention and control of disease caused by all types of hepatitis viruses are scarce. Existing preventive measures need to be reinforced. Attention must be paid to at-risk populations, awareness campaigns, and water and food safety. Affordable access to diagnosis and treatment, population screening, referral to health services and monitoring of positive cases are among the main challenges currently posed by VH in LAC. The World Health Organization framework and Pan American Health Organization regional strategy, defined in response to resolution WHA63.18 of the World Health Assembly, may help to overcome these difficulties. Successful experiences in the fight against hepatitis in some LAC countries may also provide very interesting solutions for the region.
Energy Technology Data Exchange (ETDEWEB)
Mazonakis, Michalis, E-mail: mazonak@med.uoc.gr; Damilakis, John [Department of Medical Physics, Faculty of Medicine, University of Crete, P.O. Box 2208, Iraklion, Crete 71003 (Greece); Tzedakis, Antonis [Department of Medical Physics, University Hospital of Iraklion, Iraklion, Crete 71110 (Greece); Lyraraki, Efrossyni [Department of Radiotherapy and Oncology, University Hospital of Iraklion, Iraklion, Crete 71110 (Greece)
2016-04-15
Purpose: Vertebral hemangiomas (VHs) are the most common benign tumors of the spine that may cause bone resorption. Megavoltage irradiation is usually the treatment of choice for the management of symptomatic VHs. The current study was conducted to estimate the risk for carcinogenesis from radiotherapy of this benign disease on the basis of the calculated radiation doses to healthy organs. Methods: The Monte Carlo N-particle transport code was employed to simulate the irradiation with 6 MV x-rays of a VH presented in the cervical, upper thoracic, lower thoracic, and lumbar spine. The average radiation dose (D{sub av}) received by each critical organ located outside the primarily irradiated area was calculated. Three-dimensional treatment plans were also generated for the VHs occurring at the four different sites of the spinal cord based on patients’ computed tomography data. The organ equivalent dose (OED) to each radiosensitive structure, which was partly encompassed by the applied treatment fields, was calculated with the aid of differential dose–volume histograms. The D{sub av} and the OED values were combined with a linear-no-threshold model and a nonlinear mechanistic model, respectively, to estimate the organ-, age-, and gender-specific lifetime attributable risks (LARs) for cancer development. The estimated risks were compared with the respective nominal lifetime intrinsic risks (LIRs) for the unexposed population. Results: For a standard target dose of 34 Gy, the OED varied from 0.39–5.15 Gy by the organ of interest and the irradiation site. The D{sub av} range for the out-of-field organs was 4.9 × 10{sup −4} to 0.56 Gy. The LAR for the appearance of malignancies in the partially in-field organs after radiotherapy of male and female patients was (0.08%–1.8%) and (0.09%–1.9%), respectively. These risk values were 1.5–15.5 times lower when compared to the respective LIRs. The lifetime probability for out-of-field cancer induction in irradiated
International Nuclear Information System (INIS)
Mazonakis, Michalis; Damilakis, John; Tzedakis, Antonis; Lyraraki, Efrossyni
2016-01-01
Purpose: Vertebral hemangiomas (VHs) are the most common benign tumors of the spine that may cause bone resorption. Megavoltage irradiation is usually the treatment of choice for the management of symptomatic VHs. The current study was conducted to estimate the risk for carcinogenesis from radiotherapy of this benign disease on the basis of the calculated radiation doses to healthy organs. Methods: The Monte Carlo N-particle transport code was employed to simulate the irradiation with 6 MV x-rays of a VH presented in the cervical, upper thoracic, lower thoracic, and lumbar spine. The average radiation dose (D_a_v) received by each critical organ located outside the primarily irradiated area was calculated. Three-dimensional treatment plans were also generated for the VHs occurring at the four different sites of the spinal cord based on patients’ computed tomography data. The organ equivalent dose (OED) to each radiosensitive structure, which was partly encompassed by the applied treatment fields, was calculated with the aid of differential dose–volume histograms. The D_a_v and the OED values were combined with a linear-no-threshold model and a nonlinear mechanistic model, respectively, to estimate the organ-, age-, and gender-specific lifetime attributable risks (LARs) for cancer development. The estimated risks were compared with the respective nominal lifetime intrinsic risks (LIRs) for the unexposed population. Results: For a standard target dose of 34 Gy, the OED varied from 0.39–5.15 Gy by the organ of interest and the irradiation site. The D_a_v range for the out-of-field organs was 4.9 × 10"−"4 to 0.56 Gy. The LAR for the appearance of malignancies in the partially in-field organs after radiotherapy of male and female patients was (0.08%–1.8%) and (0.09%–1.9%), respectively. These risk values were 1.5–15.5 times lower when compared to the respective LIRs. The lifetime probability for out-of-field cancer induction in irradiated males and
Verallo-Rowell, Vermén M
2011-01-01
The validated hypoallergenic (vh) rating system was initiated in 1988 to try to objectively validate the "hypoallergenic" claim in cosmetics. To show how the system rates cosmetic hypoallergenicity and to compare the prevalence of cosmetic contact dermatitis (CCD) among users of regular cosmetics versus cosmetics with high VH numbers. (1) Made a VH list based on top allergens from patch-test results published by the North American Contact Dermatitis Group (NACDG) and the European Surveillance System on Contact Allergies (ESSCA); (2) reviewed global regulatory, cosmetic, drug, packaging, and manufacturing practices to show how allergens may contaminate products; (3) compared cosmetic ingredients lists against the VH list to obtain the VH rating (the more allergens absent, the higher the VH rating); and (4) obtained CCD prevalence among users of regular cosmetics versus users of cosmetics with high VH ratings. (1) Two VH lists (1988, 2003) included only cosmetic allergens in the NACDG surveys, the third (2007) included cosmetic and potential contaminant noncosmetic allergens, and the fourth (2010) adds ESSCA patch-test surveys. (2) CCD prevalence is 0.05 to 0.12% (average, 0.08%) among users of cosmetics with high VH ratings versus 2.4 to 36.3% among users of regular cosmetics. The VH rating system is shown to objectively validate the hypoallergenic cosmetics claim.
Tracking microorganisms and gene in the environment
International Nuclear Information System (INIS)
Atlas, R.M.; Sayler, G.S.
1988-01-01
Studies have been conducted to determine the sensitivities and limitations of various methods for determining the fate of genetically engineered microorganisms (GEMs) and their genes in the environment. Selective viable plate count procedures can be designed to detect the introduced organisms with high sensitivity; but they are restricted by potential mutations affecting the expression of the selective characteristic in the introduced organism, the occurrence of the particular selective characteristic in the indigenous organisms, and the need to culture the organism. The accuracy of this approach is greatly improved by colony hybridization procedures that use a specific gene probe to detect the introduced genes, but this approach is still only as sensitive as the plating procedure. Direct extraction of DNA from environmental samples, coupled with dot blot hybridization with radiolabeled probe DNA or solution hybridization, gives a high degree of both sensitivity and precision. This approach does not require culturing of the organism; and even if an introduced gene moves into a new organism or if the introduced organism is viable but nonculturable, the gene probe methods will detect the persistence of the introduced genes in the environment. Efficient direct DNA extraction methods have been developed and tested following in vitro experimental additions of GEMs to sediment and water samples
Derrickson, J. H.; Wu, J.; Christl, M. J.; Fountain, W. F.; Parnell, T. A.
1999-01-01
The "all-particle" cosmic ray energy spectrum appears to be exhibiting a significant change in the spectral index just above approximately 3000 TeV. This could indicate (1) a change in the propagation of the cosmic rays in the galactic medium, and/or (2) the upper limit of the supernova shock wave acceleration mechanism, and/or (3) a new source of high-energy cosmic rays. Air shower and JACEE data indicate the spectral change is associated with a composition change to a heavier element mixture whereas DICE does not indicate this. A detector concept will be presented that utilizes the energy dependence of the production of direct Coulomb electron-positron pairs by energetic heavy ions. Monte Carlo simulations of a direct electron pair detector consisting of Pb target foils interleaved with planes of 1-mm square scintillating optical fibers will be discussed. The goal is to design a large area, non-saturating instrument to measure the energy spectrum of the individual cosmic ray elements in the "VH-group" for energies greater than 10 TeV/nucleon.
Mastinu, Andrea; Pira, Marilena; Pani, Luca; Pinna, Gérard Aimè; Lazzari, Paolo
2012-10-01
The present work aims to study the effects induced by a chronic treatment with a novel CB1 antagonist (NESS038C6) in C57BL/6N diet-induced obesity (DIO) mice. Mice treated with NESS038C6 and fed with a fat diet (NESS038C6 FD) were compared with the following three reference experimental groups: DIO mice fed with the same fat diet used for NESS038C6 and treated with vehicle or the reference CB1 antagonist/inverse agonist rimonabant, "VH FD" and "SR141716 FD", respectively; DIO mice treated with vehicle and switched to a normal diet (VH ND). NESS038C6 chronic treatment (30 mg/kg/day for 31 days) determined a significant reduction in DIO mice weight relative to that of VH FD. The entity of the effect was comparable to that detected in both SR141716 FD and VH ND groups. Moreover, if compared to VH FD, NESS038C6 FD evidenced: (i) improvement of cardiovascular risk factors; (ii) significant decrease in adipose tissue leptin expression; (iii) increase in mRNA expression of hypothalamic orexigenic peptides and a decrease of anorexigenic peptides; (iv) expression increase of metabolic enzymes and peroxisome proliferator-activated receptor-α in the liver; (v) normalization of monoaminergic transporters and neurotrophic expression in mesolimbic area. However, in contrast to the case of rimonabant, the novel CB1 antagonist improved the disrupted expression profile of genes linked to the hunger-satiety circuit, without altering monoaminergic transmission. In conclusion, the novel CB1 antagonist compound NESS038C6 may represent a useful candidate agent for the treatment of obesity and its metabolic complications, without or with reduced side effects relative to those instead observed with rimonabant. Copyright © 2012 Elsevier B.V. All rights reserved.
Noise minimization in eukaryotic gene expression.
Directory of Open Access Journals (Sweden)
Hunter B Fraser
2004-06-01
Full Text Available All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or "noise." Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection.
Noise minimization in eukaryotic gene expression
Energy Technology Data Exchange (ETDEWEB)
Fraser, Hunter B.; Hirsh, Aaron E.; Giaever, Guri; Kumm, Jochen; Eisen, Michael B.
2004-01-15
All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or noise. Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection.
Noise minimization in eukaryotic gene expression
International Nuclear Information System (INIS)
Fraser, Hunter B.; Hirsh, Aaron E.; Giaever, Guri; Kumm, Jochen; Eisen, Michael B.
2004-01-01
All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or noise. Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection
Raudsepp, Koit
1999-01-01
Uute heliplaatide Lou Bega "A Little Bit Of Mambo", Captain Jack "The Captain"s Revenge", Donna Summer "VH1 Presents Live & More Encore!", Freddy Fresh "The Last True Family Man", United Future Organization "Bon Voyage", Dingo "Parhaad" tutvustus
Miyano, Naoki; Inoue, Yuuki; Teramura, Yuji; Fujii, Keisuke; Tsumori, Fujio; Iwata, Hiroo; Kotera, Hidetoshi
2008-07-01
In the diffusional phase transformation of two-phase alloys, the new phase precipitates form the matrix phase at specific temperatures, followed by the formation of a mixed microstructure comprising the precipitate and the matrix. It has been found that by specific chemical-etching treatment, the precipitate in Fe-25Cr-6Ni alloy projects substantially and clusters at the surface. The configuration of the precipitate has an extremely high aspect ratio: it is several microns in width and several tens of microns in length (known as micron-spiked). This study targets the development of a gene transfer device with a micro-spike produced based on the self-organization phenomenon of the Fe-25Cr-6Ni alloy. With this spike-projected device, we tried to efficiently transfer plasmid DNA into adherent cells by electric pulse-triggered gene transfer using a plasmid-loaded electrode (electroporation-based reverse transfection). The spiked structure was applied to a substrate of the device to allow efficient gene transfer into adherent cells, although the general substrate was flat and had a smooth surface. The results suggest that this unique spike-projected device has potential applications in gene transfer devices for the analysis of the human genome in the post-genome period.
Tremblay, Line; Roy-Vaillancourt, Mélina; Chebbi, Brahim; Bouchard, Stéphane; Daoust, Michael; Dénommée, Jessica; Thorpe, Moriah
2016-02-01
It is well documented that anti-fat attitudes influence the interactions individuals have with overweight people. However, testing attitudes through self-report measures is challenging. In the present study, we explore the use of a haptic virtual reality environment to physically interact with overweight virtual human (VH). We verify the hypothesis that duration and strength of virtual touch vary according to the characteristics of VH in ways similar to those encountered from interaction with real people in anti-fat attitude studies. A group of 61 participants were randomly assigned to one of the experimental conditions involving giving a virtual hug to a female or a male VH of either normal or overweight. We found significant associations between body image satisfaction and anti-fat attitudes and sex differences on these measures. We also found a significant interaction effect of the sex of the participants, sex of the VH, and the body size of the VH. Female participants hugged longer the overweight female VH than overweight male VH. Male participants hugged longer the normal-weight VH than the overweight VH. We conclude that virtual touch is a promising method of measuring attitudes, emotion and social interactions.
Directory of Open Access Journals (Sweden)
Sonia Pinho
2011-04-01
Full Text Available The amniote organizer (Hensen's node can induce a complete nervous system when grafted into a peripheral region of a host embryo. Although BMP inhibition has been implicated in neural induction, non-neural cells cannot respond to BMP antagonists unless previously exposed to a node graft for at least 5 hours before BMP inhibitors. To define signals and responses during the first 5 hours of node signals, a differential screen was conducted. Here we describe three early response genes: two of them, Asterix and Obelix, encode previously undescribed proteins of unknown function but Obelix appears to be a nuclear RNA-binding protein. The third is TrkC, a neurotrophin receptor. All three genes are induced by a node graft within 4-5 hours but they differ in the extent to which they are inducible by FGF: FGF is both necessary and sufficient to induce Asterix, sufficient but not necessary to induce Obelix and neither sufficient nor necessary for induction of TrkC. These genes are also not induced by retinoic acid, Noggin, Chordin, Dkk1, Cerberus, HGF/SF, Somatostatin or ionomycin-mediated Calcium entry. Comparison of the expression and regulation of these genes with other early neural markers reveals three distinct "epochs", or temporal waves, of gene expression accompanying neural induction by a grafted organizer, which are mirrored by specific stages of normal neural plate development. The results are consistent with neural induction being a cascade of responses elicited by different signals, culminating in the formation of a patterned nervous system.
DEFF Research Database (Denmark)
Breuner, Anne; Brøndsted, Lone; Hammer, Karin
1999-01-01
of genetic material based upon the upp gene (encoding uracil phosphoribosyltransferase) was designed, since upp mutants are resistant to fluorouracil. By using this system, frequencies of excision on the order of 10(-5) per cell could easily be measured. The described selection principle may be of general...... use for many organisms and also for types of deletion events other than excision....
Genetic study of various agronomic traits in cotton (Gossypium hirsutum L.)
International Nuclear Information System (INIS)
Ashraf, F.; Khan, I.A.; Ahmed, S.
2009-01-01
The use of already existing genetic variability in the breeding material, as well as, the creation of new variability along with the genetic understanding of various agronomic traits is of crucial importance, in order to develop potential sources of cotton. For this purpose, 5 X 6 complete diallel cross experiment was conducted during 2003-04, involving 5 strains i.e. VH-55, MNH-516, ACALA-SJ-4, A-8100 and CRIS-420, to evaluate gene-action, general and specific combining ability for number of sympodial branches, number of monopodial branches, plant height, number of bolls per plant, boll weight and yield of seed cotton. Additive type of gene action, with partial dominance for all the traits studied, was observed. Most dominant genes for boll weight, yield of seed-cotton, and number of sympodial branches were observed in CRIS-420, while maximum dominant genes for number of monopodial branches, plant height were observed in ACALA-SJ-4. Variety VH-55 carried maximum dominant genes for number of bolls per plant. Recessive genes for the number of sympodial branches, number of monopodial branches, plant height, number of bolls per plant and yield of seed-cotton, were exhibited by MNH-516. The variety ACAU-SJ-4 showed harmonius combination for bolls per plant and yield of seed-cotton, whereas CRIS- 420 was found a good general combiner for plant height and number of sympodial branches. (author)
Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao
2013-11-27
The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.
Chromatin meets its organizers.
Bodnar, Megan S; Spector, David L
2013-06-06
Chromatin organization and gene-gene interactions are critical components of carrying out developmental programs. Phillips-Cremins et al. identify a series of unexpected architectural proteins that work in a combinatorial manner to functionally organize chromatin in a cell-type-specific manner at the submegabase-length scale. Copyright © 2013 Elsevier Inc. All rights reserved.
Gray, K M; Greenberg, E P
1992-07-01
Vibrio fischeri ES114 is an isolate representing the specific bacterial light organ symbiont of the squid Euprymna scolopes. An interesting feature of this strain of V. fischeri is that it is visibly luminous within the light organ of the squid host but is nonluminous when grown under standard laboratory conditions. Luminescence can be restored in laboratory culture, however, by the addition of autoinducer, a species-specific inducer of the V. fischeri luminescence (lux) genes. Most other isolates of V. fischeri produce autoinducer in sufficient quantities to induce luminescence in laboratory culture. We have cloned an 8.8-kb DNA fragment from V. fischeri ES114 that encodes all of the functions necessary for luminescence in Escherichia coli in the absence of exogenous autoinducer. This DNA contains both of the recognized V. fischeri lux regulatory genes, one of which (luxI) directs E. coli to synthesize autoinducer. The organization of the individual lux genes within this DNA fragment appears to be the same as that in the other strains of V. fischeri studied; the restriction map of the V. fischeri ES114 lux DNA has diverged substantially, however, from the largely conserved maps of V. fischeri MJ1 and ATCC 7744. Although E. coli containing the V. fischeri ES114 lux DNA synthesizes considerable amounts of autoinducer, V. fischeri ES114 synthesizes autoinducer only in small amounts, even when transcription of the lux genes, including luxI, is activated by the addition of exogenous autoinducer. Nonetheless, transconjugants of V. fischeri ES114 that contain multicopy plasmids bearing the ES114 lux genes synthesize sufficient autoinducer to induce luminescence. These results suggest that V. fischeri ES11r does not lack a functional luxl, nor is it deficient in the ability to synthesize metabolic precursors for autoinducer synthesis.
Gene Fusion Markup Language: a prototype for exchanging gene fusion data.
Kalyana-Sundaram, Shanker; Shanmugam, Achiraman; Chinnaiyan, Arul M
2012-10-16
An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses.
Persistence drives gene clustering in bacterial genomes
Directory of Open Access Journals (Sweden)
Rocha Eduardo PC
2008-01-01
Full Text Available Abstract Background Gene clustering plays an important role in the organization of the bacterial chromosome and several mechanisms have been proposed to explain its extent. However, the controversies raised about the validity of each of these mechanisms remind us that the cause of this gene organization remains an open question. Models proposed to explain clustering did not take into account the function of the gene products nor the likely presence or absence of a given gene in a genome. However, genomes harbor two very different categories of genes: those genes present in a majority of organisms – persistent genes – and those present in very few organisms – rare genes. Results We show that two classes of genes are significantly clustered in bacterial genomes: the highly persistent and the rare genes. The clustering of rare genes is readily explained by the selfish operon theory. Yet, genes persistently present in bacterial genomes are also clustered and we try to understand why. We propose a model accounting specifically for such clustering, and show that indispensability in a genome with frequent gene deletion and insertion leads to the transient clustering of these genes. The model describes how clusters are created via the gene flux that continuously introduces new genes while deleting others. We then test if known selective processes, such as co-transcription, physical interaction or functional neighborhood, account for the stabilization of these clusters. Conclusion We show that the strong selective pressure acting on the function of persistent genes, in a permanent state of flux of genes in bacterial genomes, maintaining their size fairly constant, that drives persistent genes clustering. A further selective stabilization process might contribute to maintaining the clustering.
Margoni, T.
2012-01-01
The paper focuses on the patentability requirements applicable to the case of biotechnological inventions (gene patents and other genetically modified organisms). The paper takes a comparative standpoint and analyzes North-American, European, and Japanese landscapes. Attention will be also paid to
Exploring the Optimal Strategy to Predict Essential Genes in Microbes
Directory of Open Access Journals (Sweden)
Yao Lu
2011-12-01
Full Text Available Accurately predicting essential genes is important in many aspects of biology, medicine and bioengineering. In previous research, we have developed a machine learning based integrative algorithm to predict essential genes in bacterial species. This algorithm lends itself to two approaches for predicting essential genes: learning the traits from known essential genes in the target organism, or transferring essential gene annotations from a closely related model organism. However, for an understudied microbe, each approach has its potential limitations. The first is constricted by the often small number of known essential genes. The second is limited by the availability of model organisms and by evolutionary distance. In this study, we aim to determine the optimal strategy for predicting essential genes by examining four microbes with well-characterized essential genes. Our results suggest that, unless the known essential genes are few, learning from the known essential genes in the target organism usually outperforms transferring essential gene annotations from a related model organism. In fact, the required number of known essential genes is surprisingly small to make accurate predictions. In prokaryotes, when the number of known essential genes is greater than 2% of total genes, this approach already comes close to its optimal performance. In eukaryotes, achieving the same best performance requires over 4% of total genes, reflecting the increased complexity of eukaryotic organisms. Combining the two approaches resulted in an increased performance when the known essential genes are few. Our investigation thus provides key information on accurately predicting essential genes and will greatly facilitate annotations of microbial genomes.
Evaluation of suitable reference genes for gene expression studies ...
Indian Academy of Sciences (India)
2011-12-14
Dec 14, 2011 ... MADS family of TFs control floral organ identity within each whorl of the flower by activating downstream genes. Measuring gene expression in different tissue types and developmental stages is of fundamental importance in TFs functional research. In last few years, quantitative real-time. PCR (qRT-PCR) ...
Unusual Gene Order and Organization of the Sea Urchin HoxCluster
Energy Technology Data Exchange (ETDEWEB)
Richardson, Paul M.; Lucas, Susan; Cameron, R. Andrew; Rowen,Lee; Nesbitt, Ryan; Bloom, Scott; Rast, Jonathan P.; Berney, Kevin; Arenas-Mena, Cesar; Martinez, Pedro; Davidson, Eric H.; Peterson, KevinJ.; Hood, Leroy
2005-05-10
The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3' gene is Hox5. (The gene order is : 5'-Hox1,2, 3, 11/13c, 11/13b, '11/13a, 9/10, 8, 7, 6, 5 - 3)'. The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.
Jhala, A J; Bhatt, H; Topinka, K; Hall, L M
2011-04-01
Coexistence allows growers and consumers the choice of producing or purchasing conventional or organic crops with known standards for adventitious presence of genetically engineered (GE) seed. Flax (Linum usitatissimum L.) is multipurpose oilseed crop in which product diversity and utility could be enhanced for industrial, nutraceutical and pharmaceutical markets through genetic engineering. If GE flax were released commercially, pollen-mediated gene flow will determine in part whether GE flax could coexist without compromising other markets. As a part of pre-commercialization risk assessment, we quantified pollen-mediated gene flow between two cultivars of flax. Field experiments were conducted at four locations during 2006 and 2007 in western Canada using a concentric donor (20 × 20 m) receptor (120 × 120 m) design. Gene flow was detected through the xenia effect of dominant alleles of high α-linolenic acid (ALA; 18:3(cisΔ9,12,15)) to the low ALA trait. Seeds were harvested from the pollen recipient plots up to a distance of 50 m in eight directions from the pollen donor. High ALA seeds were identified using a thiobarbituric acid test and served as a marker for gene flow. Binomial distribution and power analysis were used to predict the minimum number of seeds statistically required to detect the frequency of gene flow at specific α (confidence interval) and power (1-β) values. As a result of the low frequency of gene flow, approximately 4 million seeds were screened to derive accurate quantification. Frequency of gene flow was highest near the source: averaging 0.0185 at 0.1 m but declined rapidly with distance, 0.0013 and 0.00003 at 3 and 35 m, respectively. Gene flow was reduced to 50% (O₅₀) and 90% (O₉₀) between 0.85 to 2.64 m, and 5.68 to 17.56 m, respectively. No gene flow was detected at any site or year > 35 m distance from the pollen source, suggesting that frequency of gene flow was ≤ 0.00003 (P = 0.95). Although it is not possible to
Peyer, Suzanne M.; Pankey, M. Sabrina; Oakley, Todd H.; McFall-Ngai, Margaret J.
2013-01-01
The squid Euprymna scolopes has evolved independent sets of tissues capable of light detection, including a complex eye and a photophore or ‘light organ’, which houses the luminous bacterial symbiont Vibrio fischeri. As the eye and light organ originate from different embryonic tissues, we examined whether the eye-specification genes, pax6, eya, six, and dac, are shared by these two organs, and if so, whether they are regulated in the light organ by symbiosis. We obtained sequences of the fou...
Transformation and evaluation of Cry1Ac+Cry2A and GTGene in Gossypium hirsutum L.
Directory of Open Access Journals (Sweden)
Agung Nugroho Puspito
2015-11-01
Full Text Available More than 50 countries around the globe cultivate cotton on a large scale. It is a major cash crop of Pakistan and is considered white gold because it is highly important to the economy of Pakistan. In addition to its importance, cotton cultivation faces several problems, such as insect pests, weeds, and viruses. In the past, insects have been controlled by insecticides, but this method caused a severe loss to the economy. However, conventional breeding methods have provided considerable breakthroughs in the improvement of cotton, but it also has several limitations. In comparison with conventional methods, biotechnology has the potential to create genetically modified plants that are environmentally safe and economically viable. In this study, a local cotton variety VH 289 was transformed with two Bt genes (Cry1Ac and Cry2A and a herbicide resistant gene (cp4 EPSPS using the Agrobacterium mediated transformation method. The constitutive CaMV 35S promoter was attached to the genes taken from Bacillus thuringiensis (Bt and to an herbicide resistant gene during cloning, and this promoter was used for the expression of the genes in cotton plants. This construct was used to develop the Glyphosate Tolerance Gene (GTGene for herbicide tolerance and insecticidal gene (Cry1Ac and Cry2A for insect tolerance in the cotton variety VH 289. The transgenic cotton variety performed 85% better compared with the non-transgenic variety. The study results suggest that farmers should use the transgenic cotton variety for general cultivation to improve the production of cotton.
Efficient generation of monoclonal antibodies from single rhesus macaque antibody secreting cells.
Meng, Weixu; Li, Leike; Xiong, Wei; Fan, Xuejun; Deng, Hui; Bett, Andrew J; Chen, Zhifeng; Tang, Aimin; Cox, Kara S; Joyce, Joseph G; Freed, Daniel C; Thoryk, Elizabeth; Fu, Tong-Ming; Casimiro, Danilo R; Zhang, Ningyan; A Vora, Kalpit; An, Zhiqiang
2015-01-01
Nonhuman primates (NHPs) are used as a preclinical model for vaccine development, and the antibody profiles to experimental vaccines in NHPs can provide critical information for both vaccine design and translation to clinical efficacy. However, an efficient protocol for generating monoclonal antibodies from single antibody secreting cells of NHPs is currently lacking. In this study we established a robust protocol for cloning immunoglobulin (IG) variable domain genes from single rhesus macaque (Macaca mulatta) antibody secreting cells. A sorting strategy was developed using a panel of molecular markers (CD3, CD19, CD20, surface IgG, intracellular IgG, CD27, Ki67 and CD38) to identify the kinetics of B cell response after vaccination. Specific primers for the rhesus macaque IG genes were designed and validated using cDNA isolated from macaque peripheral blood mononuclear cells. Cloning efficiency was averaged at 90% for variable heavy (VH) and light (VL) domains, and 78.5% of the clones (n = 335) were matched VH and VL pairs. Sequence analysis revealed that diverse IGHV subgroups (for VH) and IGKV and IGLV subgroups (for VL) were represented in the cloned antibodies. The protocol was tested in a study using an experimental dengue vaccine candidate. About 26.6% of the monoclonal antibodies cloned from the vaccinated rhesus macaques react with the dengue vaccine antigens. These results validate the protocol for cloning monoclonal antibodies in response to vaccination from single macaque antibody secreting cells, which have general applicability for determining monoclonal antibody profiles in response to other immunogens or vaccine studies of interest in NHPs.
Yan, Y.; Smant, G.; Stokkermans, J.P.W.G.; Qin Ling,; Baum, T.J.; Schots, A.; Davis, E.L.
1998-01-01
The genomic organization of genes encoding -1,4-endoglucanases (cellulases) from the plant-parasitic cyst nematodes Heterodera glycines and Globodera rostochiensis (HG-eng1, Hg-eng2, GR-eng1, and GR-eng2) was investigated. HG-eng1 and GR-eng1 both contained eight introns and structural domains of
Flux Dynamics and Time Effects in a Carved out Superconducting Polycrystalline Bi-Sr-Ca-Cu-O Sample
Energy Technology Data Exchange (ETDEWEB)
Olutas, M [Abant Izzet Baysal University, Department of Physics, Turgut Gulez Research Laboratory 14280 Bolu (Turkey); Yetis, H [Abant Izzet Baysal University, Department of Physics, Turgut Gulez Research Laboratory 14280 Bolu (Turkey); Altinkok, A [Abant Izzet Baysal University, Department of Physics, Turgut Gulez Research Laboratory 14280 Bolu (Turkey); Soezeri, H [National Metrology Institute TUBITAK PO Box 21, 41470, Gebze-Kocaeli (Turkey); Kilic, K [Abant Izzet Baysal University, Department of Physics, Turgut Gulez Research Laboratory 14280 Bolu (Turkey); Kilic, A [Abant Izzet Baysal University, Department of Physics, Turgut Gulez Research Laboratory 14280 Bolu (Turkey); Cetin, O [Abant Izzet Baysal University, Department of Physics, Turgut Gulez Research Laboratory 14280 Bolu (Turkey)
2006-06-01
Systematic slow transport relaxation (V-t curves) and magnetovoltage measurements (V-H curves) have been carried out in a carved out superconducting polycrystalline Bi-Sr-Ca-Cu-O sample as a function of current (I), temperature (T), and external field (H). The V-t curves reveal the details of the time evolution of the penetrated state within the granular structure of the sample and also give a direct evidence of the relaxation of the flux trapped inside the drilled hole on the time scale of the experiment. On the other hand, V-H curves exhibit several unusual interesting properties upon cycling of the external magnetic field in forward and reverse directions, and, in addition to irreversibilities, strong reversible effects are observed, which is associated with the trapping of the macroscopic flux bundles in the drilled hole. It is also observed that the field sweep rate influences dramatically the reversible and irreversible behavior of V-H curves. The experimental results were mainly interpreted in terms of current and field induced organization of the vortices.
