Laser Welding Process Parameters Optimization Using Variable-Fidelity Metamodel and NSGA-II

Directory of Open Access Journals (Sweden)

Wang Chaochao

2017-01-01

Full Text Available An optimization methodology based on variable-fidelity (VF metamodels and nondominated sorting genetic algorithm II (NSGA-II for laser bead-on-plate welding of stainless steel 316L is presented. The relationships between input process parameters (laser power, welding speed and laser focal position and output responses (weld width and weld depth are constructed by VF metamodels. In VF metamodels, the information from two levels fidelity models are integrated, in which the low-fidelity model (LF is finite element simulation model that is used to capture the general trend of the metamodels, and high-fidelity (HF model which from physical experiments is used to ensure the accuracy of metamodels. The accuracy of the VF metamodel is verified by actual experiments. To slove the optimization problem, NSGA-II is used to search for multi-objective Pareto optimal solutions. The results of verification experiments show that the obtained optimal parameters are effective and reliable.

Maximum generation power evaluation of variable frequency offshore wind farms when connected to a single power converter

Energy Technology Data Exchange (ETDEWEB)

Gomis-Bellmunt, Oriol; Sumper, Andreas [Centre d' Innovacio Tecnologica en Convertidors Estatics i Accionaments (CITCEA-UPC), Universitat Politecnica de Catalunya UPC, Av. Diagonal, 647, Pl. 2, 08028 Barcelona (Spain); IREC Catalonia Institute for Energy Research, Barcelona (Spain); Junyent-Ferre, Adria; Galceran-Arellano, Samuel [Centre d' Innovacio Tecnologica en Convertidors Estatics i Accionaments (CITCEA-UPC), Universitat Politecnica de Catalunya UPC, Av. Diagonal, 647, Pl. 2, 08028 Barcelona (Spain)

2010-10-15

The paper deals with the evaluation of power generated by variable and constant frequency offshore wind farms connected to a single large power converter. A methodology to analyze different wind speed scenarios and system electrical frequencies is presented and applied to a case study, where it is shown that the variable frequency wind farm concept (VF) with a single power converter obtains 92% of the total available power, obtained with individual power converters in each wind turbine (PC). The PC scheme needs multiple power converters implying drawbacks in terms of cost, maintenance and reliability. The VF scheme is also compared to a constant frequency scheme CF, and it is shown that a significant power increase of more than 20% can be obtained with VF. The case study considers a wind farm composed of four wind turbines based on synchronous generators. (author)

75 FR 64699 - Grant of Authority for Subzone Status; VF Corporation (Apparel, Footwear and Luggage Distribution...

Science.gov (United States)

2010-10-20

... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [Order No. 1714] Grant of Authority for Subzone Status; VF Corporation (Apparel, Footwear and Luggage Distribution), Martinsville, VA Pursuant to its... authority for subzone status for activity related to apparel, footwear and luggage warehousing and...

Soil variability in mountain areas

OpenAIRE

Zanini, E.; Freppaz, M.; Stanchi, S.; Bonifacio, E.; Egli, M.

2015-01-01

The high spatial variability of soils is a relevant issue at local and global scales, and determines the complexity of soil ecosystem functions and services. This variability derives from strong dependencies of soil ecosystems on parent materials, climate, relief and biosphere, including human impact. Although present in all environments, the interactions of soils with these forming factors are particularly striking in mountain areas.

Nonlinear Dynamics of Permanent-magnet Synchronous Motor with v/f Control

International Nuclear Information System (INIS)

Wei Du-Qu; Luo Xiao-Shu; Zhang Bo; Qiu Dong-Yuan

2013-01-01

The nonlinear dynamics of permanent-magnet synchronous motor (PMSM) with v/f control signals is investigated intensively. First, the equilibria and steady-state characteristics of the system are formulated by analytical analysis. Then, some of its basic dynamical properties, such as characteristic eigenvalues, Lyapunov exponents and phase trajectories are studied by varying the values of system parameters. It is found that when the values of the system parameters are smaller, the PMSM operates in stable domains, no matter what the values of control gains are. With the values of parameters increasing, the unstability appears and PMSM falls into chaotic operation. Furthermore, the complex dynamic behaviors are verified by means of simulation. (general)

Evolution of V.F. Gening’s views and other researcher’s ones on the Mazuninskaya culture

Directory of Open Access Journals (Sweden)

Ostanina Taisiya I.

2014-03-01

Full Text Available The history of studies of the Mazunino culture (3rd -5th centuries AD located in the Middle Kama region is traced. Vladimir Fyodorovich Gening, a prominent Soviet archaeologist, was the first to start research on this culture and offer its theoretical substantiation. As a result of surveys and excavations conducted in Udmurtia and Bashkiria starting 1954, he accumulated a vast archaeological material related to the culture. A thorough analysis of V.F. Gening’s publications and essays on the Mazunino culture sites is provided. The evolution of the scholar’s views regarding the culture basic elements (territory, implements, burial rite, dating, origin, cultural ties and further fate are traced in the article. Later on, the study of new, previously unknown monuments made it possible to expand the knowledge of quite a number of problems related to the early Middle Ages in the Middle Kama River region, including those regarding the Mazunino culture. This resulted in the formation of differing viewpoints concerning the culture among both V.F. Gening’s contemporaries and further generation of researchers, and their views are also discussed and analyzed.

Seasonal variability in nitrate and phosphate uptake kinetics in a forested headwater stream using pulse nutrient additions

Science.gov (United States)

Griffiths, N. A.; Mulholland, P. J.

2011-12-01

We used the Tracer Additions for Spiraling Curve Characterization (TASCC) approach to quantify seasonal variability in ambient nutrient spiraling metrics and nutrient uptake kinetics in the West Fork of Walker Branch, a forested headwater stream in eastern Tennessee, USA. We performed instantaneous additions of nitrate (NO3-) and phosphate (PO4-3) separately with a conservative tracer (chloride, Cl-) during the following biologically-important time periods: autumn (during leaf fall, high organic matter [OM] standing stocks), winter (low OM standing stocks), spring (prior to canopy closure), and summer (closed canopy). We predicted that nutrient demand would be highest during autumn and spring, as OM inputs fuel heterotrophic respiration and high light availability stimulates autotrophic production, respectively. The measured ambient PO4-3 uptake rates (Vf-amb) followed our predictions, with the highest Vf-amb rates in autumn (Vf-amb = 2.8 mm/min) and spring (Vf-amb = 2.9 mm/min), and undetectable uptake in winter. Further, maximum areal PO4-3 uptake rates (Umax) were higher in autumn (Umax = 297 μg/m2/min) than spring (Umax = 106 μg/m2/min), possibly due to greater nutrient demand of heterotrophs on leaf litter accumulations. Contrary to our predictions, ambient NO3- uptake rates were highest in autumn and winter (autumn: Vf-amb = 2.8 mm/min, winter: Vf-amb = 2.4 mm/min), and lowest in spring (Vf-amb = 1.0 mm/min). The higher than expected Vf-amb rate in winter may be due to higher stream metabolism rates and thus greater nitrogen demand; the lower than expected Vf-amb rate in spring may reflect an alleviation of nitrogen demand due to high ammonium concentrations during this time. As the demand for both nitrogen and phosphorus in Walker Branch is greatest in autumn, future work will characterize how nutrient metrics change during this dynamic time period (i.e., before, during, and after leaf fall).

Izviđanje radio-komunikacija u VF opsegu u funkciji savremenih operacija / Communication intelligence in HF range as support of modern operations

Directory of Open Access Journals (Sweden)

Miljko Erić

2004-05-01

Full Text Available U ovom radu je, polazeći od opštih principa izviđanja radio-komunikacija analiziran problem izviđanja radio-komunikacija u VF opsegu 1,6-30 MHz na operativno-strategijskom nivou koje se sprovodi u funkciji obaveštajnog obezbeđenja. Izložen je koncept širokopojasnog multifunkcionalnog radio-goniometra u kojem su integrisane funkcije automatskog presretanja i goniometrisanja signala, koji treba da omogući trenutni i potpuni nadzor (otkrivanje i goniometrisanje svih aktivnih emisija u kompletnom VF frekvencijskom opsegu koje nisu kraće od 10 ms. Ovaj goniometar predstavlja osnovicu budućeg automatizovanog radioizviđačkog sistema za VF opseg, koji sistemu komandovanja savremenim operacijama treba da omogući potpuni uvid u stanje, odnosno praćenje aktivnosti radio-komunikacija u kompletnom VF opsegu, što postojeći sistem za izviđanje VF frekvencijskog opsega ne obezbeđuje. Izložena problematika zasniva se na analizi iskustava i trendova u ovoj oblasti u svetu, na iskustvima stečenim u VTI kroz dosadašnje istraživačke i razvojne zadatke, posebno kroz razvoj i terenska ispitivanja radio-goniometra za VVF/UVF opseg. / Starting from the elaboration of the basic principles of communication intelligence, a problem of communication intelligence in HF range 1,6-30 MHz on the operational-strategic level is analyzed in detail. A concept of the wide-band multifunctional direction finder with integrated intercept and direction finding functions is presented. The direction finder should provide complete surveillance of the HF range and interception with direction finding of all active signals in given frequency range which are not shorter than 10 ms. The direction finder is the key element of the future automated radio reconnaissance system for the HF range, that should provide a complete insight of the signal activities in the HF range, which the existing communication intelligence system does not provide. The subject matter of this paper

THE EFFECTS OF CLIMATIC VARIABLES AND CROP AREA ON MAIZE YIELD AND VARIABILITY IN GHANA

Directory of Open Access Journals (Sweden)

Henry De-Graft Acquah

2012-10-01

Full Text Available Climate change tends to have negative effects on crop yield through its influence on crop production. Understanding the relationship between climatic variables and crop area on the mean and variance of crop yield will facilitate development of appropriate policies to cope with climate change. This paper examines the effects of climatic variables and crop area on the mean and variance of maize yield in Ghana. The Just and Pope stochastic production function using the Cobb-Douglas functional form was employed. The results show that average maize yield is positively related to crop area and negatively related to rainfall and temperature. Furthermore, increase in crop area and temperature will enlarge maize yield variability while rainfall increase will decrease the variability in maize yield.

Variability of rainfall over small areas

Science.gov (United States)

Runnels, R. C.

1983-01-01

A preliminary investigation was made to determine estimates of the number of raingauges needed in order to measure the variability of rainfall in time and space over small areas (approximately 40 sq miles). The literature on rainfall variability was examined and the types of empirical relationships used to relate rainfall variations to meteorological and catchment-area characteristics were considered. Relations between the coefficient of variation and areal-mean rainfall and area have been used by several investigators. These parameters seemed reasonable ones to use in any future study of rainfall variations. From a knowledge of an appropriate coefficient of variation (determined by the above-mentioned relations) the number rain gauges needed for the precise determination of areal-mean rainfall may be calculated by statistical estimation theory. The number gauges needed to measure the coefficient of variation over a 40 sq miles area, with varying degrees of error, was found to range from 264 (10% error, mean precipitation = 0.1 in) to about 2 (100% error, mean precipitation = 0.1 in).

Thermal fluctuations induced in a conducting wall by mixing sodium jets: an application of TRIO-VF using Large Eddy Simulation modelling

International Nuclear Information System (INIS)

Menant, B.; Villand, M.

1994-01-01

The general-purpose thermal-hydraulics program TRIO-VF allows explicit simulation of the main instabilities in an un-compressible flow: it has been applied to the prediction of flow instabilities in a sodium hot jet through a transverse cold flow. in front of a conducting wall. The temperature fluctuations induced in the flow and the wall are studied and an acute skin-effect is evidenced. The temperature gradients (including three components) are analysed: temperature gradients up to 20000 degrees per meter are currently seen in the skin. They are due to the very strong value of the unstationary component normal to the fluid-wall interface. The limitations of TRIO-VF in the present state, and the lack of experimental support for validation does not allow to promise quantitative applications of this modelling to complex industrial situations nowadays, but we hope these applications are for tomorrow. (author)

An adaptive sampling method for variable-fidelity surrogate models using improved hierarchical kriging

Science.gov (United States)

Hu, Jiexiang; Zhou, Qi; Jiang, Ping; Shao, Xinyu; Xie, Tingli

2018-01-01

Variable-fidelity (VF) modelling methods have been widely used in complex engineering system design to mitigate the computational burden. Building a VF model generally includes two parts: design of experiments and metamodel construction. In this article, an adaptive sampling method based on improved hierarchical kriging (ASM-IHK) is proposed to refine the improved VF model. First, an improved hierarchical kriging model is developed as the metamodel, in which the low-fidelity model is varied through a polynomial response surface function to capture the characteristics of a high-fidelity model. Secondly, to reduce local approximation errors, an active learning strategy based on a sequential sampling method is introduced to make full use of the already required information on the current sampling points and to guide the sampling process of the high-fidelity model. Finally, two numerical examples and the modelling of the aerodynamic coefficient for an aircraft are provided to demonstrate the approximation capability of the proposed approach, as well as three other metamodelling methods and two sequential sampling methods. The results show that ASM-IHK provides a more accurate metamodel at the same simulation cost, which is very important in metamodel-based engineering design problems.

Døvfødte børn og deres livsbetingelser

DEFF Research Database (Denmark)

Bengtsson, Steen; Larsen, Lena Bech; Lindsay Sommer, Mette

Formålet med denne rapport er at give et bredt billede af levevilkår for den første generation af døvfødte børn, som er vokset op med behandlingen Cochlear Implantat (CI), og derved får bedre mulighed for at lære at lytte og tale. CI har betydet et stort fremskridt for mennesker, der bliver født...... døve. De får således lært at læse meget bedre end gruppen tidligere gjorde. CI løser dog langtfra alle problemer. Rapporten viser, at selv om børnene nu har mulighed for at kommunikere ved at lytte og tale, er de slet ikke kommet på linje med gruppen af børn, som er født uden hørehandicap. Baggrunden...... for dette er dels, at deres hørelse begynder at fungere senere end andre børns, dels at hørelse med CI slet ikke har samme kvalitet som naturlig hørelse. Det er vanskeligt at følge med, når flere mennesker deltager i samtaler, og i uformelle sammenhænge, fx sammen med kammerater. Undersøgelsen er bestilt af...

Variability of pesticide residues in eggplant units collected from a field trial and marketplaces in Greece.

Science.gov (United States)

Prodhan, Mohammad Dalower Hossain; Papadakis, Emmanouil-Nikolaos; Papadopoulou-Mourkidou, Euphemia

2018-04-01

Variability of pesticide residues among food items is very important when assessing the risks and food safety for the consumers. Therefore, the present study was undertaken to estimate the unit-to-unit residue variability factors for eggplant. In total, 120 samples from a trial field and 142 samples from different marketplaces in Thessaloniki, Greece, were collected to estimate the variability of pesticide residues in eggplant units. They were extracted by the QuEChERS method and the residues were determined by LC-MS/MS. For the field samples, the unit-to-unit variability factors (VFs) obtained for cypermethrin and deltamethrin residues were 2.54 and 2.51, respectively. The mean residue levels of both pesticides were higher in the composite samples than in the individual samples. The average VFs for the marketplace samples was 3.89. The eggplant units exposed to pesticides were higher in residues than the non-exposed units. The variability factors obtained in the marketplace samples were higher than those in the samples collected from the field trial. A default VF value of 3 for field trials is appropriate for use when assessing the acute dietary intake but a VF for the marketplace samples should be reconsidered with a larger data. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

[French translation and validation of a short version of the Suicide Intervention Response Inventory-2 (SIRI-2-VF)].

Science.gov (United States)

Kopp-Bigault, C; Audouard-Marzin, Y; Scouarnec, P; Beauchamp, G; Séguin, M; Walter, M

2017-10-30

Training health professionals about suicidal crisis is one major line of suicide prevention worldwide. France has one of the highest suicide rates in Europe, and although crisis intervention training has been set up since 2001, there presently is no training assessment tool in the French language for health professionals trained in suicide prevention. In the four levels of Kirpatrick's education pyramid, training that takes place in France today solely assesses level one status, that is to say relative to the level of satisfaction of participants (self-report). This study proposes a validated short French version of the Suicide Intervention Response Inventory-2 (SIRI-2) of Neimeyer & Mc Innes. The SIRI-2 questionnaire assesses the ability of first line intervention in dealing with suicidal individuals. The translation methodology was inspired from Vallerand's model of cross-cultural back translation. This method is regularly used for translating from the English language to a French version. In order to translate the English version, we used an extensive 7-step methodology implicating several bilingual translators, expert reviewers (psychologists and psychiatrists) and a scientific committee. Participants were 107 students from different French universities and study programs: psychology, medicine and nursing (17 were men; average age was 26.6). Fifteen of these participants answered the SIRI-2-VF on two occasions (separated by a 15-day interval) in order to estimate the temporal stability of the instrument. The scores of the students were compared to six French experts in suicide prevention and with the original expert group who worked on the development of SIRI-2 (n=7). We used Student t Test for construct validity, Cronbach's Alpha for internal consistency and Pearson's correlation coefficient for temporal stability. Following a fidelity comparison of the results of the French experts with those of the American experts, ten items presenting the least good

Understanding Hydrological Processes in Variable Source Areas in the Glaciated Northeastern US Watersheds under Variable Climate Conditions

Science.gov (United States)

Steenhuis, T. S.; Azzaino, Z.; Hoang, L.; Pacenka, S.; Worqlul, A. W.; Mukundan, R.; Stoof, C.; Owens, E. M.; Richards, B. K.

2017-12-01

The New York City source watersheds in the Catskill Mountains' humid, temperate climate has long-term hydrological and water quality monitoring data It is one of the few catchments where implementation of source and landscape management practices has led to decreased phosphorus concentration in the receiving surface waters. One of the reasons is that landscape measures correctly targeted the saturated variable source runoff areas (VSA) in the valley bottoms as the location where most of the runoff and other nonpoint pollutants originated. Measures targeting these areas were instrumental in lowering phosphorus concentration. Further improvements in water quality can be made based on a better understanding of the flow processes and water table fluctuations in the VSA. For that reason, we instrumented a self-contained upland variable source watershed with a landscape characteristic of a soil underlain by glacial till at shallow depth similar to the Catskill watersheds. In this presentation, we will discuss our experimental findings and present a mathematical model. Variable source areas have a small slope making gravity the driving force for the flow, greatly simplifying the simulation of the flow processes. The experimental data and the model simulations agreed for both outflow and water table fluctuations. We found that while the flows to the outlet were similar throughout the year, the discharge of the VSA varies greatly. This was due to transpiration by the plants which became active when soil temperatures were above 10oC. We found that shortly after the temperature increased above 10oC the baseflow stopped and only surface runoff occurred when rainstorms exceeded the storage capacity of the soil in at least a portion of the variable source area. Since plant growth in the variable source area was a major variable determining the base flow behavior, changes in temperature in the future - affecting the duration of the growing season - will affect baseflow and

Development and validation of a Luminex assay for detection of a predictive biomarker for PROSTVAC-VF therapy

Science.gov (United States)

Lucas, Julie L.; Tacheny, Erin A.; Ferris, Allison; Galusha, Michelle; Srivastava, Apurva K.; Ganguly, Aniruddha; Williams, P. Mickey; Sachs, Michael C.; Thurin, Magdalena; Tricoli, James V.; Ricker, Winnie; Gildersleeve, Jeffrey C.

2017-01-01

Cancer therapies can provide substantially improved survival in some patients while other seemingly similar patients receive little or no benefit. Strategies to identify patients likely to respond well to a given therapy could significantly improve health care outcomes by maximizing clinical benefits while reducing toxicities and adverse effects. Using a glycan microarray assay, we recently reported that pretreatment serum levels of IgM specific to blood group A trisaccharide (BG-Atri) correlate positively with overall survival of cancer patients on PROSTVAC-VF therapy. The results suggested anti-BG-Atri IgM measured prior to treatment could serve as a biomarker for identifying patients likely to benefit from PROSTVAC-VF. For continued development and clinical application of serum IgM specific to BG-Atri as a predictive biomarker, a clinical assay was needed. In this study, we developed and validated a Luminex-based clinical assay for measuring serum IgM specific to BG-Atri. IgM levels were measured with the Luminex assay and compared to levels measured using the microarray for 126 healthy individuals and 77 prostate cancer patients. This assay provided reproducible and consistent results with low %CVs, and tolerance ranges were established for the assay. IgM levels measured using the Luminex assay were found to be highly correlated to the microarray results with R values of 0.93–0.95. This assay is a Laboratory Developed Test (LDT) and is suitable for evaluating thousands of serum samples in CLIA certified laboratories that have validated the assay. In addition, the study demonstrates that discoveries made using neoglycoprotein-based microarrays can be readily migrated to a clinical assay. PMID:28771597

Leaf area index from litter collection: impact of specific leaf area variability within a beech stand

Energy Technology Data Exchange (ETDEWEB)

Bouriaud, O. [Inst. National de la Recherche Agronomique, Centre de Recherches Forestieres de Nancy, Champenoux (France); Soudani, K. [Univ. Paris-Sud XI, Dept. d' Ecophysiologie Vegetale, Lab. Ecologie Systematique et Evolution, Orsay Cedex (France); Breda, N. [Inst. National de la Recherche Agronomique, Centre de Recherches Forestieres de Nancy, Champenoux (France)

2003-06-01

Litter fall collection is a direct method widely used to estimate leaf area index (LAI) in broad-leaved forest stands. Indirect measurements using radiation transmittance and gap fraction theory are often compared and calibrated against litter fall, which is considered as a reference method, but few studies address the question of litter specific leaf area (SLA) measurement and variability. SLA (leaf area per unit of dry weight, m{sup 2}{center_dot}g{sup -1}) is used to convert dry leaf litter biomass (g .m{sup -}2) into leaf area per ground unit area (m{sup 2}{center_dot}m{sup -2}). We paid special attention to this parameter in two young beech stands (dense and thinned) in northeastern France. The variability of both canopy (closure, LAI) and site conditions (soil properties, vegetation) was investigated as potential contributing factors to beech SLA variability. A systematic description of soil and floristic composition was performed and three types of soil were identified. Ellenberg's indicator values were averaged for each plot to assess nitrogen soil content. SLA of beech litter was measured three times during the fall in 23 plots in the stands (40 ha). Litter was collected bimonthly in square-shaped traps (0.5 m{sup 2}) and dried. Before drying, 30 leaves per plot and for each date were sampled, and leaf length, width, and area were measured with the help of a LI-COR areameter. SLA was calculated as the ratio of cumulated leaf area to total dry weight of the 30 leaves. Leaves characteristics per plot were averaged for the three dates of litter collection. Plant area index (PAI), estimated using the LAI-2000 plant canopy analyser and considering only the upper three rings, ranged from 2.9 to 8.1. Specific leaf area of beech litter was also highly different from one plot to the other, ranging from 150 to 320 cm{sup 2}{center_dot}g{sup -1}. Nevertheless, no relationship was found between SLA and stand canopy closure or PAI On the contrary, a significant

Leaf area index from litter collection: impact of specific leaf area variability within a beech stand

International Nuclear Information System (INIS)

Bouriaud, O.; Soudani, K.; Breda, N.

2003-01-01

Litter fall collection is a direct method widely used to estimate leaf area index (LAI) in broad-leaved forest stands. Indirect measurements using radiation transmittance and gap fraction theory are often compared and calibrated against litter fall, which is considered as a reference method, but few studies address the question of litter specific leaf area (SLA) measurement and variability. SLA (leaf area per unit of dry weight, m 2 ·g -1 ) is used to convert dry leaf litter biomass (g .m - 2) into leaf area per ground unit area (m 2 ·m -2 ). We paid special attention to this parameter in two young beech stands (dense and thinned) in northeastern France. The variability of both canopy (closure, LAI) and site conditions (soil properties, vegetation) was investigated as potential contributing factors to beech SLA variability. A systematic description of soil and floristic composition was performed and three types of soil were identified. Ellenberg's indicator values were averaged for each plot to assess nitrogen soil content. SLA of beech litter was measured three times during the fall in 23 plots in the stands (40 ha). Litter was collected bimonthly in square-shaped traps (0.5 m 2 ) and dried. Before drying, 30 leaves per plot and for each date were sampled, and leaf length, width, and area were measured with the help of a LI-COR areameter. SLA was calculated as the ratio of cumulated leaf area to total dry weight of the 30 leaves. Leaves characteristics per plot were averaged for the three dates of litter collection. Plant area index (PAI), estimated using the LAI-2000 plant canopy analyser and considering only the upper three rings, ranged from 2.9 to 8.1. Specific leaf area of beech litter was also highly different from one plot to the other, ranging from 150 to 320 cm 2 ·g -1 . Nevertheless, no relationship was found between SLA and stand canopy closure or PAI On the contrary, a significant relationship between SLA and soil properties was observed. Both SLA

Relationship between abdominal fat area measured by screening abdominal fat CT and metabolic syndrome in asymptomatic Korean individuals

Energy Technology Data Exchange (ETDEWEB)

Park, Dae Woong; Park, Noh Hyuck; Park, Ji Yeon; Kim, Seon Jeong [Dept. of Radiology, MyoungJi Hospital, Seonam University College of Medicine, Goyang (Korea, Republic of)

2017-07-15

The purpose of this study was to investigate the relationship between abdominal fat as assessed by abdominal fat CT and metabolic syndrome (MS), especially in asymptomatic Korean individuals. Retrospectively, a medical record analysis was performed in a total of 111 patients with screening abdominal fat CT. The data such as visceral fat (VF), subcutaneous fat (SF) and VF/SF were elicited by abdominal fat CT, and we analyzed the relationship of VF, SF, and VF/SF with MS and cardiovascular risk factors. In males, VF and SF had a positive correlation with many cardiovascular risk factors and MS, but VF was superior to SF. In females, VF, but not SF, had a positive correlation with some cardiovascular risk factors and MS. The cut-off values of VF and SF to predict MS, which were calculated by drawing receiver operating characteristic curves, were as follows: the cut-off value of VF in men: 136.50 cm{sup 2}, the cut-off value of SF in men: 159.50 cm{sup 2}, and the cut-off value of VF in women: 134.50 cm{sup 2}. In conclusion, VF accumulation was the best predictor of MS and it had a positive correlation with cardiovascular risk factors in both sexes. SF also had a significant association with MS, especially in men, although it was not superior to VF.

Relationship between abdominal fat area measured by screening abdominal fat CT and metabolic syndrome in asymptomatic Korean individuals

International Nuclear Information System (INIS)

Park, Dae Woong; Park, Noh Hyuck; Park, Ji Yeon; Kim, Seon Jeong

2017-01-01

The purpose of this study was to investigate the relationship between abdominal fat as assessed by abdominal fat CT and metabolic syndrome (MS), especially in asymptomatic Korean individuals. Retrospectively, a medical record analysis was performed in a total of 111 patients with screening abdominal fat CT. The data such as visceral fat (VF), subcutaneous fat (SF) and VF/SF were elicited by abdominal fat CT, and we analyzed the relationship of VF, SF, and VF/SF with MS and cardiovascular risk factors. In males, VF and SF had a positive correlation with many cardiovascular risk factors and MS, but VF was superior to SF. In females, VF, but not SF, had a positive correlation with some cardiovascular risk factors and MS. The cut-off values of VF and SF to predict MS, which were calculated by drawing receiver operating characteristic curves, were as follows: the cut-off value of VF in men: 136.50 cm"2, the cut-off value of SF in men: 159.50 cm"2, and the cut-off value of VF in women: 134.50 cm"2. In conclusion, VF accumulation was the best predictor of MS and it had a positive correlation with cardiovascular risk factors in both sexes. SF also had a significant association with MS, especially in men, although it was not superior to VF

Plasma nitriding and simultaneous tempering of VF 800AT tool steel; Nitretacao por plasma com revenimento simultaneo do aco ferramenta VF 800AT

Energy Technology Data Exchange (ETDEWEB)

Prass, Andre Ricardo; Fontana, Luis Cesar; Recco, Abel Andre Candido, E-mail: prass.andrericardo@gmail.com, E-mail: luis.fontana@udesc.br, E-mail: abel.recco@udesc.br [Universidade do Estado de Santa Catarina (UDESC), Joinville, SC (Brazil)

2017-04-15

Plasma nitriding of tool steels improves the surface hardness due to formation of diffusion zone and/or compound layer. The process parameters such as temperature, gas composition and dwell time, allow to control the layer thickness, the microstructure, the crystalline phases and the type of layer (for example white layer or diffusion zone). This paper discusses an alternative procedure for the heat treatment of tempering and surface treatment, both in plasma or combining conventional heat treatment with subsequent plasma nitriding. Carrying out both treatments in plasma could enable reduction in manufacturing costs, lower energy consumption and less time for tools manufacturing. Samples of VF800AT steel were treated and characterized (at surface and core of samples) through the following technique: X-ray diffraction, optical microscopy, scanning electron microscopy, micro-hardness profile and Rockwell C measurement. Temperature measurements during the plasma treatment, show that arise thermal gradient between the surface and the core of the samples. In this work, it was observed that the surface was up to 7% hotter than the core of sample, during the plasma treatment with temperature of magnitude about 5 x 10{sup 2} °C. This thermal gradient seems inherent to the plasma process, so that it can produce different microstructure, hardness and crystalline phases between core and edge of samples. However, when two tempering operations are prior carried out in a muffle furnace and the third tempering treatment is subsequently carried out simultaneously with the plasma nitriding, it is observed that the microstructure, the crystalline phases, hardness and micro hardness (in both, edge and core) are similar to treatments done in conventional mode cycle (in muffle furnace) with subsequent plasma nitriding. (author)

High inter-specimen variability of baseline data for the tibio-talar contact area.

Science.gov (United States)

Matricali, Giovanni A; Bartels, Ward; Labey, Luc; Dereymaeker, Greta Ph E; Luyten, Frank P; Vander Sloten, Jos

2009-01-01

The tibio-talar contact area has been widely investigated to monitor biomechanical changes due to articular incongruities or an altered loading. This study aims to investigate for the first time in a systematic way the extent of the inter-specimen variability of the tibio-talar contact area, and its repercussions when analyzing data concerning this parameter. Ten specimens were loaded to record the tibio-talar contact characteristics by use of pressure sensitive film. The size of the talar dome area, the size of the (normalized) tibio-talar contact area, the position of the tibio-talar contact area, and the shape of the latter were determined and analyzed. Inter-specimen variability was expressed as the coefficient of variation and was calculated for the datasets of previous studies as well. The size of the tibio-talar contact area showed a very high inter-specimen variability, as is the case in previous studies. This high variability persisted when a normalized tibio-talar contact area was calculated. The shape of the tibio-talar contact area showed some basic characteristics, but a high variation in details could be observed. Every specimen can be considered to have its own "ankle print". By this variability, articular incongruities are expected to have a different effect on local biomechanical characteristics in every single individual. Therefore, every single case has to be evaluated and reported for significant changes. In case of modeling, this also underscores the need to use subject specific models fed by sets of parameters derived from a series of single specimens.

Molecular beam electric deflection of the tetrahalides CF4, CCl4, SiF4, SiCl4, GeCl4, TiF4, TiCl4, VF4, and VCl4

International Nuclear Information System (INIS)

Muenter, A.A.; Dyke, T.R.; Falconer, W.E.; Klemperer, W.

1975-01-01

Using molecular beam electric deflection, the temperature dependence of polar behavior has been studied for the molecules CF 4 , CCl 4 , SiF 4 , SiCl 4 , GeCl 4 , TiF 4 TiCl 4 , VF 4 , VF 4 , and VCl 4 . A number of these molecules show polar behavior consistent with a vibrationally induced dipole moment for states with one or both of the triply degenerate vibrations excited. In four of the tetrachloride species, the presence of a vibrationally induced dipole moment was confirmed by the change in polar behavior with isotopic substituion of the Cl atoms. The deflection behavior of the transition metal tetrahalides varied from nonpolar in VCl 4 to very polar in TiF 4

Learning effect and test-retest variability of pulsar perimetry.

Science.gov (United States)

Salvetat, Maria Letizia; Zeppieri, Marco; Parisi, Lucia; Johnson, Chris A; Sampaolesi, Roberto; Brusini, Paolo

2013-03-01

To assess Pulsar Perimetry learning effect and test-retest variability (TRV) in normal (NORM), ocular hypertension (OHT), glaucomatous optic neuropathy (GON), and primary open-angle glaucoma (POAG) eyes. This multicenter prospective study included 43 NORM, 38 OHT, 33 GON, and 36 POAG patients. All patients underwent standard automated perimetry and Pulsar Contrast Perimetry using white stimuli modulated in phase and counterphase at 30 Hz (CP-T30W test). The learning effect and TRV for Pulsar Perimetry were assessed for 3 consecutive visual fields (VFs). The learning effect were evaluated by comparing results from the first session with the other 2. TRV was assessed by calculating the mean of the differences (in absolute value) between retests for each combination of single tests. TRV was calculated for Mean Sensitivity, Mean Defect, and single Mean Sensitivity for each 66 test locations. Influence of age, VF eccentricity, and loss severity on TRV were assessed using linear regression analysis and analysis of variance. The learning effect was not significant in any group (analysis of variance, P>0.05). TRV for Mean Sensitivity and Mean Defect was significantly lower in NORM and OHT (0.6 ± 0.5 spatial resolution contrast units) than in GON and POAG (0.9 ± 0.5 and 1.0 ± 0.8 spatial resolution contrast units, respectively) (Kruskal-Wallis test, P=0.04); however, the differences in NORM among age groups was not significant (Kruskal-Wallis test, P>0.05). Slight significant differences were found for the single Mean Sensitivity TRV among single locations (Duncan test, PPulsar Perimetry CP-T30W test did not show significant learning effect in patients with standard automated perimetry experience. TRV for global indices was generally low, and was not related to patient age; it was only slightly affected by VF defect eccentricity, and significantly influenced by VF loss severity.

Bubble CPAP versus CPAP with variable flow in newborns with respiratory distress: a randomized controlled trial.

Science.gov (United States)

Yagui, Ana Cristina Zanon; Vale, Luciana Assis Pires Andrade; Haddad, Luciana Branco; Prado, Cristiane; Rossi, Felipe Souza; Deutsch, Alice D Agostini; Rebello, Celso Moura

2011-01-01

To evaluate the efficacy and safety of nasal continuous positive airway pressure (NCPAP) using devices with variable flow or bubble continuous positive airway pressure (CPAP) regarding CPAP failure, presence of air leaks, total CPAP and oxygen time, and length of intensive care unit and hospital stay in neonates with moderate respiratory distress (RD) and birth weight (BW) ≥ 1,500 g. Forty newborns requiring NCPAP were randomized into two study groups: variable flow group (VF) and continuous flow group (CF). The study was conducted between October 2008 and April 2010. Demographic data, CPAP failure, presence of air leaks, and total CPAP and oxygen time were recorded. Categorical outcomes were tested using the chi-square test or the Fisher's exact test. Continuous variables were analyzed using the Mann-Whitney test. The level of significance was set at p CPAP failure (21.1 and 20.0% for VF and CF, respectively; p = 1.000), air leak syndrome (10.5 and 5.0%, respectively; p = 0.605), total CPAP time (median: 22.0 h, interquartile range [IQR]: 8.00-31.00 h and median: 22.0 h, IQR: 6.00-32.00 h, respectively; p = 0.822), and total oxygen time (median: 24.00 h, IQR: 7.00-85.00 h and median: 21.00 h, IQR: 9.50-66.75 h, respectively; p = 0.779). In newborns with BW ≥ 1,500 g and moderate RD, the use of continuous flow NCPAP showed the same benefits as the use of variable flow NCPAP.

A Zinc-Finger-Family Transcription Factor, AbVf19, Is Required for the Induction of a Gene Subset Important for Virulence in Alternaria brassicicola

Energy Technology Data Exchange (ETDEWEB)

Srivastava, Akhil [Univ. of Hawaii, Manoa, HI (United States); Ohm, Robin A. [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Oxiles, Lindsay [Univ. of Hawaii, Manoa, HI (United States); Brooks, Fred [Univ. of Hawaii, Manoa, HI (United States); Lawrence, Christopher B. [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States); Grigoriev, Igor V. [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Cho, Yangrae [Univ. of Hawaii, Manoa, HI (United States)

2011-10-26

Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen with a broad host range within the family Brassicaceae. It produces secondary metabolites that marginally affect virulence. Cell wall degrading enzymes (CDWE) have been considered important for pathogenesis but none of them individually have been identified as significant virulence factors in A. brassicicola. In this study, knockout mutants of a gene, AbVf19, were created and produced considerably smaller lesions than the wild type on inoculated host plants. The presence of tandem zinc-finger domains in the predicted amino acid sequence and nuclear localization of AbVf19- reporter protein suggested that it was a transcription factor. Gene expression comparisons using RNA-seq identified 74 genes being downregulated in the mutant during a late stage of infection. Among the 74 downregulated genes, 28 were putative CWDE genes. These were hydrolytic enzyme genes that composed a small fraction of genes within each family of cellulases, pectinases, cutinases, and proteinases. The mutants grew slower than the wild type on an axenic medium with pectin as a major carbon source. This study demonstrated the existence and the importance of a transcription factor that regulates a suite of genes that are important for decomposing and utilizing plant material during the late stage of plant infection.

Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

Science.gov (United States)

Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

2015-01-01

Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

Betydningen af en række faktorer for døvfødte børn med CI

DEFF Research Database (Denmark)

Bengtsson, Steen; Larsen, Lena Bech

2014-01-01

Formålet med dette notat er ved hjælp af data fra SFI's undersøgelse af levevilkår for døvfødte børn med CI at belyse spørgsmålet om, hvad forskellige faktorer betyder for deres situation. Spørgsmålet er belyst ved at se på syv forhold, som repræsenterer forskellige sider af det resultat, som...... barnet har fået af CI-behandlingen. Vi belyser resultatet af behandlingen med spørgsmål, der giver vurderinger af: 1) barnets handicap, 2) barnets skolepræstationer, 3) barnets emotionelle forstyrrelser, 4) om barnet er en enspænder, 5) omfang af barnets besøg hos kammerater, 6) forældrenes bekymring...

Geochemical Modeling Of F Area Seepage Basin Composition And Variability

International Nuclear Information System (INIS)

Millings, M.; Denham, M.; Looney, B.

2012-01-01

From the 1950s through 1989, the F Area Seepage Basins at the Savannah River Site (SRS) received low level radioactive wastes resulting from processing nuclear materials. Discharges of process wastes to the F Area Seepage Basins followed by subsequent mixing processes within the basins and eventual infiltration into the subsurface resulted in contamination of the underlying vadose zone and downgradient groundwater. For simulating contaminant behavior and subsurface transport, a quantitative understanding of the interrelated discharge-mixing-infiltration system along with the resulting chemistry of fluids entering the subsurface is needed. An example of this need emerged as the F Area Seepage Basins was selected as a key case study demonstration site for the Advanced Simulation Capability for Environmental Management (ASCEM) Program. This modeling evaluation explored the importance of the wide variability in bulk wastewater chemistry as it propagated through the basins. The results are intended to generally improve and refine the conceptualization of infiltration of chemical wastes from seepage basins receiving variable waste streams and to specifically support the ASCEM case study model for the F Area Seepage Basins. Specific goals of this work included: (1) develop a technically-based 'charge-balanced' nominal source term chemistry for water infiltrating into the subsurface during basin operations, (2) estimate the nature of short term and long term variability in infiltrating water to support scenario development for uncertainty quantification (i.e., UQ analysis), (3) identify key geochemical factors that control overall basin water chemistry and the projected variability/stability, and (4) link wastewater chemistry to the subsurface based on monitoring well data. Results from this study provide data and understanding that can be used in further modeling efforts of the F Area groundwater plume. As identified in this study, key geochemical factors affecting basin

Difference in the Clinical Characteristics of Ventricular Fibrillation Occurrence in the Early Phase of an Acute Myocardial Infarction Between Patients With and Without J Waves.

Science.gov (United States)

Naruse, Yoshihisa; Nogami, Akihiko; Harimura, Yoshie; Ishibashi, Mayu; Noguchi, Yuichi; Sekiguchi, Yukio; Sato, Akira; Aonuma, Kazutaka

2015-08-01

We recently showed that the presence of J waves increases the risk of ventricular fibrillation (VF) occurrence in the early phase of an acute myocardial infarction (AMI). This study aimed to evaluate the clinical characteristics of VF occurrences in the early phase of an AMI between patients with and without J waves. This retrospective, observational study included 281 consecutive patients with an AMI (69 ± 12 years; 207 men) in whom 12-lead ECGs before AMI onset could be evaluated. The patients were classified based on a VF occurrence J waves. J waves were electrocardiographically defined as an elevation of the terminal portion of the QRS complex of >0.1 mV from baseline in at least 2 contiguous inferior or lateral leads. VF occurred in 24 patients, and J waves were present in 37. VF occurrence was more prevalent in the patients with than without J waves (27% vs. 6%; P J waves, peak creatine kinase level (P J waves, there was no significant difference in these variables. There was no association between the location of J waves and the infarct area. In patients with AMI, those with J waves were more likely to develop VF and less likely to have high-risk clinical characteristics than those without J waves. © 2015 Wiley Periodicals, Inc.

Design of a High Temperature Radiator for the Variable Specific Impulse Magnetoplasma Rocket

Science.gov (United States)

Sheth, Rubik B.; Ungar, Eugene K.; Chambliss, Joe P.

2012-01-01

The Variable Specific Impulse Magnetoplasma Rocket (VASIMR), currently under development by Ad Astra Rocket Company (Webster, TX), is a unique propulsion system that could change the way space propulsion is performed. VASIMR's efficiency, when compared to that of a conventional chemical rocket, reduces the propellant needed for exploration missions by a factor of 10. Currently plans include flight tests of a 200 kW VASIMR system, titled VF-200, on the International Space Station (ISS). The VF-200 will consist of two 100 kW thruster units packaged together in one engine bus. Each thruster core generates 27 kW of waste heat during its 15 minute firing time. The rocket core will be maintained between 283 and 573 K by a pumped thermal control loop. The design of a high temperature radiator is a unique challenge for the vehicle design. This paper will discuss the path taken to develop a steady state and transient-based radiator design. The paper will describe the radiator design option selected for the VASIMR thermal control system for use on ISS, and how the system relates to future exploration vehicles.

Accounting for Pharmacokinetic Variability of Certolizumab Pegol in Patients with Crohn's Disease.

Science.gov (United States)

Vande Casteele, Niels; Mould, Diane R; Coarse, Jason; Hasan, Iram; Gils, Ann; Feagan, Brian; Sandborn, William J

2017-12-01

Certolizumab pegol is an effective biologic for patients with Crohn's disease (CD). Individual differences in certolizumab pegol apparent clearance (CL/F) affect exposure and possibly efficacy. A previously developed population pharmacokinetic (PK) model did not account for dynamic changes in clinical parameters during therapy. The aim of this study was to refine the existing PK model to capture the time-varying influence of covariates. Data collected from 2157 Crohn's disease patients in nine studies were analyzed using nonlinear mixed-effects modeling software (NONMEM). Certolizumab pegol concentration-time data were described by a one-compartment PK model with first-order absorption, and one-compartment disposition with linear, time-dependent elimination using antidrug antibody (ADAb) concentration as a continuous variable. The final dataset consisted of 12,926 analyzable records. Parameter estimates were absorption rate constant 1.83/day, CL/F 0.527 L/day, and apparent volume of distribution (V/F) 8.33 L. ADAb concentration (2.5-214 units/mL) increased the median CL/F by 142-174%. For a typical patient, body weight (46.8-100.5 kg) increased the median CL/F and V/F from 82 to 120%. Albumin (32-48 g/L) decreased and C-reactive protein (0.5-54.0 mg/L) increased the median CL/F from 123 to 85% and from 83 to 113%, respectively. Between-patient variability of CL/F was 19.6%. By incorporating time-varying covariates, this population PK model reduces between-patient variability on CL/F estimates, and the relative influence of ADAb can now be assessed. As Crohn's disease patient covariates are often time-dependent, this model is more reflective of patient drug exposure with sustained treatment.

A tool for protected area management: multivariate control charts 'cope' with rare variable communities.

Science.gov (United States)

Stringell, Thomas B; Bamber, Roger N; Burton, Mark; Lindenbaum, Charles; Skates, Lucie R; Sanderson, William G

2013-06-01

Performance assessment, impact detection, and the assessment of regulatory compliance are common scientific problems for the management of protected areas. Some habitats in protected areas, however, are rare and/or variable and are not often selected for study by ecologists because they preclude comparison with controls and high community variability makes meaningful change detection difficult. Shallow coastal saline lagoons are habitats that experience comparatively high levels of stress due to high physical variability. Lagoons are rare, declining habitats found in coastal regions throughout Europe (and elsewhere) where they are identified as one of the habitats most in need of protected area management. The infauna in the sediments of 25 lagoons were sampled. Temporal and spatial variation in three of these [protected] lagoons was investigated further over 5 years. In a multivariate analysis of community structure similarities were found between some lagoons, but in other cases communities were unique or specific to only two sites. The protected lagoons with these unique/specific communities showed significant temporal and spatial variation, yet none of the changes observed were attributed to human impacts and were interpreted as inherent variability. Multivariate control charts can operate without experimental controls and were used to assess community changes within the context of 'normal' lagoon variability. The aim of control chart analysis is to characterize background variability in a parameter and identify when a new observation deviates more than expected. In only 1 year was variability more than expected and corresponded with the coldest December in over 100 years. Multivariate control charts are likely to have wide application in the management of protected areas and other natural systems where variability and/or rarity preclude conventional analytical and experimental approaches but where assessments of condition, impact or regulatory compliance are

Assessing the Impact of Socioeconomic Variables on Small Area Variations in Suicide Outcomes in England

Directory of Open Access Journals (Sweden)

Peter Congdon

2012-12-01

Full Text Available Ecological studies of suicide and self-harm have established the importance of area variables (e.g., deprivation, social fragmentation in explaining variations in suicide risk. However, there are likely to be unobserved influences on risk, typically spatially clustered, which can be modeled as random effects. Regression impacts may be biased if no account is taken of spatially structured influences on risk. Furthermore a default assumption of linear effects of area variables may also misstate or understate their impact. This paper considers variations in suicide outcomes for small areas across England, and investigates the impact on them of area socio-economic variables, while also investigating potential nonlinearity in their impact and allowing for spatially clustered unobserved factors. The outcomes are self-harm hospitalisations and suicide mortality over 6,781 Middle Level Super Output Areas.

Mountaintop Removal Mining and Catchment Hydrology

Directory of Open Access Journals (Sweden)

Andrew J. Miller

2014-03-01

Full Text Available Mountaintop mining and valley fill (MTM/VF coal extraction, practiced in the Central Appalachian region, represents a dramatic landscape-scale disturbance. MTM operations remove as much as 300 m of rock, soil, and vegetation from ridge tops to access deep coal seams and much of this material is placed in adjacent headwater streams altering landcover, drainage network, and topography. In spite of its scale, extent, and potential for continued use, the effects MTM/VF on catchment hydrology is poorly understood. Previous reviews focus on water quality and ecosystem health impacts, but little is known about how MTM/VF affects hydrology, particularly the movement and storage of water, hence the hydrologic processes that ultimately control flood generation, water chemistry, and biology. This paper aggregates the existing knowledge about the hydrologic impacts of MTM/VF to identify areas where further scientific investigation is needed. While contemporary surface mining generally increases peak and total runoff, the limited MTM/VF studies reveal significant variability in hydrologic response. Significant knowledge gaps relate to limited understanding of hydrologic processes in these systems. Until the hydrologic impact of this practice is better understood, efforts to reduce water quantity and quality problems and ecosystem degradation will be difficult to achieve.

Outlining precision boundaries among areas with different variability standards using magnetic susceptibility and geomorphic surfaces

OpenAIRE

Matias,Sammy S. R.; Marques Júnior,José; Siqueira,Diego S.; Pereira,Gener T.

2014-01-01

There is an increasing demand for detailed maps that represent in a simplified way the knowledge of the variability of a particular area or region maps. The objective was to outline precision boundaries among areas with different accuracy variability standards using magnetic susceptibility and geomorphic surfaces. The study was conducted in an area of 110 ha, which identified three compartment landscapes based on the geomorphic surfaces model. To determinate pH, organic matter, phosphorus, po...

The Effect of Type and Volume Fraction (Vf) of Steel Fiber on the Mechanical Properties of Self-Compacting Concrete

DEFF Research Database (Denmark)

Ghanbarpour, S.; Mazaheripour, H.; Mirmoradi, S. H.

2010-01-01

is to investigate the effects of type and volume fraction of steel fiber on the compressive strength, split tensile strength, flexural strength and modulus of elasticity of steel fiber reinforced self-compacting concrete (SFRSCC). Design/methodology/approach – For this purpose, Micro wire and Wave type steel fibers......Purpose – Self-compacting concrete (SCC) offers several economic and technical benefits; the use of steel fibers extends its possibilities. Steel fibers bridge cracks, retard their propagation, and improve several characteristics and properties of the SCC. The purpose of this paper...... – It was found that, inclusion of steel fibers significantly affect the split tensile and flexural strength of SCC accordance with type and vf. Besides, mathematical expressions were developed to estimate the flexural, modulus of elasticity and split tensile strength of SFRSCCs regarding of compressive strength...

Design Analysis of a High Temperature Radiator for the Variable Specific Impulse Magnetoplasma Rocket (VASIMR)

Science.gov (United States)

Sheth, Rubik B.; Ungar, Eugene K.; Chambliss, Joe P.; Cassady, Leonard D.

2011-01-01

The Variable Specific Impulse Magnetoplasma Rocket (VASIMR), currently under development by Ad Astra Rocket Company, is a unique propulsion system that can potentially change the way space propulsion is performed. VASIMR's efficiency, when compared to that of a conventional chemical rocket, reduce propellant needed for exploration missions by a factor of 10. Currently plans include flight tests of a 200 kW VASIMR system, titled VF-200, on the International Space Station. The VF-200 will consist of two 100 kW thruster units packaged together in one engine bus. Each thruster unit has a unique heat rejection requirement of about 27 kW over a firing time of 15 minutes. In order to control rocket core temperatures, peak operating temperatures of about 300 C are expected within the thermal control loop. Design of a high temperature radiator is a unique challenge for the vehicle design. This paper will discuss the path taken to develop a steady state and transient based radiator design. The paper will describe radiator design options for the VASIMR thermal control system for use on ISS as well as future exploration vehicles.

Performance of an area variable MOS varicap weighted programmable CCD transversal filter

OpenAIRE

Bhattacharyya, A.B.; Shankarnarayan, L.; Kapur, N.; Wallinga, Hans

1981-01-01

The performance of an electrically programmable CCD transversal filter (PTF) is presented in which tap-weight multiplication is performed by a novel and compact on chip voltage controlled area variable MOS varicap.

Can Probability Maps of Swept-Source Optical Coherence Tomography Predict Visual Field Changes in Preperimetric Glaucoma?

Science.gov (United States)

Lee, Won June; Kim, Young Kook; Jeoung, Jin Wook; Park, Ki Ho

2017-12-01

To determine the usefulness of swept-source optical coherence tomography (SS-OCT) probability maps in detecting locations with significant reduction in visual field (VF) sensitivity or predicting future VF changes, in patients with classically defined preperimetric glaucoma (PPG). Of 43 PPG patients, 43 eyes were followed-up on every 6 months for at least 2 years were analyzed in this longitudinal study. The patients underwent wide-field SS-OCT scanning and standard automated perimetry (SAP) at the time of enrollment. With this wide-scan protocol, probability maps originating from the corresponding thickness map and overlapped with SAP VF test points could be generated. We evaluated the vulnerable VF points with SS-OCT probability maps as well as the prevalence of locations with significant VF reduction or subsequent VF changes observed in the corresponding damaged areas of the probability maps. The vulnerable VF points were shown in superior and inferior arcuate patterns near the central fixation. In 19 of 43 PPG eyes (44.2%), significant reduction in baseline VF was detected within the areas of structural change on the SS-OCT probability maps. In 16 of 43 PPG eyes (37.2%), subsequent VF changes within the areas of SS-OCT probability map change were observed over the course of the follow-up. Structural changes on SS-OCT probability maps could detect or predict VF changes using SAP, in a considerable number of PPG eyes. Careful comparison of probability maps with SAP results could be useful in diagnosing and monitoring PPG patients in the clinical setting.

Variability in effective radiating area and output power of new ultrasound transducers at 3 MHz.

Science.gov (United States)

Johns, Lennart D; Straub, Stephen J; Howard, Samuel M

2007-01-01

Spatial average intensity (SAI) is often used by clinicians to gauge therapeutic ultrasound dosage, yet SAI measures are not directly regulated by US Food and Drug Administration (FDA) standards. Current FDA guidelines permit a possible 50% to 150% minimum to maximum range of SAI values, potentially contributing to variability in clinical outcomes. To measure clinical values that describe ultrasound transducers and to determine the degree of intramanufacturer and intermanufacturer variability in effective radiating area, power, and SAI when the transducer is functioning at 3 MHz. A descriptive and interferential approach was taken to this quasi-experimental design. Measurement laboratory. Sixty-six 5-cm(2) ultrasound transducers were purchased from 6 different manufacturers. All transducers were calibrated and then assessed using standardized measurement techniques; SAI was normalized to account for variability in effective radiating area, resulting in an nSAI. Effective radiating area, power, and nSAI. All manufacturers with the exception of Omnisound (P = .534) showed a difference between the reported and measured effective radiating area values (P nSAI (P < .05) than all other manufacturers functioning at 3 MHz. Intramanufacturer variability in SAI ranged from 16% to 35%, and intermanufacturer variability ranged from 22% to 61%. Clinicians should consider treatment values of each individual transducer, regardless of the manufacturer. In addition, clinicians should scrutinize the power calibration and recalibration record of the transducer and adjust clinical settings as needed for the desired level of heating. Our data may aid in explaining the reported heating differences among transducers from different manufacturers. Stricter FDA standards regarding effective radiating area and total power are needed, and standards regulating SAI should be established.

