WorldWideScience

Sample records for vfc program introductory

  1. Barriers and Facilitators of HPV Vaccination in the VFC Program.

    Science.gov (United States)

    Fleming, Wayne S; Sznajder, Kristin K; Nepps, Margaret; Boktor, Sameh W

    2018-01-04

    This study determined facilitators and barriers to human papillomavirus (HPV) vaccination perceived by providers of healthcare in the federally funded Pennsylvania Vaccines for Children (PA VFC) program. The cross-sectional study gathered descriptive data through a survey research design. Providers of healthcare were recruited through an email containing a link to an 18-question online survey. The survey was divided into four main sections which assessed the perceived facilitators and barriers to HPV vaccination of PA VFC program-eligibles. Survey respondents represented 65 of 66 Pennsylvania counties covered by the PA VFC Program. The study recruited 772 PA VFC participating healthcare facilities for a response rate of 52%. Ninety eight percent of the responding facilities reported that they offered the HPV vaccine. The most common barriers to vaccine administration were the parental belief that HPV vaccination is associated with sexual activity and parent/patient refusal of the HPV vaccination which together accounted for (44%) of responses. The majority of respondents (75.6%) indicated counseling parents and adolescents on the benefits of HPV vaccination was a very important factor in HPV vaccination uptake. Healthcare provider facility based training (32%) and web-based training for healthcare providers (22%) were the most recommended avenues for HPV training. The most common barrier to HPV vaccination was identified as the parental misconception that HPV vaccination is associated with sexual activity. Providers believed that the best way to increase HPV vaccination is through counseling parents and adolescents on the benefits of HPV vaccination and to correct misconceptions and change attitudes. Providers are desirous of receiving HPV web-based or workplace training.

  2. Failure Rates in Introductory Programming

    DEFF Research Database (Denmark)

    Bennedsen, Jens; Caspersen, Michael Edelgaard

    2007-01-01

    It is a common conception that CS1 is a very difficult course and that failure rates are high. However, until now there has only been anecdotal evidence for this claim. This article reports on a survey among institutions around the world regarding failure rates in introductory programming courses....... The article describes the design of the survey and the results. The number of institutions answering the call for data was unfortunately rather low, so it is difficult to make firm conclusions. It is our hope that this article can be the starting point for a systematic collection of data in order to find...

  3. A Theory Based Introductory Programming Course

    DEFF Research Database (Denmark)

    Hansen, Michael Reichhardt; Kristensen, Jens Thyge; Rischel, Hans

    1999-01-01

    This paper presents an introductory programming course designed to teach programming as an intellectual activity. The course emphasizes understandable concepts which can be useful in designing programs, while the oddities of today's technology are considered of secondary importance. An important...... goal is to fight the trial-and-error approach to programming which is a result of the students battles with horribly designed and documented systems and languages prior to their studies at university. Instead, the authors strive for giving the students a good experience of programming as a systematic...

  4. Dicty_cDB: VFC601 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC601 (Link to dictyBase) - - - Contig-U16269-1 VFC601E (Link to Original site) VFC60...1F 579 VFC601Z 705 VFC601P 1284 VFC601E 1149 Show VFC601 Library VF (Link to library) Clone ID VFC60...ginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC601Q.Seq.d/ Re...presentative seq. ID VFC601E (Link to Original site) Representative DNA sequence >VFC601 (VFC601Q) /CSM/VF/VFC6-A/VFC60...SM-cDNA Score E Sequences producing significant alignments: (bits) Value VFC601 (VFC601Q) /CSM/VF/VFC6-A/VFC60

  5. Dicty_cDB: VFC609 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC609 (Link to dictyBase) - - - Contig-U16605-1 VFC609P (Link to Original site) VFC60...9F 559 VFC609Z 659 VFC609P 1218 - - Show VFC609 Library VF (Link to library) Clone ID VFC60...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC609Q.Seq.d/ Representative seq. ID VFC60...9P (Link to Original site) Representative DNA sequence >VFC609 (VFC609Q) /CSM/VF/VFC6-A/VFC60...oducing significant alignments: (bits) Value VFC609 (VFC609Q) /CSM/VF/VFC6-A/VFC60

  6. Dicty_cDB: VFC602 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC602 (Link to dictyBase) - - - Contig-U16382-1 VFC602P (Link to Original site) VFC60...2F 574 VFC602Z 672 VFC602P 1246 - - Show VFC602 Library VF (Link to library) Clone ID VFC60...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC602Q.Seq.d/ Representative seq. ID VFC60...2P (Link to Original site) Representative DNA sequence >VFC602 (VFC602Q) /CSM/VF/VFC6-A/VFC60...ant alignments: (bits) Value VFC602 (VFC602Q) /CSM/VF/VFC6-A/VFC602Q.Seq.d/ 2224 0.0 VFI430 (VFI430Q) /CSM/V

  7. Dicty_cDB: VFC608 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC608 (Link to dictyBase) - - - Contig-U15776-1 VFC608P (Link to Original site) VFC60...8F 556 VFC608Z 731 VFC608P 1287 - - Show VFC608 Library VF (Link to library) Clone ID VFC60...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC608Q.Seq.d/ Representative seq. ID VFC60...8P (Link to Original site) Representative DNA sequence >VFC608 (VFC608Q) /CSM/VF/VFC6-A/VFC60...ignments: (bits) Value VFC608 (VFC608Q) /CSM/VF/VFC6-A/VFC608Q.Seq.d/ 2500 0.0 VHP263 (VHP263Q) /CSM/VH/VHP2

  8. Dicty_cDB: VFC603 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC603 (Link to dictyBase) - - - Contig-U08664-1 VFC603P (Link to Original site) VFC60...3F 233 VFC603Z 320 VFC603P 553 - - Show VFC603 Library VF (Link to library) Clone ID VFC60... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC603Q.Seq.d/ Representative seq. ID VFC60...3P (Link to Original site) Representative DNA sequence >VFC603 (VFC603Q) /CSM/VF/VFC6-A/VFC60...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VFC603 (VFC603Q) /CSM/VF/VFC6-A/VFC60

  9. Dicty_cDB: VFC607 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC607 (Link to dictyBase) - - - Contig-U16455-1 VFC607P (Link to Original site) VFC60...7F 543 VFC607Z 684 VFC607P 1227 - - Show VFC607 Library VF (Link to library) Clone ID VFC60...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC607Q.Seq.d/ Representative seq. ID VFC60...7P (Link to Original site) Representative DNA sequence >VFC607 (VFC607Q) /CSM/VF/VFC6-A/VFC60...skeletal >> prediction for VFC607 is cyt 5' end seq. ID VFC607F 5' end seq. >VFC607F.Seq ATTGTTATAATCAACTTTA

  10. Dicty_cDB: VFC604 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC604 (Link to dictyBase) - - - Contig-U14734-1 VFC604Z (Link... to Original site) - - VFC604Z 462 - - - - Show VFC604 Library VF (Link to library) Clone ID VFC604 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC604Q.Seq.d/ Representative seq. ID VFC60...4Z (Link to Original site) Representative DNA sequence >VFC604 (VFC604Q) /CSM/VF/VFC6-A/VFC604Q.Seq.d/ XXXXX...S/VSF8-B/VSF833Q.Seq.d/ 868 0.0 VFC604 (VFC604Q) /CSM/VF/VFC6-A/VFC604Q.Seq.d/ 86

  11. Dicty_cDB: VFC606 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC606 (Link to dictyBase) - - - Contig-U16358-1 VFC606F (Link to Original site) VFC60...6F 589 - - - - - - Show VFC606 Library VF (Link to library) Clone ID VFC606 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC606Q.Seq.d/ Representative seq. ID VFC60...6F (Link to Original site) Representative DNA sequence >VFC606 (VFC606Q) /CSM/VF/VFC6-A/VFC606Q.Seq.d/ TCAAA...gnificant alignments: (bits) Value VFC606 (VFC606Q) /CSM/VF/VFC6-A/VFC606Q.Seq.d/ 1168 0.0 VFL522 (VFL522Q)

  12. VFC: The Vienna Fortran Compiler

    Directory of Open Access Journals (Sweden)

    Siegfried Benkner

    1999-01-01

    Full Text Available High Performance Fortran (HPF offers an attractive high‐level language interface for programming scalable parallel architectures providing the user with directives for the specification of data distribution and delegating to the compiler the task of generating an explicitly parallel program. Available HPF compilers can handle regular codes quite efficiently, but dramatic performance losses may be encountered for applications which are based on highly irregular, dynamically changing data structures and access patterns. In this paper we introduce the Vienna Fortran Compiler (VFC, a new source‐to‐source parallelization system for HPF+, an optimized version of HPF, which addresses the requirements of irregular applications. In addition to extended data distribution and work distribution mechanisms, HPF+ provides the user with language features for specifying certain information that decisively influence a program’s performance. This comprises data locality assertions, non‐local access specifications and the possibility of reusing runtime‐generated communication schedules of irregular loops. Performance measurements of kernels from advanced applications demonstrate that with a high‐level data parallel language such as HPF+ a performance close to hand‐written message‐passing programs can be achieved even for highly irregular codes.

  13. Dicty_cDB: VFC605 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC605 (Link to dictyBase) - G20698 DDB0216312 Contig-U02087-1 | Contig-U16097-1 VFC60...5P (Link to Original site) VFC605F 145 VFC605Z 483 VFC605P 628 - - Show VFC605 Libra...ry VF (Link to library) Clone ID VFC605 (Link to dictyBase) Atlas ID - NBRP ID G20698 dictyBase ID DDB021631...cdb.biol.tsukuba.ac.jp/CSM/VF/VFC6-A/VFC605Q.Seq.d/ Representative seq. ID VFC605P (Link to Original site) R...epresentative DNA sequence >VFC605 (VFC605Q) /CSM/VF/VFC6-A/VFC605Q.Seq.d/ AAACACACTCCACCTGTATTATATCTTTTTTTC

  14. Teaching an Introductory Programming Language in a General Education Course

    Science.gov (United States)

    Ali, Azad; Smith, David

    2014-01-01

    A department of computer science (CS) has faced a peculiar situation regarding their selection of introductory programming course. This course is a required course for the students enrolled in the CS program and is a prerequisite to their other advanced programming courses. At the same time, the course can be considered a general education course…

  15. TEACHING OBJECT ORIENTED PROGRAMMING AT THE INTRODUCTORY LEVEL

    OpenAIRE

    OKUR , Prof. Dr. Mehmet C.

    2006-01-01

    Teaching object oriented programming has become a rapidly expanding preference at various educational environments. However, teachers usually experience problems when introducing object oriented concepts and programming to beginners. How to teach the fundamentals of object oriented programming at an introductory level course is still a common subject for debate. In this paper, an evaluation of these problems is presented and some possible approaches for improving the quality and success of su...

  16. A Model for Teaching an Introductory Programming Course Using ADRI

    Science.gov (United States)

    Malik, Sohail Iqbal; Coldwell-Neilson, Jo

    2017-01-01

    High failure and drop-out rates from introductory programming courses continue to be of significant concern to computer science disciplines despite extensive research attempting to address the issue. In this study, we include the three entities of the didactic triangle, instructors, students and curriculum, to explore the learning difficulties…

  17. Measuring and Improving Student Performance in an Introductory Programming Course

    Science.gov (United States)

    Alturki, Raad A.

    2016-01-01

    Students' performances in introductory programming courses show large variation across students. There may be many reasons for these variations, such as methods of teaching, teacher competence in the subject, students' coding backgrounds and abilities, students' self-discipline, the teaching environment, and the resources available to students,…

  18. Python Source Code Plagiarism Attacks on Introductory Programming Course Assignments

    Science.gov (United States)

    Karnalim, Oscar

    2017-01-01

    This paper empirically enlists Python plagiarism attacks that have been found on Introductory Programming course assignments for undergraduate students. According to our observation toward 400 plagiarism-suspected cases, there are 35 plagiarism attacks that have been conducted by students. It starts with comment & whitespace modification as…

  19. Introductory Programming Subject in European Higher Education

    Science.gov (United States)

    Aleksic, Veljko; Ivanovic, Mirjana

    2016-01-01

    Programming is one of the basic subjects in most informatics, computer science mathematics and technical faculties' curricula. Integrated overview of the models for teaching programming, problems in teaching and suggested solutions were presented in this paper. Research covered current state of 1019 programming subjects in 715 study programmes at…

  20. Python and Roles of Variables in Introductory Programming: Experiences from Three Educational Institutions

    Science.gov (United States)

    Nikula, Uolevi; Sajaniemi, Jorma; Tedre, Matti; Wray, Stuart

    2007-01-01

    Students often find that learning to program is hard. Introductory programming courses have high drop-out rates and students do not learn to program well. This paper presents experiences from three educational institutions where introductory programming courses were improved by adopting Python as the first programming language and roles of…

  1. Which Introductory Programming Approach Is Most Suitable for Students: Procedural or Visual Programming?

    Science.gov (United States)

    Eid, Chaker; Millham, Richard

    2012-01-01

    In this paper, we discuss the visual programming approach to teaching introductory programming courses and then compare this approach with that of procedural programming. The involved cognitive levels of students, as beginning students are introduced to different types of programming concepts, are correlated to the learning processes of…

  2. Introductory TORS training in an otolaryngology residency program.

    Science.gov (United States)

    Fastenberg, Judd H; Gibber, Marc J; Smith, Richard V

    2018-02-07

    Transoral robotic surgery (TORS) is becoming an integral part of the otolaryngology resident experience. While there is widespread agreement that a formal, validated curriculum for TORS training is needed for residents, none presently exists. The primary objective of this study is to evaluate an introductory resident curriculum for TORS training that could be easily adopted at other institutions. This is a prospective study of otolaryngology residents (PGY1-5) in an academic medical center from 2015 to 2016. Trainees completed an introductory TORS training program consisting of online modules, logistic training, and hands-on training consisting of 12 tasks on the da Vinci Skills Simulator (dVSS). The primary outcomes were completion of training and time to completion. The secondary outcomes included resident attitudes regarding TORS as reflected on post-training survey. A total of 20 resident trainees participated in the study. 85% of trainees completed the hands-on robotic training in the allotted 3-h time limit. The average time to completion for those who finished was 91.53 min (SD 33.59 min). There was no statistically significant correlation between time to completion and PGY, number of robotic first assists, or total number of robotic cases. An introductory, resident-directed TORS training curriculum using the dVSS on an active surgical console is feasible in an academic medical center and may contribute to basic robotic competency among residents. Institutions with a dVSS may replicate this training in a resource-efficient manner prior to implementation of more comprehensive training. Robotic skills are likely trainable and independent from surgical skills learned during residency.

  3. Measuring the Effects of Virtual Pair Programming in an Introductory Programming Java Course

    Science.gov (United States)

    Zacharis, N. Z.

    2011-01-01

    This study investigated the effectiveness of virtual pair programming (VPP) on student performance and satisfaction in an introductory Java course. Students used online tools that integrated desktop sharing and real-time communication, and the metrics examined showed that VPP is an acceptable alternative to individual programming experience.…

  4. Beyond Introductory Programming: Success Factors for Advanced Programming

    Science.gov (United States)

    Hoskey, Arthur; Maurino, Paula San Millan

    2011-01-01

    Numerous studies document high drop-out and failure rates for students in computer programming classes. Studies show that even when some students pass programming classes, they still do not know how to program. Many factors have been considered to explain this problem including gender, age, prior programming experience, major, math background,…

  5. Assessing the Success of an Introductory Programming Course

    Science.gov (United States)

    Ford, Marilyn; Venema, Sven

    2010-01-01

    With universities having difficulty attracting students to study information technology (IT), the scores needed for entry into IT degrees have dropped markedly. IT schools are thus having to cope by adjusting their introductory courses to ensure that students will still learn what is expected but without negatively impacting on pass rates. This…

  6. The Appropriateness of Scratch and App Inventor as Educational Environments for Teaching Introductory Programming in Primary and Secondary Education

    Science.gov (United States)

    Papadakis, Stamatios; Kalogiannakis, Michail; Orfanakis, Vasileios; Zaranis, Nicholas

    2017-01-01

    Teaching programming is a complex task. The task is even more challenging for introductory modules. There is an ongoing debate in the teaching community over the best approach to teaching introductory programming. Visual block-based programming environments allow school students to create their own programs in ways that are more accessible than in…

  7. The Appropriateness of Scratch and App Inventor as Educational Environments for Teaching Introductory Programming in Primary and Secondary Education

    Science.gov (United States)

    Papadakis, Stamatios; Kalogiannakis, Michail; Orfanakis, Vasileios; Zaranis, Nicholas

    Teaching programming is a complex task. The task is even more challenging for introductory modules. There is an ongoing debate in the teaching community over the best approach to teaching introductory programming. Visual block-based programming environments allow school students to create their own programs in ways that are more accessible than in…

  8. Understanding Factors Leading to Participation in Supplemental Instruction Programs in Introductory Accounting Courses

    Science.gov (United States)

    Goldstein, James; Sauer, Paul; O'Donnell, Joseph

    2014-01-01

    Although studies have shown that supplemental instruction (SI) programs can have positive effects in introductory accounting courses, these programs experience low participation rates. Thus, our study is the first to examine the factors leading to student participation in SI programs. We do this through a survey instrument based on the Theory of…

  9. Java vs. Python Coverage of Introductory Programming Concepts: A Textbook Analysis

    Science.gov (United States)

    McMaster, Kirby; Sambasivam, Samuel; Rague, Brian; Wolthuis, Stuart

    2017-01-01

    In this research, we compare two languages, Java and Python, by performing a content analysis of words in textbooks that describe important programming concepts. Our goal is to determine which language has better textbook support for teaching introductory programming courses. We used the TextSTAT program to count how often our list of concept…

  10. Influenza vaccination coverage of Vaccine for Children (VFC)-entitled versus privately insured children, United States, 2011–2013☆

    Science.gov (United States)

    Srivastav, Anup; Zhai, Yusheng; Santibanez, Tammy A.; Kahn, Katherine E.; Smith, Philip J.; Singleton, James A.

    2016-01-01

    Background The Vaccines for Children (VFC) program provides vaccines at no cost to children who are Medicaid-eligible, uninsured, American Indian or Alaska Native (AI/AN), or underinsured and vaccinated at Federally Qualified Health Centers or Rural Health Clinics. The objective of this study was to compare influenza vaccination coverage of VFC-entitled to privately insured children in the United States, nationally, by state, and by selected socio-demographic variables. Methods Data from the National Immunization Survey-Flu (NIS-Flu) surveys were analyzed for the 2011–2012 and 2012–2013 influenza seasons for households with children 6 months–17 years. VFC-entitlement and private insurance status were defined based upon questions asked of the parent during the telephone interview. Influenza vaccination coverage estimates of children VFC-entitled versus privately insured were compared by t-tests, both nationally and within state, and within selected socio-demographic variables. Results For both seasons studied, influenza coverage for VFC-entitled children did not significantly differ from coverage for privately insured children (2011–2012: 52.0% ± 1.9% versus 50.7% ± 1.2%; 2012–2013: 56.0% ± 1.6% versus 57.2% ± 1.2%). Among VFC-entitled children, uninsured children had lower coverage (2011–2012: 38.9% ± 4.7%; 2012–2013: 44.8% ± 3.5%) than Medicaid-eligible (2011–2012: 55.2% ± 2.1%; 2012–2013: 58.6% ± 1.9%) and AI/AN children (2011–2012: 54.4% ± 11.3%; 2012–2013: 54.6% ± 7.0%). Significant differences in vaccination coverage among VFC-entitled and privately insured children were observed within some subgroups of race/ethnicity, income, age, region, and living in a metropolitan statistical area principle city. Conclusions Although finding few differences in influenza vaccination coverage among VFC-entitled versus privately insured children was encouraging, nearly half of all children were not vaccinated for influenza and coverage was

  11. Influenza vaccination coverage of Vaccine for Children (VFC)-entitled versus privately insured children, United States, 2011-2013.

    Science.gov (United States)

    Srivastav, Anup; Zhai, Yusheng; Santibanez, Tammy A; Kahn, Katherine E; Smith, Philip J; Singleton, James A

    2015-06-17

    The Vaccines for Children (VFC) program provides vaccines at no cost to children who are Medicaid-eligible, uninsured, American Indian or Alaska Native (AI/AN), or underinsured and vaccinated at Federally Qualified Health Centers or Rural Health Clinics. The objective of this study was to compare influenza vaccination coverage of VFC-entitled to privately insured children in the United States, nationally, by state, and by selected socio-demographic variables. Data from the National Immunization Survey-Flu (NIS-Flu) surveys were analyzed for the 2011-2012 and 2012-2013 influenza seasons for households with children 6 months-17 years. VFC-entitlement and private insurance status were defined based upon questions asked of the parent during the telephone interview. Influenza vaccination coverage estimates of children VFC-entitled versus privately insured were compared by t-tests, both nationally and within state, and within selected socio-demographic variables. For both seasons studied, influenza coverage for VFC-entitled children did not significantly differ from coverage for privately insured children (2011-2012: 52.0%±1.9% versus 50.7%±1.2%; 2012-2013: 56.0%±1.6% versus 57.2%±1.2%). Among VFC-entitled children, uninsured children had lower coverage (2011-2012: 38.9%±4.7%; 2012-2013: 44.8%±3.5%) than Medicaid-eligible (2011-2012: 55.2%±2.1%; 2012-2013: 58.6%±1.9%) and AI/AN children (2011-2012: 54.4%±11.3%; 2012-2013: 54.6%±7.0%). Significant differences in vaccination coverage among VFC-entitled and privately insured children were observed within some subgroups of race/ethnicity, income, age, region, and living in a metropolitan statistical area principle city. Although finding few differences in influenza vaccination coverage among VFC-entitled versus privately insured children was encouraging, nearly half of all children were not vaccinated for influenza and coverage was particularly low among uninsured children. Additional public health interventions

  12. Mindstorms Robots and the Application of Cognitive Load Theory in Introductory Programming

    Science.gov (United States)

    Mason, Raina; Cooper, Graham

    2013-01-01

    This paper reports on a series of introductory programming workshops, initially targeting female high school students, which utilised Lego Mindstorms robots. Cognitive load theory (CLT) was applied to the instructional design of the workshops, and a controlled experiment was also conducted investigating aspects of the interface. Results indicated…

  13. Instructional strategies and tactics for the design of introductory computer programming courses in high school

    NARCIS (Netherlands)

    van Merrienboer, Jeroen J.G.; Krammer, H.P.M.

    1987-01-01

    This article offers an examination of instructional strategies and tactics for the design of introductory computer programming courses in high school. We distinguish the Expert, Spiral and Reading approach as groups of instructional strategies that mainly differ in their general design plan to

  14. Holistic Approach to Learning and Teaching Introductory Object-Oriented Programming

    Science.gov (United States)

    Thota, Neena; Whitfield, Richard

    2010-01-01

    This article describes a holistic approach to designing an introductory, object-oriented programming course. The design is grounded in constructivism and pedagogy of phenomenography. We use constructive alignment as the framework to align assessments, learning, and teaching with planned learning outcomes. We plan learning and teaching activities,…

  15. Teaching Introductory Programming to IS Students: Java Problems and Pitfalls

    Science.gov (United States)

    Pendergast, Mark O.

    2006-01-01

    This paper examines the impact the use of the Java programming language has had on the way our students learn to program and the success they achieve. The importance of a properly constructed first course in programming cannot be overstated. A course well experienced will leave students with good programming habits, the ability to learn on their…

  16. Using Short Videos in an Introductory Programming Course

    DEFF Research Database (Denmark)

    Nørmark, Kurt

    2014-01-01

    Video resources are gradually being introduced in a first year programming course. The course is about imperative programming in C. After each of the first two years with video lectures the students have been asked about their assessments and opinions. The main parts of the paper are based...... on evidence from two questionnaires. It is concluded that a vast majority of the students find it very attractive to learn about imperative programming via videos (with or without supplementary coverage from a textbook). The paper describes the status of an ongoing activity. In addition to conclusions on past...... experience we also carry out a discussion of future plans for using video resources in the course....

  17. The ongoing Digitalization of an Introductory Programming Course

    DEFF Research Database (Denmark)

    Nørmark, Kurt

    2016-01-01

    This paper is about the ongoing digitalization of a C programming course. The paper describes our considerations about the use of video resources, as well as other digital learning resources. In particular, we discuss the ongoing transition from using a number of supplementary videos (in a tradit......This paper is about the ongoing digitalization of a C programming course. The paper describes our considerations about the use of video resources, as well as other digital learning resources. In particular, we discuss the ongoing transition from using a number of supplementary videos (in...

  18. Predictors of student success in graduate biomedical informatics training: introductory course and program success.

    Science.gov (United States)

    Willcockson, Irmgard U; Johnson, Craig W; Hersh, William; Bernstam, Elmer V

    2009-01-01

    To predict student performance in an introductory graduate-level biomedical informatics course from application data. A predictive model built through retrospective review of student records using hierarchical binary logistic regression with half of the sample held back for cross-validation. The model was also validated against student data from a similar course at a second institution. Earning an A grade (Mastery) or a C grade (Failure) in an introductory informatics course. The authors analyzed 129 student records at the University of Texas School of Health Information Sciences at Houston (SHIS) and 106 at Oregon Health and Science University Department of Medical Informatics and Clinical Epidemiology (DMICE). In the SHIS cross-validation sample, the Graduate Record Exam verbal score (GRE-V) correctly predicted Mastery in 69.4%. Undergraduate grade point average (UGPA) and underrepresented minority status (URMS) predicted 81.6% of Failures. At DMICE, GRE-V, UGPA, and prior graduate degree significantly correlated with Mastery. Only GRE-V was a significant independent predictor of Mastery at both institutions. There were too few URMS students and Failures at DMICE to analyze. Course Mastery strongly predicted program performance defined as final cumulative GPA at SHIS (n=19, r=0.634, r2=0.40, p=0.0036) and DMICE (n=106, r=0.603, r2=0.36, p<0.001). The authors identified predictors of performance in an introductory informatics course including GRE-V, UGPA and URMS. Course performance was a very strong predictor of overall program performance. Findings may be useful for selecting students for admission and identifying students at risk for Failure as early as possible.

  19. Comparison of Traditional and ADRI Based Teaching Approaches in an Introductory Programming Course

    Directory of Open Access Journals (Sweden)

    Sohail Iqbal Malik

    2017-08-01

    Full Text Available Aim/Purpose: This study introduced a new teaching and learning approach based on an ADRI (Approach, Deployment, Result, Improvement model in an introductory programming (IP course. The effectiveness of the new teaching and learning process was determined by collecting feedback from the IP instructors and by analyzing the final exam grades of the course. Background: Learning to program is considered a difficult and challenging task for a considerable number of novice programmers. As a result, high failure and dropout rates are often reported in IP courses. Different studies have been conducted to investigate the issue. One of the reasons for this challenge is the multiple skills that students have to master in order to be able to build programs. These skills include programming knowledge and problem-solving strategies and being able to pay equal attention to these required skills in the IP course. Methodology: A focus group was conducted to obtain feedback from the IP instructors about the ADRI approach. The performance of the students who had completed the IP course before ADRI was compared with those who used the ADRI approach by undertaking a comparative analysis of their final exam grades. Contribution: The study demonstrates that the new teaching and learning approach based on the ADRI model encourages students to pay equal attention to programming knowledge and problem-solving strategies, discouraging programming shortcuts and reducing high attrition rates (failure and dropout in the IP course. Findings: The results of the focus group show that the instructors preferred the ADRI approach compared to the traditional approach. The final exam grades show that the students performed better in semesters which offered the ADRI approach as compared to those semesters without this approach. Future Research: Future research will explore the ADRI approach in other fields of computer science studies, such as database and data structure, to determine

  20. Mindstorms robots and the application of cognitive load theory in introductory programming

    Science.gov (United States)

    Mason, Raina; Cooper, Graham

    2013-12-01

    This paper reports on a series of introductory programming workshops, initially targeting female high school students, which utilised Lego Mindstorms robots. Cognitive load theory (CLT) was applied to the instructional design of the workshops, and a controlled experiment was also conducted investigating aspects of the interface. Results indicated that a truncated interface led to better learning by novice programmers as measured by test performance by participants, as well as enhanced shifts in self-efficacy and lowered perception of difficulty. There was also a transfer effect to another programming environment (Alice). It is argued that the results indicate that for novice programmers, the mere presence on-screen of additional (redundant) entities acts as a form of tacit distraction, thus impeding learning. The utility of CLT to analyse, design and deliver aspects of computer programming environments and instructional materials is discussed.

  1. A Three-Year Reflective Writing Program as Part of Introductory Pharmacy Practice Experiences

    Science.gov (United States)

    Vaughn, Jessica; Kerr, Kevin; Zielenski, Christopher; Toppel, Brianna; Johnson, Lauren; McCauley, Patrina; Turner, Christopher J.

    2013-01-01

    Objectives. To implement and evaluate a 3-year reflective writing program incorporated into introductory pharmacy practice experiences (IPPEs) in the first- through third-year of a doctor of pharmacy (PharmD) program. Design. Reflective writing was integrated into 6 IPPE courses to develop students’ lifelong learning skills. In their writing, students were required to self-assess their performance in patient care activities, identify and describe how they would incorporate learning opportunities, and then evaluate their progress. Practitioners, faculty members, and fourth-year PharmD students served as writing preceptors. Assessment. The success of the writing program was assessed by reviewing class performance and surveying writing preceptor’s opinions regarding the student’s achievement of program objectives. Class pass rates averaged greater than 99% over the 8 years of the program and the large majority of the writing preceptors reported that student learning objectives were met. A support pool of 99 writing preceptors was created. Conclusions. A 3-year reflective writing program improved pharmacy students’ reflection and reflective writing skills. PMID:23788811

  2. A Case Study of Prior Knowledge, Learning Approach and Conceptual Change in an Introductory College Chemistry Tutorial Program.

    Science.gov (United States)

    Braathen, Per Christian; Hewson, Peter W.

    This paper presents a case study involving a small group of students enrolled in a tutorial program learning introductory college chemistry. The underlying theoretical framework of this investigation was a constructivist view of learning, but more specifically it was based on Ausubel's theory of meaningful learning. The findings of this…

  3. Biotechnology by Design: An Introductory Level, Project-Based, Synthetic Biology Laboratory Program for Undergraduate Students

    Directory of Open Access Journals (Sweden)

    Dale L. Beach

    2015-08-01

    Full Text Available Synthetic biology offers an ideal opportunity to promote undergraduate laboratory courses with research-style projects, immersing students in an inquiry-based program that enhances the experience of the scientific process. We designed a semester-long, project-based laboratory curriculum using synthetic biology principles to develop a novel sensory device. Students develop subject matter knowledge of molecular genetics and practical skills relevant to molecular biology, recombinant DNA techniques, and information literacy. During the spring semesters of 2014 and 2015, the Synthetic Biology Laboratory Project was delivered to sophomore genetics courses. Using a cloning strategy based on standardized BioBrick genetic “parts,” students construct a “reporter plasmid” expressing a reporter gene (GFP controlled by a hybrid promoter regulated by the lac-repressor protein (lacI. In combination with a “sensor plasmid,” the production of the reporter phenotype is inhibited in the presence of a target environmental agent, arabinose. When arabinose is absent, constitutive GFP expression makes cells glow green. But the presence of arabinose activates a second promoter (pBAD to produce a lac-repressor protein that will inhibit GFP production. Student learning was assessed relative to five learning objectives, using a student survey administered at the beginning (pre-survey and end (post-survey of the course, and an additional 15 open-ended questions from five graded Progress Report assignments collected throughout the course. Students demonstrated significant learning gains (p < 0.05 for all learning outcomes. Ninety percent of students indicated that the Synthetic Biology Laboratory Project enhanced their understanding of molecular genetics. The laboratory project is highly adaptable for both introductory and advanced courses. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe

  4. Biotechnology by Design: An Introductory Level, Project-Based, Synthetic Biology Laboratory Program for Undergraduate Students.

    Science.gov (United States)

    Beach, Dale L; Alvarez, Consuelo J

    2015-12-01

    Synthetic biology offers an ideal opportunity to promote undergraduate laboratory courses with research-style projects, immersing students in an inquiry-based program that enhances the experience of the scientific process. We designed a semester-long, project-based laboratory curriculum using synthetic biology principles to develop a novel sensory device. Students develop subject matter knowledge of molecular genetics and practical skills relevant to molecular biology, recombinant DNA techniques, and information literacy. During the spring semesters of 2014 and 2015, the Synthetic Biology Laboratory Project was delivered to sophomore genetics courses. Using a cloning strategy based on standardized BioBrick genetic "parts," students construct a "reporter plasmid" expressing a reporter gene (GFP) controlled by a hybrid promoter regulated by the lac-repressor protein (lacI). In combination with a "sensor plasmid," the production of the reporter phenotype is inhibited in the presence of a target environmental agent, arabinose. When arabinose is absent, constitutive GFP expression makes cells glow green. But the presence of arabinose activates a second promoter (pBAD) to produce a lac-repressor protein that will inhibit GFP production. Student learning was assessed relative to five learning objectives, using a student survey administered at the beginning (pre-survey) and end (post-survey) of the course, and an additional 15 open-ended questions from five graded Progress Report assignments collected throughout the course. Students demonstrated significant learning gains (p Biology Laboratory Project enhanced their understanding of molecular genetics. The laboratory project is highly adaptable for both introductory and advanced courses.

  5. Biotechnology by Design: An Introductory Level, Project-Based, Synthetic Biology Laboratory Program for Undergraduate Students†

    Science.gov (United States)

    Beach, Dale L.; Alvarez, Consuelo J.

    2015-01-01

    Synthetic biology offers an ideal opportunity to promote undergraduate laboratory courses with research-style projects, immersing students in an inquiry-based program that enhances the experience of the scientific process. We designed a semester-long, project-based laboratory curriculum using synthetic biology principles to develop a novel sensory device. Students develop subject matter knowledge of molecular genetics and practical skills relevant to molecular biology, recombinant DNA techniques, and information literacy. During the spring semesters of 2014 and 2015, the Synthetic Biology Laboratory Project was delivered to sophomore genetics courses. Using a cloning strategy based on standardized BioBrick genetic “parts,” students construct a “reporter plasmid” expressing a reporter gene (GFP) controlled by a hybrid promoter regulated by the lac-repressor protein (lacI). In combination with a “sensor plasmid,” the production of the reporter phenotype is inhibited in the presence of a target environmental agent, arabinose. When arabinose is absent, constitutive GFP expression makes cells glow green. But the presence of arabinose activates a second promoter (pBAD) to produce a lac-repressor protein that will inhibit GFP production. Student learning was assessed relative to five learning objectives, using a student survey administered at the beginning (pre-survey) and end (post-survey) of the course, and an additional 15 open-ended questions from five graded Progress Report assignments collected throughout the course. Students demonstrated significant learning gains (p learning outcomes. Ninety percent of students indicated that the Synthetic Biology Laboratory Project enhanced their understanding of molecular genetics. The laboratory project is highly adaptable for both introductory and advanced courses. PMID:26753032

  6. Introductory Computer Programming Course Teaching Improvement Using Immersion Language, Extreme Programming, and Education Theories

    Science.gov (United States)

    Velez-Rubio, Miguel

    2013-01-01

    Teaching computer programming to freshmen students in Computer Sciences and other Information Technology areas has been identified as a complex activity. Different approaches have been studied looking for the best one that could help to improve this teaching process. A proposed approach was implemented which is based in the language immersion…

  7. Chemoreceptor VfcA mediates amino acid chemotaxis in Vibrio fischeri.

    Science.gov (United States)

    Brennan, Caitlin A; DeLoney-Marino, Cindy R; Mandel, Mark J

    2013-03-01

    Flagellar motility and chemotaxis by Vibrio fischeri are important behaviors mediating the colonization of its mutualistic host, the Hawaiian bobtail squid. However, none of the 43 putative methyl-accepting chemotaxis proteins (MCPs) encoded in the V. fischeri genome has been previously characterized. Using both an available transposon mutant collection and directed mutagenesis, we isolated mutants for 19 of these genes, and screened them for altered chemotaxis to six previously identified chemoattractants. Only one mutant was defective in responding to any of the tested compounds; the disrupted gene was thus named vfcA (Vibrio fischeri chemoreceptor A; locus tag VF_0777). In soft-agar plates, mutants disrupted in vfcA did not exhibit the serine-sensing chemotactic ring, and the pattern of migration in the mutant was not affected by the addition of exogenous serine. Using a capillary chemotaxis assay, we showed that, unlike wild-type V. fischeri, the vfcA mutant did not undergo chemotaxis toward serine and that expression of vfcA on a plasmid in the mutant was sufficient to restore the behavior. In addition to serine, we demonstrated that alanine, cysteine, and threonine are strong attractants for wild-type V. fischeri and that the attraction is also mediated by VfcA. This study thus provides the first insights into how V. fischeri integrates information from one of its 43 MCPs to respond to environmental stimuli.

  8. Analyzing the Effect of Learning Styles and Study Habits of Distance Learners on Learning Performances: A Case of an Introductory Programming Course

    Science.gov (United States)

    Çakiroglu, Ünal

    2014-01-01

    This study examined the relationships among learning styles, study habits, and learning performances in an online programming language course. Sixty-two sophomore students who enrolled in an online introductory programming course participated in the study. Kolb's Learning Style Inventory (LSI) was used to measure the students' learning styles.…

  9. Does Participation in a Computer-Based Learning Program in Introductory Financial Accounting Course Lead to Choosing Accounting as a Major?

    Science.gov (United States)

    Owhoso, Vincent; Malgwi, Charles A.; Akpomi, Margaret

    2014-01-01

    The authors examine whether students who completed a computer-based intervention program, designed to help them develop abilities and skills in introductory accounting, later declared accounting as a major. A sample of 1,341 students participated in the study, of which 74 completed the intervention program (computer-based assisted learning [CBAL])…

  10. Introductory remarks

    NARCIS (Netherlands)

    Kiefer, Friedemann; Schulte-Merker, Stefan

    2014-01-01

    This introductory section briefly highlights the subsequent chapters in the context of recent findings and open questions in lymphatic vessel biology. It aims to provide a quick overview and orientation in the contents of this monograph collection.

  11. Teaching Introductory GIS Programming to Geographers Using an Open Source Python Approach

    Science.gov (United States)

    Etherington, Thomas R.

    2016-01-01

    Computer programming is not commonly taught to geographers as a part of geographic information system (GIS) courses, but the advent of NeoGeography, big data and open GIS means that programming skills are becoming more important. To encourage the teaching of programming to geographers, this paper outlines a course based around a series of…

  12. The Impact of Different Teaching Approaches and Languages on Student Learning of Introductory Programming Concepts

    Science.gov (United States)

    Kunkle, Wanda M.

    2010-01-01

    Many students experience difficulties learning to program. They find learning to program in the object-oriented paradigm particularly challenging. As a result, computing educators have tried a variety of instructional methods to assist beginning programmers. These include developing approaches geared specifically toward novices and experimenting…

  13. The Effect of Problem-Solving Instruction on the Programming Self-efficacy and Achievement of Introductory Computer Science Students

    Science.gov (United States)

    Maddrey, Elizabeth

    Research in academia and industry continues to identify a decline in enrollment in computer science. One major component of this decline in enrollment is a shortage of female students. The primary reasons for the gender gap presented in the research include lack of computer experience prior to their first year in college, misconceptions about the field, negative cultural stereotypes, lack of female mentors and role models, subtle discriminations in the classroom, and lack of self-confidence (Pollock, McCoy, Carberry, Hundigopal, & You, 2004). Male students are also leaving the field due to misconceptions about the field, negative cultural stereotypes, and a lack of self-confidence. Analysis of first year attrition revealed that one of the major challenges faced by students of both genders is a lack of problem-solving skills (Beaubouef, Lucas & Howatt, 2001; Olsen, 2005; Paxton & Mumey, 2001). The purpose of this study was to investigate whether specific, non-mathematical problem-solving instruction as part of introductory programming courses significantly increased computer programming self-efficacy and achievement of students. The results of this study showed that students in the experimental group had significantly higher achievement than students in the control group. While this shows statistical significance, due to the effect size and disordinal nature of the data between groups, care has to be taken in its interpretation. The study did not show significantly higher programming self-efficacy among the experimental students. There was not enough data collected to statistically analyze the effect of the treatment on self-efficacy and achievement by gender. However, differences in means were observed between the gender groups, with females in the experimental group demonstrating a higher than average degree of self-efficacy when compared with males in the experimental group and both genders in the control group. These results suggest that the treatment from this

  14. Evaluation of a Continuing Professional Development program for first year student pharmacists undergoing an Introductory Pharmacy Practice Experience

    Directory of Open Access Journals (Sweden)

    Toyin Tofade, MS, PharmD, BCPS, CPCC, Pharmacotherapy Director, Wake Area Health Education Center and Clinical Associate Professor, Division of Pharmacy Practice and Experiential Education

    2011-01-01

    Full Text Available Objectives: The purpose of the study was to evaluate a live and online training program for first year pharmacy students in implementing Continuing Professional Development (CPD principles (Reflect, Plan, Act, and Evaluate, writing SMART learning objectives, and documenting learning activities prior to and during a hospital introductory professional practice experience.Design: Cohort Study. Setting: Introductory professional practice experience. Participants: First year (PY1 students at the University of North Carolina Eshelman School of Pharmacy. Intervention: Live training or online training to introduce the concept of Continuing Professional Development in practice. Main Outcomes: Implementation of CPD principles through 1 completed pre-rotation education action plans with specific, measurable, achievable, relevant and time-bound (SMART learning objectives; and 2 completed learning activity worksheets post-rotation indicating stimuli for learning, resources used and accomplished learning. objectives; and 3 documented suggestions and content feedback for future lectures and pharmaceutical care lab experiences. Results: Out of the whole cohort (N=154, 14 (87.5% live (in person trainees and 122 (88% online trainees submitted an education action plan. Objectives were scored using a rubric on a scale of 1-5. A rating of 5 means “satisfactory”, 3 means “work in progress” and 1 means “unacceptable”. There were significant differences between the mean live trainee scores and the mean online trainee scores for the following respective section comparisons: Specific 4.7 versus 3.29 (p<0.001; Measurable 3.9 versus 2.05 (p<0.001; number of objectives 3.6 versus 4.6 (p<0.001; and average grade 92.9 versus 77.7 (p<0.001. Of the 396 learning activity worksheets reviewed, 75% selected discussion with peers and/or health providers as a stimulus for learning. Students reported spending an average of 50.2 hours completing the learning objectives. All

  15. Mentored Discussions of Teaching: An Introductory Teaching Development Program for Future STEM Faculty

    Science.gov (United States)

    Baiduc, Rachael R.; Linsenmeier, Robert A.; Ruggeri, Nancy

    2016-01-01

    Today's science, technology, engineering, and mathematics (STEM) graduate students and postdoctoral fellows are tomorrow's new faculty members; but these junior academicians often receive limited pedagogical training. We describe four iterations of an entry-level program with a low time commitment, Mentored Discussions of Teaching (MDT). The…

  16. On the Treatment of Culture in the Introductory Course of Our Programs Abroad.

    Science.gov (United States)

    Hernandez, Rafael E.