Flux Dynamics and Time Effects in a Carved out Superconducting Polycrystalline Bi-Sr-Ca-Cu-O Sample
International Nuclear Information System (INIS)
Olutas, M; Yetis, H; Altinkok, A; Soezeri, H; Kilic, K; Kilic, A; Cetin, O
2006-01-01
Systematic slow transport relaxation (V-t curves) and magnetovoltage measurements (V-H curves) have been carried out in a carved out superconducting polycrystalline Bi-Sr-Ca-Cu-O sample as a function of current (I), temperature (T), and external field (H). The V-t curves reveal the details of the time evolution of the penetrated state within the granular structure of the sample and also give a direct evidence of the relaxation of the flux trapped inside the drilled hole on the time scale of the experiment. On the other hand, V-H curves exhibit several unusual interesting properties upon cycling of the external magnetic field in forward and reverse directions, and, in addition to irreversibilities, strong reversible effects are observed, which is associated with the trapping of the macroscopic flux bundles in the drilled hole. It is also observed that the field sweep rate influences dramatically the reversible and irreversible behavior of V-H curves. The experimental results were mainly interpreted in terms of current and field induced organization of the vortices
Directory of Open Access Journals (Sweden)
Yohann Le Govic
2018-04-01
Full Text Available The ubiquitous mold Scedosporium apiospermum is increasingly recognized as an emerging pathogen, especially among patients with underlying disorders such as immunodeficiency or cystic fibrosis (CF. Indeed, it ranks the second among the filamentous fungi colonizing the respiratory tract of CF patients. However, our knowledge about virulence factors of this fungus is still limited. The role of iron-uptake systems may be critical for establishment of Scedosporium infections, notably in the iron-rich environment of the CF lung. Two main strategies are employed by fungi to efficiently acquire iron from their host or from their ecological niche: siderophore production and reductive iron assimilation (RIA systems. The aim of this study was to assess the existence of orthologous genes involved in iron metabolism in the recently sequenced genome of S. apiospermum. At first, a tBLASTn analysis using A. fumigatus iron-related proteins as query revealed orthologs of almost all relevant loci in the S. apiospermum genome. Whereas the genes putatively involved in RIA were randomly distributed, siderophore biosynthesis and transport genes were organized in two clusters, each containing a non-ribosomal peptide synthetase (NRPS whose orthologs in A. fumigatus have been described to catalyze hydroxamate siderophore synthesis. Nevertheless, comparative genomic analysis of siderophore-related clusters showed greater similarity between S. apiospermum and phylogenetically close molds than with Aspergillus species. The expression level of these genes was then evaluated by exposing conidia to iron starvation and iron excess. The expression of several orthologs of A. fumigatus genes involved in siderophore-based iron uptake or RIA was significantly induced during iron starvation, and conversely repressed in iron excess conditions. Altogether, these results indicate that S. apiospermum possesses the genetic information required for efficient and competitive iron uptake
Lee, K H; Ruby, E G
1992-03-01
Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (=1 to 3 CFU/100 ml). However, probe-positive colonies of V. fischeri (up to 900 CFU/100 ml) were found only in seawater collected from within the natural habitats of the squids. A number of criteria were used to confirm that these probe-positive strains were indistinguishable from symbiotic V. fischeri. Therefore, the luxA and luxR gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples.
Genome-wide identification of KANADI1 target genes.
Directory of Open Access Journals (Sweden)
Paz Merelo
Full Text Available Plant organ development and polarity establishment is mediated by the action of several transcription factors. Among these, the KANADI (KAN subclade of the GARP protein family plays important roles in polarity-associated processes during embryo, shoot and root patterning. In this study, we have identified a set of potential direct target genes of KAN1 through a combination of chromatin immunoprecipitation/DNA sequencing (ChIP-Seq and genome-wide transcriptional profiling using tiling arrays. Target genes are over-represented for genes involved in the regulation of organ development as well as in the response to auxin. KAN1 affects directly the expression of several genes previously shown to be important in the establishment of polarity during lateral organ and vascular tissue development. We also show that KAN1 controls through its target genes auxin effects on organ development at different levels: transport and its regulation, and signaling. In addition, KAN1 regulates genes involved in the response to abscisic acid, jasmonic acid, brassinosteroids, ethylene, cytokinins and gibberellins. The role of KAN1 in organ polarity is antagonized by HD-ZIPIII transcription factors, including REVOLUTA (REV. A comparison of their target genes reveals that the REV/KAN1 module acts in organ patterning through opposite regulation of shared targets. Evidence of mutual repression between closely related family members is also shown.
Differential Gene Expression and Aging
Directory of Open Access Journals (Sweden)
Laurent Seroude
2002-01-01
Full Text Available It has been established that an intricate program of gene expression controls progression through the different stages in development. The equally complex biological phenomenon known as aging is genetically determined and environmentally modulated. This review focuses on the genetic component of aging, with a special emphasis on differential gene expression. At least two genetic pathways regulating organism longevity act by modifying gene expression. Many genes are also subjected to age-dependent transcriptional regulation. Some age-related gene expression changes are prevented by caloric restriction, the most robust intervention that slows down the aging process. Manipulating the expression of some age-regulated genes can extend an organism's life span. Remarkably, the activity of many transcription regulatory elements is linked to physiological age as opposed to chronological age, indicating that orderly and tightly controlled regulatory pathways are active during aging.
GeneBins: a database for classifying gene expression data, with application to plant genome arrays
Directory of Open Access Journals (Sweden)
Weiller Georg
2007-03-01
Full Text Available Abstract Background To interpret microarray experiments, several ontological analysis tools have been developed. However, current tools are limited to specific organisms. Results We developed a bioinformatics system to assign the probe set sequences of any organism to a hierarchical functional classification modelled on KEGG ontology. The GeneBins database currently supports the functional classification of expression data from four Affymetrix arrays; Arabidopsis thaliana, Oryza sativa, Glycine max and Medicago truncatula. An online analysis tool to identify relevant functions is also provided. Conclusion GeneBins provides resources to interpret gene expression results from microarray experiments. It is available at http://bioinfoserver.rsbs.anu.edu.au/utils/GeneBins/
Gene name ambiguity of eukaryotic nomenclatures.
Chen, Lifeng; Liu, Hongfang; Friedman, Carol
2005-01-15
With more and more scientific literature published online, the effective management and reuse of this knowledge has become problematic. Natural language processing (NLP) may be a potential solution by extracting, structuring and organizing biomedical information in online literature in a timely manner. One essential task is to recognize and identify genomic entities in text. 'Recognition' can be accomplished using pattern matching and machine learning. But for 'identification' these techniques are not adequate. In order to identify genomic entities, NLP needs a comprehensive resource that specifies and classifies genomic entities as they occur in text and that associates them with normalized terms and also unique identifiers so that the extracted entities are well defined. Online organism databases are an excellent resource to create such a lexical resource. However, gene name ambiguity is a serious problem because it affects the appropriate identification of gene entities. In this paper, we explore the extent of the problem and suggest ways to address it. We obtained gene information from 21 organisms and quantified naming ambiguities within species, across species, with English words and with medical terms. When the case (of letters) was retained, official symbols displayed negligible intra-species ambiguity (0.02%) and modest ambiguities with general English words (0.57%) and medical terms (1.01%). In contrast, the across-species ambiguity was high (14.20%). The inclusion of gene synonyms increased intra-species ambiguity substantially and full names contributed greatly to gene-medical-term ambiguity. A comprehensive lexical resource that covers gene information for the 21 organisms was then created and used to identify gene names by using a straightforward string matching program to process 45,000 abstracts associated with the mouse model organism while ignoring case and gene names that were also English words. We found that 85.1% of correctly retrieved mouse
Yamamoto, Masanori; Takano, Masamichi; Okamatsu, Kentaro; Murakami, Daisuke; Inami, Shigenobu; Xie, Yong; Seimiya, Koji; Ohba, Takayoshi; Seino, Yoshihiko; Mizuno, Kyoichi
2009-03-01
Thin cap fibroatheroma (TCFA) is considered to be a vulnerable plaque. Virtual Histology-intravascular ultrasound (VH-IVUS) can precisely identify TCFA in vivo. Intense yellow plaque on angioscopy determined by quantitative colorimetry with L a b color space corresponds with histological TCFA; in particular, a plaque of color b value >23 indicates an atheroma with a fibrous cap thickness colorimetry was investigated. Fifty-seven culprit plaques in 57 patients were evaluated by VH-IVUS and angioscopy. VH-TCFA was defined as a plaque with a necrotic core >10% of plaque area without overlying fibrous tissue, and angioscopic TCFA was a plaque with b value >23. The frequency of angioscopic TCFA was higher in the VH-TCFA group than in the VH-non-TCFA group (74% vs 23%, P=0.0002). Moreover, yellow color intensity (b value) significantly correlated with plaque classification on VH-IVUS. When TCFA detected with angioscopy was used as the gold standard, the sensitivity, specificity, and accuracy for TCFA with VH-IVUS was 68%, 81%, and 75%, respectively. VH-TCFA strongly correlated with angioscopic TCFA determined by a quantitative analysis with colorimetry.
Complete gene expression profiling of Saccharopolyspora erythraea using GeneChip DNA microarrays
Directory of Open Access Journals (Sweden)
Bordoni Roberta
2007-11-01
Full Text Available Abstract Background The Saccharopolyspora erythraea genome sequence, recently published, presents considerable divergence from those of streptomycetes in gene organization and function, confirming the remarkable potential of S. erythraea for producing many other secondary metabolites in addition to erythromycin. In order to investigate, at whole transcriptome level, how S. erythraea genes are modulated, a DNA microarray was specifically designed and constructed on the S. erythraea strain NRRL 2338 genome sequence, and the expression profiles of 6494 ORFs were monitored during growth in complex liquid medium. Results The transcriptional analysis identified a set of 404 genes, whose transcriptional signals vary during growth and characterize three distinct phases: a rapid growth until 32 h (Phase A; a growth slowdown until 52 h (Phase B; and another rapid growth phase from 56 h to 72 h (Phase C before the cells enter the stationary phase. A non-parametric statistical method, that identifies chromosomal regions with transcriptional imbalances, determined regional organization of transcription along the chromosome, highlighting differences between core and non-core regions, and strand specific patterns of expression. Microarray data were used to characterize the temporal behaviour of major functional classes and of all the gene clusters for secondary metabolism. The results confirmed that the ery cluster is up-regulated during Phase A and identified six additional clusters (for terpenes and non-ribosomal peptides that are clearly regulated in later phases. Conclusion The use of a S. erythraea DNA microarray improved specificity and sensitivity of gene expression analysis, allowing a global and at the same time detailed picture of how S. erythraea genes are modulated. This work underlines the importance of using DNA microarrays, coupled with an exhaustive statistical and bioinformatic analysis of the results, to understand the transcriptional
Wu, D D; Li, S H; Jin, L Y; Jin, Y; Cui, Y Y; Zhao, H; Liu, H J; Ma, X X; Su, W; Chen, H B
2016-04-05
To investigate the prevalence and influencing factors of visual hallucinations in patients with Parkinson's disease(PD), and to analyze the relationship between visual hallucinations and sleep disorders. We recruited 187 patients with PD(H-Y Ⅰ-Ⅲ) from outpatient department in Beijing Hospital. The patients were investigated for general information and the use of medicine. The patients were divided into visual hallucination(VH) group and non-hallucination(non-VH) group. A comparison study was conducted between two groups. We investigated the sleep disorders of PD patients according to Non Motor Symptom Quest(NMSquest) and Parkinson's disease sleep scale(PDSS). Logistic stepwise multiple regression procedures were used to determine the best predictive model of visual hallucinations in patients with PD. (1) 42 cases(22.5%) of PD patients were accompanied by visual hallucinations; (2) the VH group and non-VH group had no difference in age, sex, duration of illness, the scores of Minimum Mental State Examination(MMSE) and levodopa equivalent doses (LED). The scores of Unified Parkinson's Disease Rating Scale(UPDRS) Ⅰ, the Hamilton Rating Scale for Anxiety(HAMA) and the Hamilton Rating Scale for Depression(HAMD) in VH group were significantly higher than those in non-VH group[3.5(2, 5) vs 2 (1, 3); 10(6.75, 15) vs 8(5, 11); 11(7.75, 17) vs 9(5, 13); Psleep behavior disorder(RBD) in VH group were significantly higher than those in non-VH group(61.9% vs 40.7%, 71.4% vs 47.6%, P0.05). The score of PDSS in VH group was significantly lower than that in non-VH group[111(92.75, 128.25) vs 123(109, 135), Psleep disorder are independently associated with VH in PD.
Directory of Open Access Journals (Sweden)
Sze Sing-Hoi
2005-03-01
Full Text Available Abstract Background Chemokines and their receptors play important roles in host defense, organogenesis, hematopoiesis, and neuronal communication. Forty-two chemokines and 19 cognate receptors have been found in the human genome. Prior to this report, only 11 chicken chemokines and 7 receptors had been reported. The objectives of this study were to systematically identify chicken chemokines and their cognate receptor genes in the chicken genome and to annotate these genes and ligand-receptor binding by a comparative genomics approach. Results Twenty-three chemokine and 14 chemokine receptor genes were identified in the chicken genome. All of the chicken chemokines contained a conserved CC, CXC, CX3C, or XC motif, whereas all the chemokine receptors had seven conserved transmembrane helices, four extracellular domains with a conserved cysteine, and a conserved DRYLAIV sequence in the second intracellular domain. The number of coding exons in these genes and the syntenies are highly conserved between human, mouse, and chicken although the amino acid sequence homologies are generally low between mammalian and chicken chemokines. Chicken genes were named with the systematic nomenclature used in humans and mice based on phylogeny, synteny, and sequence homology. Conclusion The independent nomenclature of chicken chemokines and chemokine receptors suggests that the chicken may have ligand-receptor pairings similar to mammals. All identified chicken chemokines and their cognate receptors were identified in the chicken genome except CCR9, whose ligand was not identified in this study. The organization of these genes suggests that there were a substantial number of these genes present before divergence between aves and mammals and more gene duplications of CC, CXC, CCR, and CXCR subfamilies in mammals than in aves after the divergence.
[Gene doping: gene transfer and possible molecular detection].
Argüelles, Carlos Francisco; Hernández-Zamora, Edgar
2007-01-01
The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.
de Cambiaire, Jean-Charles; Otis, Christian; Lemieux, Claude; Turmel, Monique
2006-01-01
Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. While the basal position of the Prasinophyceae is well established, the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae (UTC) remains uncertain. The five complete chloroplast DNA (cpDNA) sequences currently available for representatives of these classes display considerable variability in overall structure, gene content, gene density, intron content and gene order. Among these genomes, that of the chlorophycean green alga Chlamydomonas reinhardtii has retained the least ancestral features. The two single-copy regions, which are separated from one another by the large inverted repeat (IR), have similar sizes, rather than unequal sizes, and differ radically in both gene contents and gene organizations relative to the single-copy regions of prasinophyte and ulvophyte cpDNAs. To gain insights into the various changes that underwent the chloroplast genome during the evolution of chlorophycean green algae, we have sequenced the cpDNA of Scenedesmus obliquus, a member of a distinct chlorophycean lineage. Results The 161,452 bp IR-containing genome of Scenedesmus features single-copy regions of similar sizes, encodes 96 genes, i.e. only two additional genes (infA and rpl12) relative to its Chlamydomonas homologue and contains seven group I and two group II introns. It is clearly more compact than the four UTC algal cpDNAs that have been examined so far, displays the lowest proportion of short repeats among these algae and shows a stronger bias in clustering of genes on the same DNA strand compared to Chlamydomonas cpDNA. Like the latter genome, Scenedesmus cpDNA displays only a few ancestral gene clusters. The two chlorophycean genomes share 11 gene clusters that are not found in previously sequenced trebouxiophyte and ulvophyte cpDNAs as well as a few genes that have an unusual structure; however, their single-copy regions differ
Yang, Xing; Xie, Lu; Li, Yixue; Wei, Chaochun
2009-06-29
Estimating the number of genes in human genome has been long an important problem in computational biology. With the new conception of considering human as a super-organism, it is also interesting to estimate the number of genes in this human super-organism. We presented our estimation of gene numbers in the human gut bacterial community, the largest microbial community inside the human super-organism. We got 552,700 unique genes from 202 complete human gut bacteria genomes. Then, a novel gene counting model was built to check the total number of genes by combining culture-independent sequence data and those complete genomes. 16S rRNAs were used to construct a three-level tree and different counting methods were introduced for the three levels: strain-to-species, species-to-genus, and genus-and-up. The model estimates that the total number of genes is about 9,000,000 after those with identity percentage of 97% or up were merged. By combining completed genomes currently available and culture-independent sequencing data, we built a model to estimate the number of genes in human gut bacterial community. The total number of genes is estimated to be about 9 million. Although this number is huge, we believe it is underestimated. This is an initial step to tackle this gene counting problem for the human super-organism. It will still be an open problem in the near future. The list of genomes used in this paper can be found in the supplementary table.
Guidelines for the naming of genes, gene products, and mutants in the opportunistic protists.
Limper, Andrew H; Weiss, Louis M
2011-01-01
The opportunistic protists encompass a wide diversity of organisms including Pneumocystis, Toxoplasma, cryptosporidia, microsporidia, and related genera. Recent advances in the molecular biology and cellular biochemistry of these organisms have led to the identification of an ever growing numbers of key genes and their cognate proteins. Until now, these molecules have not been designated using any consistent nomenclature system, leading to considerable confusion. The participants of the 11th International Workshop on Opportunistic Protists met on August 3, 2010 to reach consensus of a nomenclature system for genes, gene products, and mutants in the opportunistic protists. The following summary reports the consensus agreement to move toward a unified nomenclature system for these organisms. The system is adapted from that used for Saccharomyces cerevisiae. © 2011 The Author(s). Journal of Eukaryotic Microbiology © 2011 International Society of Protistologists.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHD492 (Link to dictyBase) - - - Contig-U15308-1 - (Link to Original site) - - VHD492...Z 675 - - - - Show VHD492 Library VH (Link to library) Clone ID VHD492 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHD4-D/VHD492Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHD492 (VHD492Q) /CSM/VH/VHD4-D/VHD492Q.Seq.d/ XXXXXXXXXXCTTCATC...xkiipink Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHD492 (VHD492Q) /CSM/VH/VHD4-D/VHD492
Husby, Karen Ruben; Tolstrup, Cæcilie Krogsgaard; Lose, Gunnar; Klarskov, Niels
2018-02-26
Pelvic organ prolapse (POP) is a common diagnosis that imposes high and ever-growing costs to the healthcare economy. Numerous surgical techniques for the treatment of POP exist, but there is no consensus about which is the ideal technique for treating apical prolapse. The aim of this study was to estimate hospital costs for the most frequently performed operation, vaginal hysterectomy with uterosacral ligament suspension (VH) and the uterus-preserving Manchester-Fothergill procedure (MP), when including costs of postoperative activities. The study was based on a historical matched cohort including 590 patients (295 pairs) who underwent VH or MP during 2010-2014 owing to apical prolapse. The patients were matched according to age and preoperative prolapse stage and followed for a minimum of 20 months. Data were collected from four national registries and electronic medical records. Unit costs were obtained from relevant departments, hospital administration, calculated, or estimated by experts. The hospital perspective was applied for costing the resource use. Total costs for the first 20 months after operation were 3,514 € per VH patient versus 2,318 € per MP patient. The cost difference between the techniques was 898 € (95% confidence interval [CI]: 818-982) per patient when analyzing the primary operation only and 1,196 € (CI: 927-1,465) when including subsequent activities within 20 months (p costs can be reduced by one third if MP is preferred over VH in the treatment of apical prolapse.
A novel MADS-box gene subfamily with a sister-group relationship to class B floral homeotic genes.
Becker, A; Kaufmann, K; Freialdenhoven, A; Vincent, C; Li, M-A; Saedler, H; Theissen, G
2002-02-01
Class B floral homeotic genes specify the identity of petals and stamens during the development of angiosperm flowers. Recently, putative orthologs of these genes have been identified in different gymnosperms. Together, these genes constitute a clade, termed B genes. Here we report that diverse seed plants also contain members of a hitherto unknown sister clade of the B genes, termed B(sister) (B(s)) genes. We have isolated members of the B(s) clade from the gymnosperm Gnetum gnemon, the monocotyledonous angiosperm Zea mays and the eudicots Arabidopsis thaliana and Antirrhinum majus. In addition, MADS-box genes from the basal angiosperm Asarum europaeum and the eudicot Petunia hybrida were identified as B(s) genes. Comprehensive expression studies revealed that B(s) genes are mainly transcribed in female reproductive organs (ovules and carpel walls). This is in clear contrast to the B genes, which are predominantly expressed in male reproductive organs (and in angiosperm petals). Our data suggest that the B(s) genes played an important role during the evolution of the reproductive structures in seed plants. The establishment of distinct B and B(s) gene lineages after duplication of an ancestral gene may have accompanied the evolution of male microsporophylls and female megasporophylls 400-300 million years ago. During flower evolution, expression of B(s) genes diversified, but the focus of expression remained in female reproductive organs. Our findings imply that a clade of highly conserved close relatives of class B floral homeotic genes has been completely overlooked until recently and awaits further evaluation of its developmental and evolutionary importance. Electronic supplementary material to this paper can be obtained by using the Springer Link server located at http://dx.doi.org/10.1007/s00438-001-0615-8.
Caracausi, Maria; Piovesan, Allison; Antonaros, Francesca; Strippoli, Pierluigi; Vitale, Lorenza; Pelleri, Maria Chiara
2017-09-01
The ideal reference, or control, gene for the study of gene expression in a given organism should be expressed at a medium‑high level for easy detection, should be expressed at a constant/stable level throughout different cell types and within the same cell type undergoing different treatments, and should maintain these features through as many different tissues of the organism. From a biological point of view, these theoretical requirements of an ideal reference gene appear to be best suited to housekeeping (HK) genes. Recent advancements in the quality and completeness of human expression microarray data and in their statistical analysis may provide new clues toward the quantitative standardization of human gene expression studies in biology and medicine, both cross‑ and within‑tissue. The systematic approach used by the present study is based on the Transcriptome Mapper tool and exploits the automated reassignment of probes to corresponding genes, intra‑ and inter‑sample normalization, elaboration and representation of gene expression values in linear form within an indexed and searchable database with a graphical interface recording quantitative levels of expression, expression variability and cross‑tissue width of expression for more than 31,000 transcripts. The present study conducted a meta‑analysis of a pool of 646 expression profile data sets from 54 different human tissues and identified actin γ 1 as the HK gene that best fits the combination of all the traditional criteria to be used as a reference gene for general use; two ribosomal protein genes, RPS18 and RPS27, and one aquaporin gene, POM121 transmembrane nucleporin C, were also identified. The present study provided a list of tissue‑ and organ‑specific genes that may be most suited for the following individual tissues/organs: Adipose tissue, bone marrow, brain, heart, kidney, liver, lung, ovary, skeletal muscle and testis; and also provides in these cases a representative
Gene2Function: An Integrated Online Resource for Gene Function Discovery
Directory of Open Access Journals (Sweden)
Yanhui Hu
2017-08-01
Full Text Available One of the most powerful ways to develop hypotheses regarding the biological functions of conserved genes in a given species, such as humans, is to first look at what is known about their function in another species. Model organism databases and other resources are rich with functional information but difficult to mine. Gene2Function addresses a broad need by integrating information about conserved genes in a single online resource.
Transcription Through Chromatin - Dynamic Organization of Genes
Indian Academy of Sciences (India)
different proteins involved in the synthesis of mRNA from the. DNA template. ... CBP - CREB Binding Protein. CHRAC. Chromatin .... nucleosomal interactions, and thereby change the chromatin structure, as per the ..... methyltransferases in gene regulation is yet to be elucidated. .... Molecular Biology and. Genetics Unit.
Lee, Kyu-Ho; Ruby, Edward G.
1992-01-01
Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (≤1 to 3 CFU/100 ml). However, probe-positive colonies of V. fischeri (up to 900 CFU/100 ml) were found only in seawater collected from within the natural habitats of the squids. A number of criteria were used to confirm that these probe-positive strains were indistinguishable from symbiotic V. fischeri. Therefore, the luxA and luxR gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples. Images PMID:16348678
Eramo, Alessia; Medina, William Morales; Fahrenfeld, Nicole L
2017-01-01
Combined sewer overflows (CSOs) degrade water quality and end-of-pipe treatment is one potential solution for retrofitting this outdated infrastructure. The goal of this research was to evaluate peracetic acid (PAA) as a disinfectant for CSOs using viability based molecular methods for antibiotic resistance genes (ARGs), indicator organism marker gene BacHum, and 16S rRNA genes. Simulated CSO effluent was prepared using 23-40% wastewater, representing the higher end of the range of wastewater concentrations reported in CSO effluent. PAA residual following disinfection was greatest for samples with the lowest initial COD. Treatment of simulated CSO effluent (23% wastewater) with 100 mg∙min/L PAA (5 mg/L PAA, 20 min) was needed to reduce viable cell sul 1, tet (G), and BacHum (1.0±0.63-3.2±0.25-log) while 25 to 50 mg•min/L PAA (5 mg/L PAA, 5-10 min) was needed to reduce viable cell loads (0.62±0.56-1.6±0.08-log) in 40% wastewater from a different municipal treatment plant. Increasing contact time after the initial decrease in viable cell gene copies did not significantly improve treatment. A much greater applied Ct of 1200 mg∙min/L PAA (20 mg/L PAA, 60 min) was required for significant log reduction of 16S rRNA genes (3.29±0.13-log). No significant losses of mex B were observed during the study. Data were fitted to a Chick-Watson model and resulting inactivation constants for sul 1 and tet (G) > BacHum > 16S rRNA. Amplicon sequencing of the 16S rRNA gene indicated the initial viable and total microbial communities were distinct and that treatment with PAA resulted in marked increases of the relative abundance of select phyla, particularly Clostridia which increased by 1-1.5 orders of magnitude. Results confirm that membrane disruption is a mechanism for PAA disinfection and further treatment is needed to reduce total ARGs in CSO effluent.
Radionuclide reporter gene imaging for cardiac gene therapy
International Nuclear Information System (INIS)
Inubushi, Masayuki; Tamaki, Nagara
2007-01-01
In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)
Directory of Open Access Journals (Sweden)
Yungang Xu
Full Text Available Cellular interactome, in which genes and/or their products interact on several levels, forming transcriptional regulatory-, protein interaction-, metabolic-, signal transduction networks, etc., has attracted decades of research focuses. However, such a specific type of network alone can hardly explain the various interactive activities among genes. These networks characterize different interaction relationships, implying their unique intrinsic properties and defects, and covering different slices of biological information. Functional gene network (FGN, a consolidated interaction network that models fuzzy and more generalized notion of gene-gene relations, have been proposed to combine heterogeneous networks with the goal of identifying functional modules supported by multiple interaction types. There are yet no successful precedents of FGNs on sparsely studied non-model organisms, such as soybean (Glycine max, due to the absence of sufficient heterogeneous interaction data. We present an alternative solution for inferring the FGNs of soybean (SoyFGNs, in a pioneering study on the soybean interactome, which is also applicable to other organisms. SoyFGNs exhibit the typical characteristics of biological networks: scale-free, small-world architecture and modularization. Verified by co-expression and KEGG pathways, SoyFGNs are more extensive and accurate than an orthology network derived from Arabidopsis. As a case study, network-guided disease-resistance gene discovery indicates that SoyFGNs can provide system-level studies on gene functions and interactions. This work suggests that inferring and modelling the interactome of a non-model plant are feasible. It will speed up the discovery and definition of the functions and interactions of other genes that control important functions, such as nitrogen fixation and protein or lipid synthesis. The efforts of the study are the basis of our further comprehensive studies on the soybean functional
Matheron, Eric; Kapoula, Zoï
2015-01-01
Vertical heterophoria (VH) is the latent vertical misalignment of the eyes when the retinal images are dissociated, vertical orthophoria (VO) when there is no misalignment. Studies on postural control, during binocular vision in upright stance, reported that healthy subjects with small VH vs. VO are less stable, but the experimental cancellation of VH with an appropriate prism improves postural stability. The same behavior was recorded in nonspecific chronic back pain subjects, all with VH. It was hypothesized that, without refraction problems, VH indicates a perturbation of the somaesthetic cues required in the sensorimotor loops involved in postural control and the capacity of the CNS to optimally integrate these cues, suggesting prevention possibilities. Sensorimotor conflict can induce pain and modify sensory perception in some healthy subjects; some nonspecific pain or chronic pain could result from such prolonged conflict in which VH could be a sign, with new theoretical and clinical implications.
Directory of Open Access Journals (Sweden)
Líbalová Helena
2012-01-01
Full Text Available Abstract Background Recently, we used cell-free assays to demonstrate the toxic effects of complex mixtures of organic extracts from urban air particles (PM2.5 collected in four localities of the Czech Republic (Ostrava-Bartovice, Ostrava-Poruba, Karvina and Trebon which differed in the extent and sources of air pollution. To obtain further insight into the biological mechanisms of action of the extractable organic matter (EOM from ambient air particles, human embryonic lung fibroblasts (HEL12469 were treated with the same four EOMs to assess changes in the genome-wide expression profiles compared to DMSO treated controls. Method For this purpose, HEL cells were incubated with subtoxic EOM concentrations of 10, 30, and 60 μg EOM/ml for 24 hours and global gene expression changes were analyzed using human whole genome microarrays (Illumina. The expression of selected genes was verified by quantitative real-time PCR. Results Dose-dependent increases in the number of significantly deregulated transcripts as well as dose-response relationships in the levels of individual transcripts were observed. The transcriptomic data did not differ substantially between the localities, suggesting that the air pollution originating mainly from various sources may have similar biological effects. This was further confirmed by the analysis of deregulated pathways and by identification of the most contributing gene modulations. The number of significantly deregulated KEGG pathways, as identified by Goeman's global test, varied, depending on the locality, between 12 to 29. The Metabolism of xenobiotics by cytochrome P450 exhibited the strongest upregulation in all 4 localities and CYP1B1 had a major contribution to the upregulation of this pathway. Other important deregulated pathways in all 4 localities were ABC transporters (involved in the translocation of exogenous and endogenous metabolites across membranes and DNA repair, the Wnt and TGF-β signaling pathways
Wolff-Parkinson-White Syndrome with Ventricular Hypertrophy in a Brazilian Family.
van der Steld, Lenises de Paula; Campuzano, Oscar; Pérez-Serra, Alexandra; Moura de Barros Zamorano, Mabel; Sousa Matos, Selma; Brugada, Ramon
2017-07-10
BACKGROUND PRKAG2 syndrome diagnosis is already well-defined as Wolff-Parkinson-White syndrome (WPW), ventricular hypertrophy (VH) due to glycogen accumulation, and conduction system disease (CSD). Because of its rarity, there is a lack of literature focused on the treatment. The present study aimed to describe appropriate strategies for the treatment of affected family members with PRKAG2 syndrome with a long follow-up period. CASE REPORT We studied 60 selected individuals from 84 family members (32 males, 53.3%) (mean age 27±16 years). Patients with WPW and/or VH were placed in a group of 18 individuals, in which 11 (61.1%) had VH and WPW, 6 (33.3%) had isolated WPW, and 1 (5.6%) had isolated VH. Palpitations occurred in 16 patients (88.9%), chest pain in 11 (61.1%), dizziness in 13 (72.2%), syncope in 15 (83.3%), and dyspnea in 13 (72%). Sudden cardiac death (SCD) occurred in 2 (11.1%), and 2 patients with cardiac arrest (CA) had asystole and pre-excited atrial flutter-fibrillation (AFL and AF) as the documented mechanism. Transient ischemic attack (TIA) and learning/language disabilities with delayed development were observed. Genetic analysis identified a new missense pathogenic variant (p.K290I) in the PRKAG2 gene. Cardiac histopathology demonstrated the predominance of vacuoles containing glycogen derivative and fibrosis. The treatment was based on hypertension and diabetes mellitus (DM) control, antiarrhythmic drugs (AD), anticoagulation, and radiofrequency catheter ablation (RCA). Six patients (33.3%) underwent pacemaker implantation (PM). CONCLUSIONS The present study describes the clinical treatment for a rare cardiac syndrome caused by a PRKAG2 mutation.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK246 (Link to dictyBase) - - - Contig-U16440-1 VHK246P (Link to Original site) VHK2...46F 617 VHK246Z 760 VHK246P 1357 - - Show VHK246 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-B/VHK246Q.Seq.d/ Representative seq. ID VHK2...46P (Link to Original site) Representative DNA sequence >VHK246 (VHK246Q) /CSM/VH/VHK2-B/VHK2...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHK246 (VHK246Q) /CSM/VH/VHK2-B/VHK2
Gene therapy prospects--intranasal delivery of therapeutic genes.
Podolska, Karolina; Stachurska, Anna; Hajdukiewicz, Karolina; Małecki, Maciej
2012-01-01
Gene therapy is recognized to be a novel method for the treatment of various disorders. Gene therapy strategies involve gene manipulation on broad biological processes responsible for the spreading of diseases. Cancer, monogenic diseases, vascular and infectious diseases are the main targets of gene therapy. In order to obtain valuable experimental and clinical results, sufficient gene transfer methods are required. Therapeutic genes can be administered into target tissues via gene carriers commonly defined as vectors. The retroviral, adenoviral and adeno-associated virus based vectors are most frequently used in the clinic. So far, gene preparations may be administered directly into target organs or by intravenous, intramuscular, intratumor or intranasal injections. It is common knowledge that the number of gene therapy clinical trials has rapidly increased. However, some limitations such as transfection efficiency and stable and long-term gene expression are still not resolved. Consequently, great effort is focused on the evaluation of new strategies of gene delivery. There are many expectations associated with intranasal delivery of gene preparations for the treatment of diseases. Intranasal delivery of therapeutic genes is regarded as one of the most promising forms of pulmonary gene therapy research. Gene therapy based on inhalation of gene preparations offers an alternative way for the treatment of patients suffering from such lung diseases as cystic fibrosis, alpha-1-antitrypsin defect, or cancer. Experimental and first clinical trials based on plasmid vectors or recombinant viruses have revealed that gene preparations can effectively deliver therapeutic or marker genes to the cells of the respiratory tract. The noninvasive intranasal delivery of gene preparations or conventional drugs seems to be very encouraging, although basic scientific research still has to continue.