Inter- and intrapatient variability of facial nerve response areas in the floor of the fourth ventricle.

Science.gov (United States)

Bertalanffy, Helmut; Tissira, Nadir; Krayenbühl, Niklaus; Bozinov, Oliver; Sarnthein, Johannes

2011-03-01

Surgical exposure of intrinsic brainstem lesions through the floor of the 4th ventricle requires precise identification of facial nerve (CN VII) fibers to avoid damage. To assess the shape, size, and variability of the area where the facial nerve can be stimulated electrophysiologically on the surface of the rhomboid fossa. Over a period of 18 months, 20 patients were operated on for various brainstem and/or cerebellar lesions. Facial nerve fibers were stimulated to yield compound muscle action potentials (CMAP) in the target muscles. Using the sites of CMAP yield, a detailed functional map of the rhomboid fossa was constructed for each patient. Lesions resected included 14 gliomas, 5 cavernomas, and 1 epidermoid cyst. Of 40 response areas mapped, 19 reached the median sulcus. The distance from the obex to the caudal border of the response area ranged from 8 to 27 mm (median, 17 mm). The rostrocaudal length of the response area ranged from 2 to 15 mm (median, 5 mm). Facial nerve response areas showed large variability in size and position, even in patients with significant distance between the facial colliculus and underlying pathological lesion. Lesions located close to the facial colliculus markedly distorted the response area. This is the first documentation of variability in the CN VII response area in the rhomboid fossa. Knowledge of this remarkable variability may facilitate the assessment of safe entry zones to the brainstem and may contribute to improved outcome following neurosurgical interventions within this sensitive area of the brain.

Using small area estimation and Lidar-derived variables for multivariate prediction of forest attributes

Science.gov (United States)

F. Mauro; Vicente Monleon; H. Temesgen

2015-01-01

Small area estimation (SAE) techniques have been successfully applied in forest inventories to provide reliable estimates for domains where the sample size is small (i.e. small areas). Previous studies have explored the use of either Area Level or Unit Level Empirical Best Linear Unbiased Predictors (EBLUPs) in a univariate framework, modeling each variable of interest...

Step-by-step variability of swing phase trajectory area during steady state walking at a range of speeds

Science.gov (United States)

Hurt, Christopher P.; Brown, David A.

2018-01-01

Background Step kinematic variability has been characterized during gait using spatial and temporal kinematic characteristics. However, people can adopt different trajectory paths both between individuals and even within individuals at different speeds. Single point measures such as minimum toe clearance (MTC) and step length (SL) do not necessarily account for the multiple paths that the foot may take during the swing phase to reach the same foot fall endpoint. The purpose of this study was to test a step-by-step foot trajectory area (SBS-FTA) variability measure that is able to characterize sagittal plane foot trajectories of varying areas, and compare this measure against MTC and SL variability at different speeds. We hypothesize that the SBS-FTA variability would demonstrate increased variability with speed. Second, we hypothesize that SBS-FTA would have a stronger curvilinear fit compared with the CV and SD of SL and MTC. Third, we hypothesize SBS-FTA would be more responsive to change in the foot trajectory at a given speed compared to SL and MTC. Fourth, SBS-FTA variability would not strongly co-vary with SL and MTC variability measures since it represents a different construct related to foot trajectory area variability. Methods We studied 15 nonimpaired individuals during walking at progressively faster speeds. We calculated SL, MTC, and SBS-FTA area. Results SBS-FTA variability increased with speed, had a stronger curvilinear fit compared with the CV and SD of SL and MTC, was more responsive at a given speed, and did not strongly co-vary with SL and MTC variability measures. Conclusion SBS foot trajectory area variability was sensitive to change with faster speeds, captured a relationship that the majority of the other measures did not demonstrate, and did not co-vary strongly with other measures that are also components of the trajectory. PMID:29370202

The Optic Nerve Head in Primary Open-Angle Glaucoma Eyes With High Myopia: Characteristics and Association With Visual Field Defects.

Science.gov (United States)

Chen, Li-Wei; Lan, Yu-Wen; Hsieh, Jui-Wen

2016-06-01

To evaluate the morphologic characteristics of optic neuropathy and its association with visual field (VF) defects in primary open-angle glaucoma (POAG) eyes with high myopia. In this cross-sectional study, we reviewed data from 375 Taiwanese patients (375 eyes) of POAG, ages 20 to 60 years. Optic disc photographs were used for planimetric measurements of morphologic variables. The myopic refraction was divided into high myopia (<-6.0 D) and nonhigh myopia (moderate myopia to hyperopia). The optic disc area was classified as moderate (1.59 to 2.85 mm), large, and small. Differences in characteristics between groups, correlations with the disc area, and factors associated with VF defects were determined. Of the 142 highly myopic eyes, 33 (23%) had a large disc, 26 (18%) had a small disc, and 55 (39%) had a tilted disc. Large discs had a higher cup-to-disc (C/D) area ratio and a higher tilt ratio; small discs had a smaller rim area and a lower tilt ratio (all P<0.05). Characteristics associated with high myopia included a smaller rim area, a higher C/D area ratio, and a lower tilt ratio (all P<0.001). In logistic regression, the refraction, the C/D area ratio, the rim area, and the tilt ratio (all P<0.05) were associated with VF defects. In Taiwanese individuals with POAG, our study found that tilted, large, or small discs were prevalent in highly myopic eyes. Of these characteristics, only the disc tilt and high myopia by itself were associated with the severity of glaucomatous optic neuropathy.

Power converter with maximum power point tracking MPPT for small wind-electric pumping systems

International Nuclear Information System (INIS)

Lara, David; Merino, Gabriel; Salazar, Lautaro

2015-01-01

Highlights: • We implement a wind electric pumping system of small power. • The power converter allowed to change the operating point of the electro pump. • Two control techniques were implemented in the power converter. • The control V/f variable allowed to increase the power generated by the permanent magnet generator. - Abstract: In this work, an AC–DC–AC direct-drive power converter was implemented for a wind electric pumping system consisting of a permanent magnet generator (PMG) of 1.3 kW and a peripheral single phase pump of 0.74 kW. In addition, the inverter linear V/f control scheme and the maximum power point tracking (MPPT) algorithm with variable V/f were developed. MPPT algorithm seeks to extract water in a wide range of power input using the maximum amount of wind power available. Experimental trials at different pump pressures were conducted. With a MPPT tracking system with variable V/f, a power value of 1.3 kW was obtained at a speed of 350 rpm and a maximum operating hydraulic head of 50 m. At lower operating heads pressures (between 10 and 40 m), variable V/f control increases the power generated by the PMG compared to the linear V/f control. This increase ranged between 4% and 23% depending on the operating pressure, with an average of 13%, getting close to the maximum electrical power curve of the PMG. The pump was driven at variable frequency reaching a minimum speed of 0.5 times the rated speed. Efficiency of the power converter ranges between 70% and 95% with a power factor between 0.4 and 0.85, depending on the operating pressure

Improving risk estimates of runoff producing areas: formulating variable source areas as a bivariate process.

Science.gov (United States)

Cheng, Xiaoya; Shaw, Stephen B; Marjerison, Rebecca D; Yearick, Christopher D; DeGloria, Stephen D; Walter, M Todd

2014-05-01

Predicting runoff producing areas and their corresponding risks of generating storm runoff is important for developing watershed management strategies to mitigate non-point source pollution. However, few methods for making these predictions have been proposed, especially operational approaches that would be useful in areas where variable source area (VSA) hydrology dominates storm runoff. The objective of this study is to develop a simple approach to estimate spatially-distributed risks of runoff production. By considering the development of overland flow as a bivariate process, we incorporated both rainfall and antecedent soil moisture conditions into a method for predicting VSAs based on the Natural Resource Conservation Service-Curve Number equation. We used base-flow immediately preceding storm events as an index of antecedent soil wetness status. Using nine sub-basins of the Upper Susquehanna River Basin, we demonstrated that our estimated runoff volumes and extent of VSAs agreed with observations. We further demonstrated a method for mapping these areas in a Geographic Information System using a Soil Topographic Index. The proposed methodology provides a new tool for watershed planners for quantifying runoff risks across watersheds, which can be used to target water quality protection strategies. Copyright © 2014 Elsevier Ltd. All rights reserved.

Callosal involvement in a lateralized stroop task in alcoholic and healthy subjects.

Science.gov (United States)

Schulte, T; Müller-Oehring, E M; Salo, R; Pfefferbaum, A; Sullivan, E V

2006-11-01

To investigate the role of interhemispheric attentional processes, 25 alcoholic and 28 control subjects were tested with a Stroop match-to-sample task and callosal areas were measured with magnetic resonance imaging. Stroop color-word stimuli were presented to the left or right visual field (VF) and were preceded by a color cue that did or did not match the word's color. For matching colors, both groups showed a right VF advantage; for nonmatching colors, controls showed a left VF advantage, whereas alcoholic subjects showed no VF advantage. For nonmatch trials, VF advantage correlated with callosal splenium area in controls but not alcoholic subjects, supporting the position that information presented to the nonpreferred hemisphere is transmitted via the splenium to the hemisphere specialized for efficient processing. The authors speculate that alcoholism-associated callosal thinning disrupts this processing route.

Sensitivity of marine protected area network connectivity to atmospheric variability.

Science.gov (United States)

Fox, Alan D; Henry, Lea-Anne; Corne, David W; Roberts, J Murray

2016-11-01

International efforts are underway to establish well-connected systems of marine protected areas (MPAs) covering at least 10% of the ocean by 2020. But the nature and dynamics of ocean ecosystem connectivity are poorly understood, with unresolved effects of climate variability. We used 40-year runs of a particle tracking model to examine the sensitivity of an MPA network for habitat-forming cold-water corals in the northeast Atlantic to changes in larval dispersal driven by atmospheric cycles and larval behaviour. Trajectories of Lophelia pertusa larvae were strongly correlated to the North Atlantic Oscillation (NAO), the dominant pattern of interannual atmospheric circulation variability over the northeast Atlantic. Variability in trajectories significantly altered network connectivity and source-sink dynamics, with positive phase NAO conditions producing a well-connected but asymmetrical network connected from west to east. Negative phase NAO produced reduced connectivity, but notably some larvae tracked westward-flowing currents towards coral populations on the mid-Atlantic ridge. Graph theoretical metrics demonstrate critical roles played by seamounts and offshore banks in larval supply and maintaining connectivity across the network. Larval longevity and behaviour mediated dispersal and connectivity, with shorter lived and passive larvae associated with reduced connectivity. We conclude that the existing MPA network is vulnerable to atmospheric-driven changes in ocean circulation.

Test setup for accelerated test of high power IGBT modules with online monitoring of Vce and Vf voltage during converter operation

DEFF Research Database (Denmark)

de Vega, Angel Ruiz; Ghimire, Pramod; Pedersen, Kristian Bonderup

2014-01-01

Several accelerated test methods exist in order to study the failures mechanisms of the high power IGBT modules like temperature cycling test or power cycles based on DC current pulses. The main drawback is that the test conditions do not represent the real performance and stress conditions...... of the device in real application. The hypothesis is that ageing of power modules closer to real environment including cooling system, full dc-link voltage and continuous PWM operation could lead to more accurate study of failure mechanism. A new type of test setup is proposed, which can create different real...... load conditions like in the field. Furthermore, collector-emitter voltage (Vce) has been used as indicator of the wear-out of the high power IGBT module. The innovative monitoring system implemented in the test setup is capable of measure the Vce and forward voltage of the antiparallel diode (Vf...

Climate Variability and Industrial-Suburban Heat Environment in a Mediterranean Area

Directory of Open Access Journals (Sweden)

Giuseppina A. Giorgio

2017-05-01

Full Text Available The Urban Heat Island (UHI phenomenon prevalently concerns industrialized countries. It consists of a significant increase in temperatures, especially in industrialized and urbanized areas, in particular, during extreme warm periods like summer. This paper explores the climate variability of temperatures in two stations located in Matera city (Southern Italy, evaluating the increase in temperatures from 1988 to 2015. Moreover, the Corine Land Covers (1990–2000–2006–2012 were used in order to investigate the effect of land use on temperatures. The results obtained confirm the prevalence of UHI phenomena for industrialized areas, highlighting the proposal that the spreading of settlements may further drive these effects on the microclimate. In particular, the presence of industrial structures, even in rural areas, shows a clear increase in summer maximum temperatures. This does not occur in the period before 2000, probably due to the absence of the industrial settlement. On the contrary, from 2000 to 2015, changes are not relevant, but the maximum temperatures have always been higher than in the suburban area (station localized in green zone during daylight hours.

Use of an augmented-vision device for visual search by patients with tunnel vision.

Science.gov (United States)

Luo, Gang; Peli, Eli

2006-09-01

To study the effect of an augmented-vision device that superimposes minified contour images over natural vision on visual search performance of patients with tunnel vision. Twelve subjects with tunnel vision searched for targets presented outside their visual fields (VFs) on a blank background under three cue conditions (with contour cues provided by the device, with auditory cues, and without cues). Three subjects (VF, 8 degrees -11 degrees wide) carried out the search over a 90 degrees x 74 degrees area, and nine subjects (VF, 7 degrees -16 degrees wide) carried out the search over a 66 degrees x 52 degrees area. Eye and head movements were recorded for performance analyses that included directness of search path, search time, and gaze speed. Directness of the search path was greatly and significantly improved when the contour or auditory cues were provided in the larger and the smaller area searches. When using the device, a significant reduction in search time (28% approximately 74%) was demonstrated by all three subjects in the larger area search and by subjects with VFs wider than 10 degrees in the smaller area search (average, 22%). Directness and gaze speed accounted for 90% of the variability of search time. Although performance improvement with the device for the larger search area was obvious, whether it was helpful for the smaller search area depended on VF and gaze speed. Because improvement in directness was demonstrated, increased gaze speed, which could result from further training and adaptation to the device, might enable patients with small VFs to benefit from the device for visual search tasks.

Spatial variability of soil pH based on GIS combined with geostatistics in Panzhihua tobacco area

International Nuclear Information System (INIS)

Du Wei; Wang Changquan; Li Bing; Li Qiquan; Du Qian; Hu Jianxin; Liu Chaoke

2012-01-01

GIS and geostatistics were utilized to study the spatial variability of soil pH in Panzhihua tobacco area. Results showed that pH values in this area ranged from 4.5 to 8.3, especially 5.5 to 6.5, and in few areas were lower than 5.0 or higher than 7.0 which can meet the need of high-quality tobacco production. The best fitting model of variogram was exponential model with the nugget/sill of soil pH in 13.61% indicating strong spatial correlation. The change process was 5.40 km and the coefficient of determination was 0.491. The spatial variability of soil pH was mainly caused by structural factors such as cane, topography and soil type. The soil pH in Panzhihua tobacco area also showed a increasing trend of northwest to southeast trend. The pH of some areas in Caochang, Gonghe and Yumen were lower, and in Dalongtan were slightly higher. (authors)

Relationship Between the Electroglottographic Signal and Vocal Fold Contact Area.

Science.gov (United States)

Hampala, Vít; Garcia, Maxime; Švec, Jan G; Scherer, Ronald C; Herbst, Christian T

2016-03-01

Electroglottography (EGG) is a widely used noninvasive method that purports to measure changes in relative vocal fold contact area (VFCA) during phonation. Despite its broad application, the putative direct relation between the EGG waveform and VFCA has to date only been formally tested in a single study, suggesting an approximately linear relationship. However, in that study, flow-induced vocal fold (VF) vibration was not investigated. A rigorous empirical evaluation of EGG as a measure of VFCA under proper physiological conditions is therefore still needed. Three red deer larynges were phonated in an excised hemilarynx preparation using a conducting glass plate. The time-varying contact between the VF and the glass plate was assessed by high-speed video recordings at 6000 fps, synchronized to the EGG signal. The average differences between the normalized [0, 1] VFCA and EGG waveforms for the three larynges were 0.180 (±0.156), 0.075 (±0.115), and 0.168 (±0.184) in the contacting phase and 0.159 (±0.112), -0.003 (±0.029), and 0.004 (±0.032) in the decontacting phase. Overall, there was a better agreement between VFCA and the EGG waveform in the decontacting phase than in the contacting phase. Disagreements may be caused by nonuniform tissue conductance properties, electrode placement, and electroglottograph hardware circuitry. Pending further research, the EGG waveform may be a reasonable first approximation to change in medial contact area between the VFs during phonation. However, any quantitative and statistical data derived from EGG should be interpreted cautiously, allowing for potential deviations from true VFCA. Copyright © 2016 The Auhors. Published by Elsevier Inc. All rights reserved.

Technical specifications of variable speed motors for negative pressure control in hot cell area

Energy Technology Data Exchange (ETDEWEB)

Kim, Seon Duk; Bang, H. S.; Cho, W. K

2002-01-01

Hot cells are the facilities for handling the high radioactive materials and various R and D activities are performed using hot cells. Therefore the control of air flow in hot cell area is very important technology and it is started with the variable speed motor(VSM) controlling the air handling system in that area. This report describes various technical aspects of VS motors and will be useful for understanding the practical technologies of VS motors and also for optimization of the negative pressure controls in hot cell area.

Spatial and temporal variability of rainfall and their effects on hydrological response in urban areas - A review

NARCIS (Netherlands)

Cristiano, E.; ten Veldhuis, J.A.E.; van de Giesen, N.C.

2017-01-01

In urban areas, hydrological processes are characterized by high variability in space and time, making them sensitive to small-scale temporal and spatial rainfall variability. In the last decades new instruments, techniques, and methods have been developed to capture rainfall and hydrological

Non-linear dynamical signal characterization for prediction of defibrillation success through machine learning

Directory of Open Access Journals (Sweden)

Shandilya Sharad

2012-10-01

Full Text Available Abstract Background Ventricular Fibrillation (VF is a common presenting dysrhythmia in the setting of cardiac arrest whose main treatment is defibrillation through direct current countershock to achieve return of spontaneous circulation. However, often defibrillation is unsuccessful and may even lead to the transition of VF to more nefarious rhythms such as asystole or pulseless electrical activity. Multiple methods have been proposed for predicting defibrillation success based on examination of the VF waveform. To date, however, no analytical technique has been widely accepted. We developed a unique approach of computational VF waveform analysis, with and without addition of the signal of end-tidal carbon dioxide (PetCO2, using advanced machine learning algorithms. We compare these results with those obtained using the Amplitude Spectral Area (AMSA technique. Methods A total of 90 pre-countershock ECG signals were analyzed form an accessible preshosptial cardiac arrest database. A unified predictive model, based on signal processing and machine learning, was developed with time-series and dual-tree complex wavelet transform features. Upon selection of correlated variables, a parametrically optimized support vector machine (SVM model was trained for predicting outcomes on the test sets. Training and testing was performed with nested 10-fold cross validation and 6–10 features for each test fold. Results The integrative model performs real-time, short-term (7.8 second analysis of the Electrocardiogram (ECG. For a total of 90 signals, 34 successful and 56 unsuccessful defibrillations were classified with an average Accuracy and Receiver Operator Characteristic (ROC Area Under the Curve (AUC of 82.2% and 85%, respectively. Incorporation of the end-tidal carbon dioxide signal boosted Accuracy and ROC AUC to 83.3% and 93.8%, respectively, for a smaller dataset containing 48 signals. VF analysis using AMSA resulted in accuracy and ROC AUC of 64

Spatial variability of soil potassium in sugarcane areas subjected to the application of vinasse

Directory of Open Access Journals (Sweden)

LAÉRCIO A. DE CARVALHO

2014-12-01

Full Text Available When deposited on land the vinasse can promote improvement in fertility, however, often fertilizer application occurs in areas considered homogeneous, without taking into account the variability of the soil. The objective of this study was to evaluate the effect of vinasse application on potassium content in two classes of soils cultivated with sugarcane, and characterize the spatial variability of soil using geostatistical techniques. In the 2010 and 2011 crop year, soil samples were collected from an experimental grid at 0-0.2 and 0.2-0.4 m depth in three soils cultivated with sugarcane, totaling 90 samplings in each grid, for the determination of pH, calcium (Ca, magnesium (Mg, potassium (K, phosphorus (P, aluminum (Al and potential acidity (H + Al. The data have been submitted to analysis of descriptive statistics and the K attribute was subjected to geostatistical analysis. The coefficient of variation indicated medium and high variability of K for the three soils. The results showed that the spatial dependence of K increased in depth to FRce and decreased to PHlv, indicating that the attribute could have followed the pattern of distribution of clay in depth. The investigation of the spatial variability of K on the surface and subsurface soils provided the definition of management zones with different levels of fertility, which can be organized into sub-areas for a more efficient management of the resources and the environment.

Functional visual fields: a cross-sectional UK study to determine which visual field paradigms best reflect difficulty with mobility function.

Science.gov (United States)

Subhi, Hikmat; Latham, Keziah; Myint, Joy; Crossland, Michael

2017-11-20

To develop an appropriate method of assessing visual field (VF) loss which reflects its functional consequences, this study aims to determine which method(s) of assessing VF best reflect mobility difficulty. This cross-sectional observational study took place within a single primary care setting. Participants attended a single session at a University Eye Clinic, Cambridge, UK, with data collected by a single researcher (HS), a qualified optometrist. 50 adult participants with peripheral field impairment were recruited for this study. Individuals with conditions not primarily affecting peripheral visual function, such as macular degeneration, were excluded from the study. Participants undertook three custom and one standard binocular VF tests assessing VF to 60°, and also integrated monocular threshold 24-2 visual fields (IVF). Primary VF outcomes were average mean threshold, percentage of stimuli seen and VF area. VF outcomes were compared with self-reported mobility function assessed with the Independent Mobility Questionnaire, and time taken and patient acceptability were also considered. Receiver operating characteristic (ROC) curves determined which tests best predicted difficulty with mobility tasks. Greater VF loss was associated with greater self-reported mobility difficulty with all field paradigms (R 2 0.38-0.48, all Pmobility tasks in ROC analysis. Mean duration of the tests ranged from 1 min 26 s (±9 s) for kinetic assessment to 9 min 23 s (±24 s) for IVF. The binocular VF tests extending to 60° eccentricity all relate similarly to self-reported mobility function, and slightly better than integrated monocular VFs. A kinetic assessment of VF area is quicker than and as effective at predicting mobility function as static threshold assessment. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Virulence factors and mechanisms of antimicrobial resistance in Shigella strains from periurban areas of Lima (Peru).

Science.gov (United States)

Lluque, Angela; Mosquito, Susan; Gomes, Cláudia; Riveros, Maribel; Durand, David; Tilley, Drake H; Bernal, María; Prada, Ana; Ochoa, Theresa J; Ruiz, Joaquim

2015-01-01

The study was aimed to describe the serotype, mechanisms of antimicrobial resistance, and virulence determinants in Shigella spp. isolated from Peruvian children. Eighty three Shigella spp. were serogrouped and serotyped being established the antibiotic susceptibility. The presence of 12 virulence factors (VF) and integrase 1 and 2, along with commonly found antibiotic resistance genes was established by PCR. S. flexneri was the most relevant serogroup (55 isolates, 66%), with serotype 2a most frequently detected (27 of 55, 49%), followed by S. boydii and S. sonnei at 12 isolates each (14%) and S. dysenteriae (four isolates, 5%). Fifty isolates (60%) were multi-drug resistant (MDR) including 100% of S. sonnei and 64% of S. flexneri. Resistance levels were high to trimethoprim-sulfamethoxazole (86%), tetracycline (74%), ampicillin (67%), and chloramphenicol (65%). Six isolates showed decreased azithromycin susceptibility. No isolate was resistant to nalidixic acid, ciprofloxacin, nitrofurantoin, or ceftriaxone. The most frequent resistance genes were sul2 (95%), tet(B) (92%), cat (80%), dfrA1 (47%), blaOXA-1like (40%), with intl1 and intl2 detected in 51 and 52% of the isolates, respectively. Thirty-one different VF profiles were observed, being the ipaH (100%), sen (77%), virA and icsA (75%) genes the most frequently found. Differences in the prevalence of VF were observed between species with S. flexneri isolates, particularly serotype 2a, possessing high numbers of VF. In conclusion, this study highlights the high heterogeneity of Shigella VF and resistance genes, and prevalence of MDR organisms within this geographic region. Copyright © 2015 Elsevier GmbH. All rights reserved.

Long-term follow-up for efficacy and safety of treatment of retinitis pigmentosa with valproic acid.

Science.gov (United States)

Bhalla, Sheena; Joshi, Deval; Bhullar, Shaminder; Kasuga, Daniel; Park, Yeonhee; Kay, Christine N

2013-07-01

The purpose of this study was to determine the long-term efficacy and safety of valproic acid (VPA) treatment in patients with pigmentary retinal dystrophies. A retrospective chart review was conducted on 31 patients with a diagnosis of pigmentary retinal dystrophy prescribed VPA at a single centre. Visual field (VF), visual acuity (VA), length of treatment, liver enzymes and side effects were analysed. VF areas were defined using Goldmann VF (GVF) tracings recorded before, during and after VPA treatment using the V4e isopter for each eye. Using custom software, planimetric areas of VF were calculated. Five of the patients (10 eyes) had two Goldmann VF tracings, allowing comparison between baseline and follow-up VF. After 9.8 months of VPA, VF decreased by 0.145 cm(2) (26.478%) (p=0.432). For 22 of the patients (41 eyes), VA data was available, and logarithm of the minimum angle of resolution (logMAR) score changed by 0.056 log units (representing a decline in VA) after 14.9 months on VPA (p=0.002). Twelve patients (38.7%) reported negative side effects related to VPA use. VPA plays a complex role in patients with pigmentary retinal dystrophies and may be associated with VA and field decline as well as adverse side effects. Physicians should use caution with using VPA for pigmentary retinal dystrophies.

Bioelectrical impedance and visceral fat: a comparison with computed tomography in adults and elderly

International Nuclear Information System (INIS)

Eickemberg, Michaela; Roriz, Anna Karla Carneiro; Fontes, Gardenia Abreu Vieira; Sampaio, Lilian Ramos

2013-01-01

Objective: To evaluate the association between electrical bioimpedance analysis (BIA) and visceral fat (VF) in adult and elderly patients. Subjects and methods: This was a cross-sectional study, with a sample of 191 subjects (52% women, 49% elderly) stratified by sex, age and body mass. Computerized tomography (VF area) and BIA (percentage of total body fat (%TBF-BIA), phase angle, reactance and resistance) data were generated. Statistical analysis was based on Pearson's Correlation Coefficient, Anova, Pearson's Chi-square, and ROC curves. Results: VF areas ≥ 130 cm 2 were more prevalent among the elderly and among men. Adult females showed a stronger correlation between GV and %TBF-BIA. The other groups showed similar results and statistically significant correlations. Correlations between GV and phase angle were weak and not statistically significant. ROC Curves analyzes showed the following %TBF-BIA, which identified excess VF: for male subjects: 21.5% (adults) and 24.25% (elderly); for female subjects: 35.05% (adults) and 38.45% (elderly) with sensitivity of 78.6%, 82.1%, 83.3%, and 66.7%, and specificity of 70.6%, 62.5%, 79.1%, and 69%, respectively. Conclusion: BIA was found to have satisfactory sensitivity and specificity to predict VF; however, other devices and other techniques should be investigated to improve VF prediction. (author)

Bioelectrical impedance and visceral fat: a comparison with computed tomography in adults and elderly; Bioimpedancia eletrica e gordura visceral: uma comparacao com a tomografia computadorizada em adultos e idosos

Energy Technology Data Exchange (ETDEWEB)

Eickemberg, Michaela [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Roriz, Anna Karla Carneiro [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Fontes, Gardenia Abreu Vieira [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Sampaio, Lilian Ramos [Universidade Federal de Sao Paulo (Unifesp), Sao Paulo, SP (Brazil)

2013-05-01

Objective: To evaluate the association between electrical bioimpedance analysis (BIA) and visceral fat (VF) in adult and elderly patients. Subjects and methods: This was a cross-sectional study, with a sample of 191 subjects (52% women, 49% elderly) stratified by sex, age and body mass. Computerized tomography (VF area) and BIA (percentage of total body fat (%TBF-BIA), phase angle, reactance and resistance) data were generated. Statistical analysis was based on Pearson's Correlation Coefficient, Anova, Pearson's Chi-square, and ROC curves. Results: VF areas {>=} 130 cm{sup 2} were more prevalent among the elderly and among men. Adult females showed a stronger correlation between GV and %TBF-BIA. The other groups showed similar results and statistically significant correlations. Correlations between GV and phase angle were weak and not statistically significant. ROC Curves analyzes showed the following %TBF-BIA, which identified excess VF: for male subjects: 21.5% (adults) and 24.25% (elderly); for female subjects: 35.05% (adults) and 38.45% (elderly) with sensitivity of 78.6%, 82.1%, 83.3%, and 66.7%, and specificity of 70.6%, 62.5%, 79.1%, and 69%, respectively. Conclusion: BIA was found to have satisfactory sensitivity and specificity to predict VF; however, other devices and other techniques should be investigated to improve VF prediction. (author)

Off-design performance loss model for radial turbines with pivoting, variable-area stators

Science.gov (United States)

Meitner, P. L.; Glassman, A. J.

1980-01-01

An off-design performance loss model was developed for variable stator (pivoted vane), radial turbines through analytical modeling and experimental data analysis. Stator loss is determined by a viscous loss model; stator vane end-clearance leakage effects are determined by a clearance flow model. Rotor loss coefficient were obtained by analyzing the experimental data from a turbine rotor previously tested with six stators having throat areas from 20 to 144 percent of design area and were correlated with stator-to-rotor throat area ratio. An incidence loss model was selected to obtain best agreement with experimental results. Predicted turbine performance is compared with experimental results for the design rotor as well as with results for extended and cutback versions of the rotor. Sample calculations were made to show the effects of stator vane end-clearance leakage.

Consistency of variables in PCS and JASTRO great area database

International Nuclear Information System (INIS)

Nishino, Tomohiro; Teshima, Teruki; Abe, Mitsuyuki

1998-01-01

To examine whether the Patterns of Care Study (PCS) reflects the data for the major areas in Japan, the consistency of variables in the PCS and in the major area database of the Japanese Society for Therapeutic Radiology and Oncology (JASTRO) were compared. Patients with esophageal or uterine cervical cancer were sampled from the PCS and JASTRO databases. From the JASTRO database, 147 patients with esophageal cancer and 95 patients with uterine cervical cancer were selected according to the eligibility criteria for the PCS. From the PCS, 455 esophageal and 432 uterine cervical cancer patients were surveyed. Six items for esophageal cancer and five items for uterine cervical cancer were selected for a comparative analysis of PCS and JASTRO databases. Esophageal cancer: Age (p=.0777), combination of radiation and surgery (p=.2136), and energy of the external beam (p=.6400) were consistent for PCS and JASTRO. However, the dose of the external beam for the non-surgery group showed inconsistency (p=.0467). Uterine cervical cancer: Age (p=.6301) and clinical stage (p=.8555) were consistent for the two sets of data. However, the energy of the external beam (p<.0001), dose rate of brachytherapy (p<.0001), and brachytherapy utilization by clinical stage (p<.0001) showed inconsistencies. It appears possible that the JASTRO major area database could not account for all patients' backgrounds and factors and that both surveys might have an imbalance in the stratification of institutions including differences in equipment and staffing patterns. (author)

Spatial and temporal variability of rainfall and their effects on hydrological response in urban areas – a review

OpenAIRE

E. Cristiano; M.-C. ten Veldhuis; N. van de Giesen

2017-01-01

In urban areas, hydrological processes are characterized by high variability in space and time, making them sensitive to small-scale temporal and spatial rainfall variability. In the last decades new instruments, techniques, and methods have been developed to capture rainfall and hydrological processes at high resolution. Weather radars have been introduced to estimate high spatial and temporal rainfall variability. At the same time, new models have been proposed to reproduce hydrological res...

[Autism spectrum disorder and evaluation of perceived stress parents and professionals: Study of the psychometric properties of a French adaptation of the Appraisal of Life Event Scale (ALES-vf)].

Science.gov (United States)

Cappe, É; Poirier, N; Boujut, É; Nader-Grosbois, N; Dionne, C; Boulard, A

2017-08-01

Autism and related disorders are grouped into the category of « Autism Spectrum Disorder » (ASD) in the DSM-5. This appellation reflects the idea of a dimensional representation of autism that combines symptoms and characteristics that vary in severity and intensity. Despite common characteristics, there are varying degrees in intensity and in the onset of symptoms, ranging from a disability that can be very heavy with a total lack of communication and major disorders associated with the existence of a relative autonomy associated, sometimes, with extraordinary intellectual abilities. Parents are faced with several difficult situations, such as sleep disturbances, agitation, shouting, hetero violence, self-harm, learning difficulties, stereotyping, lack of social and emotional reciprocity, inappropriate behavior, etc. They can feel helpless and may experience stress related to these developmental and behavioral difficulties. The heterogeneity of symptoms, the presence of behavioral problems, the lack of reciprocity and autonomy also represent a challenge for practitioners in institutions and teachers at school. The objective of this research is to present the validation of a French translation of the Appraisal of Life Events Scale (ALES-vf) from Ferguson, Matthex and Cox, specifically adapted to the context of ASD. ALES was originally developed to operationalize the three dimensions of perceived stress (threat, loss and challenge) described by Lazarus and Folkman. ALES-vf was initially translated into French and adapted to the situation of parents of children with ASD. It was subsequently administered to 343 parents, 150 paramedical professionals involved with people with ASD, and 155 teachers from an ordinary school environment and from specialized schools, welcoming in their classroom at least one child with ASD. An exploratory factor analysis performed on data from 170 parents highlighted two exploratory models with four and three factors, slightly different

Symptomatic ventricular tachyarrhythmia is associated with delayed gadolinium enhancement in cardiac magnetic resonance imaging and with elevated plasma brain natriuretic peptide level in hypertrophic cardiomyopathy

International Nuclear Information System (INIS)

Oka, Katsumi; Tsujino, Takeshi; Nakao, Shinji; Lee-Kawabata, Masaaki; Ezumi, Akira; Masai, Miho; Ohyanagi, Mitsumasa; Masuyama, Tohru

2008-01-01

Delayed gadolinium enhancement (DGE) in cardiac magnetic resonance (CMR) imaging indicates the areas with myocardial fibrosis, which are suggested to be arrhythmogenic substrate in hypertrophic cardiomyopathy (HCM). Elevated brain natriuretic peptide (BNP) is associated with cardiovascular events in HCM. We investigated the grade of DGE in CMR and plasma BNP levels in HCM patients with or without symptomatic ventricular tachycardia (VT) or ventricular fibrillation (VF). We recruited 26 consecutive untreated HCM patients without any symptoms of heart failure. They were divided into 2 groups: patients with symptomatic VT/VF [VT/VF (+) group, n=6]; patients without symptomatic VT/VF [VT/VF (-) group, n=20]. CMR was performed to evaluate left ventricular geometry and the grade of DGE. Plasma BNP levels, left ventricular mass index, and the number of segments with positive DGE were greater in the VT/VF (+) group than in the VT/VF (-) group (698.1±387.6 vs. 226.9±256.8 pg/ml, p=0.006; 152.3±49.5 vs. 89.5±24.1 g/m 2 , p=0.003; 9.7±5.7 vs. 3.5±3.3, p=0.013). On logistic regression, adjusted odds ratio for symptomatic VT/VF was 214 for log BNP (95% confidence interval [CI] 1.2-37,043, p=0.04) and 1.54 for DGE score (95% CI 1.01-2.34, p=0.04). High plasma BNP levels and the enlarged area of DGE in CMR were associated with symptomatic ventricular tachyarrhythmia. These factors may be useful markers for detecting high-risk patients of sudden cardiac death in HCM. (author)

Thermal infrared imagery as a tool for analysing the variability of surface saturated areas at various temporal and spatial scales

Science.gov (United States)

Glaser, Barbara; Antonelli, Marta; Pfister, Laurent; Klaus, Julian

2017-04-01

Surface saturated areas are important for the on- and offset of hydrological connectivity within the hillslope-riparian-stream continuum. This is reflected in concepts such as variable contributing areas or critical source areas. However, we still lack a standardized method for areal mapping of surface saturation and for observing its spatiotemporal variability. Proof-of-concept studies in recent years have shown the potential of thermal infrared (TIR) imagery to record surface saturation dynamics at various temporal and spatial scales. Thermal infrared imagery is thus a promising alternative to conventional approaches, such as the squishy boot method or the mapping of vegetation. In this study we use TIR images to investigate the variability of surface saturated areas at different temporal and spatial scales in the forested Weierbach catchment (0.45 km2) in western Luxembourg. We took TIR images of the riparian zone with a hand-held FLIR infrared camera at fortnightly intervals over 18 months at nine different locations distributed over the catchment. Not all of the acquired images were suitable for a derivation of the surface saturated areas, as various factors influence the usability of the TIR images (e.g. temperature contrasts, shadows, fog). Nonetheless, we obtained a large number of usable images that provided a good insight into the dynamic behaviour of surface saturated areas at different scales. The images revealed how diverse the evolution of surface saturated areas can be throughout the hydrologic year. For some locations with similar morphology or topography we identified diverging saturation dynamics, while other locations with different morphology / topography showed more similar behaviour. Moreover, we were able to assess the variability of the dynamics of expansion / contraction of saturated areas within the single locations, which can help to better understand the mechanisms behind surface saturation development.

Spatial and temporal variability of rainfall and their effects on hydrological response in urban areas - a review

Science.gov (United States)

Cristiano, Elena; ten Veldhuis, Marie-claire; van de Giesen, Nick

2017-07-01

In urban areas, hydrological processes are characterized by high variability in space and time, making them sensitive to small-scale temporal and spatial rainfall variability. In the last decades new instruments, techniques, and methods have been developed to capture rainfall and hydrological processes at high resolution. Weather radars have been introduced to estimate high spatial and temporal rainfall variability. At the same time, new models have been proposed to reproduce hydrological response, based on small-scale representation of urban catchment spatial variability. Despite these efforts, interactions between rainfall variability, catchment heterogeneity, and hydrological response remain poorly understood. This paper presents a review of our current understanding of hydrological processes in urban environments as reported in the literature, focusing on their spatial and temporal variability aspects. We review recent findings on the effects of rainfall variability on hydrological response and identify gaps where knowledge needs to be further developed to improve our understanding of and capability to predict urban hydrological response.

Visceral fat dominant distribution in male type 2 diabetic patients is closely related to hepatic insulin resistance, irrespective of body type

Directory of Open Access Journals (Sweden)

Miyazaki Yoshinori

2009-08-01

Full Text Available Abstract Background All previous studies that investigated the association between abdominal fat distribution and insulin resistance evaluated subcutaneous and visceral fat area and/or volume, but these values were not related to the body type of each subject. In the present study we have examined the association between abdominal fat distribution and peripheral (muscle/hepatic sensitivity to insulin using the visceral to abdominal subcutaneous fat area ratio (VF/SF ratio in male patients with type 2 diabetes mellitus. This ratio defines the predominancy of visceral or subcutaneous abdominal adiposity, independent of the body type of each individual. Methods Thirty-six type 2 diabetic male patients underwent a euglycemic insulin clamp (insulin infusion rate = 40 mU/m2·min with 3-3H-glucose to measure insulin-mediated total body (primarily reflects muscle glucose disposal (TGD and suppression of endogenous (primarily reflects liver glucose production (EGP in response to a physiologic increase in plasma insulin concentration. Abdominal subcutaneous (SF and intraabdominal visceral fat (VF areas were quantitated with magnetic resonance imaging (MRI at the level of L4–5. Results TGD and TGD divided by steady state plasma insulin concentration during the insulin clamp (TGD/SSPI correlated inversely with body mass index (BMI, total fat mass (FM measured by 3H2O, SF and VF areas, while VF/SF ratio displayed no significant relationship with TGD or TGD/SSPI. In contrast, EGP and the product of EGP and SSPI during the insulin clamp (an index hepatic insulin resistance correlated positively with VF/SF ratio, but not with BMI, FM, VF or SF. Conclusion We conclude that, independent of the individual's body type, visceral fat dominant accumulation as opposed to subcutaneous fat accumulation is associated with hepatic insulin resistance, whereas peripheral (muscle insulin resistance is more closely related to general obesity (i.e. higher BMI and total FM

Feasibility of vocal fold abduction and adduction assessment using cine-MRI

Energy Technology Data Exchange (ETDEWEB)

Baki, Marina Mat [National University of Malaysia, Faculty of Medicine, Kuala Lumpur (Malaysia); Menys, Alex; Morley, Simon; Beale, Timothy [University College London, Centre for Medical Imaging, London (United Kingdom); Atkinson, David; Punwani, Shonit [University College London, Centre for Medical Imaging, London (United Kingdom); Royal National Throat Nose Ear Hospital, University College London Hospital NHS Trust, London (United Kingdom); Bassett, Paul [University College London, London (United Kingdom); Sandhu, Guri [Charing Cross Hospital, Imperial College Healthcare NHS Trust, London (United Kingdom); Naduvilethil, Georgekutty; Stevenson, Nicola [Royal National Throat Nose Ear Hospital, University College London Hospital NHS Trust, London (United Kingdom); Birchall, Martin A. [Royal National Throat Nose Ear Hospital, University College London Hospital NHS Trust, London (United Kingdom); University of California, Davis, Department of Otolaryngology, Davis, CA (United States); University College London, Ear Institute, London (United Kingdom)

2017-02-15

Determine feasibility of vocal fold (VF) abduction and adduction assessment by cine magnetic resonance imaging (cine-MRI) Cine-MRI of the VF was performed on five healthy and nine unilateral VF paralysis (UVFP) participants using an axial gradient echo acquisition with temporal resolution of 0.7 s. VFs were continuously imaged with cine-MRI during a 10-s period of quiet respiration and phonation. Scanning was repeated twice within an individual session and then once again at a 1-week interval. Asymmetry of VF position during phonation (VF phonation asymmetry, VFPa) and respiration (VF respiration asymmetry, VFRa) was determined. Percentage reduction in total glottal area between respiration and phonation (VF abduction potential, VFAP) was derived to measure overall mobility. An un-paired t-test was used to compare differences between groups. Intra-session, inter-session and inter-reader repeatability of the quantitative metrics was evaluated using intraclass correlation coefficient (ICC). VF position asymmetry (VFPa and VFRa) was greater (p=0.012; p=0.001) and overall mobility (VFAP) was lower (p=0.008) in UVFP patients compared with healthy participants. ICC of repeatability of all metrics was good, ranged from 0.82 to 0.95 except for the inter-session VFPa (0.44). Cine-MRI is feasible for assessing VF abduction and adduction. Derived quantitative metrics have good repeatability. (orig.)

Feasibility of vocal fold abduction and adduction assessment using cine-MRI

International Nuclear Information System (INIS)

Baki, Marina Mat; Menys, Alex; Morley, Simon; Beale, Timothy; Atkinson, David; Punwani, Shonit; Bassett, Paul; Sandhu, Guri; Naduvilethil, Georgekutty; Stevenson, Nicola; Birchall, Martin A.

2017-01-01

Determine feasibility of vocal fold (VF) abduction and adduction assessment by cine magnetic resonance imaging (cine-MRI) Cine-MRI of the VF was performed on five healthy and nine unilateral VF paralysis (UVFP) participants using an axial gradient echo acquisition with temporal resolution of 0.7 s. VFs were continuously imaged with cine-MRI during a 10-s period of quiet respiration and phonation. Scanning was repeated twice within an individual session and then once again at a 1-week interval. Asymmetry of VF position during phonation (VF phonation asymmetry, VFPa) and respiration (VF respiration asymmetry, VFRa) was determined. Percentage reduction in total glottal area between respiration and phonation (VF abduction potential, VFAP) was derived to measure overall mobility. An un-paired t-test was used to compare differences between groups. Intra-session, inter-session and inter-reader repeatability of the quantitative metrics was evaluated using intraclass correlation coefficient (ICC). VF position asymmetry (VFPa and VFRa) was greater (p=0.012; p=0.001) and overall mobility (VFAP) was lower (p=0.008) in UVFP patients compared with healthy participants. ICC of repeatability of all metrics was good, ranged from 0.82 to 0.95 except for the inter-session VFPa (0.44). Cine-MRI is feasible for assessing VF abduction and adduction. Derived quantitative metrics have good repeatability. (orig.)

Effects of tung oilseed FAD2 and DGAT2 genes on unsaturated fatty acid accumulation in Rhodotorula glutinis and Arabidopsis thaliana.

Science.gov (United States)

Chen, Yicun; Cui, Qinqin; Xu, Yongjie; Yang, Susu; Gao, Ming; Wang, Yangdong

2015-08-01

Genetic engineering to produce valuable lipids containing unsaturated fatty acids (UFAs) holds great promise for food and industrial applications. Efforts to genetically modify plants to produce desirable UFAs with single enzymes, however, have had modest success. The key enzymes fatty acid desaturase (FAD) and diacylglycerol acyltransferase (DGAT) are responsible for UFA biosynthesis (a push process) and assembling fatty acids into lipids (a pull process) in plants, respectively. To examine their roles in UFA accumulation, VfFAD2 and VfDGAT2 genes cloned from Vernicia fordii (tung tree) oilseeds were conjugated and transformed into Rhodotorula glutinis and Arabidopsis thaliana via Agrobacterium tumefaciens. Real-time quantitative PCR revealed variable gene expression levels in the transformants, with a much higher level of VfDGAT2 than VfFAD2. The relationship between VfFAD2 expression and linoleic acid (C18:2) increases in R. glutinis (R (2) = 0.98) and A. thaliana (R (2) = 0.857) transformants was statistically linear. The VfDGAT2 expression level was statistically correlated with increased total fatty acid content in R. glutinis (R (2) = 0.962) and A. thaliana (R (2) = 0.8157) transformants. With a similar expression level between single- and two-gene transformants, VfFAD2-VfDGAT2 co-transformants showed a higher linolenic acid (C18:3) yield in R. glutinis (174.36 % increase) and A. thaliana (14.61 % increase), and eicosatrienoic acid (C20:3) was enriched (17.10 % increase) in A. thaliana. Our data suggest that VfFAD2-VfDGAT2 had a synergistic effect on UFA metabolism in R. glutinis, and to a lesser extent, A. thaliana. These results show promise for further genetic engineering of plant lipids to produce desirable UFAs.

Efficacy of the Amsler Grid Test in Evaluating Glaucomatous Central Visual Field Defects.

Science.gov (United States)

Su, Daniel; Greenberg, Andrew; Simonson, Joseph L; Teng, Christopher C; Liebmann, Jeffrey M; Ritch, Robert; Park, Sung Chul

2016-04-01

To investigate the efficacy of the Amsler grid test in detecting central visual field (VF) defects in glaucoma. Prospective, cross-sectional study. Patients with glaucoma with reliable Humphrey 10-2 Swedish Interactive Threshold Algorithm standard VF on the date of enrollment or within the previous 3 months. Amsler grid tests were performed for each eye and were considered "abnormal" if there was any perceived scotoma with missing or blurry grid lines within the central 10 degrees ("Amsler grid scotoma"). An abnormal 10-2 VF was defined as ≥3 adjacent points at P grid scotoma area were calculated with the 10-2 VF as the clinical reference standard. Among eyes with an abnormal 10-2 VF, regression analyses were performed between the Amsler grid scotoma area and the 10-2 VF parameters (mean deviation [MD], scotoma extent [number of test points with P grid scotoma area. A total of 106 eyes (53 patients) were included (mean ± standard deviation age, 24-2 MD and 10-2 MD = 66±12 years, -9.61±8.64 decibels [dB] and -9.75±9.00 dB, respectively). Sensitivity, specificity, and positive and negative predictive values of the Amsler grid test were 68%, 92%, 97%, and 46%, respectively. Sensitivity was 40% in eyes with 10-2 MD better than -6 dB, 58% in eyes with 10-2 MD between -12 and -6 dB, and 92% in eyes with 10-2 MD worse than -12 dB. The area under the receiver operating characteristic curve of the Amsler grid scotoma area was 0.810 (95% confidence interval, 0.723-0.880, P grid scotoma area had the strongest relationship with 10-2 MD (quadratic R(2)=0.681), followed by 10-2 scotoma extent (quadratic R(2)=0.611) and 10-2 scotoma mean depth (quadratic R(2)=0.299) (all P grid can be used to screen for moderate to severe central vision loss from glaucoma. Copyright © 2016 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Pore-scale modeling of vapor transport in partially saturated capillary tube with variable area using chemical potential

DEFF Research Database (Denmark)

Addassi, Mouadh; Schreyer, Lynn; Johannesson, Björn

2016-01-01

Here we illustrate the usefulness of using the chemical potential as the primary unknown by modeling isothermal vapor transport through a partially saturated cylindrically symmetric capillary tube of variable cross-sectional area using a single equation. There are no fitting parameters and the nu......Here we illustrate the usefulness of using the chemical potential as the primary unknown by modeling isothermal vapor transport through a partially saturated cylindrically symmetric capillary tube of variable cross-sectional area using a single equation. There are no fitting parameters...... and the numerical solutions to the equation are compared with experimental results with excellent agreement. We demonstrate that isothermal vapor transport can be accurately modeled without modeling the details of the contact angle, microscale temperature fluctuations, or pressure fluctuations using a modification...

Bioelectrical impedance and visceral fat: a comparison with computed tomography in adults and elderly; Bioimpedancia eletrica e gordura visceral: uma comparacao com a tomografia computadorizada em adultos e idosos

Energy Technology Data Exchange (ETDEWEB)

Eickemberg, Michaela [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Roriz, Anna Karla Carneiro [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Fontes, Gardenia Abreu Vieira [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil); Sampaio, Lilian Ramos [Universidade Federal de Sao Paulo (Unifesp), Sao Paulo, SP (Brazil)

2013-05-01

Objective: To evaluate the association between electrical bioimpedance analysis (BIA) and visceral fat (VF) in adult and elderly patients. Subjects and methods: This was a cross-sectional study, with a sample of 191 subjects (52% women, 49% elderly) stratified by sex, age and body mass. Computerized tomography (VF area) and BIA (percentage of total body fat (%TBF-BIA), phase angle, reactance and resistance) data were generated. Statistical analysis was based on Pearson's Correlation Coefficient, Anova, Pearson's Chi-square, and ROC curves. Results: VF areas {>=} 130 cm{sup 2} were more prevalent among the elderly and among men. Adult females showed a stronger correlation between GV and %TBF-BIA. The other groups showed similar results and statistically significant correlations. Correlations between GV and phase angle were weak and not statistically significant. ROC Curves analyzes showed the following %TBF-BIA, which identified excess VF: for male subjects: 21.5% (adults) and 24.25% (elderly); for female subjects: 35.05% (adults) and 38.45% (elderly) with sensitivity of 78.6%, 82.1%, 83.3%, and 66.7%, and specificity of 70.6%, 62.5%, 79.1%, and 69%, respectively. Conclusion: BIA was found to have satisfactory sensitivity and specificity to predict VF; however, other devices and other techniques should be investigated to improve VF prediction. (author)

Glaucoma progression detection by retinal nerve fiber layer measurement using scanning laser polarimetry: event and trend analysis.

Science.gov (United States)

Moon, Byung Gil; Sung, Kyung Rim; Cho, Jung Woo; Kang, Sung Yong; Yun, Sung-Cheol; Na, Jung Hwa; Lee, Youngrok; Kook, Michael S

2012-06-01

To evaluate the use of scanning laser polarimetry (SLP, GDx VCC) to measure the retinal nerve fiber layer (RNFL) thickness in order to evaluate the progression of glaucoma. Test-retest measurement variability was determined in 47 glaucomatous eyes. One eye each from 152 glaucomatous patients with at least 4 years of follow-up was enrolled. Visual field (VF) loss progression was determined by both event analysis (EA, Humphrey guided progression analysis) and trend analysis (TA, linear regression analysis of the visual field index). SLP progression was defined as a reduction of RNFL exceeding the predetermined repeatability coefficient in three consecutive exams, as compared to the baseline measure (EA). The slope of RNFL thickness change over time was determined by linear regression analysis (TA). Twenty-two eyes (14.5%) progressed according to the VF EA, 16 (10.5%) by VF TA, 37 (24.3%) by SLP EA and 19 (12.5%) by SLP TA. Agreement between VF and SLP progression was poor in both EA and TA (VF EA vs. SLP EA, k = 0.110; VF TA vs. SLP TA, k = 0.129). The mean (±standard deviation) progression rate of RNFL thickness as measured by SLP TA did not significantly differ between VF EA progressors and non-progressors (-0.224 ± 0.148 µm/yr vs. -0.218 ± 0.151 µm/yr, p = 0.874). SLP TA and EA showed similar levels of sensitivity when VF progression was considered as the reference standard. RNFL thickness as measurement by SLP was shown to be capable of detecting glaucoma progression. Both EA and TA of SLP showed poor agreement with VF outcomes in detecting glaucoma progression.

Urban mobility, socioeconomic and urban transport variables in metropolitan areas in three continents

Energy Technology Data Exchange (ETDEWEB)

Carvalho da Costa, F.B. de; Nassi, C.D.