    1981-01-01

    Outlines the contents of a culture and civilization course for first-year students of Spanish enrolled in a program abroad. Proposes to focus on the diversity of the Hispanic culture, on questions of cultural identity, cultural differences and similarities, and on the study of cultural stereotypes. (MES)

  17. Enhancing Practice and Achievement in Introductory Programming with a Robot Olympics

    Science.gov (United States)

    Scott, Michael James; Counsell, Steve; Lauria, Stanislao; Swift, Stephen; Tucker, Allan; Shepperd, Martin; Ghinea, Gheorghita

    2015-01-01

    Computer programming is notoriously difficult to learn. To this end, regular practice in the form of application and reflection is an important enabler of student learning. However, educators often find that first-year B.Sc. students do not readily engage in such activities. Providing each student with a programmable robot, however, could be used…

  18. Basic essential education program (BEEP: a brief introductory faculty development course for medical teachers

    Directory of Open Access Journals (Sweden)

    Robert Madan

    2012-09-01

    Full Text Available Background: Physicians have a unique role in teaching future physicians and allied health professionals. Yet, most medical doctors have limited instruction in this critical component of their daily activity. Methods: This study was a prospective cohort study of the effectiveness of a local teaching program at two teaching hospitals for junior faculty. Based on a needs analysis and literature review, the teaching program was developed in an accessible and compact format of six consecutive, one-hour "lunch and learn" sessions, held locally over a six week period. Pre-post questionnaires and focus groups were used to evaluate the program. Results: Participants reported being satisfied with the course as whole, particularly in respect to the format and location. There was an improvement in their knowledge in all content areas covered. The greatest benefits were derived from fostering a community of practice and having the opportunity to role play and simulate teaching skills. An attitudinal change towards teaching was noted. Conclusions: A brief, local faculty development program was effective in enhancing physicians’ knowledge, skills, and attitudes in teaching.

  19. Effects of Using Alice and Scratch in an Introductory Programming Course for Corrective Instruction

    Science.gov (United States)

    Chang, Chih-Kai

    2014-01-01

    Scratch, a visual programming language, was used in many studies in computer science education. Most of them reported positive results by integrating Scratch into K-12 computer courses. However, the object-oriented concept, one of the important computational thinking skills, is not represented well in Scratch. Alice, another visual programming…

  20. Interviews with College Students: Evaluating Computer Programming Environments for Introductory Courses

    Science.gov (United States)

    Uysal, Murat Pasa

    2014-01-01

    Different methods, strategies, or tools have been proposed for teaching Object Oriented Programming (OOP). However, it is still difficult to introduce OOP to novice learners. The problem may be not only adopting a method or language, but also use of an appropriate integrated development environment (IDE). Therefore, the focus should be on the…

  1. Biotechnology by Design: An Introductory Level, Project-Based, Synthetic Biology Laboratory Program for Undergraduate Students†

    OpenAIRE

    Beach, Dale L.; Alvarez, Consuelo J.

    2015-01-01

    Synthetic biology offers an ideal opportunity to promote undergraduate laboratory courses with research-style projects, immersing students in an inquiry-based program that enhances the experience of the scientific process. We designed a semester-long, project-based laboratory curriculum using synthetic biology principles to develop a novel sensory device. Students develop subject matter knowledge of molecular genetics and practical skills relevant to molecular biology, recombinant DNA techniq...

  2. Transforming an Introductory Programming Course: From Lectures to Active Learning via Wireless Laptops

    Science.gov (United States)

    Barak, Miri; Harward, Judson; Kocur, George; Lerman, Steven

    2007-08-01

    Within the framework of MIT's course 1.00: Introduction to Computers and Engineering Problem Solving, this paper describes an innovative project entitled: Studio 1.00 that integrates lectures with in-class demonstrations, active learning sessions, and on-task feedback, through the use of wireless laptop computers. This paper also describes a related evaluation study that investigated the effectiveness of different instructional strategies, comparing traditional teaching with two models of the studio format. Students' learning outcomes, specifically, their final grades and conceptual understanding of computational methods and programming, were examined. Findings indicated that Studio-1.00, in both its extensive- and partial-active learning modes, enhanced students' learning outcomes in Java programming. Comparing to the traditional courses, more students in the studio courses received "A" as their final grade and less failed. Moreover, students who regularly attended the active learning sessions were able to conceptualize programming principles better than their peers. We have also found two weaknesses in the teaching format of Studio-1.00 that can guide future versions of the course.

  3. Introductory Comments

    Directory of Open Access Journals (Sweden)

    Jolanta Sujecka

    2016-12-01

    Full Text Available Introductory Comments The fifth yearly volume of the Colloquia Humanistica comprises a thematic section on Nation, Natsiya, Ethnie. The subject it discusses has thus far received little attention as a research problem in the Slavia Orthodoxa, the Slavia Romana, the Balkans but also in Central and Eastern Europe.   Uwagi wstępne Piąty numer rocznika "Colloquia Humanistica" przedstawia dział tematyczny, poświęcony kategoriom narodu, nacji i etni. Temat ten, w takiej perspektywie, którą proponujemy, nie spotkał się dotąd z należytym namysłem badawczym w sferze Slavia Otrhodoxa, Slavia Romana i na Bałkanach, jak też w Europie Środkowo-Wschodniej.

  4. Organic Chemistry in Action! Developing an Intervention Program for Introductory Organic Chemistry to Improve Learners' Understanding, Interest, and Attitudes

    Science.gov (United States)

    O'Dwyer, Anne; Childs, Peter

    2014-01-01

    The main areas of difficulty experienced by those teaching and learning organic chemistry at high school and introductory university level in Ireland have been identified, and the findings support previous studies in Ireland and globally. Using these findings and insights from chemistry education research (CER), the Organic Chemistry in Action!…

  5. The periplasmic sensing domain of Vibrio fischeri chemoreceptor protein A (VfcA): cloning, purification and crystallographic analysis.

    Science.gov (United States)

    Salah Ud-Din, Abu Iftiaf Md; Roujeinikova, Anna

    2016-05-01

    Flagella-mediated motility and chemotaxis towards nutrients are important characteristics of Vibrio fischeri that play a crucial role in the development of its symbiotic relationship with its Hawaiian squid host Euprymna scolopes. The V. fischeri chemoreceptor A (VfcA) mediates chemotaxis toward amino acids. The periplasmic sensory domain of VfcA has been crystallized by the hanging-drop vapour-diffusion method using polyethylene glycol 3350 as a precipitating agent. The crystals belonged to space group P1, with unit-cell parameters a = 39.9, b = 57.0, c = 117.0 Å, α = 88.9, β = 80.5, γ = 89.7°. A complete X-ray diffraction data set has been collected to 1.8 Å resolution using cryocooling conditions and synchrotron radiation.

  6. Usability and Pedagogical Assessment of an Algorithm Learning Tool: A Case Study for an Introductory Programming Course for High School

    Directory of Open Access Journals (Sweden)

    Aimee Theresa Avancena

    2015-06-01

    Full Text Available An algorithm learning tool was developed for an introductory computer science class in a specialized science and technology high school in Japan. The tool presents lessons and simple visualizations that aim to facilitate teaching and learning of fundamental algorithms. Written tests and an evaluation questionnaire were designed and implemented along with the learning tool among the participants. The tool’s effect on the learning performance of the students was examined. The differences of the two types of visualizations offered by the tool, one with more input and control options and the other with fewer options, were analyzed. Based on the evaluation questionnaire, the scales with which the tool can be assessed according to its usability and pedagogical effectiveness were identified. After using the algorithm learning tool there was an increase in the posttest scores of the students, and those who used the visualization with more input and control options had higher scores compared to those who used the one with limited options. The learning objectives used to evaluate the tool correlated with the test performance of the students. Properties comprised of learning objectives, algorithm visualization characteristics, and interface assessment are proposed to be incorporated in evaluating an algorithm learning tool for novice learners.

  7. Microworlds, Games, Animations, Mobile Apps, Puzzle Editors and More: What Is Important for an Introductory Programming Environment?

    Science.gov (United States)

    Xinogalos, Stelios; Satratzemi, Maya; Malliarakis, Christos

    2017-01-01

    Teaching and learning programming constitutes a challenge. Although several teaching approaches and programming tools have been proposed, it seems that they have limited impact on classroom practice. This article investigates students' perceptions on five educational programming environments that are widely used and the features that any…

  8. Sustainability of school-located influenza vaccination programs in Florida.

    Science.gov (United States)

    Tran, Cuc H; Brew, Joe; Johnson, Nicholas; Ryan, Kathleen A; Martin, Brittany; Cornett, Catherine; Caron, Brad; Duncan, R Paul; Small, Parker A; Myers, Paul D; Morris, J Glenn

    2016-05-23

    School-located influenza vaccination (SLIV) programs are a promising strategy for increasing vaccination coverage among schoolchildren. However, questions of economic sustainability have dampened enthusiasm for this approach in the United States. We evaluated SLIV sustainability of a health department led, county-wide SLIV program in Alachua County, Florida. Based on Alachua's outcome data, we modeled the sustainability of SLIV programs statewide using two different implementation costs and at different vaccination rates, reimbursement amount, and Vaccines for Children (VFC) coverage. Mass vaccination clinics were conducted at 69 Alachua County schools in 2013 using VFC (for Medicaid and uninsured children) and non-VFC vaccines. Claims were processed after each clinic and submitted to insurance providers for reimbursement ($5 Medicaid and $47.04 from private insurers). We collected programmatic expenditures and volunteer hours to calculate fixed and variable costs for two different implementation costs (with or without in-kind costs included). We project program sustainability for Florida using publicly available county-specific student populations and health insurance enrollment data. Approximately 42% (n=12,853) of pre-kindergarten - 12th grade students participated in the SLIV program in Alachua. Of the 13,815 doses provided, 58% (8042) were non-VFC vaccine. Total implementation cost was $14.95/dose or $7.93/dose if "in-kind" costs were not included. The program generated a net surplus of $24,221, despite losing $4.68 on every VFC dose provided to Medicaid and uninsured children. With volunteers, 99% of Florida counties would be sustainable at a 50% vaccination rate and average reimbursement amount of $3.25 VFC and $37 non-VFC. Without volunteers, 69% of counties would be sustainable at 50% vaccination rate if all VFC recipients were on Medicaid and its reimbursement increased from $5 to $10 (amount private practices receive). Key factors that contributed to the

  9. Perceptual Skills Curriculum; Introductory Letters and Numerals, Program IV. Part 1 Capital Letters and Part 2 Lower-case Letters.

    Science.gov (United States)

    Rosner, Jerome

    This curriculum is designed primarily for use in individualized classrooms where the teacher is working with an assistant, but it has also been proven effective in traditional classrooms and in remedial situations. Program four focuses on four abilities as they relate to the basic symbol system of the classroom. These are the abilities to:…

  10. Graphical qualities of educational technology: Using drag-and-drop and text-based programs for introductory computer science.

    Science.gov (United States)

    DiSalvo, Betsy

    2014-01-01

    To determine appropriate computer science curricula, educators sought to better understand the different affordances of teaching with a visual programming language (Alice) or a text-based language (Jython). Although students often preferred one language, that language wasn't necessarily the one from which they learned the most.

  11. Vaccines for Children: Critical Issues in Design and Implementation. Report to Congressional Requesters [and] Vaccines for Children: Major Implementation Hurdles Remain. Testimony of Kwai-Cheung Chan, before the Subcommittee on Labor, Health, Human Services, and Education, Committee on Appropriations, United States Senate.

    Science.gov (United States)

    General Accounting Office, Washington, DC. Program Evaluation and Methodology Div.

    In response to congressional request, this report provides information on the implementation plans developed by the Center for Disease Control (CDC) for the Vaccines for Children (VFC) Program. Introductory material indicates that the VFC was created to increase vaccine coverage levels nationwide by creating an entitlement to free vaccine for…

  12. An Integrative Approach to Improving an Introductory Weather & Climate Course and Developing an Allied NASA Earth & Space Science Certificate Program for Pre-service Secondary Teachers (Invited)

    Science.gov (United States)

    Morrow, C. A.; Martin-Hansen, L.; Diem, J.; Elliott, W.

    2009-12-01

    An Atlanta-based partnership made up of leaders in science, education, and Georgia’s state-wide STEM Education Initiative are creating an enduring legacy of climate science education for pre-service and in-service teachers in Georgia as well as for underrepresented high school students who participate in an "Early College" program with Georgia State University (GSU). The core elements of our NASA-funded program are to infuse NASA global climate change resources and best pedagogical practice into a popular 4-credit lecture/lab course called “Introduction to Weather & Climate” (GEOG 1112) at GSU, and to establish a sustainable academic program for pre-service teachers in the College of Education called the NASA Earth & Space Science (ESS) Teacher Certificate. The NASA ESS Certificate will require candidates to accomplish the following as part of (or in addition to) standard degree and licensure requirements: 1. successfully complete a graduate section of “Introduction to Weather and Climate” (GEOG 7112), which requires lesson planning related to course content and engagement with GSU's new CO2 monitoring station whose research-quality data will provide unique hands-on opportunities for Metro Atlanta students and teachers; 2) complete an additional advanced course in climate change (GEOG 6784) plus elective hours in physical science disciplines (e.g. astronomy and physics); 3) serve as a lab teaching assistant for GEOG 1112 and a coach for a cadre of Carver Early College students who are taking the course; 4) make at least one of two teaching practica at a Georgia-based NASA Explorer School; and 5) participate or co-present in a week-long, residential, field-based, Summer Institute in Earth & Space Science intended to increase the interest, knowledge, and ability of in-service secondary science educators to fulfill climate-related standards in Earth Science and Earth Systems Science. We will evaluate, document, and disseminate (to the University System of

  13. Robots in the introductory physics laboratory

    Science.gov (United States)

    Lowe, Mary; Moore, Howard; Langrall, Edwin; Gehrman, Chuck

    2008-10-01

    We have incorporated robots into the introductory undergraduate physics laboratory to introduce a creative component and to show some applications of physics principles in a way that strongly engages student interest. We have developed low-cost mobile platforms and navigation methods suitable for large numbers of introductory level students. Radio remote control was the dominant navigation method implemented in the classroom, but autonomous navigation was also achieved. We discuss robot construction, the organization of the lab, student reactions, and our experiences in sustaining the program.

  14. Modernizing introductory physics

    Science.gov (United States)

    Holbrow, C. H.; Amato, J. C.; Galvez, E. J.; Lloyd, J. N.

    1995-12-01

    Since 1985 the Colgate University Department of Physics and Astronomy has been reshaping the first term of introductory calculus-level physics to answer the question: ``Why do we believe in atoms and the properties ascribed to them?'' This paper describes the new course, its 400-page text, its ten laboratories, its six computer exercises, and how these work together successfully to serve several purposes: For those students who do not continue on with any more physics, it is a good introduction to physics; for the many students whose quantitative skills need enhancing, it provides a better chance to improve those skills than traditional introductory physics; by its emphasis on wave-particle duality and mass-energy equivalence, the course introduces students to important quantum and relativistic ideas that are fundamental to most of what contemporary physicists actually do. We also extract from our reform efforts some lessons useful to anyone undertaking to change introductory physics.

  15. Innovative Technology for Teaching Introductory Astronomy

    Science.gov (United States)

    Guidry, Mike

    The application of state-of-the-art technology (primarily Java and Flash MX Actionscript on the client side and Java PHP PERL XML and SQL databasing on the server side) to the teaching of introductory astronomy will be discussed. A completely online syllabus in introductory astronomy built around more than 350 interactive animations called ""Online Journey through Astronomy"" and a new set of 20 online virtual laboratories in astronomy that we are currently developing will be used as illustration. In addition to demonstration of the technology our experience using these technologies to teach introductory astronomy to thousands of students in settings ranging from traditional classrooms to full distance learning will be summarized. Recent experiments using Java and vector graphics programming of handheld devices (Personal Digital Assistants and cell phones) with wireless wide-area connectivity for applications in astronomy education will also be described.

  16. Introductory real analysis

    CERN Document Server

    Kolmogorov, A N; Silverman, Richard A

    1975-01-01

    Self-contained and comprehensive, this elementary introduction to real and functional analysis is readily accessible to those with background in advanced calculus. It covers basic concepts and introductory principles in set theory, metric spaces, topological and linear spaces, linear functionals and linear operators, and much more. 350 problems. 1970 edition.

  17. An Introductory Lisp Parser.

    Science.gov (United States)

    Loritz, Donald

    1987-01-01

    Gives a short grammar of the Lisp computer language. Presents an introductory English parser (Simparse) as an example of how to write a parser in Lisp. Lists references for further explanation. Intended as preparation for teachers who may use computer-assisted language instruction in the future. (LMO)

  18. Introductory Spanish IV.

    Science.gov (United States)

    Dade County Public Schools, Miami, FL.

    This introductory conversational course in Spanish is intended primarily for use in the classroom. The student is to learn some general differences between Argentina and the United States and how to better describe his friends. The common verbs "tener,""venir,""ir,""dar," and those that change "e" are presented. Additional uses of "ser" and…

  19. Rapid conversion of traditional introductory physics sequences to an activity-based format

    National Research Council Canada - National Science Library

    G Yoder; J Cook

    2014-01-01

      The Department of Physics at EKU with support from the National Science Foundation's Course Curriculum and Laboratory Improvement Program has successfully converted our entire introductory physics...

  20. Lessons for Introductory Chemistry

    Science.gov (United States)

    Martin, John S.; Blackburn, Edward V.

    2000-07-01

    These twelve lessons, and an introductory lesson, are tutorials in basic topics of introductory chemistry. They are suitable for school use, individual study, or distance learning. They are particularly valuable as review material for students in more advanced courses who may have been away from the subject for some time. They contain a great variety of problems and exercises driven by random-number generators, so that the same problem never repeats exactly. The lessons are, for the most part, Socratic dialogues in which the student is required to answer questions and perform simulated experiments in order to discover chemical principles. They are organized in an intuitive chapter and page structure. One may move readily around each lesson. There are many on-screen facilities such as help, data tables, and a calculator.

  1. Introductory graph theory

    CERN Document Server

    Chartrand, Gary

    1984-01-01

    Graph theory is used today in the physical sciences, social sciences, computer science, and other areas. Introductory Graph Theory presents a nontechnical introduction to this exciting field in a clear, lively, and informative style. Author Gary Chartrand covers the important elementary topics of graph theory and its applications. In addition, he presents a large variety of proofs designed to strengthen mathematical techniques and offers challenging opportunities to have fun with mathematics. Ten major topics - profusely illustrated - include: Mathematical Models, Elementary Concepts of Grap

  2. Mathematization in introductory physics

    Science.gov (United States)

    Brahmia, Suzanne M.

    Mathematization is central to STEM disciplines as a cornerstone of the quantitative reasoning that characterizes these fields. Introductory physics is required for most STEM majors in part so that students develop expert-like mathematization. This dissertation describes coordinated research and curriculum development for strengthening mathematization in introductory physics; it blends scholarship in physics and mathematics education in the form of three papers. The first paper explores mathematization in the context of physics, and makes an original contribution to the measurement of physics students' struggle to mathematize. Instructors naturally assume students have a conceptual mastery of algebra before embarking on a college physics course because these students are enrolled in math courses beyond algebra. This paper provides evidence that refutes the validity of this assumption and categorizes some of the barriers students commonly encounter with quantification and representing ideas symbolically. The second paper develops a model of instruction that can help students progress from their starting points to their instructor's desired endpoints. Instructors recognize that the introductory physics course introduces new ideas at an astonishing rate. More than most physicists realize, however, the way that mathematics is used in the course is foreign to a large portion of class. This paper puts forth an instructional model that can move all students toward better quantitative and physical reasoning, despite the substantial variability of those students' initial states. The third paper describes the design and testing of curricular materials that foster mathematical creativity to prepare students to better understand physics reasoning. Few students enter introductory physics with experience generating equations in response to specific challenges involving unfamiliar quantities and units, yet this generative use of mathematics is typical of the thinking involved in

  3. Modern introductory physics

    CERN Document Server

    Holbrow, Charles H; Amato, Joseph C; Galvez, Enrique; Parks, M. Elizabeth

    2010-01-01

    Modern Introductory Physics, 2nd Edition, by Charles H. Holbrow, James N. Lloyd, Joseph C. Amato, Enrique Galvez, and Beth Parks, is a successful innovative text for teaching introductory college and university physics. It is thematically organized to emphasize the physics that answers the fundamental question: Why do we believe in atoms and their properties?  The book provides a sound introduction to basic physical concepts with particular attention to the nineteenth- and twentieth-century physics underlying our modern ideas of atoms and their structure.  After a review of basic Newtonian mechanics, the book discusses early physical evidence that matter is made of atoms.  With a simple model of the atom Newtonian mechanics can explain the ideal gas laws, temperature, and viscosity.  Basic concepts of electricity and magnetism are introduced along with a more complicated model of the atom to account for the observed electrical properties of atoms. The physics of waves---particularly light and x-rays---an...

  4. Computing in the Introductory Physics Course

    Science.gov (United States)

    Chabay, Ruth; Sherwood, Bruce

    2004-03-01

    In the Matter & Interactions version of the calculus-based introductory physics course (http://www4.ncsu.edu/ ˜rwchabay/mi) , students write programs in VPython (http://vpython.org) to model physical systems and to calculate and visualize electric and magnetic fields. VPython is unusually easy to learn, produces navigable 3D animations as a side effect of physics computations, and supports full vector calculations. The high speed of current computers makes sophisticated numerical analysis techniques unnecessary. Students can use simple first-order Euler integration, cutting the step size until the behavior of the system no longer changes. In mechanics, iterative application of the momentum principle gives students a sense of the time-evolution character of Newton's second law which is usually missing from the standard course. In E, students calculate electric and magnetic fields numerically and display them in 3D. We are currently studying the impact of introducing computational physics into the introductory course.

  5. Implementing and assessing computational modeling in introductory mechanics

    CERN Document Server

    Caballero, Marcos D; Schatz, Michael F

    2011-01-01

    Students taking introductory physics are rarely exposed to computational modeling. In a one-semester large lecture introductory calculus-based mechanics course at Georgia Tech, students learned to solve physics problems using the VPython programming environment. During the term 1357 students in this course solved a suite of fourteen computational modeling homework questions delivered using an online commercial course management system. Their proficiency with computational modeling was evaluated in a proctored environment using a novel central force problem. The majority of students (60.4%) successfully completed the evaluation. Analysis of erroneous student-submitted programs indicated that a small set of student errors explained why most programs failed. We discuss the design and implementation of the computational modeling homework and evaluation, the results from the evaluation and the implications for instruction in computational modeling in introductory STEM courses.

  6. Mathematical Rigor in Introductory Physics

    Science.gov (United States)

    Vandyke, Michael; Bassichis, William

    2011-10-01

    Calculus-based introductory physics courses intended for future engineers and physicists are often designed and taught in the same fashion as those intended for students of other disciplines. A more mathematically rigorous curriculum should be more appropriate and, ultimately, more beneficial for the student in his or her future coursework. This work investigates the effects of mathematical rigor on student understanding of introductory mechanics. Using a series of diagnostic tools in conjunction with individual student course performance, a statistical analysis will be performed to examine student learning of introductory mechanics and its relation to student understanding of the underlying calculus.

  7. Vaccines for Children: Reexamination of Program Goals and Implementation Needed to Ensure Vaccination. Report to Congressional Requesters.

    Science.gov (United States)

    General Accounting Office, Washington, DC. Program Evaluation and Methodology Div.

    This report presents: (1) a review of the evidence that vaccine cost has prevented children from being immunized on time; (2) an evaluation of the implementation of the Vaccines For Children (VFC) program, including whether this program, as implemented, is likely to meet the needs of the under-immunized children; and (3) some options for improving…

  8. Teaching introductory physics a sourcebook

    CERN Document Server

    Swartz, Clifford E

    1996-01-01

    Introductory physics attracts a wide variety of students, with different backgrounds, levels of preparedness, and academic destinations. To many, the course is one of the most daunting in the science curriclum, full of arcane principles that are difficult to grasp. To others, it is one of the most highly anticipated -the first step on the path to the upper reaches of scientific inquiry. In their years as instructors and as editors of The Physics Teacher, Clifford E. Swartz and the late Thomas Miner developed and encountered many innovative and effective ways of introducing students to the fundamental principles of physics. Teaching Introductory Physics brings these strategies, insights and techniques to you in a unique, convenient volume. This is a reference and a tutorial book for teachers of an introductory physics course at any level. It has review articles on most of the topics of introductory physics, providing background information and suggestions about presentation and relative importance. Whether you...

  9. Introductory Statistics in the Garden

    Science.gov (United States)

    Wagaman, John C.

    2017-01-01

    This article describes four semesters of introductory statistics courses that incorporate service learning and gardening into the curriculum with applications of the binomial distribution, least squares regression and hypothesis testing. The activities span multiple semesters and are iterative in nature.

  10. A MOOC for Introductory Physics

    Science.gov (United States)

    Schatz, Michael

    2014-03-01

    We describe an effort to develop and to implement a college-level introductory physics (mechanics) MOOC that offers bona fide laboratory experiences. We also discuss efforts to use MOOC curricular materials to ``flip'' the classroom in a large lecture introductory physics course offered on-campus at Georgia Tech. Preliminary results of assessments and surveys from both MOOC and on-campus students will be presented.

  11. Assessing Factors That Influence the Recruitment of Majors from Introductory Geology Classes at Northern Arizona University

    Science.gov (United States)

    Hoisch, Thomas D.; Bowie, James I.

    2010-01-01

    In order to guide the formulation of strategies for recruiting undergraduates into the geology program at Northern Arizona University, we surveyed 783 students in introductory geology classes and 23 geology majors in their junior and senior years. Our analysis shows that ~7% of students in the introductory classes are possible candidates for…

  12. Intuitive introductory statistics

    CERN Document Server

    Wolfe, Douglas A

    2017-01-01

    This textbook is designed to give an engaging introduction to statistics and the art of data analysis. The unique scope includes, but also goes beyond, classical methodology associated with the normal distribution. What if the normal model is not valid for a particular data set? This cutting-edge approach provides the alternatives. It is an introduction to the world and possibilities of statistics that uses exercises, computer analyses, and simulations throughout the core lessons. These elementary statistical methods are intuitive. Counting and ranking features prominently in the text. Nonparametric methods, for instance, are often based on counts and ranks and are very easy to integrate into an introductory course. The ease of computation with advanced calculators and statistical software, both of which factor into this text, allows important techniques to be introduced earlier in the study of statistics. This book's novel scope also includes measuring symmetry with Walsh averages, finding a nonp...

  13. Increasing Student Performance through the Use of Web Services in Introductory Programming Classrooms: Results from a Series of Quasi-Experiments

    Science.gov (United States)

    Hosack, Bryan; Lim, Billy; Vogt, W. Paul

    2012-01-01

    An introduction to programming course can be a challenge for both students and instructors. This paper describes a study that introduced Web services (WS) and Service-Oriented Architecture in Information Systems 1 (IS 1) and Computer Science 1 (CS 1) programming courses over a two-year period. WS were used as an instruction tool based on their…

  14. Introductory Critical Literacy Practices for Urban Preservice Teachers

    Science.gov (United States)

    Meller, Wendy B.; Hatch, J. Amos

    2008-01-01

    This article describes introductory practices used to prepare future urban teachers to implement critical literacy strategies in their classrooms. Based in a teacher education program designed to prepare teachers for urban multicultural settings, the authors provide an overview of critical approaches to literacy instruction, a rationale for why…

  15. Original Courseware for Introductory Psychology: Implementation and Evaluation.

    Science.gov (United States)

    Slotnick, Robert S.

    1988-01-01

    Describes the implementation and field testing of PsychWare, a courseware package for introductory psychology developed and field tested at New York Institute of Technology. Highlights include the courseware package (10 software programs, a faculty manual, and a student workbook), and instructional design features (simulations, real-time…

  16. The Importance of Attendance in an Introductory Textile Science Course

    Science.gov (United States)

    Marcketti, Sara B.; Wang, Xinxin; Greder, Kate

    2013-01-01

    At Iowa State University, the introductory textile science course is a required 4-credit class for all undergraduate students enrolled in the Apparel, Merchandising, and Design Program. Frustrated by a perceived gap between students who easily comprehended course material and those who complained and struggled, the instructor implemented an…

  17. Labatorials in introductory physics courses

    Science.gov (United States)

    Sobhanzadeh, Mandana; Kalman, Calvin S.; Thompson, R. I.

    2017-11-01

    Traditional lab sections in introductory physics courses at Mount Royal University were replaced by a new style of lab called ‘labatorials’ developed by the Physics Education Development Group at the University of Calgary. Using labatorials in introductory physics courses has lowered student anxiety and strengthened student engagement in lab sessions. Labatorials provide instant feedback to the students and instructors. Interviews with students who had completed Introductory Physics labatorials as well as the anonymous comments left by them showed that labatorials have improved student satisfaction. Students improved their understanding of concepts compared to students who had taken traditional labs in earlier years. Moreover a combination of labatorials and reflective writing can promote positive change in students’ epistemological beliefs.

  18. The African Experience. Volume I: Syllabus Lectures; Volume II: Bibliographic References; Volume IIIA: Introductory Essays; Volume IIIB: Introductory Essays.

    Science.gov (United States)

    Paden, John N.; Soja, Edward W.

    In response to demands for more and better teaching about Africa in American higher education, the US Office of Education requested that the Program of African Studies at Northwestern University generate a set of teaching materials which could be used in introductory undergraduate courses. Included in these volumes, these materials provide…

  19. Concept Maps in Introductory Statistics

    Science.gov (United States)

    Witmer, Jeffrey A.

    2016-01-01

    Concept maps are tools for organizing thoughts on the main ideas in a course. I present an example of a concept map that was created through the work of students in an introductory class and discuss major topics in statistics and relationships among them.

  20. Teaching abstraction in introductory courses

    NARCIS (Netherlands)

    Koppelman, Hermannus; van Dijk, Elisabeth M.A.G.

    Abstraction is viewed as a key concept in computer science. It is not only an important concept but also one that is difficult to master. This paper focuses on the problems that novices experience when they first encounter this concept. Three assignments from introductory courses are analyzed, to

  1. Semantics in Teaching Introductory Physics.

    Science.gov (United States)

    Williams, H. Thomas

    1999-01-01

    Contends that the large vocabulary used for precise purposes in physics contains many words that have related but potentially confusing meanings in everyday usage. Analyzes the treatment of Newton's Laws of Motion in several well-known introductory textbooks for evidence of inconsistent language use. Makes teaching suggestions. (Contains 11…

  2. Introductory Sociology: Four Classroom Exercises.

    Science.gov (United States)

    Loewen, James W.

    1979-01-01

    Describes four activities for use in introductory sociology courses on the college level. Major objectives of the exercises are to challenge assumptions often held by college students and to stress contradictions between ideological justification for a given practice with its operation. (DB)

  3. Pathogenetics. An introductory review

    African Journals Online (AJOL)

    Mohammad Saad Zaghloul Salem

    2015-07-27

    Jul 27, 2015 ... Abstract Pathogenetics refers to studying the different aspects of ..... more knowledge of the structure/function/behavior/regulation ... gens before or after periods of embryonic or fetal growth sen- sitive to ..... This type of mutation must not be confused with epigenetic ..... Improper temporal programing of these.

  4. CAS Introductory Course in Italy

    CERN Multimedia

    2008-01-01

    The CERN Accelerator School’s introductory course is a great success. This year the CERN Accelerator School held its "Introduction to Accelerator Physics" course in Frascati, Italy, from 2-14 November in collaboration with the University of Rome "La Sapienza" and the INFN Frascati National Laboratory. The Introductory level course is particularly important since, for the majority of participants, it is the first opportunity to discover the various aspects of accelerator physics. For this school the programme had been significantly revised in order to take into account the new trends currently being developed in the field, thus putting more emphasis on linacs, synchrotron light sources and free-electron lasers. The school was a resounding success with 115 participants of more than 23 nationalities. Feedback from the students praised the expertise of the lecturers, the high standard of the lectures as well as the excellent organizati...

  5. Introductory remarks on complex multiplication

    Directory of Open Access Journals (Sweden)

    Harvey Cohn

    1982-01-01

    Full Text Available Complex multiplication in its simplest form is a geometric tiling property. In its advanced form it is a unifying motivation of classical mathematics from elliptic integrals to number theory; and it is still of active interest. This interrelation is explored in an introductory expository fashion with emphasis on a central historical problem, the modular equation between j(z and j(2z.

  6. Introductory physics: The new scholasticism

    OpenAIRE

    Mahajan, Sanjoy; Hogg, David W.

    2004-01-01

    Most introductory physics textbooks neglect air resistance in situations where an astute student can observe that it dominates the dynamics. We give examples from many books. Using dimensional analysis we discuss how to estimate the relative importance of air resistance and gravity. The discussion can be used to mitigate the baleful influence of these textbooks. Incorrectly neglecting air resistance is one of their many unphysical teachings. Shouldn't a physics textbook teach correct physics?

  7. Using R for introductory statistics

    CERN Document Server

    Verzani, John

    2014-01-01

    The second edition of a bestselling textbook, Using R for Introductory Statistics guides students through the basics of R, helping them overcome the sometimes steep learning curve. The author does this by breaking the material down into small, task-oriented steps. The second edition maintains the features that made the first edition so popular, while updating data, examples, and changes to R in line with the current version.See What's New in the Second Edition:Increased emphasis on more idiomatic R provides a grounding in the functionality of base R.Discussions of the use of RStudio helps new

  8. Core Concepts in Introductory Physical Geography.

    Science.gov (United States)

    Bacon, Robert S.; Green, Jerry E.

    1981-01-01

    An analysis of 14 introductory physical geography textbooks yielded 121 core concepts (basic concepts appearing in 7-10 books). The authors suggest that the trend toward overspecialization in introductory geography classes can be reversed if teachers agree to stress core concepts and their relationships to geography as a whole. (AM)

  9. The Memorability of Introductory Psychology Revisited

    Science.gov (United States)

    Landrum, R. Eric; Gurung, Regan A. R.

    2013-01-01

    Almost 2 million students enroll in introductory psychology each year in the United States, making it the second most popular undergraduate course in the nation. Introductory psychology not only serves as a prerequisite for other courses in the discipline but for some students this course provides their only exposure to psychological science.…

  10. Psychology Ethics in Introductory Psychology Textbooks

    Science.gov (United States)

    Zucchero, Renee' A.

    2011-01-01

    Previous research revealed that introductory psychology textbooks included limited information about psychology ethics. This study reviewed 48 current introductory psychology textbooks for research and other APA ethics content. These textbooks included slightly more total ethics content and were more thorough in their review of research ethics…

  11. Introductory Guide to European Corporate Law

    DEFF Research Database (Denmark)

    Fomcenco, Alex

    Introductory Guide to European Corporate Law presents in an easily comprehensible and accessible way the main features and principles that govern European corporate law.......Introductory Guide to European Corporate Law presents in an easily comprehensible and accessible way the main features and principles that govern European corporate law....

  12. Observing Projects in Introductory Astronomy

    Science.gov (United States)

    Taylor, M. Suzanne

    2016-01-01

    Introductory astronomy classes without laboratory components face a unique challenge of how to expose students to the process of science in the framework of a lecture course. As a solution to this problem small group observing projects are incorporated into a 40 student introductory astronomy class composed primarily of non-science majors. Students may choose from 8 observing projects such as graphing the motion of the moon or a planet, measuring daily and seasonal motions of stars, and determining the rotation rate of the Sun from sunspots. Each group completes two projects, requiring the students to spend several hours outside of class making astronomical observations. Clear instructions and a check-list style observing log help students with minimal observing experience to take accurate data without direct instructor assistance. Students report their findings in a lab report-style paper, as well as in a formal oral or poster presentation. The projects serve a double purpose of allowing students to directly experience concepts covered in class as well as providing students with experience collecting, analyzing, and presenting astronomical data.

  13. Mathematical preparation and success in introductory physics

    Science.gov (United States)

    Pickett, Tracy Renae Evans

    2002-01-01

    Two surveys were administered during the fall semester of 2001 to identify the parameters that impact student performance in introductory physics. The participants included introductory physics students and their instructors. A statistical analysis was done to determine, in particular, whether college or high school algebra and/or trigonometry performance served as predictors of physics performance. Implementing multiple linear regression analysis, the primary parameters that predicted student performance in introductory physics were college trigonometry and college GPA. Algebra I, algebra II, HS trigonometry, college algebra, high school GPA, MPEX components of reality link and math link, gender, and technology and biology majors did correlate individually with introductory physics performance but offered no explanation using a multiple linear regression analysis. Future explorations concerning the topic of this study would involve the examination of the details behind any significant correlation that exists among the parameters and between the parameters and introductory physics.

  14. Os efeitos da trimetazidina na variabilidade da frequência cardíaca (VFC em pacientes com insuficiência cardíaca Los efectos de la trimetazidina en la variabilidad de la frecuencia cardíaca (VFC en pacientes con insuficiencia cardíaca The effects of trimetazidine on heart rate variability in patients with heart failure

    Directory of Open Access Journals (Sweden)

    Yilmaz Gunes

    2009-08-01

    Full Text Available FUNDAMENTO: Tem sido demonstrado que diminuições na variabilidade da frequência cardíaca (VFC estão relacionadas com o prognóstico na insuficiência cardíaca (IC. A administração crônica de trimetazidina, além da terapia convencional, tem melhorado a classe funcional e a função ventricular esquerda de pacientes com IC. OBJETIVO: Avaliar os efeitos da trimetazidina na VFC em pacientes com IC de origem isquêmica, recebendo tratamento otimizado. MÉTODOS: Trimetazidina 20 mg 3 vezes/dia foi adicionada à terapia de 30 pacientes com IC tratados com inibidores da enzima conversora de angiotensinogênio ou bloqueadores do receptor da angiotensina, carvedilol, espironolactona, digital e furosemida. A etiologia da IC era doença arterial coronariana em todos os pacientes. Os pacientes foram avaliados através de ecocardiografia e análise da VFC de 24-horas antes e 3 meses depois da adição de trimetazidina. RESULTADOS: A fração de ejeção ventricular esquerda (FEVE média aumentou significantemente após a adição da trimetazidina (33,5±5,1% para 42,5±5,8%, pFUNDAMENTO: Se ha demostrado que disminuciones en la variabilidad de la frecuencia cardíaca (VFC están relacionadas con el pronóstico en la insuficiencia cardíaca (IC. La administración crónica de trimetazidina, además de la terapia convencional, ha mejorado la clase funcional y la función ventricular izquierda de pacientes con IC. OBJETIVO: Evaluar los efectos de la trimetazidina en la VFC en pacientes con IC de origen isquémico, recibiendo tratamiento optimizado. MÉTODOS: Se agregó trimetazidina 20 mg 3 veces/día a la terapia de 30 pacientes con IC tratados con inhibidores de la enzima conversora de angiotensinógeno o bloqueadores del receptor de la angiotensina, carvedilol, espironolactona, digital y furosemida. La etiología de la IC era enfermedad arterial coronaria en todos los pacientes. Los pacientes fueron evaluados mediante ecocardiografía y análisis de

  15. Introductory course on differential equations

    CERN Document Server

    Gorain, Ganesh C

    2014-01-01

    Introductory Course on DIFFERENTIAL EQUATIONS provides an excellent exposition of the fundamentals of ordinary and partial differential equations and is ideally suited for a first course of undergraduate students of mathematics, physics and engineering. The aim of this book is to present the elementary theories of differential equations in the forms suitable for use of those students whose main interest in the subject are based on simple mathematical ideas. KEY FEATURES: Discusses the subject in a systematic manner without sacrificing mathematical rigour. A variety of exercises drill the students in problem solving in view of the mathematical theories explained in the book. Worked out examples illustrated according to the theories developed in the book with possible alternatives. Exhaustive collection of problems and the simplicity of presentation differentiate this book from several others. Material contained will help teachers as well as aspiring students of different competitive examinations.

  16. The Impact of the Supplemental Instruction Leader on Student Performance in Introductory Accounting

    Science.gov (United States)

    Jones, Jefferson P.

    2013-01-01

    This study explores the association between a supplemental instruction (SI) program and student performance in an introductory accounting course. SI is a proactive academic support program that is aimed at improving student learning in traditionally "high-risk" college courses by integrating learning and critical thinking strategies with…

  17. Contrasting grading approaches in introductory physics and quantum mechanics: The case of graduate teaching assistants

    Science.gov (United States)

    Marshman, Emily; Sayer, Ryan; Henderson, Charles; Singh, Chandralekha

    2017-06-01

    At large research universities, physics graduate teaching assistants (TAs) are often responsible for grading in courses at all levels. However, few studies have focused on TAs' grading practices in introductory and advanced physics courses. This study was designed to investigate whether physics graduate TAs grade students in introductory physics and quantum mechanics using different criteria and if so, why they may be inclined to do so. To investigate possible discrepancies in TAs' grading approaches in courses at different levels, we implemented a sequence of instructional activities in a TA professional development course that asked TAs to grade student solutions of introductory physics and upper-level quantum mechanics problems and explain why, if at all, their grading approaches were different or similar in the two contexts. We analyzed the differences in TAs' grading approaches in the two contexts and discuss the reasons they provided for the differences in their grading approaches in introductory physics and quantum mechanics in individual interviews, class discussions, and written responses. We find that a majority of the TAs graded solutions to quantum mechanics problems differently than solutions to introductory physics problems. In quantum mechanics, the TAs focused more on physics concepts and reasoning and penalized students for not showing evidence of understanding. The findings of the study have implications for TA professional development programs, e.g., the importance of helping TAs think about the difficulty of a problem from an introductory students' perspective and reflecting on the benefits of formative assessment.

  18. Contrasting grading approaches in introductory physics and quantum mechanics: The case of graduate teaching assistants

    Directory of Open Access Journals (Sweden)

    Emily Marshman

    2017-05-01

    Full Text Available At large research universities, physics graduate teaching assistants (TAs are often responsible for grading in courses at all levels. However, few studies have focused on TAs’ grading practices in introductory and advanced physics courses. This study was designed to investigate whether physics graduate TAs grade students in introductory physics and quantum mechanics using different criteria and if so, why they may be inclined to do so. To investigate possible discrepancies in TAs’ grading approaches in courses at different levels, we implemented a sequence of instructional activities in a TA professional development course that asked TAs to grade student solutions of introductory physics and upper-level quantum mechanics problems and explain why, if at all, their grading approaches were different or similar in the two contexts. We analyzed the differences in TAs’ grading approaches in the two contexts and discuss the reasons they provided for the differences in their grading approaches in introductory physics and quantum mechanics in individual interviews, class discussions, and written responses. We find that a majority of the TAs graded solutions to quantum mechanics problems differently than solutions to introductory physics problems. In quantum mechanics, the TAs focused more on physics concepts and reasoning and penalized students for not showing evidence of understanding. The findings of the study have implications for TA professional development programs, e.g., the importance of helping TAs think about the difficulty of a problem from an introductory students’ perspective and reflecting on the benefits of formative assessment.

  19. Blended Learning Versus Traditional Lecture in Introductory Nursing Pathophysiology Courses.

    Science.gov (United States)

    Blissitt, Andrea Marie

    2016-04-01

    Currently, many undergraduate nursing courses use blended-learning course formats with success; however, little evidence exists that supports the use of blended formats in introductory pathophysiology courses. The purpose of this study was to compare the scores on pre- and posttests and course satisfaction between traditional and blended course formats in an introductory nursing pathophysiology course. This study used a quantitative, quasi-experimental, nonrandomized control group, pretest-posttest design. Analysis of covariance compared pre- and posttest scores, and a t test for independent samples compared students' reported course satisfaction of the traditional and blended course formats. Results indicated that the differences in posttest scores were not statistically significant between groups. Students in the traditional group reported statistically significantly higher satisfaction ratings than students in the blended group. The results of this study support the need for further research of using blended learning in introductory pathophysiology courses in undergraduate baccalaureate nursing programs. Further investigation into how satisfaction is affected by course formats is needed. Copyright 2016, SLACK Incorporated.