Ommen, van Marouska; van Beilen, M; Cornelissen, F W; Smid, H.G.O.M.; Knegtering, H; Aleman, A; van Laar, T
Background. Little is known about visual hallucinations (VH) in psychosis. We investigated the prevalence and the role of bottom-up and top-down processing in VH. The prevailing view is that VH are probably related to altered top-down processing, rather than to distorted bottom-up processing.
Left-right functional asymmetry of ventral hippocampus depends on aversiveness of situations.
Sakaguchi, Yukitoshi; Sakurai, Yoshio
2017-05-15
Many studies suggest that animals exhibit lateralized behaviors during aversive situations, and almost all animals exhibit right hemisphere-dominant behaviors associated with fear or anxiety. However, which brain structure in each hemisphere underlies such lateralized function is unclear. In this study, we focused on the hippocampus and investigated the effects of bilateral and unilateral lesions of the ventral hippocampus (VH) on anxiety-like behavior using the successive alleys test. We also examined the expression of c-fos in the VH, which was induced by an aversive situation. Results revealed that consistent right VH dominance trended with the anxiety level. Weaker anxiety induced both right and left VH functions, whereas stronger anxiety induced right VH function. From these results, we conclude that animals are able to adaptively regulate their behaviors to avoid aversive stimuli by changing the functional dominance of their left and right VH. Copyright © 2017 Elsevier B.V. All rights reserved.
Genome organization and expression of the rat ACBP gene family
DEFF Research Database (Denmark)
Mandrup, S; Andreasen, P H; Knudsen, J
1993-01-01
pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...
Mississippi River Headwaters Lakes in Minnesota. Feasibility Study. Appendices.
1982-09-01
organisms by blanketing stream or lake bottoms, spawning beds, or other desirable bottom area. Suspended solids may kill fish and shellfish by causing...Tree S~rv Long-billed M~arsh Wren 0Ctlipping S;-arrcd Short-billed Marsh Wren N Clay-crod )rm: Mockingbird L. Field Sparrow Gray Catbird VH;;rris
Li, Xinxin; Deng, Zhiping; Liu, Zhanzhi; Yan, Yongliang; Wang, Tianshu; Xie, Jianbo; Lin, Min; Cheng, Qi; Chen, Sanfeng
2014-08-27
Most biological nitrogen fixation is catalyzed by the molybdenum nitrogenase. This enzyme is a complex which contains the MoFe protein encoded by nifDK and the Fe protein encoded by nifH. In addition to nifHDK, nifHDK-like genes were found in some Archaea and Firmicutes, but their function is unclear. We sequenced the genome of Paenibacillus sabinae T27. A total of 4,793 open reading frames were predicted from its 5.27 Mb genome. The genome of P. sabinae T27 contains fifteen nitrogen fixation (nif) genes, including three nifH, one nifD, one nifK, four nifB, two nifE, two nifN, one nifX and one nifV. Of the 15 nif genes, eight nif genes (nifB, nifH, nifD, nifK, nifE, nifN, nifX and nifV) and two non-nif genes (orf1 and hesA) form a complete nif gene cluster. In addition to the nif genes, there are nitrogenase-like genes, including two nifH-like genes and five pairs of nifDK-like genes. IS elements on the flanking regions of nif and nif-like genes imply that these genes might have been obtained by horizontal gene transfer. Phylogenies of the concatenated 8 nif gene (nifB, nifH, nifD, nifK, nifE, nifN, nifX and nifV) products suggest that P. sabinae T27 is closely related to Frankia. RT-PCR analysis showed that the complete nif gene cluster is organized as an operon. We demonstrated that the complete nif gene cluster under the control of σ70-dependent promoter enabled Escherichia coli JM109 to fix nitrogen. Also, here for the first time we demonstrated that unlike nif genes, the transcriptions of nifHDK-like genes were not regulated by ammonium and oxygen, and nifH-like or nifD-like gene could not restore the nitrogenase activity of Klebsiella pneumonia nifH- and nifD- mutant strains, respectively, suggesting that nifHDK-like genes were not involved in nitrogen fixation. Our data and analysis reveal the contents and distribution of nif and nif-like genes and contribute to the study of evolutionary history of nitrogen fixation in Paenibacillus. For the first time we
Brennan, K M; Crowdus, C A; Cantor, A H; Pescatore, A J; Barger, J L; Horgan, K; Xiao, R; Power, R F; Dawson, K A
2011-05-01
Selenium (Se) is an essential component of at least 25 selenoproteins involved in a multitude of physiological functions, including reproduction. However, relatively little is known about the mechanisms by which Se exerts its physiological effects in reproductive tissue. The objective of this study was to compare the effect of long-term inorganic Se (sodium selenite, SS) and organic yeast-derived Se (Sel-Plex(®), SP) supplementations on tissue Se content and gene expression patterns in the oviduct of broiler-breeder hens. Hens were randomly assigned at 6 weeks of age to one of the three treatments: basal semi-purified diet (control), basal diet+0.3 ppm Se as SP or basal diet+0.3 ppm Se as SS. At 49 weeks, oviduct tissue from hens randomly selected from each treatment (n=7) was analyzed for Se content and gene expression profiles using the Affymetrix Chicken genome array. Gene expression data were evaluated using GeneSpring GX 10.0 (Silicon Genetics, Redwood, CA) and Ingenuity Pathways Analysis software (Ingenuity Systems, Redwood City, CA). Oviduct Se concentration was greater with Se supplementation compared with the control (P≤0.05) but did not differ between SS- and SP-supplemented groups. Gene expression analysis revealed that the quantity of gene transcripts associated with energy production and protein translation were greater in the oviduct with SP but not SS supplementation. Targets up-regulated by SP, but not SS, included genes encoding several subunits of the mitochondrial respiratory complexes, ubiquinone production and ribosomal subunits. SS hens showed a decrease in transcripts of genes involved in respiratory complexes, ATP synthesis and protein translation and metabolism in oviduct relative to control hens. In this study, although tissue Se concentrations did not differ between hens fed SS- and SP-supplemented diets, expression patterns of genes involved in energy production and protein synthesis pathways differed between treatments. These
Process and genes for expression and overexpression of active [FeFe] hydrogenases
Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L
2014-09-16
A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.
Swanson, Lianna E; Yu, Marcus; Nelson, Kevin S; Laprise, Patrick; Tepass, Ulrich; Beitel, Greg J
2009-04-01
Insulin-like growth factors (IGFs) control cell and organism growth through evolutionarily conserved signaling pathways. The mammalian acid-labile subunit (ALS) is a secreted protein that complexes with IGFs to modulate their activity. Recent work has shown that a Drosophila homolog of ALS, dALS, can also complex with and modulate the activity of a Drosophila IGF. Here we report the first mutations in the gene encoding dALS. Unexpectedly, we find that these mutations are allelic to a previously described mutation in convoluted (conv), a gene required for epithelial morphogenesis. In conv mutants, the tubes of the Drosophila tracheal system become abnormally elongated without altering tracheal cell number. conv null mutations cause larval lethality, but do not disrupt several processes required for tracheal tube size control, including septate junction formation, deposition of a lumenal/apical extracellular matrix, and lumenal secretion of Vermiform and Serpentine, two putative matrix-modifying proteins. Clearance of lumenal matrix and subcellular localization of clathrin also appear normal in conv mutants. However, we show that Conv/dALS is required for the dynamic organization of the transient lumenal matrix and normal structure of the cuticle that lines the tracheal lumen. These and other data suggest that the Conv/dALS-dependent tube size control mechanism is distinct from other known processes involved in tracheal tube size regulation. Moreover, we present evidence indicating that Conv/dALS has a novel, IGF-signaling independent function in tracheal morphogenesis.
FunGene: the functional gene pipeline and repository.
Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R
2013-01-01
Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.
FunGene: the Functional Gene Pipeline and Repository
Directory of Open Access Journals (Sweden)
Jordan A. Fish
2013-10-01
Full Text Available Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer.While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/ offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.
Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae
Directory of Open Access Journals (Sweden)
Larisa Gunderina
2015-05-01
Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.
Raherison, Elie S M; Giguère, Isabelle; Caron, Sébastien; Lamara, Mebarek; MacKay, John J
2015-07-01
Transcript profiling has shown the molecular bases of several biological processes in plants but few studies have developed an understanding of overall transcriptome variation. We investigated transcriptome structure in white spruce (Picea glauca), aiming to delineate its modular organization and associated functional and evolutionary attributes. Microarray analyses were used to: identify and functionally characterize groups of co-expressed genes; investigate expressional and functional diversity of vascular tissue preferential genes which were conserved among Picea species, and identify expression networks underlying wood formation. We classified 22 857 genes as variable (79%; 22 coexpression groups) or invariant (21%) by profiling across several vegetative tissues. Modular organization and complex transcriptome restructuring among vascular tissue preferential genes was revealed by their assignment to coexpression groups with partially overlapping profiles and partially distinct functions. Integrated analyses of tissue-based and temporally variable profiles identified secondary xylem gene networks, showed their remodelling over a growing season and identified PgNAC-7 (no apical meristerm (NAM), Arabidopsis transcription activation factor (ATAF) and cup-shaped cotyledon (CUC) transcription factor 007 in Picea glauca) as a major hub gene specific to earlywood formation. Reference profiling identified comprehensive, statistically robust coexpressed groups, revealing that modular organization underpins the evolutionary conservation of the transcriptome structure. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Robinson, Gene E.; Fernald, Russell D.; Clayton, David F.
2008-01-01
What specific genes and regulatory sequences contribute to the organization and functioning of brain circuits that support social behavior? How does social experience interact with information in the genome to modulate these brain circuits? Here we address these questions by highlighting progress that has been made in identifying and understanding two key “vectors of influence” that link genes, brain, and social behavior: 1) social information alters gene readout in the brain to influence beh...
Non-functional genes repaired at the RNA level.
Burger, Gertraud
2016-01-01
Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Ferrell, Georgia; Lu, Minyan; Stoddard, Paul; Sammel, Mary D; Romero, Roberto; Strauss, Jerome F; Matthews, Catherine A
2009-05-01
Pelvic organ prolapse and preterm premature rupture of membranes, the 2 conditions which have in common weakening of the tensile strength of tissues, are thought to be caused, in part, by abnormal extracellular matrix synthesis and/or catabolism. We identified a new single nucleotide polymorphism (NT_010194(LOXL1):g.45008784A>C) in the promoter of the LOXL1 gene, which is essential for elastin synthesis. Promoter studies showed that the minor "C'' allele had significantly greater activity than the major "A'' allele. Case-control studies examined the association of the alleles of this single nucleotide polymorphism with pelvic organ prolapse and preterm premature rupture of membranes. When comparing allele frequencies and genotypes in pelvic organ prolapse cases versus controls, no significant associations were found. A case-control study conducted in African American neonates also found no significant associations between the promoter alleles and preterm premature rupture of membranes. We conclude that a functional single nucleotide polymorphism exists in the promoter region of the LOXL1 gene. Association studies suggest that the promoter single nucleotide polymorphism does not contribute significantly to risk of pelvic organ prolapse or preterm premature rupture of membranes.
Directory of Open Access Journals (Sweden)
Benjamin Mayne
2016-10-01
Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.
Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas
2016-05-01
Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK2...20Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK285 (Link to dictyBase) - - - - - (Link to Original site) VHK2...85F 531 - - - - - - Show VHK285 Library VH (Link to library) Clone ID VHK285 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK2...85Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...85 (VHK285Q) /CSM/VH/VHK2-D/VHK285Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA
Tsunashima, Hiroyuki; Miyake, Katsuhide; Motono, Makoto; Iijima, Shinji
2012-03-01
The capsular polysaccharide (CPS) of the important oral streptococcus Streptococcus anginosus, which causes endocarditis, and the genes for its synthesis have not been clarified. In this study, we investigated the gene locus required for CPS synthesis in S. anginosus. Southern hybridization using the cpsE gene of the well-characterized bacterium S. agalactiae revealed that there is a similar gene in the genome of S. anginosus. By using the colony hybridization technique and inverse PCR, we isolated the CPS synthesis (cps) genes of S. anginosus. This gene cluster consisted of genes containing typical regulatory genes, cpsA-D, and glycosyltransferase genes coding for glucose, rhamnose, N-acetylgalactosamine, and galactofuranose transferases. Furthermore, we confirmed that the cps locus is required for CPS synthesis using a mutant strain with a defective cpsE gene. The cps cluster was found to be located downstream the nrdG gene, which encodes ribonucleoside triphosphate reductase activator, as is the case in other oral streptococci such as S. gordonii and S. sanguinis. However, the location of the gene cluster was different from those of S. pneumonia and S. agalactiae. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
A gene regulatory network controlling hhex transcription in the anterior endoderm of the organizer
Rankin, Scott A.; Kormish, Jay; Kofron, Matt; Jegga, Anil; Zorn, Aaron M.
2011-01-01
The homeobox gene hhex is one of the earliest markers of the anterior endoderm, which gives rise to foregut organs such as the liver, ventral pancreas, thyroid, and lungs. The regulatory networks controlling hhex transcription are poorly understood. In an extensive cis-regulatory analysis of the Xenopus hhex promoter we determined how the Nodal, Wnt, and BMP pathways and their downstream transcription factors regulate hhex expression in the gastrula organizer. We show that Nodal signaling, present throughout the endoderm, directly activates hhex transcription via FoxH1/Smad2 binding sites in the proximal −0.44 Kb promoter. This positive action of Nodal is suppressed in the ventral-posterior endoderm by Vent 1 and Vent2, homeodomain repressors that are induced by BMP signaling. Maternal Wnt/β-catenin on the dorsal side of the embryo cooperates with Nodal and indirectly activate hhex expression via the homeodomain activators Siamois and Twin. Siamois/Twin stimulate hhex transcription through two mechanisms: 1) They induce the expression of Otx2 and Lim1 and together Siamois, Twin, Otx2 and Lim1 appear to promote hhex transcription through homeobox sites in a Wnt-responsive element located between −0.65 to −0.55 Kb of the hhex promoter. 2) Siamois/Twin also induce the expression of the BMP-antagonists Chordin and Noggin, which are required to exclude Vents from the organizer allowing hhex transcription. This work reveals a complex network regulating anterior endoderm transcription in the early embryo. PMID:21215263
Human gene therapy: novel approaches to improve the current gene delivery systems.
Cucchiarini, Magali
2016-06-01
Even though gene therapy made its way through the clinics to treat a number of human pathologies since the early years of experimental research and despite the recent approval of the first gene-based product (Glybera) in Europe, the safe and effective use of gene transfer vectors remains a challenge in human gene therapy due to the existence of barriers in the host organism. While work is under active investigation to improve the gene transfer systems themselves, the use of controlled release approaches may offer alternative, convenient tools of vector delivery to achieve a performant gene transfer in vivo while overcoming the various physiological barriers that preclude its wide use in patients. This article provides an overview of the most significant contributions showing how the principles of controlled release strategies may be adapted for human gene therapy.
DEFF Research Database (Denmark)
Elsafadi, E; Manikandan, M; Dawud, R. A.
2016-01-01
Regenerative medicine is a novel approach for treating conditions in which enhanced bone regeneration is required. We identified transgelin (TAGLN), a transforming growth factor beta (TGFβ)-inducible gene, as an upregulated gene during in vitro osteoblastic and adipocytic differentiation of human......MSC by regulating cytoskeleton organization. Targeting TAGLN is a plausible approach to enrich for committed hMSC cells needed for regenerative medicine application....... bone marrow-derived stromal (skeletal) stem cells (hMSC). siRNA-mediated gene silencing of TAGLN impaired lineage differentiation into osteoblasts and adipocytes but enhanced cell proliferation. Additional functional studies revealed that TAGLN deficiency impaired hMSC cell motility and in vitro...... transwell cell migration. On the other hand, TAGLN overexpression reduced hMSC cell proliferation, but enhanced cell migration, osteoblastic and adipocytic differentiation, and in vivo bone formation. In addition, deficiency or overexpression of TAGLN in hMSC was associated with significant changes...
Why is the correlation between gene importance and gene evolutionary rate so weak?
Wang, Zhi; Zhang, Jianzhi
2009-01-01
One of the few commonly believed principles of molecular evolution is that functionally more important genes (or DNA sequences) evolve more slowly than less important ones. This principle is widely used by molecular biologists in daily practice. However, recent genomic analysis of a diverse array of organisms found only weak, negative correlations between the evolutionary rate of a gene and its functional importance, typically measured under a single benign lab condition. A frequently suggested cause of the above finding is that gene importance determined in the lab differs from that in an organism's natural environment. Here, we test this hypothesis in yeast using gene importance values experimentally determined in 418 lab conditions or computationally predicted for 10,000 nutritional conditions. In no single condition or combination of conditions did we find a much stronger negative correlation, which is explainable by our subsequent finding that always-essential (enzyme) genes do not evolve significantly more slowly than sometimes-essential or always-nonessential ones. Furthermore, we verified that functional density, approximated by the fraction of amino acid sites within protein domains, is uncorrelated with gene importance. Thus, neither the lab-nature mismatch nor a potentially biased among-gene distribution of functional density explains the observed weakness of the correlation between gene importance and evolutionary rate. We conclude that the weakness is factual, rather than artifactual. In addition to being weakened by population genetic reasons, the correlation is likely to have been further weakened by the presence of multiple nontrivial rate determinants that are independent from gene importance. These findings notwithstanding, we show that the principle of slower evolution of more important genes does have some predictive power when genes with vastly different evolutionary rates are compared, explaining why the principle can be practically useful
Banisadr, Arsham; Safdari, Yaghoub; Kianmehr, Anvarsadat; Pourafshar, Mahdieh
2018-04-03
The aim of this study was to produce a humanized single chain antibody (scFv) as a potential improved product design to target EGFR (Epidermal Growth Factor Receptor) overexpressing cancer cells. To this end, CDR loops of cetuximab (an FDA-approved anti-EGFR antibody) were grafted on framework regions derived from type 3 (VH3 and VL3 kappa) human germline sequences to obtain recombinant VH and VL domainslinked together with a flexible linker [(Gly 4 Ser) 3 ] to form a scFv. Codon optimized synthetic gene encoding the scFv (with NH2-VH-linker-VL-COOH orientation) was expressed in E. coli Origami™ 2(DE3) cells and the resultant scFv purified by using Ni-NTA affinity chromatography. The scFv, called cet.Hum scFv, was evaluated in ELISA and immunoblot to determine whether it can recognize EGFR. The scFv was able to recognize EGFR over-expressing cancer cells (A-431) but failed to detect cancer cells with low levels of EGFR (MCF-7 cells). Although the affinity of the scFv forA-431 cells was 9 fold lower than that of cetuximab, it was strong enough to recognize these cells. Considering its ability to bind EGFR molecules, the scFv may exhibit a potential application for the detection of EGFR-overexpressing cancer cells.
Zhao, Peng; Wang, Dongdong; Wang, Ruoqiu; Kong, Nana; Zhang, Chao; Yang, Chenghui; Wu, Wentao; Ma, Haoli; Chen, Qin
2018-01-18
Heat shock proteins (Hsps) are essential components in plant tolerance mechanism under various abiotic stresses. Hsp20 is the major family of heat shock proteins, but little of Hsp20 family is known in potato (Solanum tuberosum), which is an important vegetable crop that is thermosensitive. To reveal the mechanisms of potato Hsp20s coping with abiotic stresses, analyses of the potato Hsp20 gene family were conducted using bioinformatics-based methods. In total, 48 putative potato Hsp20 genes (StHsp20s) were identified and named according to their chromosomal locations. A sequence analysis revealed that most StHsp20 genes (89.6%) possessed no, or only one, intron. A phylogenetic analysis indicated that all of the StHsp20 genes, except 10, were grouped into 12 subfamilies. The 48 StHsp20 genes were randomly distributed on 12 chromosomes. Nineteen tandem duplicated StHsp20s and one pair of segmental duplicated genes (StHsp20-15 and StHsp20-48) were identified. A cis-element analysis inferred that StHsp20s, except for StHsp20-41, possessed at least one stress response cis-element. A heatmap of the StHsp20 gene family showed that the genes, except for StHsp20-2 and StHsp20-45, were expressed in various tissues and organs. Real-time quantitative PCR was used to detect the expression level of StHsp20 genes and demonstrated that the genes responded to multiple abiotic stresses, such as heat, salt or drought stress. The relative expression levels of 14 StHsp20 genes (StHsp20-4, 6, 7, 9, 20, 21, 33, 34, 35, 37, 41, 43, 44 and 46) were significantly up-regulated (more than 100-fold) under heat stress. These results provide valuable information for clarifying the evolutionary relationship of the StHsp20 family and in aiding functional characterization of StHsp20 genes in further research.
Sesti, Francesco; Cosi, Veronica; Calonzi, Francesca; Ruggeri, Velia; Pietropolli, Adalgisa; Di Francesco, Lucia; Piccione, Emilio
2014-09-01
To compare the operative data and early postoperative outcomes of total laparoscopic hysterectomy (TLH), laparoscopically assisted vaginal hysterectomy (LAVH) and vaginal hysterectomy (VH). One hundred and eight women requiring hysterectomy for enlarged myomatous uterus were randomly allocated into three treatment arms: TLH (n = 36); LAVH (n = 36); VH (n = 36). Randomization procedure was based on a computer-generated list. The primary outcome was the discharge time comparison. The secondary outcomes were operating time, blood loss, paralytic ileus time, intraoperative complications, postoperative pain, and early postoperative complications. The mean discharge time was shorter after VH than after LAVH and TLH (P = 0.001). Operating time significantly influenced the discharge time, considered as a dependent variable in general linear model analysis (P = 0.006). In contrast, blood loss did not influence the discharge time (P = 0.55).The mean operating time was significantly shorter in VH than in TLH and LAVH groups (P = 0.000).The intraoperative blood loss was greater during LAVH than during TLH and VH (P = 0.000).Paralytic ileus time was shorter after VH than after TLH and LAVH (P = 0.000). No intraoperative complications or conversion to laparotomy occurred. VH was the faster operative technique with smaller blood loss and shorter discharge time compared with the others two techniques. So, VH should be considered the preferred approach in patients with enlarged myomatous uteri. When VH is not feasible or salpingo-oophorectomy is required, LAVH or TLH should be considered as valid alternatives. It is necessary to continue prospective comparative studies between the various surgical options to identify the best approach for hysterectomy in each single woman.
Wang, Gong-Wu; Liu, Jian; Wang, Xiao-Qin
2017-01-01
The ventral hippocampus (VH) and the basolateral amygdala (BLA) are both crucial in inhibitory avoidance (IA) memory. However, the exact role of the VH-BLA circuit in IA memory consolidation is unclear. This study investigated the effect of post-training reversible disconnection of the VH-BLA circuit in IA memory consolidation. Male Wistar rats…
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-03-01
By utilizing the phenomenon that the antigen induces association of VH and VL, which are the antigen-recognizing fragments of antibody, develop a novel rapid immunoassay technology which will eliminate the defects of conventional immunoassays, such as long measuring time and requirement of expensive large automated apparatus. In addition, develop a methodology to make Fvs with low VH-VL affinity but that associate tightly in the presence of antigen. Using a model anti-hen egg lysozyme antibody HyHEL-10 Fv and BlAcore, we have clarified the kinetic basis of the Fv stabilization by HEL. By labeling HyHEL-10 VH, VL with succinimide esters of fluorescein and tetramethylrhodamin, respectively, at their N-termini, we could successfully detect VH-VL association by the increment of fluorescence resonance energy transfer. As a result, 1 {mu} g/ml of antigen could be detected homogeneously in less than 5 minutes. Some VH-VL association measurement systems were made by utilizing M13 phage display of VH fragments of HyHEL-10, anti-nitrophenacetyl, anti-digoxin antibodies. (NEDO)
Cumbie, Jason S; Kimbrel, Jeffrey A; Di, Yanming; Schafer, Daniel W; Wilhelm, Larry J; Fox, Samuel E; Sullivan, Christopher M; Curzon, Aron D; Carrington, James C; Mockler, Todd C; Chang, Jeff H
2011-01-01
GENE-counter is a complete Perl-based computational pipeline for analyzing RNA-Sequencing (RNA-Seq) data for differential gene expression. In addition to its use in studying transcriptomes of eukaryotic model organisms, GENE-counter is applicable for prokaryotes and non-model organisms without an available genome reference sequence. For alignments, GENE-counter is configured for CASHX, Bowtie, and BWA, but an end user can use any Sequence Alignment/Map (SAM)-compliant program of preference. To analyze data for differential gene expression, GENE-counter can be run with any one of three statistics packages that are based on variations of the negative binomial distribution. The default method is a new and simple statistical test we developed based on an over-parameterized version of the negative binomial distribution. GENE-counter also includes three different methods for assessing differentially expressed features for enriched gene ontology (GO) terms. Results are transparent and data are systematically stored in a MySQL relational database to facilitate additional analyses as well as quality assessment. We used next generation sequencing to generate a small-scale RNA-Seq dataset derived from the heavily studied defense response of Arabidopsis thaliana and used GENE-counter to process the data. Collectively, the support from analysis of microarrays as well as the observed and substantial overlap in results from each of the three statistics packages demonstrates that GENE-counter is well suited for handling the unique characteristics of small sample sizes and high variability in gene counts.
Directory of Open Access Journals (Sweden)
Jason S Cumbie
Full Text Available GENE-counter is a complete Perl-based computational pipeline for analyzing RNA-Sequencing (RNA-Seq data for differential gene expression. In addition to its use in studying transcriptomes of eukaryotic model organisms, GENE-counter is applicable for prokaryotes and non-model organisms without an available genome reference sequence. For alignments, GENE-counter is configured for CASHX, Bowtie, and BWA, but an end user can use any Sequence Alignment/Map (SAM-compliant program of preference. To analyze data for differential gene expression, GENE-counter can be run with any one of three statistics packages that are based on variations of the negative binomial distribution. The default method is a new and simple statistical test we developed based on an over-parameterized version of the negative binomial distribution. GENE-counter also includes three different methods for assessing differentially expressed features for enriched gene ontology (GO terms. Results are transparent and data are systematically stored in a MySQL relational database to facilitate additional analyses as well as quality assessment. We used next generation sequencing to generate a small-scale RNA-Seq dataset derived from the heavily studied defense response of Arabidopsis thaliana and used GENE-counter to process the data. Collectively, the support from analysis of microarrays as well as the observed and substantial overlap in results from each of the three statistics packages demonstrates that GENE-counter is well suited for handling the unique characteristics of small sample sizes and high variability in gene counts.
Directory of Open Access Journals (Sweden)
van Hijum Sacha AFT
2008-10-01
Full Text Available Abstract Background Despite a plethora of functional genomic efforts, the function of many genes in sequenced genomes remains unknown. The increasing amount of microarray data for many species allows employing the guilt-by-association principle to predict function on a large scale: genes exhibiting similar expression patterns are more likely to participate in shared biological processes. Results We developed Prosecutor, an application that enables researchers to rapidly infer gene function based on available gene expression data and functional annotations. Our parameter-free functional prediction method uses a sensitive algorithm to achieve a high association rate of linking genes with unknown function to annotated genes. Furthermore, Prosecutor utilizes additional biological information such as genomic context and known regulatory mechanisms that are specific for prokaryotes. We analyzed publicly available transcriptome data sets and used literature sources to validate putative functions suggested by Prosecutor. We supply the complete results of our analysis for 11 prokaryotic organisms on a dedicated website. Conclusion The Prosecutor software and supplementary datasets available at http://www.prosecutor.nl allow researchers working on any of the analyzed organisms to quickly identify the putative functions of their genes of interest. A de novo analysis allows new organisms to be studied.
A comparative gene expression database for invertebrates
Directory of Open Access Journals (Sweden)
Ormestad Mattias
2011-08-01
Full Text Available Abstract Background As whole genome and transcriptome sequencing gets cheaper and faster, a great number of 'exotic' animal models are emerging, rapidly adding valuable data to the ever-expanding Evo-Devo field. All these new organisms serve as a fantastic resource for the research community, but the sheer amount of data, some published, some not, makes detailed comparison of gene expression patterns very difficult to summarize - a problem sometimes even noticeable within a single lab. The need to merge existing data with new information in an organized manner that is publicly available to the research community is now more necessary than ever. Description In order to offer a homogenous way of storing and handling gene expression patterns from a variety of organisms, we have developed the first web-based comparative gene expression database for invertebrates that allows species-specific as well as cross-species gene expression comparisons. The database can be queried by gene name, developmental stage and/or expression domains. Conclusions This database provides a unique tool for the Evo-Devo research community that allows the retrieval, analysis and comparison of gene expression patterns within or among species. In addition, this database enables a quick identification of putative syn-expression groups that can be used to initiate, among other things, gene regulatory network (GRN projects.
Patterns of evolutionary conservation of essential genes correlate with their compensability.
Directory of Open Access Journals (Sweden)
Tobias Bergmiller
2012-06-01
Full Text Available Essential genes code for fundamental cellular functions required for the viability of an organism. For this reason, essential genes are often highly conserved across organisms. However, this is not always the case: orthologues of genes that are essential in one organism are sometimes not essential in other organisms or are absent from their genomes. This suggests that, in the course of evolution, essential genes can be rendered nonessential. How can a gene become non-essential? Here we used genetic manipulation to deplete the products of 26 different essential genes in Escherichia coli. This depletion results in a lethal phenotype, which could often be rescued by the overexpression of a non-homologous, non-essential gene, most likely through replacement of the essential function. We also show that, in a smaller number of cases, the essential genes can be fully deleted from the genome, suggesting that complete functional replacement is possible. Finally, we show that essential genes whose function can be replaced in the laboratory are more likely to be non-essential or not present in other taxa. These results are consistent with the notion that patterns of evolutionary conservation of essential genes are influenced by their compensability-that is, by how easily they can be functionally replaced, for example through increased expression of other genes.
CSIR Research Space (South Africa)
Fossey, A
2009-06-01
Full Text Available in forestry breeding. Keywords Gene regulation; chromatin; histone code hyporthesis; RNA silencing; post transcriptional gene silencing; forestry. Introduction to epigenetic phenomena Most living organisms share a vast amount of genetic information... (Rapp and Wendel, 2005). Epigenetic phenomena pervade all aspects of cell proliferation and plant development and are often in conflict with Mendelian models of genetics (Grant-Downton and Dickinson, 2005). A key element in many epigenetic effects...