2016-07-01

Transportation is the soul of urban cities. Find sustainable ways to keep people moving in our cities is more important than ever. Historically, cities have developed in different ways. Each has its own personality and complexity. But in all cases, transport and mobility have played a key role in city life. Due to the relevance of mobility this article tries to establish the relationship between some variables. The method was developed by collecting, analyzing and comparing data on metropolitan regions in North America, South America, Europe and Oceania through a mathematical model. From each selected location the following data were gathered: population, area (km²), demographic density (inhab/km²), socio-economic aspects (annual GDP per capita), transport system (subway extension), number of trips per person per day and modal split (% non-motorized, % public transport and % private transport). In this study we analyze some variables that influence the number of trips per person per day. Understanding the associations between all the variables that influence the number of trips per person per day contributes the planners to determine whether changes are needed to improve in the transport system in the metropolitan region. (Author)

Variability of zooplankton communities at Condor seamount and surrounding areas, Azores (NE Atlantic)

Science.gov (United States)

Carmo, Vanda; Santos, Mariana; Menezes, Gui M.; Loureiro, Clara M.; Lambardi, Paolo; Martins, Ana

2013-12-01

Seamounts are common topographic features around the Azores archipelago (NE Atlantic). Recently there has been increasing research effort devoted to the ecology of these ecosystems. In the Azores, the mesozooplankon is poorly studied, particularly in relation to these seafloor elevations. In this study, zooplankton communities in the Condor seamount area (Azores) were investigated during March, July and September 2010. Samples were taken during both day and night with a Bongo net of 200 µm mesh that towed obliquely within the first 100 m of the water column. Total abundance, biomass and chlorophyll a concentrations did not vary with sampling site or within the diel cycle but significant seasonal variation was observed. Moreover, zooplankton community composition showed the same strong seasonal pattern regardless of spatial or daily variability. Despite seasonal differences, the zooplankton community structure remained similar for the duration of this study. Seasonal variability better explained our results than mesoscale spatial variability. Spatial homogeneity is probably related with island proximity and local dynamics over Condor seamount. Zooplankton literature for the region is sparse, therefore a short review of the most important zooplankton studies from the Azores is also presented.

Spatial representation and cognitive modulation of response variability in the lateral intraparietal area priority map.

Science.gov (United States)

Falkner, Annegret L; Goldberg, Michael E; Krishna, B Suresh

2013-10-09

The lateral intraparietal area (LIP) in the macaque contains a priority-based representation of the visual scene. We previously showed that the mean spike rate of LIP neurons is strongly influenced by spatially wide-ranging surround suppression in a manner that effectively sharpens the priority map. Reducing response variability can also improve the precision of LIP's priority map. We show that when a monkey plans a visually guided delayed saccade with an intervening distractor, variability (measured by the Fano factor) decreases both for neurons representing the saccade goal and for neurons representing the broad spatial surround. The reduction in Fano factor is maximal for neurons representing the saccade goal and steadily decreases for neurons representing more distant locations. LIP Fano factor changes are behaviorally significant: increasing expected reward leads to lower variability for the LIP representation of both the target and distractor locations, and trials with shorter latency saccades are associated with lower Fano factors in neurons representing the surround. Thus, the LIP Fano factor reflects both stimulus and behavioral engagement. Quantitative modeling shows that the interaction between mean spike count and target-receptive field (RF) distance in the surround during the predistractor epoch is multiplicative: the Fano factor increases more steeply with mean spike count further away from the RF. A negative-binomial model for LIP spike counts captures these findings quantitatively, suggests underlying mechanisms based on trial-by-trial variations in mean spike rate or burst-firing patterns, and potentially provides a principled framework to account simultaneously for the previously observed unsystematic relationships between spike rate and variability in different brain areas.

Feasibility of vocal fold abduction and adduction assessment using cine-MRI.

Science.gov (United States)

Baki, Marina Mat; Menys, Alex; Atkinson, David; Bassett, Paul; Morley, Simon; Beale, Timothy; Sandhu, Guri; Naduvilethil, Georgekutty; Stevenson, Nicola; Birchall, Martin A; Punwani, Shonit

2017-02-01

Determine feasibility of vocal fold (VF) abduction and adduction assessment by cine magnetic resonance imaging (cine-MRI) METHODS: Cine-MRI of the VF was performed on five healthy and nine unilateral VF paralysis (UVFP) participants using an axial gradient echo acquisition with temporal resolution of 0.7 s. VFs were continuously imaged with cine-MRI during a 10-s period of quiet respiration and phonation. Scanning was repeated twice within an individual session and then once again at a 1-week interval. Asymmetry of VF position during phonation (VF phonation asymmetry, VFPa) and respiration (VF respiration asymmetry, VFRa) was determined. Percentage reduction in total glottal area between respiration and phonation (VF abduction potential, VFAP) was derived to measure overall mobility. An un-paired t-test was used to compare differences between groups. Intra-session, inter-session and inter-reader repeatability of the quantitative metrics was evaluated using intraclass correlation coefficient (ICC). VF position asymmetry (VFPa and VFRa) was greater (p=0.012; p=0.001) and overall mobility (VFAP) was lower (p=0.008) in UVFP patients compared with healthy participants. ICC of repeatability of all metrics was good, ranged from 0.82 to 0.95 except for the inter-session VFPa (0.44). Cine-MRI is feasible for assessing VF abduction and adduction. Derived quantitative metrics have good repeatability. • Cine-MRI is used to assess vocal folds (VFs) mobility: abduction and adduction. • New quantitative metrics are derived from VF position and abduction potential. • Cine-MRI able to depict the difference between normal and abnormal VF mobility. • Cine-MRI derived quantitative metrics have good repeatability.

Mapping glaucoma patients' 30-2 and 10-2 visual fields reveals clusters of test points damaged in the 10-2 grid that are not sampled in the sparse 30-2 grid.

Directory of Open Access Journals (Sweden)

Ryo Asaoka

Full Text Available PURPOSE: To cluster test points in glaucoma patients' 30-2 and 10-2 visual field (VF (Humphrey Field Analyzer: HFA, Carl Zeiss Meditec, Dublin, CA in order to map the different regions damaged by the disease. METHOD: This retrospective study included 128 eyes from 128 patients. 142 total deviation (TD values (74 from the 30-2 VF and 68 from the 10-2 VF were clustered using the 'Hierarchical Ordered Partitioning And Collapsing Hybrid-Partitioning Around Medoids' algorithm. The stability of the identified clusters was evaluated using bootstrapping. RESULTS: 65 sectors were identified in total: 38 sectors were located outside the 10-2 VF whereas 29 sectors were located inside the 10-2 VF (two sectors overlap in both grids. The mapping of many sectors appeared to follow the distribution of retinal nerve fiber bundles. The results of bootstrapping suggested clusters were stable whether they were outside or inside the 10-2 VF. CONCLUSION: A considerable number of sectors were identified in the 10-2 VF area, despite the fact that clustering was carried out on all points in both the 30-2 VF and 10-2 VF simultaneously. These findings suggest that glaucomatous central VF deterioration cannot be picked up by the 30-2 test grid alone, because of poor spatial sampling; denser estimation of the central ten degrees, than offered by the 30-2 test grid alone, is needed. It may be beneficial to develop a new VF test grid that combines test points from 30-2 and 10-2 VFs--the results of this study could help to devise this test grid.

Altitude Performance Characteristics of Tail-pipe Burner with Variable-area Exhaust Nozzle

Science.gov (United States)

Jansen, Emmert T; Thorman, H Carl

1950-01-01

An investigation was conducted in the NACA Lewis altitude wind tunnel to determine effect of altitude and flight Mach number on performance of tail-pipe burner equipped with variable-area exhaust nozzle and installed on full-scale turbojet engine. At a given flight Mach number, with constant exhaust-gas and turbine-outlet temperatures, increasing altitude lowered the tail-pipe combustion efficiency and raised the specific fuel consumption while the augmented thrust ratio remained approximately constant. At a given altitude, increasing flight Mach number raised the combustion efficiency and augmented thrust ratio and lowered the specific fuel consumption.

Spatial and temporal variability of rainfall and their effects on hydrological response in urban areas – a review

Directory of Open Access Journals (Sweden)

E. Cristiano

2017-07-01

Full Text Available In urban areas, hydrological processes are characterized by high variability in space and time, making them sensitive to small-scale temporal and spatial rainfall variability. In the last decades new instruments, techniques, and methods have been developed to capture rainfall and hydrological processes at high resolution. Weather radars have been introduced to estimate high spatial and temporal rainfall variability. At the same time, new models have been proposed to reproduce hydrological response, based on small-scale representation of urban catchment spatial variability. Despite these efforts, interactions between rainfall variability, catchment heterogeneity, and hydrological response remain poorly understood. This paper presents a review of our current understanding of hydrological processes in urban environments as reported in the literature, focusing on their spatial and temporal variability aspects. We review recent findings on the effects of rainfall variability on hydrological response and identify gaps where knowledge needs to be further developed to improve our understanding of and capability to predict urban hydrological response.

Statistical variability of hydro-meteorological variables as indicators ...

African Journals Online (AJOL)

Statistical variability of hydro-meteorological variables as indicators of climate change in north-east Sokoto-Rima basin, Nigeria. ... water resources development including water supply project, agriculture and tourism in the study area. Key word: Climate change, Climatic variability, Actual evapotranspiration, Global warming ...

Resuscitation after prolonged cardiac arrest: role of cardiopulmonary bypass and systemic hyperkalemia.

Science.gov (United States)

Liakopoulos, Oliver J; Allen, Bradley S; Buckberg, Gerald D; Hristov, Nikola; Tan, Zhongtuo; Villablanca, J Pablo; Trummer, Georg

2010-06-01

The purpose of this study was to determine (1) the role of emergency cardiopulmonary bypass (CPB) after prolonged cardiac arrest and failed cardiopulmonary resuscitation, and (2) the use of systemic hyperkalemia during CPB to convert intractable ventricular fibrillation (VF). Thirty-one pigs (34 +/- 2 kg) underwent 15 minutes of cardiac arrest after induced VF, followed by 10 minutes of cardiopulmonary resuscitation-advanced life support. Peripheral CPB was used if cardiopulmonary resuscitation failed to restore stable circulation. Damage was assessed by evaluating hemodynamics, biochemical variables (creatine kinase-MB, neuron-specific enolase), neurologic deficit score, and brain magnetic resonance imaging. Cardiopulmonary resuscitation alone was successful in only 19% (6 of 31 pigs). Cardiopulmonary bypass was initiated in 81% of animals (25 of 31 pigs) either for hypotension (5 of 25 pigs) or intractable VF (20 of 25 pigs). Defibrillation was successful in 7 of 20 animals during the first 10 minutes after initiating CPB. Ventricular fibrillation persisted more than 10 minutes in 13 of 20 pigs, and animals were treated either with repeated defibrillation (6 of 13 pigs) or with a potassium bolus (7 of 13 pigs) to induce transient cardiac arrest. Overall survival at 24 hours was 84% with cardiopulmonary resuscitation (100% of pigs with hypotension; 71% in CPB-VF < 10 minutes). Despite CPB, fatal myocardial failure occurred after VF duration of more than 10 minutes in all pigs treated with electrical defibrillation, whereas hyperkalemia allowed 100% cardioversion and 86% survival. Biochemical variables remained elevated in all groups. Similarly, severe brain injury was present in all animals as confirmed by neurologic deficit score (197 +/- 10) and magnetic resonance imaging. Emergency CPB after prolonged cardiac arrest improves survival and allows systemic hyperkalemia to convert intractable VF, but fails to reduce neurologic damage. 2010 The Society of Thoracic

Spatial Variability of Sources and Mixing State of Atmospheric Particles in a Metropolitan Area.

Science.gov (United States)

Ye, Qing; Gu, Peishi; Li, Hugh Z; Robinson, Ellis S; Lipsky, Eric; Kaltsonoudis, Christos; Lee, Alex K Y; Apte, Joshua S; Robinson, Allen L; Sullivan, Ryan C; Presto, Albert A; Donahue, Neil M

2018-05-30

Characterizing intracity variations of atmospheric particulate matter has mostly relied on fixed-site monitoring and quantifying variability in terms of different bulk aerosol species. In this study, we performed ground-based mobile measurements using a single-particle mass spectrometer to study spatial patterns of source-specific particles and the evolution of particle mixing state in 21 areas in the metropolitan area of Pittsburgh, PA. We selected sampling areas based on traffic density and restaurant density with each area ranging from 0.2 to 2 km 2 . Organics dominate particle composition in all of the areas we sampled while the sources of organics differ. The contribution of particles from traffic and restaurant cooking varies greatly on the neighborhood scale. We also investigate how primary and aged components in particles mix across the urban scale. Lastly we quantify and map the particle mixing state for all areas we sampled and discuss the overall pattern of mixing state evolution and its implications. We find that in the upwind and downwind of the urban areas, particles are more internally mixed while in the city center, particle mixing state shows large spatial heterogeneity that is mostly driven by emissions. This study is to our knowledge, the first study to perform fine spatial scale mapping of particle mixing state using ground-based mobile measurement and single-particle mass spectrometry.

Area-averaged surface fluxes and their time-space variability over the FIFE experimental domain

Science.gov (United States)

Smith, E. A.; Hsu, A. Y.; Crosson, W. L.; Field, R. T.; Fritschen, L. J.; Gurney, R. J.; Kanemasu, E. T.; Kustas, W. P.; Nie, D.; Shuttleworth, W. J.

1992-01-01

The underlying mean and variance properties of surface net radiation, sensible-latent heat fluxes and soil heat flux are studied over the densely instrumented grassland region encompassing FIFE. Flux variability is discussed together with the problem of scaling up to area-averaged fluxes. Results are compared and contrasted for cloudy and clear situations and examined for the influence of surface-induced biophysical controls (burn and grazing treatments) and topographic controls (aspect ratios and slope factors).

Shape memory alloy actuation for a variable area fan nozzle

Science.gov (United States)

Rey, Nancy; Tillman, Gregory; Miller, Robin M.; Wynosky, Thomas; Larkin, Michael J.; Flamm, Jeffrey D.; Bangert, Linda S.

2001-06-01

The ability to control fan nozzle exit area is an enabling technology for next generation high-bypass-ratio turbofan engines. Performance benefits for such designs are estimated at up to 9% in thrust specific fuel consumption (TSFC) relative to current fixed-geometry engines. Conventionally actuated variable area fan nozzle (VAN) concepts tend to be heavy and complicated, with significant aircraft integration, reliability and packaging issues. The goal of this effort was to eliminate these undesirable features and formulate a design that meets or exceeds leakage, durability, reliability, maintenance and manufacturing cost goals. A Shape Memory Alloy (SMA) bundled cable actuator acting to move an array of flaps around the fan nozzle annulus is a concept that meets these requirements. The SMA bundled cable actuator developed by the United Technologies Corporation (Patents Pending) provides significant work output (greater than 2200 in-lb per flap, through the range of motion) in a compact package and minimizes system complexity. Results of a detailed design study indicate substantial engine performance, weight, and range benefits. The SMA- based actuation system is roughly two times lighter than a conventional mechanical system, with significant aircraft direct operating cost savings (2-3%) and range improvements (5-6%) relative to a fixed-geometry nozzle geared turbofan. A full-scale sector model of this VAN system was built and then tested at the Jet Exit Test Facility at NASA Langley to demonstrate the system's ability to achieve 20% area variation of the nozzle under full scale aerodynamic loads. The actuator exceeded requirements, achieving repeated actuation against full-scale loads representative of typical cruise as well as greater than worst-case (ultimate) aerodynamic conditions. Based on these encouraging results, work is continuing with the goal of a flight test on a C-17 transport aircraft.

Variability of soil fertility properties in areas planted to sugarcane in the State of Goias, Brazil

Directory of Open Access Journals (Sweden)

José Avelino Cardoso

2014-04-01

Full Text Available Soil sampling should provide an accurate representation of a given area so that recommendations for amendments of soil acidity, fertilization and soil conservation may be drafted to increase yield and improve the use of inputs. The aim of this study was to evaluate the variability of soil fertility properties of Oxisols in areas planted to sugarcane in the State of Goias, Brazil. Two areas of approximately 8,100 m² each were selected, representing two fields of the Goiasa sugarcane mill in Goiatuba. The sugarcane crop had a row spacing of 1.5 m and subsamples were taken from 49 points in the row and 49 between the row with a Dutch auger at depths of 0.0-0.2 and 0.2-0.4 m, for a total of 196 subsamples for each area. The samples were individually subjected to chemical analyses of soil fertility (pH in CaCl2, potential acidity, organic matter, P, K, Ca and Mg and particle size analysis. The number of subsamples required to compose a sample within the acceptable ranges of error of 5, 10, 20 and 40 % of each property were computed from the coefficients of variation and the Student t-value for 95 % confidence. The soil properties under analysis exhibited different variabilities: high (P and K, medium (potential acidity, Ca and Mg and low (pH, organic matter and clay content. Most of the properties analyzed showed an error of less than 20 % for a group of 20 subsamples, except for P and K, which were capable of showing an error greater than 40 % around the mean. The extreme variability in phosphorus, particularly at the depth of 0.2-0.4 m, attributed to banded application of high rates of P fertilizers at planting, places limitations on assessment of its availability due to the high number of subsamples required for a composite sample.

Influence of weather and climate variables on the basal area growth of individual shortleaf pine trees

Science.gov (United States)

Pradip Saud; Thomas B. Lynch; Duncan S. Wilson; John Stewart; James M. Guldin; Bob Heinemann; Randy Holeman; Dennis Wilson; Keith Anderson

2015-01-01

An individual-tree basal area growth model previously developed for even-aged naturally occurring shortleaf pine trees (Pinus echinata Mill.) in western Arkansas and southeastern Oklahoma did not include weather variables. Individual-tree growth and yield modeling of shortleaf pine has been carried out using the remeasurements of over 200 plots...

Spatial variability of soil CO2 emission in a sugarcane area characterized by secondary information

Directory of Open Access Journals (Sweden)

Daniel De Bortoli Teixeira

2013-06-01

Full Text Available Soil CO2 emission (FCO2 is governed by the inherent properties of the soil, such as bulk density (BD. Mapping of FCO2 allows the evaluation and identification of areas with different accumulation potential of carbon. However, FCO2 mapping over larger areas is not feasible due to the period required for evaluation. This study aimed to assess the quality of FCO2 spatial estimates using values of BD as secondary information. FCO2 and BD were evaluated on a regular sampling grid of 60 m × 60 m comprising 141 points, which was established on a sugarcane area. Four scenarios were defined according to the proportion of the number of sampling points of FCO2 to those of BD. For these scenarios, 67 (F67, 87 (F87, 107 (F107 and 127 (F127 FCO2 sampling points were used in addition to 127 BD sampling points used as supplementary information. The use of additional information from the BD provided an increase in the accuracy of the estimates only in the F107, F67 and F87 scenarios, respectively. The F87 scenario, with the approximate ratio between the FCO2 and BD of 1.00:1.50, presented the best relative improvement in the quality of estimates, thereby indicating that the BD should be sampled at a density 1.5 time greater than that applied for the FCO2. This procedure avoided problems related to the high temporal variability associated with FCO2, which enabled the mapping of this variable to be elaborated in large areas.

Pollution influence in the variability of the lichen Lecanora varia (Ehrh) ach in the area of Bratislava

Energy Technology Data Exchange (ETDEWEB)

Pisut, I; Jelinkova, E

1973-01-01

The lichen Lecanora varia was transplanted from nonpolluted areas to polluted areas in Bratislava. The morphology of the organisms changed; soredia and apothecia with a soredious margin were formed. New young ascocarp with a paler colored discus and a margin were common. The transformation is conditioned by the degree of air pollution exposure. The rate is variable, and depends considerably on macroclimatic circumstances (mainly on the quantity of precipitation in winter). 10 references, 3 figures, 5 tables.

Loss model for off-design performance analysis of radial turbines with pivoting-vane, variable-area stators

Science.gov (United States)

Meitner, P. L.; Glassman, A. J.

1980-01-01

An off-design performance loss model for a radial turbine with pivoting, variable-area stators is developed through a combination of analytical modeling and experimental data analysis. A viscous loss model is used for the variation in stator loss with setting angle, and stator vane end-clearance leakage effects are predicted by a clearance flow model. The variation of rotor loss coefficient with stator setting angle is obtained by means of an analytical matching of experimental data for a rotor that was tested with six stators, having throat areas from 20 to 144% of the design area. An incidence loss model is selected to obtain best agreement with experimental data. The stator vane end-clearance leakage model predicts increasing mass flow and decreasing efficiency as a result of end-clearances, with changes becoming significantly larger with decreasing stator area.

Combination of individual tree detection and area-based approach in imputation of forest variables using airborne laser data

Science.gov (United States)

Vastaranta, Mikko; Kankare, Ville; Holopainen, Markus; Yu, Xiaowei; Hyyppä, Juha; Hyyppä, Hannu

2012-01-01

The two main approaches to deriving forest variables from laser-scanning data are the statistical area-based approach (ABA) and individual tree detection (ITD). With ITD it is feasible to acquire single tree information, as in field measurements. Here, ITD was used for measuring training data for the ABA. In addition to automatic ITD (ITD auto), we tested a combination of ITD auto and visual interpretation (ITD visual). ITD visual had two stages: in the first, ITD auto was carried out and in the second, the results of the ITD auto were visually corrected by interpreting three-dimensional laser point clouds. The field data comprised 509 circular plots ( r = 10 m) that were divided equally for testing and training. ITD-derived forest variables were used for training the ABA and the accuracies of the k-most similar neighbor ( k-MSN) imputations were evaluated and compared with the ABA trained with traditional measurements. The root-mean-squared error (RMSE) in the mean volume was 24.8%, 25.9%, and 27.2% with the ABA trained with field measurements, ITD auto, and ITD visual, respectively. When ITD methods were applied in acquiring training data, the mean volume, basal area, and basal area-weighted mean diameter were underestimated in the ABA by 2.7-9.2%. This project constituted a pilot study for using ITD measurements as training data for the ABA. Further studies are needed to reduce the bias and to determine the accuracy obtained in imputation of species-specific variables. The method could be applied in areas with sparse road networks or when the costs of fieldwork must be minimized.

Does manipulating the speed of visual flow in virtual reality change distance estimation while walking in Parkinson's disease?

Science.gov (United States)

Ehgoetz Martens, Kaylena A; Ellard, Colin G; Almeida, Quincy J

2015-03-01

Although dopaminergic replacement therapy is believed to improve sensory processing in PD, while delayed perceptual speed is thought to be caused by a predominantly cholinergic deficit, it is unclear whether sensory-perceptual deficits are a result of corrupt sensory processing, or a delay in updating perceived feedback during movement. The current study aimed to examine these two hypotheses by manipulating visual flow speed and dopaminergic medication to examine which influenced distance estimation in PD. Fourteen PD and sixteen HC participants were instructed to estimate the distance of a remembered target by walking to the position the target formerly occupied. This task was completed in virtual reality in order to manipulate the visual flow (VF) speed in real time. Three conditions were carried out: (1) BASELINE: VF speed was equal to participants' real-time movement speed; (2) SLOW: VF speed was reduced by 50 %; (2) FAST: VF speed was increased by 30 %. Individuals with PD performed the experiment in their ON and OFF state. PD demonstrated significantly greater judgement error during BASELINE and FAST conditions compared to HC, although PD did not improve their judgement error during the SLOW condition. Additionally, PD had greater variable error during baseline compared to HC; however, during the SLOW conditions, PD had significantly less variable error compared to baseline and similar variable error to HC participants. Overall, dopaminergic medication did not significantly influence judgement error. Therefore, these results suggest that corrupt processing of sensory information is the main contributor to sensory-perceptual deficits during movement in PD rather than delayed updating of sensory feedback.

Space and time variability of heating requirements for greenhouse tomato production in the Euro-Mediterranean area.

Science.gov (United States)

Mariani, Luigi; Cola, Gabriele; Bulgari, Roberta; Ferrante, Antonio; Martinetti, Livia

2016-08-15

The Euro-Mediterranean area is the seat of a relevant greenhouse activity, meeting the needs of important markets. A quantitative assessment of greenhouse energy consumption and of its variability in space and time is an important decision support tool for both greenhouse-sector policies and farmers. A mathematical model of greenhouse energy balance was developed and parameterized for a state-of-the-art greenhouse to evaluate the heating requirements for vegetables growing. Tomato was adopted as reference crop, due to its high energy requirement for fruit setting and ripening and its economic relevance. In order to gain a proper description of the Euro-Mediterranean area, 56 greenhouse areas located within the ranges 28°N-72°N and 11°W-55°E were analyzed over the period 1973-2014. Moreover, the two 1973-1987 and 1988-2014 sub-periods were separately studied to describe climate change effects on energy consumption. Results account for the spatial variability of energy needs for tomato growing, highlighting the strong influence of latitude on the magnitude of heat requirements. The comparison between the two selected sub-periods shows a decrease of energy demand in the current warm phase, more relevant for high latitudes. Finally, suggestions to reduce energy consumptions are provided. Copyright © 2016 Elsevier B.V. All rights reserved.

GIS Based Distributed Runoff Predictions in Variable Source Area Watersheds Employing the SCS-Curve Number

Science.gov (United States)

Steenhuis, T. S.; Mendoza, G.; Lyon, S. W.; Gerard Marchant, P.; Walter, M. T.; Schneiderman, E.

2003-04-01

Because the traditional Soil Conservation Service Curve Number (SCS-CN) approach continues to be ubiquitously used in GIS-BASED water quality models, new application methods are needed that are consistent with variable source area (VSA) hydrological processes in the landscape. We developed within an integrated GIS modeling environment a distributed approach for applying the traditional SCS-CN equation to watersheds where VSA hydrology is a dominant process. Spatial representation of hydrologic processes is important for watershed planning because restricting potentially polluting activities from runoff source areas is fundamental to controlling non-point source pollution. The methodology presented here uses the traditional SCS-CN method to predict runoff volume and spatial extent of saturated areas and uses a topographic index to distribute runoff source areas through watersheds. The resulting distributed CN-VSA method was incorporated in an existing GWLF water quality model and applied to sub-watersheds of the Delaware basin in the Catskill Mountains region of New York State. We found that the distributed CN-VSA approach provided a physically-based method that gives realistic results for watersheds with VSA hydrology.

Interpolating a consumption variable for scaling and generalizing potential population pressure on urbanizing natural areas

Science.gov (United States)

Varanka, Dalia; Jiang, Bin; Yao, Xiaobai

2010-01-01

Measures of population pressure, referring in general to the stress upon the environment by human consumption of resources, are imperative for environmental sustainability studies and management. Development based on resource consumption is the predominant factor of population pressure. This paper presents a spatial model of population pressure by linking consumption associated with regional urbanism and ecosystem services. Maps representing relative geographic degree and extent of natural resource consumption and degree and extent of impacts on surrounding areas are new, and this research represents the theoretical research toward this goal. With development, such maps offer a visualization tool for planners of various services, amenities for people, and conservation planning for ecologist. Urbanization is commonly generalized by census numbers or impervious surface area. The potential geographical extent of urbanism encompasses the environmental resources of the surrounding region that sustain cities. This extent is interpolated using kriging of a variable based on population wealth data from the U.S. Census Bureau. When overlayed with land-use/land-cover data, the results indicate that the greatest estimates of population pressure fall within mixed forest areas. Mixed forest areas result from the spread of cedar woods in previously disturbed areas where further disturbance is then suppressed. Low density areas, such as suburbanization and abandoned farmland are characteristic of mixed forest areas.

Visual data mining with self-organising maps for ventricular fibrillation analysis.

Science.gov (United States)

Rosado-Muñoz, Alfredo; Martínez-Martínez, José M; Escandell-Montero, Pablo; Soria-Olivas, Emilio

2013-08-01

Detection of ventricular fibrillation (VF) at an early stage is being deeply studied in order to lower the risk of sudden death and allows the specialist to have greater reaction time to give the patient a good recovering therapy. Some works are focusing on detecting VF based on numerical analysis of time-frequency distributions, but in general the methods used do not provide insight into the problem. However, this study proposes a new methodology in order to obtain information about this problem. This work uses a supervised self-organising map (SOM) to obtain visually information among four important groups of patients: VF (ventricular fibrillation), VT (ventricular tachycardia), HP (healthy patients) and AHR (other anomalous heart rates and noise). A total number of 27 variables were obtained from continuous surface ECG recordings in standard databases (MIT and AHA), providing information in the time, frequency, and time-frequency domains. self-organising maps (SOMs), trained with 11 of the 27 variables, were used to extract knowledge about the variable values for each group of patients. Results show that the SOM technique allows to determine the profile of each group of patients, assisting in gaining a deeper understanding of this clinical problem. Additionally, information about the most relevant variables is given by the SOM analysis. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Clinical evaluation of a novel population-based regression analysis for detecting glaucomatous visual field progression.

Science.gov (United States)

Kovalska, M P; Bürki, E; Schoetzau, A; Orguel, S F; Orguel, S; Grieshaber, M C

2011-04-01

The distinction of real progression from test variability in visual field (VF) series may be based on clinical judgment, on trend analysis based on follow-up of test parameters over time, or on identification of a significant change related to the mean of baseline exams (event analysis). The aim of this study was to compare a new population-based method (Octopus field analysis, OFA) with classic regression analyses and clinical judgment for detecting glaucomatous VF changes. 240 VF series of 240 patients with at least 9 consecutive examinations available were included into this study. They were independently classified by two experienced investigators. The results of such a classification served as a reference for comparison for the following statistical tests: (a) t-test global, (b) r-test global, (c) regression analysis of 10 VF clusters and (d) point-wise linear regression analysis. 32.5 % of the VF series were classified as progressive by the investigators. The sensitivity and specificity were 89.7 % and 92.0 % for r-test, and 73.1 % and 93.8 % for the t-test, respectively. In the point-wise linear regression analysis, the specificity was comparable (89.5 % versus 92 %), but the sensitivity was clearly lower than in the r-test (22.4 % versus 89.7 %) at a significance level of p = 0.01. A regression analysis for the 10 VF clusters showed a markedly higher sensitivity for the r-test (37.7 %) than the t-test (14.1 %) at a similar specificity (88.3 % versus 93.8 %) for a significant trend (p = 0.005). In regard to the cluster distribution, the paracentral clusters and the superior nasal hemifield progressed most frequently. The population-based regression analysis seems to be superior to the trend analysis in detecting VF progression in glaucoma, and may eliminate the drawbacks of the event analysis. Further, it may assist the clinician in the evaluation of VF series and may allow better visualization of the correlation between function and structure owing to VF

Spatial and Temporal Variability of Carbon Dioxide Using Structure Functions in Urban Areas: Insights for Future Active Remote CO2 Sensors

Science.gov (United States)

Choi, Yonghoon; Yang, Melissa; Kooi, Susan A.; Browell, Edward V.; DiGangi, Joshua P.

2015-01-01

High resolution in-situ CO2 measurements were recorded onboard the NASA P-3B during the DISCOVER-AQ (Deriving Information on Surface Conditions from Column and Vertically Resolved Observations Relevant to Air Quality) Field Campaigns during July 2011 over Washington DC/Baltimore, MD; January-February 2013 over the San Joaquin Valley, CA; September 2013 over Houston, TX; and July-August 2014 over Denver, CO. Each of these campaigns have approximately two hundred vertical soundings of CO2 within the lower troposphere (surface to about 5 kilometers) at 6-8 different sites in each of the urban areas. In this study, we used structure function analysis, which is a useful way to quantify spatial and temporal variability, by displaying differences with average observations, to evaluate the variability of CO2 in the 0-2 kilometers range (representative of the planetary boundary layer). These results can then be used to provide guidance in the development of science requirements for the future ASCENDS (Active Sensing of CO2 Emissions over Nights, Days, and Seasons) mission to measure near-surface CO2 variability in different urban areas. We also compare the observed in-situ CO2 variability with the variability of the CO2 column-averaged optical depths in the 0-1 kilometer and 0-3.5 kilometers altitude ranges in the four geographically different urban areas, using vertical weighting functions for potential future ASCENDS lidar CO2 sensors operating in the 1.57 and 2.05 millimeter measurement regions. In addition to determining the natural variability of CO2 near the surface and in the column, radiocarbon method using continuous CO2 and CO measurements are used to examine the variation of emission quantification between anthropogenic and biogenic sources in the DC/Maryland urban site.

Characterizing spatial variability of air pollution from vehicle traffic around the Houston Ship Channel area

Science.gov (United States)

Zhang, Xueying; Craft, Elena; Zhang, Kai

2017-07-01

Mobile emissions are a major source of urban air pollution and have been associated with a variety of adverse health outcomes. The Houston Ship Channel area is the home of a large number of diesel-powered vehicles emitting fine particulate matter (PM2.5; ≤2.5 μm in aerodynamic diameter) and nitrogen oxides (NOx). However, the spatial variability of traffic-related air pollutants in the Houston Ship Channel area has rarely been investigated. The objective of this study is to characterize spatial variability of PM2.5 and NOx concentrations attributable to on-road traffic in the Houston Ship Channel area in the year of 2011. We extracted the road network from the Texas Department of Transportation Road Inventory, and calculated emission rates using the Motor Vehicle Emission Simulator version 2014a (MOVES2014a). These parameters and preprocessed meteorological parameters were entered into a Research LINE-source Dispersion Model (RLINE) to conduct a simulation. Receptors were placed at 50 m resolution within 300 m to major roads and at 150 m resolution in the rest of the area. Our findings include that traffic-related PM2.5 were mainly emitted from trucks, while traffic-related NOx were emitted from both trucks and cars. The traffic contributed 0.90 μg/m3 PM2.5 and 29.23 μg/m3 NOx to the annual average mass concentrations of on-road air pollution, and the concentrations of the two pollutants decreased by nearly 40% within 500 m distance to major roads. The pollution level of traffic-related PM2.5 and NOx was higher in winter than those in the other three seasons. The Houston Ship Channel has earlier morning peak hours and relative late afternoon hours, which indicates the influence of goods movement from port activity. The varied near-road gradients illustrate that proximities to major roads are not an accurate surrogate of traffic-related air pollution.

Variable Scheduling to Mitigate Channel Losses in Energy-Efficient Body Area Networks

Directory of Open Access Journals (Sweden)

Lavy Libman

2012-11-01

Full Text Available We consider a typical body area network (BAN setting in which sensor nodes send data to a common hub regularly on a TDMA basis, as defined by the emerging IEEE 802.15.6 BAN standard. To reduce transmission losses caused by the highly dynamic nature of the wireless channel around the human body, we explore variable TDMA scheduling techniques that allow the order of transmissions within each TDMA round to be decided on the fly, rather than being fixed in advance. Using a simple Markov model of the wireless links, we devise a number of scheduling algorithms that can be performed by the hub, which aim to maximize the expected number of successful transmissions in a TDMA round, and thereby significantly reduce transmission losses as compared with a static TDMA schedule. Importantly, these algorithms do not require a priori knowledge of the statistical properties of the wireless channels, and the reliability improvement is achieved entirely via shuffling the order of transmissions among devices, and does not involve any additional energy consumption (e.g., retransmissions. We evaluate these algorithms directly on an experimental set of traces obtained from devices strapped to human subjects performing regular daily activities, and confirm that the benefits of the proposed variable scheduling algorithms extend to this practical setup as well.

Stereophysicochemical variability plots highlight conserved antigenic areas in Flaviviruses

Directory of Open Access Journals (Sweden)

Zhou Bin

2005-04-01

Full Text Available Abstract Background Flaviviruses, which include Dengue (DV and West Nile (WN, mutate in response to immune system pressure. Identifying escape mutants, variant progeny that replicate in the presence of neutralizing antibodies, is a common way to identify functionally important residues of viral proteins. However, the mutations typically occur at variable positions on the viral surface that are not essential for viral replication. Methods are needed to determine the true targets of the neutralizing antibodies. Results Stereophysicochemical variability plots (SVPs, 3-D images of protein structures colored according to variability, as determined by our PCPMer program, were used to visualize residues conserved in their physical chemical properties (PCPs near escape mutant positions. The analysis showed 1 that escape mutations in the flavivirus envelope protein are variable residues by our criteria and 2 two escape mutants found at the same position in many flaviviruses sit above clusters of conserved residues from different regions of the linear sequence. Conservation patterns in T-cell epitopes in the NS3- protease suggest a similar mechanism of immune system evasion. Conclusion The SVPs add another dimension to structurally defining the binding sites of neutralizing antibodies. They provide a useful aid for determining antigenically important regions and designing vaccines.

Dynamic Analysis for a Geared Turbofan Engine with Variable Area Fan Nozzle

Science.gov (United States)

Csank, Jeffrey T.; Thomas, George L.

2017-01-01

Aggressive design goals have been set for future aero-propulsion systems with regards to fuel economy, noise, and emissions. To meet these challenging goals, advanced propulsion concepts are being explored and current operating margins are being re-evaluated to find additional concessions that can be made. One advanced propulsion concept being evaluated is a geared turbofan with a variable area fan nozzle (VAFN), developed by NASA. This engine features a small core, a fan driven by the low pressure turbine through a reduction gearbox, and a shape memory alloy (SMA)-actuated VAFN. The VAFN is designed to allow both a small exit area for efficient operation at cruise, while being able to open wider at high power conditions to reduce backpressure on the fan and ensure a safe level of stall margin is maintained. The VAFN is actuated via a SMA-based system instead of a conventional system to decrease overall weight of the system, however, SMA-based actuators respond relatively slowly, which introduces dynamic issues that are investigated in this work. This paper describes both a control system designed specifically for issues associated with SMAs, and dynamic analysis of the geared turbofan VAFN with the SMA actuators. Also, some future recommendations are provided for this type of propulsion system.

Assessing variability and long-term trends in burned area by merging multiple satellite fire products

Directory of Open Access Journals (Sweden)

L. Giglio

2010-03-01

Full Text Available Long term, high quality estimates of burned area are needed for improving both prognostic and diagnostic fire emissions models and for assessing feedbacks between fire and the climate system. We developed global, monthly burned area estimates aggregated to 0.5° spatial resolution for the time period July 1996 through mid-2009 using four satellite data sets. From 2001–2009, our primary data source was 500-m burned area maps produced using Moderate Resolution Imaging Spectroradiometer (MODIS surface reflectance imagery; more than 90% of the global area burned during this time period was mapped in this fashion. During times when the 500-m MODIS data were not available, we used a combination of local regression and regional regression trees developed over periods when burned area and Terra MODIS active fire data were available to indirectly estimate burned area. Cross-calibration with fire observations from the Tropical Rainfall Measuring Mission (TRMM Visible and Infrared Scanner (VIRS and the Along-Track Scanning Radiometer (ATSR allowed the data set to be extended prior to the MODIS era. With our data set we estimated that the global annual area burned for the years 1997–2008 varied between 330 and 431 Mha, with the maximum occurring in 1998. We compared our data set to the recent GFED2, L3JRC, GLOBCARBON, and MODIS MCD45A1 global burned area products and found substantial differences in many regions. Lastly, we assessed the interannual variability and long-term trends in global burned area over the past 13 years. This burned area time series serves as the basis for the third version of the Global Fire Emissions Database (GFED3 estimates of trace gas and aerosol emissions.

Variability of morphometric characteristics of the leaves of European white elm from the area of Great War Island

Directory of Open Access Journals (Sweden)

Devetaković Jovana

2013-01-01

Full Text Available The European White Elm (Ulmus effusa Willd. is indicated as a rare and endangered species in the growing stock of the Republic of Serbia. In the area of Great War Island, its natural populations were reduced to 56 registered trees, which occur in three spatially isolated subpopulations. On the basis of the research conducted on the level of variability of adaptible morphometric characteristics of leaves from 14 selected test trees of European White Elm, it can be concluded that the degree of interpopulation variability is satisfactory, which is a good basis for the conservation of the available gene pool.

Scotoma analysis of 10–2 visual field testing with a red target in screening for hydroxychloroquine retinopathy

Directory of Open Access Journals (Sweden)

Browning DJ

2015-08-01

Full Text Available David J Browning, Chong LeeDepartment of Ophthalmology, Charlotte Eye, Ear, Nose and Throat Associates, Charlotte, NC, USAObjective: To quantify the variability of scotomas detected by 10–2 visual field (VF testing with a red target in patients taking hydroxychloroquine without and with retinopathy.Design: Retrospective review of clinical charts and VFs.Methods: Twenty-four patients taking hydroxychloroquine without retinopathy, and eight patients taking hydroxychloroquine with retinopathy were tested in this study. Retinopathy was defined by annular scotomas on 10–2 VF testing with corroborative spectral domain optical coherence tomographic outer retinal changes and multifocal electroretinographic changes leading to cessation of hydroxychloroquine or chloroquine. Location and depth of scotoma points on 10–2 VF testing were recorded and their fates followed in serial, reliable 10–2 VFs performed with a red target over time. The main outcome measures for this study were the number of scotoma points and locations, percentage of persistent scotoma points, size of scotomas, location of scotomas, and percentage of scotomas deepening. Results: A median of 3, interquartile range (IQR (2, 5, scotoma points per VF occurred in patients without retinopathy. A median of 86%, IQR (77, 100, of these resolved on the subsequent field. For patients with retinopathy, a median of 50%, IQR (46, 79, resolved, a difference compared to patients without retinopathy that was significant (P=0.0158. The median percentage of scotoma points in the zone from 2° to 8° from fixation in eyes with retinopathy was 72%, IQR (54, 100, compared to 49%, IQR (40, 54, in eyes without retinopathy (P=0.0069. The number of persistent scotoma locations at the last visit was higher in eyes with retinopathy: 3, IQR (1, 3, versus 0, IQR (0, 1, in patients without retinopathy, P=0.0156.Conclusion: Point scotomas are common and variable in 10–2 VF testing with a red target for

Individual Movement Variability Magnitudes Are Explained by Cortical Neural Variability.

Science.gov (United States)

Haar, Shlomi; Donchin, Opher; Dinstein, Ilan

2017-09-13

Humans exhibit considerable motor variability even across trivial reaching movements. This variability can be separated into specific kinematic components such as extent and direction that are thought to be governed by distinct neural processes. Here, we report that individual subjects (males and females) exhibit different magnitudes of kinematic variability, which are consistent (within individual) across movements to different targets and regardless of which arm (right or left) was used to perform the movements. Simultaneous fMRI recordings revealed that the same subjects also exhibited different magnitudes of fMRI variability across movements in a variety of motor system areas. These fMRI variability magnitudes were also consistent across movements to different targets when performed with either arm. Cortical fMRI variability in the posterior-parietal cortex of individual subjects explained their movement-extent variability. This relationship was apparent only in posterior-parietal cortex and not in other motor system areas, thereby suggesting that individuals with more variable movement preparation exhibit larger kinematic variability. We therefore propose that neural and kinematic variability are reliable and interrelated individual characteristics that may predispose individual subjects to exhibit distinct motor capabilities. SIGNIFICANCE STATEMENT Neural activity and movement kinematics are remarkably variable. Although intertrial variability is rarely studied, here, we demonstrate that individual human subjects exhibit distinct magnitudes of neural and kinematic variability that are reproducible across movements to different targets and when performing these movements with either arm. Furthermore, when examining the relationship between cortical variability and movement variability, we find that cortical fMRI variability in parietal cortex of individual subjects explained their movement extent variability. This enabled us to explain why some subjects

A new general dynamic model predicting radionuclide concentrations and fluxes in coastal areas from readily accessible driving variables

International Nuclear Information System (INIS)

Haakanson, Lars

2004-01-01

This paper presents a general, process-based dynamic model for coastal areas for radionuclides (metals, organics and nutrients) from both single pulse fallout and continuous deposition. The model gives radionuclide concentrations in water (total, dissolved and particulate phases and concentrations in sediments and fish) for entire defined coastal areas. The model gives monthly variations. It accounts for inflow from tributaries, direct fallout to the coastal area, internal fluxes (sedimentation, resuspension, diffusion, burial, mixing and biouptake and retention in fish) and fluxes to and from the sea outside the defined coastal area and/or adjacent coastal areas. The fluxes of water and substances between the sea and the coastal area are differentiated into three categories of coast types: (i) areas where the water exchange is regulated by tidal effects; (ii) open coastal areas where the water exchange is regulated by coastal currents; and (iii) semi-enclosed archipelago coasts. The coastal model gives the fluxes to and from the following four abiotic compartments: surface water, deep water, ET areas (i.e., areas where fine sediment erosion and transport processes dominate the bottom dynamic conditions and resuspension appears) and A-areas (i.e., areas of continuous fine sediment accumulation). Criteria to define the boundaries for the given coastal area towards the sea, and to define whether a coastal area is open or closed are given in operational terms. The model is simple to apply since all driving variables may be readily accessed from maps and standard monitoring programs. The driving variables are: latitude, catchment area, mean annual precipitation, fallout and month of fallout and parameters expressing coastal size and form as determined from, e.g., digitized bathymetric maps using a GIS program. Selected results: the predictions of radionuclide concentrations in water and fish largely depend on two factors, the concentration in the sea outside the given

Photometric Variability in the Faint Sky Variability Survey

NARCIS (Netherlands)

Morales-Rueda, L.; Groot, P.J.; Augusteijn, T.; Nelemans, G.A.; Vreeswijk, P.M.; Besselaar, E.J.M. van den

2005-01-01

The Faint Sky Variability Survey (FSVS) is aimed at finding photometric and/or astrometric variable objects between 16th and 24th mag on time-scales between tens of minutes and years with photometric precisions ranging from 3 millimag to 0.2 mag. An area of ~23 deg², located at mid and

Use of clinical risk factors to identify postmenopausal women with vertebral fractures.

Science.gov (United States)

Tobias, J H; Hutchinson, A P; Hunt, L P; McCloskey, E V; Stone, M D; Martin, J C; Thompson, P W; Palferman, T G; Bhalla, A K

2007-01-01

Previous studies have been unable to identify risk factors for prevalent vertebral fractures (VF), which are suitable for use in selection strategies intended to target high-risk sub-groups for diagnostic assessment. However, these studies generally consisted of large epidemiology surveys based on questionnaires and were only able to evaluate a limited number of risk factors. Here, we investigated whether a stronger relationship exists with prevalent VF when conventional risk factors are combined with additional information obtained from detailed one-to-one assessment. Women aged 65-75 registered at four geographically distinct GP practices were invited to participate (n=1,518), of whom 540 attended for assessment as follows: a questionnaire asking about risk factors for osteoporosis such as height loss compared to age 25 and history of non-vertebral fracture (NVF), the get-up-and-go test, Margolis back pain score, measurement of wall-tragus and rib-pelvis distances, and BMD as measured by the distal forearm BMD. A lateral thoraco-lumbar spine X-ray was obtained, which was subsequently scored for the presence of significant vertebral deformities. Of the 509 subjects who underwent spinal radiographs, 37 (7.3%) were found to have one or more VF. Following logistic regression analysis, the four most predictive clinical risk factors for prevalent VF were: height loss (P=0.006), past NVF (P=0.004), history of back pain (P=0.075) and age (P=0.05). BMD was also significantly associated with prevalent VF (P=0.002), but its inclusion did not affect associations with other variables. Factors elicited from detailed one-to-one assessment were not related to the risk of one or more prevalent VFs. The area under ROC curves derived from these regressions, which suggested that models for prevalent VF had modest predictive accuracy, were as follows: 0.68 (BMD), 0.74 (four clinical risk factors above) and 0.78 (clinical risk factors + BMD). Analyses were repeated in relation to the

Application of gradient-corrected density functional theory to the structures and thermochemistries of ScF3, TiF4, VF5, and CrF6

International Nuclear Information System (INIS)

Russo, T.V.; Martin, R.L.; Jeffrey Hay, P.

1995-01-01

Density functional theory (DFT) and Hartree--Fock (HF) calculations are reported for the family of transition metal fluorides ScF 3 , TiF 4 , VF 5 , and CrF 6 . Both HF and the local-density approximation (LDA) yield excellent agreement with experimental bond lengths, while the B-LYP gradient-corrected density functional gives bond lengths 0.04-0.05 A too long. An investigation of various combinations of exchange and correlation functionals shows that, for this series, the origin of this behavior lies in the Becke exchange functional. Much improved bond distances are found using the hybrid HF/DFT functional advocated by Becke. This approximation also leads to much improved thermochemistries. The LDA overestimates average bond energies in this series by 30-40 kcal/mol, whereas the B-LYP functional overbinds by only ∼8-12 kcal/mol, and the hybrid HF/DFT method overbinds by only ∼2 kcal/mol. The hybrid method predicts the octahedral isomer of CrF 6 to be more stable than the trigonal prismatic form by 14 kcal/mol. Comparison of theoretical vibrational frequencies with experiment supports the assignment of an octahedral geometry

From "Volcanic Field" to "Volcanic Province": A Continuum of Spatial-Clustered Structures With Geological Significance or a Matter of Academic Snobbism?

Science.gov (United States)

Canon-Tapia, E.

2017-12-01

"Volcanic Field" is a term commonly used to describe a group of small, monogenetic and dominantly basaltic volcanoes, but that often includes groups of mixed monogenetic and polygenetic edifices. Besides ambiguities on the type of edifice that should be considered to form a VF, there is a lack of agreement concerning the number of volcanoes required to define a VF (ranging from five to over 1000), it is uncertain if the area covered by the volcanoes forming a VF must have a minimum number of volcanoes/unit area, or if the distance between adjacent structures needs to have a specific length. Furthermore, in many cases it is uncertain whether some area is occupied by two adjacent fields or if it is occupied by two subgroups belonging to a unique field. On the other hand, in analogy with the official definition of a geologic province, a "Volcanic Province" can be defined as a large region or area characterized by similar volcanic features, or by a history differing significantly from that of adjacent areas. Because neither the dimensions of the region nor the characteristics of the features to be used as reference are specified, there is an inherent ambiguity in this definition, which in some cases might become the source of unnecessary confusion. This work presents a review of the various ambiguities that remain unaddressed on the definition of a VF, and that bear some connection with the definition of VPs in general, with special interest in intraplate settings. It is shown that questions such as a) how many volcanoes are required to form a VF and b) when two "neighbor" volcanoes should not be considered to be part of the same field, can be adequately addressed by adopting the techniques of cluster analysis. Other parameters might not be as easy to address including aspects related to total volume of magma erupted, overall composition of the erupted products and age spans of activity and intermediate gaps. Based on the evidence presented, it is shown that there is a

Climate variability and impacts on east African livestock herders: The Maasai of Ngorongoro Conservation Area, Tanzania

OpenAIRE

Galvin, K.A.; Thornton, P.K.; Boone, R.B.; Sunderland, J.

2004-01-01

Metadata only record East African pastoral adaptation and vulnerability to climate variability and climate change is assessed, using data from decision-making processes and ecological data of the Maasai of Ngorongoro Conservation Area as an example. The paper uses integrated modeling, linking PHEWS, a household model, to SAVANNA, an ecosystem model to look at the effects of drought and a series of wet years on the well-being of Maasai pastoralists. Model results suggest that the ecosystem ...

Practical landmarks for visual field disability in glaucoma.

Science.gov (United States)

Saunders, Luke J; Russell, Richard A; Crabb, David P

2012-09-01

To assess whether mean deviation (MD) from automated perimetry is related to the visual field (VF) component for legal fitness to drive (LFTD) in glaucoma patients. Monocular 24-2 VFs of 2604 patients with bilateral VF damage were retrospectively investigated. Integrated visual fields were calculated and used as a surrogate to assess LFTD according to current UK driving licence criteria. The better eye MD (BEMD), worse eye MD (WEMD) and a measure utilising MD of both eyes were compared, to assess respective diagnostic capabilities to predict LFTD (using the integrated visual field surrogate test as the gold standard) and a 'Probability of Failure' (PoF) for various defect levels was calculated. BEMD appears to be a good predictor of the VF component for a patient's LFTD (receiver operating characteristic area under the curve: 96.2%); MDs from both eyes offered no significant extra diagnostic power (area under the curve: 96.4%). PoF for BEMD thresholds of ≤-10 dB and ≤-14 dB were 70 (95% CI 66% to 74%) and 92% (87% to 95%), respectively. There is a strong relationship between BEMD and a patient's LFTD. PoF values for LFTD associated with readily available MD values provide practical landmarks for VF disability in glaucoma.

Structure-function correlations using scanning laser polarimetry in primary angle-closure glaucoma and primary open-angle glaucoma.

Science.gov (United States)

Lee, Pei-Jung; Liu, Catherine Jui-Ling; Wojciechowski, Robert; Bailey-Wilson, Joan E; Cheng, Ching-Yu

2010-05-01

To assess the correlations between retinal nerve fiber layer (RNFL) thickness measured with scanning laser polarimetry and visual field (VF) sensitivity in primary open-angle glaucoma (POAG) and primary angle-closure glaucoma (PACG). Prospective, comparative, observational cases series. Fifty patients with POAG and 56 patients with PACG were examined using scanning laser polarimetry with variable corneal compensation (GDx VCC; Laser Diagnostic Technologies, Inc.) and Humphrey VF analyzer (Carl Zeiss Meditec, Inc.) between August 2005 and July 2006 at Taipei Veterans General Hospital. Correlations between RNFL thickness and VF sensitivity, expressed as mean sensitivity in both decibel and 1/Lambert scales, were estimated by the Spearman rank correlation coefficient (r(s)) and multivariate median regression models (pseudo R(2)). The correlations were determined globally and for 6 RNFL sectors and their corresponding VF regions. The correlation between RNFL thickness and mean sensitivity (in decibels) was weaker in the PACG group (r(s) = 0.38; P = .004; pseudo R(2) = 0.17) than in the POAG group (r(s) = 0.51; P polarimetry. Compared with eyes with POAG, fewer RNFL sectors have significant structure-function correlations in eyes with PACG. Copyright 2010 Elsevier Inc. All rights reserved.

PHENOTYPIC VARIABILITY IN FEIJOA FRUITS [Acca sellowiana (O. Berg. Burret] ON INDIGENOUS LANDS,QUILOMBOLAS COMMUNITIES AND PROTECTED AREAS IN THE SOUTH OF BRAZIL

Directory of Open Access Journals (Sweden)

LIDO JOSÉ BORSUK

Full Text Available ABSTRACT Phenotypic studies with native fruits are important sources of information for understanding the status of conservation of plant species, especially populations in protected areas (PAs. Fruits of 18 populations of feijoa [Acca sellowiana (O. Berg. Burret] present in three kind of PAs, Quilombolas Communities (QLs, Indigenous Lands (ILs and Conservation Units (CUs were evaluated with the aim to characterize the phenotypic variability. Fruits were harvested at maturity and eight morphological descriptors were measured: diameter, length, total weight, pericarp weight, pulp weight, pericarp thickness, pulp yield and solid soluble contents (°Brix. The results revealed the existence of large morphological variability for all traits, with significant differences among all populations and among those populations grouped in QLs, TIs and UCs, particularly to the total weight and peel thickness. There was a clear formation of five major clusters of genetic dissimilarity. In addition, two Uruguayan type populations and 16 Brazilian type populations showed contrast means for most of the evaluated traits. The lower variability on fruit characters found in plants collected in areas of traditional people but not in CUs suggests the existence of selection processes of feijoa genotypes on those areas.