  20. Teaching Technolgies for the Introductory Physics Classroom

    Science.gov (United States)

    McNairy, William

    2003-11-01

    At Duke University we use several technologies in the Introductory Physics Courses for Life Sciences Majors. These tools assist the instructors in obtaining formative assessments of student understanding and provide students with feedback during each week of the semester. PreLecture and Survey assignments are delivered via the Web using the BlackBoard course management program. In addition, infrared transmitters (aka Personal Response System, PRS) have been used in classroom to poll conceptual and computational questions relating to reading assignments, to examples worked in lecture and to demonstrations that have been (or will be) done for the students. The instructor may choose to review the material or to move on to subsequent topics with greater confidence that the students are fully prepared method encouraged by the Just In Time Teaching model. On occasion, the initial response distribution is hidden in order to encourage Instruction between the students before the question is repolled. From these experiences students may see shifts in their understanding (or instructors can confirm the persistence of misconceptions!). Data obtained from the courses reveal interesting correlations between polling scores, prior AP experiences, gender and the overall grades earned in the courses.

  1. Using Isomorphic Problems to Learn Introductory Physics

    CERN Document Server

    Lin, Shih-Yin

    2016-01-01

    In this study, we examine introductory physics students' ability to perform analogical reasoning between two isomorphic problems which employ the same underlying physics principles but have different surface features. Three hundred and sixty two students from a calculus-based and an algebra-based introductory physics course were given a quiz in the recitation in which they had to first learn from a solved problem provided and take advantage of what they learned from it to solve another problem (which we call the quiz problem) which was isomorphic. Previous research suggests that the multiple-concept quiz problem is challenging for introductory students. Students in different recitation classes received different interventions in order to help them discern and exploit the underlying similarities of the isomorphic solved and quiz problems. We also conducted think-aloud interviews with four introductory students in order to understand in-depth the difficulties they had and explore strategies to provide better sc...

  2. ZAP! Adapted: Incorporating design in the introductory electromagnetism lab

    Science.gov (United States)

    McNeil, J. A.

    2002-04-01

    In the last decade the Accreditation Board of Engineering and Technology(ABET) significantly reformed the criteria by which engineering programs are accredited. The new criteria are called Engineering Criteria 2000 (EC2000). Not surprisingly, engineering design constitutes an essential component of these criteria. The Engineering Physics program at the Colorado School of Mines (CSM) underwent an ABET general review and site visit in the fall of 2000. In preparation for this review and as part of a campus-wide curriculum reform the Physics Department was challenged to include elements of design in its introductory laboratories. As part of the background research for this reform, several laboratory programs were reviewed including traditional and studio modes as well as a course used by Cal Tech and MIT called "ZAP!" which incorporates design activities well-aligned with the EC2000 criteria but in a nontraditional delivery mode. CSM has adapted several ZAP! experiments to a traditional laboratory format while attempting to preserve significant design experiences. The new laboratory forms an important component of the reformed course which attempts to respect the psychological principles of learner-based education. This talk reviews the reformed introductory electromagnetism course and how the laboratories are integrated into the pedagogy along with design activities. In their new form the laboratories can be readily adopted by physics departments using traditional delivery formats.

  3. Successful Curriculum Development and Evaluation of Group Work in an Introductory Mineralogy Laboratory

    Science.gov (United States)

    Dohaney, Jacqueline; Brogt, Erik; Kennedy, Ben

    2012-01-01

    Mineralogy is a core topic for tertiary geoscience programs worldwide. We report on the use of laboratory group work as an effective and integral part of a new introductory mineralogy curriculum at the University of British Columbia. The new laboratory curriculum was developed by incorporating student feedback with evidence-based pedagogies. These…

  4. Understanding and Affecting Science Teacher Candidates' Scientific Reasoning in Introductory Astrophysics

    Science.gov (United States)

    Steinberg, Richard; Cormier, Sebastien

    2013-01-01

    This study reports on a content course for science immersion teacher candidates that emphasized authentic practice of science and thinking scientifically in the context of introductory astrophysics. We explore how 122 science teacher candidates spanning three cohorts did and did not reason scientifically and how this evolved in our program. Our…

  5. Integration of Three New Teaching Techniques in an Introductory Computer Course.

    Science.gov (United States)

    Dunn, Walter L.

    Three new teaching techniques, using established principles of learning, were combined to teach an introductory digital computer course to college students. The techniques were: 1) programed instruction; 2) Fields-type teaching tests, "a discrimination method to teach concepts by modifying the examination procedure to emphasize similarities…

  6. Active and Collaborative Learning in an Introductory Electrical and Computer Engineering Course

    Science.gov (United States)

    Kotru, Sushma; Burkett, Susan L.; Jackson, David Jeff

    2010-01-01

    Active and collaborative learning instruments were introduced into an introductory electrical and computer engineering course. These instruments were designed to assess specific learning objectives and program outcomes. Results show that students developed an understanding comparable to that of more advanced students assessed later in the…

  7. Threaded Introductory Chemistry for Prepharmacy: A Model for Preprofessional Curriculum Redesign

    Science.gov (United States)

    Barth, Benjamin S.; Bucholtz, Ehren C.

    2017-01-01

    Introductory chemistry courses are required as part of the undergraduate preparation necessary for entry into an array of professional programs. Given the varied priorities of the student population in these courses, it can be difficult to present the material such that students see their individual future academic priorities represented in each…

  8. The Client-Centered Approach as a Foundation for Teaching the Introductory Course in Public Relations.

    Science.gov (United States)

    Najor, Michele A.; Motschall, Melissa

    2001-01-01

    Describes how the authors use a broad-based, client-centered model to teach an introductory course in public relations, integrating writing assignments for "clients" into course topics, which include history, ethics, theory, research, program planning, publicity, crisis management, and evaluation methods. Discusses course objectives, and notes…

  9. Using PARSEL Modules to Contextualizing the States-of-Matter Approach (SOMA) to Introductory Chemistry

    Science.gov (United States)

    Tsaparlis, Georgios

    2008-01-01

    SOMA (States-Of-Matter Approach) is an introductory chemistry program for all students in the tenth or eleventh grade (age 16-17), which introduces chemistry through the separate study of the three states of matter. SOMA is basically a formalistic approach. In this paper, we discuss the use of PARSEL modules in providing a teaching approach to…

  10. Attitudes and Motivation of Students in an Introductory Technical Graphics Course: A Meta-Analysis Study

    Science.gov (United States)

    Ernst, Jeremy V.; Clark, Aaron C.

    2012-01-01

    Students in introductory engineering graphics courses at North Carolina State University (NCSU) were asked to complete surveys to help educators and administrators understand their attitudes toward learning and their motivation to learn. Analyses of the completed surveys provided the Graphic Communications Program at NCSU with an understanding of…

  11. An Analysis of Economic Learning among Undergraduates in Introductory Economics Courses in Germany

    Science.gov (United States)

    Happ, Roland; Zlatkin-Troitschanskaia, Olga; Schmidt, Susanne

    2016-01-01

    In this article, the authors present the findings of a pretest-posttest measurement of the economic knowledge of students in introductory economics courses in undergraduate study programs in Germany. The responses of 403 students to 14 items selected from the "Test of Economic Literacy" (Soper and Walstad 1987) were analyzed to identify…

  12. Evolving Roles For Teaching Assistants In Introductory Courses

    Science.gov (United States)

    Dunbar, R. W.; Egger, A. E.; Schwartz, J. K.

    2008-12-01

    As we bring new research-based learning approaches, curricular innovations, and student engagement practices into the introductory science classroom, expectations of teaching assistants (TAs) should have, and have, changed. Similarly, the 21st century teaching assistant has different expectations of us. Maintaining relevance in this context means bringing TAs into an integrated teaching team that supports effective learning for students and provides structured professional development opportunities for TAs. A number of support efforts on our campus, with counterparts at many other universities, seek to optimize the instructional impact of faculty and teaching assistants, thus opening the door to enhanced student engagement (e.g. the quality of effort students put forth, their persistence in science and/or engineering courses, and their perception of scientific relevance in everyday life). Among these efforts, School of Earth Sciences course development TAs work 1:1 in advance of the term with introductory course faculty to design exercises and course materials that meet clearly articulated student learning goals or pedagogical challenges. Throughout the process, TAs are mentored by the faculty as well as science pedagogy experts. Initially funded by a major teaching award, the School is now moving to institutionalize this successful program which has broadened the definition of the TA role. Another area of optimization, reflecting Shulman's concept of pedagogical content knowledge, is our campus mandate that TA development take place within a departmental, as well as general, context. Both Chemistry and Physics expect introductory course TAs to lead interactive, guided-inquiry or tutorial-style sections. Integrating these sections with lecture and positively reinforcing course goals requires TA buy-in and a set of pedagogical facilitation skills cultivated through course-specific training and active mentoring while teaching. To better support the mentoring process

  13. Different Approach for Introductory Physics Courses

    Science.gov (United States)

    Cho, Shinil

    2010-04-01

    A different approach of blending various methodologies has been adapted to introductory physics courses at La Roche College. For over 15 years, students come to La Roche College with significantly different levels of physics and mathematics, reflecting students' under-preparedness at K12 schools although the knowledge and the technology required for science majors are increasing each year. The change inevitably challenges the students to learn and the instructor to teach the courses. This presentation describes the academic trend at the College, and discusses how the introductory physics courses have been tailored to motivate students while minimizing administrative restrictions.

  14. What makes a science class introductory?

    Science.gov (United States)

    French, L. M.

    2001-11-01

    Most academic institutions offer "introductory" courses in the space sciences. Most often, the offering is either a one-semester astronomy course or one semester each on the solar system and on stellar astronomy. The designation of these courses as "introductory" presumably indicates that students are expected to have had little or no exposure to the subjects before. However, the mathematical sophistication of the students is an important determininant of how well they will perform in the class. Some topics are appropriate and instructive for students with weak preparation in mathematics, while others are not. Examples of both kinds of topics will be given.

  15. Introductory mathematics for the life sciences

    CERN Document Server

    Phoenix, David

    2002-01-01

    Introductory Mathematics for the Life Sciences offers a straightforward introduction to the mathematical principles needed for studies in the life sciences. Starting with the basics of numbers, fractions, ratios, and percentages, the author explains progressively more sophisticated concepts, from algebra, measurement, and scientific notation through the linear, power, exponential, and logarithmic functions to introductory statistics. Worked examples illustrate concepts, applications, and interpretations, and exercises at the end of each chapter help readers apply and practice the skills they develop. Answers to the exercises are posted at the end of the text.

  16. Crossword Puzzles as Learning Tools in Introductory Soil Science

    Science.gov (United States)

    Barbarick, K. A.

    2010-01-01

    Students in introductory courses generally respond favorably to novel approaches to learning. To this end, I developed and used three crossword puzzles in spring and fall 2009 semesters in Introductory Soil Science Laboratory at Colorado State University. The first hypothesis was that crossword puzzles would improve introductory soil science…

  17. Teaching Quantum Mechanics on an Introductory Level.

    Science.gov (United States)

    Muller, Rainer; Wiesner, Hartmut

    2002-01-01

    Presents a new research-based course on quantum mechanics in which the conceptual issues of quantum mechanics are taught at an introductory level. Involves students in the discovery of how quantum phenomena deviate from classical everyday experiences. (Contains 31 references.) (Author/YDS)

  18. Item Analysis in Introductory Economics Testing.

    Science.gov (United States)

    Tinari, Frank D.

    1979-01-01

    Computerized analysis of multiple choice test items is explained. Examples of item analysis applications in the introductory economics course are discussed with respect to three objectives: to evaluate learning; to improve test items; and to help improve classroom instruction. Problems, costs and benefits of the procedures are identified. (JMD)

  19. Integrated Circuits in the Introductory Electronics Laboratory

    Science.gov (United States)

    English, Thomas C.; Lind, David A.

    1973-01-01

    Discusses the use of an integrated circuit operational amplifier in an introductory electronics laboratory course for undergraduate science majors. The advantages of this approach and the implications for scientific instrumentation are identified. Describes a number of experiments suitable for the undergraduate laboratory. (Author/DF)

  20. An Integrated Learning Project in Introductory Soils.

    Science.gov (United States)

    Robinson, C. A.; Schafer, J.

    1993-01-01

    Describes a problem-solving teaching method used in the Introductory Soils course at Iowa State University whereby students are assigned to groups and asked to serve as an advisor to a landowner. Using a computerized database for most data acquisition, students recommend farm usage and urban/alternate development plans. Includes the program…

  1. Written Assignments in the Introductory Course.

    Science.gov (United States)

    Madigan, R. J.; And Others

    In an attempt to contribute to the development of students' writing skills while helping them master basic psychology, a writing component was designed for a medium sized introductory psychology course. Its purpose was to aid in the mastery of course material and to contribute to the development of students' skill in written expression. In the…

  2. "World Religions" in Introductory Sociology Textbooks

    Science.gov (United States)

    Carroll, Michael P.

    2017-01-01

    A section on "world religions" (WRs) is now routinely included in the religion chapters of introductory sociology textbooks. Looking carefully at these WR sections, however, two things seem puzzling. The first is that the criteria for defining a WR varies considerably from textbook to textbook; the second is that these WRs sections…

  3. Exploring Interdisciplinary Themes in Introductory Psychology

    Science.gov (United States)

    Ritchey, Kristin A.; Bott, Jennifer P.

    2010-01-01

    We describe a method for helping introductory psychology students identify interdisciplinary connections among 5 social science disciplines. Pre- and posttest data assessed 359 undergraduates' understanding of psychology's relation to other fields. Results indicate the method is effective and provides one way for individual instructors to address…

  4. Exploring Urban America: An Introductory Reader.

    Science.gov (United States)

    Caves, Roger W.

    This introductory text presents a collection of articles from urban-studies journals to introduce undergraduate students to the interdisciplinary field of urban studies. The book is divided into 9 parts as follows: Part 1: Cities and Urbanism; part 2: Urban History; part 3: Urban Policy; part 4: Economic Development; part 5: Community Services and…

  5. Inference and the Introductory Statistics Course

    Science.gov (United States)

    Pfannkuch, Maxine; Regan, Matt; Wild, Chris; Budgett, Stephanie; Forbes, Sharleen; Harraway, John; Parsonage, Ross

    2011-01-01

    This article sets out some of the rationale and arguments for making major changes to the teaching and learning of statistical inference in introductory courses at our universities by changing from a norm-based, mathematical approach to more conceptually accessible computer-based approaches. The core problem of the inferential argument with its…

  6. The Pythagorean Roots of Introductory Physics

    Science.gov (United States)

    Clarage, James B.

    2013-01-01

    Much of the mathematical reasoning employed in the typical introductory physics course can be traced to Pythagorean roots planted over two thousand years ago. Besides obvious examples involving the Pythagorean theorem, I draw attention to standard physics problems and derivations which often unknowingly rely upon the Pythagoreans' work on…

  7. Cumulative Exams in the Introductory Psychology Course

    Science.gov (United States)

    Lawrence, Natalie K.

    2013-01-01

    Many teachers require their students to take cumulative exams, but there are surprisingly few studies that examine the benefits of such exams. The purpose of this study was to determine whether introductory psychology students who take cumulative exams throughout the semester would have better long-term retention than students who take a…

  8. Making Introductory Quantum Physics Understandable and Interesting

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 10; Issue 1. Making Introductory Quantum Physics Understandable and Interesting. Ranjana Y Abhang. Classroom Volume 10 Issue 1 January 2005 pp 63-73. Fulltext. Click here to view fulltext PDF. Permanent link:

  9. An Introductory Calculus-Based Mechanics Investigation

    Science.gov (United States)

    Allen, Bradley

    2017-01-01

    One challenge for the introductory physics teacher is incorporating calculus techniques into the laboratory setting. It can be difficult to strike a balance between presenting an experimental task for which calculus is essential and making the mathematics accessible to learners who may be apprehensive about applying it. One-dimensional kinematics…

  10. An Infiltration Exercise for Introductory Soil Science

    Science.gov (United States)

    Barbarick, K. A.; Ippolito, J. A.; Butters, G.; Sorge, G. M.

    2005-01-01

    One of the largest challenges in teaching introductory soil science is explaining the dynamics of soil infiltration. To aid students in understanding the concept and to further engage them in active learning in the soils laboratory course, we developed an exercise using Decagon Mini-Disk Infiltrometers with a tension head (h[subscript o]) of 2 cm.…

  11. Gravitational Wave Detection in the Introductory Lab

    Science.gov (United States)

    Burko, Lior M.

    2017-01-01

    Great physics breakthroughs are rarely included in the introductory physics course. General relativity and binary black hole coalescence are no different, and can be included in the introductory course only in a very limited sense. However, we can design activities that directly involve the detection of GW150914, the designation of the Gravitation Wave signal detected on September 14, 2015, thereby engage the students in this exciting discovery directly. The activities naturally do not include the construction of a detector or the detection of gravitational waves. Instead, we design it to include analysis of the data from GW150914, which includes some interesting analysis activities for students of the introductory course. The same activities can be assigned either as a laboratory exercise or as a computational project for the same population of students. The analysis tools used here are simple and available to the intended student population. It does not include the sophisticated analysis tools, which were used by LIGO to carefully analyze the detected signal. However, these simple tools are sufficient to allow the student to get important results. We have successfully assigned this lab project for students of the introductory course with calculus at Georgia Gwinnett College.

  12. Freeing the Creative Writer: An Introductory Lesson.

    Science.gov (United States)

    Ehrle, Lisa

    1990-01-01

    Describes an introductory creative writing lesson in which students gave low grades to passages they later learned were written by William Faulkner and Ernest Hemingway. Reports that the students graded mainly on mechanics and grammar (and very little on content). Notes that students began to learn to manipulate the various aspects of writing. (RS)

  13. 29 CFR 452.1 - Introductory statement.

    Science.gov (United States)

    2010-07-01

    ... elections will be fairly conducted. Specific provisions are included to assure the right of union members to... 29 Labor 2 2010-07-01 2010-07-01 false Introductory statement. 452.1 Section 452.1 Labor Regulations Relating to Labor OFFICE OF LABOR-MANAGEMENT STANDARDS, DEPARTMENT OF LABOR LABOR-MANAGEMENT...

  14. Foreign Language: Introductory Spanish. Part I.

    Science.gov (United States)

    Dade County Public Schools, Miami, FL.

    This introductory course teaches students to speak contemporary Spanish through the use of short dialogues based on typical school activities. Emphasis is on oral Spanish, "-ar" verbs in the present, interrogatives, and hints on how to read. Objectives for culture study and the development of student attitudes are also presented.…

  15. Teaching Health Care in Introductory Economics

    Science.gov (United States)

    Cutler, David M.

    2017-01-01

    Health care is one of the economy's biggest industries, so it is natural that the health care industry should play some role in the teaching of introductory economics. There are many ways that health care can appear in such a context: in the teaching of microeconomics, as a macroeconomic issue, to learn about social welfare, and even to learn how…

  16. Teaching about Unintentional Racism in Introductory Psychology.

    Science.gov (United States)

    Ford, Thomas E.; Grossman, Robert W.; Jordan, Elizabeth A.

    1997-01-01

    Describes a technique for teaching the concept of unintentional racism in an introductory psychology course. A case study is followed by a lecture and class discussion on the nature of racism. Strategies for discussions and student responses to the unit are outlined. Presents evidence suggesting the benefits of this activity. (MJP)

  17. A Coherent Content Storyline Approach for Introductory Astronomy

    Science.gov (United States)

    Palma, Christopher; Flarend, A.; McDonald, S.; Kregenow, J. M.

    2014-01-01

    The Earth and Space Science Partnership (ESSP) is a collaboration among Penn State scientists, science educators and seven school districts across Pennsylvania. Part of the multi-faceted ESSP effort includes revising the curriculum of university science classes known to be taken by large numbers of elementary pre-service teachers. By adopting research-based pedagogical approaches in our courses, we hope to expose these pre-service teachers to excellent examples of science teaching. In this presentation, we will discuss changes made in a pilot study to one section of our introductory astronomy survey course. There have been many articles published in the Astronomy Education Review and elsewhere that detail research-based pedagogical practices for introductory astronomy courses. Many of those practices (such as from the Center for Astronomy Education) have been incorporated into introductory astronomy courses at Penn State. However, our work with middle-grades teachers in the ESSP project is based on two key practices: a Claims, Evidence, and Reasoning (CER) framework (McNeill & Krajcik 2012) and a coherent science content storyline (Roth,et. al., 2011). As a first step in modeling these practices in our University courses, we reorganized our Astro course using a content storyline approach. We plan to incorporate CER activities into the course next year that advance the storyline described. In this poster, we present the storyline developed by our team, which we believe was successful in its pilot, and was built around a conceptually coherent presentation of the diverse set of phenomena typical of an introductory astronomy course. We adopted as our main learning goal a statement based on the cosmological principle that the physical laws throughout the Universe are identical everywhere. In addition, we organized the class schedule to connect the work done in each class to this storyline. We suggest that a coherent content storyline is a useful tool for others who

  18. Community structure in introductory physics course networks

    CERN Document Server

    Traxler, Adrienne L

    2015-01-01

    Student-to-student interactions are foundational to many active learning environments, but are most often studied using qualitative methods. Network analysis tools provide a quantitative complement to this picture, allowing researchers to describe the social interactions of whole classrooms as systems. Past results from introductory physics courses have suggested a sharp division in the formation of social structure between large lecture sections and small studio classroom environments. Extending those results, this study focuses on calculus-based introductory physics courses at a large public university with a heavily commuter and nontraditional student population. Community detection network methods are used to characterize pre- and post-course collaborative structure in several sections, and differences are considered between small and large classes. These results are compared with expectations from earlier findings, and comment on implications for instruction and further study.

  19. Introductory phonetics and phonology of English

    CERN Document Server

    Daniel, Iyabode Omolara

    2011-01-01

    Introductory Phonetics and Phonology of English attempts to give a practical guide to the learner in all ramifications of theoretical and practical uses of the phonetics and phonology of the English language. Useful suggestions and tips were also given on how to do it yourself to overcome the terror of the sounds of English. An attempt was also made to give detailed information on the workings of the prosodic features of English. This was especially necessary, as they remain, largely, the mos...

  20. Learnable Programming: Blocks and Beyond

    OpenAIRE

    Bau, David; Gray, Jeff; Kelleher, Caitlin; Sheldon, Josh; Turbak, Franklyn

    2017-01-01

    Blocks-based programming has become the lingua franca for introductory coding. Studies have found that experience with blocks-based programming can help beginners learn more traditional text-based languages. We explore how blocks environments improve learnability for novices by 1) favoring recognition over recall, 2) reducing cognitive load, and 3) preventing errors. Increased usability of blocks programming has led to widespread adoption within introductory programming contexts across a rang...

  1. STUDENT LEARNING PERCEPTIONS: EVIDENCE FROM AN INTRODUCTORY ACCOUNTING COURSE

    OpenAIRE

    Bonnie P. Stivers; Emmanuel Onifade; Ruthie Reynolds

    2011-01-01

    This study sought to examine students’ perceptions of their learning experience in the introductory accounting courses at three colleges and universities in the United States. Questionnaire responses were collected from 375 students at the end of the second introductory course. The student population consisted primarily of business students. The study identified a set of six factors that represent students’ learning experience in introductory accounting. The identified set includes: accou...

  2. Myriapoda, Tardigrada, and Other Cryptozoics in Introductory Biology

    Science.gov (United States)

    Stoaks, Ralph D.

    1974-01-01

    Describes procedures for collecting and using cryptozoic invertebrates in introductory biology classes to develop interest in invertebrate ecology, behavior, physiology, morphology, and taxonomy. (PEB)

  3. Astronomical problems an introductory course in astronomy

    CERN Document Server

    Vorontsov-Vel'Yaminov, B A

    1969-01-01

    Astronomical Problems: An Introductory Course in Astronomy covers astronomical problems, together with a summary of the theory and the formula to be exercised. The book discusses the types of problems solved with the help of the celestial globe and how to solve astronomical problems. The text tackles problems on interpolation, the celestial sphere, systems of celestial coordinates, and culmination. Problems about the rising and setting of a heavenly body, precession, planetary movement, and parallax and aberration are also considered. The book presents problems about refraction, the apparent m

  4. An introductory calculus-based mechanics investigation

    Science.gov (United States)

    Allen, Bradley

    2017-11-01

    One challenge for the introductory physics teacher is incorporating calculus techniques into the laboratory setting. It can be difficult to strike a balance between presenting an experimental task for which calculus is essential and making the mathematics accessible to learners who may be apprehensive about applying it. One-dimensional kinematics is a common way to do so and has been discussed in this publication. This article outlines a two-dimensional kinematics experiment that is straightforward for students to perform, but for which the ideas of differentiation and maximizing are necessary to justify the results theoretically. It also leads to a satisfying result that ties into a derivation which students may recognize.

  5. The Pythagorean Roots of Introductory Physics

    Science.gov (United States)

    Clarage, James B.

    2013-03-01

    Much of the mathematical reasoning employed in the typical introductory physics course can be traced to Pythagorean roots planted over two thousand years ago. Besides obvious examples involving the Pythagorean theorem, I draw attention to standard physics problems and derivations which often unknowingly rely upon the Pythagoreans' work on proportion, music, geometry, harmony, the golden ratio, and cosmology. Examples are drawn from mechanics, electricity, sound, optics, energy conservation and relativity. An awareness of the primary sources of the mathematical techniques employed in the physics classroom could especially benefit students and educators at schools which encourage integration of their various courses in history, science, philosophy, and the arts.

  6. Introductory Statistics for the Behavioral Sciences

    CERN Document Server

    Cohen, Barry H; Lea, R Brooke

    2012-01-01

    A comprehensive and user-friendly introduction to statistics for behavioral science students-revised and updated Refined over seven editions by master teachers, this book gives instructors and students alike clear examples and carefully crafted exercises to support the teaching and learning of statistics for both manipulating and consuming data. One of the most popular and respected statistics texts in the behavioral sciences, the Seventh Edition of Introductory Statistics for the Behavioral Sciences has been fully revised. The new edition presents all the topics students in the behavioral s

  7. Ancient Indian Astronomy in Introductory Texts

    Science.gov (United States)

    Narahari Achar, B. N.

    1997-10-01

    It is customary in introductory survey courses in astronomy to devote some time to the history of astronomy. In the available text books only the Greek contribution receives any attention. Apart from Stonehenge and Chichenitza pictures, contributions from Babylon and China are some times mentioned. Hardly any account is given of ancient Indian astronomy. Even when something is mentioned it is incomplete or incorrect or both. Examples are given from several text books currently available. An attempt is made to correct this situation by sketching the contributions from the earliest astronomy of India, namely Vedaanga Jyotisha.

  8. Introductory modern algebra a historical approach

    CERN Document Server

    Stahl, Saul

    2013-01-01

    Praise for the First Edition ""Stahl offers the solvability of equations from the historical point of view...one of the best books available to support a one-semester introduction to abstract algebra.""-CHOICE Introductory Modern Algebra: A Historical Approach, Second Edition presents the evolution of algebra and provides readers with the opportunity to view modern algebra as a consistent movement from concrete problems to abstract principles. With a few pertinent excerpts from the writings of some of the greatest mathematicians, the Second Edition uniquely facilitates the understanding of pi

  9. Introductory statistics for the behavioral sciences

    CERN Document Server

    Welkowitz, Joan; Cohen, Jacob

    1971-01-01

    Introductory Statistics for the Behavioral Sciences provides an introduction to statistical concepts and principles. This book emphasizes the robustness of parametric procedures wherein such significant tests as t and F yield accurate results even if such assumptions as equal population variances and normal population distributions are not well met.Organized into three parts encompassing 16 chapters, this book begins with an overview of the rationale upon which much of behavioral science research is based, namely, drawing inferences about a population based on data obtained from a samp

  10. Curricular Adaptations in Introductory Physics Labs

    Science.gov (United States)

    Dreyfus, Benjamin W.; Ewell, Mary; Moore, Kimberly

    2017-01-01

    When curricular materials are disseminated to new sites, there can be a tension between fidelity to the original intent of the developers and adaptation to local needs. In this case study we look at a lab activity that was initially developed for an introductory physics for the life sciences (IPLS) course at the University of Maryland, then implemented at George Mason University with significant adaptations. The goals of the two implementations were overlapping, but also differed in ways that are reflected in the two versions of the lab. We compare student lab report data from the two sites to examine the impacts of the adaptation on how students engaged with the lab.

  11. Introductory statistics and analytics a resampling perspective

    CERN Document Server

    Bruce, Peter C

    2014-01-01

    Concise, thoroughly class-tested primer that features basic statistical concepts in the concepts in the context of analytics, resampling, and the bootstrapA uniquely developed presentation of key statistical topics, Introductory Statistics and Analytics: A Resampling Perspective provides an accessible approach to statistical analytics, resampling, and the bootstrap for readers with various levels of exposure to basic probability and statistics. Originally class-tested at one of the first online learning companies in the discipline, www.statistics.com, the book primarily focuses on application

  12. The Development and Evolution of an Introductory Statistics Course for In-Service Middle-Level Mathematics Teachers

    Science.gov (United States)

    Schmind, Kendra K.; Blankenship, Erin E.; Kerby. April T.; Green, Jennifer L.; Smith, Wendy M.

    2014-01-01

    The statistical preparation of in-service teachers, particularly middle school teachers, has been an area of concern for several years. This paper discusses the creation and delivery of an introductory statistics course as part of a master's degree program for in-service mathematics teachers. The initial course development took place before the…

  13. Who's Who in Introductory Psychology Textbooks: A Citation Analysis Redux

    Science.gov (United States)

    Griggs, Richard A.; Christopher, Andrew N.

    2016-01-01

    It is important to assess periodically how introductory textbooks portray our discipline because introductory psychology is the most popular psychology course, almost all teachers use textbooks for it, and textbooks play a major role in defining the course for students. To do so, past studies have used textbook citation analyses. We analyzed…

  14. Toward Publicly Responsive Sociology Curricula: The Role of Introductory Sociology

    Science.gov (United States)

    Greenwood, Nancy A.

    2013-01-01

    Introductory sociology casts a wide net with regard to its audience and plays an important role in capturing the public eye as well as helping students to make more informed choices in their lives and communities. I ask six questions that help us as sociologists to think about how introductory sociology can better serve our discipline, our…

  15. Faraday's Principle and Air Travel in the Introductory Labs

    Science.gov (United States)

    Abdul-Razzaq, Wathiq; Thakur, Saikat Chakraborty

    2017-01-01

    We all know that we must improve the quality of teaching in science at all levels. Not only physicists but also many students from other areas of study take the introductory physics courses in college. Physics introductory laboratories (labs) can be one of the best tools to help these students understand applications of scientific principles that…

  16. Using a Common Experience to Teach Introductory Managerial Accounting

    Science.gov (United States)

    King, Gail Hoover; McConnell, Cheryl

    2010-01-01

    Teaching introductory accounting courses can be both challenging and rewarding. In introductory financial and managerial accounting, students struggle with the unfamiliar terminology and concepts. However, managerial accounting offers distinct challenges in that managerial accounting reports used for decision-making are not publically available,…

  17. Teaching Introductory Business Statistics Using the DCOVA Framework

    Science.gov (United States)

    Levine, David M.; Stephan, David F.

    2011-01-01

    Introductory business statistics students often receive little guidance on how to apply the methods they learn to further business objectives they may one day face. And those students may fail to see the continuity among the topics taught in an introductory course if they learn those methods outside a context that provides a unifying framework.…

  18. Coverage of the Stanford Prison Experiment in Introductory Psychology Courses

    Science.gov (United States)

    Bartels, Jared M.; Milovich, Marilyn M.; Moussier, Sabrina

    2016-01-01

    The present study examined the coverage of Stanford prison experiment (SPE), including criticisms of the study, in introductory psychology courses through an online survey of introductory psychology instructors (N = 117). Results largely paralleled those of the recently published textbook analyses with ethical issues garnering the most coverage,…

  19. A Diagnostic Assessment for Introductory Molecular and Cell Biology

    Science.gov (United States)

    Shi, Jia; Wood, William B.; Martin, Jennifer M.; Guild, Nancy A.; Vicens, Quentin; Knight, Jennifer K.

    2010-01-01

    We have developed and validated a tool for assessing understanding of a selection of fundamental concepts and basic knowledge in undergraduate introductory molecular and cell biology, focusing on areas in which students often have misconceptions. This multiple-choice Introductory Molecular and Cell Biology Assessment (IMCA) instrument is designed…

  20. Introductory quantum mechanics for applied nanotechnology

    CERN Document Server

    Kim, Dae Mann

    2015-01-01

    This introductory textbook covers fundamental quantum mechanics from an application perspective, considering optoelectronic devices, biological sensors and molecular imagers as well as solar cells and field effect transistors. The book provides a brief review of classical and statistical mechanics and electromagnetism, and then turns to the quantum treatment of atoms, molecules, and chemical bonds. Aiming at senior undergraduate and graduate students in nanotechnology related areas like physics, materials science, and engineering, the book could be used at schools that offer interdisciplinary but focused training for future workers in the semiconductor industry and for the increasing number of related nanotechnology firms, and even practicing people could use it when they need to learn related concepts. The author is Professor Dae Mann Kim from the Korea Institute for Advanced Study who has been teaching Quantum Mechanics to engineering, material science and physics students for over 25 years in USA and Asia.

  1. Exams disadvantage women in introductory biology.

    Directory of Open Access Journals (Sweden)

    Cissy J Ballen

    Full Text Available The gender gap in STEM fields has prompted a great deal of discussion, but what factors underlie performance deficits remain poorly understood. We show that female students underperformed on exams compared to their male counterparts across ten large introductory biology course sections in fall 2016 (N > 1500 students. Females also reported higher levels of test anxiety and course-relevant science interest. Results from mediation analyses revealed an intriguing pattern: for female students only, and regardless of their academic standing, test anxiety negatively impacted exam performance, while interest in the course-specific science topics increased exam performance. Thus, instructors seeking equitable classrooms can aim to decrease test anxiety and increase student interest in science course content. We provide strategies for mitigating test anxiety and suggestions for alignment of course content with student interest, with the hope of successfully reimagining the STEM pathway as one that is equally accessible to all.

  2. Exams disadvantage women in introductory biology

    Science.gov (United States)

    Cotner, Sehoya

    2017-01-01

    The gender gap in STEM fields has prompted a great deal of discussion, but what factors underlie performance deficits remain poorly understood. We show that female students underperformed on exams compared to their male counterparts across ten large introductory biology course sections in fall 2016 (N > 1500 students). Females also reported higher levels of test anxiety and course-relevant science interest. Results from mediation analyses revealed an intriguing pattern: for female students only, and regardless of their academic standing, test anxiety negatively impacted exam performance, while interest in the course-specific science topics increased exam performance. Thus, instructors seeking equitable classrooms can aim to decrease test anxiety and increase student interest in science course content. We provide strategies for mitigating test anxiety and suggestions for alignment of course content with student interest, with the hope of successfully reimagining the STEM pathway as one that is equally accessible to all. PMID:29049334

  3. Introductory analysis a deeper view of calculus

    CERN Document Server

    Bagby, Richard J

    2000-01-01

    Introductory Analysis addresses the needs of students taking a course in analysis after completing a semester or two of calculus, and offers an alternative to texts that assume that math majors are their only audience. By using a conversational style that does not compromise mathematical precision, the author explains the material in terms that help the reader gain a firmer grasp of calculus concepts.* Written in an engaging, conversational tone and readable style while softening the rigor and theory* Takes a realistic approach to the necessary and accessible level of abstraction for the secondary education students* A thorough concentration of basic topics of calculus* Features a student-friendly introduction to delta-epsilon arguments * Includes a limited use of abstract generalizations for easy use* Covers natural logarithms and exponential functions* Provides the computational techniques often encountered in basic calculus

  4. Exams disadvantage women in introductory biology.

    Science.gov (United States)

    Ballen, Cissy J; Salehi, Shima; Cotner, Sehoya

    2017-01-01

    The gender gap in STEM fields has prompted a great deal of discussion, but what factors underlie performance deficits remain poorly understood. We show that female students underperformed on exams compared to their male counterparts across ten large introductory biology course sections in fall 2016 (N > 1500 students). Females also reported higher levels of test anxiety and course-relevant science interest. Results from mediation analyses revealed an intriguing pattern: for female students only, and regardless of their academic standing, test anxiety negatively impacted exam performance, while interest in the course-specific science topics increased exam performance. Thus, instructors seeking equitable classrooms can aim to decrease test anxiety and increase student interest in science course content. We provide strategies for mitigating test anxiety and suggestions for alignment of course content with student interest, with the hope of successfully reimagining the STEM pathway as one that is equally accessible to all.

  5. Introductory Physics Experiments Using the Wiimote

    Science.gov (United States)

    Somers, William; Rooney, Frank; Ochoa, Romulo

    2009-03-01

    The Wii, a video game console, is a very popular device with millions of units sold worldwide over the past two years. Although computationally it is not a powerful machine, to a physics educator its most important components can be its controllers. The Wiimote (or remote) controller contains three accelerometers, an infrared detector, and Bluetooth connectivity at a relatively low price. Thanks to available open source code, any PC with Bluetooth capability can detect the information sent out by the Wiimote. We have designed several experiments for introductory physics courses that make use of the accelerometers and Bluetooth connectivity. We have adapted the Wiimote to measure the: variable acceleration in simple harmonic motion, centripetal and tangential accelerations in circular motion, and the accelerations generated when students lift weights. We present the results of our experiments and compare them with those obtained when using motion and/or force sensors.

  6. Introductory Physics Students' Physics and Mathematics Epistemologies

    Science.gov (United States)

    Scanlon, Erin M.

    The purpose of this three study dissertation is to investigate why students are enrolled in introductory physics courses experience difficulties in being successful; one possible source of their difficulties is related to their epistemology. In order to investigate students' epistemologies about mathematics and physics, students were observed solving physics problems in groups during a laboratory course (study 1) and while solving physics and mathematics problems individually during office-hour sessions (study 2). The Epistemological Resources theoretical framework was employed (Hammer & Elby, 2002). Using emergent and a priori epistemological resource operationalizations (Jones, 2015), 25 distinct epistemological resources were identified in study 1. Differences in physics epistemological resource usage between students of varying academic background (as measured by their number of previously completed mathematics and science classes were identified. By employing an external (Jones, 2015) and internal (Scanlon, 2016) a priori epistemological resource coding scheme, a total of 17 distinct epistemological resources were identified in study 2. The data were sampled to compare the mathematics and physics epistemological resource usage of participants with consistent and inconsistent sign usage in an energy conservation physics problem in order to provide a meaningful context for discussion. Participants of the same sign usage group employed epistemological resources similarly. Conversely, participants in different groups had significantly different physics epistemological resource usage patterns. Finally, student epistemological resource usage patterns from the first two studies were compared to course outcomes in order to determine implications for practice (study 3). Educators must be aware of and address the epistemological underpinnings of students' difficulties in introductory physics courses.

  7. Introductory Nuclear Physics, 2nd Edition

    Science.gov (United States)

    Wong, Samuel S. M.

    1998-08-01

    A comprehensive, unified treatment of present-day nuclear physics-the fresh edition of a classic text/reference. "A fine and thoroughly up-to-date textbook on nuclear physics . . . most welcome." -Physics Today (on the First Edition). What sets Introductory Nuclear Physics apart from other books on the subject is its presentation of nuclear physics as an integral part of modern physics. Placing the discipline within a broad historical and scientific context, it makes important connections to other fields such as elementary particle physics and astrophysics. Now fully revised and updated, this Second Edition explores the changing directions in nuclear physics, emphasizing new developments and current research-from superdeformation to quark-gluon plasma. Author Samuel S.M. Wong preserves those areas that established the First Edition as a standard text in university physics departments, focusing on what is exciting about the discipline and providing a concise, thorough, and accessible treatment of the fundamental aspects of nuclear properties. In this new edition, Professor Wong: * Includes a chapter on heavy-ion reactions-from high-spin states to quark-gluon plasma * Adds a new chapter on nuclear astrophysics * Relates observed nuclear properties to the underlying nuclear interaction and the symmetry principles governing subatomic particles * Regroups material and appendices to make the text easier to use * Lists Internet links to essential databases and research projects * Features end-of-chapter exercises using real-world data. Introductory Nuclear Physics, Second Edition is an ideal text for courses in nuclear physics at the senior undergraduate or first-year graduate level. It is also an important resource for scientists and engineers working with nuclei, for astrophysicists and particle physicists, and for anyone wishing to learn more about trends in the field.

  8. The laboratory experience in introductory physics courses

    Science.gov (United States)

    Di Stefano, Maria C.

    1997-03-01

    The last two decades or so have witnessed intense efforts to improve the teaching and learning of physics. Scholarly studies have provided the grounding for many projects which reform the structure of introductory courses. A number of these innovations, however, are resource intensive, or depend on the ability to introduce changes in areas which are beyond the control of the faculty (e.g., scheduling), thus inhibiting their implementation. An alternative strategy that overcomes these obstacles is to modify the nature of the laboratory experience (a component that practically nobody disputes is an essential part of the introductory course), to provide hands-on learning opportunities that differ from the traditional "follow-this-recipe-to-verify-this-law" approach. I have chosen to implement a variety of activities that support the overall objectives of the course: developing conceptual understanding and transferable skills, and providing practice in the ways scientists actually do science. Given the audience in this two-semester, algebra-based course, mostly biology majors and pre-professionals (health-related careers, such as medicine, physical therapy, and veterinary), these goals were identified as the most important and lasting contribution that a physics course can make to the students intellectual development. I offer here examples of the types of hands on activities that I have implemented, organized for the sake of this presentation in four rather loose categories, depending on which subset of the course objectives the activities mostly address: self-designed lab activities, discussion of demo-type activities, building concepts from simple to complex, and out-of-lab physical phenomena.

  9. Understanding How Students Use Physical Ideas in Introductory Biology Courses

    CERN Document Server

    Watkins, Jessica; Redish, Edward; Cooke, Todd

    2010-01-01

    The University of Maryland (UMD) Biology Education and Physics Education Research Groups are investigating students' views on the role of physics in introductory biology courses. This paper presents data from an introductory course that addresses the fundamental principles of organismal biology and that incorporates several topics directly related to physics, including thermodynamics, diffusion, and fluid flow. We examine how the instructors use mathematics and physics in this introductory biology course and look at two students' responses to this use. Our preliminary observations are intended to start a discussion about the epistemological issues resulting from the integration of the science disciplines and to motivate the need for further research.

  10. Assessment of Factors that Influence the Recruitment of Majors from Introductory Geology Classes

    Science.gov (United States)

    Hoisch, T. D.; Bowie, J. I.