Peyer, Suzanne M; Heath-Heckman, Elizabeth A C; McFall-Ngai, Margaret J
2017-11-01
The protein Crumbs is a determinant of apical-basal cell polarity and plays a role in apoptosis of epithelial cells and their protection against photodamage. Using the squid-vibrio system, a model for development of symbiotic partnerships, we examined the modulation of the crumbs gene in host epithelial tissues during initiation and maintenance of the association. The extracellular luminous symbiont Vibrio fischeri colonizes the apical surfaces of polarized epithelia in deep crypts of the Euprymna scolopes light organ. During initial colonization each generation, symbiont harvesting is potentiated by the biochemical and biophysical activity of superficial ciliated epithelia, which are several cell layers from the crypt epithelia where the symbionts reside. Within hours of crypt colonization, the symbionts induce the cell death mediated regression of the remote superficial ciliated fields. However, the crypt cells directly interacting with the symbiont are protected from death. In the squid host, we characterized the gene and encoded protein during light organ morphogenesis and in response to symbiosis. Features of the protein sequence and structure, phylogenetic relationships, and localization patterns in the eye supported assignment of the squid protein to the Crumbs family. In situ hybridization revealed that the crumbs transcript shows opposite expression at the onset of symbiosis in the two different regions of the light organ: elevated levels in the superficial epithelia were attenuated whereas low levels in the crypt epithelia were turned up. Although a rhythmic association in which the host controls the symbiont population over the day-night cycle begins in the juvenile upon colonization, cycling of crumbs was evident only in the adult organ with peak expression coincident with maximum symbiont population and luminescence. Our results provide evidence that crumbs responds to symbiont cues that induce developmental apoptosis and to symbiont population
Cortright, Catherine C; Center, Sharon A; Randolph, John F; McDonough, Sean P; Fecteau, Kellie A; Warner, Karen L; Chiapella, Ann M; Pierce, Rhonda L; Graham, A Heather; Wall, Linda J; Heidgerd, John H; Degen, Melisa A; Lucia, Patricia A; Erb, Hollis N
2014-10-01
To characterize signalment, clinical features, clinicopathologic variables, hepatic ultrasonographic characteristics, endocrinologic profiles, treatment response, and age at death of Scottish Terriers with progressive vacuolar hepatopathy (VH) with or without hepatocellular carcinoma (HCC). Retrospective case series. 114 Scottish Terriers with progressive VH. Electronic databases from 1980 to 2013 were searched for adult (age > 1 year) Scottish Terriers with histopathologic diagnoses of diffuse glycogen-like VH. Available sections of liver specimens were histologically reevaluated to confirm diffuse VH with or without HCC; 8 dogs with HCC only had neoplastic tissue available. Physical examination, clinicopathologic, treatment, and survival data were obtained. 39 of 114 (34%) dogs with VH had HCC detected at surgery or necropsy or by abdominal ultrasonography. Histologic findings indicated that HCC was seemingly preceded by dysplastic hepatocellular foci. No significant differences were found in clinicopathologic variables or age at death between VH-affected dogs with or without HCC. Fifteen of 26 (58%) dogs with high hepatic copper concentrations had histologic features consistent with copper-associated hepatopathy. Although signs consistent with hyperadrenocorticism were observed in 40% (46/114) of dogs, definitive diagnosis was inconsistently confirmed. Assessment of adrenal sex hormone concentrations before and after ACTH administration identified high progesterone and androstenedione concentrations in 88% (22/25) and 80% (20/25) of tested dogs, respectively. Results suggested that VH in Scottish Terriers may be linked to adrenal steroidogenesis and a predisposition to HCC. In dogs with VH, frequent serum biochemical analysis and ultrasonographic surveillance for early tumor detection are recommended.
Directory of Open Access Journals (Sweden)
Emre Sinan Güngör
2017-09-01
Full Text Available Aim: To evaluate and compare the results and complications of tension-free vaginal tape (TVT when performed alone or with vaginal hysterectomy (VH and to evaluate the mid-term success rates of TVT for both groups. Methods: A retrospective study was performed on 179 patients who had TVT alone for stress urinary incontinance (SUI or TVT with VH for SUI and vaginal prolapse. Demographic, outcome and complication data were obtained from medical records. The main outcome measures were postoperative SUI and voiding dysfunction. Results: The mean age of the patients who underwent TVT and TVT+VH were 50.2±6.8 and 52.2±8.1, respectively (p>0.05 and the mean parity was 4±2.07 and 4.15±2.02, respectively (p>0.05. The success rate was significantly higher in TVT alone group than in TVT+VH group (93.6% vs. 84.5%, p0.05. Overall complication rate was higher in TVT+VH group (4.2% vs. 9.5%, p<0.05. Postoperative residuel urine volumes were significantly higher than preoperative residuel urine volumes in both groups (p=0.001. Due to mesh rejection, second surgery was performed in one patient from both groups to reomove the mesh. Conclusion: Midterm success rates were significantly higher in TVT group than in TVT+VH group, but success rates in TVT+VH were acceptable. Overall complication rates were higher in TVT+VH group; requirement for a second surgery was similar for both groups.
Essential Bacillus subtilis genes
DEFF Research Database (Denmark)
Kobayashi, K.; Ehrlich, S.D.; Albertini, A.
2003-01-01
To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximate to4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were...... predicted to be essential. The vast majority of essential genes were categorized in relatively few domains of cell metabolism, with about half involved in information processing, one-fifth involved in the synthesis of cell envelope and the determination of cell shape and division, and one-tenth related...... to cell energetics. Only 4% of essential genes encode unknown functions. Most essential genes are present throughout a wide range of Bacteria, and almost 70% can also be found in Archaea and Eucarya. However, essential genes related to cell envelope, shape, division, and respiration tend to be lost from...
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK273 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...73F 620 - - - - - - Show VHK273 Library VH (Link to library) Clone ID VHK273 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK273Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK273 (VHK273Q) /CSM/VH/VHK2-D/VHK273Q.Seq.d/ AACTCTCGAGTGCAAAA...27874 ) Dictyostelium discoideum cDNA clone:ddv63k23, 5' ... 1170 0.0 1 ( BJ42787
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK256 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...56F 620 - - - - - - Show VHK256 Library VH (Link to library) Clone ID VHK256 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-C/VHK256Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK256 (VHK256Q) /CSM/VH/VHK2-C/VHK256Q.Seq.d/ AACTCTCGAGTGCAAAA...27874 ) Dictyostelium discoideum cDNA clone:ddv63k23, 5' ... 1170 0.0 1 ( BJ42787
1987-09-01
and Sponheuer, W. 1969. Scale of Seismic Intensity: Proc. Fourth World Conf. on Earthquake Engineering, Santiago, Chile . Murphy, J. R., and O’Brien, L...Predom V/H el, V/I Vel V/H Displ V/H sec VIH Period Period Predom Accel cm/sec Vel cm Disp .05 Dur sec sec Period S11 2 0.48 MODIFIED MERCALLI INTENSITY...0.1 0. 0.16 142.20 Long. Vert Hor Vert Ratio Ratio Vert Ratio Vert r io Du r atio Predom Predom VIH Acce V/H Vel V /H Dspi V H sec 1, H Period Period
Problem-Solving Test: Targeted Gene Disruption
Szeberenyi, Jozsef
2008-01-01
Mutational inactivation of a specific gene is the most powerful technique to analyze the biological function of the gene. This approach has been used for a long time in viruses, bacteria, yeast, and fruit fly, but looked quite hopeless in more complex organisms. Targeted inactivation of specific genes (also known as knock-out mutation) in mice is…
Rice sHsp genes: genomic organization and expression profiling under stress and development
Directory of Open Access Journals (Sweden)
Grover Anil
2009-08-01
Full Text Available Abstract Background Heat shock proteins (Hsps constitute an important component in the heat shock response of all living systems. Among the various plant Hsps (i.e. Hsp100, Hsp90, Hsp70 and Hsp20, Hsp20 or small Hsps (sHsps are expressed in maximal amounts under high temperature stress. The characteristic feature of the sHsps is the presence of α-crystallin domain (ACD at the C-terminus. sHsps cooperate with Hsp100/Hsp70 and co-chaperones in ATP-dependent manner in preventing aggregation of cellular proteins and in their subsequent refolding. Database search was performed to investigate the sHsp gene family across rice genome sequence followed by comprehensive expression analysis of these genes. Results We identified 40 α-crystallin domain containing genes in rice. Phylogenetic analysis showed that 23 out of these 40 genes constitute sHsps. The additional 17 genes containing ACD clustered with Acd proteins of Arabidopsis. Detailed scrutiny of 23 sHsp sequences enabled us to categorize these proteins in a revised scheme of classification constituting of 16 cytoplasmic/nuclear, 2 ER, 3 mitochondrial, 1 plastid and 1 peroxisomal genes. In the new classification proposed herein nucleo-cytoplasmic class of sHsps with 9 subfamilies is more complex in rice than in Arabidopsis. Strikingly, 17 of 23 rice sHsp genes were noted to be intronless. Expression analysis based on microarray and RT-PCR showed that 19 sHsp genes were upregulated by high temperature stress. Besides heat stress, expression of sHsp genes was up or downregulated by other abiotic and biotic stresses. In addition to stress regulation, various sHsp genes were differentially upregulated at different developmental stages of the rice plant. Majority of sHsp genes were expressed in seed. Conclusion We identified twenty three sHsp genes and seventeen Acd genes in rice. Three nucleocytoplasmic sHsp genes were found only in monocots. Analysis of expression profiling of sHsp genes revealed
Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili
2017-01-01
CD20-based targeting of B-cells in hematologic malignancies and autoimmune disorders is associated with outstanding clinical outcomes. Isolation and characterization of VH and VL cDNAs encoding the variable regions of the heavy and light chains of monoclonal antibodies (MAb) is necessary to produce next generation MAbs and their derivatives such as bispecific antibodies (bsAb) and single-chain variable fragments (scFv). This study was aimed at cloning and characterization of the VH and VL cDNAs from a hybridoma cell line producing an anti-CD20 MAb. VH and VL fragments were amplified, cloned and characterized. Furthermore, amino acid sequences of VH, VL and corresponding complementarity-determining regions (CDR) were determined and compared with those of four approved MAbs including Rituximab (RTX), Ibritumomab tiuxetan, Ofatumumab and GA101. The cloned VH and VL cDNAs were found to be functional and follow a consensus pattern. Amino acid sequences corresponding to the VH and VL fragments also indicated noticeable homologies to those of RTX and Ibritumomab. Furthermore, amino acid sequences of the relating CDRs had remarkable similarities to their counterparts in RTX and Ibritumomab. Successful recovery of VH and VL fragments encourages the development of novel CD20 targeting bsAbs, scFvs, antibody conjugates and T-cells armed with chimeric antigen receptors.
Algara, Patricia; Mateo, Marisol S; Sanchez-Beato, Margarita; Mollejo, Manuela; Navas, Immaculada C; Romero, Lourdes; Solé, Francesc; Salido, Marta; Florensa, Lourdes; Martínez, Pedro; Campo, Elias; Piris, Miguel A
2002-02-15
This study aimed to correlate the frequency of somatic mutations in the IgV(H) gene and the use of specific segments in the V(H) repertoire with the clinical and characteristic features of a series of 35 cases of splenic marginal zone lymphoma (SMZL). The cases were studied by seminested polymerase chain reaction by using primers from the FR1 and J(H) region. The results showed unexpected molecular heterogeneity in this entity, with 49% unmutated cases (less than 2% somatic mutations). The 7q31 deletions and a shorter overall survival were more frequent in this group. Additionally a high percentage (18 of 40 sequences) of SMZL cases showed usage of the V(H)1-2 segment, thereby emphasizing the singularity of this neoplasia, suggesting that this tumor derives from a highly selected B-cell population and encouraging the search for specific antigens that are pathogenically relevant in the genesis or progression of this tumor.
Directory of Open Access Journals (Sweden)
Inés Beperet
Full Text Available A recombinant virus lacking the sf32 gene (Sf32null, unique to the Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV, was generated by homologous recombination from a bacmid comprising the complete viral genome (Sfbac. Transcriptional analysis revealed that sf32 is an early gene. Occlusion bodies (OBs of Sf32null contained 62% more genomic DNA than viruses containing the sf32 gene, Sfbac and Sf32null-repair, although Sf32null DNA was three-fold less infective when injected in vivo. Sf32null OBs were 18% larger in diameter and contained 17% more nucleocapsids within ODVs than those of Sfbac. No significant differences were detected in OB pathogenicity (50% lethal concentration, speed-of-kill or budded virus production in vivo. In contrast, the production of OBs/larva was reduced by 39% in insects infected by Sf32null compared to those infected by Sfbac. The SF32 predicted protein sequence showed homology (25% identity, 44% similarity to two adhesion proteins from Streptococcus pyogenes and a single N-mirystoylation site was predicted. We conclude that SF32 is a non-essential protein that could be involved in nucleocapsid organization during ODV assembly and occlusion, resulting in increased numbers of nucleocapsids within ODVs.
Expression and clinical significance of Pax6 gene in retinoblastoma
Directory of Open Access Journals (Sweden)
Hai-Dong Huang
2013-07-01
Full Text Available AIM: To discuss the expression and clinical significance of Pax6 gene in retinoblastoma(Rb. METHODS: Totally 15 cases of fresh Rb organizations were selected as observation group and 15 normal retinal organizations as control group. Western-Blot and reverse transcriptase polymerase chain reaction(RT-PCRmethods were used to detect Pax6 protein and Pax6 mRNA expressions of the normal retina organizations and Rb organizations. At the same time, Western Blot method was used to detect the Pax6 gene downstream MATH5 and BRN3b differentiation gene protein level expression. After the comparison between two groups, the expression and clinical significance of Pax6 gene in Rb were discussed. RESULTS: In the observation group, average value of mRNA expression of Pax6 gene was 0.99±0.03; average value of Pax6 gene protein expression was 2.07±0.15; average value of BRN3b protein expression was 0.195±0.016; average value of MATH5 protein expression was 0.190±0.031. They were significantly higher than the control group, and the differences were statistically significant(PCONCLUSION: Abnormal expression of Pax6 gene is likely to accelerate the occurrence of Rb.
Horizontal gene transfer between bacteria.
Heuer, Holger; Smalla, Kornelia
2007-01-01
Horizontal gene transfer (HGT) refers to the acquisition of foreign genes by organisms. The occurrence of HGT among bacteria in the environment is assumed to have implications in the risk assessment of genetically modified bacteria which are released into the environment. First, introduced genetic sequences from a genetically modified bacterium could be transferred to indigenous micro-organisms and alter their genome and subsequently their ecological niche. Second, the genetically modified bacterium released into the environment might capture mobile genetic elements (MGE) from indigenous micro-organisms which could extend its ecological potential. Thus, for a risk assessment it is important to understand the extent of HGT and genome plasticity of bacteria in the environment. This review summarizes the present state of knowledge on HGT between bacteria as a crucial mechanism contributing to bacterial adaptability and diversity. In view of the use of GM crops and microbes in agricultural settings, in this mini-review we focus particularly on the presence and role of MGE in soil and plant-associated bacteria and the factors affecting gene transfer.
Identifying essential genes in bacterial metabolic networks with machine learning methods
2010-01-01
Background Identifying essential genes in bacteria supports to identify potential drug targets and an understanding of minimal requirements for a synthetic cell. However, experimentally assaying the essentiality of their coding genes is resource intensive and not feasible for all bacterial organisms, in particular if they are infective. Results We developed a machine learning technique to identify essential genes using the experimental data of genome-wide knock-out screens from one bacterial organism to infer essential genes of another related bacterial organism. We used a broad variety of topological features, sequence characteristics and co-expression properties potentially associated with essentiality, such as flux deviations, centrality, codon frequencies of the sequences, co-regulation and phyletic retention. An organism-wise cross-validation on bacterial species yielded reliable results with good accuracies (area under the receiver-operator-curve of 75% - 81%). Finally, it was applied to drug target predictions for Salmonella typhimurium. We compared our predictions to the viability of experimental knock-outs of S. typhimurium and identified 35 enzymes, which are highly relevant to be considered as potential drug targets. Specifically, we detected promising drug targets in the non-mevalonate pathway. Conclusions Using elaborated features characterizing network topology, sequence information and microarray data enables to predict essential genes from a bacterial reference organism to a related query organism without any knowledge about the essentiality of genes of the query organism. In general, such a method is beneficial for inferring drug targets when experimental data about genome-wide knockout screens is not available for the investigated organism. PMID:20438628
Directory of Open Access Journals (Sweden)
Xifeng Wang
Full Text Available Crocodilians are evolutionarily distinct reptiles that are distantly related to lizards and are thought to be the closest relatives of birds. Compared with birds and mammals, few studies have investigated the Ig light chain of crocodilians. Here, employing an Alligator sinensis genomic bacterial artificial chromosome (BAC library and available genome data, we characterized the genomic organization of the Alligator sinensis IgL gene loci. The Alligator sinensis has two IgL isotypes, λ and κ, the same as Anolis carolinensis. The Igλ locus contains 6 Cλ genes, each preceded by a Jλ gene, and 86 potentially functional Vλ genes upstream of (Jλ-Cλn. The Igκ locus contains a single Cκ gene, 6 Jκs and 62 functional Vκs. All VL genes are classified into a total of 31 families: 19 Vλ families and 12 Vκ families. Based on an analysis of the chromosomal location of the light chain genes among mammals, birds, lizards and frogs, the data further confirm that there are two IgL isotypes in the Alligator sinensis: Igλ and Igκ. By analyzing the cloned Igλ/κ cDNA, we identified a biased usage pattern of V families in the expressed Vλ and Vκ. An analysis of the junctions of the recombined VJ revealed the presence of N and P nucleotides in both expressed λ and κ sequences. Phylogenetic analysis of the V genes revealed V families shared by mammals, birds, reptiles and Xenopus, suggesting that these conserved V families are orthologous and have been retained during the evolution of IgL. Our data suggest that the Alligator sinensis IgL gene repertoire is highly diverse and complex and provide insight into immunoglobulin gene evolution in vertebrates.
Lu, Yan; Zhang, Chenglin; Wu, Xiaobing; Han, Haitang; Zhao, Yaofeng; Ren, Liming
2016-01-01
Crocodilians are evolutionarily distinct reptiles that are distantly related to lizards and are thought to be the closest relatives of birds. Compared with birds and mammals, few studies have investigated the Ig light chain of crocodilians. Here, employing an Alligator sinensis genomic bacterial artificial chromosome (BAC) library and available genome data, we characterized the genomic organization of the Alligator sinensis IgL gene loci. The Alligator sinensis has two IgL isotypes, λ and κ, the same as Anolis carolinensis. The Igλ locus contains 6 Cλ genes, each preceded by a Jλ gene, and 86 potentially functional Vλ genes upstream of (Jλ-Cλ)n. The Igκ locus contains a single Cκ gene, 6 Jκs and 62 functional Vκs. All VL genes are classified into a total of 31 families: 19 Vλ families and 12 Vκ families. Based on an analysis of the chromosomal location of the light chain genes among mammals, birds, lizards and frogs, the data further confirm that there are two IgL isotypes in the Alligator sinensis: Igλ and Igκ. By analyzing the cloned Igλ/κ cDNA, we identified a biased usage pattern of V families in the expressed Vλ and Vκ. An analysis of the junctions of the recombined VJ revealed the presence of N and P nucleotides in both expressed λ and κ sequences. Phylogenetic analysis of the V genes revealed V families shared by mammals, birds, reptiles and Xenopus, suggesting that these conserved V families are orthologous and have been retained during the evolution of IgL. Our data suggest that the Alligator sinensis IgL gene repertoire is highly diverse and complex and provide insight into immunoglobulin gene evolution in vertebrates. PMID:26901135
DEFF Research Database (Denmark)
Rattan, Suresh
2018-01-01
The idea of gerontogenes is in line with the evolutionary explanation of ageing as being an emergent phenomenon as a result of the imperfect maintenance and repair systems. Although evolutionary processes did not select for any specific ageing genes that restrict and determine the lifespan...... of an individual, the term ‘gerontogenes’ primarily refers to any genes that may seem to influence ageing and longevity, without being specifically selected for that role. Such genes can also be called ‘virtual gerontogenes’ by virtue of their indirect influence on the rate and process of ageing. More than 1000...... virtual gerontogenes have been associated with ageing and longevity in model organisms and humans. The ‘real’ genes, which do influence the essential lifespan of a species, and have been selected for in accordance with the evolutionary life history of the species, are known as the longevity assurance...
Hägg, Sara
2009-12-04
Environmental exposures filtered through the genetic make-up of each individual alter the transcriptional repertoire in organs central to metabolic homeostasis, thereby affecting arterial lipid accumulation, inflammation, and the development of coronary artery disease (CAD). The primary aim of the Stockholm Atherosclerosis Gene Expression (STAGE) study was to determine whether there are functionally associated genes (rather than individual genes) important for CAD development. To this end, two-way clustering was used on 278 transcriptional profiles of liver, skeletal muscle, and visceral fat (n =66/tissue) and atherosclerotic and unaffected arterial wall (n =40/tissue) isolated from CAD patients during coronary artery bypass surgery. The first step, across all mRNA signals (n =15,042/12,621 RefSeqs/genes) in each tissue, resulted in a total of 60 tissue clusters (n= 3958 genes). In the second step (performed within tissue clusters), one atherosclerotic lesion (n =49/48) and one visceral fat (n =59) cluster segregated the patients into two groups that differed in the extent of coronary stenosis (P=0.008 and P=0.00015). The associations of these clusters with coronary atherosclerosis were validated by analyzing carotid atherosclerosis expression profiles. Remarkably, in one cluster (n =55/54) relating to carotid stenosis (P =0.04), 27 genes in the two clusters relating to coronary stenosis were confirmed (n= 16/17, P<10 -27and-30). Genes in the transendothelial migration of leukocytes (TEML) pathway were overrepresented in all three clusters, referred to as the atherosclerosis module (A-module). In a second validation step, using three independent cohorts, the Amodule was found to be genetically enriched with CAD risk by 1.8-fold (P<0.004). The transcription co-factor LIM domain binding 2 (LDB2) was identified as a potential high-hierarchy regulator of the A-module, a notion supported by subnetwork analysis, by cellular and lesion expression of LDB2, and by the
Xiuyuan, Zhang; Zhihong, Huang; Lixia, Wang; Xiaonan, Liu
2015-05-01
Carbaryl is a low molecular weight insecticide that inhibits cholinesterase. Residues of carbaryl in food and the environment have damaged human health. A high-specificity scFv that can identify carbaryl is still lacking. In the present study, an anti-carbaryl scFv gene was prepared by cloning VL and VH genes from hybridoma cells secreting monoclonal antibody, then VH and VL were fused together using splicing by overlap extension (SOE) PCR with a flexible polypeptide linker connector (Gly4Ser)3, and then the scFv-pET-26b recombinant plasmid was constructed and transformed into E. coli BL21 for expression using IPTG as an inducer. The expressed recombinant protein was identified by SDS-PAGE and ELISA. The three-dimensional structure of the anti-carbaryl scFv was constructed by computer modeling, and carbaryl was docked to the scFv model to obtain the structure of the binding complex. The binding site was composed of Ala51, Ser52, Ile51, Gly54, Ser56, Arg98, and Gly100. This helps to understand the mechanism of interaction between anti-carbaryl antibody and antigen. Furthermore, it provides guidance for in vitro affinity maturation of anti-carbaryl antibody.
International Nuclear Information System (INIS)
Kang, Joo Hyun
2006-01-01
Knowledge of molecular mechanisms governing malignant transformation brings new opportunities for therapeutic intervention against cancer using novel approaches. One of them is gene therapy based on the transfer of genetic material to an organism with the aim of correcting a disease. The application of gene therapy to the cancer treatment had led to the development of new experimental approaches such as suicidal gene therapy, inhibition of oncogenes and restoration of tumor-suppressor genes. Suicidal gene therapy is based on the expression in tumor cells of a gene encoding an enzyme that converts a prodrug into a toxic product. Representative suicidal genes are Herpes simplex virus type 1 thymidine kinase (HSV1-tk) and cytosine deaminase (CD). Especially, physicians and scientists of nuclear medicine field take an interest in suicidal gene therapy because they can monitor the location and magnitude, and duration of expression of HSV1-tk and CD by PET scanner
Han, Dong-gang; Duan, Xiao-yi; Guo, You-min; Zhou, Qi; Wang, Quan-ying; Yang, Guang-xiao
2010-01-01
To obtain specific anti-epidermal growth factor receptor variant III (EGFRvIII) single chain antibody (ScFv) by phage antibody library display system. The total RNA was extracted from the spleen B cells of BALB/c mice immunized with pep-3-OVA protein, and the first-strand cDNA was synthesized by reverse transcription. Antibody VH and VL gene fragments were amplified and joined to a ScFv gene with the linker. The ScFv gene was ligated into the phagemid vector pCANTAB5E, which was transformed into competent E. coli TG1. The transformed cells were then infected with M13KO7 helper phage to yield the recombinant phage to construct the phage ScFv library. Pep-3-BSA protein was used to screen the phage antibody library and ELISA carried out to characterize the activity of the antibody. The VH and VL gene fragments of the antibody were about 350 bp and 320 bp in length as analyzed by agarose gel electrophoresis. The ScFv gene was 780 bp, consistent with the expected length. The recombinant phagemid with ScFv gene insert was rescued, and an immune phage ScFv library with the content of 5.0x10(6) was constructed. The recombinant ScFv phage had a titer of 3.0x10(4) cfu/ml, and the fourth phage harvest yielded 56 times as much as that of the first one. SDS-PAGE demonstrated a molecular mass of the soluble ScFv of about 28 kD. ELISA results indicated good specificity of the ScFv to bind EGFRvIII. An immune phage ScFv library is successfully constructed, and the ScFv antibody fragment is capable of specific binding to EGFRvIII.
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
Directory of Open Access Journals (Sweden)
Diego Tolentino de Lima
2017-08-01
Full Text Available Soil organic carbon and carbon stock influence, directly or indirectly, most of soil aggregate stability indicators. The objective of this study was to quantify the production of dry biomass (DB, total organic carbon (TOC and carbon stock (CStk in soil, and to evaluate their influence on some indicators of aggregation in an Oxisol at a Cerrado biome in Uberaba-MG, Brazil. The design was completely randomized blocks, in two evaluation periods: three and six cuts, at six depths (0-0.1, 0.1-0.2, 0.2-0.3, 0.3-0.4, 0.4-0.5 and 0.5-0.6 m. It was evaluated: soil density (SD, volumetric humidity (VH, aggregate stability index (AEI, weighted mean diameter (WDA, mean diameter (GDA, index of aggregates with diameter greater than 2 mm (AI and sensitivity index (SI, replicated by 4. The best AEI of the soil and the highest TOC contents were found in the most superficial layers, 0 to 0.2 m, for both cuttings. The greater values of TOC and CStk, occurred at the sixth cut area, where there was a higher amount of DB on soil surface. The higher levels of organic matter did not provide higher AEI in the area of sixth cut, when compared to that of the third cut. The TOC and CStk levels in both areas generally had a positive influence on soil aggregation indicators for both cuts.
Paralogous Genes as a Tool to Study the Regulation of Gene Expression
DEFF Research Database (Denmark)
Hoffmann, Robert D
The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...
The organization and expression of the mdm2 gene
Energy Technology Data Exchange (ETDEWEB)
Montes De Oca Luna, R.; Tabor, A.D.; Eberspaecher, H. [Univ. of Texas, Houston, TX (United States)] [and others
1996-05-01
The mdm2 gene encodes a zinc finger protein that negatively regulates p53 function by binding and masking the p53 transcriptional activation domain. Two different promoters control expression of mdm2, one of which is also transactivated by p53. We cloned and characterized the mdm2 gene from a murine 129 library. It contained at least 12 exons and spanned approximately 25 kb of DNA. Sequencing of the mdm2 gene revealed three nucleotide differences that resulted in amino acid substitutions in the previously published mdm2 sequence. Sequences of normal BalbC/J DNA and the original cosmid clone is isolated from the 3T3DM cell line revealed that they are identical, suggesting that the published sequence is in error at these three positions. In addition, we analyzed the expression pattern of mdm2 and found ubiquitous low-level expression throughout embryo development and in adult tissues. Analysis of mRNA from numerous tissues for several mdm2 spliced variants that had been identified in the transformed 3T3DM cell line revealed that these variants could not be detected in the developing embryo or in adult tissues. 25 refs., 3 figs., 2 tabs.
Diniz, Cassiano R A F; Casarotto, Plínio C; Joca, Sâmia R L
2016-07-01
Hodological and genetic differences between dorsal (DH) and ventral (VH) hippocampus may convey distinct behavioral roles. DH is responsible for mediating cognitive process, such as learning and memory, while VH modulates neuroendocrine and emotional-motivational responses to stress. Manipulating glutamatergic NMDA receptors and nitric oxide (NO) systems of the hippocampus induces important changes in behavioral responses to stress. Nevertheless, there is no study concerning functional differences between DH and VH in the modulation of behavioral responses induced by stress models predictive of antidepressant effects. Thus, this study showed that reversible blockade of the DH or VH of animals submitted to the forced swimming test (FST), by using cobalt chloride (calcium-dependent synaptic neurotransmission blocker), was not able to change immobility time. Afterwards, the NMDA-NO system was evaluated in the FST by means of intra-DH or intra-VH administration of NMDA receptor antagonist (AP7), NOS1 and sGC inhibitors (N-PLA and ODQ, respectively). Bilateral intra-DH injections after pretest or before test were able to induce antidepressant-like effects in the FST. On the other hand, bilateral VH administration of AP-7, N-PLA and ODQ induced antidepressant-like effects only when injected before the test. Administration of NO scavenger (C-PTIO) intra-DH, after pretest and before test, or intra-VH before test induced similar results. Increased NOS1 levels was associated to stress exposure in the DH. These results suggest that the glutamatergic-NO system of the DH and VH are both able to modulate behavioral responses in the FST, albeit with differential participation along time after stress exposure. Copyright © 2016 Elsevier B.V. All rights reserved.
Vitreous humor analysis for the detection of xenobiotics in forensic toxicology: a review.
Bévalot, Fabien; Cartiser, Nathalie; Bottinelli, Charline; Fanton, Laurent; Guitton, Jérôme
2016-01-01
Vitreous humor (VH) is a gelatinous substance contained in the posterior chamber of the eye, playing a mechanical role in the eyeball. It has been the subject of numerous studies in various forensic applications, primarily for the assessment of postmortem interval and for postmortem chemical analysis. Since most of the xenobiotics present in the bloodstream are detected in VH after crossing the selective blood-retinal barrier, VH is an alternative matrix useful for forensic toxicology. VH analysis offers particular advantages over other biological matrices: it is less prone to postmortem redistribution, is easy to collect, has relatively few interfering compounds for the analytical process, and shows sample stability over time after death. The present study is an overview of VH physiology, drug transport and elimination. Collection, storage, analytical techniques and interpretation of results from qualitative and quantitative points of view are dealt with. The distribution of xenobiotics in VH samples is thus discussed and illustrated by a table reporting the concentrations of 106 drugs from more than 300 case reports. For this purpose, a survey was conducted of publications found in the MEDLINE database from 1969 through April 30, 2015.
Phylogenetically informed logic relationships improve detection of biological network organization
2011-01-01
Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058
Takeda, M; Saito, Y; Sekine, R; Onitsuka, I; Maeda, R; Maéno, M
2000-06-01
We demonstrated previously that Xmsx-1 is involved in mesoderm patterning along the dorso-ventral axis, under the regulation of BMP-4 signaling. When Xmsx-1 RNA was injected into the dorsal blastomeres, a mass of muscle tissue formed instead of notochord. This activity was similar to that of Xwnt-8 reported previously. In this study, we investigated whether the activity of Xmsx-1 is related to the ventralizing signal and myogenesis promoting factor, Xwnt-8. Whole-mount in situ hybridization showed that Xmsx-1, Xwnt-8, and XmyoD were expressed in overlapping areas, including the ventro-lateral marginal zone at mid-gastrula stage. The expression of XmyoD was induced by the ectopic expression of either Xmsx-1 or Xwnt-8 in dorsal blastomeres, and Xwnt-8 was induced by the ectopic expression of Xmsx-1. On the other hand, the expression of Xmsx-1 was not affected by the loading of pCSKA-Xwnt-8 or dominant-negative Xwnt-8 (DN-Xwnt-8) RNA. In addition, Xmsx-1 RNA did not abrogate the formation of notochord if coinjected with DN-Xwnt-8 RNA. These results suggest that Xmsx-1 functions upstream of the Xwnt-8 signal. Furthermore, the antagonistic function of Xmsx-1 to the expression of organizer genes, such as Xlim-1 and goosecoid, was shown by in situ hybridization analysis and luciferase reporter assay using the goosecoid promoter construct. Finally if Xmsx-1/VP-16 fusion RNA, which was expected to function as a dominant-negative Xmsx-1, was injected into ventral blastomeres, a partial secondary axis formed in a significant number of embryos. In such embryos, the activity of luciferase, under the control of goosecoid promoter sequence, was significantly elevated at gastrula stage. These results led us to conclude that Xmsx-1 plays a central role in establishing dorso-ventral axis in gastrulating embryo, by suppressing the expression of organizer genes.