Synchronous multi-decadal climate variability of the whole Pacific areas revealed in tree rings since 1567

Science.gov (United States)

Fang, Keyan; Cook, Edward; Guo, Zhengtang; Chen, Deliang; Ou, Tinghai; Zhao, Yan

2018-02-01

Oceanic and atmospheric patterns play a crucial role in modulating climate variability from interannual to multi-decadal timescales by causing large-scale co-varying climate changes. The brevity of the existing instrumental records hinders the ability to recognize climate patterns before the industrial era, which can be alleviated using proxies. Unfortunately, proxy based reconstructions of oceanic and atmospheric modes of the past millennia often have modest agreements with each other before the instrumental period, raising questions about the robustness of the reconstructions. To ensure the stability of climate signals in proxy data through time, we first identified tree-ring datasets from distant regions containing coherent variations in Asia and North America, and then interpreted their climate information. We found that the multi-decadal covarying climate patterns of the middle and high latitudinal regions around the northern Pacific Ocean agreed quite well with the climate reconstructions of the tropical and southern Pacific areas. This indicates a synchronous variability at the multi-decadal timescale of the past 430 years for the entire Pacific Ocean. This pattern is closely linked to the dominant mode of the Pacific sea surface temperature (SST) after removing the warming trend. This Pacific multi-decadal SST variability resembles the Interdecadal Pacific Oscillation.

The Impact of Change in Visual Field on Health-Related Quality of Life: The Los Angeles Latino Eye Study

Science.gov (United States)

Patino, Cecilia M.; Varma, Rohit; Azen, Stanley P.; Conti, David V.; Nichol, Michael B.; McKean-Cowdin, Roberta

2010-01-01

Purpose To assess the impact of change in visual field (VF) on change in health related quality of life (HRQoL) at the population level. Design Prospective cohort study Participants 3,175 Los Angles Latino Eye Study (LALES) participants Methods Objective measures of VF and visual acuity and self-reported HRQoL were collected at baseline and 4-year follow-up. Analysis of covariance was used to evaluate mean differences in change of HRQoL across severity levels of change in VF and to test for effect modification by covariates. Main outcome measures General and vision-specific HRQoL. Results Of 3,175 participants, 1430 (46%) showed a change in VF (≥1 decibel [dB]) and 1651, 1715 (54%) reported a clinically important change (≥5 points) in vision-specific HRQoL. Progressive worsening and improvement in the VF were associated with increasing losses and gains in vision-specific HRQoL for the composite score and 10 of its 11 subscales (all Ptrends 5 dB and gains > 3 dB were associated with clinically meaningful losses and gains in vision-specific HRQoL, respectively. Areas of vision-specific HRQoL most affected by greater losses in VF were driving, dependency, role-functioning, and mental health. The effect of change in VF (loss or gain) on mean change in vision-specific HRQoL varied by level of baseline vision loss (in visual field and/or visual acuity) and by change in visual acuity (all P-interactions 5 dB loss in visual field during the study period had a mean loss of vision-specific HRQoL of 11.3 points, while those with no VF loss at baseline had a mean loss of 0.97 points Similarly, with a > 5 dB loss in VF and baseline visual acuity impairment (mild/severe) there was a loss in vision-specific HRQoL of 10.5 points, whereas with no visual acuity impairment at baseline there was a loss of vision-specific HRQoL of 3.7 points. Conclusion Both losses and gains in VF produce clinically meaningful changes in vision-specific HRQoL. In the presence of pre-existing vision

Variability in large-scale wind power generation: Variability in large-scale wind power generation

Energy Technology Data Exchange (ETDEWEB)

Kiviluoma, Juha [VTT Technical Research Centre of Finland, Espoo Finland; Holttinen, Hannele [VTT Technical Research Centre of Finland, Espoo Finland; Weir, David [Energy Department, Norwegian Water Resources and Energy Directorate, Oslo Norway; Scharff, Richard [KTH Royal Institute of Technology, Electric Power Systems, Stockholm Sweden; Söder, Lennart [Royal Institute of Technology, Electric Power Systems, Stockholm Sweden; Menemenlis, Nickie [Institut de recherche Hydro-Québec, Montreal Canada; Cutululis, Nicolaos A. [DTU, Wind Energy, Roskilde Denmark; Danti Lopez, Irene [Electricity Research Centre, University College Dublin, Dublin Ireland; Lannoye, Eamonn [Electric Power Research Institute, Palo Alto California USA; Estanqueiro, Ana [LNEG, Laboratorio Nacional de Energia e Geologia, UESEO, Lisbon Spain; Gomez-Lazaro, Emilio [Renewable Energy Research Institute and DIEEAC/EDII-AB, Castilla-La Mancha University, Albacete Spain; Zhang, Qin [State Grid Corporation of China, Beijing China; Bai, Jianhua [State Grid Energy Research Institute Beijing, Beijing China; Wan, Yih-Huei [National Renewable Energy Laboratory, Transmission and Grid Integration Group, Golden Colorado USA; Milligan, Michael [National Renewable Energy Laboratory, Transmission and Grid Integration Group, Golden Colorado USA

2015-10-25

The paper demonstrates the characteristics of wind power variability and net load variability in multiple power systems based on real data from multiple years. Demonstrated characteristics include probability distribution for different ramp durations, seasonal and diurnal variability and low net load events. The comparison shows regions with low variability (Sweden, Spain and Germany), medium variability (Portugal, Ireland, Finland and Denmark) and regions with higher variability (Quebec, Bonneville Power Administration and Electric Reliability Council of Texas in North America; Gansu, Jilin and Liaoning in China; and Norway and offshore wind power in Denmark). For regions with low variability, the maximum 1 h wind ramps are below 10% of nominal capacity, and for regions with high variability, they may be close to 30%. Wind power variability is mainly explained by the extent of geographical spread, but also higher capacity factor causes higher variability. It was also shown how wind power ramps are autocorrelated and dependent on the operating output level. When wind power was concentrated in smaller area, there were outliers with high changes in wind output, which were not present in large areas with well-dispersed wind power.

Quantification of benign lesion regression as a function of 532-nm pulsed potassium titanyl phosphate laser parameter selection.

Science.gov (United States)

Mallur, Pavan S; Tajudeen, Bobby A; Aaronson, Nicole; Branski, Ryan C; Amin, Milan R

2011-03-01

Although the potassium titanyl phosphate (KTP) laser is versatile, the variability in laser parameters for laryngeal pathologies and the lack of clinical efficacy data remain problematic. We provide preliminary data regarding these parameters for benign lesion regression. In addition, we describe a novel method for the quantification of the effects of the KTP laser on vocal fold (VF) lesions. Retrospective chart review. Images were captured from examinations before and after in-office KTP treatment in patients with a range of benign lesions. Laser settings were noted for each patient. Imaging software was then used to calculate a ratio of lesion area to VF length. Ten percent of images were requantified to determine inter-rater reliability. Thirty-two patients underwent 47 procedures for lesions including hemorrhagic polyp, nonhemorrhagic polyp, vocal process granuloma, Reinke's edema, cyst/pseudocyst, leukoplakia, and squamous cell carcinoma in situ. No statistically significant differences were observed with regard to the laser parameters used as a function of lesion type. Regardless, by 1 month following treatment, all lesions had significantly decreased in size, except nonhemorrhagic polyps. Similar data were obtained at 2-month follow-up. We then compared the pre-KTP lesion size with the smallest lesion size quantified during the 1-year follow-up period. All lesions were significantly smaller, with the exception of Reinke's edema. Inter-rater reliability was quite good. KTP laser effectively reduced VF lesion size, irrespective of the laser parameters used. In addition, our quantification method for lesion size appeared to be both viable and reliable. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.

The Level of Psychological Burnout at the Teachers of Students with Autism Disorders in Light of a Number of Variables in Al-Riyadh Area

Science.gov (United States)

Atiyat, Omar Khalil

2017-01-01

This study aimed at measuring the level of the psychological burnout in the teachers of students that have autism symptoms in Al-Riyadh area--kingdom of Saudi Arabia. In light of variables. These variables are the gender, the teaching place, the academic qualification of the teachers, the experience of the teachers, the age of the teachers, and…

Blood lead level in dogs from urban and rural areas of India and its relation to animal and environmental variables

International Nuclear Information System (INIS)

Balagangatharathilagar, M.; Swarup, D.; Patra, R.C.; Dwivedi, S.K.

2006-01-01

Lead is a common environmental pollutant with deleterious health effects on human and animal. Industrial and other human activities enhance the lead level in the environment leading to its higher residues in exposed population. The present study was aimed at determining blood lead concentration in dogs from two urban areas and in surrounding rural areas of India and analyzing lead level in dogs in relation to environmental (urban/ rural) and animal (age, sex, breed and housing) variables. Blood samples were collected from 305 dogs of either sex from urban (n = 277) and unpolluted rural localities (n = 28). Irrespective of breed, age and sex, the urban dogs had significantly (P < 0.01) higher mean blood lead concentration (0.25 ± 0.01 μg/ml) than rural dogs (0.10 ± 0.01 μg/ml). The mean blood lead level in stray dogs either from urban or rural locality (0.27 ± 0.01 μg/ml) was significantly (P < 0.01) higher than that of pets (0.20 ± 0.01 μg/ml), and the blood lead concentration was significantly higher in nondescript dogs (0.25 ± 0.01 μg/ml) than pedigreed dogs (0.20 ± 0.01 μg/ml). The locality (urban/rural) was the major variable affecting blood lead concentration in dogs. Breed and housing of the dogs of urban areas and only housing (pet/stray) in rural areas significantly (P < 0.01) influenced the blood lead concentration in dogs

Implications of Wide-Area Geographic Diversity for Short- Term Variability of Solar Power

Energy Technology Data Exchange (ETDEWEB)

Mills, Andrew; Wiser, Ryan

2010-08-23

Worldwide interest in the deployment of photovoltaic generation (PV) is rapidly increasing. Operating experience with large PV plants, however, demonstrates that large, rapid changes in the output of PV plants are possible. Early studies of PV grid impacts suggested that short-term variability could be a potential limiting factor in deploying PV. Many of these early studies, however, lacked high-quality data from multiple sites to assess the costs and impacts of increasing PV penetration. As is well known for wind, accounting for the potential for geographic diversity can significantly reduce the magnitude of extreme changes in aggregated PV output, the resources required to accommodate that variability, and the potential costs of managing variability. We use measured 1-min solar insolation for 23 time-synchronized sites in the Southern Great Plains network of the Atmospheric Radiation Measurement program and wind speed data from 10 sites in the same network to characterize the variability of PV with different degrees of geographic diversity and to compare the variability of PV to the variability of similarly sited wind. The relative aggregate variability of PV plants sited in a dense 10 x 10 array with 20 km spacing is six times less than the variability of a single site for variability on time scales less than 15-min. We find in our analysis of wind and PV plants similarly sited in a 5 x 5 grid with 50 km spacing that the variability of PV is only slightly more than the variability of wind on time scales of 5-15 min. Over shorter and longer time scales the level of variability is nearly identical. Finally, we use a simple approximation method to estimate the cost of carrying additional reserves to manage sub-hourly variability. We conclude that the costs of managing the short-term variability of PV are dramatically reduced by geographic diversity and are not substantially different from the costs for managing the short-term variability of similarly sited wind in

All varieties of encoding variability are not created equal: Separating variable processing from variable tasks

Science.gov (United States)

Huff, Mark J.; Bodner, Glen E.

2014-01-01

Whether encoding variability facilitates memory is shown to depend on whether item-specific and relational processing are both performed across study blocks, and whether study items are weakly versus strongly related. Variable-processing groups studied a word list once using an item-specific task and once using a relational task. Variable-task groups’ two different study tasks recruited the same type of processing each block. Repeated-task groups performed the same study task each block. Recall and recognition were greatest in the variable-processing group, but only with weakly related lists. A variable-processing benefit was also found when task-based processing and list-type processing were complementary (e.g., item-specific processing of a related list) rather than redundant (e.g., relational processing of a related list). That performing both item-specific and relational processing across trials, or within a trial, yields encoding-variability benefits may help reconcile decades of contradictory findings in this area. PMID:25018583

Scotoma analysis of 10-2 visual field testing with a white target in screening for hydroxychloroquine retinopathy

Directory of Open Access Journals (Sweden)

Browning DJ

2015-05-01

Full Text Available David J Browning, Chong Lee Department of Ophthalmology, Charlotte Eye, Ear, Nose and Throat Associates, Charlotte, NC, USA Objective: To quantify the variability of scotomas detected by 10-2 visual field (VF testing in patients taking hydroxychloroquine without and with retinopathy.Design: Retrospective review of clinical charts and visual fields.Subjects: Twenty-one patients taking hydroxychloroquine without retinopathy, and nine patients taking hydroxychloroquine and one patient taking chloroquine with retinopathy.Methods: Retinopathy was defined by annular scotomas on 10-2 VF testing with corroborative spectral domain optical coherence tomographic outer retinal changes and multifocal electroretinographic changes leading to cessation of hydroxychloroquine or chloroquine. Location and depth of scotoma points on 10-2 VF testing were recorded and their fates followed in serial, reliable 10-2 VFs performed with a white target over time.Main outcome measures: Number of scotoma points and locations, percentage of persistent scotoma points, size of scotomas, location of scotomas, and percentage of scotomas deepening.Results: A median of five, interquartile range (IQR 3–8 scotoma points per VF occurred in patients without retinopathy. A median of 86%, IQR 63%–100% of these points resolve on the subsequent field. For patients with retinopathy, a median of 22%, IQR 10%–59% resolve. The median percentage of scotoma points in the zone 2–8 degrees from fixation in eyes with retinopathy was 79%, IQR 68%–85% compared to 60%, IQR 54%–75% in eyes without retinopathy (P=0.0094. Single-point scotomas were more common in eyes without than with retinopathy. Scotomas consisting of more than four contiguous scotoma points were generally indicative of retinopathy.Conclusion: Point scotomas are common and variable in 10-2 VF testing with a white target for hydroxychloroquine retinopathy in subjects without retinopathy. The annular zone 2 to 8�

Variability of nutrients intake, lipid profile and cardiovascular mortality among geographical areas in Spain: The DRECE study.

Science.gov (United States)

Gómez de la Cámara, Agustín; De Andrés Esteban, Eva; Urrútia Cuchí, Gerard; Calderón Sandubete, Enrique; Rubio Herrera, Miguel Ángel; Menéndez Orenga, Miguel; Lora Pablos, David

2017-11-07

It has often been suggested that cardiovascular mortality and their geographical heterogeneity are associated with nutrients intake patterns and also lipid profile. The large Spanish study Dieta y Riesgo de Enfermedades Cardiovasculares en España (DRECE) investigated this theory from 1991 to 2010. Out of the 4,783 Spanish individuals making up the DRECE cohort, 220 subjects (148 men and 72 women) died (4.62%) during the course of the study. The mean age of patients who died from cardiovascular causes (32 in all) was 61.08 years 95% CI (57.47-64.69) and 70.91% of them were males. The consumption of nutrients and the lipid profile by geographical area, studied by geospatial models, showed that the east and southern area of the country had the highest fat intake coupled to a high rate of unhealthy lipid profile. It was concluded that the spatial geographical analysis showed a relationship between high fat intake, unhealthy lipid profile and cardiovascular mortality in the different geographical areas, with a high variability within the country.

Area Regge calculus and continuum limit

International Nuclear Information System (INIS)

Khatsymovsky, V.M.

2002-01-01

Encountered in the literature generalisations of general relativity to independent area variables are considered, the discrete (generalised Regge calculus) and continuum ones. The generalised Regge calculus can be either with purely area variables or, as we suggest, with area tensor-connection variables. Just for the latter, in particular, we prove that in analogy with corresponding statement in ordinary Regge calculus (by Feinberg, Friedberg, Lee and Ren), passing to the (appropriately defined) continuum limit yields the generalised continuum area tensor-connection general relativity

Seasonal and inter-annual variability of sea surface temperature at the east coast fishing area off Peninsular Malaysia

Science.gov (United States)

Nurul Ridani, S.; Mustapha, M. A.; Lihan, T.; Ku Kassim, K. Y.; Raja Bidin, R. H.

2015-09-01

Empirical orthogonal function (EOF) analysis was used to study a time-series of the aqua MODIS data imageries in the exclusive economic zone of east coast off Peninsular Malaysia. Temporal and spatial characteristics were examined to determine the dominant pattern of sea surface temperature (SST) variability from January 2003 to December 2011.The data were analysed from daily Level 1A (1km spatial resolution) to monthly composites Level 3 data using SeaDAS and ERDAS imagine software. Four modes was obtained from the analysis with the highest variance (7.9%) represented by mode 1 which explained the seasonal cycle. Mode 2 (5.11 % of total variance) showed positive and negative peak signal during March and April and in October and November with variability near the Kelantan and Pahang waters that indicated the inter monsoon. Mode 3 (3.8 % of variance) shows variability near the Terengganu, Kelantan and Johor waters to the open sea during July and August and in May and June representing the Southwest monsoon. Mode 4 (3.36 %) showed positive signal during November and December with strong signal near Pahang and Kelantan waters while weak signal was detected near Terengganu and Kelantan's open sea representing the Northeast monsoon. The SST variability was influenced by the monsoonal system which originated by the wind forcing condition that influences circulation in the study area.

Using a topographic index to distribute variable source area runoff predicted with the SCS curve-number equation

Science.gov (United States)

Lyon, Steve W.; Walter, M. Todd; Gérard-Marchant, Pierre; Steenhuis, Tammo S.

2004-10-01

Because the traditional Soil Conservation Service curve-number (SCS-CN) approach continues to be used ubiquitously in water quality models, new application methods are needed that are consistent with variable source area (VSA) hydrological processes in the landscape. We developed and tested a distributed approach for applying the traditional SCS-CN equation to watersheds where VSA hydrology is a dominant process. Predicting the location of source areas is important for watershed planning because restricting potentially polluting activities from runoff source areas is fundamental to controlling non-point-source pollution. The method presented here used the traditional SCS-CN approach to predict runoff volume and spatial extent of saturated areas and a topographic index, like that used in TOPMODEL, to distribute runoff source areas through watersheds. The resulting distributed CN-VSA method was applied to two subwatersheds of the Delaware basin in the Catskill Mountains region of New York State and one watershed in south-eastern Australia to produce runoff-probability maps. Observed saturated area locations in the watersheds agreed with the distributed CN-VSA method. Results showed good agreement with those obtained from the previously validated soil moisture routing (SMR) model. When compared with the traditional SCS-CN method, the distributed CN-VSA method predicted a similar total volume of runoff, but vastly different locations of runoff generation. Thus, the distributed CN-VSA approach provides a physically based method that is simple enough to be incorporated into water quality models, and other tools that currently use the traditional SCS-CN method, while still adhering to the principles of VSA hydrology.

Heart rate turbulence and variability in patients with ventricular arrhythmias

Directory of Open Access Journals (Sweden)

Diego Tarricone

2009-08-01

Full Text Available Background: To evaluate the changes in autonomic neural control mechanisms before malignant ventricular arrhythmias, we measured heart rate variability (HRV and heart rate turbulence (HRT in patients with ventricular tachycardia or fibrillation (Group I; n=6, non sustained ventricular tachycardia (Group II; n=32, frequent premature ventricular beats (Group III; n=26 and with ICD implantation (Group IV; n=11. Methods: Time domain parameters of HRV and turbulence onset (TO and slope (TS were calculated on 24 hour Holter recordings. Normal values were: SDNN > 70 msec for HRV, TO <0% and TS >2.5 msec/RR-I for HRT. Results: Whereas SDNN was within normal range and similar in all study groups, HRT parameters were significantly different in patients who experienced VT/VF during Holter recording. Abnormal TO and/or TS were present in 100% of Group I patients and only in about 50% of Group II and IV. On the contrary, normal HRT parameters were present in 40-70% of Group II, III and IV patients and none of Group I. Conclusions: These data suggest that HRT analysis is more suitable than HRV to detect those transient alterations in autonomic control mechanisms that are likely to play a major trigger role in the genesis of malignant cardiac arrhythmias. (Heart International 2007; 3: 51-7

Which health technologies should be funded? A prioritization framework based explicitly on value for money

Directory of Open Access Journals (Sweden)

Golan Ofra

2012-11-01

Full Text Available Abstract Background Deciding which health technologies to fund involves confronting some of the most difficult choices in medicine. As for other countries, the Israeli health system is faced each year with having to make these difficult decisions. The Public National Advisory Committee, known as ‘the Basket Committee’, selects new technologies for the basic list of health care that all Israelis are entitled to access, known as the ‘health basket’. We introduce a framework for health technology prioritization based explicitly on value for money that enables the main variables considered by decision-makers to be explicitly included. Although the framework’s exposition is in terms of the Basket Committee selecting new technologies for Israel’s health basket, we believe that the framework would also work well for other countries. Methods Our proposed prioritization framework involves comparing four main variables for each technology: 1. Incremental benefits, including ‘equity benefits’, to Israel’s population; 2. Incremental total cost to Israel’s health system; 3. Quality of evidence; and 4. Any additional ‘X-factors’ not elsewhere included, such as strategic or legal factors, etc. Applying methodology from multi-criteria decision analysis, the multiple dimensions comprising the first variable are aggregated via a points system. Results The four variables are combined for each technology and compared across the technologies in the ‘Value for Money (VfM Chart’. The VfM Chart can be used to identify technologies that are good value for money, and, given a budget constraint, to select technologies that should be funded. This is demonstrated using 18 illustrative technologies. Conclusions The VfM Chart is an intuitively appealing decision-support tool for helping decision-makers to focus on the inherent tradeoffs involved in health technology prioritization. Such deliberations can be performed in a systematic and transparent

Factors associated with developing a fear of falling in subjects with primary open-angle glaucoma.

Science.gov (United States)

Adachi, Sayaka; Yuki, Kenya; Awano-Tanabe, Sachiko; Ono, Takeshi; Shiba, Daisuke; Murata, Hiroshi; Asaoka, Ryo; Tsubota, Kazuo

2018-02-13

To investigate the relationship between clinical risk factors, including visual field (VF) defects and visual acuity, and a fear of falling, among patients with primary open-angle glaucoma (POAG). All participants answered the following question at a baseline ophthalmic examination: Are you afraid of falling? The same question was then answered every 12 months for 3 years. A binocular integrated visual field was calculated by merging a patient's monocular Humphrey field analyzer VFs, using the 'best sensitivity' method. The means of total deviation values in the whole, superior peripheral, superior central, inferior central, and inferior peripheral VFs were calculated. The relationship between these mean VF measurements, and various clinical factors, against patients' baseline fear of falling and future fear of falling was analyzed using multiple logistic regression. Among 392 POAG subjects, 342 patients (87.2%) responded to the fear of falling question at least twice in the 3 years study period. The optimal regression model for patients' baseline fear of falling included age, gender, mean of total deviation values in the inferior peripheral VF and number of previous falls. The optimal regression equation for future fear of falling included age, gender, mean of total deviation values in the inferior peripheral VF and number of previous falls. Defects in the inferior peripheral VF area are significantly related to the development of a fear of falling.

Variability of snow line elevation, snow cover area and depletion in the main Slovak basins in winters 2001–2014

Directory of Open Access Journals (Sweden)

Krajčí Pavel

2016-03-01

Full Text Available Spatial and temporal variability of snow line (SL elevation, snow cover area (SCA and depletion (SCD in winters 2001–2014 is investigated in ten main Slovak river basins (the Western Carpathians. Daily satellite snow cover maps from MODIS Terra (MOD10A1, V005 and Aqua (MYD10A1, V005 with resolution 500 m are used.

On Recording the Unipolar ECG Limb Leads via the Wilson's vs the Goldberger's Terminals: aVR, aVL, and aVF Revisited

Directory of Open Access Journals (Sweden)

John E. Madias

2008-11-01

Full Text Available The augmented unipolar limb leads aVR, aVL, and aVF, introduced by Goldberger in 1942, are an integral part of the 12-lead ECG.1,2 Leads I, II, and III have 2 dedicated electrodes, but the other 9 leads have a single dedicated electrode, and another one constructed from the averaged inputs of multiple electrodes. This Viewpoint discusses whether an indifferent pole for the recording of unipolar limb leads is best provided by the Wilson's central terminal (WCT, or by inputs from 2 limb electrodes (Goldberger's central terminal (GCT, as done currently, and whether the latter have any advantages over the former. The term "unipolar", popularized by Wilson, is a misnomer, since no leads can be truly "unipolar", all requiring positive and negative poles. Thus the term unipolar is used herein in the quasi-unipolar sense, as when first introduced by Wilson and Goldberger, who also realized that such leads were not truly unipolar. The popularity of the unipolar leads reflected the quest of recording the ECG from various vantage points of the body, considering the limitations of the 3 bipolar leads, introduced by Einthoven,3 which register the difference of 2 ECG curves recorded at the 2 poles of these leads, and no variation in potential at each of these poles.4 In contrast the unipolar leads were thought to register such variation of absolute potential, something not really true. Initially the WCT was used to record the unipolar limb leads,5 but the amplitude was low, and the inscribed ECGs, then, and for many decades later,6 were thick-lined (≥2 mm (Figure 1.

Leaf area index estimation in a pine plantation with LAI-2000 under direct sunlight conditions: relationship with inventory and hydrologic variables; Estimacion del indice de area foliar en pinares de repolacion con LAI-2000 bajo radiacion solar directa: relacion con variables de inventario e hidrologicas

Energy Technology Data Exchange (ETDEWEB)

Molina, A.; Campo, A. D. del

2011-07-01

LAI is a key factor in light and rainfall interception processes in forest stands and, for this reason, is called to play an important role in global change adaptive silviculture. Therefore, it is necessary to develop practical and operative methodologies to measure this parameter as well as simple relationships with other silviculture variables. This work has studied 1) the feasibility of LAI-2000 sensor in estimating LAI-stand when readings are taken under direct sunlight conditions; and 2) the ability of LAI in studying rainfall partitioned into throughfall (T) in an Aleppo pine stand after different thinning intensities, as well as its relationships to basal area, (G), cover (FCC), and tree density (D). Results showed that the angular correction scheme applied to LAI-2000 direct-sunlight readings stabilized them for different solar angles, allowing a better operational use of LAI-2000 in Mediterranean areas, where uniform overcast conditions are difficult to meet and predict. Forest cover showed the highest predictive ability of LAI (R{sup 2} = 0.98; S = 0.28), then G (R{sup 2} = 0.96; S = 0.43) and D (R{sup 2} = 0.50; S = 0.28). In the hydrological plane, T increased with thinning intensity, being G the most explanatory variable (R{sup 2} = 0.81; S = 3.07) and LAI the one that showed the poorest relation with it (R{sup 2} = 0.69; S = 3.95). These results open a way for forest hydrologic modeling taking LAI as an input variable either estimated form LAI-2000 or deducted from inventory data. (Author) 36 refs.

Secondary standard dosimetry laboratory Saraykoy Nuclear Research and Training Center Ankara, Turkey

International Nuclear Information System (INIS)

Okruhlica, P.

2014-01-01

Turkish Saraykoy Nuclear Research and Training Center (SANA) was founded in 2005. In 2014 the company PTW Freiburg in cooperation with VF Cerna Hora started the construction of a comprehensive national metrology laboratories of ionizing radiation 'Secondary Standard Dosimetry Laboratory' (SSDL). The laboratory will be located in the area of 'Saraykoy Nuclear Research and Training Center' in Ankara in Turkey. SSDL will be equipped with metrology departments for calibration and measurement of standard required quantities of metrology of ionizing radiation: - Neutron workplace; Gamma workplace (low-energy X-ray, gamma Standard Cs-137 and high dose rate, Co-60); - Beta workplace; - Control system of metrology laboratories and irradiation VF DARS; - Radiation monitoring system VF RMS; - Camera and security system; - Measuring instruments (ionization chambers, electrometers, monitors for environmental measurements ...) with the appropriate phantoms and other systems.

Application of the vibration method for damage identification of a beam with a variable cross-sectional area

Directory of Open Access Journals (Sweden)

Zamorska Izabela

2018-01-01

Full Text Available The subject of the paper is an application of the non-destructive vibration method for identifying the location of two cracks occurring in a beam. The vibration method is based on knowledge of a certain number of vibration frequencies of an undamaged element and the knowledge of the same number of vibration frequencies of an element with a defect. The analyzed beam, with a variable cross-sectional area, has been described according to the Bernoulli-Euler theory. To determine the values of free vibration frequencies the analytical solution, with the help of the Green’s function method, has been used.

Variable stator radial turbine

Science.gov (United States)

Rogo, C.; Hajek, T.; Chen, A. G.

1984-01-01

A radial turbine stage with a variable area nozzle was investigated. A high work capacity turbine design with a known high performance base was modified to accept a fixed vane stagger angle moveable sidewall nozzle. The nozzle area was varied by moving the forward and rearward sidewalls. Diffusing and accelerating rotor inlet ramps were evaluated in combinations with hub and shroud rotor exit rings. Performance of contoured sidewalls and the location of the sidewall split line with respect to the rotor inlet was compared to the baseline. Performance and rotor exit survey data are presented for 31 different geometries. Detail survey data at the nozzle exit are given in contour plot format for five configurations. A data base is provided for a variable geometry concept that is a viable alternative to the more common pivoted vane variable geometry radial turbine.

Mapping Fish Community Variables by Integrating Field and Satellite Data, Object-Based Image Analysis and Modeling in a Traditional Fijian Fisheries Management Area

Directory of Open Access Journals (Sweden)

Stacy Jupiter

2011-03-01

Full Text Available The use of marine spatial planning for zoning multi-use areas is growing in both developed and developing countries. Comprehensive maps of marine resources, including those important for local fisheries management and biodiversity conservation, provide a crucial foundation of information for the planning process. Using a combination of field and high spatial resolution satellite data, we use an empirical procedure to create a bathymetric map (RMSE 1.76 m and object-based image analysis to produce accurate maps of geomorphic and benthic coral reef classes (Kappa values of 0.80 and 0.63; 9 and 33 classes, respectively covering a large (>260 km2 traditional fisheries management area in Fiji. From these maps, we derive per-pixel information on habitat richness, structural complexity, coral cover and the distance from land, and use these variables as input in models to predict fish species richness, diversity and biomass. We show that random forest models outperform five other model types, and that all three fish community variables can be satisfactorily predicted from the high spatial resolution satellite data. We also show geomorphic zone to be the most important predictor on average, with secondary contributions from a range of other variables including benthic class, depth, distance from land, and live coral cover mapped at coarse spatial scales, suggesting that data with lower spatial resolution and lower cost may be sufficient for spatial predictions of the three fish community variables.

Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens

Directory of Open Access Journals (Sweden)

Md. Zaherul Islam

2016-08-01

Full Text Available Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585, VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132 showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674 were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines.

Evaluating and Reporting Dysphagia in Trials of Chemoirradiation for Head-and-Neck Cancer

International Nuclear Information System (INIS)

Gluck, Iris; Feng, Felix Y.; Lyden, Teresa; Haxer, Marc

2010-01-01

Purpose: Reporting long-term toxicities in trials of chemoirradiation (CRT) of head-and-neck cancer (HNC) has mostly been limited to observer-rated maximal Grades ≥3. We evaluated this reporting approach for dysphagia by assessing patient-reported dysphagia (PRD) and objective swallowing dysfunction through videofluoroscopy (VF) in patients with various grades of maximal observer-reported dysphagia (ORD). Methods and Materials: A total of 62 HNC patients completed quality-of-life questionnaires periodically through 12 months post-CRT. Five PRD items were selected: three dysphagia-specific questions, an Eating-Domain, and 'Overall Bother.' They underwent VF at 3 and 12 months, and ORD (Common Terminology Criteria for Adverse Events) scoring every 2 months. We classified patients into four groups (0-3) according to maximal ORD scores documented 3-12 months post-CRT, and assessed PRD and VF summary scores in each group. Results: Differences in ORD scores among the groups were considerable throughout the observation period. In contrast, PRD scores were similar between Groups 2 and 3, and variable in Group 1. VF scores were worse in Group 3 compared with 2 at 3 months but similar at 12 months. In Group 1, PRD and VF scores from 3 through 12 months were close to Groups 2 and 3 if ORD score 1 persisted, but were similar to Group 0 in patients whose ORD scores improved by 12 months. Conclusions: Patients with lower maximal ORD grades, especially if persistent, had similar rates of PRD and objective dysphagia as patients with highest grades. Lower ORD grades should therefore be reported. These findings may have implications for reporting additional toxicities besides dysphagia.

Two-Phase Induction Motor Drives

Directory of Open Access Journals (Sweden)

Gholam Reza Arab Markadeh

2010-10-01

Full Text Available The lack of variable-speed drives for two (single induction motor is a reality. This article attempts mainly to investigate the reasons for this lack of variable – speed drives. This paper deals with literature survey of various existing converter topologies, which have been proposed for adjustable speed single phase induction motor drives. Various converter topologies have been compared in this paper. Among these converter topologies, the adjustable frequency PWM inverter is the best choice for single-phase induction motor drives. However, adjustable-frequency drives have not been widely used with single-phase Induction motors. The open-loop constant V/F control law cannot be used with the single-phase induction motor drives as it is used with three phase motors. The variation of the operating frequency at lower speed range with constant load torque causes variation in motor's slip. A constant V/F control is suitable only over the upper speed range.

CTL escape mediated by proteasomal destruction of an HIV-1 cryptic epitope.

Directory of Open Access Journals (Sweden)

Sylvain Cardinaud

2011-05-01

Full Text Available Cytotoxic CD8+ T cells (CTLs play a critical role in controlling viral infections. HIV-infected individuals develop CTL responses against epitopes derived from viral proteins, but also against cryptic epitopes encoded by viral alternative reading frames (ARF. We studied here the mechanisms of HIV-1 escape from CTLs targeting one such cryptic epitope, Q9VF, encoded by an HIVgag ARF and presented by HLA-B*07. Using PBMCs of HIV-infected patients, we first cloned and sequenced proviral DNA encoding for Q9VF. We identified several polymorphisms with a minority of proviruses encoding at position 5 an aspartic acid (Q9VF/5D and a majority encoding an asparagine (Q9VF/5N. We compared the prevalence of each variant in PBMCs of HLA-B*07+ and HLA-B*07- patients. Proviruses encoding Q9VF/5D were significantly less represented in HLA-B*07+ than in HLA-B*07- patients, suggesting that Q9FV/5D encoding viruses might be under selective pressure in HLA-B*07+ individuals. We thus analyzed ex vivo CTL responses directed against Q9VF/5D and Q9VF/5N. Around 16% of HLA-B*07+ patients exhibited CTL responses targeting Q9VF epitopes. The frequency and the magnitude of CTL responses induced with Q9VF/5D or Q9VF/5N peptides were almost equal indicating a possible cross-reactivity of the same CTLs on the two peptides. We then dissected the cellular mechanisms involved in the presentation of Q9VF variants. As expected, cells infected with HIV strains encoding for Q9VF/5D were recognized by Q9VF/5D-specific CTLs. In contrast, Q9VF/5N-encoding strains were neither recognized by Q9VF/5N- nor by Q9VF/5D-specific CTLs. Using in vitro proteasomal digestions and MS/MS analysis, we demonstrate that the 5N variation introduces a strong proteasomal cleavage site within the epitope, leading to a dramatic reduction of Q9VF epitope production. Our results strongly suggest that HIV-1 escapes CTL surveillance by introducing mutations leading to HIV ARF-epitope destruction by proteasomes.

Speed control variable rate irrigation

Science.gov (United States)

Speed control variable rate irrigation (VRI) is used to address within field variability by controlling a moving sprinkler’s travel speed to vary the application depth. Changes in speed are commonly practiced over areas that slope, pond or where soil texture is predominantly different. Dynamic presc...

An evaluation of FIA's stand age variable

Science.gov (United States)

John D. Shaw

2015-01-01

The Forest Inventory and Analysis Database (FIADB) includes a large number of measured and computed variables. The definitions of measured variables are usually well-documented in FIA field and database manuals. Some computed variables, such as live basal area of the condition, are equally straightforward. Other computed variables, such as individual tree volume,...

Rainfall trends and variability in selected areas of Ethiopian Somali ...

African Journals Online (AJOL)

Moreover, proper spatial distribution of meteorological stations together with early warning system are required to further support local adaptive and coping strategies that the community designed towards rainfall variability in particular and climate change/disaster and risk at large. Keywords: Ethiopian Somali Region, Gode, ...

Clinical Correlates of Computationally Derived Visual Field Defect Archetypes in Patients from a Glaucoma Clinic.

Science.gov (United States)

Cai, Sophie; Elze, Tobias; Bex, Peter J; Wiggs, Janey L; Pasquale, Louis R; Shen, Lucy Q

2017-04-01

To assess the clinical validity of visual field (VF) archetypal analysis, a previously developed machine learning method for decomposing any Humphrey VF (24-2) into a weighted sum of clinically recognizable VF loss patterns. For each of 16 previously identified VF loss patterns ("archetypes," denoted AT1 through AT16), we screened 30,995 reliable VFs to select 10-20 representative patients whose VFs had the highest decomposition coefficients for each archetype. VF global indices and patient ocular and demographic features were extracted retrospectively. Based on resemblances between VF archetypes and clinically observed VF patterns, hypotheses were generated for associations between certain VF archetypes and clinical features, such as an association between AT6 (central island, representing severe VF loss) and large cup-to-disk ratio (CDR). Distributions of the selected clinical features were compared between representative eyes of certain archetypes and all other eyes using the two-tailed t-test or Fisher exact test. 243 eyes from 243 patients were included, representative of AT1 through AT16. CDR was more often ≥ 0.7 among eyes representative of AT6 (central island; p = 0.002), AT10 (inferior arcuate defect; p = 0.048), AT14 (superior paracentral defect; p = 0.016), and AT16 (inferior paracentral defect; p = 0.016) than other eyes. CDR was more often 6D (p = 0.069). Shared clinical features between computationally derived VF archetypes and clinically observed VF patterns support the clinical validity of VF archetypal analysis.

Prognosis of late versus early ventricular fibrillation in acute myocardial infarction

DEFF Research Database (Denmark)

Jensen, G V; Torp-Pedersen, C; Køber, L

1990-01-01

VF was not associated with heart failure. When VF was associated with heart failure (secondary VF) early VF had a greater mortality than late VF after 2 and 5 years. Logistic regression analysis showed that heart failure (relative risk 1.9 [1.1 to 3.1]) and cardiogenic shock (relative risk 3.9 [1.......8 to 8.5]) were significant risk factors for in-hospital death. Late VF compared to early VF had no prognostic implication (relative risk 1.0 [0.6 to 1.6]). For patients discharged from the hospital, risk factors were heart failure (1.8 [1.1 to 2.8]) and previous AMI (1.6 [1.3 to 2.1]).(ABSTRACT...... TRUNCATED AT 250 WORDS)...

Leaf area index estimation in a pine plantation with LAI-2000 under direct sunlight conditions: relationship with inventory and hydrologic variables

International Nuclear Information System (INIS)

Molina, A.; Campo, A. D. del

2011-01-01

LAI is a key factor in light and rainfall interception processes in forest stands and, for this reason, is called to play an important role in global change adaptive silviculture. Therefore, it is necessary to develop practical and operative methodologies to measure this parameter as well as simple relationships with other silviculture variables. This work has studied 1) the feasibility of LAI-2000 sensor in estimating LAI-stand when readings are taken under direct sunlight conditions; and 2) the ability of LAI in studying rainfall partitioned into throughfall (T) in an Aleppo pine stand after different thinning intensities, as well as its relationships to basal area, (G), cover (FCC), and tree density (D). Results showed that the angular correction scheme applied to LAI-2000 direct-sunlight readings stabilized them for different solar angles, allowing a better operational use of LAI-2000 in Mediterranean areas, where uniform overcast conditions are difficult to meet and predict. Forest cover showed the highest predictive ability of LAI (R 2 = 0.98; S = 0.28), then G (R 2 = 0.96; S = 0.43) and D (R 2 = 0.50; S = 0.28). In the hydrological plane, T increased with thinning intensity, being G the most explanatory variable (R 2 = 0.81; S = 3.07) and LAI the one that showed the poorest relation with it (R 2 = 0.69; S = 3.95). These results open a way for forest hydrologic modeling taking LAI as an input variable either estimated form LAI-2000 or deducted from inventory data. (Author) 36 refs.

Cellular mechanism underlying hypothermia-induced ventricular tachycardia/ventricular fibrillation in the setting of early repolarization and the protective effect of quinidine, cilostazol, and milrinone.

Science.gov (United States)

Gurabi, Zsolt; Koncz, István; Patocskai, Bence; Nesterenko, Vladislav V; Antzelevitch, Charles

2014-02-01

Hypothermia has been reported to induce ventricular tachycardia and fibrillation (VT/VF) in patients with early repolarization (ER) pattern. This study examines the cellular mechanisms underlying VT/VF associated with hypothermia in an experimental model of ER syndrome and examines the effectiveness of quinidine, cilostazol, and milrinone to prevent hypothermia-induced arrhythmias. Transmembrane action potentials were simultaneously recorded from 2 epicardial and 1 endocardial site of coronary-perfused canine left ventricular wedge preparations, together with a pseudo-ECG. A combination of NS5806 (3-10 μmol/L) and verapamil (1 μmol/L) was used to pharmacologically model the genetic mutations responsible for ER syndrome. Acetylcholine (3 μmol/L) was used to simulate increased parasympathetic tone, which is known to promote ER. In controls, lowering the temperature of the coronary perfusate to induce mild hypothermia (32°C-34°C) resulted in increased J-wave area on the ECG and accentuated epicardial action potential notch but no arrhythmic activity. In the setting of ER, hypothermia caused further accentuation of the epicardial action potential notch, leading to loss of the action potential dome at some sites but not others, thus creating the substrate for development of phase 2 reentry and VT/VF. Addition of the transient outward current antagonist quinidine (5 μmol/L) or the phosphodiesterase III inhibitors cilostazol (10 μmol/L) or milrinone (5 μmol/L) diminished the ER manifestations and prevented the hypothermia-induced phase 2 reentry and VT/VF. Hypothermia leads to VT/VF in the setting of ER by exaggerating repolarization abnormalities, leading to development of phase 2 reentry. Quinidine, cilostazol, and milrinone suppress the hypothermia-induced VT/VF by reversing the repolarization abnormalities.

Seasonal variability of soil CO2 flux and its carbon isotope composition in Krakow urban area, Southern Poland.

Science.gov (United States)

Jasek, Alina; Zimnoch, Miroslaw; Gorczyca, Zbigniew; Smula, Ewa; Rozanski, Kazimierz

2014-06-01

As urban atmosphere is depleted of (13)CO2, its imprint should be detectable in the local vegetation and therefore in its CO2 respiratory emissions. This work was aimed at characterising strength and isotope signature of CO2 fluxes from soil in urban areas with varying distances from anthropogenic CO2 emissions. The soil CO2 flux and its δ(13)C isotope signature were measured using a chamber method on a monthly basis from July 2009 to May 2012 within the metropolitan area of Krakow, Southern Poland, at two locations representing different levels of anthropogenic influence: a lawn adjacent to a busy street (A) and an urban meadow (B). The small-scale spatial variability of the soil CO2 flux was also investigated at site B. Site B revealed significantly higher summer CO2 fluxes (by approximately 46 %) than site A, but no significant differences were found between their δ(13)CO2 signatures.

Land Use Induced Hydroclimatic Variability Over Large Deforested Areas in Southern Amazon Rainforest

Science.gov (United States)

Khanna, J.; Medvigy, D.

2017-12-01

Contemporary Amazonian deforestation, which occurs at scales of a few hundreds of kilometers, has been found to induce systematic changes in the regional dry season precipitation. The replacement of rough forest with smooth pasture induces a low level atmospheric convergence and uplift in the downwind and divergence and subsidence in the upwind deforested areas. The resulting precipitation change is about ±30% of the deforested area mean in the two regions respectively. Compared with the increase in non-precipitating cloudiness triggered by small scale clearings prevalent in the early phases of deforestation, this `dynamical mesoscale circulation' can have regional ecological impacts by altering precipitation seasonality and in turn ecosystem dynamics. However, the seasonality and variability of this phenomenon hasn't been studied. Using observations and numerical simulations this study investigates the relationships between the dynamical mechanism and the local- and continental-scale atmospheric conditions to understand the physical controls on this phenomenon on the inter-annual, inter-seasonal and daily time scales. We find that the strength of the dynamical mechanism is controlled mostly by regional scale thermal and dynamical conditions of the boundary layer and not the continental and global scale atmospheric state. The lifting condensation level (thermodynamic control) and wind speed (dynamic control) within the boundary layer have the largest and positive correlations with the dipole strength, which is true although not always significant across time scales. Due to this dependence it is found to be strongest during parts of the year when the atmosphere is relatively stable. Hence, overall this phenomenon is found to be the prevalent convective triggering mechanism during the dry and parts of transition seasons (especially spring), significantly affecting the hydroclimate during this period.

Diurnal and seasonal variability of outdoor radon concentration in the area of the NRPI Prague.

Science.gov (United States)

Jilek, K; Slezákova, M; Thomas, J

2014-07-01

In autumn 2010, an outdoor measuring station for measurement of atmospheric radon, gamma equivalent dose rate in the range of 100 nSv h(-1)-1 Sv h(-1) and proper meteorological parameters such as thermal air gradient, relative air humidity, wind speed and direction and solar radiation intensity was built in the area of the National Radiation Protection Institute vvi. The station was designed to be independent of an electrical network and enables on-line wireless transfer of all data. After introduction of the station, illustrations of its measurement properties and the results of measured diurnal and seasonal variability of atmospheric radon, based on annual continuous measurement using a high-volume scintillation cell at a height of 2.5 m above the ground, are presented. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Climate variability in the subarctic area for the last 2 millennia

Science.gov (United States)

Nicolle, Marie; Debret, Maxime; Massei, Nicolas; Colin, Christophe; deVernal, Anne; Divine, Dmitry; Werner, Johannes P.; Hormes, Anne; Korhola, Atte; Linderholm, Hans W.

2018-01-01

To put recent climate change in perspective, it is necessary to extend the instrumental climate records with proxy data from paleoclimate archives. Arctic climate variability for the last 2 millennia has been investigated using statistical and signal analyses from three regionally averaged records from the North Atlantic, Siberia and Alaska based on many types of proxy data archived in the Arctic 2k database v1.1.1. In the North Atlantic and Alaska, the major climatic trend is characterized by long-term cooling interrupted by recent warming that started at the beginning of the 19th century. This cooling is visible in the Siberian region at two sites, warming at the others. The cooling of the Little Ice Age (LIA) was identified from the individual series, but it is characterized by wide-range spatial and temporal expression of climate variability, in contrary to the Medieval Climate Anomaly. The LIA started at the earliest by around AD 1200 and ended at the latest in the middle of the 20th century. The widespread temporal coverage of the LIA did not show regional consistency or particular spatial distribution and did not show a relationship with archive or proxy type either. A focus on the last 2 centuries shows a recent warming characterized by a well-marked warming trend parallel with increasing greenhouse gas emissions. It also shows a multidecadal variability likely due to natural processes acting on the internal climate system on a regional scale. A ˜ 16-30-year cycle is found in Alaska and seems to be linked to the Pacific Decadal Oscillation, whereas ˜ 20-30- and ˜ 50-90-year periodicities characterize the North Atlantic climate variability, likely in relation with the Atlantic Multidecadal Oscillation. These regional features are probably linked to the sea ice cover fluctuations through ice-temperature positive feedback.

Characterization and functional analysis of seven flagellin genes in Rhizobium leguminosarum bv. viciae. Characterization of R. leguminosarum flagellins

Directory of Open Access Journals (Sweden)

Tambalo Dinah D

2010-08-01

Full Text Available Abstract Background Rhizobium leguminosarum bv. viciae establishes symbiotic nitrogen fixing partnerships with plant species belonging to the Tribe Vicieae, which includes the genera Vicia, Lathyrus, Pisum and Lens. Motility and chemotaxis are important in the ecology of R. leguminosarum to provide a competitive advantage during the early steps of nodulation, but the mechanisms of motility and flagellar assembly remain poorly studied. This paper addresses the role of the seven flagellin genes in producing a functional flagellum. Results R. leguminosarum strains 3841 and VF39SM have seven flagellin genes (flaA, flaB, flaC, flaD, flaE, flaH, and flaG, which are transcribed separately. The predicted flagellins of 3841 are highly similar or identical to the corresponding flagellins in VF39SM. flaA, flaB, flaC, and flaD are in tandem array and are located in the main flagellar gene cluster. flaH and flaG are located outside of the flagellar/motility region while flaE is plasmid-borne. Five flagellin subunits (FlaA, FlaB, FlaC, FlaE, and FlaG are highly similar to each other, whereas FlaD and FlaH are more distantly related. All flagellins exhibit conserved amino acid residues at the N- and C-terminal ends and are variable in the central regions. Strain 3841 has 1-3 plain subpolar flagella while strain VF39SM exhibits 4-7 plain peritrichous flagella. Three flagellins (FlaA/B/C and five flagellins (FlaA/B/C/E/G were detected by mass spectrometry in the flagellar filaments of strains 3841 and VF39SM, respectively. Mutation of flaA resulted in non-motile VF39SM and extremely reduced motility in 3841. Individual mutations of flaB and flaC resulted in shorter flagellar filaments and consequently reduced swimming and swarming motility for both strains. Mutant VF39SM strains carrying individual mutations in flaD, flaE, flaH, and flaG were not significantly affected in motility and filament morphology. The flagellar filament and the motility of 3841 strains

Population Pharmacokinetics of Artesunate and Dihydroartemisinin following Intra-Rectal Dosing of Artesunate in Malaria Patients

Science.gov (United States)

Simpson, Julie A; Agbenyega, Tsiri; Barnes, Karen I; Perri, Gianni Di; Folb, Peter; Gomes, Melba; Krishna, Sanjeev; Krudsood, Srivicha; Looareesuwan, Sornchai; Mansor, Sharif; McIlleron, Helen; Miller, Raymond; Molyneux, Malcolm; Mwenechanya, James; Navaratnam, Visweswaran; Nosten, Francois; Olliaro, Piero; Pang, Lorrin; Ribeiro, Isabela; Tembo, Madalitso; van Vugt, Michele; Ward, Steve; Weerasuriya, Kris; Win, Kyaw; White, Nicholas J

2006-01-01

with the remainder, independent of any confounders. No associations between the parasitological responses and the posterior individual estimates of V/F, CL/F, and AUC0–6h were observed. Conclusions The pharmacokinetic properties of DHA were affected only by gender and body weight. Patients with the lowest area under the DHA concentration curve did not have slower parasite clearance, suggesting that rectal artesunate is well absorbed in most patients with moderately severe malaria. However, a number of modelling assumptions were required due to the large intra- and inter-individual variability of the DHA concentrations. PMID:17132053

Population pharmacokinetics of artesunate and dihydroartemisinin following intra-rectal dosing of artesunate in malaria patients.

Directory of Open Access Journals (Sweden)

Julie A Simpson

2006-11-01

, independent of any confounders. No associations between the parasitological responses and the posterior individual estimates of V/F, CL/F, and AUC0-6h were observed.The pharmacokinetic properties of DHA were affected only by gender and body weight. Patients with the lowest area under the DHA concentration curve did not have slower parasite clearance, suggesting that rectal artesunate is well absorbed in most patients with moderately severe malaria. However, a number of modelling assumptions were required due to the large intra- and inter-individual variability of the DHA concentrations.

Population pharmacokinetics of artesunate and dihydroartemisinin following intra-rectal dosing of artesunate in malaria patients.

Science.gov (United States)

Simpson, Julie A; Agbenyega, Tsiri; Barnes, Karen I; Di Perri, Gianni; Folb, Peter; Gomes, Melba; Krishna, Sanjeev; Krudsood, Srivicha; Looareesuwan, Sornchai; Mansor, Sharif; McIlleron, Helen; Miller, Raymond; Molyneux, Malcolm; Mwenechanya, James; Navaratnam, Visweswaran; Nosten, Francois; Olliaro, Piero; Pang, Lorrin; Ribeiro, Isabela; Tembo, Madalitso; van Vugt, Michele; Ward, Steve; Weerasuriya, Kris; Win, Kyaw; White, Nicholas J

2006-11-01

of any confounders. No associations between the parasitological responses and the posterior individual estimates of V/F, CL/F, and AUC0-6h were observed. The pharmacokinetic properties of DHA were affected only by gender and body weight. Patients with the lowest area under the DHA concentration curve did not have slower parasite clearance, suggesting that rectal artesunate is well absorbed in most patients with moderately severe malaria. However, a number of modelling assumptions were required due to the large intra- and inter-individual variability of the DHA concentrations.

Plant community variability on a small area in southeastern Montana

Science.gov (United States)

James G. MacCracken; Daniel W. Uresk; Richard M. Hansen

1984-01-01

Plant communities are inherently variable due to a number of environmental and biological forces. Canopy cover and aboveground biomass were determined for understory vegetation in plant communities of a prairie grassland-forest ecotone in southeastern Montana. Vegetation units were described using polar ordination and stepwise discriminant analysis. Nine of a total of...