    2009-12-01

    In order to guide the formulation of strategies for recruiting undergraduates taking introductory geology courses into the geology program at Northern Arizona University, we surveyed 783 students in introductory geology classes and 23 geology majors in their junior and senior years. Our introductory courses (GLG100, Introduction to Geology; GLG101, Physical Geology; and GLG112, Geologic Disasters) typically enroll ~600 students each semester. The majority of students in these classes are non-majors who take them in order to satisfy a university general education requirement (called “Liberal Studies requirements” at NAU). A large proportion of these students are freshmen (51%) and sophomores (30%), and many have not yet decided on a major or are uncertain about the major they have chosen. Our analysis shows that ~7% of students in the introductory classes are possible candidates for recruitment. Although a small percentage, it represents a large number of individuals, in fact more than could be accommodated were they all to decide to major in geology. Influential factors that weigh in favor of majoring in geology include good employability, good salary potential, and opportunities for working outdoors, field work, observing nature, travel, and environmentally friendly employment. In addition, students view a career as a geologist as potentially the most fulfilling of the different science occupations (biologist, chemist, geologist, environmental scientist, physicist) and among the more environmentally friendly. However, students perceive geology to be the least difficult of the sciences, and geology occupations to be low-paying and low in prestige relative to the other sciences. These negative perceptions could be countered by providing data to introductory students showing the starting salaries of geologists in comparison to other science occupations, and by communicating the rigorous nature of the more advanced classes in the geology degree program. A

  11. Integrating writing research with curricular development in large-enrollment introductory physics

    Science.gov (United States)

    Demaree, Dedra

    2008-05-01

    Multiple research projects have been undertaken as part of an ongoing study to develop methods to do quantitative assessment of writing to learn within physics. The ability to make use of writing to learn at first glance appears limited in large-enrollment courses due to the time-intensive nature of essay writing and grading. However, effective ways to implement writing are quite possible. One study that will be discussed required students to do textbook summary writing in introductory physics in the 2007 spring semester of the ``Foundation Physics Course'' at the University of Cape Town. This course is a component of the special access program which contains mostly second language English speakers. Another use of writing will be reported that is currently being used in the introductory physics course at Oregon State University as a way to enhance problem solving. This project is also aimed at scaffolding students toward goals in our upper division courses. This talk will report on some of what we know about writing to learn, how we are working to improve ways to study it quantitatively, and how we are incorporating some aspects of it in accessible ways in large-enrollment introductory courses.

  12. Computational templates for introductory nuclear science using mathcad

    Science.gov (United States)

    Sarantites, D. G.; Sobotka, L. G.

    2013-01-01

    Computational templates used to teach an introductory course in nuclear chemistry and physics at Washington University in St. Louis are presented in brief. The templates cover both basic and applied topics.

  13. Introductory Chemical Education of Health Professionals: An Integrated Clinical Approach.

    Science.gov (United States)

    Farina, Joseph; Frechette, Michael

    1979-01-01

    Reports the development of an integrated clinical approach to introductory chemistry education at the undergraduate level for students majoring in nursing and the allied health professions at the University of Lowell. (BT)

  14. Introductory Biophysics Course: Presentation of Physics in a Biological Context

    Science.gov (United States)

    Henderson, B. J.; Henderson, M. A.

    1976-01-01

    An introductory biophysics course for science students who have previously taken two quarters of noncalculus physics is described. Material covered emphasizes the physical principles of sound, light, electricity, energy, and information. (Author/CP)

  15. Personalized Instruction with Bootstrap Tutors in an Introductory Biophysics Course

    Science.gov (United States)

    Roper, L. David

    1974-01-01

    Discusses the conduct of an introductory biophysics course with a personalized instruction by using tutors selected from the students themselves. Included are three tables of text contents, a sample of a terminal questionnaire, and a list of biophysics references. (CC)

  16. Two examples of circular motion for introductory courses in relativity

    Science.gov (United States)

    Wortel, Stephanie; Malin, Shimon; Semon, Mark D.

    2007-12-01

    The circular twin paradox and Thomas precession are presented in a way that makes them accessible to students in introductory relativity courses. Both are discussed by examining what happens during travel around a polygon and then in the limit as the polygon becomes a circle. Because relativistic predictions based on these examples are verified in experiments with macroscopic objects (such as atomic clocks flown in airplanes and the gyroscopes on Gravity Probe B), they are especially convincing to introductory students.

  17. Steganography and Cryptography Inspired Enhancement of Introductory Programming Courses

    Science.gov (United States)

    Kortsarts, Yana; Kempner, Yulia

    2015-01-01

    Steganography is the art and science of concealing communication. The goal of steganography is to hide the very existence of information exchange by embedding messages into unsuspicious digital media covers. Cryptography, or secret writing, is the study of the methods of encryption, decryption and their use in communications protocols.…

  18. Learning Programming Patterns Using Games

    Science.gov (United States)

    de Aquino Leal, Alexis Vinícius; Ferreira, Deller James

    2016-01-01

    There is still no pedagogy to teach programming that stands out significantly from others and no consensus on what is the best way for learning programming. There is still a need to develop new teaching methods for learning in introductory programming courses. This paper presents a pedagogic approach in support of creativity in programming and the…

  19. Sustaining educational reforms in introductory physics

    Directory of Open Access Journals (Sweden)

    Steven J. Pollock

    2008-06-01

    Full Text Available While it is well known which curricular practices can improve student performance on measures of conceptual understanding, the sustaining of these practices and the role of faculty members in implementing these practices are less well understood. We present a study of the hand-off of Tutorials in Introductory Physics [McDermott and Schaffer (Prentice-Hall, Upper Saddle River, NJ, 2002] from initial adopters to other instructors at the University of Colorado, including traditional faculty not involved in physics educational research. The study examines the impact of implementation of tutorials on student conceptual learning across ten first-semester, and seven second-semester courses, for 15 faculty members over 13 semesters, and includes roughly 5000 students. It is possible to demonstrate consistently high, and statistically indistinguishable, student learning gains for different faculty members; however, such results are not the norm and appear to rely on a variety of factors. Student performance varies by faculty background—faculty involved in, or informed by physics education research, consistently post higher student learning gains than less-informed faculty. Student performance in these courses also varies by curricula used—all semesters in which the research-based Tutorials and learning assistants are used have higher student learning gains than those semesters that rely on nonresearch-based materials and do not employ learning assistants.

  20. Podcasts as Tools in Introductory Environmental Studies

    Directory of Open Access Journals (Sweden)

    Christine Vatovec

    2009-12-01

    Full Text Available Technological tools have increasingly become a part of the college classroom, often appealing to teachers because of their potential to increase student engagement with course materials. Podcasts in particular have gained popularity as tools to better inform students by providing access to lectures outside of the classroom. In this paper, we argue that educators should expand course materials to include prepublished podcasts to engage students with both course topics and a broader skill set for evaluating readily available media. We present a pre- and postassignment survey evaluation assessing student preferences for using podcasts and the ability of a podcast assignment to support learning objectives in an introductory environmental studies course. Overall, students reported that the podcasts were useful tools for learning, easy to use, and increased their understanding of course topics. However, students also provided insightful comments on visual versus aural learning styles, leading us to recommend assigning video podcasts or providing text-based transcripts along with audio podcasts. A qualitative analysis of survey data provides evidence that the podcast assignment supported the course learning objective for students to demonstrate critical evaluation of media messages. Finally, we provide recommendations for selecting published podcasts and designing podcast assignments.

  1. Lessons Learned from Teaching Scratch as an Introduction to Object-Oriented Programming in Delphi

    Science.gov (United States)

    van Zyl, Sukie; Mentz, Elsa; Havenga, Marietjie

    2016-01-01

    As part of curriculum changes in South Africa, an introductory programming language, Scratch, must first be taught before switching to the well-established teaching of Delphi. The nature of programming in Scratch is considerably different from that in Delphi. It was assumed that the teaching of Scratch as introductory programming language could…

  2. Optimal Quadratic Programming Algorithms

    CERN Document Server

    Dostal, Zdenek

    2009-01-01

    Quadratic programming (QP) is one technique that allows for the optimization of a quadratic function in several variables in the presence of linear constraints. This title presents various algorithms for solving large QP problems. It is suitable as an introductory text on quadratic programming for graduate students and researchers

  3. Strengthening introductory psychology: A new model for teaching the introductory course.

    Science.gov (United States)

    Gurung, Regan A R; Hackathorn, Jana; Enns, Carolyn; Frantz, Susan; Cacioppo, John T; Loop, Trudy; Freeman, James E

    2016-01-01

    Introductory psychology (Intro Psych) is one of the most popular and frequently taught courses on college campuses, yet educators in psychology have limited knowledge about what is covered in classes around the nation or the extent to which class content reflects the current scope of the discipline. There is no explicit model to guide course content selection for the intro course, which poses substantial challenges for instructors. This article proposes a new model for teaching the intro course that integrates (a) scientific foundations, (b) 5 major domains or pillars of knowledge (biological, cognitive, developmental, social and personality, and mental and physical health), and (c) cross-cutting themes relevant to all domains (cultural and social diversity, ethics, variations in human functioning, and applications; American Psychological Association, 2014). We advocate for national assessment of the course, a similar introductory course for majors and nonmajors, the inclusion of experiential or laboratory components, and additional training resources for instructors of the intro course. Given the exponential growth of psychological knowledge and applications during the past decades, we caution against attempting to provide exhaustive coverage of all topic areas of psychology in a one-semester course. We conclude by discussing the challenges that lie ahead for the discipline of psychology as it launches this new model for Intro Psych. (c) 2016 APA, all rights reserved).

  4. Gender differences in introductory university physics performance: The influence of high school physics preparation and affect

    Science.gov (United States)

    Hazari, Zahra Sana

    The attrition of females studying physics after high school is a concern to the science education community. Most undergraduate science programs require introductory physics coursework. Thus, success in introductory physics is necessary for students to progress to higher levels of science study. Success also influences attitudes; if females are well-prepared, feel confident, and do well in introductory physics, they may be inclined to study physics further. This quantitative study using multilevel modeling focused on determining factors from high school physics preparation (content, pedagogy, and assessment) and the affective domain that influenced female and male performance in introductory university physics. The study controlled for some university/course level characteristics as well as student demographic and academic background characteristics. The data consisted of 1973 surveys from 54 introductory physics courses within 35 universities across the US. The results highlight high school physics and affective experiences that differentially influenced female and male performance. These experiences include: learning requirements, computer graphing/analysis, long written problems, everyday world examples, community projects, cumulative tests/quizzes, father's encouragement, family's belief that science leads to a better career, and the length of time students believed that high school physics would help in university physics. There were also experiences that had a similar influence on female and male performance. Positively related to performance were: covering fewer topics for longer periods of time, the history of physics as a recurring topic, physics-related videos, and test/quiz questions that involved calculations and/or were drawn from standardized tests. Negatively related to performance were: student-designed projects, reading/discussing labs the day before performing them, microcomputer based laboratories, discussion after demonstrations, and family

  5. Learner Centered Introductory Astronomy Community College Course

    Science.gov (United States)

    Sprague, C. J.; Grill, M. R.; Genet, C. L.; Genet, R. M.

    2002-05-01

    In the fall of 2001, learner centered education principles were applied to an introductory astronomy course at the Superstition Mountain Campus of Central Arizona College (CAC). The course was cooperatively designed and managed by the students themselves (especially Sprague and Grill), an assistant course facilitator (C. Genet), and the course instructor and developer (R. Genet). Although some time was devoted to lectures accompanied by photographic slides and open to the public, the bulk of the time was devoted to student projects. Students built telescopes, including solar, zenith, and Galileo, took measurements, made calculations, mapped stars, and determined the circumference of the earth via zenith observations at Apache Junction and at Mt. Hopkins, 120 miles away. A three-day field trip to Lowell Observatory included a tour, observations through the famous 24-inch Clark refractor, and a conference on `Undergraduate Astronomical Research' which included talks on stellar photometry by G. W. Lockwood and R. M. Genet. A second three-day field trip included a tour and observations at Kitt Peak National Observatory (0.4 m telescope), a tour of the observatories on Mt. Hopkins, and a conference on `Learner-Centered Astronomy Education.' The community college students were joined by doctoral students and alumni from the Union Institute and University, as well as by Campua Dean James Stuckey from CAC and his wife Beverly Santos of Northern Arizona University. By allowing students the freedom to explore and expand their knowledge at a rate appropriate to each individual, the students attained levels of confidence not found in traditional teaching styles. We are pleased to acknowledge Dean Stuckey who made this class possible. We also wish to thank Wesley Lockwood and Robert Bargoon at Lowell Observatory, Robert Wilson at Kitt Peak National Observatory, and Daniel Brocious at the Smithsonian's Whipple Observatory for their invaluable assistance during our field trips.

  6. The effectiveness of teaching Introductory Chemistry online

    Science.gov (United States)

    Hjorth-Gustin, Paula

    The purpose of this study was to determine the effectiveness of teaching Introductory Chemistry online as compared to a traditionally taught lecture course at the community college level. Effectiveness was determined by comparing student achievement on key topics. In addition, a comparison of student achievement on quantitative topics (QT) and non-quantitative topics (NQT) between the two groups was performed. The research design was a static group comparison. Two online courses (N = 31) and one traditional course (N = 31) participated in the study in the spring of 2003. A student survey was used to determine if the two groups, upon entering the course, were equivalent in terms of chemistry and mathematics background. The 7 quizzes consisted of questions from the test bank that accompanied the textbook. Three of the 7 quizzes covered quantitative topics, while 4 quizzes covered non-quantitative topics. Statistical tests were employed to determine if there was a statistical difference in the means of the student survey scores, each individual quiz, combined QT scores, and combined NQT scores. The two groups were found to be equivalent upon entering the course. Only 2 out of the 7 quizzes showed statistical differences in the means between the two groups. Both were QT quizzes. The online group scored higher (p = .006) on one while the traditional group scored higher (p < .001) on another. The main conclusion of the study was that online teaching is as effective as a traditionally taught course and methodologies can provide an effective alternative to lecture based instruction. Recommendations for improving traditional and online instruction were included, especially in the area of quantitative topics, and suggestions for future research in online chemistry education were provided.

  7. Designing an Introductory Physics Course for Biological Science Students

    Science.gov (United States)

    Heller, Kenneth

    2009-05-01

    For the past four years the School of Physics and Astronomy at the University of Minnesota has been revising its Introductory Physics Course specifically targeted to biological science and pre-medical students. The course design process includes determining the reasons that introductory physics is required by the biology faculty and determining how or if to satisfy their goals. The resulting course must substantially satisfy the goals of the biology faculty, be an introductory physics course that stresses the application of fundamental principles and relates them to complex situations typical in biology, be of interest to beginning biology students, and be teachable by ordinary physics professors. The design process for the content and the pedagogy of the course will be described as will the resulting course structure. Student performance measures for the revised course will also be given.

  8. Personality types and student performance in an introductory physics course

    Science.gov (United States)

    Harlow, Jason J. B.; Harrison, David M.; Justason, Michael; Meyertholen, Andrew; Wilson, Brian

    2017-12-01

    We measured the personality type of the students in a large introductory physics course of mostly life science students using the True Colors instrument. We found large correlations of personality type with performance on the precourse Force Concept Inventory (FCI), both term tests, the postcourse FCI, and the final examination. We also saw correlations with the normalized gain on the FCI. The personality profile of the students in this course is very different from the profile of the physics faculty and graduate students, and also very different from the profile of students taking the introductory physics course intended for physics majors and specialists.

  9. Students' conceptions of evidence during a university introductory forensic science course

    Science.gov (United States)

    Yeshion, Theodore Elliot

    Students' Conceptions of Science, Scientific Evidence, and Forensic Evidence during a University Introductory Forensic Science Course This study was designed to examine and understand what conceptions undergraduate students taking an introductory forensic science course had about scientific evidence. Because the relationships between the nature of science, the nature of evidence, and the nature of forensic evidence are not well understood in the science education literature, this study sought to understand how these concepts interact and affect students' understanding of scientific evidence. Four participants were purposefully selected for this study from among 89 students enrolled in two sections of an introductory forensic science course taught during the fall 2005 semester. Of the 89 students, 84 were criminal justice majors with minimal science background and five were chemistry majors with academic backgrounds in the natural and physical sciences. All 89 students completed a biographical data sheet and a pre-instruction Likert scale survey consisting of twenty questions relating to the nature of scientific evidence. An evaluation of these two documents resulted in a purposeful selection of four varied student participants, each of whom was interviewed three times throughout the semester about the nature of science, the nature of evidence, and the nature of forensic evidence. The same survey was administered to the participants again at the end of the semester-long course. This study examined students' assumptions, prior knowledge, their understanding of scientific inference, scientific theory, and methodology. Examination of the data found few differences with regard to how the criminal justice majors and the chemistry majors responded to interview questions about forensic evidence. There were qualitative differences, however, when the same participants answered interview questions relating to traditional scientific evidence. Furthermore, suggestions are

  10. Introductory Psychology: What's Lab Got to Do with It?

    Science.gov (United States)

    Peterson, Jamie J.; Sesma, Arturo, Jr.

    2017-01-01

    The American Psychological Association Board of Educational Affairs Working Group (APA) recommends providing some research experience to undergraduate students in the introductory psychology course. This nationwide survey of introductory psychology instructors explored the frequency of integrated research opportunities in introductory courses,…

  11. IT0: Discrete Math and Programming Logic Topics as a Hybrid Alternative to CS0

    Science.gov (United States)

    Martin, Nancy L.

    2015-01-01

    This paper describes the development of a hybrid introductory course for students in their first or second year of an information systems technologies degree program at a large Midwestern university. The course combines topics from discrete mathematics and programming logic and design, a unique twist on most introductory courses. The objective of…

  12. Teaching Introductory Java through LEGO MINDSTORMS Models

    OpenAIRE

    Barnes, David J

    2002-01-01

    Innovative teachers are continually looking for creative ideas, both to get their ideas across and to hold the interest of their students. One of the latest trends is the use of LEGO MINDSTORMS kits in various computing courses. These kits allow a wide variety of physical models to be built, some of which may be programmed via the RCX processor integrated into them. Using its standard firmware, the RCX device may be programmed through several different specialist languages. However, the addit...

  13. Using Eportfolios to Aid Reflection in Introductory Psychology

    Science.gov (United States)

    Siporin, Sheldon

    2013-01-01

    Electronic portfolios (EP) are an academic version of online social media (e.g., Facebook) that archive student work and support integrated learning. Despite limited theory, advocates believe EP enhances the reflective process. Thirty-six students in introductory psychology at Pace University were invited to create EP and complete optional EP…

  14. A Critical Understanding and Transformation of an Introductory Statistics Course

    Science.gov (United States)

    Magalhães, Marcos Nascimento; Magalhães, Maria Cecilia Camargo

    2014-01-01

    In this paper, we report on the impact of four activities and two interviews on the organization of an introductory statistics course attended by future mathematics teachers at the University of Sao Paulo, Brazil. The activities were designed to enhance students' learning and collaborative knowledge construction, based on Vygotsky's…

  15. Polymerization Simulator for Introductory Polymer and Material Science Courses

    Science.gov (United States)

    Chirdon, William M.

    2010-01-01

    This work describes how molecular simulation of polymerization reactions can be used to enrich introductory polymer or material science courses to give students a deeper understanding of free-radical chain and stepwise growth polymerization reactions. These simulations have proven to be effective media for instruction that do not require material…

  16. The Approaches to Studying of Portuguese Students of Introductory Accounting

    Science.gov (United States)

    Teixeira, Cláudia; Gomes, Delfina; Borges, Janete

    2013-01-01

    The focus of this paper is an investigation into the approaches to studying of Portuguese students of introductory accounting using the short version of the ASSIST instrument. In doing so, it also examined the impact upon the strategy adopted of the discipline area of students and gender. The results validate the use of the inventory with students…

  17. Implementing Recommendations for Introductory Biology by Writing a New Textbook

    Science.gov (United States)

    Barsoum, Mark J.; Sellers, Patrick J.; Campbell, A. Malcolm; Heyer, Laurie J.; Paradise, Christopher J.

    2013-01-01

    We redesigned the undergraduate introductory biology course by writing a new textbook ("Integrating Concepts in Biology" ["ICB"]) that follows first principles of learning. Our approach emphasizes primary data interpretation and the utility of mathematics in biology, while de-emphasizing memorization. This redesign divides biology into five big…

  18. Personality Types and Student Performance in an Introductory Physics Course

    Science.gov (United States)

    Harlow, Jason J. B.; Harrison, David M.; Justason, Michael; Meyertholen, Andrew; Wilson, Brian

    2017-01-01

    We measured the personality type of the students in a large introductory physics course of mostly life science students using the True Colors instrument. We found large correlations of personality type with performance on the precourse Force Concept Inventory (FCI), both term tests, the postcourse FCI, and the final examination. We also saw…

  19. Incorporating code-based software in an introductory statistics course

    Science.gov (United States)

    Doehler, Kirsten; Taylor, Laura

    2015-08-01

    This article is based on the experiences of two statistics professors who have taught students to write and effectively utilize code-based software in a college-level introductory statistics course. Advantages of using software and code-based software in this context are discussed. Suggestions are made on how to ease students into using code with minimal anxiety.

  20. Core References in Introductory Social Psychology and Developmental Psychology Textbooks

    Science.gov (United States)

    Whitehead, George I., III; Smith, Stephanie H.; Losonczy-Marshall, Marta

    2017-01-01

    The purpose of the present study was to identify the core references in introductory textbooks in two sub-disciplines of psychology: social psychology and developmental psychology. One research question was the extent to which the common references in these textbooks present the trends in contemporary research in each sub-discipline. An analysis…

  1. Eating Competence of College Students in an Introductory Nutrition Course

    Science.gov (United States)

    Brown, Lora Beth; Larsen, Katrina J.; Nyland, Nora K.; Eggett, Dennis L.

    2013-01-01

    Objective: Describe eating competence, a positive and flexible way of conceptualizing eating attitudes and behaviors, in students enrolled in an introductory nutrition course. Methods: Online completion of the Satter Eating Competence Inventory (ecSI) and self-assessment of eating disorder status by 557 students (343 ages 18-20 years and 180 ages…

  2. Student Understanding of Gravity in Introductory College Astronomy

    Science.gov (United States)

    Williamson, Kathryn E.; Willoughby, Shannon

    2012-01-01

    Twenty-four free-response questions were developed to explore introductory college astronomy students' understanding of gravity in a variety of contexts, including in and around Earth, throughout the solar system, and in hypothetical situations. Questions were separated into three questionnaires, each of which was given to a section of…

  3. Ecology Content in Introductory Biology Courses: A Comparative Analysis

    Science.gov (United States)

    Pool, Richard F.; Turner, Gregory D.; Böttger, S. Anne

    2013-01-01

    In recent years the need for ecological literacy and problem solving has increased, but there is no evidence that this need is reflected by increased ecology coverage at institutions of higher education (IHE) across the United States. Because introductory biology courses may serve to direct student interest toward particular biological categories…

  4. Lecturers' Perspectives on How Introductory Economic Courses Address Sustainability

    Science.gov (United States)

    Green, Tom L.

    2015-01-01

    Purpose: The purpose of this article is to explore sustainability commitments' potential implications for the curriculum of introductory economics courses. Universities have signed the Talloires Declaration, committing themselves to promoting students' environmental literacy and ecological citizenship, thereby creating pressure to integrate…

  5. Team-Based Learning Improves Course Outcomes in Introductory Psychology

    Science.gov (United States)

    Travis, Lisa L.; Hudson, Nathan W.; Henricks-Lepp, Genevieve M.; Street, Whitney S.; Weidenbenner, Jennifer

    2016-01-01

    This study investigated the influence of team-based learning (TBL) methods on exam performance and student satisfaction in an introductory psychology class. Fifteen instructors teaching 29 sections (with a combined enrollment of approximately 1,130 students) were randomly assigned to use TBL for 7 of 12 major topics or to use lecture. All students…

  6. Demonstrating the Gambler's Fallacy in an Introductory Statistics Class.

    Science.gov (United States)

    Riniolo, Todd C.; Schmidt, Louis A.

    1999-01-01

    Describes a classroom demonstration called the Gambler's Fallacy where students in an introductory psychology statistics class participate in simulated gambling using weekly results from professional football game outcomes over a 10 week period. Explains that the demonstration illustrates that random processes do not self-correct and statistical…

  7. Class Size and Academic Achievement in Introductory Political Science Courses

    Science.gov (United States)

    Towner, Terri L.

    2016-01-01

    Research on the influence of class size on student academic achievement is important for university instructors, administrators, and students. The article examines the influence of class size--a small section versus a large section--in introductory political science courses on student grades in two comparable semesters. It is expected that…

  8. Academic Performance in Introductory Accounting: Do Learning Styles Matter?

    Science.gov (United States)

    Tan, Lin Mei; Laswad, Fawzi

    2015-01-01

    This study examines the impact of learning styles on academic performance using major assessment methods (examinations and assignments including multiple-choice and constructed response questions (CRQs)) in an introductory accounting course. Students' learning styles were assessed using Kolb's Learning Style Inventory Version 3.1. The results…

  9. The Distribution of Macromolecular Principles throughout Introductory Organic Chemistry

    Science.gov (United States)

    Shulman, Joel I.

    2017-01-01

    Many of the principles of organic polymer chemistry are direct extensions of the information contained in the standard introductory organic chemistry course. Often, however, the discussion of macromolecules is relegated to a chapter at the end of the organic chemistry text and is covered briefly, if at all. Connecting the organic-chemical…

  10. Transitioning from Introductory Calculus to Formal Limit Conceptions

    Science.gov (United States)

    Nagle, Courtney

    2013-01-01

    The limit concept is a fundamental mathematical notion both for its practical applications and its importance as a prerequisite for later calculus topics. Past research suggests that limit conceptualizations promoted in introductory calculus are far removed from the formal epsilon-delta definition of limit. In this article, I provide an overview…

  11. Introductory Biology Labs... They Just Aren't Sexy Enough!

    Science.gov (United States)

    Cotner, Sehoya; Gallup, Gordon G., Jr.

    2011-01-01

    The typical introductory biology curriculum includes the nature of science, evolution and genetics. Laboratory activities are designed to engage students in typical subject areas ranging from cell biology and physiology, to ecology and evolution. There are few, if any, laboratory classes exploring the biology and evolution of human sexual…

  12. Introductory Life Science Mathematics and Quantitative Neuroscience Courses

    Science.gov (United States)

    Duffus, Dwight; Olifer, Andrei

    2010-01-01

    We describe two sets of courses designed to enhance the mathematical, statistical, and computational training of life science undergraduates at Emory College. The first course is an introductory sequence in differential and integral calculus, modeling with differential equations, probability, and inferential statistics. The second is an…

  13. Psychological Seduction: Effective Organization of the Introductory Course.

    Science.gov (United States)

    Lenthall, Gerard; Andrews, David

    1983-01-01

    The order of presentation of topics is an important factor in the success of introductory psychology courses. Criteria for judging the efficacy of a course sequence should include use of students' entry level skills as a foundation, sections following each other coherently, and motivation for students to learn "hard" material. (CS)

  14. A Proposal for More Sophisticated Normative Principles in Introductory Economics

    Science.gov (United States)

    Schmidt, Stephen

    2017-01-01

    Introductory textbooks teach a simple normative story about the importance of maximizing economic surplus that supports common policy claims. There is little defense of the claim that maximizing surplus is normatively important, which is not obvious to non-economists. Difficulties with the claim that society should maximize surplus are generally…

  15. Peer Discussions in Lecture-Based Tutorials in Introductory Physics

    Science.gov (United States)

    Leinonen, Risto; Asikainen, Mervi A.; Hirvonen, Pekka E.

    2017-01-01

    This study analyzes the types of peer discussion that occur during lecture-based tutorial sessions. It focuses in particular on whether discussions of this kind have certain characteristics that might indicate success in the post-testing phase. The data were collected during an introductory physics course. The main data set was gathered with the…

  16. The Effect of Vocabulary on Introductory Microbiology Instruction

    Science.gov (United States)

    Richter, Emily

    2011-01-01

    This study examines the effect of the translation of traditional scientific vocabulary into plain English, a process referred to as Anglicization, on student learning in the context of introductory microbiology instruction. Data from Anglicized and Classical-vocabulary lab sections were collected. Data included exam scores as well as pre and…

  17. Student Interpretations of Phylogenetic Trees in an Introductory Biology Course

    Science.gov (United States)

    Dees, Jonathan; Momsen, Jennifer L.; Niemi, Jarad; Montplaisir, Lisa

    2014-01-01

    Phylogenetic trees are widely used visual representations in the biological sciences and the most important visual representations in evolutionary biology. Therefore, phylogenetic trees have also become an important component of biology education. We sought to characterize reasoning used by introductory biology students in interpreting taxa…

  18. Exploring Foundation Concepts in Introductory Statistics Using Dynamic Data Points

    Science.gov (United States)

    Ekol, George

    2015-01-01

    This paper analyses introductory statistics students' verbal and gestural expressions as they interacted with a dynamic sketch (DS) designed using "Sketchpad" software. The DS involved numeric data points built on the number line whose values changed as the points were dragged along the number line. The study is framed on aggregate…

  19. The Introductory College Business Course: A New Dimension

    Science.gov (United States)

    Podell, Joel; And Others

    1977-01-01

    Describes various methodologies used at the Queensboro Community College, New York, to enrich some of the topics traditionally included in the introductory course such as union management relations, social responsibility and business ethics, internal organization structure, and small business management. (TA)

  20. The Portrayal of Intelligence in Introductory Educational Psychology Textbooks

    Science.gov (United States)

    Lusk, Danielle L.; Jones, Brett D.

    2011-01-01

    Because of the importance of students' and teachers' implicit beliefs about intelligence, we designed a study to determine: (a) How is intelligence defined--as a malleable or fixed entity--in introductory educational psychology textbooks? and (b) To what extent are classroom applications of intelligence topics included in the textbooks? We…

  1. Teaching Introductory Undergraduate Physics Using Commercial Video Games

    Science.gov (United States)

    Mohanty, Soumya D.; Cantu, Sergio

    2011-01-01

    Commercial video games are increasingly using sophisticated physics simulations to create a more immersive experience for players. This also makes them a powerful tool for engaging students in learning physics. We provide some examples to show how commercial off-the-shelf games can be used to teach specific topics in introductory undergraduate…

  2. Public Image of Counseling Psychology: What Introductory Psychology Textbooks Say.

    Science.gov (United States)

    Dixon, David N.; Vrochopoulos, Sam; Burton, Jennifer

    1997-01-01

    Examines the adequacy of descriptions of counseling psychology and its professionals in introductory psychology textbooks compared to the descriptions of other applied areas of psychology. Results indicate that counseling psychology is less represented than industrial or organizational and clinical psychology and more represented than school…

  3. Osmotic Stressing, Membrane Leakage, and Fluorescence: An Introductory Biochemistry Demonstration

    Science.gov (United States)

    Seu, Kalani J.

    2015-01-01

    A fluorescence demonstration is described that incorporates several fundamental aspects of an introductory biochemistry course. A variation of a known leakage assay is utilized to prepare vesicles containing a quenched fluorophore. The vesicles are exposed to several osmotic environments ranging from isotonic to hypotonic. The degree of vesicle…

  4. Using Facebook Data to Turn Introductory Statistics Students into Consultants

    Science.gov (United States)

    Childers, Adam F.

    2017-01-01

    Facebook provides businesses and organizations with copious data that describe how users are interacting with their page. This data affords an excellent opportunity to turn introductory statistics students into consultants to analyze the Facebook data using descriptive and inferential statistics. This paper details a semester-long project that…

  5. Incorporating Code-Based Software in an Introductory Statistics Course

    Science.gov (United States)

    Doehler, Kirsten; Taylor, Laura

    2015-01-01

    This article is based on the experiences of two statistics professors who have taught students to write and effectively utilize code-based software in a college-level introductory statistics course. Advantages of using software and code-based software in this context are discussed. Suggestions are made on how to ease students into using code with…

  6. Introductory Psychology Grades and Volunteers for Extra Credit.

    Science.gov (United States)

    Bender, Timothy A.

    The motivation of students to volunteer to participate in research studies was explored in two studies. The first study explored the motivation of 300 introductory psychology students at a large midwestern university to volunteer for research participation when one exam point was offered for each hour of participation. Study two, which was…

  7. Public Speaking versus Hybrid Introductory Communication Courses: Exploring Four Outcomes

    Science.gov (United States)

    Broeckelman-Post, Melissa A.; Pyle, Andrew S.

    2017-01-01

    The purpose of this study was to compare student growth in public speaking and hybrid introductory communication skills courses on four outcomes: public speaking anxiety, self-perceived communication competence, intercultural effectiveness, and connected classroom climate. This study also sought to find out whether there were differences in the…

  8. Teaching Introductory Cell & Molecular Biology: A Historical and Empirical Approach.

    Science.gov (United States)

    Posner, Herbert B.

    1996-01-01

    Describes the reorganized introductory cell and molecular biology lecture course at the State University of New York at Binghamton that was designed to address the issues of lack of active student participation and the stress put on memorization rather than analytical skills. Emphasizes teaching the subject historically and empirically…

  9. Challenges in Understanding Photosynthesis in a University Introductory Biosciences Class

    Science.gov (United States)

    Södervik, Ilona; Virtanen, Viivi; Mikkilä-Erdmann, Mirjamaija

    2015-01-01

    University students' understanding of photosynthesis was examined in a large introductory biosciences class. The focus of this study was to first examine the conceptions of photosynthesis among students in class and then to investigate how a certain type of text could enhance students' understanding of photosynthesis. The study was based on pre-…

  10. Effects of Team Teaching on Students Performance in Introductory ...

    African Journals Online (AJOL)

    This pre-test post-test non randomized experimental study investigated the effects of team teaching on students' performance in Introductory Technology. A total 316 Junior Secondary School Two students were randomly selected from four schools in Akwa Ibom State for the study. Data for the study was collected using ...

  11. INTRODUCTORY URDU. VOLUME I (PHONOLOGY, SCRIPT, AND GRAMMAR).

    Science.gov (United States)

    NAIM, C.M.; AND OTHERS

    AN EXPLANATION OF THE STATUS OF URDU, ONE OF THE TWO OFFICIAL LANGUAGES OF PAKISTAN, AND ITS RELATIONSHIP TO HINDI PREFACES THIS URDU LANGUAGE TEXT. PREPARED AS A TWO-SEMESTER INTRODUCTORY COURSE FOR STUDENTS INTERESTED IN A THOROUGH KNOWLEDGE OF WRITTEN URDU, THIS FIRST VOLUME CONSISTS OF (1) A SECTION ON PHONOLOGY, SUPPLEMENTED BY TAPES, (2) A…

  12. The Effects of Different Teaching Approaches in Introductory Financial Accounting

    Science.gov (United States)

    Chiang, Bea; Nouri, Hossein; Samanta, Subarna

    2014-01-01

    The purpose of the research is to examine the effect of the two different teaching approaches in the first accounting course on student performance in a subsequent finance course. The study compares 128 accounting and finance students who took introductory financial accounting by either a user approach or a traditional preparer approach to examine…

  13. Learning Communities as Transformative Pedagogy: Centering Diversity in Introductory Sociology

    Science.gov (United States)

    Snowden, Monica

    2004-01-01

    This paper discusses learning communities as pedagogy for introductory sociology courses, which are often plagued by student apathy. Most importantly, it examines the potential for learning communities to incorporate active and collaborative learning techniques as a vehicle to subvert dominant views of diversity, to see diversity as intersecting…

  14. Insights into Learning Profiles and Learning Outcomes within Introductory Accounting

    Science.gov (United States)

    Teixeira, Cláudia; Gomes, Delfina

    2017-01-01

    This paper reports an empirical study aiming to explore aspects of learning and studying introductory accounting in Portuguese higher education. It specifically provides insight into patterns of learning and learning outcomes. To do so, it draws on qualitative data collected from students' answers to a semi-structured interview about their…

  15. Catholic/Jesuit Values in an Introductory Religious Studies Course

    Science.gov (United States)

    Lynch, Patrick; S. J.; Mizak, Pat

    2012-01-01

    A growing interest in the communication to students of the mission and identity of a higher education institution prompted this study about the presence of Catholic, Jesuit values in the introductory religious studies course at a faith-based university. To conduct this study a survey instrument was developed, piloted, further refined, and then…

  16. Effects of Team Teaching on Students Performance in Introductory ...

    African Journals Online (AJOL)

    FIRST LADY

    ISSN 1994-9057 (Print). ISSN 2070-0083 (Online). Effects of Team Teaching on Students Performance in Introductory Technology in Secondary Schools in. Akwa Ibom State, Nigeria (Pp 41-54). Akpan, Godwin A. – Department of Vocational Education, University of. Uyo, Uyo, Nigeria. E-mail: akpanga2020@yahoo.com.

  17. Students' Ethics Ratings of Demonstrations in Introductory Psychology.

    Science.gov (United States)

    Harcum, E. Rae; Friedman, Herbert

    1991-01-01

    Reports results of a study of introductory psychology students' opinions of whether 10 classroom demonstrations would offend their sense of dignity or propriety. Discusses demonstrations of stages of death and dying, suggestibility, obedience to authority, and impressionability. Concludes that greater concern about ethical issues in classroom…

  18. A Pilot Study Teaching Metrology in an Introductory Statistics Course

    Science.gov (United States)

    Casleton, Emily; Beyler, Amy; Genschel, Ulrike; Wilson, Alyson

    2014-01-01

    Undergraduate students who have just completed an introductory statistics course often lack deep understanding of variability and enthusiasm for the field of statistics. This paper argues that by introducing the commonly underemphasized concept of measurement error, students will have a better chance of attaining both. We further present lecture…

  19. Basic Math Skills and Performance in an Introductory Economics Class

    Science.gov (United States)

    Ballard, Charles L.; Johnson, Marianne F.

    2004-01-01

    The authors measure math skills with a broader set of explanatory variables than have been used in previous studies. To identify what math skills are important for student success in introductory microeconomics, they examine (1) the student's score on the mathematics portion of the ACT Assessment Test, (2) whether the student has taken calculus,…

  20. Characterizing Teaching in Introductory Geology Courses: Measuring Classroom Practices

    Science.gov (United States)

    Budd, D. A.; van der Hoeven Kraft, K. J.; McConnell, D. A.; Vislova, T.

    2013-01-01

    Most research about reformed teaching practices in the college science classroom is based on instructor self-report. This research describes what is happening in some introductory geology courses at multiple institutions across the country using external observers. These observations are quantified using the Reformed Teaching Observation Protocol…

  1. A Case-Based Curriculum for Introductory Geology

    Science.gov (United States)

    Goldsmith, David W.

    2011-01-01

    For the past 5 years I have been teaching my introductory geology class using a case-based method that promotes student engagement and inquiry. This article presents an explanation of how a case-based curriculum differs from a more traditional approach to the material. It also presents a statistical analysis of several years' worth of student…

  2. Student and Professor Gender Effects in Introductory Business Statistics

    Science.gov (United States)

    Haley, M. Ryan; Johnson, Marianne F.; Kuennen, Eric W.

    2007-01-01

    Studies have yielded highly mixed results as to differences in male and female student performance in statistics courses; the role that professors play in these differences is even less clear. In this paper, we consider the impact of professor and student gender on student performance in an introductory business statistics course taught by…

  3. Special Relativity and Magnetism in an Introductory Physics Course

    Science.gov (United States)

    Piccioni, R. G.

    2007-01-01

    Too often, students in introductory courses are left with the impression that Einstein's special theory of relativity comes into play only when the relative speed of two objects is an appreciable fraction of the speed of light ("c"). In fact, relativistic length contraction, along with Coulomb's law, accounts quantitatively for the force on a…

  4. Introductory Anatomy and Physiology in an Undergraduate Nursing Curriculum

    Science.gov (United States)

    Brown, S. J.; White, S.; Power, N.

    2017-01-01

    Using an educational data mining approach, first-year academic achievement of undergraduate nursing students, which included two compulsory courses in introductory human anatomy and physiology, was compared with achievement in a final semester course that transitioned students into the workplace. We hypothesized that students could be grouped…

  5. Threshold Concepts and Conceptions: Student Learning in Introductory Management Courses

    Science.gov (United States)

    Wright, April L.; Gilmore, Anne

    2012-01-01

    This article explores how insights from the broader education literature on threshold concepts and conceptions can be applied to improve the teaching of undergraduate introductory management courses. The authors propose that these courses are underpinned by the threshold conception, or "underlying game," that management is a practice…

  6. Using Astrology to Teach Research Methods to Introductory Psychology Students.

    Science.gov (United States)

    Ward, Roger A.; Grasha, Anthony F.

    1986-01-01

    Provides a classroom demonstration designed to test an astrological hypothesis and help teach introductory psychology students about research design and data interpretation. Illustrates differences between science and nonscience, the role of theory in developing and testing hypotheses, making comparisons among groups, probability and statistical…

  7. Learning Styles and Student Performance in Introductory Economics

    Science.gov (United States)

    Brunton, Bruce

    2015-01-01

    Data from nine introductory microeconomics classes was used to test the effect of student learning style on academic performance. The Kolb Learning Style Inventory was used to assess individual student learning styles. The results indicate that student learning style has no significant effect on performance, undermining the claims of those who…

  8. Does the Choice of Introductory Microeconomics Textbook Matter?

    Science.gov (United States)

    Pyne, Derek

    2007-01-01

    The author examines the effects of different introductory microeconomics textbooks on student performance in subsequent economics courses (specifically, Intermediate Microeconomics I and Money and Banking). In some cases, the effects are significant and sizeable. There is also evidence of other variables affecting student performance in later…

  9. The Role of Applied Physics in American Introductory Physics Courses.

    Science.gov (United States)

    Poduska, Ervin L.; Lunetta, Vincent N.

    1984-01-01

    Examines the extent to which technology and applied physics should be included in introductory physics courses. Areas explored include the meaning of applied physics, the nature of pure and applied physics, and applied physics as viewed by a scientist, an educator, and society. Implications for the physics curriculum are addressed. (JN)

  10. The Impact of Student-Directed Projects in Introductory Statistics

    Science.gov (United States)

    Spence, Dianna J.; Bailey, Brad; Sharp, Julia L.

    2017-01-01

    A multi-year study investigated the impact of incorporating student-directed discovery projects into introductory statistics courses. Pilot instructors at institutions across the United States taught statistics implementing student-directed projects with the help of a common set of instructional materials designed to facilitate such projects.…

  11. Introductory statistics and random phenomena uncertainty, complexity and chaotic behavior in engineering and science

    CERN Document Server

    Denker, Manfred

    2017-01-01

    Introductory Statistics and Random Phenomena integrates traditional statistical data analysis with new computational experimentation capabilities and concepts of algorithmic complexity and chaotic behavior in nonlinear dynamic systems.  This was the first advanced text/reference to bring together such a comprehensive variety of tools for the study of random phenomena occurring in engineering and the natural, life, and social sciences. The crucial computer experiments are conducted using the readily available computer program Mathematica® Uncertain Virtual Worlds™ software packages which optimize and facilitate the simulation environment.  Brief tutorials are included that explain how to use theMathematica® programs for effective simulation and computer experiments.  Large and original real-life data sets are introduced and analyzed as a model for independent study. This is an excellent classroom tool and self-study guide.  The material is presented in a clear and accessible style providing numerous...

  12. Sustainability of a Practice-based Interprofessional Introductory Pharmacy Practice Experience Course.

    Science.gov (United States)

    Nuffer, Wesley; Gilliam, Eric; McDermott, Michael; Turner, Christopher J

    2015-06-25

    To describe a successfully sustained interprofessional introductory pharmacy practice experience (IPPE) in which third-year pharmacy students were paired with nonpharmacist practitioners. Course data were retrospectively reviewed and analyzed to reveal details about the program. Provider participant numbers and student perception data were reviewed and reported on. The number of students and providers participating increased during the 13 years of the program. On average, preceptors participated for 3 years and hosted 4 pharmacy students. Students consistently agreed the course helped increase student communication competencies and integration into interdisciplinary practice (mean agreement of 88.4% and 91.6%, respectively). A required interprofessional IPPE course designed to develop students' self-confidence working and communicating with nonpharmacist practitioners has been successfully sustained for more than a decade. Students report improvements in self-confidence and achievement of the course's primary outcomes.

  13. Computer problem-solving coaches for introductory physics: Design and usability studies

    Directory of Open Access Journals (Sweden)

    Qing X. Ryan

    2016-02-01

    Full Text Available The combination of modern computing power, the interactivity of web applications, and the flexibility of object-oriented programming may finally be sufficient to create computer coaches that can help students develop metacognitive problem-solving skills, an important competence in our rapidly changing technological society. However, no matter how effective such coaches might be, they will only be useful if they are attractive to students. We describe the design and testing of a set of web-based computer programs that act as personal coaches to students while they practice solving problems from introductory physics. The coaches are designed to supplement regular human instruction, giving students access to effective forms of practice outside class. We present results from large-scale usability tests of the computer coaches and discuss their implications for future versions of the coaches.