The Ventasso Horse: genetic characterization by microsatellites markers
Directory of Open Access Journals (Sweden)
M. Blasi
2010-04-01
Full Text Available The genetic structure of Ventasso Horse (VH was investigated using 12 microsatellites. The analyses were carried out on 117 VH individuals and the results were compared with those obtained analysing 11 other breeds reared in Italy. All microsatellites were polymorphic in VH and in the other breeds. A total of 124 alleles (from 6 to 19 alleles per microsatellite were detected. Average heterozygosity was 0.743 in VH and ranged from 0.613 to 0.759 in the other breeds. The mean FST value had an average value of 0.0932. Genetic distances were calculated using Nei’s standard genetic distance (Ds. The smallest Ds values were found between VH and Anglo-Arab, Thoroughbred, Maremmano and Lipizzan horse breeds. Phylogenetic trees constructed using neighbour-joining method showed two clear separate clusters: the first includes Bardigiano, Haflinger and Italian Heavy Draught Horse, the second contains the other 9 breeds.
Kock, K; Ahlers, C; Schmale, H
1994-05-01
The rat von Ebner's gland protein 1 (VEGP 1) is a secretory protein, which is abundantly expressed in the small acinar von Ebner's salivary glands of the tongue. Based on the primary structure of this protein we have previously suggested that it is a member of the lipocalin superfamily of lipophilic-ligand carrier proteins. Although the physiological role of VEGP 1 is not clear, it might be involved in sensory or protective functions in the taste epithelium. Here, we report the purification of VEGP 1 and of a closely related secretory polypeptide, VEGP 2, the isolation of a cDNA clone encoding VEGP 2, and the isolation and structural characterization of the genes for both proteins. Protein purification by gel-filtration and anion-exchange chromatography using Mono Q revealed the presence of two different immunoreactive VEGP species. N-terminal sequence determination of peptide fragments isolated after protease Asp-N digestion allowed the identification of a new VEGP, named VEGP 2, in addition to the previously characterized VEGP 1. The complete VEGP 2 sequence was deduced from a cDNA clone isolated from a von Ebner's gland cDNA library. The VEGP 2 cDNA encodes a protein of 177 amino acids and is 94% identical to VEGP 1. DNA sequence analysis of the rat VEGP 1 and 2 genes isolated from rat genomic libraries revealed that both span about 4.5 kb and contain seven exons. The VEGP 1 and 2 genes are non-allelic distinct genes in the rat genome and probably arose by gene duplication. The high degree of nucleotide sequence identity in introns A-C (94-100%) points to a recent gene conversion event that included the 5' part of the genes. The genomic organization of the rat VEGP genes closely resembles that found in other lipocalins such as beta-lactoglobulin, mouse urinary proteins (MUPs) and prostaglandin D synthase, and therefore provides clear evidence that VEGPs belong to this superfamily of proteins.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK209 (Link to dictyBase) - - - Contig-U16260-1 VHK209P (Link to Original site) VHK2...09F 573 VHK209Z 765 VHK209P 1318 - - Show VHK209 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK209Q.Seq.d/ Representative seq. ID VHK2...09P (Link to Original site) Representative DNA sequence >VHK209 (VHK209Q) /CSM/VH/VHK2-A/VHK2...Sequences producing significant alignments: (bits) Value N ( BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k2
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK221 (Link to dictyBase) - - - - VHK221P (Link to Original site) VHK221F 603 VHK2...21Z 724 VHK221P 1307 - - Show VHK221 Library VH (Link to library) Clone ID VHK221 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-A/VHK221Q.Seq.d/ Representative seq. ID VHK221P (Link to... Original site) Representative DNA sequence >VHK221 (VHK221Q) /CSM/VH/VHK2-A/VHK221Q.Seq.d/ AACTCTCGAGTGCAAA
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK207 (Link to dictyBase) - - - Contig-U16260-1 VHK207P (Link to Original site) VHK2...07F 371 VHK207Z 713 VHK207P 1064 - - Show VHK207 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK207Q.Seq.d/ Representative seq. ID VHK2...07P (Link to Original site) Representative DNA sequence >VHK207 (VHK207Q) /CSM/VH/VHK2-A/VHK2...ducing significant alignments: (bits) Value N ( BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3'
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK211 (Link to dictyBase) - - - - VHK211P (Link to Original site) VHK211F 605 VHK2...11Z 118 VHK211P 703 - - Show VHK211 Library VH (Link to library) Clone ID VHK211 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-A/VHK211Q.Seq.d/ Representative seq. ID VHK211P (Link to ...Original site) Representative DNA sequence >VHK211 (VHK211Q) /CSM/VH/VHK2-A/VHK211Q.Seq.d/ AACTCTCGAGTGCAAAA
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK279 (Link to dictyBase) - - - - VHK279P (Link to Original site) VHK279F 619 VHK2...79Z 149 VHK279P 748 - - Show VHK279 Library VH (Link to library) Clone ID VHK279 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-D/VHK279Q.Seq.d/ Representative seq. ID VHK279P (Link to ...Original site) Representative DNA sequence >VHK279 (VHK279Q) /CSM/VH/VHK2-D/VHK279Q.Seq.d/ AACTCTCGAGTGCAAAA
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK278 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...78F 533 - - - - - - Show VHK278 Library VH (Link to library) Clone ID VHK278 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK278Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK278 (VHK278Q) /CSM/VH/VHK2-D/VHK278Q.Seq.d/ AACTCTCGAGTGCAAAA...BJ427875 ) Dictyostelium discoideum cDNA clone:ddv63k24, 5' ... 997 0.0 1 ( BJ427874 ) Dictyostelium discoideum cDNA clone:ddv63k2
A constructive approach to gene expression dynamics
International Nuclear Information System (INIS)
Ochiai, T.; Nacher, J.C.; Akutsu, T.
2004-01-01
Recently, experiments on mRNA abundance (gene expression) have revealed that gene expression shows a stationary organization described by a scale-free distribution. Here we propose a constructive approach to gene expression dynamics which restores the scale-free exponent and describes the intermediate state dynamics. This approach requires only one assumption: Markov property
DEFF Research Database (Denmark)
Poulsen, Lars K.
2004-01-01
E (IgE) cross-reactions to known allergens, digestability studies of the proteins in simulated gastric and/or intestinal fluids, and animal studies. These steps are discussed and five examples of risk evaluation of GMOs or novel foods are presented. These include ice-structuring protein derived from......The introduction of novel proteins into foods carries a risk of eliciting allergic reactions in individuals sensitive to the introduced protein and a risk of sensitizing susceptible individuals. No single predictive test exists to perform a hazard assessment in relation to allergenic properties...... of newly expressed proteins in gene-modified organisms (GMOs). Instead, performance of a weighted risk analysis based on the decision tree approach has been suggested. The individual steps of this analysis comprise sequence homology to known allergens, specific or targeted serum screens for immunoglobulin...
International Nuclear Information System (INIS)
Sun, Mingming; Ye, Mao; Wu, Jun; Feng, Yanfang; Wan, Jinzhong; Tian, Da; Shen, Fangyuan; Liu, Kuan; Hu, Feng; Li, Huixin; Jiang, Xin; Yang, Linzhang; Kengara, Fredrick Orori
2015-01-01
Co-contaminated soils by organic pollutants (OPs), antibiotics and antibiotic resistance genes (ARGs) have been becoming an emerging problem. However, it is unclear if an interaction exists between mixed pollutants and ARG abundance. Therefore, the potential relationship between OP contents and ARG and class 1 integron-integrase gene (intI1) abundance was investigated from seven dairy farms in Nanjing, Eastern China. Phenanthrene, pentachlorophenol, sulfadiazine, roxithromycin, associated ARG genes, and intI1 had the highest detection frequencies. Correlation analysis suggested a stronger positive relationship between the ARG abundance and the bioaccessible OP content than the total OP content. Additionally, the significant correlation between the bioaccessible mixed pollutant contents and ARG/intI1 abundance suggested a direct/indirect impact of the bioaccessible mixed pollutants on soil ARG dissemination. This study provided a preliminary understanding of the interaction between mixed pollutants and ARGs in co-contaminated soils. - Highlights: • Coexistence of OPs, antibiotics, and ARGs in dairy farm soils was ubiquitous. • Bioaccessible pollutants exhibited positive correlation with ARG abundance. • ARGs significantly correlated with intI1. • Bioaccessible pollutants demonstrated strong correlation with intI1. • The intI1 gene might serve as a potential proxy for mixed pollution. - Coexistence of mixed OPs and ARGs in dairy farm soils was ubiquitous; a positive correlation can be found between the bioaccessible OP fractions and ARG/intI1 abundance.
Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks.
Directory of Open Access Journals (Sweden)
Vipin Narang
Full Text Available Human gene regulatory networks (GRN can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs. Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data accompanying this manuscript.
Zhong, R Q; Chen, L; Gao, L X; Zhang, L L; Yao, B; Yang, X G; Zhang, H F
2016-08-01
The objective of the present study was to investigate the effect of feeding two transgenic corn lines containing the mCry1Ac gene from Bacillus thuringiensis strain (BT-799) and the maroACC gene from Agrobacterium tumefaciens strain (CC-2), respectively, on growth, egg quality and organ health indicators. Expression of the mCry1Ac gene confers resistance to Pyrausta nubilalis and the maroACC gene confers tolerance to herbicides. Healthy hens (n=96 placed in cages; 3 hens/cage) were randomly assigned to one of four corn-soybean meal dietary treatments (8 cages/treatment) formulated with the following corn: non-transgenic near-isoline control corn (control), BT-799 corn, CC-2 corn and commercially available non-transgenic reference corn (reference). The experiment was divided into three 4-week phases (week 1 to 4, week 5 to 8 and week 9 to 12), during which hens were fed mash diets. Performance (BW, feed intake and egg production) and egg quality were determined. Following slaughter at the end of 12 weeks of feeding (n=8/treatment), carcass yield and organ weights (heart, liver, spleen, lung, kidneys, stomach and ovary) were recorded; organs and intestines were sampled for histological analysis. Analysis of serum biochemistry parameters to assess the liver and kidney function were performed. No differences in BW, egg production and production efficiency were observed between hens consuming the control diet and hens consuming the BT-799 or CC-2 diet. Haugh unit measures and egg component weights were similar between the control and test groups. Carcass yield was not affected by the diet treatment. Similar organosomatic indices and serum parameters did not indicate the characteristics of organ dysfunction. All observed values of the BT-799 and CC-2 groups were within the calculated tolerance intervals. This research indicates that the performance, egg quality, organ health and carcass yield of laying hens fed diets containing the BT-799 or CC-2 corn line were similar
Paternò, Annalisa; Marchesi, Ugo; Gatto, Francesco; Verginelli, Daniela; Quarchioni, Cinzia; Fusco, Cristiana; Zepparoni, Alessia; Amaddeo, Demetrio; Ciabatti, Ilaria
2009-12-09
The comparison of five real-time polymerase chain reaction (PCR) methods targeted at maize ( Zea mays ) endogenous sequences is reported. PCR targets were the alcohol dehydrogenase (adh) gene for three methods and high-mobility group (hmg) gene for the other two. The five real-time PCR methods have been checked under repeatability conditions at several dilution levels on both pooled DNA template from several genetically modified (GM) maize certified reference materials (CRMs) and single CRM DNA extracts. Slopes and R(2) coefficients of all of the curves obtained from the adopted regression model were compared within the same method and among all of the five methods, and the limit of detection and limit of quantitation were analyzed for each PCR system. Furthermore, method equivalency was evaluated on the basis of the ability to estimate the target haploid genome copy number at each concentration level. Results indicated that, among the five methods tested, one of the hmg-targeted PCR systems can be considered equivalent to the others but shows the best regression parameters and a higher repeteability along the dilution range. Thereby, it is proposed as a valid module to be coupled to different event-specific real-time PCR for maize genetically modified organism (GMO) quantitation. The resulting practicability improvement on the analytical control of GMOs is discussed.
Directory of Open Access Journals (Sweden)
Roselyn Kahindi
2017-12-01
Full Text Available Two 14-day experiments, each with 90 (Duroc × [Yorkshire × Landrace]; 7.3 ± 0.6 kg piglets, were conducted to determine the optimum sulfur amino acid (SAA to lysine (Lys ratio (SAA:Lys for piglets when reared under clean or unclean sanitary conditions using performance and non-performance response criteria. Piglets were randomly assigned to the following dietary treatments. The basal diet contained 1.18% standardized ileal digestible (SID Lys, and the SAA:Lys was 52%. In diets 2 to 5, the basal diet was supplemented with 4 graded levels of dl-Met to make SAA:Lys of 56%, 60%, 64% and 68%. In Exp. 1, piglets were housed in disinfected clean room. In Exp. 2, piglets were housed in a room previously occupied by other pigs and was not disinfected. On the last day, blood was collected to measure plasma urea nitrogen (PUN and one pig per pen was euthanized to collect jejunal tissue to measure villus height (VH, crypt depth (CD, and VH:CD. In Exp. 1, increasing SAA:Lys linearly and quadratically increased VH and VH:CD (P < 0.05. In Exp. 2, increasing SAA:Lys linearly increased (P < 0.05 VH and VH:CD and linearly and quadratically decreased PUN (P < 0.05. Estimated PUN and VH-based optimum SAA:Lys requirements for clean and unclean sanitary condition were 60%, 63% and 66%, respectively.
Wilson, Rea; Collerton, Daniel; Freeston, Mark; Christodoulides, Thomas; Dudley, Robert
2016-07-01
People with psychosis often report distressing visual hallucinations (VH). In contrast to auditory hallucinations, there is little empirical evidence on effective interventions. The effectiveness of a novel-focused cognitive-behavioural therapy (CBT) intervention for VH was explored using a multiple baseline single case design with four participants. Change to individual appraisals, emotional and behavioural responses to VH were measured with daily diaries kept throughout the baseline and intervention phase lasting up to 16 sessions. Maintenance of change was tracked during a follow-up period of one month. Changes in appraisals, distress and response in accordance with the theory was evident in two out of four of the cases. However, change occurred within the baseline phase that limited the conclusions that change could be attributed to CBT alone. There was some evidence of clinically significant change and reliable change for two out of four of the cases at follow-up on one of the standardized psychiatric assessments. The research reported here has theoretical and clinical implications for refinement of the model and interventions for distressing VH. Copyright © 2015 John Wiley & Sons, Ltd. Distressing visual hallucinations (VH) are a relatively common symptom of psychosis. Visual hallucinations seem to be associated with greater impairment and disability. We have no specific treatment for VH. The appraisal of the visual experience and the behavioural response is important in maintaining the distress. Cognitive-behavioural therapy for VH at present has limited value. Copyright © 2015 John Wiley & Sons, Ltd.
Comparative gene expression profiling of multiple tissues from rat strains with genetic predisposition to diverse cardiovascular diseases (CVD) can help decode the transcriptional program that governs organ-specific functions. We examined expressions of CVD genes in the lungs of ...
What is a gene? From molecules to metaphysics.
Rolston, Holmes
2006-01-01
Mendelian genes have become molecular genes, with increasing puzzlement about locating them, due to increasing complexity in genomic webworks. Genome science finds modular and conserved units of inheritance, identified as homologous genes. Such genes are cybernetic, transmitting information over generations; this too requires multi-leveled analysis, from DNA transcription to development and reproduction of the whole organism. Genes are conserved; genes are also dynamic and creative in evolutionary speciation-most remarkably producing humans capable of wondering about what genes are.
Directory of Open Access Journals (Sweden)
Ruihong Chen
2017-07-01
Full Text Available The flower is a plant reproductive organ that forms part of the fruit produced as the flowering season ends. While the number and identity of proteins expressed in a jujube (Ziziphus jujuba Mill. flower is currently unknown, integrative proteomic and transcriptomic analyses provide a systematic strategy of characterizing the floral biology of plants. We conducted a shotgun proteomic analysis on jujube flowers by using a filter-aided sample preparation tryptic digestion, followed by liquid chromatography-tandem mass spectrometry (LC-MS/MS. In addition, transcriptomics analyses were performed on HiSeq2000 sequencers. In total, 7,853 proteins were identified accounting for nearly 30% of the ‘Junzao’ gene models (27,443. Genes identified in proteome generally showed higher RPKM (reads per kilobase per million mapped reads values than undetected genes. Gene ontology categories showed that ribosomes and intracellular organelles were the most dominant classes and accounted for 17.0% and 14.0% of the proteome mass, respectively. The top-ranking proteins with iBAQ >1010 included non-specific lipid transfer proteins, histones, actin-related proteins, fructose-bisphosphate aldolase, Bet v I type allergens, etc. In addition, we identified one pollen-specificity S-locus F-box-like gene located on the same chromosome as the S-RNase gene. Both of these may activate the behaviour of gametophyte self-incompatibility in jujube. These results reflected the protein profile features of jujube flowers and contributes new information important to the jujube breeding system.
Global gene expression in Escherichia coli biofilms
DEFF Research Database (Denmark)
Schembri, Mark; Kjærgaard, K.; Klemm, Per
2003-01-01
It is now apparent that microorganisms undergo significant changes during the transition from planktonic to biofilm growth. These changes result in phenotypic adaptations that allow the formation of highly organized and structured sessile communities, which possess enhanced resistance to antimicr......It is now apparent that microorganisms undergo significant changes during the transition from planktonic to biofilm growth. These changes result in phenotypic adaptations that allow the formation of highly organized and structured sessile communities, which possess enhanced resistance...... the transition to biofilm growth, and these included genes expressed under oxygen-limiting conditions, genes encoding (putative) transport proteins, putative oxidoreductases and genes associated with enhanced heavy metal resistance. Of particular interest was the observation that many of the genes altered...... in expression have no current defined function. These genes, as well as those induced by stresses relevant to biofilm growth such as oxygen and nutrient limitation, may be important factors that trigger enhanced resistance mechanisms of sessile communities to antibiotics and hydrodynamic shear forces....
Directory of Open Access Journals (Sweden)
Candy M Taylor
Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other
Gene analogue finder: a GRID solution for finding functionally analogous gene products
Directory of Open Access Journals (Sweden)
Licciulli Flavio
2007-09-01
-model organisms that often have electronic associations, since experimental information is missing. With future improvements of the GO, this limit will be reduced. ENGINE will manifest its power when it is applied to the whole GODB of more than 2,1 million gene products from more than 100000 organisms. The data produced by this search is planed to be available as a supplement to the GO database as soon as we are able to provide regular updates.
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Operon Gene Order Is Optimized for Ordered Protein Complex Assembly
Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.
2016-01-01
Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901
Efficient visibility-driven medical image visualisation via adaptive binned visibility histogram.
Jung, Younhyun; Kim, Jinman; Kumar, Ashnil; Feng, David Dagan; Fulham, Michael
2016-07-01
'Visibility' is a fundamental optical property that represents the observable, by users, proportion of the voxels in a volume during interactive volume rendering. The manipulation of this 'visibility' improves the volume rendering processes; for instance by ensuring the visibility of regions of interest (ROIs) or by guiding the identification of an optimal rendering view-point. The construction of visibility histograms (VHs), which represent the distribution of all the visibility of all voxels in the rendered volume, enables users to explore the volume with real-time feedback about occlusion patterns among spatially related structures during volume rendering manipulations. Volume rendered medical images have been a primary beneficiary of VH given the need to ensure that specific ROIs are visible relative to the surrounding structures, e.g. the visualisation of tumours that may otherwise be occluded by neighbouring structures. VH construction and its subsequent manipulations, however, are computationally expensive due to the histogram binning of the visibilities. This limits the real-time application of VH to medical images that have large intensity ranges and volume dimensions and require a large number of histogram bins. In this study, we introduce an efficient adaptive binned visibility histogram (AB-VH) in which a smaller number of histogram bins are used to represent the visibility distribution of the full VH. We adaptively bin medical images by using a cluster analysis algorithm that groups the voxels according to their intensity similarities into a smaller subset of bins while preserving the distribution of the intensity range of the original images. We increase efficiency by exploiting the parallel computation and multiple render targets (MRT) extension of the modern graphical processing units (GPUs) and this enables efficient computation of the histogram. We show the application of our method to single-modality computed tomography (CT), magnetic resonance
DEFF Research Database (Denmark)
Ghisari, Mandana; Eiberg, Hans; Long, Manhai
2014-01-01
BACKGROUND: We have previously reported that chemicals belonging to the persistent organic pollutants (POPs) such as perfluorinated compounds (PFAS) and polychlorinated biphenyls (PCBs) are risk factors in Breast Cancer (BC) development in Greenlandic Inuit women. The present case-control study...... on BC risk in Greenlandic Inuit women. METHODS: The study population consisted of 31 BC cases and 115 matched controls, with information on serum levels of POPs. Genotyping was conducted for CYP1A1 (Ile462Val; rs1048943), CYP1B1 (Leu432Val; rs1056836), COMT (Val158Met; rs4680), CYP17A1 (A1> A2; rs743572...... aimed to investigate the main effect of polymorphisms in genes involved in xenobiotic metabolism and estrogen biosynthesis, CYP1A1, CYP1B1, COMT and CYP17, CYP19 and the BRCA1 founder mutation in relation to BC risk and to explore possible interactions between the gene polymorphisms and serum POP levels...
Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet
Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...
Mycoplasma hyopneumoniae Transcription Unit Organization: Genome Survey and Prediction
Siqueira, Franciele Maboni; Schrank, Augusto; Schrank, Irene Silveira
2011-01-01
Mycoplasma hyopneumoniae is associated with swine respiratory diseases. Although gene organization and regulation are well known in many prokaryotic organisms, knowledge on mycoplasma is limited. This study performed a comparative analysis of three strains of M. hyopneumoniae (7448, J and 232), with a focus on genome organization and gene comparison for open read frame (ORF) cluster (OC) identification. An in silico analysis of gene organization demonstrated 117 OCs and 34 single ORFs in M. hyopneumoniae 7448 and J, while 116 OCs and 36 single ORFs were identified in M. hyopneumoniae 232. Genomic comparison revealed high synteny and conservation of gene order between the OCs defined for 7448 and J strains as well as for 7448 and 232 strains. Twenty-one OCs were chosen and experimentally confirmed by reverse transcription–PCR from M. hyopneumoniae 7448 genome, validating our prediction. A subset of the ORFs within an OC could be independently transcribed due to the presence of internal promoters. Our results suggest that transcription occurs in ‘run-on’ from an upstream promoter in M. hyopneumoniae, thus forming large ORF clusters (from 2 to 29 ORFs in the same orientation) and indicating a complex transcriptional organization. PMID:22086999
System Biology Approach: Gene Network Analysis for Muscular Dystrophy.
Censi, Federica; Calcagnini, Giovanni; Mattei, Eugenio; Giuliani, Alessandro
2018-01-01
Phenotypic changes at different organization levels from cell to entire organism are associated to changes in the pattern of gene expression. These changes involve the entire genome expression pattern and heavily rely upon correlation patterns among genes. The classical approach used to analyze gene expression data builds upon the application of supervised statistical techniques to detect genes differentially expressed among two or more phenotypes (e.g., normal vs. disease). The use of an a posteriori, unsupervised approach based on principal component analysis (PCA) and the subsequent construction of gene correlation networks can shed a light on unexpected behaviour of gene regulation system while maintaining a more naturalistic view on the studied system.In this chapter we applied an unsupervised method to discriminate DMD patient and controls. The genes having the highest absolute scores in the discrimination between the groups were then analyzed in terms of gene expression networks, on the basis of their mutual correlation in the two groups. The correlation network structures suggest two different modes of gene regulation in the two groups, reminiscent of important aspects of DMD pathogenesis.
International Nuclear Information System (INIS)
Hood, D.M.; Pitzer, R.M.; Schaefer III, H.F.
1979-01-01
Ab initio molecular electronic structure theory has been applied to the family of transition metal tetrahydrides TiH 4 through NiH 4 . For the TiH 4 molecule a wide range of contracted Gaussian basis sets has been tested at the self-consistent-field (SCF) level of theory. The largest basis, labeled M(14s 11p 6d/10s 8p 3d), H(5s 1p/3s 1p), was used for all members of the series and should yield wave functions approaching true Hartree-Fock quality. Predicted SCF dissociation energies (relative to M+4H) and M--H bond distances are TiH 4 132 kcal, 1.70 A; VH 4 86 kcal, 1.64 A; CrH 4 65 kcal, 1.59 A; MnH 4 -- 36 kcal, 1.58 A; FeH 4 0 kcal, 1.58 A; CoH 4 27 kcal, 1.61 A; and NiH 4 18 kcal, 1.75 A. It should be noted immediately that each of these SCF dissociation energies will be increased by electron correlation effects by perhaps as much as 90 kcal. For all of these molecules except TiH 4 excited states have also been studied. One of the most interesting trends seen for these excited states is the shortening of the M--H bond as electrons are transferred from the antibonding 4t 2 orbital to the nonbonding 1e orbitals
Regulation of meiotic gene expression in plants
Directory of Open Access Journals (Sweden)
Adele eZhou
2014-08-01
Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.
Directory of Open Access Journals (Sweden)
Shimada Yukinori
2010-05-01
Full Text Available Abstract Background Identification of genes involved in adaptation and speciation by targeting specific genes of interest has become a plausible strategy also for non-model organisms. We investigated the potential utility of available sequenced fish genomes to develop microsatellite (cf. simple sequence repeat, SSR markers for functionally important genes in nine-spined sticklebacks (Pungitius pungitius, as well as cross-species transferability of SSR primers from three-spined (Gasterosteus aculeatus to nine-spined sticklebacks. In addition, we examined the patterns and degree of SSR conservation between these species using their aligned sequences. Results Cross-species amplification success was lower for SSR markers located in or around functionally important genes (27 out of 158 than for those randomly derived from genomic (35 out of 101 and cDNA (35 out of 87 libraries. Polymorphism was observed at a large proportion (65% of the cross-amplified loci independently of SSR type. To develop SSR markers for functionally important genes in nine-spined sticklebacks, SSR locations were surveyed in or around 67 target genes based on the three-spined stickleback genome and these regions were sequenced with primers designed from conserved sequences in sequenced fish genomes. Out of the 81 SSRs identified in the sequenced regions (44,084 bp, 57 exhibited the same motifs at the same locations as in the three-spined stickleback. Di- and trinucleotide SSRs appeared to be highly conserved whereas mononucleotide SSRs were less so. Species-specific primers were designed to amplify 58 SSRs using the sequences of nine-spined sticklebacks. Conclusions Our results demonstrated that a large proportion of SSRs are conserved in the species that have diverged more than 10 million years ago. Therefore, the three-spined stickleback genome can be used to predict SSR locations in the nine-spined stickleback genome. While cross-species utility of SSR primers is limited due
Genomewide analysis of the lateral organ boundaries domain gene ...
Indian Academy of Sciences (India)
of plants such as Arabidopsis, Oryza sativa, Zea mays, poplar, apple and tomato. However ... found to share a similar intron/exon structure and gene length within the same class. .... ches against the proteome and genome files downloaded.
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK294 (Link to dictyBase) - - - Contig-U15304-1 VHK294P (Link to Original site) VHK2...94F 611 VHK294Z 780 VHK294P 1371 - - Show VHK294 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK294Q.Seq.d/ Representative seq. ID VHK2...94P (Link to Original site) Representative DNA sequence >VHK294 (VHK294Q) /CSM/VH/VHK2-D/VHK2...yscfyw ns*i*ngsgyf**tfttti Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHK294 (VHK2
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK296 (Link to dictyBase) - - - Contig-U16260-1 VHK296P (Link to Original site) VHK2...96F 531 VHK296Z 314 VHK296P 825 - - Show VHK296 Library VH (Link to library) Clone ID VHK2... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK296Q.Seq.d/ Representative seq. ID VHK2...96P (Link to Original site) Representative DNA sequence >VHK296 (VHK296Q) /CSM/VH/VHK2-D/VHK2... 5' ... 993 0.0 1 ( BJ427875 ) Dictyostelium discoideum cDNA clone:ddv63k24, 5' ... 993 0.0 1 ( BJ427874 ) D
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK202 (Link to dictyBase) - - - Contig-U16260-1 VHK202P (Link to Original site) VHK2...02F 618 VHK202Z 741 VHK202P 1339 - - Show VHK202 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK202Q.Seq.d/ Representative seq. ID VHK2...02P (Link to Original site) Representative DNA sequence >VHK202 (VHK202Q) /CSM/VH/VHK2-A/VHK2...446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3' ... 1449 0.0 1 ( BJ446732 ) Dictyostelium discoide
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK254 (Link to dictyBase) - - - Contig-U16260-1 VHK254P (Link to Original site) VHK2...54F 616 VHK254Z 744 VHK254P 1340 - - Show VHK254 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-C/VHK254Q.Seq.d/ Representative seq. ID VHK2...54P (Link to Original site) Representative DNA sequence >VHK254 (VHK254Q) /CSM/VH/VHK2-C/VHK2...BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3' ... 1455 0.0 1 ( BJ446732 ) Dictyostelium discoi
Energy Technology Data Exchange (ETDEWEB)
Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))
1990-08-28
The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.
Mutated genes as research tool
International Nuclear Information System (INIS)
1981-01-01
Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of
Huq, Muhammad Aminul; Takeyama, Naoshi; Harada, Makoto; Miki, Yasuo; Takeuchi, Akinori; Inoue, Sousuke; Nakagawa, Takashi; Kanou, Hideki; Hirakawa, Akihiko; Noguchi, Hiroshi
2012-01-01
Impaired fibrinolysis is associated with a higher incidence of both multiple organ dysfunction and mortality in the intensive care unit (ICU). Plasminogen activator inhibitor (PAI)-1 is the chief inhibitor of fibrinolysis. We investigated the influence of the 4G/5G polymorphism (rs1799768) of the PAI-1 gene on the plasma PAI-1 level and the outcome of critically ill patients. In 41 consecutive patients admitted to the ICU, PAI-1 gene polymorphism was assessed, plasma PAI-1 and arterial lactate concentrations were measured and clinical severity scores were recorded. Homozygotes for the 4G allele had higher plasma levels of PAI-1 antigen. The mean ± SD PAI-1 antigen level was 193.31 ± 167.93 ng/ml for the 4G/4G genotype, 100.67 ± 114.16 ng/ml for the 4G/5G genotype and 0.43 ± 0.53 ng/ml for the 5G/5G genotype. There was a significant correlation between plasma PAI-1 and arterial lactate concentrations, as well as between PAI-1 and severity scores. The mortality rate was 63, 33 and 0% for patients with the 4G/4G, 4G/5G and 5G/5G genotypes, respectively. These results demonstrate that the 4G/5G polymorphism of the PAI-1 gene affects the plasma PAI-1 concentration, which could impair fibrinolysis and cause organ failure, and thus the presence of the 4G allele increases the risk of death. Copyright © 2011 S. Karger AG, Basel.
Energy Technology Data Exchange (ETDEWEB)
Harding, Scott A. [Univ. of Georgia, Athens, GA (United States); Tsai, Chung-Jui [Univ. of Georgia, Athens, GA (United States)
2016-01-04
The overall project objective was to probe the relationship between sucrose transporters and plant productivity in the biomass for biofuels woody perennial, Populus. At the time the proposal was written, sucrose transporters had already been investigated in many plant model systems, primarily with respect to the export of photosynthate sucrose from source leaves, and the uptake of sucrose in storage organs and seeds. Preliminary findings by the PI found that in Populus, sucrose transporter genes (SUTs) were well expressed in wood-forming tissues that comprise the feedstock for biofuels production. Because sucrose comprises by far the predominant form in which photosynthate is delivered from source organs to sink organs like roots and wood-forming tissues, SUTs control a gate that nominally at least could impact the allocation or partitioning of sucrose for potentially competing end uses like growth (stem biomass) and storage. In addition, water use might be conditioned by the way in which sucrose is distributed throughout the plant, and/or by the way in which sucrose is partitioned intracellularly. Several dozen transgenic lines were produced in year 1 of the project to perturb the expression ratio of multiple plasma membrane (PM) SUTs (intercellular trafficking), versus the single tonoplast membrane (TM) sucrose transporter that effectively regulates intracellular trafficking of sucrose. It was possible to obtain transgenic lines with dual SUT gene knockdown using the 35S promoter, but not the wood-specific TUA1 promoter. By the end of project year 2, a decision was made to work with the 35S plants while archiving the TUA1 plants. The PhD candidate charged with producing the transgenic lines abandoned the project during its second year, substantially contributing to the decision to operate with just the 35S lines. That student’s interests ranged more toward evolutionary topics, and a report on SUT gene evolution was published (Peng et al 2014).
Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension.
Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei
2016-11-21
Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2 -/- mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis.
Genetically engineered micro-organisms: Aromatic hydrocarbon biodegradation genes from Rhodococcus
International Nuclear Information System (INIS)
Kendall, K.
1993-01-01
DNA known to encode toluene biodegradation genes in Pseudomonas putida was used in Southern Blots to identify homologous DNA in the unrelated toluene degrading Actinomycete, Rhodococcus sp. ATCC 19070. Two strongly hybridizing EcoRI fragments of 2.3 kb and 2.7 kb respectively were cloned into E. coli. Sequence analysis of a 400 bp section of the 2.3 kb fragment demonstrated that it encodes proteins with similar amino acid sequences to the xylX and xylY genes of P. putida. These proteins are components of toluate oxygenase, the enzyme catalyzing the first step in the metabolism of benzoic acid
An Interactive Database of Cocaine-Responsive Gene Expression
Directory of Open Access Journals (Sweden)
Willard M. Freeman
2002-01-01
Full Text Available The postgenomic era of large-scale gene expression studies is inundating drug abuse researchers and many other scientists with findings related to gene expression. This information is distributed across many different journals, and requires laborious literature searches. Here, we present an interactive database that combines existing information related to cocaine-mediated changes in gene expression in an easy-to-use format. The database is limited to statistically significant changes in mRNA or protein expression after cocaine administration. The Flash-based program is integrated into a Web page, and organizes changes in gene expression based on neuroanatomical region, general function, and gene name. Accompanying each gene is a description of the gene, links to the original publications, and a link to the appropriate OMIM (Online Mendelian Inheritance in Man entry. The nature of this review allows for timely modifications and rapid inclusion of new publications, and should help researchers build second-generation hypotheses on the role of gene expression changes in the physiology and behavior of cocaine abuse. Furthermore, this method of organizing large volumes of scientific information can easily be adapted to assist researchers in fields outside of drug abuse.
The Co-regulation Data Harvester: Automating gene annotation starting from a transcriptome database
Tsypin, Lev M.; Turkewitz, Aaron P.
Identifying co-regulated genes provides a useful approach for defining pathway-specific machinery in an organism. To be efficient, this approach relies on thorough genome annotation, a process much slower than genome sequencing per se. Tetrahymena thermophila, a unicellular eukaryote, has been a useful model organism and has a fully sequenced but sparsely annotated genome. One important resource for studying this organism has been an online transcriptomic database. We have developed an automated approach to gene annotation in the context of transcriptome data in T. thermophila, called the Co-regulation Data Harvester (CDH). Beginning with a gene of interest, the CDH identifies co-regulated genes by accessing the Tetrahymena transcriptome database. It then identifies their closely related genes (orthologs) in other organisms by using reciprocal BLAST searches. Finally, it collates the annotations of those orthologs' functions, which provides the user with information to help predict the cellular role of the initial query. The CDH, which is freely available, represents a powerful new tool for analyzing cell biological pathways in Tetrahymena. Moreover, to the extent that genes and pathways are conserved between organisms, the inferences obtained via the CDH should be relevant, and can be explored, in many other systems.
International Nuclear Information System (INIS)
He, Bin; Frey, Eric C
2006-01-01
Accurate quantification of organ radionuclide uptake is important for patient-specific dosimetry. The quantitative accuracy from conventional conjugate view methods is limited by overlap of projections from different organs and background activity, and attenuation and scatter. In this work, we propose and validate a quantitative planar (QPlanar) processing method based on maximum likelihood (ML) estimation of organ activities using 3D organ VOIs and a projector that models the image degrading effects. Both a physical phantom experiment and Monte Carlo simulation (MCS) studies were used to evaluate the new method. In these studies, the accuracies and precisions of organ activity estimates for the QPlanar method were compared with those from conventional planar (CPlanar) processing methods with various corrections for scatter, attenuation and organ overlap, and a quantitative SPECT (QSPECT) processing method. Experimental planar and SPECT projections and registered CT data from an RSD Torso phantom were obtained using a GE Millenium VH/Hawkeye system. The MCS data were obtained from the 3D NCAT phantom with organ activity distributions that modelled the uptake of 111 In ibritumomab tiuxetan. The simulations were performed using parameters appropriate for the same system used in the RSD torso phantom experiment. The organ activity estimates obtained from the CPlanar, QPlanar and QSPECT methods from both experiments were compared. From the results of the MCS experiment, even with ideal organ overlap correction and background subtraction, CPlanar methods provided limited quantitative accuracy. The QPlanar method with accurate modelling of the physical factors increased the quantitative accuracy at the cost of requiring estimates of the organ VOIs in 3D. The accuracy of QPlanar approached that of QSPECT, but required much less acquisition and computation time. Similar results were obtained from the physical phantom experiment. We conclude that the QPlanar method, based
DEFF Research Database (Denmark)
Wolters, Birgit; Jacquiod, Samuel Jehan Auguste; Sørensen, Søren Johannes
2018-01-01
Organic soil fertilizers, such as livestock manure and biogas digestate, frequently contain bacteria carrying resistance genes (RGs) to antimicrobial substances and mobile genetic elements (MGEs). The effects of different fertilizers (inorganic, manure, digestate) on RG and MGE abundance...... and microbial community composition were investigated in a field plot experiment. The relative abundances of RGs [sul1, sul2, tet(A), tet(M), tet(Q), tet(W), qacEΔ1/qacE] and MGEs [intI1, intI2, IncP-1, IncP-1ε and LowGC plasmids] in total community (TC)-DNA from organic fertilizers, bulk soil and maize......, integrons and few genera affiliated to Bacteroidetes and Firmicutes in bulk soil, while digestate increased sul2, tet(W) and intI2. At harvest, treatment effects vanished in bulk soil. However, organic fertilizer effects were still detectable in the rhizosphere for RGs [manure: intI1, sul1; digestate: tet...
Msx homeobox gene family and craniofacial development.
Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping
2003-12-01
Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.
Models of natural computation : gene assembly and membrane systems
Brijder, Robert
2008-01-01
This thesis is concerned with two research areas in natural computing: the computational nature of gene assembly and membrane computing. Gene assembly is a process occurring in unicellular organisms called ciliates. During this process genes are transformed through cut-and-paste operations. We
Phylogenetic origin and diversification of RNAi pathway genes in insects
DEFF Research Database (Denmark)
Dowling, Daniel; Pauli, Thomas; Donath, Alexander
2016-01-01
RNAinterference (RNAi) refers tothe set ofmolecular processes foundin eukaryotic organisms in which smallRNAmolecules mediate the silencing or down-regulation of target genes. In insects, RNAi serves a number of functions, including regulation of endogenous genes, anti-viral defense, and defense...... against transposable elements. Despite being well studied in model organisms, such as Drosophila, the distribution of core RNAi pathway genes and their evolution in insects is not well understood. Here we present the most comprehensive overview of the distribution and diversity of core RNAi pathway genes...... across 100 insect species, encompassing all currently recognized insect orders. We inferred the phylogenetic origin of insect-specific RNAi pathway genes and also identified several hitherto unrecorded gene expansions using whole-body transcriptome data from the international 1KITE (1000 Insect...
Co-evolution of affinity and stability of grafted amyloid-motif domain antibodies.
Julian, Mark C; Lee, Christine C; Tiller, Kathryn E; Rabia, Lilia A; Day, Evan K; Schick, Arthur J; Tessier, Peter M
2015-10-01
An attractive approach for designing lead antibody candidates is to mimic natural protein interactions by grafting peptide recognition motifs into the complementarity-determining regions (CDRs). We are using this approach to generate single-domain (VH) antibodies specific for amyloid-forming proteins such as the Alzheimer's Aβ peptide. Here, we use random mutagenesis and yeast surface display to improve the binding affinity of a lead VH domain grafted with Aβ residues 33-42 in CDR3. Interestingly, co-selection for improved Aβ binding and VH display on the surface of yeast yields antibody domains with improved affinity and reduced stability. The highest affinity VH domains were strongly destabilized on the surface of yeast as well as unfolded when isolated as autonomous domains. In contrast, stable VH domains with improved affinity were reliably identified using yeast surface display by replacing the display antibody that recognizes a linear epitope tag at the terminus of both folded and unfolded VH domains with a conformational ligand (Protein A) that recognizes a discontinuous epitope on the framework of folded VH domains. Importantly, we find that selection for improved stability using Protein A without simultaneous co-selection for improved Aβ binding leads to strong enrichment for stabilizing mutations that reduce antigen binding. Our findings highlight the importance of simultaneously optimizing affinity and stability to improve the rapid isolation of well-folded and specific antibody fragments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Alquicer, Glenda; Silva-Gómez, Adriana B; Peralta, Fernando; Flores, Gonzalo
2004-04-01
The neonatal ventral Hippocampus (nVH) lesion in rats has been used as a model to test the hypothesis that early neurodevelopmental abnormalities lead to behavioral changes putatively linked to schizophrenia. The schizophrenic patients tend to social isolation. In addition, considerable evidence from behavioral and neurochemistry studies strongly implicate the dopamine (DA) system and the medial part of the prefrontal cortex (mPFC) in the pathophysiology of the social isolation syndrome. In order to assess effects of the postweaning social isolation (pwSI) on the DA system of the nVH lesions, we investigated the DA content and its metabolite, DOPAC in different limbic subregions in rats postpubertally at postnatal day (P) 78 following nVH lesions at P7 with and without pwSI for 8 weeks. The DA and DOPAC were measured by HPLC with electrochemical detection. The nVH lesion induces increase in the DA content in the hippocampus with no effect in the mPFC, nucleus accumbens and caudate-putamen, while the pwSI induces major increase in the DA content in limbic subregions such as the mPFC, nucleus accumbens and hipocampus with opposite effect in the caudate-putamen. These results suggest that while pwSI has an effect in the postpubertal content of DA in both sham and nVH lesions in rats, the nVH-lesioned rats appear to be affected to a greater extent than the sham animals underscoring the influence of pwSI differences in the development of behaviors in the nVH-lesioned animals.
Sheng, Wei-Jin; Miao, Qing-Fang; Zhen, Yong-Su
2009-06-01
Recent studies have shown that epidermal growth factor receptor (EGFR) is an important target for cancer therapy. The present study prepared single chain Fv (scFv) directed against EGFR. Balb/c mice were immunized by human carcinoma A431 cells, and total RNA of the splenic cells was extracted. VH and VL gene fragments were amplified by RT-PCR and further joined into scFv gene with a linker, then scFv gene fragments were ligated into the phagemid vector pCANTAB 5E. The phagemid containing scFv were transformed into electro-competent E. coli TG1 cells. The recombinant phage antibody library was constructed through rescuing the transformed cells with help phage M13K07. The specified recombinant phages were enriched through 5 rounds of affinity panning and the anti-EGFR phage scFv clones were screened and identified with ELISA. A total of 48 clones from the library were selected randomly and 45 clones were identified positive. After infecting E. coli HB2151 cells with one positive clone, soluble recombinant antibodies about 27 kD were produced and located in the periplasm and the supernatant. The result of sequencing showed that the scFv gene was 768 bp, which encoded 256 amino acid residues. VH and VL including 3 CDRs and 4 FRs, respectively, were all homologous to mouse Ig. The soluble scFv showed the specific binding activity to purified EGFR and EGFR located in carcinoma cell membrane. The successful preparation of anti-EGFR scFv will provide an EGFR targeted molecule for the development of antibody-based drugs and biological therapy of cancer.
Kannan, Lavanya; Li, Hua; Rubinstein, Boris; Mushegian, Arcady
2013-12-19
The problem of probabilistic inference of gene content in the last common ancestor of several extant species with completely sequenced genomes is: for each gene that is conserved in all or some of the genomes, assign the probability that its ancestral gene was present in the genome of their last common ancestor. We have developed a family of models of gene gain and gene loss in evolution, and applied the maximum-likelihood approach that uses phylogenetic tree of prokaryotes and the record of orthologous relationships between their genes to infer the gene content of LUCA, the Last Universal Common Ancestor of all currently living cellular organisms. The crucial parameter, the ratio of gene losses and gene gains, was estimated from the data and was higher in models that take account of the number of in-paralogs in genomes than in models that treat gene presences and absences as a binary trait. While the numbers of genes that are placed confidently into LUCA are similar in the ML methods and in previously published methods that use various parsimony-based approaches, the identities of genes themselves are different. Most of the models of either kind treat the genes found in many existing genomes in a similar way, assigning to them high probabilities of being ancestral ("high ancestrality"). The ML models are more likely than others to assign high ancestrality to the genes that are relatively rare in the present-day genomes.
Carlsbecker, Annelie; Sundström, Jens; Tandre, Karolina; Englund, Marie; Kvarnheden, Anders; Johanson, Urban; Engström, Peter
2003-01-01
Transcription factors encoded by different members of the MADS-box gene family have evolved central roles in the regulation of reproductive organ development in the flowering plants, the angiosperms. Development of the stamens and carpels, the pollen- and seed-bearing organs, involves the B- and C-organ-identity MADS-box genes. B- and C-type gene orthologs with activities specifically in developing pollen- and seed-bearing organs are also present in the distantly related gymnosperms: the conifers and the gnetophytes. We now report on the characterization of DAL10, a novel MADS-box gene from the conifer Norway spruce, which unlike the B- and C-type conifer genes shows no distinct orthology relationship to any angiosperm gene or clade in phylogenetic analyses. Like the B- and C-type genes, it is active specifically in developing pollen cones and seed cones. In situ RNA localization experiments show DAL10 to be expressed in the cone axis, which carry the microsporophylls of the young pollen cone. In contrast, in the seed cone it is expressed both in the cone axis and in the bracts, which subtend the ovuliferous scales. Expression data and the phenotype of transgenic Arabidopsis plants expressing DAL10 suggest that the gene may act upstream to or in concert with the B- and C-type genes in the establishment of reproductive identity of developing cones.
Genomic organization and evolution of the Atlantic salmon hemoglobin repertoire
Directory of Open Access Journals (Sweden)
Phillips Ruth B
2010-10-01
Full Text Available Abstract Background The genomes of salmonids are considered pseudo-tetraploid undergoing reversion to a stable diploid state. Given the genome duplication and extensive biological data available for salmonids, they are excellent model organisms for studying comparative genomics, evolutionary processes, fates of duplicated genes and the genetic and physiological processes associated with complex behavioral phenotypes. The evolution of the tetrapod hemoglobin genes is well studied; however, little is known about the genomic organization and evolution of teleost hemoglobin genes, particularly those of salmonids. The Atlantic salmon serves as a representative salmonid species for genomics studies. Given the well documented role of hemoglobin in adaptation to varied environmental conditions as well as its use as a model protein for evolutionary analyses, an understanding of the genomic structure and organization of the Atlantic salmon α and β hemoglobin genes is of great interest. Results We identified four bacterial artificial chromosomes (BACs comprising two hemoglobin gene clusters spanning the entire α and β hemoglobin gene repertoire of the Atlantic salmon genome. Their chromosomal locations were established using fluorescence in situ hybridization (FISH analysis and linkage mapping, demonstrating that the two clusters are located on separate chromosomes. The BACs were sequenced and assembled into scaffolds, which were annotated for putatively functional and pseudogenized hemoglobin-like genes. This revealed that the tail-to-tail organization and alternating pattern of the α and β hemoglobin genes are well conserved in both clusters, as well as that the Atlantic salmon genome houses substantially more hemoglobin genes, including non-Bohr β globin genes, than the genomes of other teleosts that have been sequenced. Conclusions We suggest that the most parsimonious evolutionary path leading to the present organization of the Atlantic salmon
Genomic organization and evolution of the Atlantic salmon hemoglobin repertoire
2010-01-01
Background The genomes of salmonids are considered pseudo-tetraploid undergoing reversion to a stable diploid state. Given the genome duplication and extensive biological data available for salmonids, they are excellent model organisms for studying comparative genomics, evolutionary processes, fates of duplicated genes and the genetic and physiological processes associated with complex behavioral phenotypes. The evolution of the tetrapod hemoglobin genes is well studied; however, little is known about the genomic organization and evolution of teleost hemoglobin genes, particularly those of salmonids. The Atlantic salmon serves as a representative salmonid species for genomics studies. Given the well documented role of hemoglobin in adaptation to varied environmental conditions as well as its use as a model protein for evolutionary analyses, an understanding of the genomic structure and organization of the Atlantic salmon α and β hemoglobin genes is of great interest. Results We identified four bacterial artificial chromosomes (BACs) comprising two hemoglobin gene clusters spanning the entire α and β hemoglobin gene repertoire of the Atlantic salmon genome. Their chromosomal locations were established using fluorescence in situ hybridization (FISH) analysis and linkage mapping, demonstrating that the two clusters are located on separate chromosomes. The BACs were sequenced and assembled into scaffolds, which were annotated for putatively functional and pseudogenized hemoglobin-like genes. This revealed that the tail-to-tail organization and alternating pattern of the α and β hemoglobin genes are well conserved in both clusters, as well as that the Atlantic salmon genome houses substantially more hemoglobin genes, including non-Bohr β globin genes, than the genomes of other teleosts that have been sequenced. Conclusions We suggest that the most parsimonious evolutionary path leading to the present organization of the Atlantic salmon hemoglobin genes involves
A circadian gene expression atlas in mammals: implications for biology and medicine.
Zhang, Ray; Lahens, Nicholas F; Ballance, Heather I; Hughes, Michael E; Hogenesch, John B
2014-11-11
To characterize the role of the circadian clock in mouse physiology and behavior, we used RNA-seq and DNA arrays to quantify the transcriptomes of 12 mouse organs over time. We found 43% of all protein coding genes showed circadian rhythms in transcription somewhere in the body, largely in an organ-specific manner. In most organs, we noticed the expression of many oscillating genes peaked during transcriptional "rush hours" preceding dawn and dusk. Looking at the genomic landscape of rhythmic genes, we saw that they clustered together, were longer, and had more spliceforms than nonoscillating genes. Systems-level analysis revealed intricate rhythmic orchestration of gene pathways throughout the body. We also found oscillations in the expression of more than 1,000 known and novel noncoding RNAs (ncRNAs). Supporting their potential role in mediating clock function, ncRNAs conserved between mouse and human showed rhythmic expression in similar proportions as protein coding genes. Importantly, we also found that the majority of best-selling drugs and World Health Organization essential medicines directly target the products of rhythmic genes. Many of these drugs have short half-lives and may benefit from timed dosage. In sum, this study highlights critical, systemic, and surprising roles of the mammalian circadian clock and provides a blueprint for advancement in chronotherapy.
Lee, Sang-Hoon; Park, Yun-Ji; Park, Sang Un; Lee, Sang-Won; Kim, Seong-Cheol; Jung, Chan-Sik; Jang, Jae-Ki; Hur, Yoonkang; Kim, Yeon Bok
2017-05-30
Members of the genus Ixeris have long been used in traditional medicines as stomachics, sedatives, and diuretics. Phenylalanine ammonia-lyase (PAL), cinnamate-4-hydroxylase (C4H), 4-coumarate: coenzyme-A (CoA) ligase (4CL), chalcone synthase (CHS), and dihydroflavonol 4-reductase (DFR) are important enzymes in the phenylpropanoid pathway. In this study, we analyzed seven genes from Ixeris dentata var. albiflora that are involved in phenylpropanoid biosynthesis, using an Illumina/Solexa HiSeq 2000 platform. The amino acid sequence alignments for IdPAL s, IdC4H, Id4CL s, IdCHS , and IdDFR showed high identity to sequences from other plants. We also investigated transcript levels using quantitative real-time PCR, and analyzed the accumulation of phenylpropanoids in different organs of I. dentata var. albiflora using high-performance liquid chromatography. The transcript levels of IdC4H, Id4CL1 , IdCHS , and IdDFR were highest in the leaf. The catechin, chlorogenic acid, ferulic acid, and quercetin contents were also highest in the leaf. We suggest that expression of IdC4H, Id4CL1 , IdCHS , and IdDFR is associated with the accumulation of phenylpropanoids. Our results may provide baseline information for elucidating the mechanism of phenylpropanoid biosynthesis in different organs of I. dentata var. albiflora .
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Toxic Diatom Aldehydes Affect Defence Gene Networks in Sea Urchins.
Directory of Open Access Journals (Sweden)
Stefano Varrella
Full Text Available Marine organisms possess a series of cellular strategies to counteract the negative effects of toxic compounds, including the massive reorganization of gene expression networks. Here we report the modulated dose-dependent response of activated genes by diatom polyunsaturated aldehydes (PUAs in the sea urchin Paracentrotus lividus. PUAs are secondary metabolites deriving from the oxidation of fatty acids, inducing deleterious effects on the reproduction and development of planktonic and benthic organisms that feed on these unicellular algae and with anti-cancer activity. Our previous results showed that PUAs target several genes, implicated in different functional processes in this sea urchin. Using interactomic Ingenuity Pathway Analysis we now show that the genes targeted by PUAs are correlated with four HUB genes, NF-κB, p53, δ-2-catenin and HIF1A, which have not been previously reported for P. lividus. We propose a working model describing hypothetical pathways potentially involved in toxic aldehyde stress response in sea urchins. This represents the first report on gene networks affected by PUAs, opening new perspectives in understanding the cellular mechanisms underlying the response of benthic organisms to diatom exposure.
A functional gene array for detection of bacterial virulence elements
Energy Technology Data Exchange (ETDEWEB)
Jaing, C
2007-11-01
We report our development of the first of a series of microarrays designed to detect pathogens with known mechanisms of virulence and antibiotic resistance. By targeting virulence gene families as well as genes unique to specific biothreat agents, these arrays will provide important data about the pathogenic potential and drug resistance profiles of unknown organisms in environmental samples. To validate our approach, we developed a first generation array targeting genes from Escherichia coli strains K12 and CFT073, Enterococcus faecalis and Staphylococcus aureus. We determined optimal probe design parameters for microorganism detection and discrimination, measured the required target concentration, and assessed tolerance for mismatches between probe and target sequences. Mismatch tolerance is a priority for this application, due to DNA sequence variability among members of gene families. Arrays were created using the NimbleGen Maskless Array Synthesizer at Lawrence Livermore National Laboratory. Purified genomic DNA from combinations of one or more of the four target organisms, pure cultures of four related organisms, and environmental aerosol samples with spiked-in genomic DNA were hybridized to the arrays. Based on the success of this prototype, we plan to design further arrays in this series, with the goal of detecting all known virulence and antibiotic resistance gene families in a greatly expanded set of organisms.
Evidence against the energetic cost hypothesis for the short introns in highly expressed genes
Directory of Open Access Journals (Sweden)
Niu Deng-Ke
2008-05-01
Full Text Available Abstract Background In animals, the moss Physcomitrella patens and the pollen of Arabidopsis thaliana, highly expressed genes have shorter introns than weakly expressed genes. A popular explanation for this is selection for transcription efficiency, which includes two sub-hypotheses: to minimize the energetic cost or to minimize the time cost. Results In an individual human, different organs may differ up to hundreds of times in cell number (for example, a liver versus a hypothalamus. Considered at the individual level, a gene specifically expressed in a large organ is actually transcribed tens or hundreds of times more than a gene with a similar expression level (a measure of mRNA abundance per cell specifically expressed in a small organ. According to the energetic cost hypothesis, the former should have shorter introns than the latter. However, in humans and mice we have not found significant differences in intron length between large-tissue/organ-specific genes and small-tissue/organ-specific genes with similar expression levels. Qualitative estimation shows that the deleterious effect (that is, the energetic burden of long introns in highly expressed genes is too negligible to be efficiently selected against in mammals. Conclusion The short introns in highly expressed genes should not be attributed to energy constraint. We evaluated evidence for the time cost hypothesis and other alternatives.
Visual Hallucinations in PD and Lewy Body Dementias: Old and New Hypotheses
Directory of Open Access Journals (Sweden)
M. Onofrj
2013-01-01
Full Text Available Visual Hallucinations (VH are a common non-motor symptom of Parkinson’s Disease (PD and the Lewy body dementias (LBD of Parkinson's disease with dementia (PDD and Dementia with Lewy Bodies (DLB. The origin of VH in PD and LBD is debated: earlier studies considered a number of different possible mechanisms underlying VH including visual disorders, Rapid Eye Movement (REM Sleep Intrusions, dysfunctions of top down or bottom up visual pathways, and neurotransmitter imbalance.
Potential renal toxicity bio-markers indicating radiation injury after 177Lu-octreotate treatment
International Nuclear Information System (INIS)
Dalmo, J.; Forssell-Aronsson, E.; Westberg, E.; Toernqvist, M.; Svedborn, L.; Barregaerd, L.
2015-01-01
Full text of publication follows. The kidneys are one of the most exposed non-tumor tissues and regarded as one of the main dose-limiting organs in peptide receptor radionuclide therapy (PRRT). [ 177 Lu-DOTA0, Tyr3]-octreotate ( 177 Lu-octreotate) has shown promising results in the treatment of somatostatin receptor over-expressing neuroendocrine tumors, but optimization is still needed. The ability to give each patient as much 177 Lu-octreotate as possible without inducing nephrotoxicity is necessary for an efficient treatment. However, due to large inter-individual differences in uptake and retention in the kidneys, there is a need for efficient methods that can indicate renal injury early. A possible way is to identify bio-markers for high risk of radiation nephrotoxicity. The aim of this study was to investigate the potential of using urinary retinol binding protein (RBP), and blood valinhydantoin (VH) as bio-markers of nephrotoxicity on adult mice after 177 Lu-octreotate treatment. BALB/c nude mice (n=6/group) were i.v. injected with 60 MBq or 120 MBq of 177 Lu-octreotate. The control group was mock treated with saline. Spot urine samples were collected before injection, and 14, 30, 60 and 90 days after injection. Analysis of RBP4 and creatinine was performed using Mouse RBP4 ELISA kit and Creatinine kit from R/D Systems, respectively. Erythrocytes were separated from whole blood samples collected 90 days after injection, and analysed for VH by LC-MS/MS. The ratio between VH and a volumetric standard was calculated. The RBP/creatinine level increased with time in both groups given 177 Lu-octreotate, with earlier and higher response for the 120 MBq group. No clear change in VH level between the different groups was observed. The results show that RBP may be a promising new bio-marker for radiation induced kidney toxicity. The presently used method based on VH was not sensitive enough to be used as kidney toxicity marker. Further studies on mice are ongoing to
Melatonin Receptor Genes in Vertebrates
Directory of Open Access Journals (Sweden)
Hua Dong Yin
2013-05-01
Full Text Available Melatonin receptors are members of the G protein-coupled receptor (GPCR family. Three genes for melatonin receptors have been cloned. The MT1 (or Mel1a or MTNR1A and MT2 (or Mel1b or MTNR1B receptor subtypes are present in humans and other mammals, while an additional melatonin receptor subtype, Mel1c (or MTNR1C, has been identified in fish, amphibians and birds. Another melatonin related orphan receptor, GPR50, which does not bind melatonin, is found exclusively in mammals. The hormone melatonin is secreted primarily by the pineal gland, with highest levels occurring during the dark period of a circadian cycle. This hormone acts systemically in numerous organs. In the brain, it is involved in the regulation of various neural and endocrine processes, and it readjusts the circadian pacemaker, the suprachiasmatic nucleus. This article reviews recent studies of gene organization, expression, evolution and mutations of melatonin receptor genes of vertebrates. Gene polymorphisms reveal that numerous mutations are associated with diseases and disorders. The phylogenetic analysis of receptor genes indicates that GPR50 is an outgroup to all other melatonin receptor sequences. GPR50 may have separated from a melatonin receptor ancestor before the split between MTNR1C and the MTNR1A/B ancestor.
New Erwinia-Like Organism Causing Cervical Lymphadenitis▿
Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo
2008-01-01
The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665
Using riboswitches to regulate gene expression and define gene function in mycobacteria.
Van Vlack, Erik R; Seeliger, Jessica C
2015-01-01
Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Nagayasu Nakanishi
Full Text Available In Bilateria, Pax6, Six, Eya and Dach families of transcription factors underlie the development and evolution of morphologically and phyletically distinct eyes, including the compound eyes in Drosophila and the camera-type eyes in vertebrates, indicating that bilaterian eyes evolved under the strong influence of ancestral developmental gene regulation. However the conservation in eye developmental genetics deeper in the Eumetazoa, and the origin of the conserved gene regulatory apparatus controlling eye development remain unclear due to limited comparative developmental data from Cnidaria. Here we show in the eye-bearing scyphozoan cnidarian Aurelia that the ectodermal photosensory domain of the developing medusa sensory structure known as the rhopalium expresses sine oculis (so/six1/2 and eyes absent/eya, but not optix/six3/6 or pax (A&B. In addition, the so and eya co-expression domain encompasses the region of active cell proliferation, neurogenesis, and mechanoreceptor development in rhopalia. Consistent with the role of so and eya in rhopalial development, developmental transcriptome data across Aurelia life cycle stages show upregulation of so and eya, but not optix or pax (A&B, during medusa formation. Moreover, pax6 and dach are absent in the Aurelia genome, and thus are not required for eye development in Aurelia. Our data are consistent with so and eya, but not optix, pax or dach, having conserved functions in sensory structure specification across Eumetazoa. The lability of developmental components including Pax genes relative to so-eya is consistent with a model of sense organ development and evolution that involved the lineage specific modification of a combinatorial code that specifies animal sense organs.
Epithelial Cell Gene Expression Induced by Intracellular Staphylococcus aureus
Directory of Open Access Journals (Sweden)
Xianglu Li
2009-01-01
Full Text Available HEp-2 cell monolayers were cocultured with intracellular Staphylococcus aureus, and changes in gene expression were profiled using DNA microarrays. Intracellular S. aureus affected genes involved in cellular stress responses, signal transduction, inflammation, apoptosis, fibrosis, and cholesterol biosynthesis. Transcription of stress response and signal transduction-related genes including atf3, sgk, map2k1, map2k3, arhb, and arhe was increased. In addition, elevated transcription of proinflammatory genes was observed for tnfa, il1b, il6, il8, cxcl1, ccl20, cox2, and pai1. Genes involved in proapoptosis and fibrosis were also affected at transcriptional level by intracellular S. aureus. Notably, intracellular S. aureus induced strong transcriptional down-regulation of several cholesterol biosynthesis genes. These results suggest that epithelial cells respond to intracellular S. aureus by inducing genes affecting immunity and in repairing damage caused by the organism, and are consistent with the possibility that the organism exploits an intracellular environment to subvert host immunity and promote colonization.