Current concepts on ventricular fibrillation: A Vicious Circle of Cardiomyocyte Calcium Overload in the Initiation, Maintenance, and Termination of Ventricular Fibrillation

Directory of Open Access Journals (Sweden)

Christian E. Zaugg

2004-04-01

Full Text Available Based on recent experimental studies, this review article introduces the novel concept that cardiomyocyte Ca2+ and ventricular fibrillation (VF are mutually related, forming a self-maintaining vicious circle in the initiation, maintenance, and termination of VF. On the one hand, elevated myocyte Ca2+ can cause delayed afterdepolarizations, triggered activity, and consequently life-threatening ventricular tachyarrhythmias in various pathological conditions such as digitalis toxicity, myocardial ischemia, or heart failure. On the other hand, VF itself directly and rapidly causes progressive myocyte Ca2+ overload that maintains VF and renders termination of VF increasingly difficult. Accordingly, energy levels for successful electrical defibrillation (defibrillation thresholds increase as both VF and Ca2+ overload progress. Furthermore, VF-induced myocyte Ca2+ overload can promote re-induction of VF after defibrillation and/or postfibrillatory myocardial dysfunction (postresuscitation stunning due to reduced myofilament Ca2+ responsiveness. The probability of these adverse events is best reduced by early detection and rapid termination of VF to prevent or limit Ca2+ overload. Early additional therapy targeting transsarcolemmal Ca2+ entry, particularly during the first 2 min of VF, may partially prevent myocyte Ca2+ overload and thus, increase the likelihood of successful defibrillation as well as prevent postfibrillatory myocardial dysfunction.

Prevalence and evolution of low frequency HIV drug resistance mutations detected by ultra deep sequencing in patients experiencing first line antiretroviral therapy failure.

Science.gov (United States)

Vandenhende, Marie-Anne; Bellecave, Pantxika; Recordon-Pinson, Patricia; Reigadas, Sandrine; Bidet, Yannick; Bruyand, Mathias; Bonnet, Fabrice; Lazaro, Estibaliz; Neau, Didier; Fleury, Hervé; Dabis, François; Morlat, Philippe; Masquelier, Bernard

2014-01-01

Clinical relevance of low-frequency HIV-1 variants carrying drug resistance associated mutations (DRMs) is still unclear. We aimed to study the prevalence of low-frequency DRMs, detected by Ultra-Deep Sequencing (UDS) before antiretroviral therapy (ART) and at virological failure (VF), in HIV-1 infected patients experiencing VF on first-line ART. Twenty-nine ART-naive patients followed up in the ANRS-CO3 Aquitaine Cohort, having initiated ART between 2000 and 2009 and experiencing VF (2 plasma viral loads (VL) >500 copies/ml or one VL >1000 copies/ml) were included. Reverse transcriptase and protease DRMs were identified using Sanger sequencing (SS) and UDS at baseline (before ART initiation) and VF. Additional low-frequency variants with PI-, NNRTI- and NRTI-DRMs were found by UDS at baseline and VF, significantly increasing the number of detected DRMs by 1.35 fold (plow-frequency DRMs modified ARV susceptibility predictions to the prescribed treatment for 1 patient at baseline, in whom low-frequency DRM was found at high frequency at VF, and 6 patients at VF. DRMs found at VF were rarely detected as low-frequency DRMs prior to treatment. The rare low-frequency NNRTI- and NRTI-DRMs detected at baseline that correlated with the prescribed treatment were most often found at high-frequency at VF. Low frequency DRMs detected before ART initiation and at VF in patients experiencing VF on first-line ART can increase the overall burden of resistance to PI, NRTI and NNRTI.

Estimation of brachial artery volume flow by duplex ultrasound imaging predicts dialysis access maturation.

Science.gov (United States)

Ko, Sae Hee; Bandyk, Dennis F; Hodgkiss-Harlow, Kelley D; Barleben, Andrew; Lane, John

2015-06-01

This study validated duplex ultrasound measurement of brachial artery volume flow (VF) as predictor of dialysis access flow maturation and successful hemodialysis. Duplex ultrasound was used to image upper extremity dialysis access anatomy and estimate access VF within 1 to 2 weeks of the procedure. Correlation of brachial artery VF with dialysis access conduit VF was performed using a standardized duplex testing protocol in 75 patients. The hemodynamic data were used to develop brachial artery flow velocity criteria (peak systolic velocity and end-diastolic velocity) predictive of three VF categories: low (800 mL/min). Brachial artery VF was then measured in 148 patients after a primary (n = 86) or revised (n = 62) upper extremity dialysis access procedure, and the VF category correlated with access maturation or need for revision before hemodialysis usage. Access maturation was conferred when brachial artery VF was >600 mL/min and conduit imaging indicated successful cannulation based on anatomic criteria of conduit diameter >5 mm and skin depth 800 mL/min was predicted when the brachial artery lumen diameter was >4.5 mm, peak systolic velocity was >150 cm/s, and the diastolic-to-systolic velocity ratio was >0.4. Brachial artery velocity spectra indicating VF 800 mL/min. Duplex testing to estimate brachial artery VF and assess the conduit for ease of cannulation can be performed in 5 minutes during the initial postoperative vascular clinic evaluation. Estimation of brachial artery VF using the duplex ultrasound, termed the "Fast, 5-min Dialysis Duplex Scan," facilitates patient evaluation after new or revised upper extremity dialysis access procedures. Brachial artery VF correlates with access VF measurements and has the advantage of being easier to perform and applicable for forearm and also arm dialysis access. When brachial artery velocity spectra criteria confirm a VF >800 mL/min, flow maturation and successful hemodialysis are predicted if anatomic criteria

Electrical storm presages nonsudden death: the antiarrhythmics versus implantable defibrillators (AVID) trial.

Science.gov (United States)

Exner, D V; Pinski, S L; Wyse, D G; Renfroe, E G; Follmann, D; Gold, M; Beckman, K J; Coromilas, J; Lancaster, S; Hallstrom, A P

2001-04-24

Electrical storm, multiple temporally related episodes of ventricular tachycardia (VT) or ventricular fibrillation (VF), is a frequent problem among recipients of implantable cardioverter defibrillators (ICDs). However, insufficient data exist regarding its prognostic significance. This analysis includes 457 patients who received an ICD in the Antiarrhythmics Versus Implantable Defibrillators (AVID) trial and who were followed for 31 +/- 13 months. Electrical storm was defined as > or = 3 separate episodes of VT/VF within 24 hours. Characteristics and survival of patients surviving electrical storm (n = 90), those with VT/VF unrelated to electrical storm (n = 184), and the remaining patients (n = 183) were compared. The 3 groups differed in terms of ejection fraction, index arrhythmia, revascularization status, and baseline medication use. Survival was evaluated using time-dependent Cox modeling. Electrical storm occurred 9.2 +/- 11.5 months after ICD implantation, and most episodes (86%) were due to VT. Electrical storm was a significant risk factor for subsequent death, independent of ejection fraction and other prognostic variables (relative risk [RR], 2.4; 95% confidence interval [CI], 1.3 to 4.2; P = 0.003), but VT/VF unrelated to electrical storm was not (RR, 1.0; 95% CI, 0.6 to 1.7; P = 0.9). The risk of death was greatest 3 months after electrical storm (RR, 5.4; 95% Cl, 2.4 to 12.3; P = 0.0001) and diminished beyond this time (RR, 1.9; 95% CI, 1.0 to 3.6; P=0.04). Electrical storm is an important, independent marker for subsequent death among ICD recipients, particularly in the first 3 months after its occurrence. However, the development of VT/VF unrelated to electrical storm does not seem to be associated with an increased risk of subsequent death.

Modeling Short-Range Soil Variability and its Potential Use in Variable-Rate Treatment of Experimental Plots

Directory of Open Access Journals (Sweden)

A Moameni

2011-02-01

Full Text Available Abstract In Iran, the experimental plots under fertilizer trials are managed in such a way that the whole plot area uniformly receives agricultural inputs. This could lead to biased research results and hence to suppressing of the efforts made by the researchers. This research was conducted in a selected site belonging to the Gonbad Agricultural Research Station, located in the semiarid region, northeastern Iran. The aim was to characterize the short-range spatial variability of the inherent and management-depended soil properties and to determine if this variation is large and can be managed at practical scales. The soils were sampled using a grid 55 m apart. In total, 100 composite soil samples were collected from topsoil (0-30 cm and were analyzed for calcium carbonate equivalent, organic carbon, clay, available phosphorus, available potassium, iron, copper, zinc and manganese. Descriptive statistics were applied to check data trends. Geostatistical analysis was applied to variography, model fitting and contour mapping. Sampling at 55 m made it possible to split the area of the selected experimental plot into relatively uniform areas that allow application of agricultural inputs with variable rates. Keywords: Short-range soil variability, Within-field soil variability, Interpolation, Precision agriculture, Geostatistics

Vision Health-Related Quality of Life in Chinese Glaucoma Patients

Directory of Open Access Journals (Sweden)

Lei Zuo

2015-01-01

Full Text Available This cross-sectional study evaluated VRQOL in Chinese glaucoma patients and the potential factors influencing VRQOL. The VRQOL was assessed using the Chinese-version low vision quality of life questionnaire. Visual field loss was classified by the Hodapp-Parrish-Anderson method. The correlations of VRQOL to the best corrected visual acuity and the VF loss were investigated. The potential impact factors to VRQOL of glaucoma patients were screened by single factor analysis and were further analyzed by multiple regression analysis. There were significant differences in VRQOL scores between mild VF loss group and moderate VF loss group, moderate VF loss group and severe VF loss group, and mild VF loss group and severe VF loss group according to the better eye. In multiple linear regression, the binocular weighted average BCVA significantly affected the VRQOL scores. Binocular MD was the second influencing factor. In logistic regression, binocular severe VF loss and stroke were significantly associated with abnormal VRQOL. Education was the next influencing factor. This study showed that visual acuity correlated linearly with VRQOL, and VF loss might reach a certain level, correlating with abnormal VRQOL scores. Stroke was significantly associated with abnormal VRQOL.

Climate variability in the subarctic area for the last 2 millennia

Directory of Open Access Journals (Sweden)

M. Nicolle

2018-01-01

Full Text Available To put recent climate change in perspective, it is necessary to extend the instrumental climate records with proxy data from paleoclimate archives. Arctic climate variability for the last 2 millennia has been investigated using statistical and signal analyses from three regionally averaged records from the North Atlantic, Siberia and Alaska based on many types of proxy data archived in the Arctic 2k database v1.1.1. In the North Atlantic and Alaska, the major climatic trend is characterized by long-term cooling interrupted by recent warming that started at the beginning of the 19th century. This cooling is visible in the Siberian region at two sites, warming at the others. The cooling of the Little Ice Age (LIA was identified from the individual series, but it is characterized by wide-range spatial and temporal expression of climate variability, in contrary to the Medieval Climate Anomaly. The LIA started at the earliest by around AD 1200 and ended at the latest in the middle of the 20th century. The widespread temporal coverage of the LIA did not show regional consistency or particular spatial distribution and did not show a relationship with archive or proxy type either. A focus on the last 2 centuries shows a recent warming characterized by a well-marked warming trend parallel with increasing greenhouse gas emissions. It also shows a multidecadal variability likely due to natural processes acting on the internal climate system on a regional scale. A ∼ 16–30-year cycle is found in Alaska and seems to be linked to the Pacific Decadal Oscillation, whereas ∼ 20–30- and ∼ 50–90-year periodicities characterize the North Atlantic climate variability, likely in relation with the Atlantic Multidecadal Oscillation. These regional features are probably linked to the sea ice cover fluctuations through ice–temperature positive feedback.

Elevers oppfatning av lærers tilbakemeldingspraksis: om sammenheng mellom graden av VfL-praksis og elevenes opplevde nytte av lærers skriftlige tilbakemeldinger i skriftlig norsk

Directory of Open Access Journals (Sweden)

Harald Eriksen

2017-11-01

Full Text Available Formålet med denne studien var å undersøke elevers oppfatninger av norsklærerens tilbakemeldingspraksis i skriftlig norsk. På bakgrunn av omfattende internasjonal forskning innen feltet ‘Vurdering for læring’ (VfL er det i denne studien utviklet teoridrevne hypoteser som testes ved å analysere et datasett fra to videregående skoler. Hypotesene er at elevene oppfatter lærers tilbakemelding som mer nyttig hvis den 1 retter seg mot målet med opplæringen, 2 gir elevene informasjon via en forklaring eller instruks om hvordan de skal komme nærmere målet og 3 at lærer legger til rette for bruk av tilbakemeldingen. Strukturell likningsmodellering (SEM av resultater fra en spørreundersøkelse blant elever (N = 213 er brukt som metode til å estimere forholdet mellom de fire latente variablene kriterier, forklaring, bruk og nytte (avhengig variabel. SEM er brukt fordi metoden egner seg til å undersøke sammenhenger i komplekse datasett. Funn er at elevene oppfatter at hvis lærer forklarer hvordan de kan forbedre seg, er dette positivt statistisk assosiert med opplevd nytte. Et mer overraskende funn er at lærerens tilrettelegging for bruk av tilbakemeldinger ikke er signifikant assosiert med opplevd nytte. Resultatene blir diskutert i artikkelen.

Alternative approach for management of an electrical storm in Brugada syndrome:Importance of primary ablation within a narrow time window

Directory of Open Access Journals (Sweden)

Ahmed Karim Talib, MD, PhD

2016-06-01

Full Text Available Placement of an implantable cardioverter–defibrillator (ICD is the only powerful treatment modality for Brugada syndrome in patients presenting with ventricular fibrillation (VF. For those whose first presentation is an electrical storm, pharmacologic therapy is typically used to control VF followed by ICD implantation. We report an alternative approach whereby, before ICD implantation, emergency catheter ablation of the VF-triggering premature ventricular contraction (PVC resulted in long-term VF-free survival. The results suggest that, because VF triggers appear in a narrow time window, ablation of the culprit PVCs that initiate VF before the index PVCs subside is a reasonable alternative approach.

Spatially uniform but temporally variable bacterioplankton in a semi-enclosed coastal area.

Science.gov (United States)

Meziti, Alexandra; Kormas, Konstantinos A; Moustaka-Gouni, Maria; Karayanni, Hera

2015-07-01

Studies focusing on the temporal and spatial dynamics of bacterioplankton communities within littoral areas undergoing direct influences from the coast are quite limited. In addition, they are more complicated to resolve compared to communities in the open ocean. In order to elucidate the effects of spatial vs. temporal variability on bacterial communities in a highly land-influenced semi-enclosed gulf, surface bacterioplankton communities from five coastal sites in Igoumenitsa Gulf (Ionian Sea, Greece) were analyzed over a nine-month period using 16S rDNA 454-pyrosequencing. Temporal differences were more pronounced than spatial ones, with lower diversity indices observed during the summer months. During winter and early spring, bacterial communities were dominated by SAR11 representatives, while this pattern changed in May when they were abruptly replaced by members of Flavobacteriales, Pseudomonadales, and Alteromonadales. Additionally, correlation analysis showed high negative correlations between the presence of SAR11 OTUs in relation to temperature and sunlight that might have driven, directly or indirectly, the disappearance of these OTUs in the summer months. The dominance of SAR11 during the winter months further supported the global distribution of the clade, not only in the open-sea, but also in coastal systems. This study revealed that specific bacteria exhibited distinct succession patterns in an anthropogenic-impacted coastal system. The major bacterioplankton component was represented by commonly found marine bacteria exhibiting seasonal dynamics, while freshwater and terrestrial-related phylotypes were absent. Copyright © 2015 Elsevier GmbH. All rights reserved.

The relationship between better-eye and integrated visual field mean deviation and visual disability.

Science.gov (United States)

Arora, Karun S; Boland, Michael V; Friedman, David S; Jefferys, Joan L; West, Sheila K; Ramulu, Pradeep Y

2013-12-01

To determine the extent of difference between better-eye visual field (VF) mean deviation (MD) and integrated VF (IVF) MD among Salisbury Eye Evaluation (SEE) subjects and a larger group of glaucoma clinic subjects and to assess how those measures relate to objective and subjective measures of ability/performance in SEE subjects. Retrospective analysis of population- and clinic-based samples of adults. A total of 490 SEE and 7053 glaucoma clinic subjects with VF loss (MD ≤-3 decibels [dB] in at least 1 eye). Visual field testing was performed in each eye, and IVF MD was calculated. Differences between better-eye and IVF MD were calculated for SEE and clinic-based subjects. In SEE subjects with VF loss, models were constructed to compare the relative impact of better-eye and IVF MD on driving habits, mobility, self-reported vision-related function, and reading speed. Difference between better-eye and IVF MD and relationship of better-eye and IVF MD with performance measures. The median difference between better-eye and IVF MD was 0.41 dB (interquartile range [IQR], -0.21 to 1.04 dB) and 0.72 dB (IQR, 0.04-1.45 dB) for SEE subjects and clinic-based patients with glaucoma, respectively, with differences of ≥ 2 dB between the 2 MDs observed in 9% and 18% of the groups, respectively. Among SEE subjects with VF loss, both MDs demonstrated similar associations with multiple ability and performance metrics as judged by the presence/absence of a statistically significant association between the MD and the metric, the magnitude of observed associations (odds ratios, rate ratios, or regression coefficients associated with 5-dB decrements in MD), and the extent of variability in the metric explained by the model (R(2)). Similar associations of similar magnitude also were noted for the subgroup of subjects with glaucoma and subjects in whom better-eye and IVF MD differed by ≥ 2 dB. The IVF MD rarely differs from better-eye MD, and similar associations between VF loss and

Sudden cardiac arrest in people with epilepsy in the community

Science.gov (United States)

Lamberts, Robert J.; Blom, Marieke T.; Wassenaar, Merel; Bardai, Abdennasser; Leijten, Frans S.; de Haan, Gerrit-Jan; Sander, Josemir W.; Thijs, Roland D.

2015-01-01

Objective: To ascertain whether characteristics of ventricular tachycardia/fibrillation (VT/VF) differed between people with epilepsy and those without and which individuals with epilepsy were at highest risk. Methods: We ascertained 18 people with active epilepsy identified in a community-based registry of sudden cardiac arrest (SCA) with ECG-confirmed VT/VF (cases). We compared them with 470 individuals with VT/VF without epilepsy (VT/VF controls) and 54 individuals with epilepsy without VT/VF (epilepsy controls). Data on comorbidity, epilepsy severity, and medication use were collected and entered into (conditional) logistic regression models to identify determinants of VT/VF in epilepsy. Results: In most cases, there was an obvious (10/18) or presumed cardiovascular cause (5/18) in view of preexisting heart disease. In 2 of the 3 remaining events, near–sudden unexpected death in epilepsy (SUDEP) was established after successful resuscitation. Cases had a higher prevalence of congenital/inherited heart disease (17% vs 1%, p = 0.002), and experienced VT/VF at younger age (57 vs 64 years, p = 0.023) than VT/VF controls. VT/VF in cases occurred more frequently at/near home (89% vs 58%, p = 0.009), and was less frequently witnessed (72% vs 89%, p = 0.048) than in VT/VF controls. Cases more frequently had clinically relevant heart disease (50% vs 15%, p = 0.005) and intellectual disability (28% vs 1%, p epilepsy controls. Conclusion: Cardiovascular disease rather than epilepsy characteristics is the main determinant of VT/VF in people with epilepsy in the community. SCA and SUDEP are partially overlapping disease entities. PMID:26092917

Analysis of the Variability of Classified and Unclassified Radiological Source term Inventories in the Frenchman Flat Area, Nevada test Site

International Nuclear Information System (INIS)

Zhao, P.; Zavarin, M.

2008-01-01

It has been proposed that unclassified source terms used in the reactive transport modeling investigations at NTS CAUs should be based on yield-weighted source terms calculated using the average source term from Bowen et al. (2001) and the unclassified announced yields reported in DOE/NV-209. This unclassified inventory is likely to be used in unclassified contaminant boundary calculations and is, thus, relevant to compare to the classified inventory. They have examined the classified radionuclide inventory produced by 10 underground nuclear tests conducted in the Frenchman Flat (FF) area of the Nevada Test Site. The goals were to (1) evaluate the variability in classified radiological source terms among the 10 tests and (2) compare that variability and inventory uncertainties to an average unclassified inventory (e.g. Bowen 2001). To evaluate source term variability among the 10 tests, radiological inventories were compared on two relative scales: geometric mean and yield-weighted geometric mean. Furthermore, radiological inventories were either decay corrected to a common date (9/23/1992) or the time zero (t 0 ) of each test. Thus, a total of four data sets were produced. The date of 9/23/1992 was chosen based on the date of the last underground nuclear test at the Nevada Test Site

Vulnerability Assessment of Mangrove Habitat to the Variables of the Oceanography Using CVI Method (Coastal Vulnerability Index) in Trimulyo Mangrove Area, Genuk District, Semarang

Science.gov (United States)

Ahmad, Rifandi Raditya; Fuad, Muhammad

2018-02-01

Some functions of mangrove areas in coastal ecosystems as a green belt, because mangrove serves as a protector of the beach from the sea waves, as a good habitat for coastal biota and for nutrition supply. Decreased condition or degradation of mangrove habitat caused by several oceanographic factors. Mangrove habitats have some specific characteristics such as salinity, tides, and muddy substrates. Considering the role of mangrove area is very important, it is necessary to study about the potential of mangrove habitat so that the habitat level of mangrove habitat in the east coast of Semarang city is known. The purpose of this research is to obtain an index and condition of habitat of mangrove habitat at location of research based on tidal, salinity, substrate type, coastline change. Observation by using purposive method and calculation of habitat index value of mangrove habitat using CVI (Coastal Vulnerability Index) method with scores divided into 3 groups namely low, medium and high. The results showed that there is a zone of research belonging to the medium vulnerability category with the most influential variables is because there is abrasion that sweeps the mangrove substrate. Trimulyo mangrove habitat has high vulnerable variable of tidal frequency, then based on value variable Salinity is categorized as low vulnerability, whereas for mangrove habitat vulnerability based on variable type of substrate belong to low and medium vulnerability category. The CVI values of mangrove habitats divided into zones 1; 2; and 3 were found to varying values of 1.54; 3.79; 1.09, it indicates that there is a zone with the vulnerability of mangrove habitat at the study site belonging to low and medium vulnerability category.

Glacier variability in the conterminous United States during the twentieth century

Science.gov (United States)

McCabe, Gregory J.; Fountain, Andrew G.

2013-01-01

Glaciers of the conterminous United States have been receding for the past century. Since 1900 the recession has varied from a 24 % loss in area (Mt. Rainier, Washington) to a 66 % loss in the Lewis Range of Montana. The rates of retreat are generally similar with a rapid loss in the early decades of the 20th century, slowing in the 1950s–1970s, and a resumption of rapid retreat starting in the 1990s. Decadal estimates of changes in glacier area for a subset of 31 glaciers from 1900 to 2000 are used to test a snow water equivalent model that is subsequently employed to examine the effects of temperature and precipitation variability on annual glacier area changes for these glaciers. Model results indicate that both winter precipitation and winter temperature have been important climatic factors affecting the variability of glacier variability during the 20th Century. Most of the glaciers analyzed appear to be more sensitive to temperature variability than to precipitation variability. However, precipitation variability is important, especially for high elevation glaciers. Additionally, glaciers with areas greater than 1 km2 are highly sensitive to variability in temperature.

Development of visual field defect after first-detected optic disc hemorrhage in preperimetric open-angle glaucoma.

Science.gov (United States)

Kim, Hae Jin; Song, Yong Ju; Kim, Young Kook; Jeoung, Jin Wook; Park, Ki Ho

2017-07-01

To evaluate functional progression in preperimetric glaucoma (PPG) with disc hemorrhage (DH) and to determine the time interval between the first-detected DH and development of glaucomatous visual field (VF) defect. A total of 87 patients who had been first diagnosed with PPG were enrolled. The medical records of PPG patients without DH (Group 1) and with DH (Group 2) were reviewed. When glaucomatous VF defect appeared, the time interval from the diagnosis of PPG to the development of VF defect was calculated and compared between the two groups. In group 2, the time intervals from the first-detected DH to VF defect of the single- and recurrent-DH were compared. Of the enrolled patients, 45 had DH in the preperimetric stage. The median time interval from the diagnosis of PPG to the development of VF defect was 73.3 months in Group 1, versus 45.4 months in Group 2 (P = 0.042). The cumulative probability of development of VF defect after diagnosis of PPG was significantly greater in Group 2 than in Group 1. The median time interval from first-detected DH to the development of VF defect was 37.8 months. The median time interval from DH to VF defect and cumulative probability of VF defect after DH did not show a statistical difference between single and recurrent-DH patients. The median time interval between the diagnosis of PPG and the development of VF defect was significantly shorter in PPG with DH. The VF defect appeared 37.8 months after the first-detected DH in PPG.

Comparison of circadian, weekly, and seasonal variations of electrical storms and single events of ventricular fibrillation in patients with Brugada syndrome

Directory of Open Access Journals (Sweden)

Yoshiyasu Aizawa

2016-06-01

Full Text Available In patients with Brugada syndrome (BS, VF occurred predominantly during the nocturnal period. Some patients also developed ESs. In addition to the circadian rhythm, patients showed weekly and seasonal patterns. The patients with ESs had peak episodes of VF on Saturday and in the winter and spring, while episodes of VF in patients with single VF events occurred most often on Monday with smaller seasonal variation. Except for age, there was no difference in the clinical or ECG characteristics between the patients with ESs and those with single VF episodes.

Flow variability and hillslope hydrology

Energy Technology Data Exchange (ETDEWEB)

Huff, D D; O' Neill, R V; Emanuel, W R; Elwood, J W; Newbold, J D

1982-01-01

Examination of spatial variability of streamflow in headwater areas can provide important insight about factors that influence hillslope hydrology. Detailed observations of variations in stream channel input, based on a tracer experiment, indicate that topography alone cannot explain flow variability. However, determination of changes in channel input on a small spatial scale can provide valuable clues to factors, such as structural geology that control subsurface flows.

Normalization of flow-mediated dilation to shear stress area under the curve eliminates the impact of variable hyperemic stimulus

Directory of Open Access Journals (Sweden)

Mickleborough Timothy D

2008-09-01

Full Text Available Abstract Background Normalization of brachial artery flow-mediated dilation (FMD to individual shear stress area under the curve (peak FMD:SSAUC ratio has recently been proposed as an approach to control for the large inter-subject variability in reactive hyperemia-induced shear stress; however, the adoption of this approach among researchers has been slow. The present study was designed to further examine the efficacy of FMD normalization to shear stress in reducing measurement variability. Methods Five different magnitudes of reactive hyperemia-induced shear stress were applied to 20 healthy, physically active young adults (25.3 ± 0. 6 yrs; 10 men, 10 women by manipulating forearm cuff occlusion duration: 1, 2, 3, 4, and 5 min, in a randomized order. A venous blood draw was performed for determination of baseline whole blood viscosity and hematocrit. The magnitude of occlusion-induced forearm ischemia was quantified by dual-wavelength near-infrared spectrometry (NIRS. Brachial artery diameters and velocities were obtained via high-resolution ultrasound. The SSAUC was individually calculated for the duration of time-to-peak dilation. Results One-way repeated measures ANOVA demonstrated distinct magnitudes of occlusion-induced ischemia (volume and peak, hyperemic shear stress, and peak FMD responses (all p AUC (p = 0.785. Conclusion Our data confirm that normalization of FMD to SSAUC eliminates the influences of variable shear stress and solidifies the utility of FMD:SSAUC ratio as an index of endothelial function.

Comparison of Macular Integrity Assessment (MAIA ™, MP-3, and the Humphrey Field Analyzer in the Evaluation of the Relationship between the Structure and Function of the Macula.

Directory of Open Access Journals (Sweden)

Kazuyuki Hirooka

Full Text Available This study was conducted in order to compare relationships between the macular visual field (VF mean sensitivity measured by MAIATM (Macular Integrity Assessment, MP-3, or Humphry field analyzer (HFA and the ganglion cell and inner plexiform layer (GCA thicknesses.This cross-sectional study examined 73 glaucoma patients and 19 normal subjects. All subjects underwent measurements for GCA thickness by Cirrus HD-OCT and static threshold perimetry using MAIATM, MP-3, or HFA. VF and OCT in the retinal view were used to examine both the global relationship between the VF sensitivity and GCA thickness, and the superior hemiretina and inferior hemiretina. The relationship between the GCA thickness and macular sensitivity was examined by Spearman correlation analysis.For each instrument, statistically significant macular VF sensitivity (dB and GCA thickness relationships were observed using the decibel scale (R = 0.547-0.687, all P < 0.001. The highest correlation for the global (R = 0.682 and the superior hemiretina (R = 0.594 GCA thickness-VF mean sensitivity was observed by the HFA. The highest correlation for the inferior hemiretina (R = 0.687 GCA thickness-VF mean sensitivity was observed by the MP-3. Among the three VF measurement instruments, however, no significant differences were found for the structure-function relationships.All three VF measurement instruments found similar structure-function relationships in the central VF.

Plasmids of Raw Milk Cheese Isolate Lactococcus lactis subsp. lactis Biovar diacetylactis DPC3901 Suggest a Plant-Based Origin for the Strain ▿ †

Science.gov (United States)

Fallico, Vincenzo; McAuliffe, Olivia; Fitzgerald, Gerald F.; Ross, R. Paul

2011-01-01

The four-plasmid complement of the raw milk cheese isolate Lactococcus lactis subsp. lactis biovar diacetylactis DPC3901 was sequenced, and some genetic features were functionally analyzed. The complete sequences of pVF18 (18,977 bp), pVF21 (21,739 bp), pVF22 (22,166 bp), and pVF50 (53,876 bp) were obtained. Each plasmid contained genes not previously described for Lactococcus, in addition to genes associated with plant-derived lactococcal strains. Most of the novel genes were found on pVF18 and encoded functions typical of bacteria associated with plants, such as activities of plant cell wall modification (orf11 and orf25). In addition, a predicted high-affinity regulated system for the uptake of cobalt was identified (orf19 to orf21 [orf19-21]), which has a single database homolog on a plant-derived Leuconostoc plasmid and whose functionality was demonstrated following curing of pVF18. pVF21 and pVF22 encode additional metal transporters, which, along with orf19-21 of pVF18, could enhance host ability to uptake growth-limiting amounts of biologically essential ions within the soil. In addition, vast regions from pVF50 and pVF21 share significant homology with the plant-derived lactococcal plasmid pGdh442, which is indicative of extensive horizontal gene transfer and recombination between these plasmids and suggests a common plant niche for their hosts. Phenotypes associated with these regions include glutamate dehydrogenase activity and Na+ and K+ transport. The presence of numerous plant-associated markers in L. lactis DPC3901 suggests a plant origin for the raw milk cheese isolate and provides for the first time the genetic basis to support the concept of the plant-milk transition for Lactococcus strains. PMID:21803914

Vitex rotundifolia Fruit Suppresses the Proliferation of Human Colorectal Cancer Cells through Down-regulation of Cyclin D1 and CDK4 via Proteasomal-Dependent Degradation and Transcriptional Inhibition.

Science.gov (United States)

Song, Hun Min; Park, Gwang Hun; Park, Su Bin; Kim, Hyun-Seok; Son, Ho-Jun; Um, Yurry; Jeong, Jin Boo

2018-01-01

Viticis Fructus (VF) as the dried fruit from Vitex rotundifolia L. used as a traditional medicine for treating inflammation, headache, migraine, chronic bronchitis, eye pain, and gastrointestinal infections has been reported to have antiproliferative effects against various cancer cells, including breast, lung and colorectal cancer cells. However, the molecular mechanisms by which VF mediates the inhibitory effect of the proliferation of cancer cells have not been elucidated in detail. In this study, we investigated the molecular mechanism of VF on the down-regulation of cyclin D1 and CDK4 level associated with cancer cell proliferation. VF suppressed the proliferation of human colorectal cancer cell lines such as HCT116 and SW480. VF induced decrease in cyclin D1 and CDK4 in both protein and mRNA levels. However, the protein levels of cyclin D1 and CDK4 were decreased by VF at an earlier time than the change of mRNA levels; rather it suppressed the expression of cyclin D1 and CDK4 via the proteasomal degradation. In cyclin D1 and CDK4 degradation, we found that Thr286 phosphorylation of cyclin D1 plays a pivotal role in VF-mediated cyclin D1 degradation. Subsequent experiments with several kinase inhibitors suggest that VF-mediated degradation of cyclin D1 may be dependent on GSK3[Formula: see text] and VF-mediated degradation of CDK4 is dependent on ERK1/2, p38 and GSK3[Formula: see text]. In the transcriptional regulation of cyclin D1 and CDK4, we found that VF inhibited Wnt activation associated with cyclin D1 transcriptional regulation through TCF4 down-regulation. In addition, VF treatment down-regulated c-myc expression associated CDK4 transcriptional regulation. Our results suggest that VF has potential to be a candidate for the development of chemoprevention or therapeutic agents for human colorectal cancer.

Inferior J waves in patients with vasospastic angina might be a risk factor for ventricular fibrillation.

Science.gov (United States)

Fumimoto, Tomoko; Ueyama, Takeshi; Shimizu, Akihiko; Yoshiga, Yasuhiro; Ono, Makoto; Kato, Takayoshi; Ishiguchi, Hironori; Okamura, Takayuki; Yamada, Jutaro; Yano, Masafumi

2017-09-01

There is little information about the relationship between J waves and the occurrence of ventricular fibrillation (VF) in patients with vasospastic angina (VSA). The present study aimed to assess the incidence of J waves and the occurrence of VF in patients with VSA. The subjects consisted of 62 patients with VSA diagnosed by acetylcholine provocation tests in our institution from 2002 to 2014. We investigated the VF events, prevalence of J waves, and relationship between the VF events and J waves. J waves were observed in 16 patients (26%) and VF events were documented in 11 (18%). The incidence of VF in the patients with J waves was significantly higher than that in those without J waves (38% vs 11%, p=0.026). J waves were observed in the inferior leads in 14 patients, lateral leads in 5, and anterior leads in 3. A univariate analysis indicated that the incidence of VF in the inferior leads of J wave positive patients (46%=6/14) was significantly (p=0.01) higher than that in the inferior leads of J wave negative patients (10%=5/48). The J waves in the anterior and/or lateral leads were not related to the incidence of VF. Notched type and slurred type J waves were not associated with VF. A multivariate analysis revealed that J waves in VSA patients were associated with VF [odds ratio (OR) 6.41, 95% confidence interval (CI) 1.37-29.93, p=0.02] and organic stenosis (OR 6.98, 95% CI 1.39-35.08, p=0.02). Further, J waves in the inferior leads were strongly correlated with VF (OR 11.85, 95% CI 2.05-68.42, p=0.006). The results suggest that the existence of J waves, especially in the inferior leads, might be a risk factor for VF in VSA patients. Copyright © 2016 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

Normalization of flow-mediated dilation to shear stress area under the curve eliminates the impact of variable hyperemic stimulus.

Science.gov (United States)

Padilla, Jaume; Johnson, Blair D; Newcomer, Sean C; Wilhite, Daniel P; Mickleborough, Timothy D; Fly, Alyce D; Mather, Kieren J; Wallace, Janet P

2008-09-04

Normalization of brachial artery flow-mediated dilation (FMD) to individual shear stress area under the curve (peak FMD:SSAUC ratio) has recently been proposed as an approach to control for the large inter-subject variability in reactive hyperemia-induced shear stress; however, the adoption of this approach among researchers has been slow. The present study was designed to further examine the efficacy of FMD normalization to shear stress in reducing measurement variability. Five different magnitudes of reactive hyperemia-induced shear stress were applied to 20 healthy, physically active young adults (25.3 +/- 0. 6 yrs; 10 men, 10 women) by manipulating forearm cuff occlusion duration: 1, 2, 3, 4, and 5 min, in a randomized order. A venous blood draw was performed for determination of baseline whole blood viscosity and hematocrit. The magnitude of occlusion-induced forearm ischemia was quantified by dual-wavelength near-infrared spectrometry (NIRS). Brachial artery diameters and velocities were obtained via high-resolution ultrasound. The SSAUC was individually calculated for the duration of time-to-peak dilation. One-way repeated measures ANOVA demonstrated distinct magnitudes of occlusion-induced ischemia (volume and peak), hyperemic shear stress, and peak FMD responses (all p index of endothelial function.

Digital Cover Photography for Estimating Leaf Area Index (LAI in Apple Trees Using a Variable Light Extinction Coefficient

Directory of Open Access Journals (Sweden)

Carlos Poblete-Echeverría

2015-01-01

Full Text Available Leaf area index (LAI is one of the key biophysical variables required for crop modeling. Direct LAI measurements are time consuming and difficult to obtain for experimental and commercial fruit orchards. Devices used to estimate LAI have shown considerable errors when compared to ground-truth or destructive measurements, requiring tedious site-specific calibrations. The objective of this study was to test the performance of a modified digital cover photography method to estimate LAI in apple trees using conventional digital photography and instantaneous measurements of incident radiation (Io and transmitted radiation (I through the canopy. Leaf area of 40 single apple trees were measured destructively to obtain real leaf area index (LAID, which was compared with LAI estimated by the proposed digital photography method (LAIM. Results showed that the LAIM was able to estimate LAID with an error of 25% using a constant light extinction coefficient (k = 0.68. However, when k was estimated using an exponential function based on the fraction of foliage cover (ff derived from images, the error was reduced to 18%. Furthermore, when measurements of light intercepted by the canopy (Ic were used as a proxy value for k, the method presented an error of only 9%. These results have shown that by using a proxy k value, estimated by Ic, helped to increase accuracy of LAI estimates using digital cover images for apple trees with different canopy sizes and under field conditions.

Digital cover photography for estimating leaf area index (LAI) in apple trees using a variable light extinction coefficient.

Science.gov (United States)

Poblete-Echeverría, Carlos; Fuentes, Sigfredo; Ortega-Farias, Samuel; Gonzalez-Talice, Jaime; Yuri, Jose Antonio

2015-01-28

Leaf area index (LAI) is one of the key biophysical variables required for crop modeling. Direct LAI measurements are time consuming and difficult to obtain for experimental and commercial fruit orchards. Devices used to estimate LAI have shown considerable errors when compared to ground-truth or destructive measurements, requiring tedious site-specific calibrations. The objective of this study was to test the performance of a modified digital cover photography method to estimate LAI in apple trees using conventional digital photography and instantaneous measurements of incident radiation (Io) and transmitted radiation (I) through the canopy. Leaf area of 40 single apple trees were measured destructively to obtain real leaf area index (LAI(D)), which was compared with LAI estimated by the proposed digital photography method (LAI(M)). Results showed that the LAI(M) was able to estimate LAI(D) with an error of 25% using a constant light extinction coefficient (k = 0.68). However, when k was estimated using an exponential function based on the fraction of foliage cover (f(f)) derived from images, the error was reduced to 18%. Furthermore, when measurements of light intercepted by the canopy (Ic) were used as a proxy value for k, the method presented an error of only 9%. These results have shown that by using a proxy k value, estimated by Ic, helped to increase accuracy of LAI estimates using digital cover images for apple trees with different canopy sizes and under field conditions.

Digital Cover Photography for Estimating Leaf Area Index (LAI) in Apple Trees Using a Variable Light Extinction Coefficient

Science.gov (United States)

Poblete-Echeverría, Carlos; Fuentes, Sigfredo; Ortega-Farias, Samuel; Gonzalez-Talice, Jaime; Yuri, Jose Antonio

2015-01-01

Leaf area index (LAI) is one of the key biophysical variables required for crop modeling. Direct LAI measurements are time consuming and difficult to obtain for experimental and commercial fruit orchards. Devices used to estimate LAI have shown considerable errors when compared to ground-truth or destructive measurements, requiring tedious site-specific calibrations. The objective of this study was to test the performance of a modified digital cover photography method to estimate LAI in apple trees using conventional digital photography and instantaneous measurements of incident radiation (Io) and transmitted radiation (I) through the canopy. Leaf area of 40 single apple trees were measured destructively to obtain real leaf area index (LAID), which was compared with LAI estimated by the proposed digital photography method (LAIM). Results showed that the LAIM was able to estimate LAID with an error of 25% using a constant light extinction coefficient (k = 0.68). However, when k was estimated using an exponential function based on the fraction of foliage cover (ff) derived from images, the error was reduced to 18%. Furthermore, when measurements of light intercepted by the canopy (Ic) were used as a proxy value for k, the method presented an error of only 9%. These results have shown that by using a proxy k value, estimated by Ic, helped to increase accuracy of LAI estimates using digital cover images for apple trees with different canopy sizes and under field conditions. PMID:25635411

Increased variability of watershed areas in patients with high-grade carotid stenosis

DEFF Research Database (Denmark)

Kaczmarz, Stephan; Griese, Vanessa; Preibisch, Christine

2018-01-01

. Despite of high relevance for both clinical diagnostics and research, individual in vivo WSA definition is fairly limited to date. Thus, this study proposes a standardized segmentation approach to delineate individual WSAs by use of time-to-peak (TTP) maps and investigates spatial variability...... of individual WSAs. Methods: We defined individual watershed masks based on relative TTP increases in 30 healthy elderly persons and 28 patients with unilateral, high-grade carotid stenosis, being at risk for watershed-related hemodynamic impairment. Determined WSA location was confirmed by an arterial transit...... time atlas and individual super-selective arterial spin labeling. We compared spatial variability of WSA probability maps between groups and assessed TTP differences between hemispheres in individual and group-average watershed locations. Results: Patients showed significantly higher spatial...

Cardiorespiratory Fitness is a Strong Predictor of the Cardio-ankle Vascular Index in Hypertensive Middle-aged and Elderly Japanese Men.

Science.gov (United States)

Tanisawa, Kumpei; Ito, Tomoko; Sun, Xiaomin; Kawakami, Ryoko; Oshima, Satomi; Gando, Yuko; Cao, Zhen-Bo; Sakamoto, Shizuo; Higuchi, Mitsuru

2015-01-01

This study aimed to examine whether cardiorespiratory fitness (CRF) is associated with arterial stiffening, evaluated using the cardio-ankle vascular index (CAVI), independent of visceral fat (VF) in middle-aged and elderly Japanese men. We also examined whether the relationship between CRF and the CAVI is modified by age and/or hypertension. The CAVI was determined in 157 Japanese men (age range, 30-79 years), including 96 hypertensive subjects (61.1%). CRF was assessed by measuring the peak oxygen uptake (VO2peak). The subjects were divided into low- and high-CRF groups, and the VF area was assessed using magnetic resonance imaging. The VO2peak correlated with the CAVI following adjustment for age and body mass index in the middle-aged and elderly groups (all the subjects: r=-0.285, p＜0.001; middle-aged: r=-0.240, p=0.040; elderly: r=-0.225, p=0.049). VF also correlated with the CAVI (r=0.230, p=0.004). A multiple linear regression analysis revealed that age (β=0.406, pmen.

V. F. Gening and problems of the Volga Bulgaria archaeology

Directory of Open Access Journals (Sweden)

Rudenko Konstantin A.

2014-03-01

Full Text Available V.F. Gening’s contribution to the study of the Volga Bulgaria and his views concerning the history and archaeology of this state formation are considered in the article. His sphere of interest first of all included the links between the Volga Bulgaria population and the tribes belonging to preceding cultures, such as Pyanoborye and Imenkovo ones. V.F. Gening investigated the Bolshie Tarkhany, Turaevo and Rozdestveno burial grounds dated by the 8-9th, 5th and 6-7th centuries A.D., and the materials collected modified the notion of the time and character of the Bulgars arrival in the Volga area. He reconsidered the chronology and interpretation of the archaeological monuments, which referred to the epoch preceding the Bulgars appearance on the Volga, and proposed a hypothesis of the Volga Bulgars as a Turkic-Ugrian ethnos. V.F. Gening created a periodization of the Bolgars history in Eastern Europe within the time span between 1st-3rd centuries AD and the early 13th century AD

Risk factors for predicting visual field progression in Chinese patients with primary open-angle glaucoma: A retrospective study.

Science.gov (United States)

Hung, Kuo-Hsuan; Cheng, Ching-Yu; Liu, Catherine Jui-Ling

2015-07-01

Glaucoma is a leading cause of irreversible blindness worldwide. It is characterized by progressive deterioration of the visual field (VF) that results in a complete loss of vision. This study aimed to determine the risk factors associated with VF progression in Chinese patients with primary open-angle glaucoma (POAG). We reviewed the charts of POAG patients who visited our clinic between July 2009 and June 2010. We included patients with five or more reliable VF tests using the Humphrey Field Analyzer (Humphrey Instruments, San Leandro, CA, USA) during a period of at least 2 years. The scoring system of the Collaborative Initial Glaucoma Treatment Study (CIGTS) was used to code the VF. Progression was defined as an increasing score ≥3, compared to the averaged baseline data. Univariate and multivariate logistic regression analyses were performed to identify the risk factors of VF progression. There were 92 patients (representing 92 eyes) with an average of 8.9 reliable VFs over a mean follow up of 5.4 years. Multivariate logistic regression showed that eyes with more VF tests [odds ratio (OR) = 1.500, p < 0.010] and either increased peak intraocular pressure (IOP) (OR = 1.235, p = 0.044) or a wide IOP range (OR = 1.165, p = 0.041) favored VF progression. High myopia (less than -6.0 D) was not a risk factor (OR = 1.289, p = 0.698) for VF progression in this study. In addition to a greater number of VF tests, Chinese patients with treated POAG who experienced a high peak IOP or a wide range of IOP during follow up were more likely to have VF deterioration. Copyright © 2015. Published by Elsevier Taiwan.

Activation patterns of Purkinje fibers during long-duration ventricular fibrillation in an isolated canine heart model.

Science.gov (United States)

Tabereaux, Paul B; Walcott, Greg P; Rogers, Jack M; Kim, Jong; Dosdall, Derek J; Robertson, Peter G; Killingsworth, Cheryl R; Smith, William M; Ideker, Raymond E

2007-09-04

The roles of Purkinje fibers (PFs) and focal wave fronts, if any, in the maintenance of ventricular fibrillation (VF) are unknown. If PFs are involved in VF maintenance, it should be possible to map wave fronts propagating from PFs into the working ventricular myocardium during VF. If wave fronts ever arise focally during VF, it should be possible to map them appearing de novo. Six canine hearts were isolated, and the left main coronary artery was cannulated and perfused. The left ventricular cavity was exposed, which allowed direct endocardial mapping of the anterior papillary muscle insertion. Nonperfused VF was induced, and 6 segments of data, each 5 seconds long, were analyzed during 10 minutes of VF. During 36 segments of data that were analyzed, 1018 PF or focal wave fronts of activation were identified. In 534 wave fronts, activation was mapped propagating from working ventricular myocardium to PF. In 142 wave fronts, activation was mapped propagating from PF to working ventricular myocardium. In 342 wave fronts, activation was mapped arising focally. More than 1 of these 3 patterns could occur in the same wave front. PFs are highly active throughout the first 10 minutes of VF. In addition to retrograde propagation from the working ventricular myocardium to PFs, antegrade propagation occurs from PFs to working ventricular myocardium, which suggests PFs are important in VF maintenance. Prior plunge needle recordings in dogs indicate activation propagates from the endocardium toward the epicardium after 1 minute of VF, which suggests that focal sites on the endocardium may represent foci and not breakthrough. If so, in addition to reentry, abnormal automaticity or triggered activity may also occur during VF.

The Impact of School Gardening on Cree Children's Knowledge and Attitudes toward Vegetables and Fruit.

Science.gov (United States)

Hanbazaza, Mahitab A; Triador, Lucila; Ball, Geoff D C; Farmer, Anna; Maximova, Katerina; Alexander First Nation; Willows, Noreen D

2015-09-01

School-based interventions may increase children's preferences for vegetables and fruit (V&F). This Canadian study measured changes in Indigenous First Nations schoolchildren's V&F knowledge, preferences, and home consumption following the implementation of a gardening and V&F snack program. At baseline, 7 months, and 18 months, children in grades 1-6 (i) listed at least 5 V&F they knew, (ii) tasted and indicated their preferences towards 9 vegetables and 8 fruit using a 6-point Likert scale, and (iii) indicated their home consumption of 17 V&F. At all 3 time points, 56.8% (n = 66/116) of children provided data. Children listed a greater number of V&F at 18 months (4.9 ± 0.1) than at baseline (4.5 ± 1.0) or 7 months (4.7 ± .07) (F(1.6,105.6) = 6.225, P < 0.05). Vegetable preferences became more positive between baseline (37.9 ± 9.3) and 7 months (39.9 ± 9.2), but returned to baseline levels at 18 months (37.3 ± 8.7) (F(1.6,105.8) = 4.581, P < 0.05). Fruit preferences at 18 months (42.7 ± 3.0) were greater than at baseline (41.1 ± 4.3) and at 7 months (41.9 ± 5.1) (F(1.7,113.3) = 3.409, P < 0.05). No change in V&F consumption occurred at home. Despite improvements in V&F knowledge and preferences, home consumption of V&F did not occur. Complementing school-based programs with home-based components may be needed to influence V&F intake of children.

Polyphenol content and glycemic load of pasta enriched with Faba bean flour

Directory of Open Access Journals (Sweden)

Imma Turco

2016-05-01

Full Text Available Background: Legumes contain elevated levels of health functional components. The objective of the present paper was to evaluate the nutritional properties and the post-prandial glycaemic responses of pasta obtained using 35% Vicia Faba (VF bean flour, which is an important source of fiber and phytochemical compounds. Results: Protein and fiber content were higher in VF pasta compared with durum wheat semolina (DWS pasta. The total phenol content in VF pasta was about two fold higher compared to that of DWS pasta. A higher total flavonoid content, higher antioxidant activity against peroxyl radicals evaluated by oxygen radical absorbance capacity (ORAC assay was also observed in VF pasta. The comparison of post-prandial increase of glucose after VF intake or DWS demonstrated significant differences and VF pasta exhibited a lower glycemic index value, a lower glycemic load and higher glycemic profile compared with DWS pasta. Conclusion: The results suggest that enrichment with 35% Vicia faba bean has potential health benefits and that VF flour can be used as an ingredient to prepare added-value products.

Addressing the role of earthworms in treating domestic wastewater by analyzing biofilm modification through chemical and spectroscopic methods.

Science.gov (United States)

Wang, Yin; Xing, Mei-Yan; Yang, Jian; Lu, Biao

2016-03-01

Vermifiltration eco-friendly system is an alternative and low-cost artificial ecosystem for decentralized wastewater treatment and excess sludge reduction. The biofilm characteristics of a vermifilter (VF) with earthworms, Eisenia fetida, for domestic wastewater treatment were studied. A conventional biofilter (BF) without earthworms served as the control. Pore number in VF biofilm was significantly more than BF biofilm, and VF biofilm showed a better level-administrative structure through scanning electron microscope. VF biofilms had lower levels of protein and polysaccharide, but phosphoric acids and humic acid showed the opposite results. Furthermore, in the presence of earthworms, VF biofilms contained higher total organic carbon (TOC) percentage composition in the condition of less volatile suspended substances (VSS) contents. Dehydrogenase activity (DHA) and adenosine triphosphate (ATP) contents along VF showed better results than BF by increment of 12.84 ∼ 16.46 %. Overall findings indicated that the earthworms' presence remarkably decreases biofilm contests but increases enzyme activity and improves the community structure of VF biofilms, which is beneficial for the wastewater disposal.

A fundamental study of a variable critical nozzle flow

International Nuclear Information System (INIS)

Kim, Jea Hyung; Kim, Heuy Dong; Park, Kyung Am

2003-01-01

The mass flow rate of gas flow through critical nozzle depends on the nozzle supply conditions and the cross-sectional area at the nozzle throat. In order that the critical nozzle can be operated at a wide range of supply conditions, the nozzle throat diameter should be controlled to change the flow passage area. This can be achieved by means of a variable critical nozzle. In the present study, both experimental and computational works are performed to develop variable critical nozzle. A cone-cylinder with a diameter of d is inserted into conventional critical nozzle. It can move both upstream and downstream, thereby changing the cross-sectional area of the nozzle throat. Computational work using the axisymmetric, compressible Navier-Stokes equations is carried out to simulate the variable critical nozzle flow. An experiment is performed to measure the mass flow rate through variable critical nozzle. The present computational results are in close agreement with measured ones. The boundary layer displacement and momentum thickness are given as a function of Reynolds number. An empirical equation is obtained to predict the discharge coefficient of variable critical nozzle

Epidemiology and genetics of ventricular fibrillation during acute myocardial infarction

DEFF Research Database (Denmark)

Glinge, Charlotte; Sattler, Stefan; Jabbari, Reza

2016-01-01

of a family member is a risk factor for SCD and VF during acute myocardial infarction (MI), independent of traditional risk factors including family history of MI, suggesting a genetic component in the susceptibility to VF. To prevent SCD and VF due to MI, we need a better understanding of the genetic...... and molecular mechanisms causing VF in this apparently healthy population. Even though new insights and technologies have become available, the genetic predisposition to VF during MI remains poorly understood. Findings from a variety of different genetic studies have failed to reach reproducibility, although...... several genetic variants, both common and rare variants, have been associated to either VF or SCD. For this review, we searched PubMed for potentially relevant articles, using the following MeSH-terms: "sudden cardiac death", "ventricular fibrillation", "out-of-hospital cardiac arrest", "myocardial...