  14. Promoting Sketching in Introductory Geoscience Courses: CogSketch Geoscience Worksheets.

    Science.gov (United States)

    Garnier, Bridget; Chang, Maria; Ormand, Carol; Matlen, Bryan; Tikoff, Basil; Shipley, Thomas F

    2017-10-01

    Research from cognitive science and geoscience education has shown that sketching can improve spatial thinking skills and facilitate solving spatially complex problems. Yet sketching is rarely implemented in introductory geosciences courses, due to time needed to grade sketches and lack of materials that incorporate cognitive science research. Here, we report a design-centered, collaborative effort, between geoscientists, cognitive scientists, and artificial intelligence (AI) researchers, to characterize spatial learning challenges in geoscience and to design sketch activities that use a sketch-understanding program, CogSketch. We developed 26 CogSketch worksheets that use cognitive science-based principles to scaffold problem solving of spatially complex geoscience problems and report observations of an implementation in an introductory geoscience course where students used CogSketch or human-graded paper worksheets. Overall, this research highlights the principles of interdisciplinary design between cognitive scientists, geoscientists, and AI researchers that can inform the collaborative design process for others aiming to develop effective educational materials. Copyright © 2017 Cognitive Science Society, Inc.

  15. Conversational English Program, 2.

    Science.gov (United States)

    Instituto de Idiomas Yazigi, Sao Paulo (Brazil). Centro de Linguistica Aplicada.

    This second book of a conversational English program for adults contains an introductory section in Portuguese and exercises in English. The text centers around an English-speaking family from the United States that goes to live in Brazil. It contains color photographs with captions followed by exercises. The exercises are in English and involve…

  16. Conversational English Program, 1.

    Science.gov (United States)

    Instituto de Idiomas Yazigi, Sao Paulo (Brazil). Centro de Linguistica Aplicada.

    This first book of a conversational English program for adults contains an introductory section in Portuguese and exercises in English. The text centers around an English-speaking family from the United States that goes to live in Brazil. It contains color photographs with captions followed by exercises. The exercises are in English and involve…

  17. Implementation of Aerobic Programs.

    Science.gov (United States)

    American Alliance for Health, Physical Education, Recreation and Dance (AAHPERD).

    This information is intended for health professionals interested in implementing aerobic exercise programs in public schools, institutions of higher learning, and business and industry workplaces. The papers are divided into three general sections. The introductory section presents a basis for adhering to a health fitness lifestyle, using…

  18. Six Sigma and Introductory Statistics Education

    Science.gov (United States)

    Maleyeff, John; Kaminsky, Frank C.

    2002-01-01

    A conflict exists between the way statistics is practiced in contemporary business environments and the way statistics is taught in schools of management. While businesses are embracing programs, such as six sigma and TQM, that bring statistical methods to the forefront of management decision making, students do not graduate with the skills to…

  19. Integrating Excel Spreadsheets into the Introductory Astronomy Laboratory

    Science.gov (United States)

    Keohane, Jonathan W.; Bartlett, J. L.; Bloom, S. D.; Foy, J. P.; Thurman, H. O.

    2008-05-01

    At Hampden-Sydney College, we teach a one-semester introductory astronomy class targeting non-science majors. This course fulfills the laboratory science requirement, and as such the class is obligated to teach transferable skills such as basic numeracy, quantitative reasoning and data analysis. To this end, we explicitly teach the use of the most commonly available data analysis program, which is currently Microsoft Excel. The laboratory sciences are ideally suited to teaching these skills. During each laboratory session, students explore an astronomical phenomenon related to the lectures for that week. Randomly assigned partners use computers to analyze their data in spreadsheets and to write detailed reports structured like journal articles. We present nine Excel templates, along with the corresponding laboratory instructions, that are designed to teach general data analysis techniques using spreadsheets within the context of a traditional astronomy laboratory. These exercises begin with basic calculations and move toward more complex ones such as least squares fitting of sine functions and calculating distances from measured magnitudes and assumed luminosities. Laboratory Exercises with Excel TemplatesMeasuring AnglesThis first lab uses the small angle formula.Jupiter's MoonsThe students take data with the CLEA lab of Jupiter's moons, but complete the data analysis using Excel. This includes least squares fitting of sine functions.Astrometry and ParallaxThe students complete the Astrometry of Asteroids CLEA lab, but perform the parallax calculations using Excel.The Resolution of a TelescopeThe students measure the resolution of their naked eyes and a telescope, using two eye charts, along with the theoretical resolution of the telescope for comparison.The Light Gathering Power of a TelescopeThe students observe a light bulb using a telescope equipped with a photometer and a mask of variable aperture.Solar RadiationThe students measure the length of a solar day

  20. Class modality, student characteristics, and performance in a community college introductory STEM course

    Science.gov (United States)

    Fogle, Thomas Ty

    Research on introductory STEM course performance has indicated that student characteristics (age, ethnicity and gender) and Grade Point Average (G.P.A.) can be predictive of student performance, and by implication, a correlation among these factors can help determine course design interventions to help certain types of students perform well in introductory STEM courses. The basis of this study was a community college Visual Basic programming course taught in both online and hybrid format. Beginning students in this course represented a diverse population residing in a large, mid-western, city and surrounding communities. Many of these students were defined as "at-Risk" or "non-traditional, which generally means any combination of socio-economic, cultural, family and employment factors that indicate a student is non-traditional. Research has shown these students struggle academically in technologically dense STEM courses, and may require student services and support to achieve their individual performance goals. The overall number in the study range was 392 distance students and 287 blended course students. The main question of this research was to determine to what extent student characteristics in a community college context, and previous success, as measured in overall G.P.A., were related to course performance in an introductory Visual Basic programming (STEM) course; and, whether or not a combination of these factors and course modality was predictive of success. The study employed a quantitative, quasi-experimental design to assess whether students' course performance was linked to course modality, student characteristics and overall G.P.A. The results indicated that the only predictor of student performance was overall G.P.A. Despite the research analyzed in Chapter 2, there was no statistically significant relationship to modality, age, ethnicity, or gender to performance in the course. Cognitive load is significant in a computer programming course and it

  1. Real Scientific Research in Introductory Astronomy

    Science.gov (United States)

    Rector, Travis A.; Pilachowski, Caty A.; Margheim, Steven

    Undergraduate students enrolled in a freshman seminar at Indiana University Bloomington were given the opportunity to participate in an ongoing research program with the WIYN 0.9-m telescope at Kitt Peak. Students analyzed digital images of the Andromeda Galaxy taken over a span of more than five years to discover novae as part of a program to determine the nova rate for Local Group galaxies. The course was designed to get non-majors to do real research; and in the process learn that science is a creative process and a way of thinking about nature rather than mere memorization of a body of knowledge. Participating in all aspects of research students formulated plans for their measurements and analysis carried out their project and presented their results to their peers. Students also participated in remote observing using video conferencing with on-site observers. Classroom computers enabled each student to blink images of fields in Andromeda to identify novae and to measure their magnitudes and celestial coordinates. Students wrote draft IAU circulars announcing their discoveries and research papers describing their results. The course is an extension of the nova search project in NOAO's Research Based Science Education program

  2. Real Scientific Research in Introductory Astronomy

    Science.gov (United States)

    Pilachowski, C. A.; Rector, T.; Margheim, S.

    2002-12-01

    Undergraduate students enrolled in a freshman seminar at Indiana University Bloomington were given the opportunity to participate in an ongoing research program with the WIYN 0.9-m telescope at Kitt Peak. Students analyzed digital images of the Andromeda Galaxy, taken over a span of more than five years, to discover novae as part of a program to determine the nova rate for Local Group galaxies. The course was designed to get non-majors to do real research, and in the process learn that science is a creative process and a way of thinking about nature, rather than mere memorization of a body of knowledge. Participating in all aspects of research, students formulated plans for their measurements and analysis, carried out their project, and presented their results to their peers. Students also participated in remote observing using video conferencing with on-site observers. Classroom computers running Scion Image software allowed each student to blink images of fields in Andromeda to identify novae, and to measure their magnitudes and celestial coordinates. Students wrote draft IAU circulars announcing their discoveries and research papers describing their results. The course is an extension of the nova search project in NOAO's Research Based Science Education program. The course included an in-depth study of the evolution of stars to allow students to understand and interpret their results. In-class activities, many web or computer-based, allowed the students to explore astrophysical concepts in depth. Assigned reading, Just-in-Time questions, and brief, in-class lectures provided background content material to help the students learn from class activities.

  3. The role of applied physics in American introductory physics courses

    Science.gov (United States)

    Poduska, Ervin L.; Lunetta, Vincent N.

    1984-09-01

    To what extent should technology and applied physics be included in introductory physics courses? What is the proper balance between pure and applied physics? Should physics teachers devote precious time to socially relevant issues like nuclear power and alternative sources of energy? How much time should be spent, if any, on applications that are more relevant to the student's world like cars, music, television and refrigeration? Does including applications reduce or enhance student understanding of important classical topics? A response to these questions must be based on goals for physics teaching, on knowledge of how students learn and on the nature of the physics discipline. Since there is not enough time to teach everything in an introductory course, priorities must be determined.

  4. Teaching assistants' beliefs regarding example solutions in introductory physics

    CERN Document Server

    Lin, Shih-Yin; Mamudi, William; Singh, Chandralekha; Yerushalmi, Edit

    2016-01-01

    As part of a larger study to understand instructors' considerations regarding the learning and teaching of problem solving in an introductory physics course, we investigated beliefs of first-year graduate teaching assistants (TAs) regarding the use of example solutions in introductory physics. In particular, we examine how the goal of promoting expert-like problem solving is manifested in the considerations of graduate TAs choices of example solutions. Twenty-four first-year graduate TAs were asked to discuss their goals for presenting example solutions to students. They were also provided with different example solutions and asked to discuss their preferences for prominent solution features. TAs' awareness, preferences and actual practices related to solution features were examined in light of recommendations from the literature for the modeling of expert-like problem solving approaches. The study concludes that the goal of helping students develop an expert-like problem solving approach underlies many TAs' ...

  5. First order error corrections in common introductory physics experiments

    Science.gov (United States)

    Beckey, Jacob; Baker, Andrew; Aravind, Vasudeva; Clarion Team

    As a part of introductory physics courses, students perform different standard lab experiments. Almost all of these experiments are prone to errors owing to factors like friction, misalignment of equipment, air drag, etc. Usually these types of errors are ignored by students and not much thought is paid to the source of these errors. However, paying attention to these factors that give rise to errors help students make better physics models and understand physical phenomena behind experiments in more detail. In this work, we explore common causes of errors in introductory physics experiment and suggest changes that will mitigate the errors, or suggest models that take the sources of these errors into consideration. This work helps students build better and refined physical models and understand physics concepts in greater detail. We thank Clarion University undergraduate student grant for financial support involving this project.

  6. Facilitating Students' Problem Solving across Multiple Representations in Introductory Mechanics

    Science.gov (United States)

    Nguyen, Dong-Hai; Gire, Elizabeth; Rebello, N. Sanjay

    2010-10-01

    Solving problems presented in multiple representations is an important skill for future physicists and engineers. However, such a task is not easy for most students taking introductory physics courses. We conducted teaching/learning interviews with 20 students in a first-semester calculus-based physics course on several topics in introductory mechanics. These interviews helped identify the common difficulties students encountered when solving physics problems posed in multiple representations as well as the hints that help students overcome those difficulties. We found that most representational difficulties arise due to the lack of students' ability to associate physics knowledge with corresponding mathematical knowledge. Based on those findings, we developed, tested and refined a set of problem-solving exercises to help students learn to solve problems in graphical and equational representations. We present our findings on students' common difficulties with graphical and equational representations, the problem-solving exercises and their impact on students' problem solving abilities.

  7. Revealing the programming process

    DEFF Research Database (Denmark)

    Bennedsen, Jens; Caspersen, Michael Edelgaard

    2005-01-01

    One of the most important goals of an introductory programming course is that the students learn a systematic approach to the development of computer programs. Revealing the programming process is an important part of this; however, textbooks do not address the issue -- probably because...... the textbook medium is static and therefore ill-suited to expose the process of programming. We have found that process recordings in the form of captured narrated programming sessions are a simple, cheap, and efficient way of providing the revelation.We identify seven different elements of the programming...

  8. Introductory life science mathematics and quantitative neuroscience courses.

    Science.gov (United States)

    Duffus, Dwight; Olifer, Andrei

    2010-01-01

    We describe two sets of courses designed to enhance the mathematical, statistical, and computational training of life science undergraduates at Emory College. The first course is an introductory sequence in differential and integral calculus, modeling with differential equations, probability, and inferential statistics. The second is an upper-division course in computational neuroscience. We provide a description of each course, detailed syllabi, examples of content, and a brief discussion of the main issues encountered in developing and offering the courses.

  9. Introduction to neutron scattering. Lecture notes of the introductory course

    Energy Technology Data Exchange (ETDEWEB)

    Furrer, A. [ed.

    1996-12-31

    These proceedings enclose ten papers presented at the 1. European Conference on Neutron scattering (ECNS `96). The aim of the Introductory Course was fourfold: - to learn the basic principles of neutron scattering, - to get introduced into the most important classes of neutron scattering instruments, -to learn concepts and their transformation into neutron scattering experiments in various fields of condensed matter research, - to recognize the limitations of the neutron scattering technique as well as to the complementarity of other methods. figs., tabs., refs.

  10. Teaching introductory undergraduate physics using commercial video games

    Science.gov (United States)

    Mohanty, Soumya D.; Cantu, Sergio

    2011-09-01

    Commercial video games are increasingly using sophisticated physics simulations to create a more immersive experience for players. This also makes them a powerful tool for engaging students in learning physics. We provide some examples to show how commercial off-the-shelf games can be used to teach specific topics in introductory undergraduate physics. The examples are selected from a course taught predominantly through the medium of commercial video games.

  11. Increasing Student Success Using Online Quizzing in Introductory (Majors) Biology

    OpenAIRE

    Orr, Rebecca; Foster, Shellene

    2013-01-01

    Students often complain about their perceived disconnect between the time and effort spent studying and their subsequent performance on exams. Robert Bjork's research asserts that retrieval of stored information acts as a memory modifier, and that using tests as learning events creates ?desirable difficulties that enhance learning.? To determine the effect of utilizing testing as a learning event in the introductory (majors) biology classroom, we used an online homework platform to give requi...

  12. Teaching introductory undergraduate Physics using commercial video games

    CERN Document Server

    Mohanty, Soumya D

    2011-01-01

    Commercial video games are increasingly using sophisticated physics simulations to create a more immersive experience for players. This also makes them a powerful tool for engaging students in learning physics. We provide some examples to show how commercial off-the-shelf games can be used to teach specific topics in introductory undergraduate physics. The examples are selected from a course taught predominantly through the medium of commercial video games.

  13. Teaching introductory thermal physics through problem based learning

    OpenAIRE

    Tracey, Rebecca

    2005-01-01

    The development and delivery of an introductory thermal physics module taught through Problem Based Learning (PBL) in a lecture-based curriculum is reported on. The development and implementation of the module is illustrated through discussion of the problems and students responses. The PBL methodology is compared with traditional lecture style teaching and the educational theories that the methodologies stem from are discussed. Examples of how PBL has been used to teach physics, along wi...

  14. An Introductory Description of the ILLIAC IV System. Volume 1

    Science.gov (United States)

    1971-07-15

    m r AN INTRODUCTORY DESCRIPTION OF THE ILLIAC IV SYSTEM Volume I by- Stewart A. Denenberg I Accession For NTIS 6RA&I DTIC TAB Unannounced... MANIAC (Los Alamos) and WEIZIAC (Woizman Institute of Israel) soon followed and were patterned after the IAS machine. They all had addition times of...ultrasonic storage is the long access time. The time required for an accumulator to access a bit in storage varies from near zero, to the time it takes a

  15. Introductory biology and ecological literacy: A critical cultural analysis

    Science.gov (United States)

    Kellogg, Joseph Damian

    Despite the lack of accepted standards for the introductory biology course for students majoring in biology, the content and format of the first-year biology course is remarkably uniform in terms of both curriculum and pedagogy. This investigation is a critical cultural analysis of the purpose of, and practices within, undergraduate biology education in general, and the introductory biology course in particular. Drawing on a theoretical framework that combines critical philosophical inquiry, ecological literacy, science studies, and cultural studies, I argue that the failure of biology educators within the university to acknowledge the diversity of their student body and to actively engage social and ecological issues has resulted in a curriculum that has almost no meaning for students, and that is socially and ecologically irresponsible. This work is a search for meaningful alternatives. Within this work, I attempt to provide biology educators, as well as would-be reformers, with a seldom-seen view of academic biology. This is done to unsettle the status quo, and to initiate processes of seeking out spaces for change. Through the discourses of critical pedagogy and ecological literacy I examine the laboratories, lecture halls, teaching practices, and course materials that students encounter as they experience "the study of life." Additionally, I place the genesis and evolution of the introductory biology course within the sociohistorical context of reform in science education and academic biology in an effort to explain the amazing and problematic stability of this course.

  16. 1, 2, 3, 4: infusing quantitative literacy into introductory biology.

    Science.gov (United States)

    Speth, Elena Bray; Momsen, Jennifer L; Moyerbrailean, Gregory A; Ebert-May, Diane; Long, Tammy M; Wyse, Sara; Linton, Debra

    2010-01-01

    Biology of the twenty-first century is an increasingly quantitative science. Undergraduate biology education therefore needs to provide opportunities for students to develop fluency in the tools and language of quantitative disciplines. Quantitative literacy (QL) is important for future scientists as well as for citizens, who need to interpret numeric information and data-based claims regarding nearly every aspect of daily life. To address the need for QL in biology education, we incorporated quantitative concepts throughout a semester-long introductory biology course at a large research university. Early in the course, we assessed the quantitative skills that students bring to the introductory biology classroom and found that students had difficulties in performing simple calculations, representing data graphically, and articulating data-driven arguments. In response to students' learning needs, we infused the course with quantitative concepts aligned with the existing course content and learning objectives. The effectiveness of this approach is demonstrated by significant improvement in the quality of students' graphical representations of biological data. Infusing QL in introductory biology presents challenges. Our study, however, supports the conclusion that it is feasible in the context of an existing course, consistent with the goals of college biology education, and promotes students' development of important quantitative skills.

  17. Methods for conducting an introductory flight test engineering course

    Science.gov (United States)

    Shelton, Gentry

    This thesis serves as a guide to teaching an introductory flight test engineering course. There are several references pertaining to this area of study, but they are limited in their discussion of the details in how the professor can teach the course, how the professor can handle the logistics of the course, how the students can record and reduce the data and how the pilot can perform the flight test maneuvers. As such, this thesis, along with the materials developed therein, serves the reader as a guide to developing and conducting an introductory flight test engineering course. Materials were developed for the parties involved with an introductory flight test engineering course. Lesson plans and background theory is developed for the professor of the course. In-flight videos and flight maneuver manuals were developed to assist the pilot with flying the maneuvers. In-flight videos, a workbook and in-flight data collection manuals were developed to teach the students the basics of flight test engineering. A chapter is also dedicated to the logistics of the course for the professor. With these materials, any university interested in teaching the basics of flight test engineering will have a foundation to build upon. They will also be guided in the selection of a pilot who can perform the flight test maneuvers required of this course.

  18. Introductory Biology Textbooks Under-Represent Scientific Process

    Science.gov (United States)

    Duncan, Dara B.; Lubman, Alexandra; Hoskins, Sally G.

    2011-01-01

    Attrition of undergraduates from Biology majors is a long-standing problem. Introductory courses that fail to engage students or spark their curiosity by emphasizing the open-ended and creative nature of biological investigation and discovery could contribute to student detachment from the field. Our hypothesis was that introductory biology books devote relatively few figures to illustration of the design and interpretation of experiments or field studies, thereby de-emphasizing the scientific process. To investigate this possibility, we examined figures in six Introductory Biology textbooks published in 2008. On average, multistep scientific investigations were presented in fewer than 5% of the hundreds of figures in each book. Devoting such a small percentage of figures to the processes by which discoveries are made discourages an emphasis on scientific thinking. We suggest that by increasing significantly the illustration of scientific investigations, textbooks could support undergraduates’ early interest in biology, stimulate the development of design and analytical skills, and inspire some students to participate in investigations of their own. PMID:23653758

  19. Reducing the failure rate in introductory physics classes

    Science.gov (United States)

    Saul, Jeff; Coulombe, Patrick; Lindell, Rebecca

    2017-01-01

    Calculus-based introductory physics courses are often among the most difficult at many colleges and universities. With the national movement to increase STEM majors, the introductory calculus-based courses need to be less of a weed-out course and more of a course that propels students forward into successful majors. This talk discusses two approaches to reduce DFW rates and improve student retention: studio courses and parachute courses. Studio courses integrate lecture/laboratory into one course where the primary mode of instruction is small group activities. Typically, any students enrolled in the college or university can enroll in a studio version of the course. Parachute courses on the other hand, focus on the poor performing students. Designed so that students not doing well in an introductory physics course can switch into the parachute class mid-semester without harm to their GPA. In addition, the parachute course focuses on helping students build the knowledge and skills necessary for success when retaking the calculus-based Physics course. The studio course format has been found to reduce DFW rates at several universities by 40-60% compared with separate lecture and laboratory format versions of the same courses, while parachutes courses were less successful. At one university, the parachute course succeeded in helping 80% of students maintain their GPA, but only helped 20% successfully pass the calculus-based physics course.

  20. 1, 2, 3, 4: Infusing Quantitative Literacy into Introductory Biology

    Science.gov (United States)

    Momsen, Jennifer L.; Moyerbrailean, Gregory A.; Ebert-May, Diane; Long, Tammy M.; Wyse, Sara; Linton, Debra

    2010-01-01

    Biology of the twenty-first century is an increasingly quantitative science. Undergraduate biology education therefore needs to provide opportunities for students to develop fluency in the tools and language of quantitative disciplines. Quantitative literacy (QL) is important for future scientists as well as for citizens, who need to interpret numeric information and data-based claims regarding nearly every aspect of daily life. To address the need for QL in biology education, we incorporated quantitative concepts throughout a semester-long introductory biology course at a large research university. Early in the course, we assessed the quantitative skills that students bring to the introductory biology classroom and found that students had difficulties in performing simple calculations, representing data graphically, and articulating data-driven arguments. In response to students' learning needs, we infused the course with quantitative concepts aligned with the existing course content and learning objectives. The effectiveness of this approach is demonstrated by significant improvement in the quality of students' graphical representations of biological data. Infusing QL in introductory biology presents challenges. Our study, however, supports the conclusion that it is feasible in the context of an existing course, consistent with the goals of college biology education, and promotes students' development of important quantitative skills. PMID:20810965

  1. Introductory Biology Textbooks Under-Represent Scientific Process

    Directory of Open Access Journals (Sweden)

    Dara B. Duncan

    2011-08-01

    Full Text Available Attrition of undergraduates from Biology majors is a long-standing problem. Introductory courses that fail to engage students or spark their curiosity by emphasizing the open-ended and creative nature of biological investigation and discovery could contribute to student detachment from the field. Our hypothesis was that introductory biology books devote relatively few figures to illustration of the design and interpretation of experiments or field studies, thereby de-emphasizing the scientific process.To investigate this possibility, we examined figures in six Introductory Biology textbooks published in 2008. On average, multistep scientific investigations were presented in fewer than 5% of the hundreds of figures in each book. Devoting such a small percentage of figures to the processes by which discoveries are made discourages an emphasis on scientific thinking. We suggest that by increasing significantly the illustration of scientific investigations, textbooks could support undergraduates’ early interest in biology, stimulate the development of design and analytical skills, and inspire some students to participate in investigations of their own.

  2. Teaching introductory game development with unreal engine: Challenges, strategies, and experiences

    Science.gov (United States)

    Head, Nicholas A.

    From the days of Pong to 100 million dollar projects such as the Grand Theft Auto franchise, video games have evolved significantly over the years. This evolution has also changed the way game development is viewed as a career. Today, video games are one of the most profitable forms of entertainment, and game development courses are appearing at universities around the world. Even with this growth, a degree from a university has yet to be an important factor in finding a job in game development (Owen, 2013). This thesis examines a method of creating and implementing an introductory gaming course and recommends ways to improve the curriculum. The main focus of the course was to introduce game development to the students. Each week, they were given an exercise that covered a different topic. Students also took part in a team project in which they were tasked with creating a complete game. The goal of the team projects was to expand the student's basic knowledge given to them from the exercises. Data was gathered on the students' subjective experiences with the class. This data and the class's overall performance were compared with past iterations of the course. New to the course was the Unreal Engine. Students used the latest version of the engine, Unreal Engine 4, to complete exercises. Not all students chose to use this engine for the team project. Instructor and students experiences with the engine were also recorded. While there were some problems implementing the engine within our lab environment, we were still able to execute the overall lesson plan. Even with the engine issues, the course had overall good performance. CGT 241, Introduction to 3D Animation, was shown to help the students to complete the course while CGT 215, Computer Graphics Programming I, did not provide enough information on game programming. Exercises were found to be helpful but students wanted a better understanding of how these skills can be applied to game development. Team projects

  3. Programming in Context

    DEFF Research Database (Denmark)

    Bennedsen, J.; Caspersen, M.E.

    2004-01-01

    The recommendations of the Joint Task Force on Computing Curricula 2001 encompass suggestions for an object-first introductory programming course. We have identified conceptual modeling as a lacking perspective in the suggestions for CS1. Conceptual modeling is the defining characteristic of object...... approach to programming; both of these are a big help to newcomers. The approach has a very positive impact on the number of students passing the course....

  4. Integration of a Low-Cost Introductory Ultrasound Curriculum Into Existing Procedural Skills Education for Preclinical Medical Students.

    Science.gov (United States)

    Maloney, Lauren; Zach, Kristen; Page, Christopher; Tewari, Neera; Tito, Matthew; Seidman, Peggy

    2017-02-01

    We evaluated integration of an introductory ultrasound curriculum into our existing mandatory procedural skills program for preclinical medical students. Phantoms consisting of olives, pimento olives, and grapes embedded in opaque gelatin were developed. Four classes encouraged progressive refinement of phantom-scanning and object identification skills. Students improved their ability to identify hidden objects, although each object type achieved a statistically significant improvement in correct identification at different time points. The total phantom cost per student was $0.76. Our results suggest that short repeated experiences scanning simple, low-cost ultrasound phantoms confer basic ultrasound skills. © 2016 by the American Institute of Ultrasound in Medicine.

  5. The Impact of Baby Swimming on Introductory and Elementary Swimming Training

    OpenAIRE

    Břízová, Gabriela

    2007-01-01

    THESIS ANNOTATION Title: The Impact of Baby Swimming on Introductory and Elementary Swimming Training Aim: To assess the impact of 'baby swimming' on the successfulness in introductory and partly in elementary swimming training, and to find out whether also other circumstances (for example the length of attendance at 'baby swimming') have some influence on introductory swimming training. Methods: We used a questionnaire method for the parents of children who had attended 'baby swimming' and f...

  6. Examining the Motivation and Learning Strategies Use of Different Populations in Introductory Geosciences

    Science.gov (United States)

    van der Hoeven Kraft, K.; Stempien, J. A.; Bykerk-Kauffman, A.; Jones, M. H.; Matheney, R. K.; McConnell, D.; Perkins, D.; Wilson, M. J.; Wirth, K. R.

    2010-12-01

    level of interest in science as they enter the classroom, but minority students’ interest in science at the end of the semester significantly declines relative to that of Caucasians. These findings have implications for student success in the course and their decisions to enroll in future geoscience classes. If we hope to recruit students into competitive research programs, changes need to occur at the introductory level in order to address these affective experiences for our students that present an obstacle to their participation in future coursework.

  7. BOOK REVIEW: Introductory Nanoscience: Physical and Chemical Concepts Introductory Nanoscience: Physical and Chemical Concepts

    Science.gov (United States)

    Bich Ha, Nguyen

    2011-12-01

    Having grown rapidly during the last two decades, and successfully synthesized the achievements of physics, chemistry, life science as well as information and computational science and technology, nanoscience and nanotechnology have emerged as interdisciplinary fields of modern science and technology with various prospective applications towards environmental protection and the sustainable development of industry, agriculture, public health etc. At the present time, there exist many textbooks, monographs and encyclopedias on nanoscience and nanotechnology. They present to readers the whole process of development from the emergence of new scientific ideas to comprehensive studies of concrete subjects. They are useful for experienced scientists in nanoscience and nanotechnology as well as related scientific disciplines. However, there are very few textbooks on nanoscience and nanotechnology for beginners—senior undergraduate and junior graduate students. Published by Garland Science in August 2011, Introductory Nanoscience: Physical and Chemical Concepts by Masaru Kuno is one of these rare textbooks. The purpose of this book is twofold. In a pedagogical manner the author presents the basic physical and chemical concepts of nanoscience and nanotechnology. Students with a background knowledge in general chemistry and semiclassical quantum physics can easily understand these concepts. On the other hand, by carefully studying the content of this textbook, readers can learn how to derive a large number of formulae and expressions which they will often use in their study as well as in their future research work. A distinguishing feature of the book is the inclusion of a large number of thought problems at the end of each chapter for demonstrating how to calculate the numerical values of almost all physical quantities involved in the theoretical and experimental studies of all subjects of nanoscience and nanotechnology. The author has successfully achieved both of the

  8. Rubella: Make Sure Your Child Gets Vaccinated

    Science.gov (United States)

    ... insurance or if your insurance does not cover vaccines for your child, the Vaccines for Children (VFC) Program may be able to ... children who might not otherwise have access to vaccines. To learn more, visit the VFC website or ask your child’s doctor. You can also contact your state VFC ...

  9. Symmetry and aesthetics in introductory physics: An experiment in interdisciplinary physics and fine arts education

    Science.gov (United States)

    van der Veen, Janet Krause

    In a recent editorial in Physics Today (July, 2006, p. 10) the ability of physicists to "imagine new realities" was correlated with what have been traditionally considered non-scientific qualities of imagination and creativity, which are usually associated with fine arts. In view of the current developments in physics of the 21st Century, including the searches for cosmic dark energy and evidence from the Large Hadron Collider which, it is hoped, will verify or refute the proposals of String Theory, the importance of developing creativity and imagination through education is gaining recognition. Two questions are addressed by this study: First, How can we bring the sense of aesthetics and creativity, which are important in the practice of physics, into the teaching and learning of physics at the introductory college level, without sacrificing the mathematical rigor which is necessary for proper understanding of physics? Second, How can we provide access to physics for a diverse population of students which includes physics majors, arts majors, and future teachers? An interdisciplinary curriculum which begins with teaching math as a language of nature, and utilizes arts to help visualize the connections between mathematics and the physical universe, may provide answers to these questions. In this dissertation I describe in detail the case study of the eleven students - seven physics majors and four arts majors - who participated in an experimental course, Symmetry and Aesthetics in Introductory Physics, in Winter Quarter, 2007, at UCSB's College of Creative Studies. The very positive results of this experiment suggest that this model deserves further testing, and could provide an entry into the study of physics for physics majors, liberal arts majors, future teachers, and as a foundation for media arts and technology programs.

  10. Implementation of the Introductory Clinician Development Series: an optional boot camp for Emergency Medicine interns

    Directory of Open Access Journals (Sweden)

    Min AA

    2014-08-01

    Full Text Available Alice A Min,1 Lisa R Stoneking,1 Kristi H Grall,1 Karen Spear-Ellinwood2 1Department of Emergency Medicine, 2Office of Medical Student Education, University of Arizona, Tucson, AZ, USA Background: The transition from medical student to first-year intern can be challenging. The stress of increased responsibilities, the gap between performance expectations and varying levels of clinical skills, and the need to adapt to a new institutional space and culture can make this transition overwhelming. Orientation programs intend to help new residents prepare for their new training environment. Objective: To ease our interns' transition, we piloted a novel clinical primer course. We believe this course will provide an introduction to basic clinical knowledge and procedures, without affecting time allotted for mandatory orientation activities, and will help the interns feel better prepared for their clinical duties. Methods: First-year Emergency Medicine residents were invited to participate in this primer course, called the Introductory Clinician Development Series (or "intern boot camp", providing optional lecture and procedural skills instruction prior to their participation in the mandatory orientation curriculum and assumption of clinical responsibilities. Participating residents completed postcourse surveys asking for feedback on the experience. Results: Survey responses indicated that the intern boot camp helped first-year residents feel more prepared for their clinical shifts in the Emergency Department. Conclusion: An optional clinical introductory series can allow for maintenance of mandatory orientation activities and clinical shifts while easing the transition from medical student to clinician. Keywords: orientation, residency training, educational design

  11. Evaluating Effectiveness of Pair Programming as a Teaching Tool in Programming Courses

    Science.gov (United States)

    Faja, Silvana

    2014-01-01

    This study investigates the effectiveness of pair programming on student learning and satisfaction in introductory programming courses. Pair programming, used in the industry as a practice of an agile development method, can be adopted in classroom settings to encourage peer learning, increase students' social skills, and enhance student…

  12. An analysis of the LIGO discovery based on Introductory Physics

    CERN Document Server

    Mathur, Harsh; Lowenstein, Ashton

    2016-01-01

    Binary black hole mergers are analyzed using concepts from introductory physics. Drawing upon Newtonian mechanics, dimensional considerations, and analogies between gravitational and electromagnetic waves, we are able to explain the principal features of LIGO's data and make order of magnitude estimates of key parameters of the event by inspection of the data. Our estimates of the black hole masses, the distance to the event, the initial separation of the pair, and the stupendous total amount of energy radiated are all in good agreement with the best fit values of these parameters obtained by the LIGO-VIRGO collaboration.

  13. Atmosphere, Ocean and Climate Dynamics An Introductory Text

    CERN Document Server

    Marshall, John

    1961-01-01

    For advanced undergraduate and beginning graduate students in atmospheric, oceanic, and climate science, Atmosphere, Ocean and Climate Dynamics is an introductory textbook on the circulations of the atmosphere and ocean and their interaction, with an emphasis on global scales. It will give students a good grasp of what the atmosphere and oceans look like on the large-scale and why they look that way. The role of the oceans in climate and paleoclimate is also discussed. The combination of observations, theory and accompanying illustrative laboratory experiments sets this text apart by making i

  14. An equity investigation of attitudinal shifts in introductory physics

    CERN Document Server

    Traxler, Adrienne L

    2014-01-01

    We report on seven years of attitudinal data using the Colorado Learning Attitudes about Science Survey from University Modeling Instruction (UMI) sections of introductory physics at Florida International University. This work expands upon previous studies that reported consistently positive attitude shifts in UMI courses; here, we disaggregate the data by gender and ethnicity to look for any disparities in the pattern of favorable shifts. We find that women and students from statistically underrepresented ethnic groups are equally supported on this attitudinal measure, and that this result holds even when interaction effects of gender and ethnicity are included. We conclude with suggestions for future work in UMI courses and for attitudinal equity investigations generally.

  15. The physical basis of electronics an introductory course

    CERN Document Server

    Harris, D J; Hammond, P

    1975-01-01

    The Physical Basis of Electronics: An Introductory Course, Second Edition is an 11-chapter text that discusses the physical concepts of electronic devices. This edition deals with the considerable advances in electronic techniques, from the introduction of field effect transistors to the development of integrated circuits. The opening chapters discuss the fundamentals of vacuum electronics and solid-state electronics. The subsequent chapters deal with the other components of electronic devices and their functions, including semiconductor diode and transistor as an amplifier and a switch. The d

  16. Characterizing, modeling, and addressing gender disparities in introductory college physics

    Science.gov (United States)

    Kost-Smith, Lauren Elizabeth

    2011-12-01

    The underrepresentation and underperformance of females in physics has been well documented and has long concerned policy-makers, educators, and the physics community. In this thesis, we focus on gender disparities in the first- and second-semester introductory, calculus-based physics courses at the University of Colorado. Success in these courses is critical for future study and careers in physics (and other sciences). Using data gathered from roughly 10,000 undergraduate students, we identify and model gender differences in the introductory physics courses in three areas: student performance, retention, and psychological factors. We observe gender differences on several measures in the introductory physics courses: females are less likely to take a high school physics course than males and have lower standardized mathematics test scores; males outscore females on both pre- and post-course conceptual physics surveys and in-class exams; and males have more expert-like attitudes and beliefs about physics than females. These background differences of males and females account for 60% to 70% of the gender gap that we observe on a post-course survey of conceptual physics understanding. In analyzing underlying psychological factors of learning, we find that female students report lower self-confidence related to succeeding in the introductory courses (self-efficacy) and are less likely to report seeing themselves as a "physics person". Students' self-efficacy beliefs are significant predictors of their performance, even when measures of physics and mathematics background are controlled, and account for an additional 10% of the gender gap. Informed by results from these studies, we implemented and tested a psychological, self-affirmation intervention aimed at enhancing female students' performance in Physics 1. Self-affirmation reduced the gender gap in performance on both in-class exams and the post-course conceptual physics survey. Further, the benefit of the self

  17. The Symbolic Dimension of Gender Violence: an introductory discussion

    Directory of Open Access Journals (Sweden)

    Romeu Gomes

    2008-11-01

    Full Text Available The aim of this article is to support a positive campaign against gender violence, or violence against women, by offering an introductory account of its symbolism. First, I set out the case for taking gender and masculinity to be the keys to understanding the symbolism of violence in the conetxt of gender relations. I then use that analysis to bring into focus those cases of violence which are otherwise hidden or unrecognised. Lastly, I offer suggestions as to how the debate may be continued.

  18. Bilingual Vocational Training Program for Chinese Chefs. Curriculum Package.

    Science.gov (United States)

    China Inst. in America, New York, NY.

    This manual was prepared by the staff of the China Institute's Bilingual Vocational Training Program, which has been in operation since 1975. The document includes a description of the training program for Chinese chefs and the curriculum guide used in the program. Following the introductory section, which describes the program objectives,…

  19. Multimedia programming with pure data

    CERN Document Server

    Chung, Bryan

    2013-01-01

    A quick and comprehensive tutorial book for media designers to jump-start interactive multimedia production with computer graphics, digital audio, digital video, and interactivity, using the Pure Data graphical programming environment.An introductory book on multimedia programming for media artists/designers who like to work on interactivity in their projects, digital art/design students who like to learn the first multimedia programming technique, and audio-visual performers who like to customize their performance sets

  20. Introducing Object-Oriented Programming

    DEFF Research Database (Denmark)

    Caspersen, Michael Edelgaard

    2008-01-01

    The practice of teaching programming at universities, colleges and high schools went through a major change roughly in the mid 1990s: The teaching of objectorientation in introductory courses slowly became mainstream. Fairly soon, the Object First or Objects Early school of thought was formulated...

  1. New Approach to Analyzing Physics Problems: A Taxonomy of Introductory Physics Problems

    Science.gov (United States)

    Teodorescu, Raluca E.; Bennhold, Cornelius; Feldman, Gerald; Medsker, Larry

    2013-01-01

    This paper describes research on a classification of physics problems in the context of introductory physics courses. This classification, called the Taxonomy of Introductory Physics Problems (TIPP), relates physics problems to the cognitive processes required to solve them. TIPP was created in order to design educational objectives, to develop…

  2. Contrasting Grading Approaches in Introductory Physics and Quantum Mechanics: The Case of Graduate Teaching Assistants

    Science.gov (United States)

    Marshman, Emily; Sayer, Ryan; Henderson, Charles; Singh, Chandralekha

    2017-01-01

    At large research universities, physics graduate teaching assistants (TAs) are often responsible for grading in courses at all levels. However, few studies have focused on TAs' grading practices in introductory and advanced physics courses. This study was designed to investigate whether physics graduate TAs grade students in introductory physics…

  3. Pre-Service Physics Teachers' Opinions about the Difficulties in Understanding Introductory Quantum Physics Topics

    Science.gov (United States)

    Kizilcik, Hasan Sahin; Yavas, Pervin Ünlü

    2017-01-01

    The aim of this study is to identify the opinions of pre-service physics teachers about the difficulties in introductory quantum physics topics. In this study conducted with twenty-five pre-service physics teachers, the case study method was used. The participants were interviewed about introductory quantum physics topics. The interviews were…

  4. Behaviorism, Latent Learning, and Cognitive Maps: Needed Revisions in Introductory Psychology Textbooks

    Science.gov (United States)

    Jensen, Robert

    2006-01-01

    This paper critically assesses the scholarship in introductory psychology textbooks in relation to the topic of latent learning. A review of the treatment of latent learning in 48 introductory psychology textbooks published between 1948 and 2004, with 21 of these texts published since 1999, reveals that the scholarship on the topic of latent…

  5. Introductory Astronomy Course at the University of Cape Town: Probing Student Perspectives

    Science.gov (United States)

    Rajpaul, Vinesh; Allie, Saalih; Blyth, Sarah-Louise

    2014-01-01

    We report on research carried out to improve teaching and student engagement in the introductory astronomy course at the University of Cape Town. This course is taken by a diverse range of students, including many from educationally disadvantaged backgrounds. We describe the development of an instrument, the Introductory Astronomy Questionnaire…

  6. Improving Introductory Astronomy Education in American Colleges and Universities: A Review of Recent Progress

    Science.gov (United States)

    Waller, William H.; Slater, Timothy F.

    2011-01-01

    Over the past 15 years, professional astronomers, their societies, and associated funding agencies have collaborated to improve astronomy teaching and learning at the introductory undergraduate level. Many nonscience majors and preservice teachers enroll in these introductory astronomy courses, thus meriting the focused attention. In this review…

  7. Stimulating Situational Interest and Student Questioning through Three Types of Historical Introductory Texts

    Science.gov (United States)

    Logtenberg, Albert; van Boxtel, Carla; van Hout-Wolters, Bernadette

    2011-01-01

    This study investigates questions students ask related to an introductory text about a new topic in the history classroom. The effects of a narrative, problematizing, and expository introductory text on the situational interest of students and the number and type of student-generated questions, are compared. Participants are 174 students in higher…

  8. An Analysis of Learning Objectives and Content Coverage in Introductory Psychology Syllabi

    Science.gov (United States)

    Homa, Natalie; Hackathorn, Jana; Brown, Carrie M.; Garczynski, Amy; Solomon, Erin D.; Tennial, Rachel; Sanborn, Ursula A.; Gurung, Regan A. R.

    2013-01-01

    Introductory psychology is one of the most popular undergraduate courses and often serves as the gateway to choosing psychology as an academic major. However, little research has examined the typical structure of introductory psychology courses. The current study examined student learning objectives (SLOs) and course content in introductory…

  9. Peer Learning as a Tool to Strengthen Math Skills in Introductory Chemistry Laboratories

    Science.gov (United States)

    Srougi, Melissa C.; Miller, Heather B.

    2018-01-01

    Math skills vary greatly among students enrolled in introductory chemistry courses. Students with weak math skills (algebra and below) tend to perform poorly in introductory chemistry courses, which is correlated with increased attrition rates. Previous research has shown that retention of main ideas in a peer learning environment is greater when…

  10. Content Trends in Sustainable Business Education: An Analysis of Introductory Courses in the USA

    Science.gov (United States)

    Landrum, Nancy E.; Ohsowski, Brian

    2017-01-01

    Purpose: This study aims to identify the content in introductory business sustainability courses in the USA to determine the most frequently assigned reading material and its sustainability orientation. Design/methodology/approach: In total, 81 introductory sustainable business course syllabi reading lists were analyzed from 51 US colleges and…

  11. Research and Teaching: Reenvisioning the Introductory Science Course as a Cognitive Apprenticeship

    Science.gov (United States)

    Thompson, Meredith M.; Pastorino, Lucia; Lee, Star; Lipton, Paul

    2016-01-01

    Introductory science courses play a critical role in the recruitment and retention of undergraduate science majors. In particular, first-year courses are opportunities to engage students in scientific practices and motivate them to consider scientific careers. We developed an introductory course using a semester-long series of established…

  12. Introductory Chemistry Needs A Revolution. ACS and IUPAC and AAAS and ICUC Should Lead It

    Science.gov (United States)

    Hawkes, Stephen J.