Wang, Yinliang; Chen, Qi; Zhao, Hanbo; Ren, Bingzhong
2016-01-01
The leaf beetle Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae) is a predominant forest pest that causes substantial damage to the lumber industry and city management. However, no effective and environmentally friendly chemical method has been discovered to control this pest. Until recently, the molecular basis of the olfactory system in A. quadriimpressum was completely unknown. In this study, antennae and leg transcriptomes were analyzed and compared using deep sequencing data to identify the olfactory genes in A. quadriimpressum. Moreover, the expression profiles of both male and female candidate olfactory genes were analyzed and validated by bioinformatics, motif analysis, homology analysis, semi-quantitative RT-PCR and RT-qPCR experiments in antennal and non-olfactory organs to explore the candidate olfactory genes that might play key roles in the life cycle of A. quadriimpressum. As a result, approximately 102.9 million and 97.3 million clean reads were obtained from the libraries created from the antennas and legs, respectively. Annotation led to 34344 Unigenes, which were matched to known proteins. Annotation data revealed that the number of genes in antenna with binding functions and receptor activity was greater than that of legs. Furthermore, many pathway genes were differentially expressed in the two organs. Sixteen candidate odorant binding proteins (OBPs), 10 chemosensory proteins (CSPs), 34 odorant receptors (ORs), 20 inotropic receptors [1] and 2 sensory neuron membrane proteins (SNMPs) and their isoforms were identified. Additionally, 15 OBPs, 9 CSPs, 18 ORs, 6 IRs and 2 SNMPs were predicted to be complete ORFs. Using RT-PCR, RT-qPCR and homology analysis, AquaOBP1/2/4/7/C1/C6, AquaCSP3/9, AquaOR8/9/10/14/15/18/20/26/29/33, AquaIR8a/13/25a showed olfactory-specific expression, indicating that these genes might play a key role in olfaction-related behaviors in A. quadriimpressum such as foraging and seeking. AquaOBP4/C5, AquaOBP4/C5, AquaCSP7
Directory of Open Access Journals (Sweden)
Yinliang Wang
Full Text Available The leaf beetle Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae is a predominant forest pest that causes substantial damage to the lumber industry and city management. However, no effective and environmentally friendly chemical method has been discovered to control this pest. Until recently, the molecular basis of the olfactory system in A. quadriimpressum was completely unknown. In this study, antennae and leg transcriptomes were analyzed and compared using deep sequencing data to identify the olfactory genes in A. quadriimpressum. Moreover, the expression profiles of both male and female candidate olfactory genes were analyzed and validated by bioinformatics, motif analysis, homology analysis, semi-quantitative RT-PCR and RT-qPCR experiments in antennal and non-olfactory organs to explore the candidate olfactory genes that might play key roles in the life cycle of A. quadriimpressum. As a result, approximately 102.9 million and 97.3 million clean reads were obtained from the libraries created from the antennas and legs, respectively. Annotation led to 34344 Unigenes, which were matched to known proteins. Annotation data revealed that the number of genes in antenna with binding functions and receptor activity was greater than that of legs. Furthermore, many pathway genes were differentially expressed in the two organs. Sixteen candidate odorant binding proteins (OBPs, 10 chemosensory proteins (CSPs, 34 odorant receptors (ORs, 20 inotropic receptors [1] and 2 sensory neuron membrane proteins (SNMPs and their isoforms were identified. Additionally, 15 OBPs, 9 CSPs, 18 ORs, 6 IRs and 2 SNMPs were predicted to be complete ORFs. Using RT-PCR, RT-qPCR and homology analysis, AquaOBP1/2/4/7/C1/C6, AquaCSP3/9, AquaOR8/9/10/14/15/18/20/26/29/33, AquaIR8a/13/25a showed olfactory-specific expression, indicating that these genes might play a key role in olfaction-related behaviors in A. quadriimpressum such as foraging and seeking. AquaOBP4/C5, Aqua
2013-01-01
Background The problem of probabilistic inference of gene content in the last common ancestor of several extant species with completely sequenced genomes is: for each gene that is conserved in all or some of the genomes, assign the probability that its ancestral gene was present in the genome of their last common ancestor. Results We have developed a family of models of gene gain and gene loss in evolution, and applied the maximum-likelihood approach that uses phylogenetic tree of prokaryotes and the record of orthologous relationships between their genes to infer the gene content of LUCA, the Last Universal Common Ancestor of all currently living cellular organisms. The crucial parameter, the ratio of gene losses and gene gains, was estimated from the data and was higher in models that take account of the number of in-paralogs in genomes than in models that treat gene presences and absences as a binary trait. Conclusion While the numbers of genes that are placed confidently into LUCA are similar in the ML methods and in previously published methods that use various parsimony-based approaches, the identities of genes themselves are different. Most of the models of either kind treat the genes found in many existing genomes in a similar way, assigning to them high probabilities of being ancestral (“high ancestrality”). The ML models are more likely than others to assign high ancestrality to the genes that are relatively rare in the present-day genomes. Reviewers This article was reviewed by Martijn A Huynen, Toni Gabaldón and Fyodor Kondrashov. PMID:24354654
Conners, Rebecca; Konarev, Alexander V; Forsyth, Jane; Lovegrove, Alison; Marsh, Justin; Joseph-Horne, Timothy; Shewry, Peter; Brady, R Leo
2007-09-21
The storage tissues of many plants contain protease inhibitors that are believed to play an important role in defending the plant from invasion by pests and pathogens. These proteinaceous inhibitor molecules belong to a number of structurally distinct families. We describe here the isolation, purification, initial inhibitory properties, and three-dimensional structure of a novel trypsin inhibitor from seeds of Veronica hederifolia (VhTI). The VhTI peptide inhibits trypsin with a submicromolar apparent K(i) and is expected to be specific for trypsin-like serine proteases. VhTI differs dramatically in structure from all previously described families of trypsin inhibitors, consisting of a helix-turn-helix motif, with the two alpha helices tightly associated by two disulfide bonds. Unusually, the crystallized complex is in the form of a stabilized acyl-enzyme intermediate with the scissile bond of the VhTI inhibitor cleaved and the resulting N-terminal portion of the inhibitor remaining attached to the trypsin catalytic serine 195 by an ester bond. A synthetic, truncated version of the VhTI peptide has also been produced and co-crystallized with trypsin but, surprisingly, is seen to be uncleaved and consequently forms a noncovalent complex with trypsin. The VhTI peptide shows that effective enzyme inhibitors can be constructed from simple helical motifs and provides a new scaffold on which to base the design of novel serine protease inhibitors.
Directory of Open Access Journals (Sweden)
Baseler Michael W
2007-11-01
Full Text Available Abstract Background Due to the complex and distributed nature of biological research, our current biological knowledge is spread over many redundant annotation databases maintained by many independent groups. Analysts usually need to visit many of these bioinformatics databases in order to integrate comprehensive annotation information for their genes, which becomes one of the bottlenecks, particularly for the analytic task associated with a large gene list. Thus, a highly centralized and ready-to-use gene-annotation knowledgebase is in demand for high throughput gene functional analysis. Description The DAVID Knowledgebase is built around the DAVID Gene Concept, a single-linkage method to agglomerate tens of millions of gene/protein identifiers from a variety of public genomic resources into DAVID gene clusters. The grouping of such identifiers improves the cross-reference capability, particularly across NCBI and UniProt systems, enabling more than 40 publicly available functional annotation sources to be comprehensively integrated and centralized by the DAVID gene clusters. The simple, pair-wise, text format files which make up the DAVID Knowledgebase are freely downloadable for various data analysis uses. In addition, a well organized web interface allows users to query different types of heterogeneous annotations in a high-throughput manner. Conclusion The DAVID Knowledgebase is designed to facilitate high throughput gene functional analysis. For a given gene list, it not only provides the quick accessibility to a wide range of heterogeneous annotation data in a centralized location, but also enriches the level of biological information for an individual gene. Moreover, the entire DAVID Knowledgebase is freely downloadable or searchable at http://david.abcc.ncifcrf.gov/knowledgebase/.
Expansion of B-1a cells with germline heavy chain sequence in lupus mice
Directory of Open Access Journals (Sweden)
Nichol E Holodick
2016-03-01
Full Text Available B6.Sle1.Sle2.Sle3 (B6.TC lupus-prone mice carrying the NZB allele of Cdkn2c, encoding for the cyclin-dependent kinase inhibitor P18INK4, accumulate B-1a cells due to a higher rate of proliferative self-renewal. However, it is unclear whether this affects primarily early appearing B-1a cells of fetal origin or later appearing B-1a cells that emerge from bone marrow. B-1a cells are the major source of natural autoantibodies, and it has been shown that their protective nature is associated with a germline-like sequence, which is characterized by few N-nucleotide insertions and a repertoire skewed towards rearrangements predominated during fetal life, VH11 and VH12. To determine the nature of B-1a cells expanded in B6.TC mice, we amplified immunoglobulin genes by PCR from single cells in mice. Sequencing showed a significantly higher proportion of B-1a cell antibodies display fewer N-additions in B6.TC mice than in B6 control mice. Following this lower number of N-insertions within the CDR-H3 region, the B6.TC B-1a cells display shorter CDR-H3 length than B6 B-1a cells. The absence of N-additions is a surrogate for fetal origin, as TdT expression starts after birth in mice. Therefore, our results suggest that the B-1a cell population is not only expanded in autoimmune B6.TC mice but also qualitatively different with the majority of cells from fetal origin. Accordingly, our sequencing results also demonstrated overuse of VH11 and VH12 in autoimmune B6.TC mice as compared to B6 controls. These results suggest that the development of lupus autoantibodies in these mice is coupled with skewing of the B-1a cell repertoire and possible retention of protective natural antibodies.
Jia, Chen; Qian, Hong; Chen, Min; Zhang, Michael Q.
2018-03-01
The transient response to a stimulus and subsequent recovery to a steady state are the fundamental characteristics of a living organism. Here we study the relaxation kinetics of autoregulatory gene networks based on the chemical master equation model of single-cell stochastic gene expression with nonlinear feedback regulation. We report a novel relation between the rate of relaxation, characterized by the spectral gap of the Markov model, and the feedback sign of the underlying gene circuit. When a network has no feedback, the relaxation rate is exactly the decaying rate of the protein. We further show that positive feedback always slows down the relaxation kinetics while negative feedback always speeds it up. Numerical simulations demonstrate that this relation provides a possible method to infer the feedback topology of autoregulatory gene networks by using time-series data of gene expression.
The Role of Integrated Gas Compounds in Regulation of Gas Homeostasis in the Norm
Alexander G. Kruglov; Valery N. Utkin; Alexander Yu. Vasilyev
2017-01-01
In practically healthy people on the background of self-breathing, we used catheterization to obtain blood samples from Ao, PT, SC, VJI, SS, VH and VR. We believe that the standard tests of blood gases by volume (pO2 and pCO2) and their A-V gradients, quantitatively determined, are insufficient to fully assess the hypoxic states both in the whole organism and in individual organs. To estimate gas homeokinesis, we performed integral gas tests, including an additive criterion of blood gases—pr...
Candidate innate immune system gene expression in the ecological model Daphnia.
Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J
2011-10-01
The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive
Dunfield, K. E.; Gaiero, J. R.; Condron, L.
2017-12-01
Healthy and diverse communities of soil organisms influence key soil ecosystem services such as carbon sequestration, water quality protection, climate regulation and nutrient cycling. Microbially driven mineralization of organic phosphorus is an important contributor to plant available inorganic orthophosphates. In acidic soils, microbes produce non-specific acid phosphatases (NSAPs) which act on common forms of organic phosphorus (P). Our current understanding of P turnover in soils has been limited by lack of research tools capable of targeting these genes. Thus, we developed a set of oligonucleotide PCR primers that targeted bacteria with the genetic potential for acid phosphatase production. A long term randomized-block pasture trial was sampled following 22 years of continued aerial biomass removal and retention. Primers were used to target genes encoding alkaline phosphatase (phoD) and the three classes (CAAP, CBAP, CCAP) of non-specific acid phosphatases. PCR amplicons targeting total genes and gene transcripts were sequenced using Illumina MiSeq to understand the diversity of the bacterial phosphatase producing communities. In general, the majority of operational taxonomic units (OTUs) were shared across both treatments and across metagenomes and transcriptomes. However, analysis of DNA OTUs revealed significantly different communities driven by treatment differences (P reduced Olsen P levels (15 vs. 36 mg kg-1 in retained treatment). Acid phosphatase activity was measured in all samples, and found to be highest in the biomass retained treatment (16.8 vs. 11.4 µmol g-1 dry soil h-1), likely elevated due to plant-derived enzymes; however, was still correlated to bacterial gene abundances. Overall, the phosphatase producing microbial communities responded to the effect of consistent P limitation as expected, through alteration in the composition of the community structure and through increased levels of gene expression of the phosphatase genes.
Directory of Open Access Journals (Sweden)
Ashley Lisa
2010-05-01
Full Text Available Abstract Background Increasingly, multiple intervention programming is being understood and implemented as a key approach to developing public health initiatives and strategies. Using socio-ecological and population health perspectives, multiple intervention programming approaches are aimed at providing coordinated and strategic comprehensive programs operating over system levels and across sectors, allowing practitioners and decision makers to take advantage of synergistic effects. These approaches also require vertical and horizontal (v/h integration of policy and practice in order to be maximally effective. Discussion This paper examines v/h integration of interventions for childhood overweight/obesity prevention and reduction from a Canadian perspective. It describes the implications of v/h integration for childhood overweight and obesity prevention, with examples of interventions where v/h integration has been implemented. An application of a conceptual framework for structuring v/h integration of an overweight/obesity prevention initiative is presented. The paper concludes with a discussion of the implications of vertical/horizontal integration for policy, research, and practice related to childhood overweight and obesity prevention multiple intervention programs. Summary Both v/h integration across sectors and over system levels are needed to fully support multiple intervention programs of the complexity and scope required by obesity issues. V/h integration requires attention to system structures and processes. A conceptual framework is needed to support policy alignment, multi-level evaluation, and ongoing coordination of people at the front lines of practice. Using such tools to achieve integration may enhance sustainability, increase effectiveness of prevention and reduction efforts, decrease stigmatization, and lead to new ways to relate the environment to people and people to the environment for better health for children.
Maclean, Lynne M; Clinton, Kathryn; Edwards, Nancy; Garrard, Michael; Ashley, Lisa; Hansen-Ketchum, Patti; Walsh, Audrey
2010-05-17
Increasingly, multiple intervention programming is being understood and implemented as a key approach to developing public health initiatives and strategies. Using socio-ecological and population health perspectives, multiple intervention programming approaches are aimed at providing coordinated and strategic comprehensive programs operating over system levels and across sectors, allowing practitioners and decision makers to take advantage of synergistic effects. These approaches also require vertical and horizontal (v/h) integration of policy and practice in order to be maximally effective. This paper examines v/h integration of interventions for childhood overweight/obesity prevention and reduction from a Canadian perspective. It describes the implications of v/h integration for childhood overweight and obesity prevention, with examples of interventions where v/h integration has been implemented. An application of a conceptual framework for structuring v/h integration of an overweight/obesity prevention initiative is presented. The paper concludes with a discussion of the implications of vertical/horizontal integration for policy, research, and practice related to childhood overweight and obesity prevention multiple intervention programs. Both v/h integration across sectors and over system levels are needed to fully support multiple intervention programs of the complexity and scope required by obesity issues. V/h integration requires attention to system structures and processes. A conceptual framework is needed to support policy alignment, multi-level evaluation, and ongoing coordination of people at the front lines of practice. Using such tools to achieve integration may enhance sustainability, increase effectiveness of prevention and reduction efforts, decrease stigmatization, and lead to new ways to relate the environment to people and people to the environment for better health for children.
Aranda, Carlos; Paredes, Javier; Valenzuela, Cristian; Lam, Phyllis; Guillou, Laure
2010-01-01
The mat forming bacteria covering organic matter-enriched and anoxic marine sediments underlying a salmon farm in Southern Chile, were examined using 16S rRNA gene phylogenies. This mat was absent in the sea bed outside the direct influence of the farm (360 m outside fish cages). Based on nearly complete 16S rRNA gene sequences (-1500 bp), mat-forming filamentous cells were settled as the sulphur-oxidizing and putatively dissimilative nitrate-reducing Beggiatoa spp., being closely related (up...
Transgenic Arabidopsis Gene Expression System
Ferl, Robert; Paul, Anna-Lisa
2009-01-01
The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.
Directory of Open Access Journals (Sweden)
Guetterman TC
2017-07-01
Full Text Available Timothy C Guetterman,1 Frederick W Kron,1 Toby C Campbell,2 Mark W Scerbo,3 Amy B Zelenski,4 James F Cleary,5 Michael D Fetters1 1Department of Family Medicine, University of Michigan, Ann Arbor, MI, 2Department of Medicine, University of Wisconsin–Madison, Madison, WI, 3Department of Psychology, Old Dominion University, Norfolk, VA, 4Department of General Internal Medicine, University of Wisconsin–Madison, University of Wisconsin Medical Foundation, 5Department of Medicine, School of Medicine and Public Health, University of Wisconsin–Madison, Clinical Science Center, Madison, WI, USA Background: Despite interest in using virtual humans (VHs for assessing health care communication, evidence of validity is limited. We evaluated the validity of a VH application, MPathic-VR, for assessing performance-based competence in breaking bad news (BBN to a VH patient.Methods: We used a two-group quasi-experimental design, with residents participating in a 3-hour seminar on BBN. Group A (n=15 completed the VH simulation before and after the seminar, and Group B (n=12 completed the VH simulation only after the BBN seminar to avoid the possibility that testing alone affected performance. Pre- and postseminar differences for Group A were analyzed with a paired t-test, and comparisons between Groups A and B were analyzed with an independent t-test.Results: Compared to the preseminar result, Group A’s postseminar scores improved significantly, indicating that the VH program was sensitive to differences in assessing performance-based competence in BBN. Postseminar scores of Group A and Group B were not significantly different, indicating that both groups performed similarly on the VH program.Conclusion: Improved pre–post scores demonstrate acquisition of skills in BBN to a VH patient. Pretest sensitization did not appear to influence posttest assessment. These results provide initial construct validity evidence that the VH program is effective for
A strategy to discover new organizers identifies a putative heart organizer.
Anderson, Claire; Khan, Mohsin A F; Wong, Frances; Solovieva, Tatiana; Oliveira, Nidia M M; Baldock, Richard A; Tickle, Cheryll; Burt, Dave W; Stern, Claudio D
2016-08-25
Organizers are regions of the embryo that can both induce new fates and impart pattern on other regions. So far, surprisingly few organizers have been discovered, considering the number of patterned tissue types generated during development. This may be because their discovery has relied on transplantation and ablation experiments. Here we describe a new approach, using chick embryos, to discover organizers based on a common gene expression signature, and use it to uncover the anterior intestinal portal (AIP) endoderm as a putative heart organizer. We show that the AIP can induce cardiac identity from non-cardiac mesoderm and that it can pattern this by specifying ventricular and suppressing atrial regional identity. We also uncover some of the signals responsible. The method holds promise as a tool to discover other novel organizers acting during development.
CRISPR/Cas9-mediated gene targeting in Arabidopsis using sequential transformation.
Miki, Daisuke; Zhang, Wenxin; Zeng, Wenjie; Feng, Zhengyan; Zhu, Jian-Kang
2018-05-17
Homologous recombination-based gene targeting is a powerful tool for precise genome modification and has been widely used in organisms ranging from yeast to higher organisms such as Drosophila and mouse. However, gene targeting in higher plants, including the most widely used model plant Arabidopsis thaliana, remains challenging. Here we report a sequential transformation method for gene targeting in Arabidopsis. We find that parental lines expressing the bacterial endonuclease Cas9 from the egg cell- and early embryo-specific DD45 gene promoter can improve the frequency of single-guide RNA-targeted gene knock-ins and sequence replacements via homologous recombination at several endogenous sites in the Arabidopsis genome. These heritable gene targeting can be identified by regular PCR. Our approach enables routine and fine manipulation of the Arabidopsis genome.
New Gene Evolution: Little Did We Know
Long, Manyuan; VanKuren, Nicholas W.; Chen, Sidi; Vibranovski, Maria D.
2014-01-01
Genes are perpetually added to and deleted from genomes during evolution. Thus, it is important to understand how new genes are formed and evolve as critical components of the genetic systems determining the biological diversity of life. Two decades of effort have shed light on the process of new gene origination, and have contributed to an emerging comprehensive picture of how new genes are added to genomes, ranging from the mechanisms that generate new gene structures to the presence of new genes in different organisms to the rates and patterns of new gene origination and the roles of new genes in phenotypic evolution. We review each of these aspects of new gene evolution, summarizing the main evidence for the origination and importance of new genes in evolution. We highlight findings showing that new genes rapidly change existing genetic systems that govern various molecular, cellular and phenotypic functions. PMID:24050177
Haack, Sheridan K.; Duris, Joseph W.
2013-01-01
Little information exists on the co-occurrence of fecal indicator bacteria (FIB), bacterial pathogens, and organic wastewater-associated chemicals (OWCs) within Great Lakes tributaries. Fifteen watershed sites and one beach site adjacent to the Little Calumet River–Portage Burns Waterway (LCRPBW) on Lake Michigan were tested on four dates for pH, dissolved oxygen, specific conductance, chloride, color, ammonia- and nitrate-nitrogen, soluble phosphorus, sulfate, turbidity, and atrazine; for concentrations of FIB; and for genes indicating the presence of human-pathogenic enterococci (ENT) and of Shiga-toxin producing Escherichia coli (EC) from various animal sources. Nineteen samples were also tested for 60 OWCs. Half of the watershed samples met EC recreational water quality standards; none met ENT standards. Human-wastewater-associated OWC detections were correlated with human-influence indicators such as population/km2, chloride concentrations, and the presence of WWTP effluents, but EC and ENT concentrations were not. Bacterial pathogen genes indicated rural human and several potential animal sources. OWCs of human or ecosystem health concern (musk fragrances AHTN and HHCB, alkylphenols, carbamazepine) and 3 bacterial pathogen genes were detected at the mouth of the LCRPBW, but no such OWCs and only 1 pathogen gene were detected at the beach. The LCRPBW has significant potential to deliver FIB, potential bacterial pathogens, and OWCs of human or ecosystem health concern to the nearshore of Lake Michigan, under conditions enhancing nearshore transport of the river plume. Nearshore mixing of lake and river water, and the lack of relationship between OWCs and FIB or pathogen genes, pose numerous challenges for watershed and nearshore assessment and remediation.
Zaag, Rim; Tamby, Jean Philippe; Guichard, Cécile; Tariq, Zakia; Rigaill, Guillem; Delannoy, Etienne; Renou, Jean-Pierre; Balzergue, Sandrine; Mary-Huard, Tristan; Aubourg, Sébastien; Martin-Magniette, Marie-Laure; Brunaud, Véronique
2015-01-01
CATdb (http://urgv.evry.inra.fr/CATdb) is a database providing a public access to a large collection of transcriptomic data, mainly for Arabidopsis but also for other plants. This resource has the rare advantage to contain several thousands of microarray experiments obtained with the same technical protocol and analyzed by the same statistical pipelines. In this paper, we present GEM2Net, a new module of CATdb that takes advantage of this homogeneous dataset to mine co-expression units and decipher Arabidopsis gene functions. GEM2Net explores 387 stress conditions organized into 18 biotic and abiotic stress categories. For each one, a model-based clustering is applied on expression differences to identify clusters of co-expressed genes. To characterize functions associated with these clusters, various resources are analyzed and integrated: Gene Ontology, subcellular localization of proteins, Hormone Families, Transcription Factor Families and a refined stress-related gene list associated to publications. Exploiting protein-protein interactions and transcription factors-targets interactions enables to display gene networks. GEM2Net presents the analysis of the 18 stress categories, in which 17,264 genes are involved and organized within 681 co-expression clusters. The meta-data analyses were stored and organized to compose a dynamic Web resource. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
Chapman, Joanne R; Waldenström, Jonas
2015-01-01
The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.
Directory of Open Access Journals (Sweden)
Warren D Anderson
2017-07-01
Full Text Available Multiple physiological systems interact throughout the development of a complex disease. Knowledge of the dynamics and connectivity of interactions across physiological systems could facilitate the prevention or mitigation of organ damage underlying complex diseases, many of which are currently refractory to available therapeutics (e.g., hypertension. We studied the regulatory interactions operating within and across organs throughout disease development by integrating in vivo analysis of gene expression dynamics with a reverse engineering approach to infer data-driven dynamic network models of multi-organ gene regulatory influences. We obtained experimental data on the expression of 22 genes across five organs, over a time span that encompassed the development of autonomic nervous system dysfunction and hypertension. We pursued a unique approach for identification of continuous-time models that jointly described the dynamics and structure of multi-organ networks by estimating a sparse subset of ∼12,000 possible gene regulatory interactions. Our analyses revealed that an autonomic dysfunction-specific multi-organ sequence of gene expression activation patterns was associated with a distinct gene regulatory network. We analyzed the model structures for adaptation motifs, and identified disease-specific network motifs involving genes that exhibited aberrant temporal dynamics. Bioinformatic analyses identified disease-specific single nucleotide variants within or near transcription factor binding sites upstream of key genes implicated in maintaining physiological homeostasis. Our approach illustrates a novel framework for investigating the pathogenesis through model-based analysis of multi-organ system dynamics and network properties. Our results yielded novel candidate molecular targets driving the development of cardiovascular disease, metabolic syndrome, and immune dysfunction.
The Organization of the Quorum Sensing luxI/R Family Genes in Burkholderia
Directory of Open Access Journals (Sweden)
Sándor Pongor
2013-07-01
Full Text Available Members of the Burkholderia genus of Proteobacteria are capable of living freely in the environment and can also colonize human, animal and plant hosts. Certain members are considered to be clinically important from both medical and veterinary perspectives and furthermore may be important modulators of the rhizosphere. Quorum sensing via N-acyl homoserine lactone signals (AHL QS is present in almost all Burkholderia species and is thought to play important roles in lifestyle changes such as colonization and niche invasion. Here we present a census of AHL QS genes retrieved from public databases and indicate that the local arrangement (topology of QS genes, their location within chromosomes and their gene neighborhoods show characteristic patterns that differ between the known Burkholderia clades. In sequence phylogenies, AHL QS genes seem to cluster according to the local gene topology rather than according to the species, which suggests that the basic topology types were present prior to the appearance of current Burkholderia species. The data are available at http://net.icgeb.org/burkholderia/.
The Organization of the Quorum Sensing luxI/R Family Genes in Burkholderia
Choudhary, Kumari Sonal; Hudaiberdiev, Sanjarbek; Gelencsér, Zsolt; Coutinho, Bruna Gonçalves; Venturi, Vittorio; Pongor, Sándor
2013-01-01
Members of the Burkholderia genus of Proteobacteria are capable of living freely in the environment and can also colonize human, animal and plant hosts. Certain members are considered to be clinically important from both medical and veterinary perspectives and furthermore may be important modulators of the rhizosphere. Quorum sensing via N-acyl homoserine lactone signals (AHL QS) is present in almost all Burkholderia species and is thought to play important roles in lifestyle changes such as colonization and niche invasion. Here we present a census of AHL QS genes retrieved from public databases and indicate that the local arrangement (topology) of QS genes, their location within chromosomes and their gene neighborhoods show characteristic patterns that differ between the known Burkholderia clades. In sequence phylogenies, AHL QS genes seem to cluster according to the local gene topology rather than according to the species, which suggests that the basic topology types were present prior to the appearance of current Burkholderia species. The data are available at http://net.icgeb.org/burkholderia/. PMID:23820583
A stochastic approach to multi-gene expression dynamics
International Nuclear Information System (INIS)
Ochiai, T.; Nacher, J.C.; Akutsu, T.
2005-01-01
In the last years, tens of thousands gene expression profiles for cells of several organisms have been monitored. Gene expression is a complex transcriptional process where mRNA molecules are translated into proteins, which control most of the cell functions. In this process, the correlation among genes is crucial to determine the specific functions of genes. Here, we propose a novel multi-dimensional stochastic approach to deal with the gene correlation phenomena. Interestingly, our stochastic framework suggests that the study of the gene correlation requires only one theoretical assumption-Markov property-and the experimental transition probability, which characterizes the gene correlation system. Finally, a gene expression experiment is proposed for future applications of the model
Organization and transient expression of the gene for human U11 snRNA
Clemens, Suter-Crazzolara; Walter, Keller
1991-01-01
The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214
Risks from GMOs due to horizontal gene transfer.
Keese, Paul
2008-01-01
Horizontal gene transfer (HGT) is the stable transfer of genetic material from one organism to another without reproduction or human intervention. Transfer occurs by the passage of donor genetic material across cellular boundaries, followed by heritable incorporation to the genome of the recipient organism. In addition to conjugation, transformation and transduction, other diverse mechanisms of DNA and RNA uptake occur in nature. The genome of almost every organism reveals the footprint of many ancient HGT events. Most commonly, HGT involves the transmission of genes on viruses or mobile genetic elements. HGT first became an issue of public concern in the 1970s through the natural spread of antibiotic resistance genes amongst pathogenic bacteria, and more recently with commercial production of genetically modified (GM) crops. However, the frequency of HGT from plants to other eukaryotes or prokaryotes is extremely low. The frequency of HGT to viruses is potentially greater, but is restricted by stringent selection pressures. In most cases the occurrence of HGT from GM crops to other organisms is expected to be lower than background rates. Therefore, HGT from GM plants poses negligible risks to human health or the environment.
Directory of Open Access Journals (Sweden)
Neutelings Godfrey
2010-04-01
Full Text Available Abstract Background Quantitative real-time PCR (qRT-PCR is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs. Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L. Results Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups. qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59. LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both ge
Huis, Rudy; Hawkins, Simon; Neutelings, Godfrey
2010-04-19
Quantitative real-time PCR (qRT-PCR) is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs). Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L). Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs) and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH) as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups.qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59). LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both geNorm-designated- and Norm
Borrás, Teresa
2017-01-01
Treatment of diseases with gene therapy is advancing rapidly. The use of gene therapy has expanded from the original concept of re-placing the mutated gene causing the disease to the use of genes to con-trol nonphysiological levels of expression or to modify pathways known to affect the disease. Genes offer numerous advantages over conventional drugs. They have longer duration of action and are more specific. Genes can be delivered to the target site by naked DNA, cells, nonviral, and viral vectors. The enormous progress of the past decade in molecular bi-ology and delivery systems has provided ways for targeting genes to the intended cell/tissue and safe, long-term vectors. The eye is an ideal organ for gene therapy. It is easily accessible and it is an immune-privileged site. Currently, there are clinical trials for diseases affecting practically every tissue of the eye, including those to restore vision in patients with Leber congenital amaurosis. However, the number of eye trials compared with those for systemic diseases is quite low (1.8%). Nevertheless, judg-ing by the vast amount of ongoing preclinical studies, it is expected that such number will increase considerably in the near future. One area of great need for eye gene therapy is glaucoma, where a long-term gene drug would eliminate daily applications and compliance issues. Here, we review the current state of gene therapy for glaucoma and the possibilities for treating the trabecular meshwork to lower intraocular pressure and the retinal ganglion cells to protect them from neurodegeneration. Copyright© 2017 Asia-Pacific Academy of Ophthalmology.
Selection of suitable reference genes for RT-qPCR analyses in cyanobacteria.
Directory of Open Access Journals (Sweden)
Filipe Pinto
Full Text Available Cyanobacteria are a group of photosynthetic prokaryotes that have a diverse morphology, minimal nutritional requirements and metabolic plasticity that has made them attractive organisms to use in biotechnological applications. The use of these organisms as cell factories requires the knowledge of their physiology and metabolism at a systems level. For the quantification of gene transcripts real-time quantitative polymerase chain reaction (RT-qPCR is the standard technique. However, to obtain reliable RT-qPCR results the use and validation of reference genes is mandatory. Towards this goal we have selected and analyzed twelve candidate reference genes from three morphologically distinct cyanobacteria grown under routinely used laboratory conditions. The six genes exhibiting less variation in each organism were evaluated in terms of their expression stability using geNorm, NormFinder and BestKeeper. In addition, the minimum number of reference genes required for normalization was determined. Based on the three algorithms, we provide a list of genes for cyanobacterial RT-qPCR data normalization. To our knowledge, this is the first work on the validation of reference genes for cyanobacteria constituting a valuable starting point for future works.
Kohnen, Markus V; Schmid-Siegert, Emanuel; Trevisan, Martine; Petrolati, Laure Allenbach; Sénéchal, Fabien; Müller-Moulé, Patricia; Maloof, Julin; Xenarios, Ioannis; Fankhauser, Christian
2016-12-01
In response to neighbor proximity, plants increase the growth of specific organs (e.g., hypocotyls) to enhance access to sunlight. Shade enhances the activity of Phytochrome Interacting Factors (PIFs) by releasing these bHLH transcription factors from phytochrome B-mediated inhibition. PIFs promote elongation by inducing auxin production in cotyledons. In order to elucidate spatiotemporal aspects of the neighbor proximity response, we separately analyzed gene expression patterns in the major light-sensing organ (cotyledons) and in rapidly elongating hypocotyls of Arabidopsis thaliana PIFs initiate transcriptional reprogramming in both organs within 15 min, comprising regulated expression of several early auxin response genes. This suggests that hypocotyl growth is elicited by both local and distal auxin signals. We show that cotyledon-derived auxin is both necessary and sufficient to initiate hypocotyl growth, but we also provide evidence for the functional importance of the local PIF-induced response. With time, the transcriptional response diverges increasingly between organs. We identify genes whose differential expression may underlie organ-specific elongation. Finally, we uncover a growth promotion gene expression signature shared between different developmentally regulated growth processes and responses to the environment in different organs. © 2016 American Society of Plant Biologists. All rights reserved.
Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine
2014-07-22
Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad
Predictability of Genetic Interactions from Functional Gene Modules
Directory of Open Access Journals (Sweden)
Jonathan H. Young
2017-02-01
Full Text Available Characterizing genetic interactions is crucial to understanding cellular and organismal response to gene-level perturbations. Such knowledge can inform the selection of candidate disease therapy targets, yet experimentally determining whether genes interact is technically nontrivial and time-consuming. High-fidelity prediction of different classes of genetic interactions in multiple organisms would substantially alleviate this experimental burden. Under the hypothesis that functionally related genes tend to share common genetic interaction partners, we evaluate a computational approach to predict genetic interactions in Homo sapiens, Drosophila melanogaster, and Saccharomyces cerevisiae. By leveraging knowledge of functional relationships between genes, we cross-validate predictions on known genetic interactions and observe high predictive power of multiple classes of genetic interactions in all three organisms. Additionally, our method suggests high-confidence candidate interaction pairs that can be directly experimentally tested. A web application is provided for users to query genes for predicted novel genetic interaction partners. Finally, by subsampling the known yeast genetic interaction network, we found that novel genetic interactions are predictable even when knowledge of currently known interactions is minimal.
Medvedeva, Irina V; Demenkov, Pavel S; Ivanisenko, Vladimir A
2017-04-01
Functional sites define the diversity of protein functions and are the central object of research of the structural and functional organization of proteins. The mechanisms underlying protein functional sites emergence and their variability during evolution are distinguished by duplication, shuffling, insertion and deletion of the exons in genes. The study of the correlation between a site structure and exon structure serves as the basis for the in-depth understanding of sites organization. In this regard, the development of programming resources that allow the realization of the mutual projection of exon structure of genes and primary and tertiary structures of encoded proteins is still the actual problem. Previously, we developed the SitEx system that provides information about protein and gene sequences with mapped exon borders and protein functional sites amino acid positions. The database included information on proteins with known 3D structure. However, data with respect to orthologs was not available. Therefore, we added the projection of sites positions to the exon structures of orthologs in SitEx 2.0. We implemented a search through database using site conservation variability and site discontinuity through exon structure. Inclusion of the information on orthologs allowed to expand the possibilities of SitEx usage for solving problems regarding the analysis of the structural and functional organization of proteins. Database URL: http://www-bionet.sscc.ru/sitex/ .
Expression of Fox genes in the cephalochordate Branchiostoma lanceolatum
Directory of Open Access Journals (Sweden)
Daniel eAldea
2015-07-01
Full Text Available Forkhead box (Fox genes code for transcription factors that play important roles in different biological processes. They are found in a wide variety of organisms and appeared in unicellular eukaryotes. In metazoans, the gene family includes many members that can be subdivided into 24 classes. Cephalochordates are key organisms to understand the functional evolution of gene families in the chordate lineage due to their phylogenetic position as an early divergent chordate, their simple anatomy and genome structure. In the genome of the cephalochordate amphioxus Branchiostoma floridae, 32 Fox genes were identified, with at least one member for each of the classes that were present in the ancestor of bilaterians. In this work we describe the expression pattern of 13 of these genes during the embryonic development of the Mediterranean amphioxus, Branchiostoma lanceolatum. We found that FoxK and FoxM genes present an ubiquitous expression while all the others show specific expression patterns restricted to diverse embryonic territories. Many of these expression patterns are conserved with vertebrates, suggesting that the main functions of Fox genes in chordates were present in their common ancestor.
Colson-Proch, Céline; Morales, Anne; Hervant, Frédéric; Konecny, Lara; Moulin, Colette; Douady, Christophe J
2010-05-01
Whereas the consequences of global warming at population or community levels are well documented, studies at the cellular level are still scarce. The study of the physiological or metabolic effects of such small increases in temperature (between +2 degrees C and +6 degrees C) is difficult because they are below the amplitude of the daily or seasonal thermal variations occurring in most environments. In contrast, subterranean biotopes are highly thermally buffered (+/-1 degrees C within a year), and underground water organisms could thus be particularly well suited to characterise cellular responses of global warming. To this purpose, we studied genes encoding chaperone proteins of the HSP70 family in amphipod crustaceans belonging to the ubiquitous subterranean genus Niphargus. An HSP70 sequence was identified in eight populations of two complexes of species of the Niphargus genus (Niphargus rhenorhodanensis and Niphargus virei complexes). Expression profiles were determined for one of these by reverse transcription and quantitative polymerase chain reaction, confirming the inducible nature of this gene. An increase in temperature of 2 degrees C seemed to be without effect on N. rhenorhodanensis physiology, whereas a heat shock of +6 degrees C represented an important thermal stress for these individuals. Thus, this study shows that although Niphargus individuals do not undergo any daily or seasonal thermal variations in underground water, they display an inducible HSP70 heat shock response. This controlled laboratory-based physiological experiment constitutes a first step towards field investigations of the cellular consequences of global warming on subterranean organisms.
Haygood, M G; Cohn, D H
1986-01-01
Light organs of anomalopid (flashlight) fish contain luminous bacteroids that have never been cultured and, consequently, have been difficult to study. We have characterized the luciferase (lux) region of DNA extracted from light organs of the Caribbean flashlight fish Kryptophanaron alfredi by hybridization of cloned Vibrio harveyi lux genes to restriction-endonuclease-digested, light organ DNA. Comparison of the hybridization pattern of light organ DNA with that of DNA of a putative symbiotic isolate provides a method for identifying the authentic luminous symbiont regardless of its luminescence, and was used to reject one such isolate. Light organ DNA was further used to construct a cosmid clone bank and the luciferase genes were isolated. Unlike other bacterial luciferase genes, the genes were not expressed in Escherichia coli. When placed under the control of the E. coli trp promoter, the genes were transcribed but no luciferase was detected, suggesting a posttranscriptional block to expression.
Gene expression patterns of oxidative phosphorylation complex I subunits are organized in clusters.
Directory of Open Access Journals (Sweden)
Yael Garbian
Full Text Available After the radiation of eukaryotes, the NUO operon, controlling the transcription of the NADH dehydrogenase complex of the oxidative phosphorylation system (OXPHOS complex I, was broken down and genes encoding this protein complex were dispersed across the nuclear genome. Seven genes, however, were retained in the genome of the mitochondrion, the ancient symbiote of eukaryotes. This division, in combination with the three-fold increase in subunit number from bacteria (N = approximately 14 to man (N = 45, renders the transcription regulation of OXPHOS complex I a challenge. Recently bioinformatics analysis of the promoter regions of all OXPHOS genes in mammals supported patterns of co-regulation, suggesting that natural selection favored a mechanism facilitating the transcriptional regulatory control of genes encoding subunits of these large protein complexes. Here, using real time PCR of mitochondrial (mtDNA- and nuclear DNA (nDNA-encoded transcripts in a panel of 13 different human tissues, we show that the expression pattern of OXPHOS complex I genes is regulated in several clusters. Firstly, all mtDNA-encoded complex I subunits (N = 7 share a similar expression pattern, distinct from all tested nDNA-encoded subunits (N = 10. Secondly, two sub-clusters of nDNA-encoded transcripts with significantly different expression patterns were observed. Thirdly, the expression patterns of two nDNA-encoded genes, NDUFA4 and NDUFA5, notably diverged from the rest of the nDNA-encoded subunits, suggesting a certain degree of tissue specificity. Finally, the expression pattern of the mtDNA-encoded ND4L gene diverged from the rest of the tested mtDNA-encoded transcripts that are regulated by the same promoter, consistent with post-transcriptional regulation. These findings suggest, for the first time, that the regulation of complex I subunits expression in humans is complex rather than reflecting global co-regulation.
Directory of Open Access Journals (Sweden)
Angireddy Rajesh
Full Text Available The cysteine rich prostate and testis expressed (Pate proteins identified till date are thought to resemble the three fingered protein/urokinase-type plasminogen activator receptor proteins. In this study, for the first time, we report the identification, cloning and characterization of rat Pate gene cluster and also determine the expression pattern. The rat Pate genes are clustered on chromosome 8 and their predicted proteins retained the ten cysteine signature characteristic to TFP/Ly-6 protein family. PATE and PATE-F three dimensional protein structure was found to be similar to that of the toxin bucandin. Though Pate gene expression is thought to be prostate and testis specific, we observed that rat Pate genes are also expressed in seminal vesicle and epididymis and in tissues beyond the male reproductive tract. In the developing rats (20-60 day old, expression of Pate genes seem to be androgen dependent in the epididymis and testis. In the adult rat, androgen ablation resulted in down regulation of the majority of Pate genes in the epididymides. PATE and PATE-F proteins were found to be expressed abundantly in the male reproductive tract of rats and on the sperm. Recombinant PATE protein exhibited potent antibacterial activity, whereas PATE-F did not exhibit any antibacterial activity. Pate expression was induced in the epididymides when challenged with LPS. Based on our results, we conclude that rat PATE proteins may contribute to the reproductive and defense functions.
DEFF Research Database (Denmark)
Kooistra, Susanne M; van den Boom, Vincent; Thummer, Rajkumar P
2010-01-01
Previous reports showed that embryonic stem (ES) cells contain hyperdynamic and globally transcribed chromatin-properties that are important for ES cell pluripotency and differentiation. Here, we demonstrate a role for undifferentiated embryonic cell transcription factor 1 (UTF1) in regulating ES...... cell chromatin structure. Using chromatin immunoprecipitation-on-chip analysis, we identified >1,700 UTF1 target genes that significantly overlap with previously identified Nanog, Oct4, Klf-4, c-Myc, and Rex1 targets. Gene expression profiling showed that UTF1 knock down results in increased expression...... of a large set of genes, including a significant number of UTF1 targets. UTF1 knock down (KD) ES cells are, irrespective of the increased expression of several self-renewal genes, Leukemia inhibitory factor (LIF) dependent. However, UTF1 KD ES cells are perturbed in their differentiation in response...
Dixit, R; Trivedi, P K; Nath, P; Sane, P V
1999-09-01
Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.
A misterious fate - the destiny of Nicolas Donitch
Gaina, Alex
This paper describes a history of collaboration between the astronomers N. Donitch and A.A. Baikov. Information on other astronomers, L.V. Ocoulitch and E.A. Von der Pahlen, and meteorologists V.H. Dubinskii and Nina Gouma, can also be found. Details on the expeditions aimed at observing the total solar eclipses on 30 August 1905 (organized by the Imperial Academy of Sciences in Sankt-Petersburg) and 19 June 1936 (organized by the Romanian Royal Cultural foundation) are given. Some Informations concerning the Bessarabian Society of Naturalists and Amateur Naturalists are given also.
Neonatal exposure to phenobarbital potentiates schizophrenia-like behavioral outcomes in the rat.
Bhardwaj, S K; Forcelli, P A; Palchik, G; Gale, K; Srivastava, L K; Kondratyev, A
2012-06-01
Previous work has indicated an association between seizures early in life and increased risk of psychiatric disorders, including schizophrenia. However, because early-life seizures are commonly treated with antiepileptic drugs (AEDs) such as phenobarbital, the possibility that drug treatment may affect later-life psychiatric outcomes needs to be evaluated. We therefore tested the hypothesis that phenobarbital exposure in the neonatal rat increases the risk of schizophrenia-like behavioral abnormalities in adulthood. Thus, in this study, we examined the effects of a single acute neonatal exposure to phenobarbital on adult behavioral outcomes in the rat neonatal ventral hippocampal (nVH) lesion model of schizophrenia. We compared these outcomes to those in rats a) without nVH lesions and b) with nVH lesions, without phenobarbital. The tasks used for behavioral evaluation were: amphetamine-induced locomotion, prepulse inhibition, elevated plus-maze, and novel object recognition task. We found that neonatal phenobarbital treatment (in the absence of nVH lesions) was sufficient to disrupt sensorimotor gating (as tested by prepulse inhibition) in adulthood to an extent equivalent to nVH lesions. Additionally, neonatal phenobarbital exposure enhanced the locomotor response to amphetamine in adult animals with and without nVH lesions. Our findings suggest that neonatal exposure to phenobarbital can predispose to schizophrenia-like behavioral abnormalities. Our findings underscore the importance of examining AED exposure early in life as a potential risk factor for later-life neuropsychiatric abnormalities in clinical populations. Copyright © 2012 Elsevier Ltd. All rights reserved.
Gene therapy for ocular diseases.
Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao
2011-05-01
The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.
Babu, Peram Ravindra; Rao, Khareedu Venkateswara; Reddy, Vudem Dashavantha
2013-01-15
Flax CYPome analysis resulted in the identification of 334 putative cytochrome P450 (CYP450) genes in the cultivated flax genome. Classification of flax CYP450 genes based on the sequence similarity with Arabidopsis orthologs and CYP450 nomenclature, revealed 10 clans representing 44 families and 98 subfamilies. CYP80, CYP83, CYP92, CYP702, CYP705, CYP708, CYP728, CYP729, CYP733 and CYP736 families are absent in the flax genome. The subfamily members exhibited conserved sequences, length of exons and phasing of introns. Similarity search of the genomic resources of wild flax species Linum bienne with CYP450 coding sequences of the cultivated flax, revealed the presence of 127 CYP450 gene orthologs, indicating amplification of novel CYP450 genes in the cultivated flax. Seven families CYP73, 74, 75, 76, 77, 84 and 709, coding for enzymes associated with phenylpropanoid/fatty acid metabolism, showed extensive gene amplification in the flax. About 59% of the flax CYP450 genes were present in the EST libraries. Copyright © 2012 Elsevier B.V. All rights reserved.
Effect of multipurpose solutions against Acinetobacter carrying QAC genes.
Boost, Maureen V; Chan, Jessica; Shi, Guang-sen; Cho, Pauline
2014-03-01
Acinetobacter has low virulence but causes infections in subjects with reduced immunity. It has been reported in ocular infections including those of patients using contact lenses. Treatment is difficult because Acinetobacter is frequently multidrug resistant. Antibiotic-resistant strains frequently also harbor genes for antiseptic resistance (quaternary ammonium compound [QAC]) genes. Because Acinetobacter is part of the normal flora, it may contaminate contact lens and accessories. This study aims to investigate carriage rates of QAC genes in household and clinical isolates of Acinetobacter and to determine the effectiveness of two multipurpose solutions (MPSs) for soft lenses against organisms carrying QAC genes. DNA was extracted from 11 bathroom isolates and 15 clinical isolates and amplified by polymerase chain reaction to determine the presence of qacEΔ1. Gene-positive and gene-negative control strains were used to challenge the two MPSs, and minimum inhibitory concentrations (MICs) of these organisms to benzalkonium chloride and chlorhexidine gluconate were determined. More than 90% of isolates carried qacEΔ1. The MICs of clinical isolates were higher than those of isolates of bathrooms. Both MPSs were able to produce a 3-log reduction in the numbers of all isolates. Although most isolates carried qacEΔ1 and elevated MICs to benzalkonium chloride and chlorhexidine gluconate were observed, all were susceptible to both MPSs tested. However, if there were to be poor compliance with care procedures, it is probable that such organisms could survive in the presence of diluted or expired solutions.
Characterization of chemically induced liver injuries using gene co-expression modules.
Directory of Open Access Journals (Sweden)
Gregory J Tawa
Full Text Available Liver injuries due to ingestion or exposure to chemicals and industrial toxicants pose a serious health risk that may be hard to assess due to a lack of non-invasive diagnostic tests. Mapping chemical injuries to organ-specific damage and clinical outcomes via biomarkers or biomarker panels will provide the foundation for highly specific and robust diagnostic tests. Here, we have used DrugMatrix, a toxicogenomics database containing organ-specific gene expression data matched to dose-dependent chemical exposures and adverse clinical pathology assessments in Sprague Dawley rats, to identify groups of co-expressed genes (modules specific to injury endpoints in the liver. We identified 78 such gene co-expression modules associated with 25 diverse injury endpoints categorized from clinical pathology, organ weight changes, and histopathology. Using gene expression data associated with an injury condition, we showed that these modules exhibited different patterns of activation characteristic of each injury. We further showed that specific module genes mapped to 1 known biochemical pathways associated with liver injuries and 2 clinically used diagnostic tests for liver fibrosis. As such, the gene modules have characteristics of both generalized and specific toxic response pathways. Using these results, we proposed three gene signature sets characteristic of liver fibrosis, steatosis, and general liver injury based on genes from the co-expression modules. Out of all 92 identified genes, 18 (20% genes have well-documented relationships with liver disease, whereas the rest are novel and have not previously been associated with liver disease. In conclusion, identifying gene co-expression modules associated with chemically induced liver injuries aids in generating testable hypotheses and has the potential to identify putative biomarkers of adverse health effects.
Drosophila olfactory memory: single genes to complex neural circuits.
Keene, Alex C; Waddell, Scott
2007-05-01
A central goal of neuroscience is to understand how neural circuits encode memory and guide behaviour. Studying simple, genetically tractable organisms, such as Drosophila melanogaster, can illuminate principles of neural circuit organization and function. Early genetic dissection of D. melanogaster olfactory memory focused on individual genes and molecules. These molecular tags subsequently revealed key neural circuits for memory. Recent advances in genetic technology have allowed us to manipulate and observe activity in these circuits, and even individual neurons, in live animals. The studies have transformed D. melanogaster from a useful organism for gene discovery to an ideal model to understand neural circuit function in memory.
Gene structure, phylogeny and expression profile of the sucrose ...
Indian Academy of Sciences (India)
Gene structure, phylogeny and expression profile of the sucrose synthase gene family in .... 24, 701–713. Bate N. and Twell D. 1998 Functional architecture of a late pollen .... Manzara T. and Gruissem W. 1988 Organization and expression.
Chen, Veronica M; Foilb, Allison R; Christianson, John P
2016-01-01
The ventral hippocampus (VH) is involved in the both the acquisition and recall of conditioned fear. Here, we tested the role of VH in acquisition and recall of a conditioned fear discrimination. Intra-VH vehicle or muscimol injections were made 1h prior to a CS+/CS- conditioning or prior to later recall. Vehicle treated rats exhibited discrimination with significantly greater freezing to the CS+ than to the CS- whereas muscimol treated rats did not freeze. Injections made before recall had no effect as both treatment groups displayed equal freezing in response to the CS+, and discrimination. While these results are consistent with several reports, the failure to influence fear discrimination upon recall appears to contrast with the hypothesized role of VH in recall of extinguished conditioned fear cues. Copyright © 2015 Elsevier B.V. All rights reserved.
Stably Expressed Genes Involved in Basic Cellular Functions.
Directory of Open Access Journals (Sweden)
Kejian Wang
Full Text Available Stably Expressed Genes (SEGs whose expression varies within a narrow range may be involved in core cellular processes necessary for basic functions. To identify such genes, we re-analyzed existing RNA-Seq gene expression profiles across 11 organs at 4 developmental stages (from immature to old age in both sexes of F344 rats (n = 4/group; 320 samples. Expression changes (calculated as the maximum expression / minimum expression for each gene of >19000 genes across organs, ages, and sexes ranged from 2.35 to >109-fold, with a median of 165-fold. The expression of 278 SEGs was found to vary ≤4-fold and these genes were significantly involved in protein catabolism (proteasome and ubiquitination, RNA transport, protein processing, and the spliceosome. Such stability of expression was further validated in human samples where the expression variability of the homologous human SEGs was significantly lower than that of other genes in the human genome. It was also found that the homologous human SEGs were generally less subject to non-synonymous mutation than other genes, as would be expected of stably expressed genes. We also found that knockout of SEG homologs in mouse models was more likely to cause complete preweaning lethality than non-SEG homologs, corroborating the fundamental roles played by SEGs in biological development. Such stably expressed genes and pathways across life-stages suggest that tight control of these processes is important in basic cellular functions and that perturbation by endogenous (e.g., genetics or exogenous agents (e.g., drugs, environmental factors may cause serious adverse effects.
Würtz, Rolf P
2008-01-01
Organic Computing is a research field emerging around the conviction that problems of organization in complex systems in computer science, telecommunications, neurobiology, molecular biology, ethology, and possibly even sociology can be tackled scientifically in a unified way. From the computer science point of view, the apparent ease in which living systems solve computationally difficult problems makes it inevitable to adopt strategies observed in nature for creating information processing machinery. In this book, the major ideas behind Organic Computing are delineated, together with a sparse sample of computational projects undertaken in this new field. Biological metaphors include evolution, neural networks, gene-regulatory networks, networks of brain modules, hormone system, insect swarms, and ant colonies. Applications are as diverse as system design, optimization, artificial growth, task allocation, clustering, routing, face recognition, and sign language understanding.
Marsico, Annalisa
2013-01-01
Abstract The zebrafish (Danio rerio) is an established model organism for developmental and biomedical research. It is frequently used for high-throughput functional genomics experiments, such as genome-wide gene expression measurements, to systematically analyze molecular mechanisms. However, the use of whole embryos or larvae in such experiments leads to a loss of the spatial information. To address this problem, we have developed a tool called Zebrafish Expression Ontology of Gene Sets (ZEOGS) to assess the enrichment of anatomical terms in large gene sets. ZEOGS uses gene expression pattern data from several sources: first, in situ hybridization experiments from the Zebrafish Model Organism Database (ZFIN); second, it uses the Zebrafish Anatomical Ontology, a controlled vocabulary that describes connected anatomical structures; and third, the available connections between expression patterns and anatomical terms contained in ZFIN. Upon input of a gene set, ZEOGS determines which anatomical structures are overrepresented in the input gene set. ZEOGS allows one for the first time to look at groups of genes and to describe them in terms of shared anatomical structures. To establish ZEOGS, we first tested it on random gene selections and on two public microarray datasets with known tissue-specific gene expression changes. These tests showed that ZEOGS could reliably identify the tissues affected, whereas only very few enriched terms to none were found in the random gene sets. Next we applied ZEOGS to microarray datasets of 24 and 72 h postfertilization zebrafish embryos treated with beclomethasone, a potent glucocorticoid. This analysis resulted in the identification of several anatomical terms related to glucocorticoid-responsive tissues, some of which were stage-specific. Our studies highlight the ability of ZEOGS to extract spatial information from datasets derived from whole embryos, indicating that ZEOGS could be a useful tool to automatically analyze gene
Prykhozhij, Sergey V; Marsico, Annalisa; Meijsing, Sebastiaan H
2013-09-01
The zebrafish (Danio rerio) is an established model organism for developmental and biomedical research. It is frequently used for high-throughput functional genomics experiments, such as genome-wide gene expression measurements, to systematically analyze molecular mechanisms. However, the use of whole embryos or larvae in such experiments leads to a loss of the spatial information. To address this problem, we have developed a tool called Zebrafish Expression Ontology of Gene Sets (ZEOGS) to assess the enrichment of anatomical terms in large gene sets. ZEOGS uses gene expression pattern data from several sources: first, in situ hybridization experiments from the Zebrafish Model Organism Database (ZFIN); second, it uses the Zebrafish Anatomical Ontology, a controlled vocabulary that describes connected anatomical structures; and third, the available connections between expression patterns and anatomical terms contained in ZFIN. Upon input of a gene set, ZEOGS determines which anatomical structures are overrepresented in the input gene set. ZEOGS allows one for the first time to look at groups of genes and to describe them in terms of shared anatomical structures. To establish ZEOGS, we first tested it on random gene selections and on two public microarray datasets with known tissue-specific gene expression changes. These tests showed that ZEOGS could reliably identify the tissues affected, whereas only very few enriched terms to none were found in the random gene sets. Next we applied ZEOGS to microarray datasets of 24 and 72 h postfertilization zebrafish embryos treated with beclomethasone, a potent glucocorticoid. This analysis resulted in the identification of several anatomical terms related to glucocorticoid-responsive tissues, some of which were stage-specific. Our studies highlight the ability of ZEOGS to extract spatial information from datasets derived from whole embryos, indicating that ZEOGS could be a useful tool to automatically analyze gene expression
The functional landscape of mouse gene expression
Directory of Open Access Journals (Sweden)
Zhang Wen
2004-12-01
Full Text Available Abstract Background Large-scale quantitative analysis of transcriptional co-expression has been used to dissect regulatory networks and to predict the functions of new genes discovered by genome sequencing in model organisms such as yeast. Although the idea that tissue-specific expression is indicative of gene function in mammals is widely accepted, it has not been objectively tested nor compared with the related but distinct strategy of correlating gene co-expression as a means to predict gene function. Results We generated microarray expression data for nearly 40,000 known and predicted mRNAs in 55 mouse tissues, using custom-built oligonucleotide arrays. We show that quantitative transcriptional co-expression is a powerful predictor of gene function. Hundreds of functional categories, as defined by Gene Ontology 'Biological Processes', are associated with characteristic expression patterns across all tissues, including categories that bear no overt relationship to the tissue of origin. In contrast, simple tissue-specific restriction of expression is a poor predictor of which genes are in which functional categories. As an example, the highly conserved mouse gene PWP1 is widely expressed across different tissues but is co-expressed with many RNA-processing genes; we show that the uncharacterized yeast homolog of PWP1 is required for rRNA biogenesis. Conclusions We conclude that 'functional genomics' strategies based on quantitative transcriptional co-expression will be as fruitful in mammals as they have been in simpler organisms, and that transcriptional control of mammalian physiology is more modular than is generally appreciated. Our data and analyses provide a public resource for mammalian functional genomics.
Improvisation in evolution of genes and genomes: whose structure is it anyway?
Shakhnovich, Boris E; Shakhnovich, Eugene I
2008-06-01
Significant progress has been made in recent years in a variety of seemingly unrelated fields such as sequencing, protein structure prediction, and high-throughput transcriptomics and metabolomics. At the same time, new microscopic models have been developed that made it possible to analyze the evolution of genes and genomes from first principles. The results from these efforts enable, for the first time, a comprehensive insight into the evolution of complex systems and organisms on all scales--from sequences to organisms and populations. Every newly sequenced genome uncovers new genes, families, and folds. Where do these new genes come from? How do gene duplication and subsequent divergence of sequence and structure affect the fitness of the organism? What role does regulation play in the evolution of proteins and folds? Emerging synergism between data and modeling provides first robust answers to these questions.
Gene duplications in prokaryotes can be associated with environmental adaptation.
Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn
2010-10-20
Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate
Linear verrucous hemangioma-a rare case and dermoscopic clues to diagnosis.
Dhanta, Aditi; Chauhan, Payal; Meena, Dilip; Hazarika, Neirita
2018-01-01
Verrucous hemangioma (VH) is a rare, congenital and localized vascular malformation, which usually presents as warty, bluish, vascular papules, plaques, or nodules, mainly on the lower extremities. Linear presentation of the disease is rare. A deep biopsy is necessary to confirm the clinical diagnosis by histopathological examination, with dermoscopy acting as a useful tool for evaluating the precise vascular structure. Here, we report on a 13-year-old female child with linear VH presenting over her foot since infancy and dermoscopic findings of VH along with the clinical-pathologic features.
M. Banach (Maciej); C. Serban (Corina); A. Sahebkar (Amirhossein); D.P. Mikhailidis (Dimitri P.); S. Ursoniu (Sorin); K.K. Ray (Kausik K.); J. Rysz (Jacek); P.P. Toth (Peter); P. Muntner (Paul); S. Mosteoru (Svetlana); H.M. Garcia-Garcia (Hector); G.K. Hovingh (Kees); J.J.P. Kastelein (John); P.W.J.C. Serruys (Patrick)
2015-01-01
textabstractBackground: Virtual histology intravascular ultrasound (VH-IVUS) imaging is an innovative tool for the morphological evaluation of coronary atherosclerosis. Evidence for the effects of statin therapy on VH-IVUS parameters have been inconclusive. Consequently, we performed a systematic
NOVEL ORGANIZATION OF THE GENES FOR PHTHALATE DEGRADATION FROM BURKHOLDERIA CEPACIA DBO1
Burkholderia cepacia DBO1 is able to utilize phthalate as the sole source of carbon and energy for growth. Two overlapping cosmid clones containing the genes for phthalate degradation were isolated from this strain. Subcloning and activity analysis localized the genes for phthala...
Gao, C Q; Yang, J X; Chen, M X; Yan, H C; Wang, X Q
2016-04-01
Two experiments were conducted to fit growth curves, and determine age-related changes in carcass characteristics, organs, serum biochemical parameters, and gene expression of intestinal nutrient transporters in domestic pigeon (Columba livia). In experiment 1, body weight (BW) of 30 pigeons was respectively determined at 1, 3, 7, 14, 21, 28, and 35 days old to fit growth curves and to describe the growth of pigeons. In experiment 2, eighty-four 1-day-old squabs were grouped by weight into 7 groups. On d 1, 3, 7, 14, 21, 28, and 35, twelve birds from each group were randomly selected for slaughter and post-slaughter analysis. The results showed that BW of pigeons increased rapidly from d 1 to d 28 (a 25.7-fold increase), and then had little change until d 35. The Logistic, Gompertz, and Von Bertalanffy functions can all be well fitted with the growth curve of domestic pigeons (R2>0.90) and the Gompertz model showed the highest R2value among the models (R2=0.9997). The equation of Gompertz model was Y=507.72×e-(3.76exp(-0.17t))(Y=BW of pigeon (g); t=time (day)). In addition, breast meat yield (%) increased with age throughout the experiment, whereas the leg meat yield (%) reached to the peak on d 14. Serum total protein, albumin, globulin, and glucose concentration were increased with age, whereas serum uric acid concentration was decreased (P<0.05). Furthermore, the gene expressions of nutrient transporters (y+LAT2, LAT1, B0AT1, PepT1, and NHE2) in jejunum of pigeon were increased with age. The results of correlation analysis showed the gene expressions of B0AT1, PepT1, and NHE2 had positive correlations with BW (0.73
The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.
Zhao, D; Yu, Q; Chen, M; Ma, H
2001-07-01
The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.
Khatri, Purvesh; Roedder, Silke; Kimura, Naoyuki; De Vusser, Katrien; Morgan, Alexander A; Gong, Yongquan; Fischbein, Michael P; Robbins, Robert C; Naesens, Maarten; Butte, Atul J; Sarwal, Minnie M
2013-10-21
Using meta-analysis of eight independent transplant datasets (236 graft biopsy samples) from four organs, we identified a common rejection module (CRM) consisting of 11 genes that were significantly overexpressed in acute rejection (AR) across all transplanted organs. The CRM genes could diagnose AR with high specificity and sensitivity in three additional independent cohorts (794 samples). In another two independent cohorts (151 renal transplant biopsies), the CRM genes correlated with the extent of graft injury and predicted future injury to a graft using protocol biopsies. Inferred drug mechanisms from the literature suggested that two FDA-approved drugs (atorvastatin and dasatinib), approved for nontransplant indications, could regulate specific CRM genes and reduce the number of graft-infiltrating cells during AR. We treated mice with HLA-mismatched mouse cardiac transplant with atorvastatin and dasatinib and showed reduction of the CRM genes, significant reduction of graft-infiltrating cells, and extended graft survival. We further validated the beneficial effect of atorvastatin on graft survival by retrospective analysis of electronic medical records of a single-center cohort of 2,515 renal transplant patients followed for up to 22 yr. In conclusion, we identified a CRM in transplantation that provides new opportunities for diagnosis, drug repositioning, and rational drug design.
Honey bee protein atlas at organ-level resolution.
Chan, Queenie W T; Chan, Man Yi; Logan, Michelle; Fang, Yuan; Higo, Heather; Foster, Leonard J
2013-11-01
Genome sequencing has provided us with gene lists but cannot tell us where and how their encoded products work together to support life. Complex organisms rely on differential expression of subsets of genes/proteins in organs and tissues, and, in concert, evolved to their present state as they function together to improve an organism's overall reproductive fitness. Proteomics studies of individual organs help us understand their basic functions, but this reductionist approach misses the larger context of the whole organism. This problem could be circumvented if all the organs in an organism were comprehensively studied by the same methodology and analyzed together. Using honey bees (Apis mellifera L.) as a model system, we report here an initial whole proteome of a complex organism, measuring 29 different organ/tissue types among the three honey bee castes: queen, drone, and worker. The data reveal that, e.g., workers have a heightened capacity to deal with environmental toxins and queens have a far more robust pheromone detection system than their nestmates. The data also suggest that workers altruistically sacrifice not only their own reproductive capacity but also their immune potential in favor of their queen. Finally, organ-level resolution of protein expression offers a systematic insight into how organs may have developed.