Groundwater level responses to precipitation variability in Mediterranean insular aquifers

Science.gov (United States)

Lorenzo-Lacruz, Jorge; Garcia, Celso; Morán-Tejeda, Enrique

2017-09-01

Groundwater is one of the largest and most important sources of fresh water on many regions under Mediterranean climate conditions, which are exposed to large precipitation variability that includes frequent meteorological drought episodes, and present high evapotranspiration rates and water demand during the dry season. The dependence on groundwater increases in those areas with predominant permeable lithologies, contributing to aquifer recharge and the abundance of ephemeral streams. The increasing pressure of tourism on water resources in many Mediterranean coastal areas, and uncertainty related to future precipitation and water availability, make it urgent to understand the spatio-temporal response of groundwater bodies to precipitation variability, if sustainable use of the resource is to be achieved. We present an assessment of the response of aquifers to precipitation variability based on correlations between the Standardized Precipitation Index (SPI) at various time scales and the Standardized Groundwater Index (SGI) across a Mediterranean island. We detected three main responses of aquifers to accumulated precipitation anomalies: (i) at short time scales of the SPI (24 months). The differing responses were mainly explained by differences in lithology and the percentage of highly permeable rock strata in the aquifer recharge areas. We also identified differences in the months and seasons when aquifer storages are more dependent on precipitation; these were related to climate seasonality and the degree of aquifer exploitation or underground water extraction. The recharge of some aquifers, especially in mountainous areas, is related to precipitation variability within a limited spatial extent, whereas for aquifers located in the plains, precipitation variability influence much larger areas; the topography and geological structure of the island explain these differences. Results indicate large spatial variability in the response of aquifers to precipitation in

Estimating variability in placido-based topographic systems.

Science.gov (United States)

Kounis, George A; Tsilimbaris, Miltiadis K; Kymionis, George D; Ginis, Harilaos S; Pallikaris, Ioannis G

2007-10-01

To describe a new software tool for the detailed presentation of corneal topography measurements variability by means of color-coded maps. Software was developed in Visual Basic to analyze and process a series of 10 consecutive measurements obtained by a topographic system on calibration spheres, and individuals with emmetropic, low, high, and irregular astigmatic corneas. Corneal surface was segmented into 1200 segments and the coefficient of variance of each segment's keratometric dioptric power was used as the measure of variability. The results were presented graphically in color-coded maps (Variability Maps). Two topographic systems, the TechnoMed C-Scan and the TOMEY Topographic Modeling System (TMS-2N), were examined to demonstrate our method. Graphic representation of coefficient of variance offered a detailed representation of examination variability both in calibration surfaces and human corneas. It was easy to recognize an increase in variability, as the irregularity of examination surfaces increased. In individuals with high and irregular astigmatism, a variability pattern correlated with the pattern of corneal topography: steeper corneal areas possessed higher variability values compared with flatter areas of the same cornea. Numerical data permitted direct comparisons and statistical analysis. We propose a method that permits a detailed evaluation of the variability of corneal topography measurements. The representation of the results both graphically and quantitatively improves interpretability and facilitates a spatial correlation of variability maps with original topography maps. Given the popularity of topography based custom refractive ablations of the cornea, it is possible that variability maps may assist clinicians in the evaluation of corneal topography maps of patients with very irregular corneas, before custom ablation procedures.

Variability of pesticide residues in cauliflower units collected from a field trial and market places in Greece.

Science.gov (United States)

Prodhan, M D H; Papadakis, Emmanouil-N; Papadopoulou-Mourkidou, Euphemia

2016-09-01

To estimate the variability of pesticide residue levels present in cauliflower units, a total of 142 samples were collected from a field trial of a cooperative farmer, and 120 samples were collected from different market places in Thessaloniki, Greece. The collected samples were extracted using the quick, easy, cheap, effective, rugged, and safe (QuEChERS) extraction technique, and the residues were determined by liquid chromatography-tandem mass spectrometry. The developed method was validated by evaluating the accuracy, precision, linearity, limit of detection (LOD), and limit of quantification (LOQ). The average recoveries for all the analytes, derived from the data of control samples fortified at 0.01, 0.05, 0.1, and 0.2 mg/kg, ranged from 74 to 110% with a relative standard deviation of ≤8%. The correlation coefficient (R(2)) was ≥0.997 for all the analytes using matrix-matched calibration standards. The LOD values ranged from 0.001 to 0.003 mg/kg, and the LOQ was determined at 0.01 mg/kg for all the sought analytes. The matrix effect was found to be at a considerable level, especially for cypermethrin and deltamethrin, amounting to +90% and +145%, respectively. For the field samples, the unit-to-unit variability factors (VFs) calculated for cypermethrin and deltamethrin were 2.38 and 2.32, respectively, while the average VF for the market basket samples was 5.11. In the market basket samples, residues of cypermethrin, deltamethrin, chlorpyrifos, and indoxacarb were found at levels ≥LOQ and their respective VFs were 7.12, 5.67, 5.28, and 2.40.

Between-centre variability versus variability over time in DXA whole body measurements evaluated using a whole body phantom

Energy Technology Data Exchange (ETDEWEB)

Louis, Olivia [Department of Radiology, AZ-VUB, Vrije Universiteit Brussel, Laarbeeklaan 101, 1090 Brussel (Belgium)]. E-mail: olivia.louis@az.vub.ac.be; Verlinde, Siska [Belgian Study Group for Pediatric Endocrinology (Belgium); Thomas, Muriel [Belgian Study Group for Pediatric Endocrinology (Belgium); De Schepper, Jean [Department of Pediatrics, AZ-VUB, Vrije Universiteit Brussel, Laarbeeklaan 101, 1090 Brussel (Belgium)

2006-06-15

This study aimed to compare the variability of whole body measurements, using dual energy X-ray absorptiometry (DXA), among geographically distinct centres versus that over time in a given centre. A Hologic-designed 28 kg modular whole body phantom was used, including high density polyethylene, gray polyvinylchloride and aluminium. It was scanned on seven Hologic QDR 4500 DXA devices, located in seven centres and was also repeatedly (n = 18) scanned in the reference centre, over a time span of 5 months. The mean between-centre coefficient of variation (CV) ranged from 2.0 (lean mass) to 5.6% (fat mass) while the mean within-centre CV ranged from 0.3 (total mass) to 4.7% (total area). Between-centre variability compared well with within-centre variability for total area, bone mineral content and bone mineral density, but was significantly higher for fat (p < 0.001), lean (p < 0.005) and total mass (p < 0.001). Our results suggest that, even when using the same device, the between-centre variability remains a matter of concern, particularly where body composition is concerned.

Application of Boost Converter to Increase the Speed Range of Dual-stator Winding Induction Generator in Wind Power Systems

DEFF Research Database (Denmark)

Kavousi, Ayoub; Fathi, S. Hamid; Milimonfared, Jafar

2018-01-01

In this paper, a topology using a Dual-stator Winding Induction Generator (DWIG) and a boost converter is proposed for the variable speed wind power application. At low rotor speeds, the generator saturation limits the voltage of the DWIG. Using a boost converter, higher DC voltage can be produced...... while the DWIG operates at Maximum Power Point Tracking (MPPT) even at low speed and low voltage conditions. Semiconductor Excitation Controller (SEC) of the DWIG utilizes Control-Winding Voltage Oriented Control (CWVOC) method to adjust the voltage, considering V/f characteristics. For the proposed...... topology, the SEC capacity and the excitation capacitor is optimized by analyzing the SEC reactive current considering wind turbine power-speed curve, V/f strategy, and the generator parameters. The method shows that the per-unit capacity of the SEC can be limited to the inverse of DWIG magnetizing...

Computational study of variable area ejector rocket flowfields

Science.gov (United States)

Etele, Jason

Access to space has always been a scientific priority for countries which can afford the prohibitive costs associated with launch. However, the large scale exploitation of space by the business community will require the cost of placing payloads into orbit be dramatically reduced for space to become a truly profitable commodity. To this end, this work focuses on a next generation propulsive technology called the Rocket Based Combined Cycle (RBCC) engine in which rocket, ejector, ramjet, and scramjet cycles operate within the same engine environment. Using an in house numerical code solving the axisymmetric version of the Favre averaged Navier Stokes equations (including the Wilcox ko turbulence model with dilatational dissipation) a systematic study of various ejector designs within an RBCC engine is undertaken. It is shown that by using a central rocket placed along the axisymmetric axis in combination with an annular rocket placed along the outer wall of the ejector, one can obtain compression ratios of approximately 2.5 for the case where both the entrained air and rocket exhaust mass flows are equal. Further, it is shown that constricting the exit area, and the manner in which this constriction is performed, has a significant positive impact on the compression ratio. For a decrease in area of 25% a purely conical ejector can increase the compression ratio by an additional 23% compared to an equal length unconstricted ejector. The use of a more sharply angled conical section followed by a cylindrical section to maintain equivalent ejector lengths can further increase the compression ratio by 5--7% for a total increase of approximately 30%.

Homonymous Visual Field Loss and Its Impact on Visual Exploration: A Supermarket Study.

Science.gov (United States)

Kasneci, Enkelejda; Sippel, Katrin; Heister, Martin; Aehling, Katrin; Rosenstiel, Wolfgang; Schiefer, Ulrich; Papageorgiou, Elena

2014-10-01

Homonymous visual field defects (HVFDs) may critically interfere with quality of life. The aim of this study was to assess the impact of HVFDs on a supermarket search task and to investigate the influence of visual search on task performance. Ten patients with HVFDs (four with a right-sided [HR] and six with a left-sided defect [HL]), and 10 healthy-sighted, sex-, and age-matched control subjects were asked to collect 20 products placed on two supermarket shelves as quickly as possible. Task performance was rated as "passed" or "failed" with regard to the time per correctly collected item ( T C -failed = 4.84 seconds based on the performance of healthy subjects). Eye movements were analyzed regarding the horizontal gaze activity, glance frequency, and glance proportion for different VF areas. Seven of 10 HVFD patients (three HR, four HL) passed the supermarket search task. Patients who passed needed significantly less time per correctly collected item and looked more frequently toward the VFD area than patients who failed. HL patients who passed the test showed a higher percentage of glances beyond the 60° VF ( P < 0.05). A considerable number of HVFD patients performed successfully and could compensate for the HVFD by shifting the gaze toward the peripheral VF and the VFD area. These findings provide new insights on gaze adaptations in patients with HVFDs during activities of daily living and will enhance the design and development of realistic examination tools for use in the clinical setting to improve daily functioning. (http://www.clinicaltrials.gov, NCT01372319, NCT01372332).

Vocal Tract Adjustments of Dysphonic and Non-Dysphonic Women Pre- and Post-Flexible Resonance Tube in Water Exercise: A Quantitative MRI Study.

Science.gov (United States)

Yamasaki, Rosiane; Murano, Emi Z; Gebrim, Eloisa; Hachiya, Adriana; Montagnoli, Arlindo; Behlau, Mara; Tsuji, Domingos

2017-07-01

To compare vocal tract (VT) adjustments of dysphonic and non-dysphonic women before and after flexible resonance tube in water exercise (FRTWE) at rest and during phonation using magnetic resonance imaging. Prospective study. Twenty women, aged 20-40 years, 10 dysphonic with vocal nodules (VNG) and 10 controls (CG), underwent four sets of sagittal VT MRI: two pre-FRTWE, at rest and during phonation, and two post-FRTWE, during phonation and at rest. The subjects performed 3 minutes of exercise. Nine parameters at rest and 21 during phonation were performed. Pre-FRTWE, eight significant differences were found, three at rest and five during phonation: at rest - laryngeal vestibule area, distance from epiglottis to pharyngeal posterior wall (PPW) and interarytenoid complex length were smaller in the VNG; during phonation - laryngeal vestibule area, angle between PPW and vocal fold (VF), epiglottis to PPW, and anterior commissure of the larynx to laryngeal posterior wall were smaller in the VNG; tongue area was larger in the VNG. Post-FRTWE, only three significant differences were found, two during phonation and one at rest: during phonation - angle between PPW and VF and the membranous portion of the VF length were smaller in the VNG; at rest - distance from epiglottis to PPW was smaller in the VNG. Results suggest that the habitual VT adjustments of dysphonic and non-dysphonic women are different at rest and during phonation. The FRTWE promoted positive VT changes in the VNG, reducing the intergroup differences. Copyright © 2017 The Voice Foundation. Published by Elsevier Inc. All rights reserved.

Variable area manifolds for ring mirror heat exchangers

Science.gov (United States)

Eng, Albert; Senterfitt, Donald R.

1988-05-01

A laser ring mirror assembly is disclosed which supports and cools an annular ring mirror of a high powered laser with a cooling manifold which has a coolant flow design which is intended to reduce thermal distortions of the ring mirror by minimizing azimuthal variations in temperature around its circumference. The cooling manifold has complementary pairs of cooling passages each of which conduct coolant in opposite flow directions. The manifold also houses adjusters which vary the depth between the annular ring mirror and each cooling, and which vary the flow area of the cooling passage to produce a control over the cooling characteristics of the cooling manifold.

Chromatic Multifocal Pupillometer for Objective Perimetry and Diagnosis of Patients with Retinitis Pigmentosa.

Science.gov (United States)

Chibel, Ron; Sher, Ifat; Ben Ner, Daniel; Mhajna, Mohamad O; Achiron, Asaf; Hajyahia, Soad; Skaat, Alon; Berchenko, Yakir; Oberman, Bernice; Kalter-Leibovici, Ofra; Freedman, Laurence; Rotenstreich, Ygal

2016-09-01

To assess visual field (VF) defects and retinal function objectively in healthy participants and patients with retinitis pigmentosa (RP) using a chromatic multifocal pupillometer. Cross-sectional study. The right eyes of 16 healthy participants and 13 RP patients. Pupil responses to red and blue light (peak, 485 and 625 nm, respectively) presented by 76 light-emitting diodes, 1.8-mm spot size at different locations of a 16.2° VF were recorded. Subjective VFs of RP patients were determined using chromatic dark-adapted Goldmann VFs (CDA-GVFs). Six healthy participants underwent 2 pupillometer examinations to determine test-retest reliability. Three parameters of pupil contraction were determined automatically: percentage of change of pupil size (PPC), maximum contraction velocity (MCV; in pixels per second), and latency of MCV (LMCV; in seconds). The fraction of functional VF was determined by CDA-GVF. In healthy participants, higher PPC and MCV were measured in response to blue compared with red light. The LMCV in response to blue light was relatively constant throughout the VF. Healthy participants demonstrated higher PPC and MCV and shorter LMCV in central compared with peripheral test points in response to red light. Test-retest correlation coefficients were 0.7 for PPC and 0.5 for MCV. In RP patients, test point in which the PPC and MCV were lower than 4 standard errors from the mean of healthy participants correlated with areas that were indicated as nonseeing by CDA-GVF. The mean absolute deviation in LMCV parameter in response to the red light between different test point was significantly higher in RP patients (range, 0.16-0.47) than in healthy participants (range, 0.02-0.16; P chromatic multifocal pupillometer for objective diagnosis of RP and assessment of VF defects. Copyright © 2016 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

The role of the accessory pathway radiofrequency catheter ablation in the secondary prevention of the malignant tachyarrhythmias in patients with Wolff-Parkinson-White syndrome

Directory of Open Access Journals (Sweden)

Mujović Nebojša

2010-01-01

Full Text Available Background/Aim. The occurrence of atrial fibrillation (AF in the presence of an accessory pathway (AP that conducts rapidly is potentially lethal because the rapid ventricular response may lead to ventricular fibrillation (VF. The aim of the study was to determine long-term efficacy of AP catheter-ablation using radiofrequency (RF current in secondary prevention of VF in WPW patients. Methods. Study included a total of 192 symptomatic WPW patients who underwent RF catheter-ablation of AP in our institution from 1994 to 2007 and were available for clinical follow-up for more than 3 months after procedure. Results. Before ablation, VF was recorded in total of 27 patients (14.1%. In 14 of patients (51.9% VF was the first clinical manifestation of WPW syndrome. A total of 35 VF episodes were identified in 27 patients. The occurrence of VF was preceded by physical activity or emotional stress in 17.1% of cases, by alcohol abuse in 2.9% and by inappropriate intravenous drug administration in 28.6%. In addition, no clear precipitating factor was identified in 40% of VF cases, while informations about activities preceding 11.4% of VF episodes were not available. The follow-up of 5.7 ± 3.3 years was obtained in all of 27 VF patients. Of the 20 patients who underwent successful AP ablation, all were alive, without syncope or ventricular tachyarrhythmias during long-term follow-up. In 4 of 7 unsuccessfully treated patients, recurrence of supraventricular tachycardia and/or preexcited atrial fibrillation were recorded; one of these patients suddenly died of VF, 6 years after procedure. Conclusion. In significant proportion of WPW patients, VF was the first clinical manifestation of WPW syndrome, often precipitated by physical activity, emotional stress or inappropriate drug administration. Successful elimination of AP by percutaneous RF catheter-ablation is highly effective in secondary prevention of life-threatening tachyarrhythmias in patients with

Species richness, area and climate correlates

DEFF Research Database (Denmark)

Nogues, David Bravo; Bastos Araujo, Miguel

2006-01-01

affects: (1) the selection of climate variables entering a species richness model; and (2) the accuracy of models in predicting species richness in unsampled grid cells. Location Western Europe. Methods Models are developed for European plant, breeding bird, mammal and herptile species richness using...... seven climate variables. Generalized additive models are used to relate species richness, climate and area. Results We found that variation in the grid cell area was large (50 × 50 km: 8-3311 km2; 220 × 220: 193-55,100 km2), but this did not affect the selection of variables in the models. Similarly...... support the assumption that variation in near-equal area cells may be of second-order importance for models explaining or predicting species richness in relation to climate, although there is a possibility that drops in accuracy might increase with grid cell size. The results are, however, contingent...

Dicty_cDB: VFK250 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VF (Link to library) VFK250 (Link to dictyBase) - - - Contig-U13825-1 VFK250P (Link to Original site) VFK2...50F 647 VFK250Z 679 VFK250P 1306 - - Show VFK250 Library VF (Link to library) Clone ID VFK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-C/VFK250Q.Seq.d/ Representative seq. ID VFK2...50P (Link to Original site) Representative DNA sequence >VFK250 (VFK250Q) /CSM/VF/VFK2-C/VFK2...re E Sequences producing significant alignments: (bits) Value VFK250 (VFK250Q) /CSM/VF/VFK2-C/VFK250Q.Seq.d/

Early Ventricular Tachycardia or Fibrillation in Patients With ST Elevation Myocardial Infarction Undergoing Primary Percutaneous Coronary Intervention and Impact on Mortality and Stent Thrombosis (from the Harmonizing Outcomes with Revascularization and Stents in Acute Myocardial Infarction Trial).

Science.gov (United States)

Kosmidou, Ioanna; Embacher, Monica; McAndrew, Thomas; Dizon, José M; Mehran, Roxana; Ben-Yehuda, Ori; Mintz, Gary S; Stone, Gregg W

2017-11-15

The prevalence and impact of early ventricular arrhythmias (ventricular tachycardia [VT]/ventricular fibrillation [VF]) occurring before mechanical revascularization for acute ST segment elevation myocardial infarction (STEMI) treated with percutaneous coronary intervention are poorly understood. We sought to investigate the association between early VT/VF and long-term clinical outcomes using data from the Harmonizing Outcomes with Revascularization and Stents in Acute Myocardial Infarction trial. Among 3,602 patients with STEMI, 108 patients (3.0%) had early VT/VF. Baseline clinical characteristics were similar in patients with versus without early VT/VF. Patients with early VT/VF had shorter symptom-to-balloon times and lower left ventricular ejection fraction and underwent more frequent thrombectomy compared with patients without early VT/VF. Adjusted 3-year rates of all-cause death (15.7% vs 6.5%; adjusted hazard ratio 2.62, 95% confidence interval 1.48 to 4.61, p stent thrombosis (13.7% vs 5.7%; adjusted hazard ratio 2.74, 95% confidence interval 1.52 to 4.93, p Stents in Acute Myocardial Infarction trial, VT/VF occurring before coronary angiography and revascularization in patients with STEMI was strongly associated with increased 3-year rates of death and stent thrombosis. Further investigation into the mechanisms underlying the increased risk of early stent thrombosis in patients with early VT/VF is required. Copyright © 2017 Elsevier Inc. All rights reserved.

Altitude Performance Characteristics of Turbojet-engine Tail-pipe Burner with Variable-area Exhaust Nozzle Using Several Fuel Systems and Flame Holders

Science.gov (United States)

Johnson, Lavern A; Meyer, Carl L

1950-01-01

A tail-pipe burner with a variable-area exhaust nozzle was investigated. From five configurations a fuel-distribution system and a flame holder were selected. The best configuration was investigated over a range of altitudes and flight Mach numbers. For the best configuration, an increase in altitude lowered the augmented thrust ratio, exhaust-gas total temperature, and tail-pipe combustion efficiency, and raised the specific fuel consumption. An increase in flight Mach number raised the augmented thrust ratio but had no apparent effect on exhaust-gas total temperature, tail-pipe combustion efficiency, or specific fuel consumption.

Variability of vascular CT measurement techniques used in the assessment abdominal aortic aneurysms

International Nuclear Information System (INIS)

England, Andrew; Niker, Amanda; Redmond, Claire

2010-01-01

Purpose: The aim of this project is to assess the variability of six CT measurement techniques for sizing abdominal aortic aneurysms (AAAs). Method: 37 CT scans with known AAAs were loaded on to a departmental picture archiving and communication system (PACS). A team of three observers, with experience in aortic CT measurements and the PACS performed a series of 2D and 3D measurements on the abdominal aorta. Each observer was asked to measure 3 quantities; anterior-posterior AAA diameter, maximum oblique AAA diameter, maximum aneurysm area using both 2D and 3D techniques. In order to test intra-observer variability each observer was asked to repeat their measurements. All measurements were taken using electronic callipers, under standardised viewing conditions using previously calibrated equipment. 3D measurements were conducted using a computer generated central luminal line (CLL). All measurements for this group were taken perpendicular to the CLL. Results: A total of 972 independent measurements were recorded by three observers. Mean intra-observer variability was lower for 2D diameter measurements (AP 1.3 ± 1.6 mm; 2D Oblique 1.2 ± 1.3 mm) and 2D areas (0.7 ± 1.3 cm 2 ) when compared to inter-observer variability (AP 1.7 ± 1.9 mm; Oblique 1.6 ± 1.7 mm; area 1.1 ± 1.5 cm 2 ). When comparing 2D with 3D measurements, differences were comparable except for 3D AP diameter and area which had lower inter-observer variability than their 2D counterparts (AP 2D 1.7 ± 1.9 mm, 3D 1.3 ± 1.3 mm; area 2D 1.1 ± 1.5 cm 2 , 3D 0.7 ± 0.7 cm 2 ). 3D area measurement was the only technique which had equal variability for intra- and inter-observer measurements. Overall observer variability for the study was good with 94-100% of all paired measurements within 5.00 mm/cm 2 or less. Using Pitman's test it can be confirmed that area measurements in the 3D plane have the least variability (r = 0.031) and 3D oblique measurements have the highest variability (r = 0

Beta-Zone parapapillary atrophy and the velocity of glaucoma progression.

Science.gov (United States)

Teng, Christopher C; De Moraes, Carlos Gustavo V; Prata, Tiago S; Tello, Celso; Ritch, Robert; Liebmann, Jeffrey M

2010-05-01

Beta-Zone parapapillary atrophy (PPA) occurs more commonly in eyes with glaucoma. Rates of glaucomatous visual field (VF) progression in eyes with and without beta-zone PPA at the time of baseline assessment were compared. Retrospective, comparative study. Two hundred forty-five patients from the New York Glaucoma Progression Study. Subjects with glaucomatous optic neuropathy and repeatable VF loss were assessed for eligibility. Eyes with a Heidelberg Retina Tomograph II (HRT) examination, at least 5 visual field tests after the HRT in either eye, optic disc photographs, and Zone PPA was defined as a region of chorioretinal atrophy with visible sclera and choroidal vessels adjacent to the optic disc. Global rates of VF progression were determined by automated pointwise linear regression analysis. Univariate analysis included age, gender, ethnicity, central corneal thickness (CCT), refractive error, baseline mean deviation, baseline intraocular pressure (IOP), mean IOP, IOP fluctuation, disc area, rim area, rim area-to-disc area ratio, beta-zone PPA area, beta-zone PPA area-to-disc area ratio, and presence or absence of beta-zone PPA. The relationship between beta-zone PPA and the rate and risk of glaucoma progression. Two hundred forty-five eyes of 245 patients (mean age, 69.6+/-12.3 years) were enrolled. The mean follow-up was 4.9+/-1.4 years and the mean number of VFs after HRT was 9.3+/-2.7. beta-Zone PPA was present in 146 eyes (65%). Eyes with beta-zone PPA progressed more rapidly (-0.84+/-0.8 dB/year) than eyes without it (-0.51+/-0.6 dB/year; Pzone PPA (HR, 2.59; P1.5 dB/year; P = 0.08) global rates of progression occurred more commonly in eyes with beta-zone PPA than in eyes without it. Thinner CCT (zone PPA (kappa = 0.13). Eyes with beta-zone PPA are at increased risk for glaucoma progression and warrant close clinical surveillance. Copyright 2010 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Salivary adiponectin concentration in healthy adult males in relation to anthropometric measures and fat distribution

Directory of Open Access Journals (Sweden)

Abdalla Mona Mohamed Ibrahim

2017-10-01

Full Text Available Objectives. Body fat content, fat distribution, and adiponectin level are important variables in the development of obesity related complications. Anthropometric indices may provide an economic and faster method in measuring the risk for complications through their predictive effect of fat distribution and adiponectin concentration. We aimed to determine, which of the waist circumference (WC, waist-to-hip ratio (WHR, and body mass index (BMI may be the best predictor for the total fat percentage (WF, visceral fat level (VF, and subcutaneous whole-body fat (SCWBF. We aimed also to investigate the potential use of the anthropometric measures and fat distribution as predictors for the salivary adiponectin level in the healthy adult males. Subjects. A total of 88 adult males aged between 18−25 years with a wide range of BMI were studied. Anthropometric indices were measured using standardized methods and salivary adiponectin level was assessed using an enzyme-linked immunosorbent assay. Results. In path analysis of the Structural Equation Model (SEM using IBM@SPSS AMOS, version22, BMI and WC, but not WHR, were strong predictors for WF and SCWBF (p<0.05. BMI but not WC was a strong predictor for VF (p<0.001. WF was strong predictor for SCWBF (p<0.001, but not for VF. BMI, WC, WHR, WF, VF, and SCWBF were poor predictors of the salivary adiponectin level. Conclusion. BMI is the best predictor for the total body fat and fat distribution. However, WHR seems to be of a little value and the salivary adiponectin level independent of BMI and body fat in healthy adult Malay males.

Variability in oocyte size and batch fecundity in anchoveta (Engraulis ringens, Jenyns 1842 from two spawning areas off the Chilean coast

Directory of Open Access Journals (Sweden)

Elson M. Leal

2009-03-01

Full Text Available Utilising histological preparations of ovaries from Engraulis ringens females collected in two contrasting spawning habitats along the Chilean coast, we assess the variability in oocyte size and batch fecundity during the peak spawning seasons in three years. The effects of female size (length and weight, batch fecundity and mean sea surface temperature on oocyte size were also examined. Results showed larger oocytes and lower batch fecundity in females from the southern area. Oocyte volume differences persisted inter-annually and were not explained by differences in female sizes. Since ovary weight was similar between areas, the cost of producing larger oocytes in the south population seems to be a fecundity reduction. The latitudinal variations in oocyte number and size seem to be determined by the predominant environmental conditions in each habitat. Hence, female E. ringens seem to adapt their reproductive tactics by producing eggs sizes and quantities that favour survival of their offspring under the environmental conditions in which they are to develop.

Visual field examination in children with brain disorders

NARCIS (Netherlands)

Koenraads, Y

2016-01-01

The aim of this thesis is to gain more insight in the diagnostic and prognostic implications of visual field (VF) examination in children with brain disorders. Several aspects of VF examination in children with brain disorders were evaluated: All VF examinations that were performed with the

Climate change, variability and extreme events : risk assessment and management strategies in a Peach cultivated area in Italy.

Science.gov (United States)

Alfieri, Silvia Maria; De Lorenzi, Francesca; Basile, Angelo; Bonfante, Antonello; Missere, Daniele; Menenti, Massimo

2014-05-01

Climate change in Mediterranean area is likely to reduce precipitation amounts and to increase temperature thus affecting the timing of development stages and the productivity of crops. Further, extreme weather events are expected to increase in the future leading to significant increase in agricultural risk. Some strategies for effectively managing risks and adapting to climate change involve adjustments to irrigation management and use of different varieties. We quantified the risk on Peach production in an irrigated area of "Emilia Romagna" region ( Italy) taking into account the impact on crop yield due to climate change and variability and to extreme weather events as well as the ability of the agricultural system to modulate this impact (adaptive capacity) through changes in water and crop management. We have focused on climatic events causing insufficient water supply to crops, while taking into account the effect of climate on the duration and timing of phenological stages. Further, extreme maximum and minimum temperature events causing significant reduction of crop yield have been considered using phase-specific critical temperatures. In our study risk was assessed as the product of the probability of a damaging event (hazard), such as drought or extreme temperatures, and the estimated impact of such an event (vulnerability). To estimate vulnerability we took into account the possible options to reduce risk, by combining estimates of the sensitivity of the system (negative impact on crop yield) and its adaptive capacity. The latter was evaluated as the relative improvement due to alternate management options: the use of alternate varieties or the changes in irrigation management. Vulnerability was quantified using cultivar-specific thermal and hydrologic requirements of a set of cultivars determined by experimental data and from scientific literature. Critical temperatures determining a certain reduction of crop yield have been estimated and used to assess

Small area estimation for semicontinuous data.

Science.gov (United States)

Chandra, Hukum; Chambers, Ray

2016-03-01

Survey data often contain measurements for variables that are semicontinuous in nature, i.e. they either take a single fixed value (we assume this is zero) or they have a continuous, often skewed, distribution on the positive real line. Standard methods for small area estimation (SAE) based on the use of linear mixed models can be inefficient for such variables. We discuss SAE techniques for semicontinuous variables under a two part random effects model that allows for the presence of excess zeros as well as the skewed nature of the nonzero values of the response variable. In particular, we first model the excess zeros via a generalized linear mixed model fitted to the probability of a nonzero, i.e. strictly positive, value being observed, and then model the response, given that it is strictly positive, using a linear mixed model fitted on the logarithmic scale. Empirical results suggest that the proposed method leads to efficient small area estimates for semicontinuous data of this type. We also propose a parametric bootstrap method to estimate the MSE of the proposed small area estimator. These bootstrap estimates of the MSE are compared to the true MSE in a simulation study. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Internal variability of fine-scale components of meteorological fields in extended-range limited-area model simulations with atmospheric and surface nudging

Science.gov (United States)

Separovic, Leo; Husain, Syed Zahid; Yu, Wei

2015-09-01

Internal variability (IV) in dynamical downscaling with limited-area models (LAMs) represents a source of error inherent to the downscaled fields, which originates from the sensitive dependence of the models to arbitrarily small modifications. If IV is large it may impose the need for probabilistic verification of the downscaled information. Atmospheric spectral nudging (ASN) can reduce IV in LAMs as it constrains the large-scale components of LAM fields in the interior of the computational domain and thus prevents any considerable penetration of sensitively dependent deviations into the range of large scales. Using initial condition ensembles, the present study quantifies the impact of ASN on IV in LAM simulations in the range of fine scales that are not controlled by spectral nudging. Four simulation configurations that all include strong ASN but differ in the nudging settings are considered. In the fifth configuration, grid nudging of land surface variables toward high-resolution surface analyses is applied. The results show that the IV at scales larger than 300 km can be suppressed by selecting an appropriate ASN setup. At scales between 300 and 30 km, however, in all configurations, the hourly near-surface temperature, humidity, and winds are only partly reproducible. Nudging the land surface variables is found to have the potential to significantly reduce IV, particularly for fine-scale temperature and humidity. On the other hand, hourly precipitation accumulations at these scales are generally irreproducible in all configurations, and probabilistic approach to downscaling is therefore recommended.

Solar Variability and Planetary Climates

CERN Document Server

Calisesi, Y; Gray, L; Langen, J; Lockwood, M

2007-01-01

Variations in solar activity, as revealed by variations in the number of sunspots, have been observed since ancient times. To what extent changes in the solar output may affect planetary climates, though, remains today more than ever a subject of controversy. In 2000, the SSSI volume on Solar Variability and Climate reviewed the to-date understanding of the physics of solar variability and of the associated climate response. The present volume on Solar Variability and Planetary Climates provides an overview of recent advances in this field, with particular focus at the Earth's middle and lower atmosphere. The book structure mirrors that of the ISSI workshop held in Bern in June 2005, the collection of invited workshop contributions and of complementary introductory papers synthesizing the current understanding in key research areas such as middle atmospheric processes, stratosphere-troposphere dynamical coupling, tropospheric aerosols chemistry, solar storm influences, solar variability physics, and terrestri...

Beyond imperviousness: A statistical approach to identifying functional differences between development morphologies on variable source area-type response in urbanized watersheds

Science.gov (United States)

Lim, T. C.

2016-12-01

Empirical evidence has shown linkages between urbanization, hydrological regime change, and degradation of water quality and aquatic habitat. Percent imperviousness, has long been suggested as the dominant source of these negative changes. However, recent research identifying alternative pathways of runoff production at the watershed scale have called into question percent impervious surface area's primacy in urban runoff production compared to other aspects of urbanization including change in vegetative cover, imported water and water leakages, and the presence of drainage infrastructure. In this research I show how a robust statistical methodology can detect evidence of variable source area (VSA)-type hydrologic response associated with incremental hydraulic connectivity in watersheds. I then use logistic regression to explore how evidence of VSA-type response relates to the physical and meterological characteristics of the watershed. I find that impervious surface area is highly correlated with development, but does not add significant explanatory power beyond percent developed in predicting VSA-type response. Other aspects of development morphology, including percent developed open space and type of drainage infrastructure also do not add to the explanatory power of undeveloped land in predicting VSA-type response. Within only developed areas, the effect of developed open space was found to be more similar to that of total impervious area than to undeveloped land. These findings were consistent when tested across a national cross-section of urbanized watersheds, a higher resolution dataset of Baltimore Metropolitan Area watersheds, and a subsample of watersheds confirmed not to be served by combined sewer systems. These findings suggest that land development policies that focus on lot coverage should be revisited, and more focus should be placed on preserving native vegetation and soil conditions alongside development.

Echinococcus multilocularis vesicular fluid inhibits activation and proliferation of natural killer cells.

Science.gov (United States)

Bellanger, Anne-Pauline; Mougey, Valentine; Pallandre, Jean-Rene; Gbaguidi-Haore, Houssein; Godet, Yann; Millon, Laurence

2017-08-25

Alveolar echinococcosis is a severe chronic helminthic disease that mimics slow-growing liver cancer. The immune evasion strategy of Echinococcus multilocularis Leuckart, 1863 remains poorly understood. The aim of this study was to investigate in vitro the impact of E. multilocularis vesicular fluid (Em-VF) on peripheral blood mononuclear cells (PBMC) and on natural killer (NK) cells. PBMC and NK cells were exposed to Em-VF (1 µg/ml) during six days. The effect of Em-VF was assessed on CD69, viability and proliferation, and on and transforming growth factor β (TGF-β), interferon γ (IFN-γ), interleukin 17 (IL-17) and interleukin 10, using flow cytometry and ELISA, respectively. Exposure to Em-VF had no bearing on PBMC's viability, proliferation and expression of CD69. In contrast, higher levels of IL-17 at day three and of TGF-β at day six were observed in PBMC supernatant after exposure to Em-VF (p Wilcoxon signed-rank test). Exposure to Em-VF induced a significant decrease of CD69 expression of NK cells at day three and a significant decrease of proliferation of NK cells at day six (p Wilcoxon signed-rank test). In contrast, NK cells viability and levels of cytokines did not vary significantly over Em-VF stimulation. Exposure to Em-VF had a significant bearing on activation and proliferation of NK cells. NK cells may play an important role in the immune response of the host against E. multilocularis.

A Valepotriate Fraction of Valeriana glechomifolia Shows Sedative and Anxiolytic Properties and Impairs Recognition But Not Aversive Memory in Mice

Directory of Open Access Journals (Sweden)

Natasha Maurmann

2011-01-01

Full Text Available Plants of the genus Valeriana (Valerianaceae are used in traditional medicine as a mild sedative, antispasmodic and tranquilizer in many countries. This study was undertaken to explore the neurobehavioral effects of systemic administration of a valepotriate extract fraction of known quantitative composition of Valeriana glechomifolia (endemic of southern Brazil in mice. Adult animals were treated with a single intraperitoneal injection of valepotriate fraction (VF in the concentrations of 1, 3 or 10 mg kg-1, or with vehicle in the pre-training period before each behavioral test. During the exploration of an open field, mice treated with 10 mg kg-1 of VF showed reduced locomotion and exploratory behavior. Although overall habituation sessions for locomotion and exploratory behavior among vehicle control and doses of VF were not affected, comparison between open-field and habituation sessions within each treatment showed that VF administration at 1 and 10 mg kg-1 impaired habituation. In the elevated plus-maze test, mice treated with VF (10 mg kg-1 showed a significant increase in the percentage of time spent in the open arms without significant effects in the number of total arm entries. VF at 3 mg kg-1 produced an impairment of novel-object recognition memory. In contrast, VF did not affect fear-related memory assessed in an inhibitory avoidance task. The results indicate that VF can have sedative effects and affect behavioral parameters related to recognition memory.

Vellozia flavicans Mart. ex Schult. hydroalcoholic extract inhibits the neuromuscular blockade induced by Bothrops jararacussu venom.

Science.gov (United States)

Tribuiani, Natália; da Silva, Alexandro Mateus; Ferraz, Miriéle Cristina; Silva, Magali Glauzer; Bentes, Ana Paula Guerreiro; Graziano, Talita Signoreti; dos Santos, Marcio Galdino; Cogo, José Carlos; Varanda, Eliana Aparecida; Groppo, Francisco Carlos; Cogo, Karina; Oshima-Franco, Yoko

2014-02-08

Snakebite is a significant public health issue in tropical countries. In Brazil, some of the most common snake envenomations are from Bothrops. Bothrops bites trigger local and systemic effects including edema, pain, erythema, cyanosis, infections, and necrosis. Vellozia flavicans is a plant from the Brazilian "cerrado" (savanna) that is popularly used as an anti-inflammatory medicine. Since inflammation develops quickly after Bothrops bites, which can lead to infection, the aim of the present study was to observe possible anti-snake venom and antimicrobial activities of V. flavicans (Vf). The chromatographic profile of the main constituents from the Vf leaf hydroalcoholic extract was obtained by thin-layer chromatography (TLC). The anti-snake venom activity was measured by Vf's ability to neutralize the in vitro neuromuscular blockade caused by Bothrops jararacussu venom (Bjssu) in a mouse phrenic nerve-diaphragm model (PND). After a 20 min incubation, preparations of PND were added to Tyrode's solution (control); Vf (0.2, 0.5, 1, and 2 mg/mL); 40 μg/mL Bjssu; pre-incubation for 30 min with Bjssu and 1 mg/mL Vf; and a Bjssu pretreated preparation (for 10 min) followed by 1 mg/mL Vf. Myographic recording was performed, and the contractile responses were recorded. The antimicrobial activity (minimum inhibitory concentration [MIC] and minimum bactericidal concentration [MBC]) was obtained for Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Enterococcus faecalis, using gentamicin and vancomycin as positive controls. TLC analysis yielded several compounds from Vf, such as flavonoids (quercetin) and phenolic acids (chlorogenic acid). Bjssu completely blocked the contractile responses of PND preparations, while Vf preserved 97% (±10%) of the contractile responses when incubated with Bjssu. In the PND pretreated with Bjssu, Vf was able to inhibit the neuromuscular blockade progress. MIC and MBC of Vf ranged from 2.5 to 5.0 mg/mL for P. aeruginosa

Identifying Areas of Primary Care Shortage in Urban Ohio

Directory of Open Access Journals (Sweden)

Hsin-Chung Liao

Full Text Available ABSTRACT: This study considers both spatial and a-spatial variables in examining accessibility to primary healthcare in the three largest urban areas of Ohio (Cleveland, Columbus, and Cincinnati. Spatial access emphasizes the importance of geographic barriers between individuals and primary care physicians, while a-spatial variables include non-geographic barriers or facilitators such as age, sex, race, income, social class, education, living conditions and language skills. Population and socioeconomic data were obtained from the 2000 Census, and primary care physician data for 2008 was provided by the Ohio Medical Board. We first implemented a two-step method based on a floating catchment area using Geographic Information Systems to measure spatial accessibility in terms of 30-minute travel times. We then used principal component analysis to group various socio-demographic variables into three groups: (1 socioeconomic disadvantages, (2 living conditions, and (3 healthcare needs. Finally, spatial and a-spatial variables were integrated to identify areas with poor access to primary care in Cleveland, Columbus, and Cincinnati. KEYWORDS: Geographic information systems, healthcare access, spatial accessibility, primary care shortage areas

Risk factors for vaginal fistula symptoms in Sub-Saharan Africa

DEFF Research Database (Denmark)

Maheu-Giroux, Mathieu; Filippi, Véronique; Maulet, Nathalie

2016-01-01

Background Vaginal fistula (VF) is one of the most severe maternal morbidities with the immediate consequence of chronic urinary and/or fecal incontinence. The epidemiological evidence regarding risk factors for VF is dominated by facility-based studies. Our aim is to estimate the effect size...... of selected risk factors for VF using population-based survey data.  Methods We pooled all available Demographic and Health Surveys and Multiple Indicators Cluster Surveys carried out in sub-Saharan Africa that collected information on VF symptoms. Bayesian matched logistic regression models that accounted...

Area-normalized thematic views

Energy Technology Data Exchange (ETDEWEB)

Keahey, T.A.

1998-10-01

This paper presents a novel technique for dealing with a classic problem that frequently arises in visualization. Very expressive nonlinear transformations can be automatically generated to correct thematic maps so that the areas of map regions are proportional to the thematic variables assigned to them. This helps to eliminate one of the most commonly occurring visual lies that occurs in information visualization. Thematic variables are commonly used in cartography to encode additional information within the spatial layout of a map. Common examples of thematic variables are population density, pollution level and birth rate. The method is illustrated with two examples, mapping interstate speed limits and presidential election results.

Mapping area variability in social and behavioural difficulties among Glasgow pre-schoolers: linkage of a survey of pre-school staff with routine monitoring data.

Science.gov (United States)

Barry, S J E; Marryat, L; Thompson, L; Ellaway, A; White, J; McClung, M; Wilson, P

2015-11-01

Social, emotional and behavioural development in early to middle childhood impact upon many outcomes in future life and are influenced by home, neighbourhood and school environments. We used linked data to investigate differences between areas in Glasgow City in level of difficulties in pre-school age children, after consideration of demographics, including area-level deprivation. Pre-school education staff completed Strengths and Difficulties Questionnaires (SDQ) on all children progressing to school from a local authority or partnership (local authority-funded private) pre-school in Glasgow City between 2010 and 2012. These data were linked to individual (age, gender) and area-level (deprivation) demographics from the City Council Education Services Department. Statistical models were fitted to the SDQ scores, adjusting for age, gender, area deprivation, year of school entry, pre-school establishment attended and electoral ward of residence. Correlation between neighbouring wards was incorporated to allow for clustering of scores. Boys and those living in more deprived areas had higher levels of difficulties. Children aged 5.0-5.5 years had fewest difficulties, while the oldest and youngest children had similar levels of difficulties. There were no significant secular trends by year of school entry. There remained differences among areas after adjusting for these variables, with children living in some areas having fewer difficulties than would be expected based on their socio-demographic characteristics. There remained differences in children's levels of difficulties between areas after adjusting for age, gender, area deprivation and year of school entry. Children in some very deprived areas had fewer difficulties than might be expected, while those in relatively affluent areas had more difficulties than expected based on their deprivation level. There may be other, unmeasured, individual- and area-level reasons for children's level of difficulties, and these

Incidence and risk factors of ventricular fibrillation before primary angioplasty in patients with first ST-elevation myocardial infarction: a nationwide study in Denmark.

Science.gov (United States)

Jabbari, Reza; Engstrøm, Thomas; Glinge, Charlotte; Risgaard, Bjarke; Jabbari, Javad; Winkel, Bo Gregers; Terkelsen, Christian Juhl; Tilsted, Hans-Henrik; Jensen, Lisette Okkels; Hougaard, Mikkel; Chiuve, Stephanie E; Pedersen, Frants; Svendsen, Jesper Hastrup; Haunsø, Stig; Albert, Christine M; Tfelt-Hansen, Jacob

2015-01-05

We aimed to investigate the incidence and risk factors for ventricular fibrillation (VF) before primary percutaneous coronary intervention (PPCI) among patients with ST-segment elevation myocardial infarction (STEMI) in a prospective nationwide setting. In this case-control study, patients presenting within the first 12 hours of first STEMI who survived to undergo angiography and subsequent PPCI were enrolled. Over 2 years, 219 cases presenting with VF before PPCI and 441 controls without preceding VF were enrolled. Of the 219 case patients, 182 (83%) had STEMI with out-of-hospital cardiac arrest due to VF, and 37 (17%) had cardiac arrest upon arrival to the emergency room. Medical history was collected by standardized interviews and by linkage to national electronic health records. The incidence of VF before PPCI among STEMI patients was 11.6%. Multivariable logistic regression analysis identified novel associations between atrial fibrillation and alcohol consumption with VF. Patients with a history of atrial fibrillation had a 2.80-fold odds of experiencing VF before PPCI (95% CI 1.10 to 7.30). Compared with nondrinkers, patients who consumed 1 to 7 units, 8 to 14 units, or >15 units of alcohol per week had an odds ratio (OR) of 1.30 (95% CI, 0.80 to 2.20), 2.30 (95% CI, 1.20 to 4.20), or 3.30 (95% CI, 1.80 to 5.90), respectively, for VF. Previously reported associations for preinfarction angina (OR 0.46; 95% CI 0.32 to 0.67), age of history of sudden death (OR 1.60; 95% CI 1.10 to 2.40) were all associated with VF. Several easily assessed risk factors were associated with VF occurring out-of-hospital or on arrival at the emergency room before PPCI in STEMI patients, thus providing potential avenues for investigation regarding improved identification and prevention of life-threatening ventricular arrhythmias. © 2015 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

The use of hybrid constructed wetlands for wastewater treatment with special attention to nitrogen removal: a review of a recent development.

Science.gov (United States)

Vymazal, Jan

2013-09-15

The hybrid systems were developed in the 1960s but their use increased only during the late 1990 s and in the 2000s mostly because of more stringent discharge limits for nitrogen and also more complex wastewaters treated in constructed wetlands (CWs). The early hybrid CWs consisted of several stages of vertical flow (VF) followed by several stages of horizontal flow (HF) beds. During the 1990 s, HF-VF and VF-HF hybrid systems were introduced. However, to achieve higher removal of total nitrogen or to treat more complex industrial and agricultural wastewaters other types of hybrid constructed wetlands including free water surface (FWS) CWs and multistage CWs have recently been used as well. The survey of 60 hybrid constructed wetlands from 24 countries reported after 2003 revealed that hybrid constructed wetlands are primarily used on Europe and in Asia while in other continents their use is limited. The most commonly used hybrid system is a VF-HF constructed wetland which has been used for treatment of both sewage and industrial wastewaters. On the other hand, the use of a HF-VF system has been reported only for treatment of municipal sewage. Out of 60 surveyed hybrid systems, 38 have been designed to treat municipal sewage while 22 hybrid systems were designed to treat various industrial and agricultural wastewaters. The more detailed analysis revealed that VF-HF hybrid constructed wetlands are slightly more efficient in ammonia removal than hybrid systems with FWS CWs, HF-VF systems or multistage VF and HF hybrid CWs. All types of hybrid CWs are comparable with single VF CWs in terms of NH4-N removal rates. On the other hand, CWs with FWS units remove substantially more total nitrogen as compared to other types of hybrid constructed wetlands. However, all types of hybrid constructed wetlands are more efficient in total nitrogen removal than single HF or VF constructed wetlands. Copyright © 2013 Elsevier Ltd. All rights reserved.

The brain map of gait variability in aging, cognitive impairment and dementia. A systematic review

Science.gov (United States)

Tian, Qu; Chastan, Nathalie; Bair, Woei-Nan; Resnick, Susan M.; Ferrucci, Luigi; Studenski, Stephanie A.

2017-01-01

While gait variability may reflect subtle changes due to aging or cognitive impairment (CI), associated brain characteristics remain unclear. We summarize structural and functional neuroimaging findings associated with gait variability in older adults with and without CI and dementia. We identified 17 eligible studies; all were cross-sectional; few examined multiple brain areas. In older adults, temporal gait variability was associated with structural differences in medial areas important for lower limb coordination and balance. Both temporal and spatial gait variability were associated with structural and functional differences in hippocampus and primary sensorimotor cortex and structural differences in anterior cingulate cortex, basal ganglia, association tracts, and posterior thalamic radiation. In CI or dementia, some associations were found in primary motor cortex, hippocampus, prefrontal cortex and basal ganglia. In older adults, gait variability may be associated with areas important for sensorimotor integration and coordination. To comprehend the neural basis of gait variability with aging and CI, longitudinal studies of multiple brain areas are needed. PMID:28115194

Characterization of soils in terms of pedological variability under different physiography of Damodar command area (part, West Bengal, India

Directory of Open Access Journals (Sweden)

Ranjan Bera

2015-12-01

Full Text Available Five representative soil profiles occurring on four different physiography under subtropical environment of Damodar command area, India, were studied for soil pedological variability. Two way approaches were taken to evaluate the extent of profile development. Firstly different extractants were used to determine various forms of Fe and Al and their different ratios. Average contents of Fe and Al, extracted by different extracting reagents were found to be in descending order, as follows: Aldith > Aloxa > Alpyr and Fedith > Feoxa > Fepyr. Analysis of pyrophosphate (pyr, oxalate (oxa, and dithionate (dith extractable Fe and Al fractions indicated that with increasing soil age, the content of crystalline Fe and Al oxides increased at the expense of the poorly crystalline forms. The mean content of amorphous Fe and Al, crystalline Fe and Al, and their ratios estimated the degree of soil development. In the second part, elemental analysis was done, silica to sesquioxide ratio as well as ratio of alkali cations was measured and weathering index of each horizon was determined. The ratios and weathering indices indicated that except Madhpur soil series, all other soils were young and pedological development was still in progress in Damodar command area.

Brain Signal Variability Differentially Affects Cognitive Flexibility and Cognitive Stability.

Science.gov (United States)

Armbruster-Genç, Diana J N; Ueltzhöffer, Kai; Fiebach, Christian J

2016-04-06

Recent research yielded the intriguing conclusion that, in healthy adults, higher levels of variability in neuronal processes are beneficial for cognitive functioning. Beneficial effects of variability in neuronal processing can also be inferred from neurocomputational theories of working memory, albeit this holds only for tasks requiring cognitive flexibility. However, cognitive stability, i.e., the ability to maintain a task goal in the face of irrelevant distractors, should suffer under high levels of brain signal variability. To directly test this prediction, we studied both behavioral and brain signal variability during cognitive flexibility (i.e., task switching) and cognitive stability (i.e., distractor inhibition) in a sample of healthy human subjects and developed an efficient and easy-to-implement analysis approach to assess BOLD-signal variability in event-related fMRI task paradigms. Results show a general positive effect of neural variability on task performance as assessed by accuracy measures. However, higher levels of BOLD-signal variability in the left inferior frontal junction area result in reduced error rate costs during task switching and thus facilitate cognitive flexibility. In contrast, variability in the same area has a detrimental effect on cognitive stability, as shown in a negative effect of variability on response time costs during distractor inhibition. This pattern was mirrored at the behavioral level, with higher behavioral variability predicting better task switching but worse distractor inhibition performance. Our data extend previous results on brain signal variability by showing a differential effect of brain signal variability that depends on task context, in line with predictions from computational theories. Recent neuroscientific research showed that the human brain signal is intrinsically variable and suggested that this variability improves performance. Computational models of prefrontal neural networks predict differential

Inter-Annual Variability of Area-Scaled Gaseous Carbon Emissions from Wetland Soils in the Liaohe Delta, China.

Science.gov (United States)

Ye, Siyuan; Krauss, Ken W; Brix, Hans; Wei, Mengjie; Olsson, Linda; Yu, Xueyang; Ma, Xueying; Wang, Jin; Yuan, Hongming; Zhao, Guangming; Ding, Xigui; Moss, Rebecca F

2016-01-01

Global management of wetlands to suppress greenhouse gas (GHG) emissions, facilitate carbon (C) sequestration, and reduce atmospheric CO2 concentrations while simultaneously promoting agricultural gains is paramount. However, studies that relate variability in CO2 and CH4 emissions at large spatial scales are limited. We investigated three-year emissions of soil CO2 and CH4 from the primary wetland types of the Liaohe Delta, China, by focusing on a total wetland area of 3287 km2. One percent is Suaeda salsa, 24% is Phragmites australis, and 75% is rice. While S. salsa wetlands are under somewhat natural tidal influence, P. australis and rice are managed hydrologically for paper and food, respectively. Total C emissions from CO2 and CH4 from these wetland soils were 2.9 Tg C/year, ranging from 2.5 to 3.3 Tg C/year depending on the year assessed. Primary emissions were from CO2 (~98%). Photosynthetic uptake of CO2 would mitigate most of the soil CO2 emissions, but CH4 emissions would persist. Overall, CH4 fluxes were high when soil temperatures were >18°C and pore water salinity emissions from rice habitat alone in the Liaohe Delta represent 0.2% of CH4 carbon emissions globally from rice. With such a large area and interannual sensitivity in soil GHG fluxes, management practices in the Delta and similar wetlands around the world have the potential not only to influence local C budgeting, but also to influence global biogeochemical cycling.

Ventricular fibrillation cardiac arrest produces a chronic striatal hyperdopaminergic state that is worsened by methylphenidate treatment.