    2005-01-01

    The standard curriculum for introductory chemistry does not reflect the needs of students, is enforced by custom and untenured teachers who deviate from it endanger prospects for tenure. Hence, revision of the introductory curriculum should involve research into actual needs and interests of students and should reflect what modern workers conceive…

  13. Agricultural In-Service Needs of Introductory Level Career and Technical Education Teachers

    Science.gov (United States)

    Christensen, Jolene; Warnick, Brian K.; Spielmaker, Debra; Tarpley, Rudy S.; Straquadine, Gary S.

    2009-01-01

    This study identified and prioritized the agricultural in-service needs of introductory level career and technical education teachers in Utah. The Utah State Board of Education requires that all seventh grade students complete an introductory career and technical education course as their first formal career exploration experience. One component…

  14. Quantifying the Level of Inquiry in a Reformed Introductory Geology Lab Course

    Science.gov (United States)

    Moss, Elizabeth; Cervato, Cinzia

    2016-01-01

    As part of a campus-wide effort to transform introductory science courses to be more engaging and more accurately convey the excitement of discovery in science, the curriculum of an introductory physical geology lab course was redesigned. What had been a series of ''cookbook'' lab activities was transformed into a sequence of activities based on…

  15. Practice (Rather than Graded) Quizzes, with Answers, May Increase Introductory Psychology Exam Performance

    Science.gov (United States)

    Wickline, Virginia B.; Spektor, Valeriya G.

    2011-01-01

    The authors investigated whether practice (or graded) quizzes, with or without provision of correct answers, would be more beneficial for introductory psychology exam performance. In six sections (N = 249) of an introductory psychology class, taught by the same professor, different approaches to quizzes were applied across sections to measure…

  16. Cultural Diversity in Introductory Psychology Textbook Selection: The Case for Historically Black Colleges/Universities (HBCUs)

    Science.gov (United States)

    Whaley, Arthur L.; Clay, William A. L.; Broussard, Dominique

    2017-01-01

    The present study describes a culturally relevant approach to introductory psychology textbook selection for students attending a historically Black college/university (HBCU). The following multistage procedure was used: (1) a survey of HBCU psychology departments was conducted to ascertain how they selected their introductory psychology…

  17. Enhancing the Teaching of Introductory Economics with a Team-Based, Multi-Section Competition

    Science.gov (United States)

    Beaudin, Laura; Berdiev, Aziz N.; Kaminaga, Allison Shwachman; Mirmirani, Sam; Tebaldi, Edinaldo

    2017-01-01

    The authors describe a unique approach to enhancing student learning at the introductory economics level that utilizes a multi-section, team-based competition. The competition is structured to supplement learning throughout the entire introductory course. Student teams are presented with current economic issues, trends, or events, and use economic…

  18. The Development of a Set of Core Communication Competencies for Introductory Communication Courses

    Science.gov (United States)

    Engleberg, Isa N.; Ward, Susan M.; Disbrow, Lynn M.; Katt, James A.; Myers, Scott A.; O'Keefe, Patricia

    2017-01-01

    In most academic disciplines, there is "one" introductory course that presents an overview of the discipline and introduces fundamental, discipline-specific principles and competencies. However, in Communication Studies, the discipline recognizes and offers multiple course options that may serve as the introductory course. This project…

  19. Computer-Tailored Student Support in Introductory Physics.

    Science.gov (United States)

    Huberth, Madeline; Chen, Patricia; Tritz, Jared; McKay, Timothy A

    2015-01-01

    Large introductory courses are at a disadvantage in providing personalized guidance and advice for students during the semester. We introduce E2Coach (an Expert Electronic Coaching system), which allows instructors to personalize their communication with thousands of students. We describe the E2Coach system, the nature of the personalized support it provides, and the features of the students who did (and did not) opt-in to using it during the first three terms of its use in four introductory physics courses at the University of Michigan. Defining a 'better-than-expected' measure of performance, we compare outcomes for students who used E2Coach to those who did not. We found that moderate and high E2Coach usage was associated with improved performance. This performance boost was prominent among high users, who improved by 0.18 letter grades on average when compared to nonusers with similar incoming GPAs. This improvement in performance was comparable across both genders. E2Coach represents one way to use technology to personalize education at scale, contributing to the move towards individualized learning that is becoming more attainable in the 21st century.

  20. Equity investigation of attitudinal shifts in introductory physics

    Directory of Open Access Journals (Sweden)

    Adrienne Traxler

    2015-11-01

    Full Text Available We report on seven years of attitudinal data using the Colorado Learning Attitudes about Science Survey from University Modeling Instruction (UMI sections of introductory physics at Florida International University. University Modeling Instruction is a curricular and pedagogical transformation of introductory university physics that engages students in building and testing conceptual models in an integrated lab and lecture learning environment. This work expands upon previous studies that reported consistently positive attitude shifts in UMI courses; here, we disaggregate the data by gender and ethnicity to look for any disparities in the pattern of favorable shifts. We find that women and students from statistically underrepresented ethnic groups have gains that are comparable to those of men and students from well-represented ethnic groups on this attitudinal measure, and that this result holds even when interaction effects of gender and ethnicity are included. We conclude with suggestions for future work in UMI courses and for attitudinal equity investigations generally. We encourage researchers to expand their scope beyond simple performance gaps when considering equity concerns, and to avoid relying on a single measure to evaluate student success. Finally, we conjecture that students’ social and academic networks are one means by which attitudinal and efficacy beliefs about the course are propagated.

  1. Problem roulette: Studying introductory physics in the cloud

    Science.gov (United States)

    Evrard, August E.; Mills, Michael; Winn, David; Jones, Kathryn; Tritz, Jared; McKay, Timothy A.

    2015-01-01

    We introduce Problem Roulette (PR), a web-based study service at the University of Michigan that offers random-within-topic access to a large library of past exam problems in introductory physics courses. Built on public-private cloud infrastructure, PR served nearly 1000 students during Fall 2012 term, delivering more than 60,000 problem pages. The service complements that of commercial publishing houses by offering problems authored by local professors and by explicitly aligning topics with exam content. We describe the service architecture, including reporting and analytical capabilities, and present an initial evaluation of the impact of its use. Among roughly 500 students studying electromagnetism, we find that the 229 students who worked fifty or more problems over the term outperformed their complement by 0.40 grade points (on a 4.0 scale). This improvement partly reflects a selection bias that academically stronger students used the service more frequently. Adjusting for this selection bias, we find a grade point improvement of 0.22, significantly above the random noise level of 0.04. The simple message to students is that working five or more additional problems per week can lead to a quarter-letter grade improvement in introductory physics. Student comments emphasize the importance of randomness in helping them to synthesize concepts. The PR source code is publicly available.

  2. Equity investigation of attitudinal shifts in introductory physics

    Science.gov (United States)

    Traxler, Adrienne; Brewe, Eric

    2015-12-01

    We report on seven years of attitudinal data using the Colorado Learning Attitudes about Science Survey from University Modeling Instruction (UMI) sections of introductory physics at Florida International University. University Modeling Instruction is a curricular and pedagogical transformation of introductory university physics that engages students in building and testing conceptual models in an integrated lab and lecture learning environment. This work expands upon previous studies that reported consistently positive attitude shifts in UMI courses; here, we disaggregate the data by gender and ethnicity to look for any disparities in the pattern of favorable shifts. We find that women and students from statistically underrepresented ethnic groups have gains that are comparable to those of men and students from well-represented ethnic groups on this attitudinal measure, and that this result holds even when interaction effects of gender and ethnicity are included. We conclude with suggestions for future work in UMI courses and for attitudinal equity investigations generally. We encourage researchers to expand their scope beyond simple performance gaps when considering equity concerns, and to avoid relying on a single measure to evaluate student success. Finally, we conjecture that students' social and academic networks are one means by which attitudinal and efficacy beliefs about the course are propagated.

  3. Computer-Tailored Student Support in Introductory Physics

    Science.gov (United States)

    Huberth, Madeline; Chen, Patricia; Tritz, Jared; McKay, Timothy A.

    2015-01-01

    Large introductory courses are at a disadvantage in providing personalized guidance and advice for students during the semester. We introduce E2Coach (an Expert Electronic Coaching system), which allows instructors to personalize their communication with thousands of students. We describe the E2Coach system, the nature of the personalized support it provides, and the features of the students who did (and did not) opt-in to using it during the first three terms of its use in four introductory physics courses at the University of Michigan. Defining a ‘better-than-expected’ measure of performance, we compare outcomes for students who used E2Coach to those who did not. We found that moderate and high E2Coach usage was associated with improved performance. This performance boost was prominent among high users, who improved by 0.18 letter grades on average when compared to nonusers with similar incoming GPAs. This improvement in performance was comparable across both genders. E2Coach represents one way to use technology to personalize education at scale, contributing to the move towards individualized learning that is becoming more attainable in the 21st century. PMID:26352403

  4. Students' Studying and Approaches to Learning in Introductory Biology

    Science.gov (United States)

    2004-01-01

    This exploratory study was conducted in an introductory biology course to determine 1) how students used the large lecture environment to create their own learning tasks during studying and 2) whether meaningful learning resulted from the students' efforts. Academic task research from the K–12 education literature and student approaches to learning research from the postsecondary education literature provided the theoretical framework for the mixed methods study. The subject topic was cell division. Findings showed that students 1) valued lectures to develop what they believed to be their own understanding of the topic; 2) deliberately created and engaged in learning tasks for themselves only in preparation for the unit exam; 3) used course resources, cognitive operations, and study strategies that were compatible with surface and strategic, rather than deep, approaches to learning; 4) successfully demonstrated competence in answering familiar test questions aligned with their surface and strategic approaches to studying and learning; and 5) demonstrated limited meaningful understanding of the significance of cell division processes. Implications for introductory biology education are discussed. PMID:15592598

  5. Computer-Tailored Student Support in Introductory Physics.

    Directory of Open Access Journals (Sweden)

    Madeline Huberth

    Full Text Available Large introductory courses are at a disadvantage in providing personalized guidance and advice for students during the semester. We introduce E2Coach (an Expert Electronic Coaching system, which allows instructors to personalize their communication with thousands of students. We describe the E2Coach system, the nature of the personalized support it provides, and the features of the students who did (and did not opt-in to using it during the first three terms of its use in four introductory physics courses at the University of Michigan. Defining a 'better-than-expected' measure of performance, we compare outcomes for students who used E2Coach to those who did not. We found that moderate and high E2Coach usage was associated with improved performance. This performance boost was prominent among high users, who improved by 0.18 letter grades on average when compared to nonusers with similar incoming GPAs. This improvement in performance was comparable across both genders. E2Coach represents one way to use technology to personalize education at scale, contributing to the move towards individualized learning that is becoming more attainable in the 21st century.

  6. Mississippi Curriculum Framework for Welding and Cutting Programs (Program CIP: 48.0508--Welder/Welding Technologist). Postsecondary Programs.

    Science.gov (United States)

    Mississippi Research and Curriculum Unit for Vocational and Technical Education, State College.

    This document, which is intended for use by community and junior colleges throughout Mississippi, contains curriculum frameworks for the course sequences in the welding and cutting programs cluster. Presented in the introductory section are a description of the program and suggested course sequence. Section I lists baseline competencies, and…

  7. Towards a model of educational transformation: Documenting the changing educational practices of professors, institutions, and students in introductory physics

    Science.gov (United States)

    Turpen, Chandra Anne

    While research-based curricula and instructional strategies in introductory physics are becoming more widespread, how these strategies are implemented by educators is less well understood. Understanding classroom implementation of these strategies is further complicated by the fact that they are being used beyond the institutions at which they were developed. This thesis examines how educational innovations are taken up, take root, and transform educational practice. Data is analyzed from two case studies in educational change at the University of Colorado: the use of Peer Instruction (PI) and the use of the Tutorials in Introductory Physics. Our research studies on PI establish that (1) professors' actual practices involving the use of PI differ strikingly, thus exposing students to different scientific practices, (2) variations in classroom practices create different classroom norms, and (3) students perceive PI classrooms differently in ways that are associated with corresponding PI implementation. Investigations into the use of the Tutorials in Introductory Physics (Tutorials) reveal that focusing purely on individual faculty members' experiences does not fully capture the complexity of the change processes associated with Tutorials adoption. Although individual faculty members play important roles in the adoption and institutionalization process, other changes occur simultaneously throughout the educational system (i.e. shifts in internal and external funding, as well as expanding partnerships between the physics department, other STEM departments, the School of Education, and other university programs). By examining faculty within the situations that they work, we have found that structural changes in how institutions operate are coupled with changes in how individual faculty members' teach their courses. These findings call into question the common assumption of dissemination approaches that focus solely on individual faculty members' adoption and individual

  8. Students Working for Students on Programming Courses

    Science.gov (United States)

    Kalles, Dimitrios

    2008-01-01

    In this paper we offer a report on a university-level programming laboratory course that has been designed on top of a programming library. The course enforces soft skills, such as code inspection and team working, sharpens implementation skills and creates a bridge between introductory, language-specific instruction and senior-year full-blown…

  9. Understanding and affecting science teacher candidates' scientific reasoning in introductory astrophysics

    Science.gov (United States)

    Steinberg, Richard; Cormier, Sebastien

    2013-12-01

    This study reports on a content course for science immersion teacher candidates that emphasized authentic practice of science and thinking scientifically in the context of introductory astrophysics. We explore how 122 science teacher candidates spanning three cohorts did and did not reason scientifically and how this evolved in our program. Our primary method of exploring teacher candidate reasoning is through analysis of responses to an apparently simple multiple-choice question. The question asks for the relative motion between the Sun and Earth and then for a scientific argument supporting the response. To explore these participants’ reasoning and its potential impact on classroom practice, we also describe qualitative observations of how the teacher candidates were reasoning while participating in a science course, participant evaluations, and long-term follow-up with select program graduates after they had taught science in middle or high school. Our results suggest that participant ability to reason scientifically improved significantly and that this can impact classroom practice in a positive way.

  10. Using multiple-possibility physics problems in introductory physics courses

    Science.gov (United States)

    Shekoyan, Vazgen

    I have explored the instructional value of using multiple-possibility problems (MPPs) in introductory physics courses. MPPs are different from problems we most often encounter in textbooks. They are different from regular problems since (1) they have missing information, vaguely defined goals or unstated constrains, (2) they possess multiple solutions with multiple criteria for evaluating the solutions, (3) they present uncertainty about which concepts, rules, and principles are necessary for the solution or how they are organized. Real-life problems and professional problems are MPPs. Students rarely encounter such problems in introductory physics courses. Kitchener (1983) proposed a three-level model of cognitive processing to categorize the thinking steps one makes when faced with such problems (cognition, metacognition, epistemic cognition). The critical and distinctive component of MPP solving is epistemic cognition. At that level individuals reflect on the limits of knowing, the certainty of knowing, the underlying assumptions made. It is an important part of thinking in real life. Firstly, I developed and tested a coding scheme for measuring epistemic cognition. Using the coding scheme I compared the epistemic cognition level of experts and novices by conducting think-aloud problem-solving interviews with them. Although experts had higher epistemic cognition level than novices, I documented some instances where a novice showed an expert-like epistemic cognition. I found that prompting question during interviews were 50% effective for students. Secondly, I tested the following two hypotheses by conducting two experimental design and one pre-post treatment design investigations in an algebra-based physics course at Rutgers University: Hypothesis 1: Solving MPPs enhances students' epistemic cognition; Hypothesis 2: Solving MPPs engages students in more meaningful problem solving and thus helps them construct a better conceptual understanding of physics. I found

  11. Development and evaluation of clicker methodology for introductory physics courses

    Science.gov (United States)

    Lee, Albert H.

    Many educators understand that lectures are cost effective but not learning efficient, so continue to search for ways to increase active student participation in this traditionally passive learning environment. In-class polling systems, or "clickers", are inexpensive and reliable tools allowing students to actively participate in lectures by answering multiple-choice questions. Students assess their learning in real time by observing instant polling summaries displayed in front of them. This in turn motivates additional discussions which increase the opportunity for active learning. We wanted to develop a comprehensive clicker methodology that creates an active lecture environment for a broad spectrum of students taking introductory physics courses. We wanted our methodology to incorporate many findings of contemporary learning science. It is recognized that learning requires active construction; students need to be actively involved in their own learning process. Learning also depends on preexisting knowledge; students construct new knowledge and understandings based on what they already know and believe. Learning is context dependent; students who have learned to apply a concept in one context may not be able to recognize and apply the same concept in a different context, even when both contexts are considered to be isomorphic by experts. On this basis, we developed question sequences, each involving the same concept but having different contexts. Answer choices are designed to address students preexisting knowledge. These sequences are used with the clickers to promote active discussions and multiple assessments. We have created, validated, and evaluated sequences sufficient in number to populate all of introductory physics courses. Our research has found that using clickers with our question sequences significantly improved student conceptual understanding. Our research has also found how to best measure student conceptual gain using research-based instruments

  12. Reflection on problem solving in introductory and advanced physics

    Science.gov (United States)

    Mason, Andrew J.

    Reflection is essential in order to learn from problem solving. This thesis explores issues related to how reflective students are and how we can improve their capacity for reflection on problem solving. We investigate how students naturally reflect in their physics courses about problem solving and evaluate strategies that may teach them reflection as an integral component of problem-solving. Problem categorization based upon similarity of solution is a strategy to help them reflect about the deep features of the problems related to the physics principles involved. We find that there is a large overlap between the introductory and graduate students in their ability to categorize. Moreover, introductory students in the calculus-based courses performed better categorization than those in the algebra-based courses even though the categorization task is conceptual. Other investigations involved exploring if reflection could be taught as a skill on individual and group levels. Explicit self-diagnosis in recitation investigated how effectively students could diagnose their own errors on difficult problems, how much scaffolding was necessary for this purpose, and how effective transfer was to other problems employing similar principles. Difficulty in applying physical principles and difference between the self-diagnosed and transfer problems affected performance. We concluded that a sustained intervention is required to learn effective problem-solving strategies. Another study involving reflection on problem solving with peers suggests that those who reflected with peers drew more diagrams and had a larger gain from the midterm to final exam. Another study in quantum mechanics involved giving common problems in midterm and final exams and suggested that advanced students do not automatically reflect on their mistakes. Interviews revealed that even advanced students often focus mostly on exams rather than learning and building a robust knowledge structure. A survey was

  13. Mississippi Curriculum Framework for Horticulture Technology Cluster (Program CIP: 01.0601--Horticulture Serv. Op. & Mgmt., Gen.) (Program CIP: 01.0605--Landscaping Op. & Mgmt.). Postsecondary Programs.

    Science.gov (United States)

    Mississippi Research and Curriculum Unit for Vocational and Technical Education, State College.

    This document, which is intended for use by community and junior colleges throughout Mississippi, contains curriculum frameworks for the course sequences in the horticulture technology programs cluster. Presented in the introductory section are a framework of programs and courses, description of the programs, and suggested course sequences for…

  14. Characterization of the Vibrio fischeri Fatty Acid Chemoreceptors, VfcB and VfcB2.

    Science.gov (United States)

    Nikolakakis, K; Monfils, K; Moriano-Gutierrez, S; Brennan, C A; Ruby, E G

    2015-11-13

    Bacteria use a wide variety of methyl-accepting chemotaxis proteins (MCPs) to mediate their attraction to or repulsion from different chemical signals in their environment. The bioluminescent marine bacterium Vibrio fischeri is the monospecific symbiont of the Hawaiian bobtail squid, Euprymna scolopes, and encodes a large repertoire of MCPs that are hypothesized to be used during different parts of its complex, multistage lifestyle. Here, we report the initial characterization of two such MCPs from V. fischeri that are responsible for mediating migration toward short- and medium-chain aliphatic (or fatty) acids. These receptors appear to be distributed among only members of the family Vibrionaceae and are likely descended from a receptor that has been lost by the majority of the members of this family. While chemotaxis greatly enhances the efficiency of host colonization by V. fischeri, fatty acids do not appear to be used as a chemical cue during this stage of the symbiosis. This study presents an example of straight-chain fatty acid chemoattraction and contributes to the growing body of characterized MCP-ligand interactions. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Reinforcing cultural competency concepts during introductory pharmacy practice experiences.

    Science.gov (United States)

    Vyas, Deepti; Caligiuri, Frank J

    2010-09-10

    To incorporate cultural competency concepts into various introductory pharmacy practice experiences (IPPE) at the University of Missouri - Kansas City, School of Pharmacy. A 6-week series, titled "Becoming a Culturally Competent Provider" was developed to provide IPPE students with the opportunity to apply theory regarding cultural competency in a clinical context. Pre- and post-intervention attitude survey instruments were administered to 25 students in the spring semester of 2009. Several activities within the series were associated with reflection exercises. Student presentations were evaluated and formal feedback was provided by faculty members. A course evaluation was administered to evaluate the series and determine areas of improvement. A special series on cultural competency resulted in positive changes in students' attitudes, highlighting the importance of reinforcing cultural competency concepts during IPPEs.

  16. Fuzzy logic an introductory course for engineering students

    CERN Document Server

    Trillas, Enric

    2015-01-01

      This book introduces readers to fundamental concepts in fuzzy logic. It describes the necessary theoretical background and a number of basic mathematical models. Moreover, it makes them familiar with fuzzy control, an important topic in the engineering field. The book offers an unconventional introductory textbook on fuzzy logic, presenting theory together with examples and not always following the typical mathematical style of theorem-corollaries. Primarily intended to support engineers during their university studies, and to spark their curiosity about fuzzy logic and its applications, the book is also suitable for self-study, providing a valuable resource for engineers and professionals who deal with imprecision and non-random uncertainty in real-world applications.  

  17. Promoting Metacognition in Introductory Calculus-based Physics Labs

    Science.gov (United States)

    Grennell, Drew; Boudreaux, Andrew

    2010-10-01

    In the Western Washington University physics department, a project is underway to develop research-based laboratory curriculum for the introductory calculus-based course. Instructional goals not only include supporting students' conceptual understanding and reasoning ability, but also providing students with opportunities to engage in metacognition. For the latter, our approach has been to scaffold reflective thinking with guided questions. Specific instructional strategies include analysis of alternate reasoning presented in fictitious dialogues and comparison of students' initial ideas with their lab group's final, consensus understanding. Assessment of student metacognition includes pre- and post- course data from selected questions on the CLASS survey, analysis of written lab worksheets, and student opinion surveys. CLASS results are similar to a traditional physics course and analysis of lab sheets show that students struggle to engage in a metacognitive process. Future directions include video studies, as well as use of additional written assessments adapted from educational psychology.

  18. The Climate Experiences of Students in Introductory Biology

    Directory of Open Access Journals (Sweden)

    Ramón S. Barthelemy

    2015-08-01

    Full Text Available Understanding course climate is important for improving students’ experiences and increasing the likelihood of their persistence in STEM fields. This study presents climate survey results from 523 students taking introductory biology at the University of Michigan. Principal component analysis revealed that a student’s climate experience is comprised of five main elements: comfort, school avoidance, relationship to course, academic stress, and discomfort. Of these climate factors, comfort, school avoidance, and relationship to course were significant predictors of course satisfaction, and academic stress was a significant predictor of persistence. The results indicated the importance of a positive climate that is facilitated by the instructor in order to promote a positive student experience. Climate may be an important metric for institutions to track across time and course.

  19. Measuring Student Effort and Engagement in an Introductory Physics Course

    Science.gov (United States)

    Bonham, Scott

    2007-11-01

    Multiple scales reflecting student effort were developed using factor and scale analysis on data from an introductory physics course. This data included interactions with an on-line homework system. One of the scales displays many characteristics of a metric of the individual level of engagement in the course. This scale is shown to be a good predictor of performance on class exams and the Force Concept Inventory (FCI). Furthermore, normalized learning gains on the FCI are well predicted by this scale while pre-instructional FCI scores provide no additional predictive ability, agreeing with observations by Richard Hake. This scale also correlates strongly with epistemological beliefs that learning is related to effort and is the responsibility of the student. The factors that enter into this scale, writing and mastering expert-like problem-solving, are consistent with this being a measure of individual levels of class engagement.

  20. An analysis of the LIGO discovery based on introductory physics

    Science.gov (United States)

    Mathur, Harsh; Brown, Katherine; Lowenstein, Ashton

    2017-09-01

    By observing gravitational radiation from a binary black hole merger, the LIGO collaboration has simultaneously opened a new window on the universe and achieved the first direct detection of gravitational waves. Here this discovery is analyzed using concepts from introductory physics. Drawing upon Newtonian mechanics, dimensional considerations, and analogies between gravitational and electromagnetic waves, we are able to explain the principal features of LIGO's data and make order of magnitude estimates of key parameters of the event by inspection of the data. Our estimates of the black hole masses, the distance to the event, the initial separation of the pair, and the stupendous total amount of energy radiated are all in good agreement with the best fit values of these parameters obtained by the LIGO-VIRGO collaboration.

  1. Effect of written presentation on performance in introductory physics

    Directory of Open Access Journals (Sweden)

    Shawn Ballard

    2010-10-01

    Full Text Available This study examined the written work of students in the introductory calculus-based electricity and magnetism course at the University of Arkansas. The students’ solutions to hourly exams were divided into a small set of countable features organized into three major categories, mathematics, language, and graphics. Each category was further divided into subfeatures. The total number of features alone explained more than 30% of the variance in exam scores and from 9% to 15% of the variance in conceptual posttest scores. If all features and subfeatures are used, between 44% and 49% of the variance in exam scores is explained and between 22% and 28% of the variance in conceptual posttest scores. The use of language is consistently positively correlated with both exam performance and conceptual understanding.

  2. Patterns of Gendered Performance Difference in Introductory STEM Courses

    CERN Document Server

    Koester, Benjamin P; McKay, Timothy A

    2016-01-01

    Grades provide students with their primary performance feedback: signals which affect academic choices. Variations in grading practice among courses impose grade penalties (and bonuses) on students who take them. These grade penalties are sometimes gendered. Using extensive data from the University of Michigan, we report on patterns of grade penalty and gendered performance difference across 116 large courses. We find that significant gendered performance differences are ubiquitous in large introductory STEM lecture courses. They are largely absent in both STEM labs and in lecture courses in other disciplines. Exploring the features of these courses, we hypothesize that evaluation methods used in STEM lecture courses interact with stereotype threat to create these gendered performance differences.

  3. Successful Application of Active Learning Techniques to Introductory Microbiology

    Directory of Open Access Journals (Sweden)

    Elizabeth A. Hoffman

    2009-12-01

    Full Text Available While the traditional lecture format may be a successful way to teach microbiology to both medical and nursing students, it was not an effective means of learning for many prenursing and preprofessional students enrolled in either of the introductory microbiology courses at Ashland Community College, an open enrollment institution. The structure of both Medical Microbiology and Principles of Microbiology was redesigned to allow students to address the material in an active manner. Daily quizzes, student group discussions, scrapbooks, lab project presentations and papers, and extra credit projects were all added in order to allow students maximum exposure to the course material in a manner compatible with various methods of learning. Student knowledge, course evaluations, and student success rates have all improved with the active learning format.

  4. Introductory Physics Experiments Using the Wii Balance Board

    Science.gov (United States)

    Starr, Julian; Sobczak, Robert; Iqbal, Zohaib; Ochoa, Romulo

    2010-02-01

    The Wii, a video game console by Nintendo, utilizes several different controllers, such as the Wii remote (Wiimote) and the balance board, for game-playing. The balance board was introduced in early 2008. It contains four strain gauges and has Bluetooth connectivity at a relatively low price. Thanks to available open source code, such as GlovePie, any PC with Bluetooth capability can detect the information sent out by the balance board. Based on the ease with which the forces measured by each strain gauge can be obtained, we have designed several experiments for introductory physics courses that make use of this device. We present experiments to measure the forces generated when students lift their arms with and without added weights, distribution of forces on an extended object when weights are repositioned, and other normal forces cases. The results of our experiments are compared with those predicted by Newtonian mechanics. )

  5. Student interpretations of phylogenetic trees in an introductory biology course.

    Science.gov (United States)

    Dees, Jonathan; Momsen, Jennifer L; Niemi, Jarad; Montplaisir, Lisa

    2014-01-01

    Phylogenetic trees are widely used visual representations in the biological sciences and the most important visual representations in evolutionary biology. Therefore, phylogenetic trees have also become an important component of biology education. We sought to characterize reasoning used by introductory biology students in interpreting taxa relatedness on phylogenetic trees, to measure the prevalence of correct taxa-relatedness interpretations, and to determine how student reasoning and correctness change in response to instruction and over time. Counting synapomorphies and nodes between taxa were the most common forms of incorrect reasoning, which presents a pedagogical dilemma concerning labeled synapomorphies on phylogenetic trees. Students also independently generated an alternative form of correct reasoning using monophyletic groups, the use of which decreased in popularity over time. Approximately half of all students were able to correctly interpret taxa relatedness on phylogenetic trees, and many memorized correct reasoning without understanding its application. Broad initial instruction that allowed students to generate inferences on their own contributed very little to phylogenetic tree understanding, while targeted instruction on evolutionary relationships improved understanding to some extent. Phylogenetic trees, which can directly affect student understanding of evolution, appear to offer introductory biology instructors a formidable pedagogical challenge. © 2014 J. Dees et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  6. Incorporating Geoethics in Introductory Earth System Science Courses

    Science.gov (United States)

    Schmitt, J.

    2014-12-01

    The integrative nature of Earth System Science courses provides extensive opportunities to introduce students to geoethical inquiry focused on globally significant societal issues. Geoscience education has traditionally lagged in its efforts to increase student awareness of the significance of geologic knowledge to understanding and responsibly confronting causes and possible solutions for emergent, newly emerging, and future problems of anthropogenic cause and consequence. Developing an understanding of the human impact on the earth system requires early (lower division) and for geoscience majors, repeated (upper division) curricular emphasis on the interactions of the lithosphere, hydrosphere, atmosphere, biosphere, and pedosphere across space and through time. Capturing the interest of university students in globally relevant earth system issues and their ethical dimensions while first learning about the earth system is an important initial step in bringing geoethical deliberation and awareness to the next generation of geoscientists. Development of a new introductory Earth System Science course replacing a traditional introductory Physical Geology course at Montana State University has involved abandonment of concept-based content organization in favor of a place-based approach incorporating examination of the complex interactions of earth system components and emergent issues and dilemmas deriving from the unique component interactions that characterize each locale. Thirteen different place-based week-long modules (using web- and classroom-based instruction) were developed to ensure cumulative broad coverage across the earth geographically and earth system components conceptually. Each place-based instructional module contains content of societal relevance requiring synthesis, critical evaluation, and reflection by students. Examples include making linkages between deforestation driven by economics and increased seismicity in Haiti, agriculture and development

  7. Mental Models and Programming Aptitude

    DEFF Research Database (Denmark)

    Caspersen, Michael Edelgaard; Bennedsen, Jens; Larsen, Kasper Dalgaard

    2007-01-01

    Predicting the success of students participating in introductory programming courses has been an active research area for more than 25 years. Until recently, no variables or tests have had any significant predictive power. However, Dehnadi and Bornat claim to have found a simple test for programm......Predicting the success of students participating in introductory programming courses has been an active research area for more than 25 years. Until recently, no variables or tests have had any significant predictive power. However, Dehnadi and Bornat claim to have found a simple test...... for programming aptitude to cleanly separate programming sheep from non-programming goats. We briefly present their theory and test instrument. We have repeated their test in our local context in order to verify and perhaps generalise their findings, but we could not show that the test predicts students' success...... in our introductory program-ming course. Based on this failure of the test instrument, we discuss various explanations for our differing results and suggest a research method from which it may be possible to generalise local results in this area. Furthermore, we discuss and criticize Dehnadi and Bornat...

  8. Motivating Programming: Using Storytelling to Make Computer Programming Attractive to Middle School Girls

    Science.gov (United States)

    2006-11-01

    In Generic Alice, there are two common default Chapter 5: Developing the Storytelling Gallery 114 positions for characters and, consequently , two...balance or generating the nth Fibonacci number. Often, students write programs in introductory computer science using professional programming...handle without fundamentally changing the common control structures found in general -purpose languages. Consequently , when a student moves from one of

  9. Helping Students Test Programs That Have Graphical User Interfaces

    Directory of Open Access Journals (Sweden)

    Matthew Thornton

    2008-08-01

    Full Text Available Within computer science education, many educators are incorporating software testing activities into regular programming assignments. Tools like JUnit and its relatives make software testing tasks much easier, bringing them into the realm of even introductory students. At the same time, many introductory programming courses are now including graphical interfaces as part of student assignments to improve student interest and engagement. Unfortunately, writing software tests for programs that have significant graphical user interfaces is beyond the skills of typical students (and many educators. This paper presents initial work at combining educationally oriented and open-source tools to create an infrastructure for writing tests for Java programs that have graphical user interfaces. Critically, these tools are intended to be appropriate for introductory (CS1/CS2 student use, and to dovetail with current teaching approaches that incorporate software testing in programming assignments. We also include in our findings our proposed approach to evaluating our techniques.

  10. Teaching Programming to Liberal Arts Students

    DEFF Research Database (Denmark)

    Andersen, Peter Bøgh; Bennedsen, Jens; Brandorff, Steffen

    2003-01-01

    In this paper we present a new learning environment to be used in an introductory programming course for studentsthat are non-majors in computer science, more precisely formultimedia students with a liberal arts background. Media-oriented programming adds new requirements to thecraft of programming...... (e.g. aesthetic and communicative).We argue that multimedia students with a liberal arts background need programming competences because programmability is the defining characteristic of the computer medium.We compare programming with the creation of traditionalmedia products and identify two...... environment for an introductory programmingcourse for multimedia students.We have designed a learning environment called Lingoland with the new skills of media programming in mind thathopefully can help alleviate the problems we have experiencedin teaching programming to liberal arts students....

  11. Creation and Assessment of an Active e-Learning Introductory Geology Course

    Science.gov (United States)

    Sit, Stefany M.; Brudzinski, Michael R.

    2017-12-01

    The recent emphasis in higher education on both student engagement and online learning encouraged the authors to develop an active e-learning environment for an introductory geohazards course, which enrolls 70+ undergraduate students per semester. Instructors focused on replicating the achievements and addressing the challenges within an already established face-to-face student-centered class (Brudzinski and Sikorski 2010; Sit 2013). Through the use of a learning management system (LMS) and other available technologies, a wide range of course components were developed including online homework assignments with automatic grading and tailored feedback, video tutorials of software programs like Google Earth and Microsoft Excel, and more realistic scientific investigations using authentic and freely available data downloaded from the internet. The different course components designed to engage students and improve overall student learning and development were evaluated using student surveys and instructor reflection. Each component can be used independently and intertwined into a face-to-face course. Results suggest that significant opportunities are available in an online environment including the potential for improved student performance and new datasets for educational research. Specifically, results from pre and post-semester Geoscience Concept Inventory (GCI) testing in an active e-learning course show enhanced student learning gains compared to face-to-face lecture-based and student-centered courses.

  12. Creation and Assessment of an Active e-Learning Introductory Geology Course

    Science.gov (United States)

    Sit, Stefany M.; Brudzinski, Michael R.

    2017-08-01

    The recent emphasis in higher education on both student engagement and online learning encouraged the authors to develop an active e-learning environment for an introductory geohazards course, which enrolls 70+ undergraduate students per semester. Instructors focused on replicating the achievements and addressing the challenges within an already established face-to-face student-centered class (Brudzinski and Sikorski 2010; Sit 2013). Through the use of a learning management system (LMS) and other available technologies, a wide range of course components were developed including online homework assignments with automatic grading and tailored feedback, video tutorials of software programs like Google Earth and Microsoft Excel, and more realistic scientific investigations using authentic and freely available data downloaded from the internet. The different course components designed to engage students and improve overall student learning and development were evaluated using student surveys and instructor reflection. Each component can be used independently and intertwined into a face-to-face course. Results suggest that significant opportunities are available in an online environment including the potential for improved student performance and new datasets for educational research. Specifically, results from pre and post-semester Geoscience Concept Inventory (GCI) testing in an active e-learning course show enhanced student learning gains compared to face-to-face lecture-based and student-centered courses.

  13. A Sequence of Introductory Pharmacy Practice Experiences to Address the New Standards for Experiential Learning

    Science.gov (United States)

    Luer, Mark S.

    2008-01-01

    Objective To implement an introductory pharmacy practice experience (IPPE) curricular sequence in a manner that optimized preceptor availability, fostered significant learning, and addressed the new standards for experiential education. Design A 4-course, 300+ hour IPPE sequence was developed with 1 module in each semester of the first 2 professional years. Semesters were 18 weeks in length with IPPE taking place in the middle weeks as dedicated time blocks when no concurrent didactic courses were scheduled. Learning exercises were developed to build a progressive foundation in preparation for advanced pharmacy practice experiences (APPE). Assessment During 2 academic years, 161 students participated in the IPPE program. Eighty-one students completed the 4-course sequence and another 80 students completed the first 2 courses. Collectively, 486 individual IPPE placements were made at over 120 community pharmacies and 60 hospital pharmacies or alternative practice sites located over a broad geographic region. Student evaluations by preceptors, evaluation of student journals by faculty, and surveys of students and preceptors demonstrated that course objectives were being achieved. Conclusion An innovative approach to scheduling IPPE optimized preceptor availability, exceeded the minimum number of IPPE hours required by current accreditation standards, and achieved development of desired competencies. PMID:19002273

  14. Interprofessional education day - an evaluation of an introductory experience for first-year students.

    Science.gov (United States)

    Singer, Zachary; Fung, Kevin; Lillie, Elaine; McLeod, Jennifer; Scott, Grace; You, Peng; Helleman, Krista

    2018-02-09

    Interprofessional health care teams have been shown to improve patient safety and reduce medical errors, among other benefits. Introducing interprofessional concepts to students in full day events is an established model that allows students to learn together. Our group developed an academic day for first-year students devoted to an introductory interprofessional education (IPE) experience, 'IPE Day'. In total, 438 students representing medicine, dentistry, pharmacy and optometry gathered together, along with 25 facilitators, for IPE Day. Following the day's program, students completed the evaluation consisting of the Interprofessional Collaborative Competencies Attainment Survey and open-ended questions. Narrative responses were analyzed for content and coded using the Canadian Interprofessional Health Collaborative competency domains. Three hundred and eight evaluations were completed. Students reported increased self-ratings of competency across all 20 items (p < 0.05). Their comments were organized into the six domains: interprofessional communication, collaborative leadership, role clarification, patient-centred care, conflict resolution, and team functioning. Based on these findings, we suggest that this IPE activity may be useful for improving learner perceptions about their interprofessional collaborative practice competence.

  15. Off to the (Earthworm) Races: A Quick and Flexible Lab Experiment for Introductory Zoology Courses.

    Science.gov (United States)

    Switzer, Paul V.; Fritz, Ann H.

    2001-01-01

    Presents a hands-on, investigative lab activity for use in an introductory zoology course. Tests the behavioral hypothesis that substrate texture affects earthworm locomotor ability. Provides background information on earthworm locomotion followed by details of the lab exercise. (NB)

  16. Demonstrating Classical Conditioning in Introductory Psychology: Needles Do Not Always Make Balloons Pop!

    Science.gov (United States)

    Vernoy, Mark W.

    1987-01-01

    Describes a method of teaching classical conditioning to an introductory psychology class which involves demonstrating the conditioned response that occurs when a needle pierces, but does not pop, a balloon. (GEA)

  17. A Quantitative Professionalism Policy in a Community Pharmacy Introductory Pharmacy Practice Experience

    OpenAIRE

    Shtaynberg, Jane; Rivkin, Anastasia; Shah, Bupendra; Rush, Sharon

    2013-01-01

    Objective. To determine whether implementing a quantitative professionalism policy would lead to improved behaviors in an introductory pharmacy practice experience (IPPE) and to evaluate students’ attitudes about professionalism expectations in the IPPE.

  18. The joy of stats a short guide to introductory statistics in the social sciences

    CERN Document Server

    Garner, Roberta

    2010-01-01

    "This is a great book for social science students. Clearly written, with many examples, Garner certainly makes learning and teaching introductory statistics a joy!" - Nikolaos Liodakis, Wilfrid Laurier University.

  19. An Evaluation of Lectures in a Computer-Based, PSI Introductory Psychology Course.

    Science.gov (United States)

    Brothen, Thomas; Wambach, Cathrine

    1999-01-01

    Describes an evaluation of lectures in a computer-based, personalized system of instruction (PSI) introductory psychology class. Results question the effectiveness of lectures, based on students instructor evaluations, student characteristics, personality test scores, and academic performance. (Author/LRW)

  20. Introductory labs; what they don't, should, and can teach (and why)

    Science.gov (United States)

    Wieman, Carl

    2016-03-01

    Introductory physics labs are widely used and expensive. They have a wide variety of potential learning goals, but these are seldom specified and less often measured if they are achieved. We cover three different research projects on introductory labs: 1) We have done cognitive task analyses of both experimental research in physics and instructional labs. The striking differences explain much of the unhappiness expressed by students with labs: 2) We have measured the effectiveness of two introductory physics lab courses specifically intended to teach the physics content covered in standard introductory courses on mechanics and E & M. As measured by course exams, the benefit is 0 +/-2% for both. 3) We show how it is possible to use lab courses to teach students to correctly evaluate physical models with uncertain data. Such quantitative critical thinking is an important skill that is not learned in typical lab courses, but is well learned by our modified lab instruction.

  1. O ProUni e a conclusão do ensino superior: questões introdutórias sobre os egressos do programa na zona oeste do Rio de Janeiro El ProUni (Programa de Ayuda Universitario brasileño y la conclusión del curso superior: planteos introductorios sobre los egresados del programa en la zona oeste de Río de Janeiro PROUNI (University for All Program and the conclusion of higher education: introductory questions about the students leaving the program in the west zone of Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Daniela Patti do Amaral

    2011-03-01

    becarios del ProUni de 81% (ingresaron en 2005 y de 75% (ingresaron en 2006.The analysis and evaluation of policies implemented by a government involve factors of different natures, especially when it focuses on social inclusion policies in higher education. With the objective of analyzing the program University for All - ProUni, we started the research ProUni and access to higher education: introductory study on users of the program in the western city of Rio de Janeiro. ProUni aims at evaluating the impacts of public policy in education, focusing on the inclusion of populations with lower chances of access to higher education, in private higher education institutions through scholarships. This paper presents the initial data collected in a higher education institution in Campo Grande, west of Rio de Janeiro, pointing to a dropout rate similar to the national average. That leads us to infer the effectiveness of ProUni and the educational success of individuals benefited by the Program.

  2. Gender, experience, and self-efficacy in introductory physics

    Science.gov (United States)

    Nissen, Jayson M.; Shemwell, Jonathan T.