Science.gov (United States)

Nora, Gerald J; Harun, Rashed; Fine, David F; Hutchison, Daniel; Grobart, Adam C; Stezoski, Jason P; Munoz, Miranda J; Kochanek, Patrick M; Leak, Rehana K; Drabek, Tomas; Wagner, Amy K

2017-07-01

Cardiac arrest survival rates have improved with modern resuscitation techniques, but many survivors experience impairments associated with hypoxic-ischemic brain injury (HIBI). Currently, little is understood about chronic changes in striatal dopamine (DA) systems after HIBI. Given the common empiric clinical use of DA enhancing agents in neurorehabilitation, investigation evaluating dopaminergic alterations after cardiac arrest (CA) is necessary to optimize rehabilitation approaches. We hypothesized that striatal DA neurotransmission would be altered chronically after ventricular fibrillation cardiac arrest (VF-CA). Fast-scan cyclic voltammetry was used with median forebrain bundle (MFB) maximal electrical stimulations (60Hz, 10s) in rats to characterize presynaptic components of DA neurotransmission in the dorsal striatum (D-Str) and nucleus accumbens 14 days after a 5-min VF-CA when compared to Sham or Naïve. VF-CA increased D-Str-evoked overflow [DA], total [DA] released, and initial DA release rate versus controls, despite also increasing maximal velocity of DA reuptake (V max ). Methylphenidate (10 mg/kg), a DA transporter inhibitor, was administered to VF-CA and Shams after establishing a baseline, pre-drug 60 Hz, 5 s stimulation response. Methylphenidate increased initial evoked overflow [DA] more-so in VF-CA versus Sham and reduced D-Str V max in VF-CA but not Shams; these findings are consistent with upregulated striatal DA transporter in VF-CA versus Sham. Our work demonstrates that 5-min VF-CA increases electrically stimulated DA release with concomitant upregulation of DA reuptake 2 weeks after brief VF-CA insult. Future work should elucidate how CA insult duration, time after insult, and insult type influence striatal DA neurotransmission and related cognitive and motor functions. © 2017 International Society for Neurochemistry.

Identification and characterization of NF-YB family genes in tung tree.

Science.gov (United States)

Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

2015-12-01

The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

Predictors of having a resistance test following confirmed virological failure of combination antiretroviral therapy: data from EuroSIDA

DEFF Research Database (Denmark)

Fox, Zoe V; Cozzi-Lepri, Alessandro; D'Arminio Monforte, Antonella

2011-01-01

these recommendations. Methods: In EuroSIDA, virological failure (VF) was defined as confirmed VL>1,000 copies/ml after =4 months continuous use of any antiretroviral in a =3-drug regimen started during or after 2002. We assessed whether a resistance test was performed around VF (from 4 months before to 1 year after VF...

Influences of the alternation of wet-dry periods on the variability of chromophoric dissolved organic matter in the water level fluctuation zone of the Three Gorges Reservoir area, China.

Science.gov (United States)

Jiang, Tao; Wang, Dingyong; Wei, Shiqiang; Yan, Jinlong; Liang, Jian; Chen, Xueshuang; Liu, Jiang; Wang, Qilei; Lu, Song; Gao, Jie; Li, Lulu; Guo, Nian; Zhao, Zheng

2018-04-26

Dissolved organic matter (DOM) is a crucial driver of various biogeochemical processes in aquatic systems. Thus, many lakes and streams have been investigated in the past several decades. However, fewer studies have sought to understand the changes in DOM characteristics in the waters of the Three Gorges Reservoir (TGR) areas, which are the largest artificial reservoir areas in the world. Thus, a field investigation of dissolved organic carbon (DOC) concentrations and of chromophoric dissolved organic matter (CDOM) properties was conducted from 2013 to 2015 to track the spatial-temporal variability of DOM properties in the TGR areas. The results showed that the alternations of wet and dry periods due to hydrological management have a substantial effect on the quantity and quality of aquatic DOM in TGR areas. Increases in DOC concentrations in the wet period show an apparent "dilution effect" that decreases CDOM compounds with relatively lower aromaticity (i.e., SUVA 254 ) and molecular weight (i.e., S R ). In contrast to the obvious temporal variations of DOM, significant spatial variability was not observed in this study. Additionally, DOM showed more terrigenous characteristics in the dry period but weak terrigenous characteristics in the wet period. Furthermore, the positive correlation between SUVA 254 and CDOM suggests that the aromatic component controls the CDOM dynamics in TGR areas. The first attempt to investigate the DOM dynamics in TGR areas since the Three Gorges Dam was conducted in 2012, and the unique patterns of spatial-temporal variations in DOM that are highlighted in this study might provide a new insight for understanding the role of DOM in the fates of contaminants and may help in the further management of flow loads and water quality in the TGR area. Copyright © 2018 Elsevier B.V. All rights reserved.

The Effectiveness of A School-Based Nutrition Intervention on Children's Fruit, Vegetables, and Dairy Product Intake.

Science.gov (United States)

Drapeau, Vicky; Savard, Mathieu; Gallant, Annette; Nadeau, Luc; Gagnon, Jocelyn

2016-05-01

Most Canadian children do not meet daily recommendations for consumption of vegetables and fruits (V/F) and dairy products (DP). The aim of this study was to evaluate the impact of Team Nutriathlon on V/F and DP consumption of children. Participants were 404 children from grades 5 and 6 (intervention group [IG] N = 242, control group [CG] N = 162). Teams of children were guided to increase their consumption and variety of V/F and DP over an 8-week period. Daily servings of V/F and DP were compared between groups at 4 time points: baseline (week 0), during (week 6), immediately after (week 9 or 10), and a follow-up 10 weeks after (week 20) the intervention. During and after the program and at follow-up, children in the IG consumed more servings of V/F and DP compared to the CG (group × time, p .05). Team Nutriathlon is an innovative school-based nutrition program that can help to increase the V/F and DP consumption of children. © 2016, American School Health Association.

Improvement of Screening Accuracy of Mini-Mental State Examination for Mild Cognitive Impairment and Non-Alzheimer's Disease Dementia by Supplementation of Verbal Fluency Performance.

Science.gov (United States)

Kim, Jee Wook; Lee, Dong Young; Seo, Eun Hyun; Sohn, Bo Kyung; Choe, Young Min; Kim, Shin Gyeom; Park, Shin Young; Choo, Il Han; Youn, Jong Chul; Jhoo, Jin Hyeong; Kim, Ki Woong; Woo, Jong Inn

2014-01-01

THIS STUDY AIMED TO INVESTIGATE WHETHER THE SUPPLEMENTATION OF VERBAL FLUENCY: Animal category test (VF) performance can improve the screening ability of Mini-Mental State Examination (MMSE) for mild cognitive impairment (MCI), dementia and their major subtypes. Six hundred fifty-five cognitively normal (CN), 366 MCI [282 amnestic MCI (aMCI); 84 non-amnestic MCI (naMCI)] and 494 dementia [346 Alzheimer's disease (AD); and 148 non-Alzheimer's disease dementia (NAD)] individuals living in the community were included (all aged 50 years and older) in the study. The VF-supplemented MMSE (MMSE+VF) score had a significantly better screening ability for MCI, dementia and overall cognitive impairment (MCI plus dementia) than the MMSE raw score alone. MMSE+VF showed a significantly better ability than MMSE for both MCI subtypes, i.e., aMCI and naMCI. In the case of dementia subtypes, MMSE+VF was better than the MMSE alone for NAD screening, but not for AD screening. The results support the usefulness of VF-supplementation to improve the screening performance of MMSE for MCI and NAD.

Detection of Life Threatening Ventricular Arrhythmia Using Digital Taylor Fourier Transform.

Science.gov (United States)

Tripathy, Rajesh K; Zamora-Mendez, Alejandro; de la O Serna, José A; Paternina, Mario R Arrieta; Arrieta, Juan G; Naik, Ganesh R

2018-01-01

Accurate detection and classification of life-threatening ventricular arrhythmia episodes such as ventricular fibrillation (VF) and rapid ventricular tachycardia (VT) from electrocardiogram (ECG) is a challenging problem for patient monitoring and defibrillation therapy. This paper introduces a novel method for detection and classification of life-threatening ventricular arrhythmia episodes. The ECG signal is decomposed into various oscillatory modes using digital Taylor-Fourier transform (DTFT). The magnitude feature and a novel phase feature namely the phase difference (PD) are evaluated from the mode Taylor-Fourier coefficients of ECG signal. The least square support vector machine (LS-SVM) classifier with linear and radial basis function (RBF) kernels is employed for detection and classification of VT vs. VF, non-shock vs. shock and VF vs. non-VF arrhythmia episodes. The accuracy, sensitivity, and specificity values obtained using the proposed method are 89.81, 86.38, and 93.97%, respectively for the classification of Non-VF and VF episodes. Comparison with the performance of the state-of-the-art features demonstrate the advantages of the proposition.

The Effect of Combination of Video Feedback and Audience Feedback on Social Anxiety: Preliminary Findings.

Science.gov (United States)

Chen, Junwen; Mak, Rebecca; Fujita, Satoko

2015-09-01

Although video feedback (VF) is shown to improve appraisals of social performance in socially anxious individuals, its impact on state anxiety during a social situation is mixed. The current study investigated the effect of combined video feedback and audience feedback (AF) on self-perceptions of performance and bodily sensations as well as state anxiety pertaining to a speech task. Forty-one socially anxious students were randomly allocated to combined video feedback with audience feedback (VF + AF), video feedback only (VF), audience feedback only (AF), or a control condition. Following a 3-min speech, participants in the VF + AF, VF, and AF conditions watched the videotape of their speech with cognitive preparation in the presence of three confederates who served as audience, and/or received feedback from the confederates, while the control group watched their videotaped speech without cognitive preparation. Both VF + AF and AF conditions improved distorted appraisal of performance and bodily sensations as well as state anxiety. The clinical implications of these findings are discussed. © The Author(s) 2015.

Epicardial mapping of ventricular fibrillation over the posterior descending artery and left posterior papillary muscle of the swine heart.

Science.gov (United States)

Nielsen, Thomas D; Huang, Jian; Rogers, Jack M; Killingsworth, Cheryl R; Ideker, Raymond E

2009-01-01

Recent studies suggest that during ventricular fibrillation (VF) epicardial vessels may be a site of conduction block and the posterior papillary muscle (PPM) in the left ventricle (LV) may be the location of a "mother rotor." The goal of this study was to obtain evidence to support or refute these possibilities. Epicardial activation over the posterior LV and right ventricle (RV) was mapped during the first 20 s of electrically induced VF in six open-chest pigs with a 504 electrode plaque covering a 20 cm(2) area centered over the posterior descending artery (PDA). The locations of epicardial breakthrough as well as reentry clustered in time and space during VF. Spatially, reentry occurred significantly more frequently over the LV than the RV in all 48 episodes, and breakthrough clustered near the PPM (p < 0.001). Significant temporal clustering occurred in 79% of breakthrough episodes and 100% of reentry episodes. These temporal clusters occurred at different times so that there was significantly less breakthrough when reentry was present (p < 0.0001). Conduction block occurred significantly more frequently near the PDA than elsewhere. The PDA is a site of epicardial block which may contribute to VF maintenance. Epicardial breakthrough clusters near the PPM. Reentry also clusters in space but at a separate site. The fact that breakthrough and reentry cluster at different locations and at different times supports the possibility of a drifting filament at the PPM so that at times reentry is present on the surface but at other times the reentrant wavefront breaks through to the epicardium.

Prompt prediction of successful defibrillation from 1-s ventricular fibrillation waveform in patients with out-of-hospital sudden cardiac arrest.

Science.gov (United States)

Endoh, Hiroshi; Hida, Seiji; Oohashi, Satomi; Hayashi, Yusuke; Kinoshita, Hidenori; Honda, Tadayuki

2011-02-01

Ventricular fibrillation (VF) is a common cardiac arrest rhythm that can be terminated by electrical defibrillation. During cardiopulmonary resuscitation, there is a strong need for a prompt and reliable predictor of successful defibrillation because myocardial damage can result from repeated futile defibrillation attempts. Continuous wavelet transform (CWT) provides excellent time and frequency resolution of signals. The purpose of this study was to evaluate whether features based on CWT could predict successful defibrillation. VF electrocardiogram (ECG) waveforms stored in ambulance-located defibrillators were collected. Predefibrillation waveforms were divided into 1.0- or 5.12-s VF waveforms. Indices in frequency domain or nonlinear analysis were calculated on the 5.12-s waveform. Simultaneously, CWT was performed on the 1.0-s waveform, and total low-band (1-3 Hz), mid-band (3-10 Hz), and high-band (10-32 Hz) energy were calculated. In 152 patients with out-of-hospital cardiac arrest, a total of 233 ECG predefibrillation recordings, consisting of 164 unsuccessful and 69 successful episodes, were analyzed. Indices of frequency domain analysis (peak frequency, centroid frequency, and amplitude spectral area), nonlinear analysis (approximate entropy and Hurst exponent, detrended fluctuation analysis), and CWT analysis (mid-band and high-band energy) were significantly different between unsuccessful and successful episodes (P centroid frequency and total mid-band energy were effective predictors (P < 0.01 for both). Energy spectrum analysis based on CWT as short as a 1.0-s VF ECG waveform enables prompt and reliable prediction of successful defibrillation.

Enhancement of Visual Field Predictions with Pointwise Exponential Regression (PER) and Pointwise Linear Regression (PLR).

Science.gov (United States)

Morales, Esteban; de Leon, John Mark S; Abdollahi, Niloufar; Yu, Fei; Nouri-Mahdavi, Kouros; Caprioli, Joseph

2016-03-01

The study was conducted to evaluate threshold smoothing algorithms to enhance prediction of the rates of visual field (VF) worsening in glaucoma. We studied 798 patients with primary open-angle glaucoma and 6 or more years of follow-up who underwent 8 or more VF examinations. Thresholds at each VF location for the first 4 years or first half of the follow-up time (whichever was greater) were smoothed with clusters defined by the nearest neighbor (NN), Garway-Heath, Glaucoma Hemifield Test (GHT), and weighting by the correlation of rates at all other VF locations. Thresholds were regressed with a pointwise exponential regression (PER) model and a pointwise linear regression (PLR) model. Smaller root mean square error (RMSE) values of the differences between the observed and the predicted thresholds at last two follow-ups indicated better model predictions. The mean (SD) follow-up times for the smoothing and prediction phase were 5.3 (1.5) and 10.5 (3.9) years. The mean RMSE values for the PER and PLR models were unsmoothed data, 6.09 and 6.55; NN, 3.40 and 3.42; Garway-Heath, 3.47 and 3.48; GHT, 3.57 and 3.74; and correlation of rates, 3.59 and 3.64. Smoothed VF data predicted better than unsmoothed data. Nearest neighbor provided the best predictions; PER also predicted consistently more accurately than PLR. Smoothing algorithms should be used when forecasting VF results with PER or PLR. The application of smoothing algorithms on VF data can improve forecasting in VF points to assist in treatment decisions.

Structure-Function Correlations using Scanning Laser Polarimetry in Primary Angle-Closure Glaucoma and Primary Open Angle Glaucoma

Science.gov (United States)

Lee, Pei-Jung; Liu, Catherine Jui-Ling.; Wojciechowski, Robert; Bailey-Wilson, Joan E.; Cheng, Ching-Yu

2010-01-01

Purpose To assess the correlations between retinal nerve fiber layer (RNFL) thickness measured with scanning laser polarimetry (SLP) and visual field (VF) sensitivity in primary open angle glaucoma (POAG) and primary angle-closure glaucoma (PACG). Design Prospective, comparative, observational cases series Methods Fifty patients with POAG and 56 with PACG were examined using SLP with variable corneal compensation (GDx VCC) and Humphrey VF analyzer between August 2005 and July 2006 at Taipei Veterans General Hospital. Correlations between RNFL thickness and VF sensitivity, expressed as mean sensitivity (MS) in both decibel (dB) and 1/Lambert (L) scales, were estimated by Spearman's rank correlation coefficient (rs) and multivariate median regression models (pseudo R2). The correlations were determined globally and for six RNFL sectors and their corresponding VF regions. Results The correlation between RNFL thickness and MS (in dB) was weaker in the PACG group (rs = 0.38, P = 0.004, pseudo R2 = 0.17) than in the POAG group (rs = 0.51, P <0.001, pseudo R2 = 0.31), but the difference in the magnitude of correlation was not significant (P = 0.42).With Bonferroni correction, the structure-function correlation was significant in the superotemporal (rs = 0.62), superonasal (rs = 0.56), inferonasal (rs = 0.53), and inferotemporal (rs = 0.50) sectors in the POAG group (all P <0.001), while it was significant only in the superotemporal (rs = 0.53) and inferotemporal (rs = 0.48) sectors in the PACG group (both P <0.001). The results were similar when MS was expressed as 1/L scale. Conclusions Both POAG and PACG eyes had moderate structure-function correlations using SLP. Compared to eyes with POAG, fewer RNFL sectors have significant structure-function correlations in eyes with PACG. PMID:20202618

Prehension synergies and control with referent hand configurations.

Science.gov (United States)

Latash, Mark L; Friedman, Jason; Kim, Sun Wook; Feldman, Anatol G; Zatsiorsky, Vladimir M

2010-04-01

We used the framework of the equilibrium-point hypothesis (in its updated form based on the notion of referent configuration) to investigate the multi-digit synergies at two levels of a hypothetical hierarchy involved in prehensile actions. Synergies were analyzed at the thumb-virtual finger (VF) level (VF is an imaginary digit with the mechanical action equivalent to that of the four actual fingers) and at the individual finger level. The subjects performed very quick vertical movements of a handle into a target. A load could be attached off-center to provide a pronation or supination torque. In a few trials, the handle was unexpectedly fixed to the table and the digits slipped off the sensors. In such trials, the hand stopped at a higher vertical position and rotated into pronation or supination depending on the expected torque. The aperture showed non-monotonic changes with a large, fast decrease and further increase, ending up with a smaller distance between the thumb and the fingers as compared to unperturbed trials. Multi-digit synergies were quantified using indices of co-variation between digit forces and moments of force across unperturbed trials. Prior to the lifting action, high synergy indices were observed at the individual finger level while modest indices were observed at the thumb-VF level. During the lifting action, the synergies at the individual finger level disappeared while the synergy indices became higher at the thumb-VF level. The results support the basic premise that, within a given task, setting a referent configuration may be described with a few referent values of variables that influence the equilibrium state, to which the system is attracted. Moreover, the referent configuration hypothesis can help interpret the data related to the trade-off between synergies at different hierarchical levels.

Cardiac effects of electrical stun guns: does position of barbs contact make a difference?

Science.gov (United States)

Lakkireddy, Dhanunjaya; Wallick, Donald; Verma, Atul; Ryschon, Kay; Kowalewski, William; Wazni, Oussama; Butany, Jagdish; Martin, David; Tchou, Patrick J

2008-04-01

The use of electrical stun guns has been rising among law enforcement authorities for subduing violent subjects. Multiple reports have raised concerns over their safety. The cardiovascular safety profile of these devices in relationship to the position of delivery on the torso has not been well studied. We tested 13 adult pigs using a custom device built to deliver neuromuscular incapacitating (NMI) discharge of increasing intensity that matched the waveform of a commercially available stun gun (TASER(R) X-26, TASER International, Scottsdale, AZ, USA). Discharges with increasing multiples of output capacitances were applied in a step-up and step-down fashion, using two-tethered barbs at five locations: (1) Sternal notch to cardiac apex (position-1), (2) sternal notch to supraumbilical area (position-2), (3) sternal notch to infraumbilical area (position-3), (4) side to side on the chest (position-4), and (5) upper to lower mid-posterior torso (position-5). Endpoints included determination of maximum safe multiple (MaxSM), ventricular fibrillation threshold (VFT), and minimum ventricular fibrillation induction multiple (MinVFIM). Standard TASER discharges repeated three times did not cause ventricular fibrillation (VF) at any of the five locations. When the barbs were applied in the axis of the heart (position-1), MaxSM and MinVFIM were significantly lower than when applied away from the heart, on the dorsum (position-5) (4.31 +/- 1.11 vs 40.77 +/- 9.54, P< 0.001 and 8.31 +/- 2.69 vs 50.77 +/- 9.54, P< 0.001, respectively). The values of these endpoints at position-2, position-3, and position-4 were progressively higher and ranged in between those of position-1 and position-5. Presence of ventricular capture at a 2:1 ratio to the delivered TASER impulses correlated with induction of VF. No significant metabolic changes were seen after standard NMI TASER discharge. There was no evidence of myocardial damage based on serum cardiac markers, electrocardiography

Assessment of patient perception of glaucomatous visual field loss and its association with disease severity using Amsler grid.

Directory of Open Access Journals (Sweden)

Kenji Fujitani

Full Text Available To investigate patients' perception of glaucomatous VF loss and its association with glaucoma severity using the Amsler grid test.In this prospective cross-sectional study, glaucoma patients with abnormal 10-2 Humphrey Swedish Interactive Threshold Algorithm-standard VF tests were enrolled consecutively. All patients underwent a black-on-white Amsler grid test for each eligible eye. They were asked to outline any perceived scotomas (areas with abnormal grid lines on the grid and then describe verbally their perception of the scotomas. Examiners asked patients to clarify their descriptions. All descriptions used by patients were recorded in their own words, which were then sorted into descriptor categories according to similar themes. The number of descriptor categories was counted for each eye. 10-2 VF mean deviation (MD was compared among eyes that reported different number of descriptor categories. The mean 10-2 VF MD values were compared among different descriptor categories.Fifty glaucoma patients (88 eyes were included. Patients used a total of 44 different descriptors for their scotomas. Patients' descriptors were classified into categories that incorporated similar themes, resulting in 4 overarching descriptor categories: Missing/White, Blurry/Gray, Black, and Not Aware. Fifty-two eyes reported one descriptor category and 19 eyes reported two descriptor categories (mean number of descriptor categories = 1.27±0.45. Eyes that reported two descriptor categories had worse VF MD than those that reported one (-17.86±10.31 dB vs. -12.08±7.53 dB; p = 0.012. When eyes were organized according to its combination of descriptor categories, each eye naturally sorted into one of the following 5 groups, in frequency order: Missing/White (27 eyes; 31%, Blurry/Gray (21 eyes; 24%, combined Missing/White and Blurry/Gray (19 eyes; 21%, Not Aware (17 eyes; 19%, and Black (4 eyes; 5%. The mean 10-2 VF MD severity order was Black (-21.18±10.59 dB, combined

Spectral analysis-based risk score enables early prediction of mortality and cerebral performance in patients undergoing therapeutic hypothermia for ventricular fibrillation and comatose status

Science.gov (United States)

Filgueiras-Rama, David; Calvo, Conrado J.; Salvador-Montañés, Óscar; Cádenas, Rosalía; Ruiz-Cantador, Jose; Armada, Eduardo; Rey, Juan Ramón; Merino, J.L.; Peinado, Rafael; Pérez-Castellano, Nicasio; Pérez-Villacastín, Julián; Quintanilla, Jorge G.; Jiménez, Santiago; Castells, Francisco; Chorro, Francisco J.; López-Sendón, J.L.; Berenfeld, Omer; Jalife, José; López de Sá, Esteban; Millet, José

2017-01-01

Background Early prognosis in comatose survivors after cardiac arrest due to ventricular fibrillation (VF) is unreliable, especially in patients undergoing mild hypothermia. We aimed at developing a reliable risk-score to enable early prediction of cerebral performance and survival. Methods Sixty-one out of 239 consecutive patients undergoing mild hypothermia after cardiac arrest, with eventual return of spontaneous circulation (ROSC), and comatose status on admission fulfilled the inclusion criteria. Background clinical variables, VF time and frequency domain fundamental variables were considered. The primary and secondary outcomes were a favorable neurological performance (FNP) during hospitalization and survival to hospital discharge, respectively. The predictive model was developed in a retrospective cohort (n=32; September 2006–September 2011, 48.5 ± 10.5 months of follow-up) and further validated in a prospective cohort (n = 29; October 2011–July 2013, 5 ± 1.8 months of follow-up). Results FNP was present in 16 (50.0%) and 21 patients (72.4%) in the retrospective and prospective cohorts, respectively. Seventeen (53.1%) and 21 patients (72.4%), respectively, survived to hospital discharge. Both outcomes were significantly associated (p < 0.001). Retrospective multivariate analysis provided a prediction model (sensitivity= 0.94, specificity = 1) that included spectral dominant frequency, derived power density and peak ratios between high and low frequency bands, and the number of shocks delivered before ROSC. Validation on the prospective cohort showed sensitivity = 0.88 and specificity = 0.91. A model-derived risk-score properly predicted 93% of FNP. Testing the model on follow-up showed a c-statistic ≥ 0.89. Conclusions A spectral analysis-based model reliably correlates time-dependent VF spectral changes with acute cerebral injury in comatose survivors undergoing mild hypothermia after cardiac arrest. PMID:25828128

Satellite Power System (SPS) mapping of exclusion areas for rectenna sites

Science.gov (United States)

Blackburn, J. B., Jr.; Bavinger, B. A.

1978-01-01

The areas of the United States that were not available as potential sites for receiving antennas that are an integral part of the Satellite Power System concept are presented. Thirty-six variables with the potential to exclude the rectenna were mapped and coded in a computer. Some of these variables exclude a rectenna from locating within the area of its spatial influence, and other variables potentially exclude the rectenna. These maps of variables were assembled from existing data and were mapped on a grid system.

Drift wave stabilized by an additional streaming ion or plasma population

Science.gov (United States)

Bashir, M. F.; Vranjes, J.

2015-03-01

It is shown that the universally unstable kinetic drift wave in an electron-ion plasma can very effectively be suppressed by adding an extra flowing ion (or plasma) population. The effect of the flow of the added ions is essential, their response is of the type (vp h-vf 0) exp[-(vph-vf 0) 2] , where vf 0 is the flow speed and vp h is the phase speed parallel to the magnetic field vector. The damping is strong and it is mainly due to this ion exponential term, and this remains so for vf 0

Stability of termite mound populations in a variable environment ...

African Journals Online (AJOL)

Of all the climatic variables in the environment of termites in southern Kenya, only rainfall shows marked seasonality and unpredictability. But despite the great variability in rainfall patterns, the populations of termite mounds of various species in three well-separated study areas remained remarkably constant over a period ...

SMART_PV: A SOFTWARE APPLICATION FOR MANAGING ENGLISH PHRASAL VERBS SMART_PV: UNA APLICACIÓN DE SOFTWARE PARA LA GESTIÓN DE VERBOS FRASALES EN INGLÉS

Directory of Open Access Journals (Sweden)

Bell Manrique Losada

2012-12-01

Full Text Available Phrasal verbs (PVs are lexical units consisting of a verb and one or two particles. In this paper we present a characterization of English PVs. This characterization serves as the backbone for our web application called Smart_PV. The purpose of Smart_PV is twofold: i to allow the input of PVs and ii to detect PVs in texts. We designed web interfaces to register the PVs with their features and to detect PVs in the texts as follows: the user enters the text and starts the PVs detection process by splitting the text into words. Smart_PV was validated inserting 80 PVs (including the 25 most common PVs in documents of the European Union and detecting PVs in texts from different domains. Our results show the expediency of this kind of applications for teachers, students, translators, and common users, as a tool to support translation and text mining tasks. Although a database with more PVs and the analysis of more documents are required, our results demonstrate the feasibility and usefulness of our application.Los verbos frasales (VF son unidades léxicas conformadas por un verbo y una o dos partículas. En este artículo se presenta una caracterización para los VF en inglés, la cual es usada como eje principal de una aplicación web para VF llamada Smart_PV. El objetivo de Smart_PV es doble: i permitir el ingreso de VF, y ii detectar VF en textos. Se diseñaron interfaces web para ingresar los VF con sus características y para detectarlos en textos así: el usuario ingresa un texto y comienza el proceso de detección de VF dividiendo el texto en palabras. Smart_PV fue validada insertando 80 VF (incluyendo los 25 VF más comunes en documentos de la Unión Europea, y detectando VF en textos de diferentes dominios. Los resultados muestran la conveniencia de este tipo de aplicaciones para profesores, estudiantes, traductores y usuarios comunes como apoyo en tareas de traducción y minería de textos. Aunque es deseable una base de datos con más VF y

Long-Term Variability of Surface Albedo and Its Correlation with Climatic Variables over Antarctica

Directory of Open Access Journals (Sweden)

Minji Seo

2016-11-01

Full Text Available The cryosphere is an essential part of the earth system for understanding climate change. Components of the cryosphere, such as ice sheets and sea ice, are generally decreasing over time. However, previous studies have indicated differing trends between the Antarctic and the Arctic. The South Pole also shows internal differences in trends. These phenomena indicate the importance of continuous observation of the Polar Regions. Albedo is a main indicator for analyzing Antarctic climate change and is an important variable with regard to the radiation budget because it can provide positive feedback on polar warming and is related to net radiation and atmospheric heating in the mainly snow- and ice-covered Antarctic. Therefore, in this study, we analyzed long-term temporal and spatial variability of albedo and investigated the interrelationships between albedo and climatic variables over Antarctica. We used broadband surface albedo data from the Satellite Application Facility on Climate Monitoring and data for several climatic variables such as temperature and Antarctic oscillation index (AAO during the period of 1983 to 2009. Time series analysis and correlation analysis were performed through linear regression using albedo and climatic variables. The results of this research indicated that albedo shows two trends, west trend and an east trend, over Antarctica. Most of the western side of Antarctica showed a negative trend of albedo (about −0.0007 to −0.0015 year−1, but the other side showed a positive trend (about 0.0006 year−1. In addition, albedo and surface temperature had a negative correlation, but this relationship was weaker in west Antarctica than in east Antarctica. The correlation between albedo and AAO revealed different relationships in the two regions; west Antarctica had a negative correlation and east Antarctica showed a positive correlation. In addition, the correlation between albedo and AAO was weaker in the west. This

Spatial variability of soil CO2 emission in different topographic positions

Directory of Open Access Journals (Sweden)

Liziane de Figueiredo Brito

2010-01-01

Full Text Available The spatial variability of soil CO2 emission is controlled by several properties related to the production and transport of CO2 inside the soil. Considering that soil properties are also influenced by topography, the objective of this work was to investigate the spatial variability of soil CO2 emission in three different topographic positions in an area cultivated with sugarcane, just after mechanical harvest. One location was selected on a concave-shaped form and two others on linear-shaped form (in back-slope and foot-slope. Three grids were installed, one in each location, containing 69 points and measuring 90 x 90 m each. The spatial variability of soil CO2 emission was characterized by means of semivariance. Spatial variability models derived from soil CO2 emission were exponential in the concave location while spherical models fitted better in the linear shaped areas. The degree of spatial dependence was moderate in all cases and the range of spatial dependence for the CO2 emission in the concave area was 44.5 m, higher than the mean value obtained for the linear shaped areas (20.65 m. The spatial distribution maps of soil CO2 emission indicate a higher discontinuity of emission in the linear form when compared to the concave form.

Report: The value-for-money discourse: risks and opportunities for ...

International Development Research Centre (IDRC) Digital Library (Canada)

29 avr. 2016 ... The value-for-money discourse is gaining prominence in all areas of society. It also increasingly affects what matters to donors. This report seeks to provide a neutral assessment of value-for-money (VfM), informing and contributing to the larger on-going conversation regarding the most appropriate and ...

Genome and transcriptome studies of the protozoan parasites Trypanosoma cruzi and Giardia intestinalis

Science.gov (United States)

Farran, Alexandra J. E.

Vocal fold (VF) diseases and disorders are difficult to treat surgically or therapeutically. Tissue engineering offers an alternative strategy for the restoration of functional VF. In this work, we have developed tissue engineering methodologies for the functional reconstruction of VF. As a first step, the structure, composition and mechanical properties of native VF tissues have been investigated. In pigs ranging from fetal to 2+ years old, the VF structure and viscoelastic properties were found to be age-dependent. Adult tissues were more organized, displaying a denser lamina propria, and mature elastin fibers compared to fetal tissues, resulting in higher storage moduli. Secondly, biomimetic scaffolds which recaptured the mechanical properties of the native VF were developed. Chemically-defined collagen-hyaluronic acid (HA) composite hydrogels, and elastin-mimetic hybrid polymers (EMHPs) were successfully used as conducive 3D matrices, and 2D elastic scaffolds respectively, to in vitro static culture of fibroblasts. While the collagen-HA hydrogels allowed for in situ cell encapsulation and supported cell attachment and proliferation in 3D, the integrin-binding domain RGDSP was needed for cell proliferation on EMHPs. To emulate in vitro the mechanical environment of the native VF tissue, a dynamic culture system capable of generating vibratory stimulations at human phonation frequencies was successfully created and characterized. Gene expression analysis of fibroblasts subjected to 1 hour vibrations in 2D revealed that the expression of ECM-related genes was altered in response to changes in vibratory frequency and amplitude. Finally, expanding on our previous studies, the dynamic culture system was modified to accommodate for the long-term dynamic culture of cell-laden hydrogels. Human mesenchymal stem cells (hMSCs) encapsulated in a collagen/HA-based hydrogel, cultured in presence of connective tissue growth factor (CTGF), and subjected to high frequency

Region-to-area screening methodology for the Crystalline Repository Project

International Nuclear Information System (INIS)

1985-04-01

The purpose of this document is to describe the Crystalline Repository Project's (CRP) process for region-to-area screening of exposed and near-surface crystalline rock bodies in the three regions of the conterminous United States where crystalline rock is being evaluated as a potential host for the second nuclear waste repository (i.e., in the North Central, Northeastern, and Southeastern Regions). This document indicates how the US Department of Energy's (DOE) General Guidelines for the Recommendation of Sites for Nuclear Waste Repositories (10 CFR 960) were used to select and apply factors and variables for the region-to-area screening, explains how these factors and variable are to be applied in the region-to-area screening, and indicates how this methodology relates to the decision process leading to the selection of candidate areas. A brief general discussion of the screening process from the national survey through area screening and site recommendation is presented. This discussion sets the scene for detailed discussions which follow concerning the region-to-area screening process, the guidance provided by the DOE Siting Guidelines for establishing disqualifying factors and variables for screening, and application of the disqualifying factors and variables in the screening process. This document is complementary to the regional geologic and environmental characterization reports to be issued in the summer of 1985 as final documents. These reports will contain the geologic and environmental data base that will be used in conjunction with the methodology to conduct region-to-area screening

Evaluation of Visual Field Test Parameters after Artificial Tear Administration in Patients with Glaucoma and Dry Eye.

Science.gov (United States)

Özyol, Pelin; Özyol, Erhan; Karalezli, Aylin

2018-01-01

To examine the effect of a single dose of artificial tear administration on automated visual field (VF) testing in patients with glaucoma and dry eye syndrome. A total of 35 patients with primary open-angle glaucoma experienced in VF testing with symptoms of dry eye were enrolled in this study. At the first visit, standard VF testing was performed. At the second and third visits with an interval of one week, while the left eyes served as control, one drop of artificial tear was administered to each patient's right eye, and then VF testing was performed again. The reliability parameters, VF indices, number of depressed points at probability levels of pattern deviation plots, and test times were compared between visits. No significant difference was observed in any VF testing parameters of control eyes (P>0.05). In artificial tear administered eyes, significant improvement was observed in test duration, mean deviation, and the number of depressed points at probability levels (P˂0.5%, P˂1%, P˂2) of pattern deviation plots (P˂0.05). The post-hoc test revealed that artificial tear administration elicited an improvement in test duration, mean deviation, and the number of depressed points at probability levels (P˂0.5%, P˂1%, P˂2%) of pattern deviation plots from first visit to second and third visits (P˂0.01, for all comparisons). The intraclass correlation coefficient for the three VF test indices was found to be between 0.735 and 0.85 (P<0.001, for all). A single dose of artificial tear administration immediately before VF testing seems to improve test results and decrease test time.

THE VELOCITY FUNCTION IN THE LOCAL ENVIRONMENT FROM ΛCDM AND ΛWDM CONSTRAINED SIMULATIONS

International Nuclear Information System (INIS)

Zavala, J.; Jing, Y. P.; Faltenbacher, A.; Yepes, G.; Hoffman, Y.; Gottloeber, S.; Catinella, B.

2009-01-01

Using constrained simulations of the local universe for generic cold dark matter (CDM) and for 1 keV warm dark matter (WDM), we investigate the difference in the abundance of dark matter halos in the local environment. We find that the mass function (MF) within 20 h -1 Mpc of the Local Group is ∼2 times larger than the universal MF in the 10 9 -10 13 h -1 M sun mass range. Imposing the field of view of the ongoing H I blind survey Arecibo Legacy Fast ALFA (ALFALFA) in our simulations, we predict that the velocity function (VF) in the Virgo-direction region (VdR) exceeds the universal VF by a factor of 3. Furthermore, employing a scheme to translate the halo VF into a galaxy VF, we compare the simulation results with a sample of galaxies from the early catalog release of ALFALFA. We find that our simulations are able to reproduce the VF in the 80-300 km s -1 velocity range, having a value ∼10 times larger than the universal VF in the VdR. In the low-velocity regime, 35-80 km s -1 , the WDM simulation reproduces the observed flattening of the VF. In contrast, the simulation with CDM predicts a steep rise in the VF toward lower velocities; for V max = 35 km s -1 , it forecasts ∼10 times more sources than the ones observed. If confirmed by the complete ALFALFA survey, our results indicate a potential problem for the CDM paradigm or for the conventional assumptions about energetic feedback in dwarf galaxies.

Precipitation variability increases in a warmer climate.

Science.gov (United States)

Pendergrass, Angeline G; Knutti, Reto; Lehner, Flavio; Deser, Clara; Sanderson, Benjamin M

2017-12-21

Understanding changes in precipitation variability is essential for a complete explanation of the hydrologic cycle's response to warming and its impacts. While changes in mean and extreme precipitation have been studied intensively, precipitation variability has received less attention, despite its theoretical and practical importance. Here, we show that precipitation variability in most climate models increases over a majority of global land area in response to warming (66% of land has a robust increase in variability of seasonal-mean precipitation). Comparing recent decades to RCP8.5 projections for the end of the 21 st century, we find that in the global, multi-model mean, precipitation variability increases 3-4% K -1 globally, 4-5% K -1 over land and 2-4% K -1 over ocean, and is remarkably robust on a range of timescales from daily to decadal. Precipitation variability increases by at least as much as mean precipitation and less than moisture and extreme precipitation for most models, regions, and timescales. We interpret this as being related to an increase in moisture which is partially mitigated by weakening circulation. We show that changes in observed daily variability in station data are consistent with increased variability.

Robust cluster analysis and variable selection

CERN Document Server

Ritter, Gunter

2014-01-01

Clustering remains a vibrant area of research in statistics. Although there are many books on this topic, there are relatively few that are well founded in the theoretical aspects. In Robust Cluster Analysis and Variable Selection, Gunter Ritter presents an overview of the theory and applications of probabilistic clustering and variable selection, synthesizing the key research results of the last 50 years. The author focuses on the robust clustering methods he found to be the most useful on simulated data and real-time applications. The book provides clear guidance for the varying needs of bot

Stochastic dynamics of phase singularities under ventricular fibrillation in 2D Beeler-Reuter model

Directory of Open Access Journals (Sweden)

Akio Suzuki

2011-09-01

Full Text Available The dynamics of ventricular fibrillation (VF has been studied extensively, and the initiation mechanism of VF has been elucidated to some extent. However, the stochastic dynamical nature of sustained VF remains unclear so far due to the complexity of high dimensional chaos in a heterogeneous system. In this paper, various statistical mechanical properties of sustained VF are studied numerically in 2D Beeler-Reuter-Drouhard-Roberge (BRDR model with normal and modified ionic current conductance. The nature of sustained VF is analyzed by measuring various fluctuations of spatial phase singularity (PS such as velocity, lifetime, the rates of birth and death. It is found that the probability density function (pdf for lifetime of PSs is independent of system size. It is also found that the hyper-Gamma distribution serves as a universal pdf for the counting number of PSs for various system sizes and various parameters of our model tissue under VF. Further, it is demonstrated that the nonlinear Langevin equation associated with a hyper-Gamma process can mimic the pdf and temporal variation of the number of PSs in the 2D BRDR model.

Estimating the probability that the Taser directly causes human ventricular fibrillation.

Science.gov (United States)

Sun, H; Haemmerich, D; Rahko, P S; Webster, J G

2010-04-01

This paper describes the first methodology and results for estimating the order of probability for Tasers directly causing human ventricular fibrillation (VF). The probability of an X26 Taser causing human VF was estimated using: (1) current density near the human heart estimated by using 3D finite-element (FE) models; (2) prior data of the maximum dart-to-heart distances that caused VF in pigs; (3) minimum skin-to-heart distances measured in erect humans by echocardiography; and (4) dart landing distribution estimated from police reports. The estimated mean probability of human VF was 0.001 for data from a pig having a chest wall resected to the ribs and 0.000006 for data from a pig with no resection when inserting a blunt probe. The VF probability for a given dart location decreased with the dart-to-heart horizontal distance (radius) on the skin surface.

Quantum engineering of continuous variable quantum states

Energy Technology Data Exchange (ETDEWEB)

Sabuncu, Metin

2009-10-29

Quantum information with continuous variables is a field attracting increasing attention recently. In continuous variable quantum information one makes use of the continuous information encoded into the quadrature of a quantized light field instead of binary quantities such as the polarization state of a single photon. This brand new research area is witnessing exciting theoretical and experimental achievements such as teleportation, quantum computation and quantum error correction. The rapid development of the field is mainly due higher optical data rates and the availability of simple and efficient manipulation tools in continuous-variable quantum information processing. We in this thesis extend the work in continuous variable quantum information processing and report on novel experiments on amplification, cloning, minimal disturbance and noise erasure protocols. The promising results we obtain in these pioneering experiments indicate that the future of continuous variable quantum information is bright and many advances can be foreseen. (orig.)

Quantum engineering of continuous variable quantum states

International Nuclear Information System (INIS)

Sabuncu, Metin

2009-01-01

Quantum information with continuous variables is a field attracting increasing attention recently. In continuous variable quantum information one makes use of the continuous information encoded into the quadrature of a quantized light field instead of binary quantities such as the polarization state of a single photon. This brand new research area is witnessing exciting theoretical and experimental achievements such as teleportation, quantum computation and quantum error correction. The rapid development of the field is mainly due higher optical data rates and the availability of simple and efficient manipulation tools in continuous-variable quantum information processing. We in this thesis extend the work in continuous variable quantum information processing and report on novel experiments on amplification, cloning, minimal disturbance and noise erasure protocols. The promising results we obtain in these pioneering experiments indicate that the future of continuous variable quantum information is bright and many advances can be foreseen. (orig.)

Validation of the USGS Landsat Burned Area Essential Climate Variable (BAECV) across the conterminous United States

Science.gov (United States)

Vanderhoof, Melanie; Fairaux, Nicole; Beal, Yen-Ju G.; Hawbaker, Todd J.

2017-01-01

The Landsat Burned Area Essential Climate Variable (BAECV), developed by the U.S. Geological Survey (USGS), capitalizes on the long temporal availability of Landsat imagery to identify burned areas across the conterminous United States (CONUS) (1984–2015). Adequate validation of such products is critical for their proper usage and interpretation. Validation of coarse-resolution products often relies on independent data derived from moderate-resolution sensors (e.g., Landsat). Validation of Landsat products, in turn, is challenging because there is no corresponding source of high-resolution, multispectral imagery that has been systematically collected in space and time over the entire temporal extent of the Landsat archive. Because of this, comparison between high-resolution images and Landsat science products can help increase user's confidence in the Landsat science products, but may not, alone, be adequate. In this paper, we demonstrate an approach to systematically validate the Landsat-derived BAECV product. Burned area extent was mapped for Landsat image pairs using a manually trained semi-automated algorithm that was manually edited across 28 path/rows and five different years (1988, 1993, 1998, 2003, 2008). Three datasets were independently developed by three analysts and the datasets were integrated on a pixel by pixel basis in which at least one to all three analysts were required to agree a pixel was burned. We found that errors within our Landsat reference dataset could be minimized by using the rendition of the dataset in which pixels were mapped as burned if at least two of the three analysts agreed. BAECV errors of omission and commission for the detection of burned pixels averaged 42% and 33%, respectively for CONUS across all five validation years. Errors of omission and commission were lowest across the western CONUS, for example in the shrub and scrublands of the Arid West (31% and 24%, respectively), and highest in the grasslands and

Dicty_cDB: VFK273 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VF (Link to library) VFK273 (Link to dictyBase) - - - Contig-U16028-1 | Contig-U16311-1 VFK2...73P (Link to Original site) VFK273F 633 VFK273Z 575 VFK273P 1188 - - Show VFK273 Library VF (Link to library) Clone ID VFK2...028-1 | Contig-U16311-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-D/VFK2...73Q.Seq.d/ Representative seq. ID VFK273P (Link to Original site) Representative DNA sequence >VFK273 (VFK2...73Q) /CSM/VF/VFK2-D/VFK273Q.Seq.d/ AAATCTTTATTAATATTTTTCAAAATAAATAAATAAATAAATTAAAAATGAAAGTTTTAT

Variability of femoral muscle attachments.

Science.gov (United States)

Duda, G N; Brand, D; Freitag, S; Lierse, W; Schneider, E

1996-09-01

Analytical and experimental models of the musculoskeletal system often assume single values rather than ranges for anatomical input parameters. The hypothesis of the present study was that anatomical variability significantly influences the results of biomechanical analyses, specifically regarding the moment arms of the various thigh muscles. Insertions and origins of muscles crossing or attaching to the femur were digitized in six specimens. Muscle volumes were measured; muscle attachment area and centroid location were computed. To demonstrate the influence of inter-individual anatomic variability on a mechanical modeling parameter, the corresponding range of muscle moment arms were calculated. Standard deviations, as a percentage of the mean, were about 70% for attachment area and 80% for muscle volume and attachment centroid location. The resulting moment arms of the m. gluteus maximus and m. rectus femoris were especially sensitive to anatomical variations (SD 65%). The results indicate that sensitivity to anatomical variations should be analyzed in any investigation simulating musculoskeletal interactions. To avoid misinterpretations, investigators should consider using several anatomical configurations rather than relying on a mean data set.

DATA COLLECTION METHOD FOR PEDESTRIAN MOVEMENT VARIABLES

Directory of Open Access Journals (Sweden)

Hajime Inamura

2000-01-01

Full Text Available The need of tools for design and evaluation of pedestrian areas, subways stations, entrance hall, shopping mall, escape routes, stadium etc lead to the necessity of a pedestrian model. One approach pedestrian model is Microscopic Pedestrian Simulation Model. To be able to develop and calibrate a microscopic pedestrian simulation model, a number of variables need to be considered. As the first step of model development, some data was collected using video and the coordinate of the head path through image processing were also taken. Several numbers of variables can be gathered to describe the behavior of pedestrian from a different point of view. This paper describes how to obtain variables from video taking and simple image processing that can represent the movement of pedestrians and its variables

A Source Area Approach Demonstrates Moderate Predictive Ability but Pronounced Variability of Invasive Species Traits.

Directory of Open Access Journals (Sweden)

Günther Klonner

Full Text Available The search for traits that make alien species invasive has mostly concentrated on comparing successful invaders and different comparison groups with respect to average trait values. By contrast, little attention has been paid to trait variability among invaders. Here, we combine an analysis of trait differences between invasive and non-invasive species with a comparison of multidimensional trait variability within these two species groups. We collected data on biological and distributional traits for 1402 species of the native, non-woody vascular plant flora of Austria. We then compared the subsets of species recorded and not recorded as invasive aliens anywhere in the world, respectively, first, with respect to the sampled traits using univariate and multiple regression models; and, second, with respect to their multidimensional trait diversity by calculating functional richness and dispersion metrics. Attributes related to competitiveness (strategy type, nitrogen indicator value, habitat use (agricultural and ruderal habitats, occurrence under the montane belt, and propagule pressure (frequency were most closely associated with invasiveness. However, even the best multiple model, including interactions, only explained a moderate fraction of the differences in invasive success. In addition, multidimensional variability in trait space was even larger among invasive than among non-invasive species. This pronounced variability suggests that invasive success has a considerable idiosyncratic component and is probably highly context specific. We conclude that basing risk assessment protocols on species trait profiles will probably face hardly reducible uncertainties.

Variability in chemical composition of Vitis vinifera cv Mencía from different geographic areas and vintages in Ribeira Sacra (NW Spain).

Science.gov (United States)

Vilanova, M; Rodríguez, I; Canosa, P; Otero, I; Gamero, E; Moreno, D; Talaverano, I; Valdés, E

2015-02-15

A chemical study was conducted from 2009 to 2012 to examine spatial and seasonal variability of red Vitis vinifera Mencía located in different geographic areas (Amandi, Chantada, Quiroga-Bibei, Ribeiras do Sil and Ribeiras do Miño) from NW Spain. Mencía samples were analysed for phenolic, (flavan-3-ols, flavonols, anthocyanins, acids and resveratrol), nitrogen (TAC, TAN, YAN and TAS) and volatiles compounds (alcohols, C6 compounds, ethyl esters, terpenes, aldehydes, acids, lactones, volatile phenols and carbonyl compounds) by GC-MS and HPLC. Results showed that the composition of Mencía cultivar was more affected by the vintage than the geographic area. The amino acid composition was less affected by both geographic origin and vintage, showing more varietal stability. Application of Principal Component Analysis (PCA) to experimental data showed a good separation of Mencía grape according to geographical origin and vintages. PCA also showed high correlations between the ripening ratio and C6 compounds, resveratrol and carbonyl compounds. Copyright © 2014 Elsevier Ltd. All rights reserved.

Review of Aircraft Electric Power Systems and Architectures

DEFF Research Database (Denmark)

Zhao, Xin; Guerrero, Josep M.; Wu, Xiaohao

2014-01-01

In recent years, the electrical power capacity is increasing rapidly in more electric aircraft (MEA), since the conventional mechanical, hydraulic and pneumatic energy systems are partly replaced by electrical power system. As a consequence, capacity and complexity of aircraft electric power...... systems (EPS) will increase dramatically and more advanced aircraft EPSs need to be developed. This paper gives a brief description of the constant frequency (CF) EPS, variable frequency (VF) EPS and advanced high voltage (HV) EPS. Power electronics in the three EPS is overviewed. Keywords: Aircraft Power...... System, More Electric Aircraft, Constant Frequency, Variable Frequency, High Voltage....

Ecosystem services in European protected areas: Ambiguity in the views of scientists and managers?

Directory of Open Access Journals (Sweden)

Christiaan Hummel

Full Text Available Protected Areas are a key component of nature conservation. They can play an important role in counterbalancing the impacts of ecosystem degradation. For an optimal protection of a Protected Area it is essential to account for the variables underlying the major Ecosystem Services an area delivers, and the threats upon them. Here we show that the perception of these important variables differs markedly between scientists and managers of Protected Areas in mountains and transitional waters. Scientists emphasise variables of abiotic and biotic nature, whereas managers highlight socio-economic, cultural and anthropogenic variables. This indicates fundamental differences in perception. To be able to better protect an area it would be advisable to bring the perception of scientists and managers closer together. Intensified and harmonised communication across disciplinary and professional boundaries will be needed to implement and improve Ecosystem Service oriented management strategies in current and future Protected Areas.

Ecosystem services in European protected areas: Ambiguity in the views of scientists and managers?

Science.gov (United States)

Provenzale, Antonello; van der Meer, Jaap; Wijnhoven, Sander; Nolte, Arno; Poursanidis, Dimitris; Janss, Guyonne; Jurek, Matthias; Andresen, Magnus; Poulin, Brigitte; Kobler, Johannes; Beierkuhnlein, Carl; Honrado, João; Razinkovas, Arturas; Stritih, Ana; Bargmann, Tessa; Ziemba, Alex; Bonet-García, Francisco; Adamescu, Mihai Cristian; Janssen, Gerard; Hummel, Herman

2017-01-01

Protected Areas are a key component of nature conservation. They can play an important role in counterbalancing the impacts of ecosystem degradation. For an optimal protection of a Protected Area it is essential to account for the variables underlying the major Ecosystem Services an area delivers, and the threats upon them. Here we show that the perception of these important variables differs markedly between scientists and managers of Protected Areas in mountains and transitional waters. Scientists emphasise variables of abiotic and biotic nature, whereas managers highlight socio-economic, cultural and anthropogenic variables. This indicates fundamental differences in perception. To be able to better protect an area it would be advisable to bring the perception of scientists and managers closer together. Intensified and harmonised communication across disciplinary and professional boundaries will be needed to implement and improve Ecosystem Service oriented management strategies in current and future Protected Areas. PMID:29140983

Ecosystem services in European protected areas: Ambiguity in the views of scientists and managers?

Science.gov (United States)

Hummel, Christiaan; Provenzale, Antonello; van der Meer, Jaap; Wijnhoven, Sander; Nolte, Arno; Poursanidis, Dimitris; Janss, Guyonne; Jurek, Matthias; Andresen, Magnus; Poulin, Brigitte; Kobler, Johannes; Beierkuhnlein, Carl; Honrado, João; Razinkovas, Arturas; Stritih, Ana; Bargmann, Tessa; Ziemba, Alex; Bonet-García, Francisco; Adamescu, Mihai Cristian; Janssen, Gerard; Hummel, Herman

2017-01-01

Protected Areas are a key component of nature conservation. They can play an important role in counterbalancing the impacts of ecosystem degradation. For an optimal protection of a Protected Area it is essential to account for the variables underlying the major Ecosystem Services an area delivers, and the threats upon them. Here we show that the perception of these important variables differs markedly between scientists and managers of Protected Areas in mountains and transitional waters. Scientists emphasise variables of abiotic and biotic nature, whereas managers highlight socio-economic, cultural and anthropogenic variables. This indicates fundamental differences in perception. To be able to better protect an area it would be advisable to bring the perception of scientists and managers closer together. Intensified and harmonised communication across disciplinary and professional boundaries will be needed to implement and improve Ecosystem Service oriented management strategies in current and future Protected Areas.