    2016-12-01

    [This paper is part of the Focused Collection on Gender in Physics.] There is growing evidence of persistent gender achievement gaps in university physics instruction, not only for learning physics content, but also for developing productive attitudes and beliefs about learning physics. These gaps occur in both traditional and interactive-engagement (IE) styles of physics instruction. We investigated one gender gap in the area of attitudes and beliefs. This was men's and women's physics self-efficacy, which comprises students' thoughts and feelings about their capabilities to succeed as learners in physics. According to extant research using pre- and post-course surveys, the self-efficacy of both men and women tends to be reduced after taking traditional and IE physics courses. Moreover, self-efficacy is reduced further for women than for men. However, it remains unclear from these studies whether this gender difference is caused by physics instruction. It may be, for instance, that the greater reduction of women's self-efficacy in physics merely reflects a broader trend in university education that has little to do with physics per se. We investigated this and other alternative causes, using an in-the-moment measurement technique called the Experience Sampling Method (ESM). We used ESM to collect multiple samples of university students' feelings of self-efficacy during four types of activity for two one-week periods: (i) an introductory IE physics course, (ii) students' other introductory STEM courses, (iii) their non-STEM courses, and (iv) their activities outside of school. We found that women experienced the IE physics course with lower self-efficacy than men, but for the other three activity types, women's self-efficacy was not reliably different from men's. We therefore concluded that the experience of physics instruction in the IE physics course depressed women's self-efficacy. Using complementary measures showing the IE physics course to be similar to

  3. A collaborative learning approach for service-oriented introductory physics

    Science.gov (United States)

    Smith, Michael R.

    1997-03-01

    I have taught algebra-based introductory physics for six years to liberal arts students. It was primarily a service course for students majoring in Athletic Training, Physical Therapy, Geology, Biology, and Pre-Med. The typical student was characterized by having a minimal math and problem-solving proficiency. There also was a pattern of students being predisposed to memorizing facts and formulas, and attempting to solve problems by finding the correct formula and "plugging in" numbers to get an answer. The students seemed to have a minimal ability in deductive reasoning and problem solving, starting from basic principles. It is no wonder that they entered the introductory physics service course with extreme trepidation, based upon a strongly perceived physics phobia. A standard lecture format was used for the class size of approximately 25-30 students; and an attempt was always made to engage the students through the Socratic approach, by asking leading questions during the course of the lecture. The students were relatively unprepared and couldn't participate in the class, and often responded antagonistically. They indicated they didn't want to be asked to think about an issue, but would rather just be told the facts so they could take specific notes for subsequent memorization. It was clear from the results of the open book exams given during the semester that the majority of students could not approach problem solving using deductive reasoning based on basic principles, but relied on attempting to force-fit the problem into a worked example in the text (often out of context, with illogical results). The absentee rate in the classroom was usually around 30-40%. The academic administration of my liberal arts university has the policy of formal course evaluations by the students at the end of each semester. The evaluation questionnaire appears to be primarily a measurement of the stress level of the student during the course, and the evaluation score I received

  4. Gender, experience, and self-efficacy in introductory physics

    Directory of Open Access Journals (Sweden)

    Jayson M. Nissen

    2016-08-01

    Full Text Available [This paper is part of the Focused Collection on Gender in Physics.] There is growing evidence of persistent gender achievement gaps in university physics instruction, not only for learning physics content, but also for developing productive attitudes and beliefs about learning physics. These gaps occur in both traditional and interactive-engagement (IE styles of physics instruction. We investigated one gender gap in the area of attitudes and beliefs. This was men’s and women’s physics self-efficacy, which comprises students’ thoughts and feelings about their capabilities to succeed as learners in physics. According to extant research using pre- and post-course surveys, the self-efficacy of both men and women tends to be reduced after taking traditional and IE physics courses. Moreover, self-efficacy is reduced further for women than for men. However, it remains unclear from these studies whether this gender difference is caused by physics instruction. It may be, for instance, that the greater reduction of women’s self-efficacy in physics merely reflects a broader trend in university education that has little to do with physics per se. We investigated this and other alternative causes, using an in-the-moment measurement technique called the Experience Sampling Method (ESM. We used ESM to collect multiple samples of university students’ feelings of self-efficacy during four types of activity for two one-week periods: (i an introductory IE physics course, (ii students’ other introductory STEM courses, (iii their non-STEM courses, and (iv their activities outside of school. We found that women experienced the IE physics course with lower self-efficacy than men, but for the other three activity types, women’s self-efficacy was not reliably different from men’s. We therefore concluded that the experience of physics instruction in the IE physics course depressed women’s self-efficacy. Using complementary measures showing the IE

  5. Implementing Inclusive Design for Learning in an introductory geology laboratory

    Science.gov (United States)

    Robert, G.; Merriman, J. D.; Ceylan, G. M.

    2013-12-01

    As an expansion of universal design for learning, IDL provides a framework for opening up and adapting classroom interaction systems, minimizing barriers through promoting perception, engagement, expression, and accommodation for diverse learners. We implemented an introductory-level laboratory for communicating the concept of magma viscosity using the guidelines and principles of IDL. We developed the lab as a mini-implementation project for an IDL course offered by the University of Missouri (MU) Graduate School. The laboratory was subsequently taught during the summer session of Principles of Geology in our Department of Geological Sciences. Traditional geology laboratories rely heavily on visual aids, either physical (rocks and minerals) or representative (idealized cartoons of processes, videos), with very few alternative representations and descriptions made available to the students. Our main focus for this new lab was to diversify the means of representation available to the students (and instructor) to make the lab as equitable and flexible as possible. We considered potential barriers to learning arising from the physical lab environment, from the means of representation, engagement and expression, and tried to minimize them upfront. We centred the laboratory on the link between volcano shape and viscosity as an applied way to convey that viscosity is the resistance to flow. The learning goal was to have the students observe that more viscous eruptives resulted in steeper-sided volcanoes through experimentation. Students built their own volcanoes by erupting lava (foods of various viscosities) onto the Earth's surface (a piece of sturdy cardboard with a hole for the 'vent') through a conduit (pastry bag). Such a hands on lab exercise allows students to gain a tactile and visual, i.e., physical representation of an abstract concept. This specific exercise was supported by other, more traditional, means of representation (e.g., lecture, videos, cartoons, 3D

  6. Workforce, subject of law and education: introductory notes

    Directory of Open Access Journals (Sweden)

    Carolina Roig Catini

    2016-06-01

    Full Text Available This article consists of an introductory exposition to the Marxist critique of law that, as we aim to demonstrate, provides relevant conceptual contributions to critical reflection on the specifically capitalistic social relations of education. It is an analysis of the fundamental concepts that circumscribe the social function of massive education in capitalism, under hegemony of the school form: workforce and subject of law. The mercantile social nexus, under the aegis of the blind and automatic movement of capital accumulation foresees not only the generalization of the worker "free" from the means of production, but also the universalization of the law-form, which conceals the economic subordination under the mask of equality between private owners. In the first section we briefly resumed a critical interpretation of the work presented by Karl Marx in Capital, in order to move on to the Marxist critique of law and in the second part, based on Evgène Pachukanis, Walter Benjamin and Bernard Edelman´s studies. Based on this presentation, we extract, by way of conclusion and in a preliminary way, some theoretical consequences for the apprehension of the specifically capitalist way of education. Keywords: Education. Work. Merchandise.

  7. Teaching Science Writing in an Introductory Lab Course

    Science.gov (United States)

    Holstein, Sarah E.; Mickley Steinmetz, Katherine R.; Miles, John D.

    2015-01-01

    One challenge that many neuroscience instructors face is how to teach students to communicate within the field. The goal of this project was to improve students’ scientific writing in an introductory psychology laboratory course that serves as a feeder course into the neuroscience curriculum. This course included a scaffolded approach - breaking assignments into different sections that build upon each other to allow for more direction and feedback on each section. Students were also provided with examples of scientific writing, given direction on finding and reading journal articles, and were taught how to effectively peer review a paper. Research papers were assessed before (Year 1) and after (Year 2) this scaffolded approach was instituted. The assessment included measures of “Genre Knowledge” for each section of a research paper (abstract, introduction, method, results, discussion) as well as measures of “Writing Elements” (grammar, formatting, clarity, transitions, building to the hypothesis, using evidence). The results indicated that there was an improvement for Genre Knowledge scores when comparing Year 1 to Year 2. However, there was no systematic improvement in Writing Elements. This suggests that this teaching technique was most effective in improving students’ ability to write within the scientific genre. The logistics of implementing such an approach are discussed. PMID:25838801

  8. Introducing CFD in Introductory Undergraduate Fluid Mechanics Courses

    Science.gov (United States)

    Cimbala, John M.

    2005-11-01

    Many instructors want to introduce CFD into their introductory junior-level fluid mechanics course, but cannot because it requires several hours of class time at the cost of displacement of other basic material. A simple but effective method is now available that has been used successfully at Penn State since Spring 2005. It requires minimal instructor preparation time and only about one class period. Namely, immediately after solving the Navier-Stokes equation analytically for simple flows such as Couette and Poiseuille flow, CFD is introduced as a modern tool for solving the same equations numerically. The application of CFD (grid generation, boundary conditions, etc.), rather than numerical algorithms, is stressed. Homework problems are then assigned using pre-defined templates for FlowLab, a student-friendly analysis and visualization package created by Fluent, Inc. The templates and exercises are designed to support and emphasize the theory and concepts taught in class and in the textbook. For example, the new textbook by Cengel and Cimbala (McGraw-Hill 2006) contains 46 end-of-chapter homework problems that are used in conjunction with 42 FlowLab templates. Each exercise has been designed with two major learning objectives in mind: (1) enhance student understanding of a specific fluid mechanics concept, and (2) introduce the student to a specific capability and/or limitation of CFD through hands-on practice.

  9. Effectiveness of Tutorials for Introductory Physics in Argentinean high schools

    Science.gov (United States)

    Benegas, J.; Flores, J. Sirur

    2014-06-01

    This longitudinal study reports the results of a replication of Tutorials in Introductory Physics in high schools of a Latin-American country. The main objective of this study was to examine the suitability of Tutorials for local science education reform. Conceptual learning of simple resistive electric circuits was determined by the application of the single-response multiple-choice test "Determining and Interpreting Resistive Electric Circuits Concepts Test" (DIRECT) to high school classes taught with Tutorials and traditional instruction. The study included state and privately run schools of different socioeconomic profiles, without formal laboratory space and equipment, in classes of mixed-gender and female-only students, taught by novice and experienced instructors. Results systematically show that student learning is significantly higher in the Tutorials classes compared with traditional teaching for all of the studied conditions. The results also show that long-term learning (one year after instruction) in the Tutorials classes is highly satisfactory, very similar to the performance of the samples of college students used to develop the test DIRECT. On the contrary, students following traditional instruction returned one year after instruction to the poor performance (students attending seven universities in Spain and four Latin-American countries. Some replication and adaptation problems and difficulties of this experience are noted, as well as recommendations for successful use of Tutorials in high schools of similar educational systems.

  10. Problem Roulette: Studying Introductory Physics in the Cloud

    CERN Document Server

    Evrard, August E; Winn, David; Jones, Kathryn; Tritz, Jared; McKay, Timothy A

    2013-01-01

    Problem Roulette (PR) is a web-based study service at the University of Michigan that offers random-within-topic access to a large library of past exam problems in introductory physics courses. Built on public-private cloud computing infrastructure, PR served nearly 1000 students during Fall 2012 term, delivering more than 60,000 problem pages. The service complements that of commercial publishing houses by offering problems authored by local professors. We describe the service architecture, including reporting and analytical capabilities, and present an initial evaluation of the impact of its use. Among roughly 500 students studying electromagnetism, we find that the 229 students who worked fifty or more problems over the term outperformed their complement by 0.40 grade points (on a 4.0 scale). This improvement partly reflects a selection bias that better students used the service more frequently. Adjusting for this selection bias by using overall grade point average (GPA) as a classifier, we find a grade po...

  11. How different incentives affect homework completion in introductory physics courses

    CERN Document Server

    Kontur, F J

    2013-01-01

    This article quantitatively examines the effects that different incentives have on students' homework completion in introductory physics courses at the United States Air Force Academy. According to our findings, there is a strong linear relationship between the amount of course credit awarded and the amount of homework that students complete. The line fits show that, for the courses that were studied, 3-4% more homework is completed for every additional 1% of course credit awarded to students for completing homework. In addition, we find that there is a strong relationship between students' average perception of the learning benefit of homework and how much homework they complete, and that students completed 15% more homework when their average perception of homework increased by 0.5 points on a 4-point Likert scale. Finally, we find that giving students in-class quizzes that come directly from homework resulted in 15% greater homework completion than giving them in-class quizzes that were only conceptually r...

  12. Active Learning Strategies for Introductory Light and Optics

    Science.gov (United States)

    Sokoloff, David R.

    2016-01-01

    There is considerable evidence that traditional approaches are ineffective in teaching physics concepts, including light and optics concepts. A major focus of the work of the Activity Based Physics Group has been on the development of active learning curricula like RealTime Physics (RTP) labs and Interactive Lecture Demonstrations (ILDs). Among the characteristics of these curricula are: (1) use of a learning cycle in which students are challenged to compare predictions—discussed with their peers in small groups—to observations of the physical world, (2) use of guided hands-on work to construct basic concepts from observations, and (3) use of computer-based tools. It has been possible to change the lecture and laboratory learning environments at a large number of universities, colleges, and high schools without changing the structure of the introductory course. For example, in the United States, nearly 200 physics departments have adopted RTP, and many others use pre-publication, open-source versions or have adopted the RTP approach to develop their own labs. Examples from RTP and ILDs (including optics magic tricks) are described in this paper.

  13. Increased course structure improves performance in introductory biology.

    Science.gov (United States)

    Freeman, Scott; Haak, David; Wenderoth, Mary Pat

    2011-01-01

    We tested the hypothesis that highly structured course designs, which implement reading quizzes and/or extensive in-class active-learning activities and weekly practice exams, can lower failure rates in an introductory biology course for majors, compared with low-structure course designs that are based on lecturing and a few high-risk assessments. We controlled for 1) instructor effects by analyzing data from quarters when the same instructor taught the course, 2) exam equivalence with new assessments called the Weighted Bloom's Index and Predicted Exam Score, and 3) student equivalence using a regression-based Predicted Grade. We also tested the hypothesis that points from reading quizzes, clicker questions, and other "practice" assessments in highly structured courses inflate grades and confound comparisons with low-structure course designs. We found no evidence that points from active-learning exercises inflate grades or reduce the impact of exams on final grades. When we controlled for variation in student ability, failure rates were lower in a moderately structured course design and were dramatically lower in a highly structured course design. This result supports the hypothesis that active-learning exercises can make students more skilled learners and help bridge the gap between poorly prepared students and their better-prepared peers.

  14. Introductory anatomy and physiology in an undergraduate nursing curriculum.

    Science.gov (United States)

    Brown, S J; White, S; Power, N

    2017-03-01

    Using an educational data mining approach, first-year academic achievement of undergraduate nursing students, which included two compulsory courses in introductory human anatomy and physiology, was compared with achievement in a final semester course that transitioned students into the workplace. We hypothesized that students could be grouped according to their first-year academic achievement using a two-step cluster analysis method and that grades achieved in the human anatomy and physiology courses would be strong predictors of overall achievement. One cohort that graduated in 2014 (n = 105) and one that graduated in 2015 (n = 94) were analyzed separately, and for both cohorts, two groups were identified, these being "high achievers" (HIGH) and "low achievers" (LOW). Consistently, the anatomy and physiology courses were the strongest predictors of group assignment, such that a good grade in these was much more likely to put a student into a high-achieving group. Students in the HIGH groups also scored higher in the Transition to Nursing course when compared with students in the LOW groups. The higher predictor importance of the anatomy and physiology courses suggested that if a first-year grade-point average was calculated for students, an increased weighting should be attributed to these courses. Identifying high-achieving students based on first-year academic scores may be a useful method to predict future academic performance. Copyright © 2017 the American Physiological Society.

  15. Situated Self-efficacy in Introductory Physics Students

    Science.gov (United States)

    Henderson, Rachel; DeVore, Seth; Michaluk, Lynnette; Stewart, John

    2017-01-01

    Within the general university environment, students' perceived self-efficacy has been widely studied and findings suggest it plays a role in student success. The current research adapted a self-efficacy survey, from the ``Self-Efficacy for Learning Performance'' subscale of the Motivated Learning Strategies Questionnaire and administered it to the introductory, calculus-based physics classes (N=1005) over the fall 2015 and spring 2016 semesters. This assessment measured students' self-efficacy in domains including the physics class, other science and mathematics classes, and their intended future career. The effect of gender was explored with the only significant gender difference (p gender difference was not explained by a student's performance which was measured by test average. However, a mediation analysis showed that students' overall academic self-efficacy, measured by their math and science self-efficacy, acts as a mediator for the effect of test average on self-efficacy towards the physics class domain. This mediation effect was significant for both female (p < . 01) and male students (p < . 001) however, it was more pronounced for male students.

  16. New Session of introductory “E-Groups Training”

    CERN Multimedia

    2013-01-01

    The session provides a short introduction of E-Groups and how to use it to efficiently manage mailing lists at CERN. Alongside a general overview of the E-Groups application, E-Groups specific terminology, the management of dynamic and static groups and the specific settings for mails and archives are discussed in detail.   The course is intended to give newcomers a clear idea of what E-Groups are and how they can be used at CERN. It should enable users to be more efficient when being confronted in particular with: the creation of dynamic and static E-groups and the decision whether the one or the other type is more appropriate, the management of E-group memberships, and the setting of mailing/archiving related properties. The session will also focus on some best practices and give general advice on how to use E-Groups. This introductory training session is given jointly by members of the IT-OIS and GS-AIS groups and is intended for any member at CERN potentially being confronted with the ...

  17. Introductory Astronomy as a Measure of Grade Inflation

    CERN Document Server

    Schombert, James

    2010-01-01

    We use four years of introductory astronomy scores to analyze the ability of the current population to perform college level work and measure the amount of grade inflation across various majors. Using an objective grading scale, one that is independent of grading curves, we find that 29% of intro astronomy students fail to meet minimal standards for college level work. Of the remaining students, 41% achieve satisfactory work, 30% achieve mastery of the topics. Intro astronomy scores correlate with SAT and college GPA. Sequential mapping of the objective grade scheme onto GPA finds that college grades are inflated by 0.2 for natural sciences majors, 0.3 for social sciences, professional schools and undeclared majors), 0.5 for humanities majors. It is unclear from the data whether grade inflation is due to easier grading curves or depression of course material. Experiments with student motivation tools indicates that poor student performance is due to deficiency in student abilities rather than social factors (...

  18. Teaching science writing in an introductory lab course.

    Science.gov (United States)

    Holstein, Sarah E; Mickley Steinmetz, Katherine R; Miles, John D

    2015-01-01

    One challenge that many neuroscience instructors face is how to teach students to communicate within the field. The goal of this project was to improve students' scientific writing in an introductory psychology laboratory course that serves as a feeder course into the neuroscience curriculum. This course included a scaffolded approach - breaking assignments into different sections that build upon each other to allow for more direction and feedback on each section. Students were also provided with examples of scientific writing, given direction on finding and reading journal articles, and were taught how to effectively peer review a paper. Research papers were assessed before (Year 1) and after (Year 2) this scaffolded approach was instituted. The assessment included measures of "Genre Knowledge" for each section of a research paper (abstract, introduction, method, results, discussion) as well as measures of "Writing Elements" (grammar, formatting, clarity, transitions, building to the hypothesis, using evidence). The results indicated that there was an improvement for Genre Knowledge scores when comparing Year 1 to Year 2. However, there was no systematic improvement in Writing Elements. This suggests that this teaching technique was most effective in improving students' ability to write within the scientific genre. The logistics of implementing such an approach are discussed.

  19. Incorporating Service Learning into the Introductory Astronomy Course

    Science.gov (United States)

    Mukherjee, K.

    2002-05-01

    The introductory Astronomy course can be enriched by adding a service learning component to it. This enables students to interact with and educate the general public about matters of outer space. At Slippery Rock University we have incorporated this idea into our Astronomy and Space Science courses. Working in groups, the students do a presentation which is often interdisciplinary. Frequently the department gets requests from schools to do a show specifically tailored to a topic like the solar system or constellations. Such projects are beneficial to students in many ways. They demand a thorough knowledge of the subject matter so as to communicate to the audience in a clear and nontechnical manner. The students also experience first hand the difficulties involved in coordinating a group effort. They learn to take responsibility for their allocated part and how to combine effectively to make the entire show a success. Interacting with various age groups demands a versatility in planning content and public speaking skills not easily available elsewhere in a traditional education. Our planetarium facilities help in attracting diverse audiences from preschoolers to senior citizens. Performance in these shows constitutes twenty five percent of course grade. Feedback from audience groups helps refine future shows by subsequent student cohorts.

  20. Increasing student success using online quizzing in introductory (majors) biology.

    Science.gov (United States)

    Orr, Rebecca; Foster, Shellene

    2013-01-01

    Students often complain about their perceived disconnect between the time and effort spent studying and their subsequent performance on exams. Robert Bjork's research asserts that retrieval of stored information acts as a memory modifier, and that using tests as learning events creates "desirable difficulties that enhance learning." To determine the effect of utilizing testing as a learning event in the introductory (majors) biology classroom, we used an online homework platform to give required quizzes throughout the course. Analysis of exam grades earned by those taking 100% of pre-exam quizzes indicates that not only does this group have a significantly higher exam average than the group of students who took 0% of the pre-exam quizzes, but they also have a significantly higher exam average than the class average. Through detailed, statistical analysis, the benefit of quizzing is demonstrated to be significant for students of diverse academic abilities. Pre-exam quizzing using an online homework platform is an effective way to increase student performance on exams and allows class time to be utilized for teaching activities.

  1. Active Learning Outside the Classroom: Implementation and Outcomes of Peer-Led Team-Learning Workshops in Introductory Biology.

    Science.gov (United States)

    Kudish, Philip; Shores, Robin; McClung, Alex; Smulyan, Lisa; Vallen, Elizabeth A; Siwicki, Kathleen K

    2016-01-01

    Study group meetings (SGMs) are voluntary-attendance peer-led team-learning workshops that supplement introductory biology lectures at a selective liberal arts college. While supporting all students' engagement with lecture material, specific aims are to improve the success of underrepresented minority (URM) students and those with weaker backgrounds in biology. Peer leaders with experience in biology courses and training in science pedagogy facilitate work on faculty-generated challenge problems. During the eight semesters assessed in this study, URM students and those with less preparation attended SGMs with equal or greater frequency than their counterparts. Most agreed that SGMs enhanced their comprehension of biology and ability to articulate solutions. The historical grade gap between URM and non-URM students narrowed slightly in Biology 2, but not in other biology and science, technology, engineering, and mathematics courses. Nonetheless, URM students taking introductory biology after program implementation have graduated with biology majors or minors at the same rates as non-URM students, and have enrolled in postcollege degree programs at equal or greater rates. These results suggest that improved performance as measured by science grade point average may not be necessary to improve the persistence of students from underrepresented groups as life sciences majors. © 2016 P. Kudish et al. CBE—Life Sciences Education © 2016 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  2. Peer Tutoring in Programming: Lessons Learned

    Science.gov (United States)

    Gerhardt, Jill; Olan, Michael

    2010-01-01

    This article describes our experience with peer tutoring in introductory programming courses. This tutoring concept was one of the integral support services out of five student services, which were part of a National Science Foundation Grant, designed to improve education, increase retention, improve professional development and employability, and…

  3. Programs for Individuals with Developmental Disabilities. Revised.

    Science.gov (United States)

    Sizemore, C. J.

    This publication describes the programs and services offered through the Office of Developmental Disabilities of the Illinois Department of Human Services. Introductory information includes an overview of supports and service, a definition of "developmental disability," and a guide to the publication. This is followed by a description of…

  4. Performance Evaluation Workshop for In-Service Managers. Introductory Module and Module 1: Introductory Manual. The Urban Management Development Project, Package XIV.

    Science.gov (United States)

    Scontrino, M. Peter

    This is the first module in a four-module training package for use in inservice seminars or workshops on performance appraisal and employee development. It also contains an introductory manual with general information pertaining to all four modules in addition to specific outlines and objectives for each of the modules. Module 1 overviews the…

  5. Sprego Programming

    Directory of Open Access Journals (Sweden)

    Maria Csernoch

    2015-02-01

    Full Text Available Spreadsheet management is a border-land between office applications and programming, however, it is rather communicated that spreadsheet is nothing more than an easily handled fun piece. Consequently, the complexity of spreadsheet handling, the unprepared end-users, their problem solving abilities and approaches do not match. To overcome these problems we have developed and introduced Sprego (Spreadsheet Lego. Sprego is a simplified functional programming language in spreadsheet environment, and such as can be used both as introductory language and the language of end-user programmers. The essence of Sprego is that we use as few and simple functions as possible and based on these functions build multilevel formulas. With this approach, similar to high level programming, we are able solve advanced problems, developing algorithmic skills, computational thinking. The advantage of Sprego is the simplicity of the language, when the emphasis is not on the coding but on the problem. Beyond that spreadsheets would provide real life problems with authentic data and tables which students are more interested in than the artificial environment and semi-authentic problems of high level programming languages.

  6. Teaching Introductory Computer Security at a Department of Defense University.

    Science.gov (United States)

    1997-04-02

    program in computer security . Its objective is to insure that students not only understand practical aspects of computer security associated with current...can be achieved. Introduction to Computer Security , the cornerstone course for our program is described here.

  7. Planetary missions as lab experiments in the introductory classroom

    Science.gov (United States)

    Collins, G. C.

    2011-12-01

    As is the case at many liberal arts colleges, at Wheaton we require all of our students to take a class in the natural sciences. Our introductory classes must include some type of experimental or laboratory component that allows students to directly experience the scientific cycle of asking a question, collecting data, and analyzing the data to either answer the question or to ask new ones. We want them to use their creativity and deal with ambiguity, so they can break out of the idea that science is something that is already written down in a book. This can be a challenge in planetary science, which draws on so many different disciplines and has so many targets of interest that one could spend the entire semester on background material without getting to the experiment cycle. For the past several years, I have been developing a structure for integrating experimentation into the introductory planetary science classroom, alongside some of the more traditional background material. We spend the first half of the semester getting used to asking questions about planets, and then finding and using simple types of data that have already been collected by spacecraft to answer those questions. Along the way, we track a current planetary mission to examine the questions it was designed to investigate, and how its instruments work together to address those questions. By the second half of the semester, the students are ready for two more challenging group projects. In the first project, the class (36 students) is divided in half, and each group must write a plan for the first day of operations of a robotic rover. The opposite group then goes out to an undisclosed field location and collects the data according to the first group's operations plan. After the field trips, the groups receive the data back from their rovers, still without knowing exactly where they landed, and have to hold a press conference discussing the important scientific discoveries at their landing site

  8. A Web Support System for Submission and Handling of Programming Assignments

    DEFF Research Database (Denmark)

    Nørmark, Kurt

    2011-01-01

    Individual submission of programming assignments should be considered in all introductory programming courses. We describe a custom web support system for submission and management of programming assignments in an introductory C programming course. Experience from the first time use of the system...... is reported. In addition, we compare the pattern of use with the results of the final exam in order to reveal a possible impact of the programming assignments. We summarize the lessons learned in preparation for improving the system prior to the next round of use in the fall of 2011....

  9. Instructors’ Support of Student Autonomy in an Introductory Physics Course

    Directory of Open Access Journals (Sweden)

    Nicholas Hall

    2014-08-01

    Full Text Available The role of autonomy in the student experience in a large-enrollment undergraduate introductory physics course was studied from a self-determination theory perspective. A correlational study investigated whether certain aspects of the student experience correlated with how autonomy supportive (versus controlling students perceived their instructors to be. An autonomy-supportive instructor acknowledges students’ perspectives and feelings and provides students with information and opportunities for choice while minimizing external pressures (e.g., incentives or deadlines. It was found that the degree to which students perceived their instructors as autonomy supportive was positively correlated with student interest and enjoyment in learning physics (β=0.31^{***} and negatively correlated with student anxiety about taking physics (β=-0.23^{**}. It was also positively correlated with how autonomous (versus controlled students’ reasons for studying physics became over the duration of the course (i.e., studying physics more because they wanted to versus had to; β=0.24^{***}. This change in autonomous reasons for studying physics was in turn positively correlated with student performance in the course (β=0.17^{*}. Additionally, the degree to which students perceived their instructors as autonomy supportive was directly correlated with performance for those students entering the course with relatively autonomous reasons for studying physics (β=0.25^{**}. In summary, students who perceived their instructors as more autonomy supportive tended to have a more favorable motivational, affective, and performance experience in the course. The findings of the present study are consistent with experimental studies in other contexts that argue for autonomy-supportive instructor behaviors as the cause of a more favorable student experience.

  10. Instructors' Support of Student Autonomy in an Introductory Physics Course

    Science.gov (United States)

    Hall, Nicholas; Webb, David

    2014-12-01

    The role of autonomy in the student experience in a large-enrollment undergraduate introductory physics course was studied from a self-determination theory perspective. A correlational study investigated whether certain aspects of the student experience correlated with how autonomy supportive (versus controlling) students perceived their instructors to be. An autonomy-supportive instructor acknowledges students' perspectives and feelings and provides students with information and opportunities for choice while minimizing external pressures (e.g., incentives or deadlines). It was found that the degree to which students perceived their instructors as autonomy supportive was positively correlated with student interest and enjoyment in learning physics (β =0.31***) and negatively correlated with student anxiety about taking physics (β =-0.23**). It was also positively correlated with how autonomous (versus controlled) students' reasons for studying physics became over the duration of the course (i.e., studying physics more because they wanted to versus had to; β =0.24***). This change in autonomous reasons for studying physics was in turn positively correlated with student performance in the course (β =0.17*). Additionally, the degree to which students perceived their instructors as autonomy supportive was directly correlated with performance for those students entering the course with relatively autonomous reasons for studying physics (β =0.25**). In summary, students who perceived their instructors as more autonomy supportive tended to have a more favorable motivational, affective, and performance experience in the course. The findings of the present study are consistent with experimental studies in other contexts that argue for autonomy-supportive instructor behaviors as the cause of a more favorable student experience.

  11. An evaluation of teaching methods in the introductory physics classroom

    Science.gov (United States)

    Savage, Lauren Michelle Williams

    The introductory physics mechanics course at the University of North Carolina at Charlotte has a history of relatively high DFW rates. In 2011, the course was redesigned from the traditional lecture format to the inverted classroom format (flipped). This format inverts the classroom by introducing material in a video assigned as homework while the instructor conducts problem solving activities and guides discussions during the regular meetings. This format focuses on student-centered learning and is more interactive and engaging. To evaluate the effectiveness of the new method, final exam data over the past 10 years was mined and the pass rates examined. A normalization condition was developed to evaluate semesters equally. The two teaching methods were compared using a grade distribution across multiple semesters. Students in the inverted class outperformed those in the traditional class: "A"s increased by 22% and "B"s increased by 38%. The final exam pass rate increased by 12% under the inverted classroom approach. The same analysis was used to compare the written and online final exam formats. Surprisingly, no students scored "A"s on the online final. However, the percent of "B"s increased by 136%. Combining documented best practices from a literature review with personal observations of student performance and attitudes from first hand classroom experience as a teaching assistant in both teaching methods, reasons are given to support the continued use of the inverted classroom approach as well as the online final. Finally, specific recommendations are given to improve the course structure where weaknesses have been identified.

  12. Effectiveness of Tutorials for Introductory Physics in Argentinean high schools

    Directory of Open Access Journals (Sweden)

    J. Benegas

    2014-03-01

    Full Text Available This longitudinal study reports the results of a replication of Tutorials in Introductory Physics in high schools of a Latin-American country. The main objective of this study was to examine the suitability of Tutorials for local science education reform. Conceptual learning of simple resistive electric circuits was determined by the application of the single-response multiple-choice test “Determining and Interpreting Resistive Electric Circuits Concepts Test” (DIRECT to high school classes taught with Tutorials and traditional instruction. The study included state and privately run schools of different socioeconomic profiles, without formal laboratory space and equipment, in classes of mixed-gender and female-only students, taught by novice and experienced instructors. Results systematically show that student learning is significantly higher in the Tutorials classes compared with traditional teaching for all of the studied conditions. The results also show that long-term learning (one year after instruction in the Tutorials classes is highly satisfactory, very similar to the performance of the samples of college students used to develop the test DIRECT. On the contrary, students following traditional instruction returned one year after instruction to the poor performance (<20% shown before instruction, a result compatible with the very low level of conceptual knowledge of basic physics recently determined by a systematic study of first-year students attending seven universities in Spain and four Latin-American countries. Some replication and adaptation problems and difficulties of this experience are noted, as well as recommendations for successful use of Tutorials in high schools of similar educational systems.

  13. Peer discussions in lecture-based tutorials in introductory physics

    Science.gov (United States)

    Leinonen, Risto; Asikainen, Mervi A.; Hirvonen, Pekka E.

    2017-06-01

    This study analyzes the types of peer discussion that occur during lecture-based tutorial sessions. It focuses in particular on whether discussions of this kind have certain characteristics that might indicate success in the post-testing phase. The data were collected during an introductory physics course. The main data set was gathered with the aid of audio recordings. Data-driven content analysis was applied in the analysis to facilitate the placement of students' discussions in particular categories related to different types of discussions. Four major discussion types were found: discussions related to the content knowledge, metalevel discussions including metaconceptual and metacognitive elements, discussions related to practical issues, and creating a base for discussion, seen here in the order of their prevalence. These categories were found to possess individual substructures that involved, for example, asking and answering questions, participating in a dialogue, or disagreeing with a peer. Analyzing the substructures of the categories revealed that there were evident differences between the groups, some of them related to the group size. With regard to the characteristics of discussions considered to be connected to a better learning outcome, it was observed that a great number of lines uttered related to the physics content or metalevel discussions seemed to have a direct bearing on success in the post test at the group level. For individual students, answering content-related questions posed by their peers might also indicate success in the post test. We would encourage researchers to continue this type of research in order to discover the essential characteristics of students' discussions that facilitate learning.

  14. The Social Interplay of Disciplinarity and Interdisciplinarity. Some Introductory Remarks

    Directory of Open Access Journals (Sweden)

    Reinhold Hedtke

    2006-12-01

    Full Text Available Social Science Education as a subject field in schools is an intrinsic pluridisciplinary feature, whatever disciplines are included, however it may be organised and wherever it may be institutionalised. Civic education, economic education, social education and historical education each comprise several academic disciplines even if they are thought to be completely independent subjects. From the start on, disciplinarity and interdisciplinarity are on the agenda for any subject related to social science education and are one of its main problems. For these introductory remarks interdisciplinarity can be simply defined as relating two or more academic disciplines or school subjects to each other if this is done in a purposeful, systematic, explicit and reflective way. The overarching goal is to improve education that is to enhance students' understandings of the worlds and their abilities to act within and towards them. A relationship between disciplines or subjects which misses one or more of the four characteristics can be called pluridisciplinary or multidisciplinary (cf. Audigier 2006. In the following I first want to discuss some aspects of disciplinarity and interdisciplinarity at schools and at universities and the weakness of interdisciplinarity. I sketch some social science based ideas on the interrelationship between the subject structure of the academic world and the world of schools (3. and of some tendency to commonalities or even unification of social sciences and related competencies (4.. I conclude with some remarks on different kinds of knowledge (5.. Last but not least, I'll give an overview on the papers in this issue of the Journal of Social Science Education (6..

  15. Tracking Success in Large Introductory Classes using Technology

    Science.gov (United States)

    Robertson, Thomas H.

    2011-01-01

    A common problem frequently encountered in large introductory classes is the anonymity experienced by students. An effort is underway at Ball State University to explore the impact of technology on reducing this anonymity and improving student performance and success. In preparation for this study, performance and success measures for students in a previous class have been examined to provide background for construction of a model for formal testing and a control group for comparison of future results. Student performance measures obtained early in the course and final course grades were examined to identify potential early warning indicators that might be used to plan interventions much earlier than the traditional midterm course reports used to alert freshmen at academic risk. Class participation scores were based on data obtained with a personal response system (i>clicker). The scores were scaled to reflect about 80% comprehension and 20% attendance. Homework scores were obtained using the LON-CAPA Course Management System and instructional materials created by the author. Substantial linear correlations exist between 1) Exam 1 Scores after Four Weeks and 2) Raw Class Participation Scores for the First Six Weeks and the Final Course Score. A more modest linear correlation was found between 3) Homework Scores for First Six Weeks and Final Course Score. Of these three measures, only Class Participation Scores identified all students who ultimately received course grades lower than C. Several students scored in the danger zone according to Homework and Class Participation Scores but earned course grades of C or better. It appears that an early warning plan based on Class Participation Scores would permit effective identification of at-risk students early in the course.

  16. Collaborative Assessment Tool (CAT) - Assessing scientific practices in introductory physics

    Science.gov (United States)

    Irving, Paul

    2017-01-01

    An important learning goal of Projects and Practices in Physics (P3) , the transformed introductory mechanics course at Michigan State University, is the development of scientific practices. The design team, as part of the P3 course construction, made clear attempts to assess learning goals that can often be perceived as being a part of the hidden curriculum or considered difficult to assess (e.g., learning to work productively in a group) by developing a collaborative assessment tool (CAT). The CAT is a formative assessment tool that provides students with a numerical grade for how they participated in their learning group on a weekly basis while also providing feedback in the form of written commentary and suggestions on how they might improve at a particular collaborative practice. In this presentation, we demonstrate the CAT tool from two perspectives: 1) how the CAT tool is used within the P3 context and 2) how the formative feedback has affected changes in student interactions in class. We will present the case studies of 3 students who had differing reactions to the feedback they received. We will explore the role the feedback had in their interactions over a four-week period from an in-class perspective and a reflected perspective through interviews and observations. The analysis will also be presented from a tutor and group perspective, which will highlight the affordances the CAT can have in creating a productive learning group. The research on the CAT shows promise in encouraging growth in students' collaborative skills, but this research is still in its infancy and needs to be expanded to include different contexts.

  17. Correlates of gender and achievement in introductory algebra based physics

    Science.gov (United States)

    Smith, Rachel Clara

    The field of physics is heavily male dominated in America. Thus, half of the population of our country is underrepresented and underserved. The identification of factors that contribute to gender disparity in physics is necessary for educators to address the individual needs of students, and, in particular, the separate and specific needs of female students. In an effort to determine if any correlations could be established or strengthened between sex, gender identity, social network, algebra skill, scientific reasoning ability, and/or student attitude, a study was performed on a group of 82 students in an introductory algebra based physics course. The subjects each filled out a survey at the beginning of the semester of their first semester of algebra based physics. They filled out another survey at the end of that same semester. These surveys included physics content pretests and posttests, as well as questions about the students' habits, attitudes, and social networks. Correlates of posttest score were identified, in order of significance, as pretest score, emphasis on conceptual learning, preference for male friends, number of siblings (negatively correlated), motivation in physics, algebra score, and parents' combined education level. Number of siblings was also found to negatively correlate with, in order of significance, gender identity, preference for male friends, emphasis on conceptual learning, and motivation in physics. Preference for male friends was found to correlate with, in order of significance, emphasis on conceptual learning, gender identity, and algebra score. Also, gender identity was found to correlate with emphasis on conceptual learning, the strongest predictor of posttest score other than pretest score.

  18. Characterizing interactive engagement activities in a flipped introductory physics class

    Directory of Open Access Journals (Sweden)

    Anna K. Wood

    2016-06-01

    Full Text Available Interactive engagement activities are increasingly common in undergraduate physics teaching. As research efforts move beyond simply showing that interactive engagement pedagogies work towards developing an understanding of how they lead to improved learning outcomes, a detailed analysis of the way in which these activities are used in practice is needed. Our aim in this paper is to present a characterization of the type and duration of interactions, as experienced by students, that took place during two introductory physics courses (1A and 1B at a university in the United Kingdom. Through this work, a simple framework for analyzing lectures—the framework for interactive learning in lectures (FILL, which focuses on student interactions (with the lecturer, with each other, and with the material is proposed. The pedagogical approach is based on Peer Instruction (PI and both courses are taught by the same lecturer. We find lecture activities can be categorized into three types: interactive (25%, vicarious interactive (20% (involving questions to and from the lecturer, and noninteractive (55%. As expected, the majority of both interactive and vicarious interactive activities took place during PI. However, the way that interactive activities were used during non-PI sections of the lecture varied significantly between the two courses. Differences were also found in the average time spent on lecturer-student interactions (28% for 1A and 12% for 1B, although not on student-student interactions (12% and 12% or on individual learning (10% and 7%. These results are explored in detail and the implications for future research are discussed.

  19. Using active learning strategies to investigate student learning and attitudes in a large enrollment, introductory geology course

    Science.gov (United States)

    Berry, Stacy Jane

    considered as significant as the academic merit. The qualitative data substantiated the achievement success and revealed a positive relationship between a student centered learning environment and attitudes regarding learning geology. Our findings indicated a positive trend favoring active learning instructional practices, particularly methods that emphasize independent and active thinking, and analyzing of data. Of particular interest was the correlation between the amount of student ownership in an activity and students' attitude toward authenticity and application in learning. Students' perceptions and attitudes provided depth in program evaluation and helped in identifying which components used in teaching methodologies were the most effective towards learning. Although the exigencies of high enrollment introductory courses set limits for this study, the outcomes support the positive influence that active learning has on achievement performance in a high enrollment, introductory Geology course.

  20. Learning to Program with Personal Robots: Influences on Student Motivation

    Science.gov (United States)

    McGill, Monica M.

    2012-01-01

    One of the goals of using robots in introductory programming courses is to increase motivation among learners. There have been several types of robots that have been used extensively in the classroom to teach a variety of computer science concepts. A more recently introduced robot designed to teach programming to novice students is the Institute…

  1. A SUGGESTED CHECKLIST FOR ASSESSING A SCIENCE PROGRAM.

    Science.gov (United States)

    Office of Education (DHEW), Washington, DC.

    SUGGESTIONS AND A CHECKLIST FOR THE EVALUATION OF ELEMENTARY AND SECONDARY SCHOOL SCIENCE PROGRAMS ARE CONTAINED IN THIS UNITED STATES OFFICE OF EDUCATION BULLETIN. AN INTRODUCTORY SECTION DEALS WITH THE IMPORTANCE OF (1) BROAD FACULTY PARTICIPATION, AND (2) UP-TO-DATE CONTENT AND METHODS IN PROGRAM EVALUATION. EXPLANATIONS FOR THE CONSTRUCTION…

  2. Whatever Happened to Richard Reid's List of First Programming Languages?

    Science.gov (United States)

    Siegfried, Robert M.; Greco, Daniel M.; Miceli, Nicholas G.; Siegfried, Jason P.

    2012-01-01

    Throughout the 1990s, Richard Reid of Michigan State University maintained a list showing the first programming language used in introductory programming courses taken by computer science and information systems majors; it was updated for several years afterwards by Frances Van Scoy of West Virginia University. However, it has been 5 years since…

  3. Developing and validating a conceptual survey to assess introductory physics students’ understanding of magnetism

    Science.gov (United States)

    Li, Jing; Singh, Chandralekha

    2017-03-01

    Development of validated physics surveys on various topics is important for investigating the extent to which students master those concepts after traditional instruction and for assessing innovative curricula and pedagogies that can improve student understanding significantly. Here, we discuss the development and validation of a conceptual multiple-choice survey related to magnetism suitable for introductory physics courses. The survey was developed taking into account common students’ difficulties with magnetism concepts covered in introductory physics courses found in our investigation and the incorrect choices to the multiple-choice questions were designed based upon those common student difficulties. After the development and validation of the survey, it was administered to introductory physics students in various classes in paper-pencil format before and after traditional lecture-based instruction in relevant concepts. We compared the performance of students on the survey in the algebra-based and calculus-based introductory physics courses before and after traditional lecture-based instruction in relevant magnetism concepts. We discuss the common difficulties of introductory physics students with magnetism concepts we found via the survey. We also administered the survey to upper-level undergraduates majoring in physics and PhD students to benchmark the survey and compared their performance with those of traditionally taught introductory physics students for whom the survey is intended. A comparison with the base line data on the validated magnetism survey from traditionally taught introductory physics courses and upper-level undergraduate and PhD students discussed in this paper can help instructors assess the effectiveness of curricula and pedagogies which is especially designed to help students integrate conceptual and quantitative understanding and develop a good grasp of the concepts. In particular, if introductory physics students’ average

  4. Mississippi Curriculum Framework for Fashion Marketing Technology (Program CIP: 08.0101--Apparel and Accessories Mkt. Op., Gen.). Postsecondary Programs.

    Science.gov (United States)

    Mississippi Research and Curriculum Unit for Vocational and Technical Education, State College.

    This document, which is intended for use by community and junior colleges throughout Mississippi, contains curriculum frameworks for the course sequences in the fashion marketing technology programs cluster. Presented in the introductory section are a description of the program and suggested course sequence. Section I lists baseline competencies,…

  5. A 21st century perspective as a primer to introductory physics

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, Lorenzo J, E-mail: ljc@physics.utoledo.edu [Department of Physics and Astronomy, University of Toledo, Toledo, OH 43606 (United States)

    2011-09-15

    Much effort over many years has been devoted to the reform of the teaching of physics. This has led to many new and imaginative approaches in the content and delivery of material. Great strides have been made in the delivery, and the content has been continually supplemented. However, attempts to modernize the basic structure of the presentation have faced resistance, and the majority of introductory physics textbooks in wide adoption today have a general structure that has changed little in over 60 years. Thus, in comparison to biology, chemistry, geology, etc, physics is unique in that its introductory course is not a survey of the current status of the field. In an attempt to circumvent this problem in a tractable way, we have developed a qualitative front-end course designed to create a 21st century perspective that can be embedded into the beginning of a standard introductory physics sequence.

  6. Computer Self-Efficacy: A Practical Indicator of Student Computer Competency in Introductory IS Courses

    Directory of Open Access Journals (Sweden)

    Rex Karsten

    1998-01-01

    Full Text Available Students often receive their first college-level computer training in introductory information systems courses. Students and faculty frequently expect this training to develop a level of student computer competence that will support computer use in future courses. In this study, we applied measures of computer self-efficacy to students in a typical introductory IS course. The measures provided useful evidence that student perceptions of their ability to use computers effectively in the future significantly improved as a result of their training experience. The computer self-efficacy measures also provided enhanced insight into course-related factors of practical concern to IS educators. Study results also suggest computer self-efficacy measures may be a practical and informative means of assessing computer-training outcomes in the introductory IS course context

  7. Development of an Introductory Oceanography Concept Inventory Survey

    Science.gov (United States)

    Arthurs, L.; Marchitto, T.

    2008-12-01

    Concept inventories are one type of assessment that can be used to evaluate whether a student has an accurate and working knowledge of a specific set of concepts. Although such assessment tools have been developed in astronomy, biology, chemistry, engineering, fluid mechanics, geology, and physics, none has been available. Our development of an Introductory Oceanography Concept Inventory Survey (IO-CIS) serves to fill this gap. Much of the development of the IO-CIS utilized students enrolled in the Spring 2008 Introduction to Oceanography course taught at the University of Colorado at Boulder. The first step in the development of IO-CIS involved the identification and selection of the critical concepts to be addressed in the course and the survey. Next, learning goals were defined for each critical concept. These learning goals then provided the basis for framing open-ended questions that were administered to students in pre-module in-class Concept Inventory Exercises (CIEs). These open-ended questions each underwent validation and revision with expert and novice input prior to being administered in a CIE. Each CIE comprised 4-5 open-ended questions, which each contained 1-4 parts. During the semester, 4 different CIEs were administered, with the number of respondents for each CIE ranging from 57-134. Student responses were then binned according to misconceptions and alternate conceptions, tallied, and "distractors" were written based on the most popular bins using the same language employed by students in their responses. Student responses were also used as part of the validation process to ensure that the questions were interpreted by students in the manner intended. Student responses were also used as a basis to discard particular questions from inclusion in the overall IO-CIS. After the initial IO-CIS questions and distractors had been designed as described above, 23 one-on-one student interviews were conducted as part of the validation process. As a result of

  8. Illustrating Geology With Customized Video in Introductory Geoscience Courses

    Science.gov (United States)

    Magloughlin, J. F.

    2008-12-01

    For the past several years, I have been creating short videos for use in large-enrollment introductory physical geology classes. The motivation for this project included 1) lack of appropriate depth in existing videos, 2) engagement of non-science students, 3) student indifference to traditional textbooks, 4) a desire to share the visual splendor of geology through virtual field trips, and 5) a desire to meld photography, animation, narration, and videography in self-contained experiences. These (HD) videos are information-intensive but short, allowing a focus on relatively narrow topics from numerous subdisciplines, incorporation into lectures to help create variety while minimally interrupting flow and holding students' attention, and manageable file sizes. Nearly all involve one or more field locations, including sites throughout the western and central continental U.S., as well as Hawaii, Italy, New Zealand, and Scotland. The limited scope of the project and motivations mentioned preclude a comprehensive treatment of geology. Instead, videos address geologic processes, locations, features, and interactions with humans. The videos have been made available via DVD and on-line streaming. Such a project requires an array of video and audio equipment and software, a broad knowledge of geology, very good computing power, adequate time, creativity, a substantial travel budget, liability insurance, elucidation of the separation (or non-separation) between such a project and other responsibilities, and, preferably but not essentially, the support of one's supervisor or academic unit. Involving students in such projects entails risks, but involving necessary technical expertise is virtually unavoidable. In my own courses, some videos are used in class and/or made available on-line as simply another aspect of the educational experience. Student response has been overwhelmingly positive, particularly when expectations of students regarding the content of the videos is made

  9. Using News Media Databases (LexisNexis) To Identify Relevant Topics For Introductory Earth Science Classes

    Science.gov (United States)

    Cervato, C.; Jach, J. Y.; Ridky, R.

    2003-12-01

    Introductory Earth science courses are undergoing pedagogical changes in universities across the country and are focusing more than ever on the non-science majors. Increasing enrollment of non-science majors in these introductory Earth science courses demands a new look at what is being taught and how the content can be objectively chosen. Assessing the content and effectiveness of these courses requires a quantitative investigation of introductory Earth science topics and their relevance to current issues and concerns. Relevance of Earth science topics can be linked to improved students' attitude toward science and a deeper understanding of concepts. We have used the Internet based national news search-engine LexisNexis Academic Universe (http://www.lexisnexis.org/) to select the occurrence of Earth science terms over the last 12 months, five and ten years both regionally and nationally. This database of term occurrences is being used to examine how Earth sciences have evolved in the news through the last 10 years and is also compared with textbook contents and course syllabi from randomly selected introductory earth science courses across the nation. These data constitute the quantitative foundation for this study and are being used to evaluate the relevance of introductory earth science course content. The relevance of introductory course content and current real-world issues to student attitudes is a crucial factor when considering changes in course curricula and pedagogy. We have examined students' conception of the nature of science and attitudes towards science and learning science using a Likert-scale assessment instrument in the fall 2002 Geology 100 classes at Iowa State University. A pre-test and post-test were administered to see if the students' attitudes changed during the semester using as reference a control group comprised of geoscience undergraduate and graduate students, and faculty. The results of the attitude survey have been analyzed in terms

  10. Persistence of elementary programming skills

    DEFF Research Database (Denmark)

    Bennedsen, Jens Benned; Caspersen, Michael E.

    2012-01-01

    Programming is recognised as one of seven grand challenges in computing education and attracts much attention in computing education research. Most research in the area concerns teaching methods, educational technology and student understanding/misconceptions. Typically, evaluation of learning...... population consists of 10 students who have taken an introductory object-oriented programming course 3, 15 or 27 months prior to our study. None of the students have been exposed to programming in the intervening period. As expected, our research shows that syntactical issues in general hinder immediate...

  11. Humor to the Rescue: How to Make Introductory Economics an Appealing Social Science for Non-Majors

    Science.gov (United States)

    Jones, George H.

    2014-01-01

    Despite efforts made over the past few years to improve upon the way introductory economics is taught, these efforts have unfortunately done very little to change student perception of economics as a dry, difficult and boring subject. Since the introductory economics course for many nonmajors may be their only economics course in college, it is…

  12. First-Day Strategies for Millennial Students in Introductory Accounting Courses: It's All Fun and Games until Something Gets Learned

    Science.gov (United States)

    Mastilak, Christian

    2012-01-01

    Millennial students often possess characteristics at odds with typical lecture-based approaches to introductory accounting courses. The author introduces an approach for reaching millennial students early in introductory accounting courses in ways that fit millennials' characteristics. This article describes the use of the board game Monopoly[R]…

  13. Reworking the science curriculum: A case study in the interdependence between introductory biology and multiculturalism

    Science.gov (United States)

    Persell, Roger

    1994-12-01

    Multiculturalism has emerged as the major influence in revising science curricula and teaching, yet misunderstanding about the history and theoretical underpinnings of multiculturalism has made the separation of political and education reform contentious and difficult. Within the context of a new college-wide pluralism and diversity requirement, a large introductory biology course at Hunter College of the City University of New York is now the testing ground for an interdependent model of multicultural education. The implications for multiculturalism, science pedagogy, and the pivotal role of introductory courses are discussed.

  14. Should Introductory Comparative ­Philosophy Courses Be Structured Around Topics or Traditions?

    Directory of Open Access Journals (Sweden)

    Jeremy Henkel

    2016-07-01

    Full Text Available Should introductory courses in comparative philosophy be organized around traditions or around topics? Will students be better served by considering Indian, Chinese, African, and Native American philosophies in depth and in sequence, or by exploring differing philosophical approaches to such topics as beauty, moral responsibility, and human nature? Each approach has reasons that recommend it, but each also brings with it serious limitations. In this essay I rehearse what I take to be the most salient arguments both for and against each approach. In the end, I conclude that, for introductory courses in comparative philosophy, an approach organized around traditions is preferable to one organized around topics.

  15. Verbal Final Exam in Introductory Biology Yields Gains in Student Content Knowledge and Longitudinal Performance

    Science.gov (United States)

    Luckie, Douglas B.; Rivkin, Aaron M.; Aubry, Jacob R.; Marengo, Benjamin J.; Creech, Leah R.; Sweeder, Ryan D.

    2013-01-01

    We studied gains in student learning over eight semesters in which an introductory biology course curriculum was changed to include optional verbal final exams (VFs). Students could opt to demonstrate their mastery of course material via structured oral exams with the professor. In a quantitative assessment of cell biology content knowledge, students who passed the VF outscored their peers on the medical assessment test (MAT), an exam built with 40 Medical College Admissions Test (MCAT) questions (66.4% [n = 160] and 62% [n = 285], respectively; p exams at the introductory level may allow instructors to assess and aid students striving to achieve higher-level learning. PMID:24006399

  16. Java Programming Language

    Science.gov (United States)

    Shaykhian, Gholam Ali

    2007-01-01

    The Java seminar covers the fundamentals of Java programming language. No prior programming experience is required for participation in the seminar. The first part of the seminar covers introductory concepts in Java programming including data types (integer, character, ..), operators, functions and constants, casts, input, output, control flow, scope, conditional statements, and arrays. Furthermore, introduction to Object-Oriented programming in Java, relationships between classes, using packages, constructors, private data and methods, final instance fields, static fields and methods, and overloading are explained. The second part of the seminar covers extending classes, inheritance hierarchies, polymorphism, dynamic binding, abstract classes, protected access. The seminar conclude by introducing interfaces, properties of interfaces, interfaces and abstract classes, interfaces and cailbacks, basics of event handling, user interface components with swing, applet basics, converting applications to applets, the applet HTML tags and attributes, exceptions and debugging.

  17. Autonomy and the Student Experience in Introductory Physics

    Science.gov (United States)

    Hall, Nicholas Ron

    The role of autonomy in the student experience in a large-enrollment undergraduate introductory physics course was studied from a Self-Determination Theory perspective with two studies. Study I, a correlational study, investigated whether certain aspects of the student experience correlated with how autonomy supportive (vs. controlling) students perceived their instructors to be. An autonomy supportive instructor acknowledges students' perspectives, feelings, and perceptions and provides students with information and opportunities for choice, while minimizing external pressures. It was found that the degree to which students perceived their instructors as autonomy supportive was positively correlated with student interest and enjoyment in learning physics (beta=0.31***) and negatively correlated with student anxiety about taking physics (beta=-0.23**). It was also positively correlated with how autonomous (vs. controlled) students' reasons for studying physics became over the duration of the course (i.e., studying physics more because they wanted to vs. had to; beta=0.24***). This change in autonomous reasons for studying physics was in turn positively correlated with student performance in the course (beta=0.17*). Additionally, the degree to which students perceived their instructors as autonomy supportive was directly correlated with performance for those students entering the course with relatively autonomous reasons for studying physics (beta=0.25**). In summary, students who perceived their instructors as more autonomy supportive tended to have a more favorable experience in the course. If greater autonomy support was in fact the cause of a more favorable student experience, as suggested by Self-determination Theory and experimental studies in other contexts, these results would have implications for instruction and instructor professional development in similar contexts. I discuss these implications. Study II, an experimental study, investigated the effect

  18. Interactive Computer Visualization in the Introductory Chemistry Curriculum

    Science.gov (United States)

    Bragin, Victoria M.

    1996-08-01

    Increasingly, chemistry instructors, especially in two-year colleges, find themselves teaching classes where there is great disparity in the academic preparation of the students and where even those students with good mathematics and basic science backgrounds have poor English language and communication skills. This project explores the use of technological innovations to facilitate learning in introductory chemistry courses by those with a poor academic background, while also challenging those prepared to master the curriculum. An additional objective is to improve the communication skills of all students. Material is presented visually and in as engaging a fashion as possible, students are provided ready access to relevant information about the course content in ways that are adapted to their individual learning styles, and collaborative learning is encouraged, especially among those who work and live at a distance from campus. The chief tactics employed are: Development of software that can be customized to meet the varying needs of individual students, courses, and instructors. Use of simulations that, while not replacing laboratory bench experiments, allow students to practice important laboratory techniques and observe the physical behavior of chemical systems. Use of software that allows students to explore the molecular basis of chemical phenomena. Use of software that allows students to display and analyze data in ways that facilitate drawing general conclusions about the quantitative relationships between observable properties. Use of the computer as a communications device. The ability to customize software is important in adapting to different learning styles and in encouraging students to learn by discovery. For example, TitrationLab was developed so that the material may merely be presented empirically or in ways in which the principles of equilibrium are demonstrated. At the advanced level, automatically generated titration curves are used to

  19. Teaching Sustainability from a Scientific Standpoint at the Introductory Level

    Science.gov (United States)

    Campbell-Stone, E.; Myers, J. D.

    2008-12-01

    In recent decades, humankind has recognized that current levels of resource utilization are seriously impacting our planet's life support systems and threatening the ability of future generations to provide for themselves. The concept of sustainability has been promoted by a variety of national and international organizations as a method to devise ways to adjust humanity's habits and consumption to levels that can be maintained over the long term, i.e. sustained. Courses on sustainability are being offered at many universities and colleges, but most are taught outside of science departments; they are often designed around policy concerns or focus primarily on environmental impacts while neglecting the science of sustainability. Because the three foundations necessary to implement sustainability are sustainability governance, sustainability accounting, and sustainability science, it is imperative that science departments play an active role in preparing citizens and professionals for dealing with sustainability issues. The geosciences are one of the scientific disciplines that offer a logical foundation from which to teach sustainability science. Geoscientists can also offer a unique and relevant geologic perspective on sustainability issues. The authors have developed an introductory, interdisciplinary course entitled 'Global Sustainability: Managing Earth's Resources' that integrates scientific disciplines in the examination of real world sustainability issues. In-depth understanding of physical, Earth and biological science principles are necessary for students to identify the limits and constraints imposed on important issues facing modern society, e.g. water, energy, population growth, etc. This course exposes students to all the scientific principles that apply directly to sustainability. The subject allows the instructors to present open-ended, multifaceted and complex problems relevant to today's industrialized and globalized world, and it encourages

  20. Multiple-Choice Exams: An Obstacle for Higher-Level Thinking in Introductory Science Classes

    Science.gov (United States)

    Stanger-Hall, Kathrin F.

    2012-01-01

    Learning science requires higher-level (critical) thinking skills that need to be practiced in science classes. This study tested the effect of exam format on critical-thinking skills. Multiple-choice (MC) testing is common in introductory science courses, and students in these classes tend to associate memorization with MC questions and may not…

  1. Creating Trans-Inclusive Schools: Introductory Activities That Enhance the Critical Consciousness of Future Educators

    Science.gov (United States)

    De Pedro, Kris Tunac; Jackson, Christopher; Campbell, Erin; Gilley, Jade; Ciarelli, Brock

    2016-01-01

    The Lawrence King murder and other tragedies surrounding transgender youth have prompted a national discussion about the need for schools to be more supportive and inclusive of transgender students. In this multi-authored reflection, the authors describe a series of three introductory activities in an undergraduate educational studies course aimed…

  2. Teaching Quantum Interpretations: Revisiting the Goals and Practices of Introductory Quantum Physics Courses

    Science.gov (United States)

    Baily, Charles; Finkelstein, Noah D.

    2015-01-01

    Most introductory quantum physics instructors would agree that transitioning students from classical to quantum thinking is an important learning goal, but may disagree on whether or how this can be accomplished. Although (and perhaps because) physicists have long debated the physical interpretation of quantum theory, many instructors choose to…

  3. Active Processing via Write-to-Learn Assignments: Learning and Retention Benefits in Introductory Psychology

    Science.gov (United States)

    Gingerich, Karla J.; Bugg, Julie M.; Doe, Sue R.; Rowland, Christopher A.; Richards, Tracy L.; Tompkins, Sara Anne; McDaniel, Mark A.

    2014-01-01

    This study evaluated brief, in-class write-to-learn assignments as a tool for promoting learning and retention in large, introductory psychology courses. A within-subjects (student) design was used with assignment of concepts to write-to-learn and copy (control) conditions counterbalanced across sections for each instructor. Students performed…

  4. Teaching about Climate Change in the Business Curriculum: An Introductory Module and Resource List

    Science.gov (United States)

    Takacs, C. Helen

    2013-01-01

    Business managers are increasingly engaged with climate change issues, but pedagogy on climate change in the business curriculum is in its infancy. The author addresses the need for greater integration of climate change knowledge in the business curriculum by describing a teaching module for an undergraduate introductory business course and…

  5. Retention of Statistical Concepts in a Preliminary Randomization-Based Introductory Statistics Curriculum

    Science.gov (United States)

    Tintle, Nathan; Topliff, Kylie; VanderStoep, Jill; Holmes, Vicki-Lynn; Swanson, Todd

    2012-01-01

    Previous research suggests that a randomization-based introductory statistics course may improve student learning compared to the consensus curriculum. However, it is unclear whether these gains are retained by students post-course. We compared the conceptual understanding of a cohort of students who took a randomization-based curriculum (n = 76)…

  6. Evaluating Two Models of Collaborative Tests in an Online Introductory Statistics Course

    Science.gov (United States)

    Björnsdóttir, Auðbjörg; Garfield, Joan; Everson, Michelle

    2015-01-01

    This study explored the use of two different types of collaborative tests in an online introductory statistics course. A study was designed and carried out to investigate three research questions: (1) What is the difference in students' learning between using consensus and non-consensus collaborative tests in the online environment?, (2) What is…

  7. Global Multiculturalism in Undergraduate Sociology Course: An Analysis of Introductory Textbooks in the U.S.

    Science.gov (United States)

    Shin, Kyoung-Ho

    2014-01-01

    Focusing on global multiculturalism, this study offers a content review of undergraduate introductory sociology textbooks that are being used in the United States. Through both quantitative and qualitative review of texts, it is found that there is a considerable variation in the way which concepts and latent meanings are embedded within textbook…

  8. Enhancing Basic Skills in Modern Introductory Engineering Mathematics with High IT Integration

    DEFF Research Database (Denmark)

    Schmidt, Karsten; Hussmann, Peter Munkebo

    2013-01-01

    At a technical university, the freshmen meet technical textbooks and instructions that require mastery of basic pre-university mathematical skills. In this project we are testing these skills, and propose a curriculum redesign for introductory mathematics aimed for bridging the gaps. Mathematics ...

  9. Experimental Population Genetics in the Introductory Genetics Laboratory Using "Drosophila" as a Model Organism

    Science.gov (United States)

    Johnson, Ronald; Kennon, Tillman

    2009-01-01

    Hypotheses of population genetics are derived and tested by students in the introductory genetics laboratory classroom as they explore the effects of biotic variables (physical traits of fruit flies) and abiotic variables (island size and distance) on fruit fly populations. In addition to this hypothesis-driven experiment, the development of…

  10. Sociology Dismissing Religion? The Presentation of Religious Change in Introductory Sociology Textbooks

    Science.gov (United States)

    Featherstone, Richard; Sorrell, Katie L.

    2007-01-01

    This paper explores whether the field of sociology harbors a dismissive attitude towards religion. Specifically it examines whether introductory sociology textbooks present the classic secularization theory over the more recent religious economies explanation of religious change. The classical secularization thesis suggests that religion is…

  11. Prism Foil from an LCD Monitor as a Tool for Teaching Introductory Optics

    Science.gov (United States)

    Planinsic, Gorazd; Gojkosek, Mihael

    2011-01-01

    Transparent prism foil is part of a backlight system in LCD monitors that are widely used today. This paper describes the optical properties of the prism foil and several pedagogical applications suitable for undergraduate introductory physics level. Examples include experiments that employ refraction, total internal reflection, diffraction and…

  12. A Dynamic Duo: LCD Overhead Displays and Laptops as Instructional Aids in Introductory Psychology.

    Science.gov (United States)

    Ransdell, Sarah

    1989-01-01

    Describes simulation software that was used with an LCD overhead display and laptop computers for large introductory psychology courses. The use of experiment simulators to increase student interest and activity is discussed, hardware is explained, and interaction between students, instructor, and the simulation is described. (14 references) (LRW)

  13. Interactive Introductory Nutrition Course Focusing on Disease Prevention Increased Whole-Grain Consumption by College Students

    Science.gov (United States)

    Ha, Eun-Jeong; Caine-Bish, Natalie

    2011-01-01

    Objective: To estimate current consumption of whole grains in college students and determine whether there would be an increase in whole-grain consumption after the students completed an interactive introductory nutrition course focusing on disease prevention. Methods: Eighty college students, 18-24 years old, participated in the study. Grain and…

  14. Coverage of the Stanford Prison Experiment in Introductory Social Psychology Textbooks

    Science.gov (United States)

    Griggs, Richard A.; Whitehead, George I., III

    2014-01-01

    This study is concerned with the nature of the coverage in introductory social psychology textbooks of the Stanford prison experiment (SPE), given the many criticisms, especially recently, of the SPE. These criticisms concern both the study's methodology and the situationist explanation of the outcome. Ten textbooks were analyzed for coverage of…

  15. A Pilot Study of Core Topics in Introductory Social Psychology and Developmental Psychology Textbooks

    Science.gov (United States)

    Whitehead, George I., III; Smith, Stephanie H.; Losonczy-Marshall, Marta

    2014-01-01

    This study examined the similarities and differences in the topics and references in selected chapters of eight introductory social psychology textbooks and six developmental psychology textbooks. We wanted to determine the extent to which there were core concepts and references presented in these chapters. We found a relatively small set of core…

  16. Learning from the Starry Message: Using Galileo's "Sidereus Nuncius" in Introductory Astronomy Classes

    Science.gov (United States)

    Wiesner, Matthew P.

    2015-01-01

    Every introductory astronomy class encounters Galileo during the course as the first man to systematically study the sky with a telescope. Every Astronomy 101 student meets Galileo as one of the major catalysts behind the shift from the Ptolemaic to the Copernican system and as one of the great minds behind the scientific method. But most of the…

  17. Deliberation as Communication Instruction: A Study of a Climate Change Deliberation in an Introductory Biology Course

    Science.gov (United States)

    Drury, Sara A. Mehltretter

    2015-01-01

    The author argues that deliberation is an innovative method for teaching communication skills, particularly group communication, in the undergraduate science, technology, engineering, and math (STEM) curriculum. A case study using a deliberation activity on global climate change in an introductory biology course demonstrates how deliberative…

  18. Predictors of Performance in Introductory Finance: Variables within and beyond the Student's Control

    Science.gov (United States)

    Englander, Fred; Wang, Zhaobo; Betz, Kenneth

    2015-01-01

    This study examined variables that are within and beyond the control of students in explaining variations in performance in an introductory finance course. Regression models were utilized to consider whether the variables within the student's control have a greater impact on course performance relative to the variables beyond the student's…

  19. The Robotic Decathlon: Project-Based Learning Labs and Curriculum Design for an Introductory Robotics Course

    Science.gov (United States)

    Cappelleri, D. J.; Vitoroulis, N.

    2013-01-01

    This paper presents a series of novel project-based learning labs for an introductory robotics course that are developed into a semester-long Robotic Decathlon. The last three events of the Robotic Decathlon are used as three final one-week-long project tasks; these replace a previous course project that was a semester-long robotics competition.…

  20. A One-Year Introductory Robotics Curriculum for Computer Science Upperclassmen

    Science.gov (United States)

    Correll, N.; Wing, R.; Coleman, D.

    2013-01-01

    This paper describes a one-year introductory robotics course sequence focusing on computational aspects of robotics for third- and fourth-year students. The key challenges this curriculum addresses are "scalability," i.e., how to teach a robotics class with a limited amount of hardware to a large audience, "student assessment,"…

  1. Introductory Psychology: How Student Experiences Relate to Their Understanding of Psychological Science

    Science.gov (United States)

    Toomey, Thomas; Richardson, Deborah; Hammock, Georgina

    2017-01-01

    Many students who declare a psychology major are unaware that they are studying a scientific discipline, precipitating a need for exercises and experiences that help students understand the scientific nature of the discipline. The present study explores aspects of an introductory psychology class that may contribute to students' understanding of…

  2. Coverage of Industrial/Organizational Psychology in Introductory Psychology Textbooks: An Update.

    Science.gov (United States)

    Maynard, Douglas C.; Geberth, Karen L.; Joseph, Todd A.

    2002-01-01

    Examines the extent to which industrial/organizational (I/O) psychology is covered within introductory psychology textbooks (n=54). Determined whether I/O psychology was in a section, appendix, or chapter; and also compiled the number of pages that contained I/O psychology. Reports that only one-fourth of the textbooks had an overview. (CMK)

  3. Conceptual Framework to Help Promote Retention and Transfer in the Introductory Chemical Engineering Course

    Science.gov (United States)

    Hanyak, Michael E., Jr.

    2015-01-01

    In an introductory chemical engineering course, the conceptual framework of a holistic problem-solving methodology in conjunction with a problem-based learning approach has been shown to create a learning environment that nurtures deep learning rather than surface learning. Based on exam scores, student grades are either the same or better than…

  4. Assessment of the Effectiveness of the Studio Format in Introductory Undergraduate Biology

    Science.gov (United States)

    Montelone, Beth A.; Rintoul, David A.; Williams, Larry G.

    2008-01-01

    Kansas State University converted its introductory biology course, previously taught as an audio-tutorial (A-T), to a studio format in 1997. We share with others information about the process involved and present assessment data for the studio format course that address 1) student exam performance in A-T and studio; 2) student course grades in A-T…

  5. Teaching a Chemistry MOOC with a Virtual Laboratory: Lessons Learned from an Introductory Physical Chemistry Course

    Science.gov (United States)

    O'Malley, Patrick J.; Agger, Jonathan R.; Anderson, Michael W.

    2015-01-01

    An analysis is presented of the experience and lessons learned of running a MOOC in introductory physical chemistry. The course was unique in allowing students to conduct experimental measurements using a virtual laboratory constructed using video and simulations. A breakdown of the student background and motivation for taking the course is…

  6. Explaining Electromagnetic Plane Waves in a Vacuum at the Introductory Level

    Science.gov (United States)

    Allred, Clark L.; Della-Rose, Devin J.; Flusche, Brian M.; Kiziah, Rex R.; Lee, David J.

    2010-01-01

    A typical introduction to electromagnetic waves in vacuum is illustrated by the following quote from an introductory physics text: "Maxwell's equations predict that an electromagnetic wave consists of oscillating electric and magnetic fields. The changing fields induce each other, which maintains the propagation of the wave; a changing electric…

  7. Transversality of Electromagnetic Waves in the Calculus-Based Introductory Physics Course

    Science.gov (United States)

    Burko, Lior M.

    2008-01-01

    Introductory calculus-based physics textbooks state that electromagnetic waves are transverse and list many of their properties, but most such textbooks do not bring forth arguments why this is so. Both physical and theoretical arguments are at a level appropriate for students of courses based on such books, and could be readily used by…

  8. Making Politics "Click": The Costs and Benefits of Using Clickers in an Introductory Political Science Course

    Science.gov (United States)

    Evans, Heather K.

    2012-01-01

    In this article, the author addresses both the costs and benefits of implementing clickers into an introductory political science course. Comparing student responses to a mid-semester survey in both a clicker and non-clicker course, the results show that students have higher satisfaction of the course and instructor, higher exam scores, and feel…

  9. Ditching the Script: Moving beyond "Automatic Thinking" in Introductory Political Science Courses

    Science.gov (United States)

    Glover, Robert W.; Tagliarina, Daniel

    2011-01-01

    Political science is a challenging field, particularly when it comes to undergraduate teaching. If we are to engage in something more than uncritical ideological instruction, it demands from the student a willingness to approach alien political ideas with intellectual generosity. Yet, students within introductory classes often harbor inherited…

  10. Data Analysis and Graphing in an Introductory Physics Laboratory: Spreadsheet versus Statistics Suite

    Science.gov (United States)

    Peterlin, Primoz

    2010-01-01

    Two methods of data analysis are compared: spreadsheet software and a statistics software suite. Their use is compared analysing data collected in three selected experiments taken from an introductory physics laboratory, which include a linear dependence, a nonlinear dependence and a histogram. The merits of each method are compared. (Contains 7…

  11. Using Topic Order to Reinforce Student Algebra Skills in a Community College Introductory Chemistry Course

    Science.gov (United States)

    Blakely, Alan W.

    2011-01-01

    This article describes the impact of starting with gases in an introductory chemistry course at a community college. Students in the author's class frequently are very weak in algebra skills, and this has a cumulative impact over time that culminates in student struggles when moles and reaction stoichiometry are discussed. The rationale behind…

  12. Does Lecture Capturing Impact Student Performance and Attendance in an Introductory Accounting Course?

    Science.gov (United States)

    Aldamen, Husam; Al-Esmail, Rajab; Hollindale, Janice

    2015-01-01

    The study empirically examines the interplay between lecture capturing viewership, performance and attendance for students in the Middle Eastern country of Qatar. The sample consists of 254 students enrolled in an introductory accounting class either in the Fall semester or in the Spring semester. We show a weak positive relationship between…

  13. Learning the Brain in Introductory Psychology: Examining the Generation Effect for Mnemonics and Examples

    Science.gov (United States)

    McCabe, Jennifer A.

    2015-01-01

    The goal of this research was to determine whether there is a generation effect for learner-created keyword mnemonics and real-life examples, compared to instructor-provided materials, when learning neurophysiological terms and definitions in introductory psychology. Students participated in an individual (Study 1) or small-group (Study 2)…

  14. Student Success in Introductory Psychology: The Value of Teachers Knowing More about Their Students

    Science.gov (United States)

    Wu, Jennifer; Kraemer, Philipp

    2017-01-01

    This project describes the results from a large enrollment introductory psychology course specially designed to improve performance of first-year students. The main objective of the project was to identify early indicators of student success to inform future teaching and promote classroom engagement. Variables representing academic preparation,…

  15. The Lack of Representation of Educational Psychology and School Psychology in Introductory Psychology Textbooks

    Science.gov (United States)

    Lucas, Jennifer L.; Blazek, Melissa A.; Raley, Amber B.; Washington, Christi

    2005-01-01

    The first goal of this study was to look at the representation of educational and school psychology in introductory psychology textbooks. Research into the representation of other sub-fields of psychology has been conducted but no research has looked specifically at educational or school psychology. The second goal was to compare the…

  16. Dualism-Based Design of the Introductory Chinese MOOC "Kit de contact en langue chinoise"

    Science.gov (United States)

    Wang-Szilas, Jue; Bellassen, Joël

    2017-01-01

    This article reviews the existing Chinese language Massive Open Online Courses (MOOCs) and points out three problems in their design: the monism-based teaching method, the non-integration of cultural elements, and the lack of learner-learner interactions. It then presents the design principles of the Introductory Chinese MOOC in an attempt to…

  17. An Integrative Landscape-Scale Exercise for Introductory Soil Science Classes.

    Science.gov (United States)

    Levy, D. B.; Graham, R. C.

    1993-01-01

    Describes how teachers can improve introductory soil science courses by applying concepts taught in the classroom to actual field situations. Presents a specific example of a field exercise designed to illustrate soil properties and processes with respect to their environmental settings. (11 references) (Author/MCO)

  18. Looking for Work: The Coverage of Work in Canadian Introductory Sociology Textbooks

    Science.gov (United States)

    Dixon, Shane Michael; Quirke, Linda

    2014-01-01

    This paper examines the textual coverage of the topic of work in Canadian English--language introductory sociology textbooks. Our findings are based on a content analysis of 21 Canadian texts published between 2008 and 2012. We found that only 12 of 21 textbooks included a chapter on work, suggesting that work occupies a peripheral position in…

  19. Another Nibble at the Core: Student Learning in a Thematically-Focused Introductory Sociology Course

    Science.gov (United States)

    Howard, Jay R.; Novak, Katherine B.; Cline, Krista M. C.; Scott, Marvin B.

    2014-01-01

    Identifying and assessing core knowledge has been and continues to be a challenge that vexes the discipline of sociology. With the adoption of a thematic approach to courses in the core curriculum at Butler University, faculty teaching Introductory Sociology were presented with the opportunity and challenge of defining the core knowledge and…

  20. The Effect of Relevance Strategies on Student Perceptions of Introductory Courses

    Science.gov (United States)

    Fedesco, Heather N.; Kentner, Ashley; Natt, Jane

    2017-01-01

    The purpose of this study was to test whether increasing the relevancy of course assignments in a large multisection introductory public-speaking course would lead to improvements in student perceptions of course outcomes. Survey responses from 1,878 students were analyzed to test whether differences exist between students enrolled in classes held…

  1. A Tutorial Design Process Applied to an Introductory Materials Engineering Course

    Science.gov (United States)

    Rosenblatt, Rebecca; Heckler, Andrew F.; Flores, Katharine

    2013-01-01

    We apply a "tutorial design process", which has proven to be successful for a number of physics topics, to design curricular materials or "tutorials" aimed at improving student understanding of important concepts in a university-level introductory materials science and engineering course. The process involves the identification…

  2. Guided Inquiry Activities for Learning about the Macro- and Micronutrients in Introductory Nutrition Courses

    Science.gov (United States)

    Smith, Andri L.; Purcell, Rebecca J.; Vaughan, Joel M.

    2015-01-01

    Most students enroll in general education introductory nutrition classes because they want to improve their diets in order to lose weight or enhance athletic performance. These nonscience majors are often less interested in learning about the fundamental biochemical principles underlying nutrition or are surprised that this foundational knowledge…

  3. An Engineering-Oriented Approach to the Introductory Differential Equations Course

    Science.gov (United States)

    Pennell, S.; Avitabile, P.; White, J.

    2009-01-01

    The introductory differential equations course can be made more relevant to engineering students by including more of the engineering viewpoint, in which differential equations are regarded as systems with inputs and outputs. This can be done without sacrificing any of the usual topical coverage. This point of view is conducive to student…

  4. Beyond Euler's Method: Implicit Finite Differences in an Introductory ODE Course

    Science.gov (United States)

    Kull, Trent C.

    2011-01-01

    A typical introductory course in ordinary differential equations (ODEs) exposes students to exact solution methods. However, many differential equations must be approximated with numerical methods. Textbooks commonly include explicit methods such as Euler's and Improved Euler's. Implicit methods are typically introduced in more advanced courses…

  5. Understanding Introductory Students' Application of Integrals in Physics from Multiple Perspectives

    Science.gov (United States)

    Hu, Dehui

    2013-01-01

    Calculus is used across many physics topics from introductory to upper-division level college courses. The concepts of differentiation and integration are important tools for solving real world problems. Using calculus or any mathematical tool in physics is much more complex than the straightforward application of the equations and algorithms that…

  6. Food Preparation and Service. An Introductory Course for Food Services Careers.

    Science.gov (United States)

    Douma, Elaine L.

    Intended for use in a comprehensive senior high school, this curriculum guide for an introductory laboratory course focuses on the development of abilities, attitudes, and personal qualities which would lead to job success at the entry level in the food service industry, including in the areas of cooking, waitressing, supermarkets, and similar…

  7. Spanish Is Foreign: Heritage Speakers' Interpretations of the Introductory Spanish Language Curriculum

    Science.gov (United States)

    DeFeo, Dayna Jean

    2015-01-01

    This article presents a case study of the perceptions of Spanish heritage speakers enrolled in introductory-level Spanish foreign language courses. Despite their own identities that were linked to the United States and Spanish of the Borderlands, the participants felt that the curriculum acknowledged the Spanish of Spain and foreign countries but…

  8. The Analysis of Analogy Use in the Teaching of Introductory Quantum Theory

    Science.gov (United States)

    Didis, Nilufer

    2015-01-01

    This study analyzes the analogies used in the teaching of introductory quantum theory concepts. Over twelve weeks, the researcher observed each class for a semester and conducted interviews with the students and the instructor. In the interviews, students answered questions about quantum theory concepts, which the instructor had taught them using…

  9. Learning as Accessing a Disciplinary Discourse: Integrating Academic Literacy into Introductory Physics through Collaborative Partnership

    Science.gov (United States)

    Marshall, Delia; Conana, Honjiswa; Maclon, Rohan; Herbert, Mark; Volkwyn, Trevor

    2011-01-01

    This paper examines a collaborative partnership between discipline lecturers and an academic literacy practitioner in the context of undergraduate physics. Gee's sociocultural construct of Discourse is used as a framework for the design of an introductory physics course, explicitly framed around helping students access the disciplinary discourse…

  10. Degree of Mathematics Fluency and Success in Second-Semester Introductory Chemistry

    Science.gov (United States)

    Leopold, Doreen Geller; Edgar, Barbara

    2008-01-01

    We report on the contents and results for 360 students of a mathematics assessment administered at the start of the second-semester introductory chemistry course required for science and engineering majors at the University of Minnesota. This calculator-free, 20-question, 30-minute, multiple-choice, diagnostic quiz includes questions selected…

  11. How Are Non-Geography Majors Motivated in a Large Introductory World Geography Course?

    Science.gov (United States)

    Park, Seung Won; Huynh, Niem Tu

    2015-01-01

    University students who do not declare geography as their major are at risk of poor motivation to learn in an introductory geography class. However, research exploring the role of non-majors' motivation is lacking. This study examines motivational factors impacting non-geography students' engagement and performance. The findings suggest that…

  12. Republication of "Experiencing Management: A Comprehensive, 'Hands-On' Model for the Introductory Undergraduate Management Course"

    Science.gov (United States)

    Miller, John A.

    2017-01-01

    The purpose of this article is to describe an experiential course designed to overcome the specific problems inherent in working with undergraduate students in introductory management courses. The article grew out of discussions among faculty at the 1988 Academy of Management meetings who shared deep concerns about the quality of undergraduate…

  13. Chemical Structure and Properties: A Modified Atoms-First, One-Semester Introductory Chemistry Course

    Science.gov (United States)

    Schaller, Chris P.; Graham, Kate J.; Johnson, Brian J.; Jakubowski, Henry V.; McKenna, Anna G.; McIntee, Edward J.; Jones, T. Nicholas; Fazal, M. A.; Peterson, Alicia A.

    2015-01-01

    A one-semester, introductory chemistry course is described that develops a primarily qualitative understanding of structure-property relationships. Starting from an atoms-first approach, the course examines the properties and three-dimensional structure of metallic and ionic solids before expanding into a thorough investigation of molecules. In…

  14. Particle in a Box: An Experiential Environment for Learning Introductory Quantum Mechanics

    Science.gov (United States)

    Anupam, Aditya; Gupta, Ridhima; Naeemi, Azad; JafariNaimi, Nassim

    2018-01-01

    Quantum mechanics (QMs) is a foundational subject in many science and engineering fields. It is difficult to teach, however, as it requires a fundamental revision of the assumptions and laws of classical physics and probability. Furthermore, introductory QM courses and texts predominantly focus on the mathematical formulations of the subject and…

  15. Use of Multimedia in an Introductory College Biology Course to Improve Comprehension of Complex Material

    Science.gov (United States)

    Rhodes, Ashley; Rozell, Tim; Shroyer, Gail

    2014-01-01

    Many students who have the ability to succeed in science, technology, engineering and math (STEM) disciplines are often alienated by the traditional instructional methods encountered within introductory courses; as a result, attrition from STEM fields is highest after completion of these courses. This is especially true for females. The present…

  16. "But I Thought I Knew That!" Student Confidence Judgments on Course Examinations in Introductory Psychology

    Science.gov (United States)

    Nevid, Jeffrey S.; Cheney, Brianna; Thompson, Clarissa

    2015-01-01

    Students in an introductory psychology class rated their level of confidence in their answers to exam questions on four multiple-choice exams through the course of a semester. Correlations between confidence judgments and accuracy (correct vs. incorrect) at the individual item level showed modest but significant relationships for item sets scaled…

  17. Using Action Verbs as Learning Outcomes: Applying Bloom's Taxonomy in Measuring Instructional Objectives in Introductory Psychology

    Science.gov (United States)

    Nevid, Jeffrey S.; McClelland, Nate

    2013-01-01

    We used a set of action verbs based on Bloom's taxonomy to assess learning outcomes in two college-level introductory psychology courses. The action verbs represented an acronym, IDEA, comprising skills relating to identifying, defining or describing, evaluating or explaining, and applying psychological knowledge. Exam performance demonstrated…

  18. Developing and Implementing a Simple, Affordable Hydrogen Fuel Cell Laboratory in Introductory Chemistry

    Science.gov (United States)

    Klara, Kristina; Hou, Ning; Lawman, Allison; Wu, Liheng; Morrill, Drew; Tente, Alfred; Wang, Li-Qiong

    2014-01-01

    A simple, affordable hydrogen proton exchange membrane (PEM) fuel cell laboratory was developed through a collaborative effort between faculty and undergraduate students at Brown University. It has been incorporated into the introductory chemistry curriculum and successfully implemented in a class of over 500 students per academic year for over 3…

  19. Mass-Elastic Band Thermodynamics: A Visual Teaching Aid at the Introductory Level

    Science.gov (United States)

    Galley, William C.

    2007-01-01

    The analysis a recently developed mass-elastic band process that will help in providing a better understanding of various aspects of chemical thermodynamics. These processes also include the use of a visual teaching aid at the introductory level, which helps students to think better.

  20. Success in an Introductory Operations Research Course: A Case Study at the United Arab Emirates University

    Science.gov (United States)

    Yousef, Darwish Abdulrahman

    2009-01-01

    Purpose: The purpose of this paper is to examine the influence of a number of factors such as high school major, high school score, gender, Stat105, Maths I, Maths II grades, and grade point average (GPA) on students' academic performance in an introductory operations research (OR) course at the department of Business Administration--College of…