Variability and climate change trend in vegetation phenology of recent decades in the Greater Khingan Mountain area, Northeastern China

Directory of Open Access Journals (Sweden)

Huan Tang

2015-09-01

Full Text Available Vegetation phenology has been used in studies as an indicator of an ecosystem’s responses to climate change. Satellite remote sensing techniques can capture changes in vegetation greenness, which can be used to estimate vegetation phenology. In this study, a long-term vegetation phenology study of the Greater Khingan Mountain area in Northeastern China was performed by using the Global Inventory Modeling and Mapping Studies (GIMMS normalized difference vegetation index version 3 (NDVI3g dataset from the years 1982–2012. After reconstructing the NDVI time series, the start date of the growing season (SOS, the end date of the growing season (EOS and the length of the growing season (LOS were extracted using a dynamic threshold method. The response of the variation in phenology with climatic factors was also analyzed. The results showed that the phenology in the study area changed significantly in the three decades between 1982 and 2012, including a 12.1-day increase in the entire region’s average LOS, a 3.3-day advance in the SOS and an 8.8-day delay in the EOS. However, differences existed between the steppe, forest and agricultural regions, with the LOSs of the steppe region, forest region and agricultural region increasing by 4.40 days, 10.42 days and 1.71 days, respectively, and a later EOS seemed to more strongly affect the extension of the growing season. Additionally, temperature and precipitation were closely correlated with the phenology variations. This study provides a useful understanding of the recent change in phenology and its variability in this high-latitude study area, and this study also details the responses of several ecosystems to climate change.

Climate influences the leaf area/sapwood area ratio in Scots pine.

Science.gov (United States)

Mencuccini, M; Grace, J

1995-01-01

We tested the hypothesis that the leaf area/sapwood area ratio in Scots pine (Pinus sylvestris L.) is influenced by site differences in water vapor pressure deficit of the air (D). Two stands of the same provenance were selected, one in western Scotland and one in eastern England, so that effects resulting from age, genetic variability, density and fertility were minimized. Compared with the Scots pine trees at the cooler and wetter site in Scotland, the trees at the warmer and drier site in England produced less leaf area per unit of conducting sapwood area both at a stem height of 1.3 m and at the base of the live crown, whereas stem permeability was similar at both sites. Also, trees at the drier site had less leaf area per unit branch cross-sectional area at the branch base than trees at the wetter site. For each site, the average values for leaf area, sapwood area and permeability were used, together with values of transpiration rates at different D, to calculate average stem water potential gradients. Changes in the leaf area/sapwood area ratio acted to maintain a similar water potential gradient in the stems of trees at both sites despite climatic differences between the sites.

Spatio-temporal variability of airborne bacterial communities and their correlation with particulate matter chemical composition across two urban areas.

Science.gov (United States)

Gandolfi, I; Bertolini, V; Bestetti, G; Ambrosini, R; Innocente, E; Rampazzo, G; Papacchini, M; Franzetti, A

2015-06-01

The study of spatio-temporal variability of airborne bacterial communities has recently gained importance due to the evidence that airborne bacteria are involved in atmospheric processes and can affect human health. In this work, we described the structure of airborne microbial communities in two urban areas (Milan and Venice, Northern Italy) through the sequencing, by the Illumina platform, of libraries containing the V5-V6 hypervariable regions of the 16S rRNA gene and estimated the abundance of airborne bacteria with quantitative PCR (qPCR). Airborne microbial communities were dominated by few taxa, particularly Burkholderiales and Actinomycetales, more abundant in colder seasons, and Chloroplasts, more abundant in warmer seasons. By partitioning the variation in bacterial community structure, we could assess that environmental and meteorological conditions, including variability between cities and seasons, were the major determinants of the observed variation in bacterial community structure, while chemical composition of atmospheric particulate matter (PM) had a minor contribution. Particularly, Ba, SO4 (2-) and Mg(2+) concentrations were significantly correlated with microbial community structure, but it was not possible to assess whether they simply co-varied with seasonal shifts of bacterial inputs to the atmosphere, or their variation favoured specific taxa. Both local sources of bacteria and atmospheric dispersal were involved in the assembling of airborne microbial communities, as suggested, to the one side by the large abundance of bacteria typical of lagoon environments (Rhodobacterales) observed in spring air samples from Venice and to the other by the significant effect of wind speed in shaping airborne bacterial communities at all sites.

Sensorimotor Learning of Acupuncture Needle Manipulation Using Visual Feedback.

Directory of Open Access Journals (Sweden)

Won-Mo Jung

Full Text Available Humans can acquire a wide variety of motor skills using sensory feedback pertaining to discrepancies between intended and actual movements. Acupuncture needle manipulation involves sophisticated hand movements and represents a fundamental skill for acupuncturists. We investigated whether untrained students could improve their motor performance during acupuncture needle manipulation using visual feedback (VF.Twenty-one untrained medical students were included, randomly divided into concurrent (n = 10 and post-trial (n = 11 VF groups. Both groups were trained in simple lift/thrusting techniques during session 1, and in complicated lift/thrusting techniques in session 2 (eight training trials per session. We compared the motion patterns and error magnitudes of pre- and post-training tests.During motion pattern analysis, both the concurrent and post-trial VF groups exhibited greater improvements in motion patterns during the complicated lifting/thrusting session. In the magnitude error analysis, both groups also exhibited reduced error magnitudes during the simple lifting/thrusting session. For the training period, the concurrent VF group exhibited reduced error magnitudes across all training trials, whereas the post-trial VF group was characterized by greater error magnitudes during initial trials, which gradually reduced during later trials.Our findings suggest that novices can improve the sophisticated hand movements required for acupuncture needle manipulation using sensorimotor learning with VF. Use of two types of VF can be beneficial for untrained students in terms of learning how to manipulate acupuncture needles, using either automatic or cognitive processes.

Relationship between optical coherence tomography, pattern electroretinogram and automated perimetry in eyes with temporal hemianopia from chiasmal compression.

Science.gov (United States)

Monteiro, Mário L R; Cunha, Leonardo P; Costa-Cunha, Luciana V F; Maia, Otacílio O; Oyamada, Maria K

2009-08-01

To evaluate the relationship between pattern electroretinogram (PERG) amplitude, macular and retinal nerve fiber layer (RNFL) thickness by optical coherence tomography (OCT), and visual field (VF) loss on standard automated perimetry (SAP) in eyes with temporal hemianopia from chiasmal compression. Forty-one eyes from 41 patients with permanent temporal VF defects from chiasmal compression and 41 healthy subjects underwent transient full-field and hemifield (temporal or nasal) stimulation PERG, SAP and time domain-OCT macular and RNFL thickness measurements. Comparisons were made using Student's t-test. Deviation from normal VF sensitivity for the central 18 degrees of VF was expressed in 1/Lambert units. Correlations between measurements were verified by linear regression analysis. PERG and OCT measurements were significantly lower in eyes with temporal hemianopia than in normal eyes. A significant correlation was found between VF sensitivity loss and full-field or nasal, but not temporal, hemifield PERG amplitude. Likewise a significant correlation was found between VF sensitivity loss and most OCT parameters. No significant correlation was observed between OCT and PERG parameters, except for nasal hemifield amplitude. A significant correlation was observed between several macular and RNFL thickness parameters. In patients with chiasmal compression, PERG amplitude and OCT thickness measurements were significant related to VF loss, but not to each other. OCT and PERG quantify neuronal loss differently, but both technologies are useful in understanding structure-function relationship in patients with chiasmal compression. (ClinicalTrials.gov number, NCT00553761).

HIV-1 resistance dynamics in patients failing dolutegravir maintenance monotherapy.

Science.gov (United States)

Wijting, Ingeborg E A; Lungu, Cynthia; Rijnders, Bart J A; van der Ende, Marchina E; Pham, Hanh T; Mesplede, Thibault; Pas, Suzan D; Voermans, Jolanda J C; Schuurman, Rob; van de Vijver, David A M C; Boers, Patrick H M; Gruters, Rob A; Boucher, Charles A B; van Kampen, Jeroen J A

2018-03-29

A high genetic resistance barrier to the integrase-strand-transfer-inhibitor (INSTI) dolutegravir has been reported in vitro and in vivo. We describe the dynamics of INSTI-resistance-associated-mutations (INSTI-RAMs) and mutations in the 3'-polypurine tract (3'-PPT) in relation to virological failure (VF) observed in the randomized dolutegravir maintenance monotherapy study (DOMONO, NCT02401828). From ten patients with VF plasma samples prior to start cART and during VF were used to generate Sanger sequences of integrase, the 5' terminal bases of the 3'- LTR, and the 3'-PPT. Median HIV-RNA (IQR) at VF was 3,490 (1,440-4,990) c/mL. INSTI-RAMs were detected in 4/10 patients (S230R, R263K, N155H, E92Q+N155H) and in 4/10 patients no INSTI-RAMs were detected (2/10 patients integrase sequencing was unsuccessful). The time-to-VF ranged from 4 weeks to 72 weeks. In one patient, mutations developed in the highly conserved 3'-PPT. No changes in the terminal bases of the 3'-LTR were observed. The genetic barrier to resistance is too low to justify dolutegravir maintenance monotherapy as single INSTI-RAMs are sufficient to cause VF. The large variation in time-to-VF suggests that stochastic reactivation of a pre-existing provirus containing a single INSTI-RAM is the mechanism for failure. Changes in the 3'-PPT point to a new dolutegravir resistance mechanism in vivo.

Earthworm eco-physiological characteristics and quantification of earthworm feeding in vermifiltration system for sewage sludge stabilization using stable isotopic natural abundance

Energy Technology Data Exchange (ETDEWEB)

Li, Xiaowei; Xing, Meiyan, E-mail: lixiaowei419@163.com; Yang, Jian; Dai, Xiaohu

2014-07-15

Highlights: • Earthworm growth biomass and activity decreased with the VF depth. • Earthworm gut microbial communities were dominated by Gammaproteobacteria. • δ{sup 15}N and δ{sup 13}C in earthworms decreased with time, and increased with the VF depth. • Effect of earthworm feeding in enhanced VSS reduction was analyzed quantitatively. • Earthworm feeding had low contribution to the enhanced VSS reduction. - Abstract: Previous studies showed that the presence of earthworm improves treatment performance of vermifilter (VF) for sewage sludge stabilization, but earthworm eco-physiological characteristics and effects in VF were not fully investigated. In this study, earthworm population, enzymatic activity, gut microbial community and stable isotopic abundance were investigated in the VF. Results showed that biomass, average weight, number and alkaline phosphatase activity of the earthworms tended to decrease, while protein content and activities of peroxidase and catalase had an increasing tendency as the VF depth. Earthworm gut microbial communities were dominated by Gammaproteobacteria, and the percentages arrived to 76–92% of the microbial species detected. {sup 15}N and {sup 13}C natural abundance of the earthworms decreased with operation time, and increased as the VF depth. Quantitative analysis using δ{sup 15}N showed that earthworm feeding and earthworm–microorganism interaction were responsible for approximately 21% and 79%, respectively, of the enhanced volatile suspended solid reduction due to the presence of earthworm. The finding provides a quantitative insight into how earthworms influence on sewage sludge stabilization in vermifiltration system.

Baseline mean deviation and rates of visual field change in treated glaucoma patients.

Science.gov (United States)

Forchheimer, I; de Moraes, C G; Teng, C C; Folgar, F; Tello, C; Ritch, R; Liebmann, J M

2011-05-01

To evaluate the relationships between baseline visual field (VF) mean deviation (MD) and subsequent progression in treated glaucoma. Records of patients seen in a glaucoma practice between 1999 and 2009 were reviewed. Patients with glaucomatous optic neuropathy, baseline VF damage, and ≥8 SITA-standard 24-2 VF were included. Patients were divided into tertiles based upon baseline MD. Automated pointwise linear regression determined global and localized rates (decibels (dB) per year) of change. Progression was defined when two or more adjacent test locations in the same hemifield showed a sensitivity decline at a rate of >1.0  dB per year, P0.50) and global rates of VF change of progressing eyes were -1.3±1.2, -1.01±0.7, and -0.9±0.5 dB/year (P=0.09, analysis of variance). Within these groups, intraocular pressure (IOP) in stable vs progressing eyes were 15.5±3.3 vs 17.0±3.1 (P0.50) and multivariate (P=0.26) analyses adjusting for differences in follow-up IOP. After correcting for differences in IOP in treated glaucoma patients, we did not find a relationship between the rate of VF change (dB per year) and the severity of the baseline VF MD. This finding may have been due to more aggressive IOP lowering in eyes with more severe disease. Eyes with lower IOP progressed less frequently across the spectrum of VF loss.

Performance of Sorghum Varieties under Variable Rainfall in Central Tanzania.

Science.gov (United States)

Msongaleli, Barnabas M; Tumbo, S D; Kihupi, N I; Rwehumbiza, Filbert B

2017-01-01

Rainfall variability has a significant impact on crop production with manifestations in frequent crop failure in semiarid areas. This study used the parameterized APSIM crop model to investigate how rainfall variability may affect yields of improved sorghum varieties based on long-term historical rainfall and projected climate. Analyses of historical rainfall indicate a mix of nonsignificant and significant trends on the onset, cessation, and length of the growing season. The study confirmed that rainfall variability indeed affects yields of improved sorghum varieties. Further analyses of simulated sorghum yields based on seasonal rainfall distribution indicate the concurrence of lower grain yields with the 10-day dry spells during the cropping season. Simulation results for future sorghum response, however, show that impacts of rainfall variability on sorghum will be overridden by temperature increase. We conclude that, in the event where harms imposed by moisture stress in the study area are not abated, even improved sorghum varieties are likely to perform poorly.

Effect of Three Types of Exogenous Organic Carbon on Soil Organic Matter and Physical Properties of a Sandy Technosol

Directory of Open Access Journals (Sweden)

Paul Robin

2018-04-01

Full Text Available Technosols made by covering agricultural soils with coastal sediments need additional organic matter (OM to be suitable for agricultural use. Climate change will likely increase the frequency and intensity of droughts in several areas. The choice of the nature and quantity of OM to add depends on dose-response curves for soil quality. This study quantifies the influence of three contrasting organic materials (vermicompost (VF, green waste compost (GWC and dairy manure (DM on four soil properties: soil organic carbon, evaporation rate, bulk density and structural stability. Soil was sampled in April and May 2014 in an artificial crop field of the vegetable production basin of Mont Saint-Michel (France made with sediments from the bay of Mont Saint-Michel in 2013. Increasing the dose of OM increased soil organic carbon from 10 to 45 g C kg−1 dry soil and increased the porosity and the structural stability, thus decreasing compaction. Increasing the dose of OM also decreased the evaporation rate. VF and DM had similar effects, while those of GWC were weaker. Compared to DM, VF had greater biological stability. Therefore, high OM inputs along with soil decompaction can increase drought resistance by increasing rooting depth and water retention.

Acute Unilateral Vestibular Failure Does Not Cause Spatial Hemineglect.

Directory of Open Access Journals (Sweden)

Julian Conrad

Full Text Available Visuo-spatial neglect and vestibular disorders have common clinical findings and involve the same cortical areas. We questioned (1 whether visuo-spatial hemineglect is not only a disorder of spatial attention but may also reflect a disorder of higher cortical vestibular function and (2 whether a vestibular tone imbalance due to an acute peripheral dysfunction can also cause symptoms of neglect or extinction. Therefore, patients with an acute unilateral peripheral vestibular failure (VF were tested for symptoms of hemineglect.Twenty-eight patients with acute VF were assessed for signs of vestibular deficits and spatial neglect using clinical measures and various common standardized paper-pencil tests. Neglect severity was evaluated further with the Center of Cancellation method. Pathological neglect test scores were correlated with the degree of vestibular dysfunction determined by the subjective visual vertical and caloric testing.Three patients showed isolated pathological scores in one or the other neglect test, either ipsilesionally or contralesionally to the VF. None of the patients fulfilled the diagnostic criteria of spatial hemineglect or extinction.A vestibular tone imbalance due to unilateral failure of the vestibular endorgan does not cause spatial hemineglect, but evidence indicates it causes mild attentional deficits in both visual hemifields.

Increasing importance of precipitation variability on global livestock grazing lands

Science.gov (United States)

Sloat, Lindsey L.; Gerber, James S.; Samberg, Leah H.; Smith, William K.; Herrero, Mario; Ferreira, Laerte G.; Godde, Cécile M.; West, Paul C.

2018-03-01

Pastures and rangelands underpin global meat and milk production and are a critical resource for millions of people dependent on livestock for food security1,2. Forage growth, which is highly climate dependent3,4, is potentially vulnerable to climate change, although precisely where and to what extent remains relatively unexplored. In this study, we assess climate-based threats to global pastures, with a specific focus on changes in within- and between-year precipitation variability (precipitation concentration index (PCI) and coefficient of variation of precipitation (CVP), respectively). Relating global satellite measures of vegetation greenness (such as the Normalized Difference Vegetation Index; NDVI) to key climatic factors reveals that CVP is a significant, yet often overlooked, constraint on vegetation productivity across global pastures. Using independent stocking data, we found that areas with high CVP support lower livestock densities than less-variable regions. Globally, pastures experience about a 25% greater year-to-year precipitation variation (CVP = 0.27) than the average global land surface area (0.21). Over the past century, CVP has generally increased across pasture areas, although both positive (49% of pasture area) and negative (31% of pasture area) trends exist. We identify regions in which livestock grazing is important for local food access and economies, and discuss the potential for pasture intensification in the context of long-term regional trends in precipitation variability.

Real variables with basic metric space topology

CERN Document Server

Ash, Robert B

2009-01-01

Designed for a first course in real variables, this text presents the fundamentals for more advanced mathematical work, particularly in the areas of complex variables, measure theory, differential equations, functional analysis, and probability. Geared toward advanced undergraduate and graduate students of mathematics, it is also appropriate for students of engineering, physics, and economics who seek an understanding of real analysis.The author encourages an intuitive approach to problem solving and offers concrete examples, diagrams, and geometric or physical interpretations of results. Deta

Ventricular fibrillation occurring after atrioventricular node ablation despite minimal difference between pre- and post-ablation heart rates.

Science.gov (United States)

Squara, F; Theodore, G; Scarlatti, D; Ferrari, E

2017-02-01

We report the case of an 82-year-old man presenting with ventricular fibrillation (VF) occurring acutely after atrioventricular node (AVN) ablation. This patient had severe valvular cardiomyopathy, chronic atrial fibrillation (AF), and underwent prior to the AVN ablation a biventricular implantable cardiac defibrillator positioning. The VF was successfully cardioverted with one external electrical shock. What makes this presentation original is that the pre-ablation spontaneous heart rate in AF was slow (84 bpm), and that VF occurred after ablation despite a minimal heart rate drop of only 14 bpm. VF is the most feared complication of AVN ablation, but it had previously only been described in case of acute heart rate drop after ablation of at least 30 bpm (and more frequently>50 bpm). This case report highlights the fact that VF may occur after AVN ablation regardless of the heart rate drop, rendering temporary fast ventricular pacing mandatory whatever the pre-ablation heart rate. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

The impact of including spatially longitudinal heterogeneities of vessel oxygen content and vascular fraction in 3D tumor oxygenation models on predicted radiation sensitivity.

Science.gov (United States)

Lagerlöf, Jakob H; Kindblom, Jon; Bernhardt, Peter

2014-04-01

Oxygen distribution models have been used to analyze the influences of oxygen tensions on tissue response after radiotherapy. These distributions are often generated assuming constant oxygen tension in the blood vessels. However, as red blood cells progress through the vessels, oxygen is continuously released into the plasma and the surrounding tissue, resulting in longitudinally varying oxygen levels in the blood vessels. In the present study, the authors investigated whether a tumor oxygenation model that incorporated longitudinally varying oxygen levels would provide different predictions of necrotic fractions and radiosensitivity compared to commonly used models with a constant oxygen pressure. Our models simulated oxygen diffusion based on a Green's function approach and oxygen consumption according to the Michaelis-Menten equation. The authors constructed tumor models with different vascular fractions (VFs), from which they generated depth oxygenation curves and a look-up table of oxygen pressure gradients. The authors evaluated models of spherical tumors of various sizes, from 1 to 10(4) mg. The authors compared the results from a model with constant vessel oxygen (CVO) pressure to those from models with longitudinal variations in oxygen saturation and either a constant VF (CVF) or variable VF (VVF) within the tumor tissue. The authors monitored the necrotic fractions, defined as tumor regions with an oxygen pressure below 1 mmHg. Tumor radiation sensitivity was expressed as D99, the homogeneous radiation dose required for a tumor control probability of 0.99. In the CVO saturation model, no necrosis was observed, and decreasing the VF could only decrease the D99 by up to 10%. Furthermore, the D99 vs VF dependence was similar for different tumor masses. Compared to the CVO model, the extended CVF and VVF models provided clearly different results, including pronounced effects of VF and tumor size on the necrotic fraction and D99, necrotic fractions ranging

Laryngeal electromyography-guided hyaluronic acid vocal fold injection for unilateral vocal fold paralysis: a prospective long-term follow-up outcome report.

Science.gov (United States)

Wang, Chen-Chi; Chang, Ming-Hong; Jiang, Rong-San; Lai, Hsiu-Chin; De Virgilio, Armando; Wang, Ching-Ping; Wu, Shang-Heng; Liu, Shi-An; Liang, Kai-Li

2015-03-01

Unilateral vocal fold paralysis (UVFP) is a common voice disorder that may cause glottal closure insufficiency with hoarseness of voice. Laryngeal electromyography (LEMG)-guided hyaluronic acid vocal fold (VF) injection has been proposed as a treatment option to improve glottal closure with a satisfactory short-term effect. To our knowledge, this study reports the first long-term follow-up result of this treatment modality. To present the long-term treatment results of LEMG-guided hyaluronic acid VF injection for UVFP. Prospective study of the treatment results of 74 patients who received LEMG-guided hyaluronic acid VF injection for UVFP at a tertiary referral medical center from March 2010 to February 2013. In the office-based procedure, 1.0 mL of hyaluronic acid was injected via a 26-gauge monopolar injectable needle electrode into paralyzed thyroarytenoid muscles by LEMG guidance. Various glottal closure evaluations such as normalized glottal gap area, maximal phonation time, phonation quotient, mean airflow rate, perceptual GRBAS (grade, roughness, breathiness, asthenia, strain) scale, and Voice Handicap Index were compared before and after injection using the nonparametric Wilcoxon signed rank test within 1 month, at 6 months, and at the last follow-up examination. Sixty patients had been followed up for at least 6 months. Forty-four patients received only 1 injection, and 16 patients received repeated injections (2 injections for 13 patients and 3 for 3 patients). All the glottal closure parameters improved significantly (P injection and 16 (22%) who received repeated injections did not require another treatment after long-term follow-up. Laryngeal electromyography-guided hyaluronic acid VF injection is an option for treating UVFP with satisfactory results.

Role of Myocardial Collagen in Severe Aortic Stenosis With Preserved Ejection Fraction and Symptoms of Heart Failure.

Science.gov (United States)

Echegaray, Kattalin; Andreu, Ion; Lazkano, Ane; Villanueva, Iñaki; Sáenz, Alberto; Elizalde, María Reyes; Echeverría, Tomás; López, Begoña; Garro, Asier; González, Arantxa; Zubillaga, Elena; Solla, Itziar; Sanz, Iñaki; González, Jesús; Elósegui-Artola, Alberto; Roca-Cusachs, Pere; Díez, Javier; Ravassa, Susana; Querejeta, Ramón

2017-10-01

We investigated the anatomical localization, biomechanical properties, and molecular phenotype of myocardial collagen tissue in 40 patients with severe aortic stenosis with preserved ejection fraction and symptoms of heart failure. Two transmural biopsies were taken from the left ventricular free wall. Mysial and nonmysial regions of the collagen network were analyzed. Myocardial collagen volume fraction (CVF) was measured by picrosirius red staining. Young's elastic modulus (YEM) was measured by atomic force microscopy in decellularized slices to assess stiffness. Collagen types I and III were measured as C I VF and C III VF, respectively, by confocal microscopy in areas with YEM evaluation. Compared with controls, patients exhibited increased mysial and nonmysial CVF and nonmysial:mysial CVF ratio (P < .05). In patients, nonmysial CVF (r = 0.330; P = .046) and the nonmysial:mysial CVF ratio (r = 0.419; P = .012) were directly correlated with the ratio of maximal early transmitral flow velocity in diastole to early mitral annulus velocity in diastole. Both the C I VF:C III VF ratio and YEM were increased (P ≤ .001) in nonmysial regions compared with mysial regions in patients, with a direct correlation (r = 0.895; P < .001) between them. These findings suggest that, in patients with severe aortic stenosis with preserved ejection fraction and symptoms of heart failure, diastolic dysfunction is associated with increased nonmysial deposition of collagen, predominantly type I, resulting in increased extracellular matrix stiffness. Therefore, the characteristics of collagen tissue may contribute to diastolic dysfunction in these patients. Copyright © 2016 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

The influence of al-madinah al-munawwara treated and untreated domestic wastewater on growth and physiology of three tomato (lycopersicon esculentum mill.) genotypes

International Nuclear Information System (INIS)

Akhkha, A.; Boutraa, T.; Shoaibi, A.K.

2017-01-01

The impact of irrigation with Al-Madinah Al-Munawwara domestic wastewater on three tomato genotypes (AL, P and VF) was investigated. Five treatments including Tap water, untreated (TN), primary (T1), secondary (T2) and tertiary (T3) treated wastewaters were used for irrigation. The physico-chemical characteristics of wastewater were determined. Leaves were analysed for N, P, K and heavy metals (Copper, Cadmium, Lead and Nickel). The growth parameters assessed were % germination, plant height, shoot and root dry weights, and total leaf dry weight. Some physiological parameters such as photosynthetic light response curve, maximum gross photosynthesis (Amax), dark respiration (DR), chlorophyll fluorescence parameters (Fo, Fm and Fv / Fm), chlorophyll content index and stomatal conductance were detected. % germination was decreased in both A1 and P genotype, with no effect on VF genotype. Most growth parameters were increased in genotype A1, followed by VF then P genotype which had a sensitive leaf dry weight to T2 and T3. Photosynthesis was mainly increased in A1 genotype with a decrease in VF genotype. DR was negatively affected in VF genotype with no response of A1 genotype. Chlorophyll fluorescence showed an increase in Fo in VF genotype but a decrease in Fv / Fm in both A1 and VF genotypes. Chlorophyll content index was decreased but only in A1 and VF genotypes under TN. Treatment with TN and / or T1 decreased stomatal conductance in all genotypes. The levels of heavy metals in wastewaters used were lower than the standard limits; however, plant chemical analysis showed that the leaves of the three tomato genotypes accumulated heavy metals but differently with higher levels at TN and lower levels at T3. (author)

The effect of short-range spatial variability on soil sampling uncertainty

Energy Technology Data Exchange (ETDEWEB)

Perk, Marcel van der [Department of Physical Geography, Utrecht University, P.O. Box 80115, 3508 TC Utrecht (Netherlands)], E-mail: m.vanderperk@geo.uu.nl; De Zorzi, Paolo; Barbizzi, Sabrina; Belli, Maria [Agenzia per la Protezione dell' Ambiente e per i Servizi Tecnici (APAT), Servizio Laboratori, Misure ed Attivita di Campo, Via di Castel Romano, 100-00128 Roma (Italy); Fajgelj, Ales; Sansone, Umberto [International Atomic Energy Agency (IAEA), Agency' s Laboratories Seibersdorf, A-1400 Vienna (Austria); Jeran, Zvonka; Jacimovic, Radojko [Jozef Stefan Institute, Jamova 39, 1000 Ljubljana (Slovenia)

2008-11-15

This paper aims to quantify the soil sampling uncertainty arising from the short-range spatial variability of elemental concentrations in the topsoils of agricultural, semi-natural, and contaminated environments. For the agricultural site, the relative standard sampling uncertainty ranges between 1% and 5.5%. For the semi-natural area, the sampling uncertainties are 2-4 times larger than in the agricultural area. The contaminated site exhibited significant short-range spatial variability in elemental composition, which resulted in sampling uncertainties of 20-30%.

The effect of short-range spatial variability on soil sampling uncertainty.

Science.gov (United States)

Van der Perk, Marcel; de Zorzi, Paolo; Barbizzi, Sabrina; Belli, Maria; Fajgelj, Ales; Sansone, Umberto; Jeran, Zvonka; Jaćimović, Radojko

2008-11-01

This paper aims to quantify the soil sampling uncertainty arising from the short-range spatial variability of elemental concentrations in the topsoils of agricultural, semi-natural, and contaminated environments. For the agricultural site, the relative standard sampling uncertainty ranges between 1% and 5.5%. For the semi-natural area, the sampling uncertainties are 2-4 times larger than in the agricultural area. The contaminated site exhibited significant short-range spatial variability in elemental composition, which resulted in sampling uncertainties of 20-30%.

Spatial variability of the physical and mineralogical properties of the soil from the areas with variation in landscape shapes

Directory of Open Access Journals (Sweden)

Zigomar Menezes de Souza

2009-04-01

Full Text Available The objective of this work it was to use the geostatistics methods to investigate the spatial relationships between the physical and mineralogical properties of an oxisol planted with the sugarcane in an area of slight variations in the landform. The soil was sampled at 10 m regular intervals in the crossing points of a 100 x 100 m grid. At each point, the soil was collected at 0.0-0.2 m, 0.2-0.4 m and 0.4-0.6 m depths for the analyzes of physical properties and at 0.6-0.8 m for the mineralogical analyses. Both the Kt/Kt+Gb ratio and Kt relative crystallization level were higher in the compartment I than in the compartment II. As a consequence, the soil penetration resistance and bulk density were higher in the compartment I, while the macroporosity and Ksat were lower. Therefore, it was concluded that both the identification and mapping of a landform were efficient for understanding the spatial variability of the soil properties. Moreover, variations in the landscape shape promoted the differentiated variability of the physical and mineralogical soil properties: the more variable the landscape, the more variable was the soil properties.Este trabalho teve como objetivo avaliar a influência das formas do relevo na variabilidade espacial de atributos físicos e suas relações com a mineralogia da argila de um Latossolo Vermelho eutroférrico, utilizando a técnica da geoestatística. Os solos foram amostrados nos pontos de cruzamento de uma malha, com intervalos regulares de 10 m, nas profundidades de 0,0-0,2 m, 0,2-0,4 m e 0,4-0,6 m para os atributos físicos e 0,6-0,8 m para os atributos mineralógicos. Os valores médios para a densidade do solo e resistência do solo à penetração são maiores no compartimento I onde a relação Ct/Ct+Gb é relativamente maior, indicando a presença de maior teor de caulinita. No compartimento II a condutividade hidráulica e a macroporsidade são maiores, influenciados provavelmente pelo predomínio da

Variable Work Hours--The MONY Experience

Science.gov (United States)

Fields, Cynthia J.

1974-01-01

An experiment with variable work hours in one department of a large company was so successful that it has become standard procedure in various corporate areas, both staff and line. The result? Increased production, fewer errors, improved employee morale, and a significant reduction in lateness and absenteeism. (Author)

Rainfall interception and spatial variability of throughfall in spruce stand

Directory of Open Access Journals (Sweden)

Dohnal Michal

2014-12-01

Full Text Available The interception was recognized as an important part of the catchment water balance in temperate climate. The mountainous forest ecosystem at experimental headwater catchment Liz has been subject of long-term monitoring. Unique dataset in terms of time resolution serves to determine canopy storage capacity and free throughfall. Spatial variability of throughfall was studied using one weighing and five tipping bucket rain gauges. The basic characteristics of forest affecting interception process were determined for the Norway spruce stand at the experimental area - the leaf area index was 5.66 - 6.00 m2 m-2, the basal area was 55.7 m2 ha-1, and the crown closure above individual rain gauges was between 19 and 95%. The total interception loss in both growing seasons analyzed was 34.5%. The mean value of the interception capacity determined was about 2 mm. Throughfall exhibited high variability from place to place and it was strongly affected by character of rainfall. On the other hand, spatial pattern of throughfall in average showed low variability.

Dicty_cDB: VFD492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VF (Link to library) VFD492 (Link to dictyBase) - - - Contig-U16603-1 VFD492P (Link to Original site) VFD492...F 516 VFD492Z 653 VFD492P 1169 - - Show VFD492 Library VF (Link to library) Clone ID VFD492...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFD4-D/VFD492Q.Seq.d/ Representative seq. ID VFD492...P (Link to Original site) Representative DNA sequence >VFD492 (VFD492Q) /CSM/VF/VFD4-D/VFD492...al 8.0 %: nuclear >> prediction for VFD492 is exc 5' end seq. ID VFD492F 5' end seq. >VFD492

Dicty_cDB: VFK244 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VF (Link to library) VFK244 (Link to dictyBase) - - - Contig-U16513-1 VFK244E (Link to Original site) VFK2...44F 710 VFK244Z 703 VFK244P 1393 VFK244E 1166 Show VFK244 Library VF (Link to library) Clone ID VFK2...ginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-B/VFK244Q.Seq.d/ Re...presentative seq. ID VFK244E (Link to Original site) Representative DNA sequence >VFK244 (VFK244Q) /CSM/VF/VFK2-B/VFK2...nsif*nlsnqnklnlfrk*k*ikkkn Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VFK244 (VFK2

Dicty_cDB: VFK242 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VF (Link to library) VFK242 (Link to dictyBase) - - - Contig-U16260-1 VFK242P (Link to Original site) VFK2...42F 606 VFK242Z 292 VFK242P 878 - - Show VFK242 Library VF (Link to library) Clone ID VFK2... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-B/VFK242Q.Seq.d/ Representative seq. ID VFK2...42P (Link to Original site) Representative DNA sequence >VFK242 (VFK242Q) /CSM/VF/VFK2-B/VFK2...eum cDNA clone:ddv63n23, 5' ... 1142 0.0 1 ( BJ427875 ) Dictyostelium discoideum cDNA clone:ddv63k24, 5' ...

Research Article Special Issue

African Journals Online (AJOL)

2017-08-08

Aug 8, 2017 ... For predicting purposes, artificial neural network (ANN) and ... This study focused on the area of the southern region in Peninsular Malaysia. ... CA was used to investigate the spatial of the sampling sites. HAC ..... In the case of MPS, the first VF1 explains 43.3% of the total variance and it has strong positive.

An immediate effect of axial neck rotation training with real time visual feedback using a smartphone inclinometer on improvement in axial neck rotation function.

Science.gov (United States)

Park, Kyue-Nam; Kwon, Oh-Yun; Kim, Si-Hyun; Jeon, In-Cheol

2017-03-01

The purpose of this study was to compare the immediate effects of axial neck rotation training (Axi-NRT) with and without real-time visual feedback (VF) using a smartphone inclinometer on the range of motion (ROM) for axial neck rotation and the onset of compensatory neck lateral bending and extension during active neck rotation. Twenty participants with restricted ROM for neck rotation but no neck pain (21.1 ± 1.6 years and 8 males, 12 females) were recruited for Axi-NRT with VF, and twenty age- and gender-matched participants with restricted ROM for neck rotation were recruited for Axi-NRT without VF. Changes in ROM for neck rotation and the onset time of compensatory neck movement during active neck rotation were measured using an electromagnetic tracking system. Axi-NRT with VF was more effective in increasing ROM for neck rotation and decreasing and delaying the onset of compensatory neck movements during active neck rotation compared with Axi-NRT without VF. Repeated Axi-NRT using VF is useful to educate participants in maintaining the axis of the cervical spine and to increase ROM for axial neck rotation with less compensatory neck motion in participants with a restricted range of neck rotations.

Mediating effects of group cohesion on physical activity and diet in women of color: health is power.

Science.gov (United States)

Lee, Rebecca E; O'Connor, Daniel P; Smith-Ray, Renae; Mama, Scherezade K; Medina, Ashley V; Reese-Smith, Jacqueline Y; Banda, Jorge A; Layne, Charles S; Brosnan, Marcella; Cubbin, Catherine; McMillan, Tracy; Estabrooks, Paul A

2012-01-01

To determine the effects and mediating factors of a physical activity (PA) or vegetable and fruit (VF) group cohesion intervention. Longitudinal design. Harris County and Travis County, Texas. Community-dwelling African-American and Hispanic or Latina women. Three hundred ten women were randomized to a PA (n  =  204) or VF (n  =  106) intervention group. Women met in groups six times over the course of 6 months and were exposed to a group cohesion intervention to promote walking or to increase VF consumption. Women completed the International PA Questionnaire, National Cancer Institute VF and fat screeners, PA Group Environment Questionnaire, and 7-day accelerometer protocol at baseline and post-intervention. The direct and mediated effects of the intervention on outcomes were evaluated using a mediational chain model, controlling for baseline values and covariates using path analysis. Women were middle aged (mean  =  44.4 years) and overweight or obese (mean body mass index  =  34.0 kg/m(2)). PA increased and fat consumption decreased for both groups, whereas VF consumption increased for women in VF group only (all p psychological and physical health benefits for African-American and Hispanic or Latina women, but refinement of measures and intervention delivery is needed to determine whether hypothesized mediational pathways are valid.

On the product and ratio of Bessel random variables

Directory of Open Access Journals (Sweden)

Saralees Nadarajah

2005-01-01

Full Text Available The distributions of products and ratios of random variables are of interest in many areas of the sciences. In this paper, the exact distributions of the product |XY| and the ratio |X/Y| are derived when X and Y are independent Bessel function random variables. An application of the results is provided by tabulating the associated percentage points.

Small-Area Estimation with Zero-Inflated Data – a Simulation Study

Directory of Open Access Journals (Sweden)

Krieg Sabine

2016-12-01

Full Text Available Many target variables in official statistics follow a semicontinuous distribution with a mixture of zeros and continuously distributed positive values. Such variables are called zero inflated. When reliable estimates for subpopulations with small sample sizes are required, model-based small-area estimators can be used, which improve the accuracy of the estimates by borrowing information from other subpopulations. In this article, three small-area estimators are investigated. The first estimator is the EBLUP, which can be considered the most common small-area estimator and is based on a linear mixed model that assumes normal distributions. Therefore, the EBLUP is model misspecified in the case of zero-inflated variables. The other two small-area estimators are based on a model that takes zero inflation explicitly into account. Both the Bayesian and the frequentist approach are considered. These small-area estimators are compared with each other and with design-based estimation in a simulation study with zero-inflated target variables. Both a simulation with artificial data and a simulation with real data from the Dutch Household Budget Survey are carried out. It is found that the small-area estimators improve the accuracy compared to the design-based estimator. The amount of improvement strongly depends on the properties of the population and the subpopulations of interest.

Spatial and temporal variability of winds in the Northern European Seas

DEFF Research Database (Denmark)

Karagali, Ioanna; Badger, Merete; Hahmann, Andrea N.

2013-01-01

the spatial and temporal variability of the near-surface wind field, including the inter- and intra-annual variability for resource assessment purposes. This study demonstrates the applicability of satellite observations as the means to provide information useful for selecting areas to perform higher...

Association of Lutzomyia longipalpis (Diptera: Psychodidae) population density with climate variables in Montes Claros, an area of American visceral leishmaniasis transmission in the state of Minas Gerais, Brazil.

Science.gov (United States)

Michalsky, Erika Monteiro; Fortes-Dias, Consuelo Latorre; França-Silva, João Carlos; Rocha, Marilia Fonseca; Barata, Ricardo Andrade; Dias, Edelberto Santos

2009-12-01

In the present paper, we evaluate the relationship between climate variables and population density of Lutzomyia longipalpis in Montes Claros, an area of active transmission of American visceral leishmaniasis (AVL) in Brazil. Entomological captures were performed in 10 selected districts of the city, between September 2002-August 2003. A total of 773 specimens of L. longipalpiswere captured in the period and the population density could be associated with local climate variables (cumulative rainfall, average temperature and relative humidity) through a mathematical linear model with a determination coefficient (Rsqr) of 0.752. Although based on an oversimplified statistical analysis, as far as the vector is concerned, this approach showed to be potentially useful as a starting point to guide control measures for AVL in Montes Claros.

Transforming variability to profitability – variable seed rates in New Zealand maize

OpenAIRE

Holmes, A

2017-01-01

The use of variable rate seeding (VRS) in arable crops to match seeding rates to areas with homogenous paddock performance, known as Management Zones (MZ) is widespread worldwide. However, VRS has not been undertaken in commercial maize crops in New Zealand. This paper outlines a single maize VRS trial carried out in the 2015/16 growing season in the Waikato, New Zealand, to investigate the relationship between different seeding rates and MZ to maximise crop yield, but also gross margin (GM)....

Decomposing global crop yield variability

Science.gov (United States)

Ben-Ari, Tamara; Makowski, David

2014-11-01

Recent food crises have highlighted the need to better understand the between-year variability of agricultural production. Although increasing future production seems necessary, the globalization of commodity markets suggests that the food system would also benefit from enhanced supplies stability through a reduction in the year-to-year variability. Here, we develop an analytical expression decomposing global crop yield interannual variability into three informative components that quantify how evenly are croplands distributed in the world, the proportion of cultivated areas allocated to regions of above or below average variability and the covariation between yields in distinct world regions. This decomposition is used to identify drivers of interannual yield variations for four major crops (i.e., maize, rice, soybean and wheat) over the period 1961-2012. We show that maize production is fairly spread but marked by one prominent region with high levels of crop yield interannual variability (which encompasses the North American corn belt in the USA, and Canada). In contrast, global rice yields have a small variability because, although spatially concentrated, much of the production is located in regions of below-average variability (i.e., South, Eastern and South Eastern Asia). Because of these contrasted land use allocations, an even cultivated land distribution across regions would reduce global maize yield variance, but increase the variance of global yield rice. Intermediate results are obtained for soybean and wheat for which croplands are mainly located in regions with close-to-average variability. At the scale of large world regions, we find that covariances of regional yields have a negligible contribution to global yield variance. The proposed decomposition could be applied at any spatial and time scales, including the yearly time step. By addressing global crop production stability (or lack thereof) our results contribute to the understanding of a key

Predicting long-term streamflow variability in moist eucalypt forests using forest growth models and a sapwood area index

Science.gov (United States)

Jaskierniak, D.; Kuczera, G.; Benyon, R.

2016-04-01

A major challenge in surface hydrology involves predicting streamflow in ungauged catchments with heterogeneous vegetation and spatiotemporally varying evapotranspiration (ET) rates. We present a top-down approach for quantifying the influence of broad-scale changes in forest structure on ET and hence streamflow. Across three catchments between 18 and 100 km2 in size and with regenerating Eucalyptus regnans and E. delegatensis forest, we demonstrate how variation in ET can be mapped in space and over time using LiDAR data and commonly available forest inventory data. The model scales plot-level sapwood area (SA) to the catchment-level using basal area (BA) and tree stocking density (N) estimates in forest growth models. The SA estimates over a 69 year regeneration period are used in a relationship between SA and vegetation induced streamflow loss (L) to predict annual streamflow (Q) with annual rainfall (P) estimates. Without calibrating P, BA, N, SA, and L to Q data, we predict annual Q with R2 between 0.68 and 0.75 and Nash Sutcliffe efficiency (NSE) between 0.44 and 0.48. To remove bias, the model was extended to allow for runoff carry-over into the following year as well as minor correction to rainfall bias, which produced R2 values between 0.72 and 0.79, and NSE between 0.70 and 0.79. The model under-predicts streamflow during drought periods as it lacks representation of ecohydrological processes that reduce L with either reduced growth rates or rainfall interception during drought. Refining the relationship between sapwood thickness and forest inventory variables is likely to further improve results.

Combined laryngeal inflammation and trauma mediate long-lasting immunoreactivity response in the brainstem sensory nuclei in the rat

Directory of Open Access Journals (Sweden)

Kristina eSimonyan

2012-11-01

Full Text Available Somatosensory feedback from the larynx plays a critical role in regulation of normal upper airway functions, such as breathing, deglutition and voice production, while altered laryngeal sensory feedback is known to elicit a variety of pathological reflex responses, including persistent coughing, dysphonia and laryngospasm. Despite its clinical impact, the central mechanisms underlying the development of pathological laryngeal responses remain poorly understood. We examined the effects of persistent vocal fold (VF inflammation and trauma, as frequent causes of long-lasting modulation of laryngeal sensory feedback, on brainstem immunoreactivity in the rat. Combined VF inflammation and trauma were induced by injection of lipopolysaccharide (LPS solution and compared to VF trauma alone from injection of vehicle solution and to controls without any VF manipulations. Using a c-fos marker, we found significantly increased Fos-like immunoreactivity (FLI in the bilateral intermediate/parvicellular reticular formation (IRF/PCRF with a trend in the left solitary tract nucleus (NTS only in animals with LPS-induced VF inflammation and trauma. Further, FLI in the right NTS was significantly correlated with the severity of LPS-induced VF changes. However, increased brainstem FLI response was not associated with FLI changes in the first-order neurons of the laryngeal afferents located in the nodose and jugular ganglia in either group. Our data indicate that complex VF alterations (i.e., inflammation/trauma vs. trauma alone may cause prolonged excitability of the brainstem nuclei receiving a direct sensory input from the larynx, which, in turn, may lead to (malplastic changes within the laryngeal central sensory control.

The impact of antecedent fire area on burned area in southern California coastal ecosystems

Science.gov (United States)

Price, Owen F.; Bradstock, Ross A.; Keeley, Jon E.; Syphard, Alexandra D.

2012-01-01

Frequent wildfire disasters in southern California highlight the need for risk reduction strategies for the region, of which fuel reduction via prescribed burning is one option. However, there is no consensus about the effectiveness of prescribed fire in reducing the area of wildfire. Here, we use 29 years of historical fire mapping to quantify the relationship between annual wildfire area and antecedent fire area in predominantly shrub and grassland fuels in seven southern California counties, controlling for annual variation in weather patterns. This method has been used elsewhere to measure leverage: the reduction in wildfire area resulting from one unit of prescribed fire treatment. We found little evidence for a leverage effect (leverage = zero). Specifically our results showed no evidence that wildfire area was negatively influenced by previous fires, and only weak relationships with weather variables rainfall and Santa Ana wind occurrences, which were variables included to control for inter-annual variation. We conclude that this is because only 2% of the vegetation burns each year and so wildfires rarely encounter burned patches and chaparral shrublands can carry a fire within 1 or 2 years after previous fire. Prescribed burning is unlikely to have much influence on fire regimes in this area, though targeted treatment at the urban interface may be effective at providing defensible space for protecting assets. These results fit an emerging global model of fire leverage which position California at the bottom end of a continuum, with tropical savannas at the top (leverage = 1: direct replacement of wildfire by prescribed fire) and Australian eucalypt forests in the middle (leverage ∼ 0.25).

Spatio-Temporal Variability of Urban Heat Island and Urban Mobility

Science.gov (United States)

Kar, B.; Omitaomu, O.

2017-12-01

A 2016 report by the U.S. Census stated that while the rural areas cover 97% of the U.S. landmass, these areas house only 19.7% of the nation's population. Given that the U.S. coastal counties are home to more than 50% of the U.S. population, these urban areas are clustered along the coast that is susceptible to sea level rise induced impacts. In light of increasing climate variability and extreme events, it is pertinent to understand the Urban Heat Island (UHI) effect that results from increasing population density and mobility in the urban areas, and that contributes to increased energy consumption and temperature as well as unmitigated flooding events. For example, in Illinois, warmer summers contribute to heavy precipitation that overwhelms the region's drainage capacity. This study focuses on understanding the spatio-temporal variability of the relationship between population density and mobility distribution, and creation of UHI due to temperature change in selected cities across the U.S. This knowledge will help us understand the role of UHI in energy-water nexus in urban areas, specifically, energy consumption.

Analysis on Residents’ Travel Activity Pattern in Historic Urban Areas: A Case Study of Historic Urban Area of Yangzhou, China

Directory of Open Access Journals (Sweden)

Mao Ye

2013-01-01

Full Text Available Travel behaviors and activity patterns in the historic urban area of a city are expected to be different from the overall situations in the city area. The primary objective of this study is to analyze the residents’ travel activity patterns in historic urban area. Based on survey data conducted in the historic urban area of Yangzhou, the travel activities of local residents in a whole day were classified into five types of patterns. The multinomial logit (MNL model was developed to evaluate the impacts of explanatory variables on the choices of activity patterns. The results showed that the choice of activity pattern was significantly impacted by five contributing factors including the gender, age, occupation, car ownership, and number of electric bikes in household. The other variables, which were the family population, preschoolers, number of conventional bikes in household, motorcycle ownership, and income, were found to be not significantly related to the choice of activities. The results of this study from historic urban area were compared to findings of previous studies from overall urban area. The comparison showed that the impacts of factors on activity pattern in the historic urban area were different from those in the overall area. Findings of this study provide important suggestions for the policy makings to improve the traffic situations in historic urban areas of cities.

Factors Associated with Low-Level Viraemia and Virological Failure: Results from the Austrian HIV Cohort Study.

Directory of Open Access Journals (Sweden)

Gisela Leierer

Full Text Available In human immunodeficiency virus treatment adequate virological suppression is warranted, nevertheless for some patients it remains a challenge. We investigated factors associated with low-level viraemia (LLV and virological failure (VF under combined antiretroviral therapy (cART.We analysed patients receiving standard regimens between 1st July 2012 and 1st July 2013 with at least one viral load (VL measurement below the quantification limit (BLQ in their treatment history. After a minimum of 6 months of unmodified cART, the next single VL measurement within 6 months was analysed. VF was defined as HIV RNA levels ≥ 200 copies/mL and all other quantifiable measurements were classified as LLV. Factors associated with LLV and VF compared to BLQ were identified by logistic regression models.Of 2276 participants, 1972 (86.6% were BLQ, 222 (9.8% showed LLV and 82 (3.6% had VF. A higher risk for LLV and VF was shown in patients with cART interruptions and in patients with boosted PI therapy. The risk for LLV and VF was lower in patients from centres using the Abbott compared to the Roche assay to measure VL. A higher risk for LLV but not for VF was found in patients with a higher VL before cART [for >99.999 copies/mL: aOR (95% CI: 4.19 (2.07-8.49; for 10.000-99.999 copies/mL: aOR (95% CI: 2.52 (1.23-5.19] and shorter cART duration [for <9 months: aOR (95% CI: 2.59 (1.38-4.86]. A higher risk for VF but not for LLV was found in younger patients [for <30 years: aOR (95% CI: 2.76 (1.03-7.35; for 30-50 years: aOR (95% CI: 2.70 (1.26-5.79], people originating from high prevalence countries [aOR (95% CI: 2.20 (1.09-4.42] and in male injecting drug users [aOR (95% CI: 2.72 (1.38-5.34].For both VF and LLV, factors associated with adherence play a prominent role. Furthermore, performance characteristics of the diagnostic assay used for VL quantification should also be taken into consideration.

Dispositional and situational variables related to evacuation at Three Mile Island

International Nuclear Information System (INIS)

Miller, I.S.

1981-01-01

The purpose of this study was to explore some of the factors influential in local residents' evacuating or remaining in the Three Mile Island area during the nuclear power plant accident of March, 1979. Investigated variables included individuals' behavioral dispositions to attend or to avoid threatening stimuli as well as situational concerns related to demographic characteristics and subjective experience. Investigation of situational variables also probed respondents' concerns about accident-related fears. Two main relationships were investigated. The first hypothesized that positive relationships existed both between dispositional attention to threat and evacuation and between dispositional avoidance of threat and remaining. The second investigation task of the research explored evacuation-related situational variables in regard to individuals' awareness of potential danger at TMI. No support was found for the hypothesized relationships between evacuation and dispositions relative to threat. Situational variables significantly related to evacuation included: specific directives to evacuate the area; disruption of telephone service during the week of the accident; and household proximity to TMI

Alpha-contingent EEG feedback reduces SPECT rCBF variability

DEFF Research Database (Denmark)

McLaughlin, Thomas; Steinberg, Bruce; Mulholland, Thomas

2005-01-01

EEG feedback methods, which link the occurrence of alpha to the presentation of repeated visual stimuli, reduce the relative variability of subsequent, alpha-blocking event durations. The temporal association between electro-cortical field activation and regional cerebral blood flow (rCBF) led us...... to investigate whether the reduced variability of alpha-blocking durations with feedback is associated with a reduction in rCBF variability. Reduced variability in the rCBF response domain under EEG feedback control might have methodological implications for future brain-imaging studies. Visual stimuli were...... to quantify the variance-reducing effects of ACS across multiple, distributed areas of the brain. Both EEG and rCBF measures demonstrated decreased variability under ACS. This improved control was seen for localized as well as anatomically distributed rCBF measures....

Spatial scales of pollution from variable resolution satellite imaging

International Nuclear Information System (INIS)

Chudnovsky, Alexandra A.; Kostinski, Alex; Lyapustin, Alexei; Koutrakis, Petros

2013-01-01

The Moderate Resolution Imaging Spectroradiometer (MODIS) provides daily global coverage, but the 10 km resolution of its aerosol optical depth (AOD) product is not adequate for studying spatial variability of aerosols in urban areas. Recently, a new Multi-Angle Implementation of Atmospheric Correction (MAIAC) algorithm was developed for MODIS which provides AOD at 1 km resolution. Using MAIAC data, the relationship between MAIAC AOD and PM 2.5 as measured by the EPA ground monitoring stations was investigated at varying spatial scales. Our analysis suggested that the correlation between PM 2.5 and AOD decreased significantly as AOD resolution was degraded. This is so despite the intrinsic mismatch between PM 2.5 ground level measurements and AOD vertically integrated measurements. Furthermore, the fine resolution results indicated spatial variability in particle concentration at a sub-10 km scale. Finally, this spatial variability of AOD within the urban domain was shown to depend on PM 2.5 levels and wind speed. - Highlights: ► The correlation between PM 2.5 and AOD decreases as AOD resolution is degraded. ► High resolution MAIAC AOD 1 km retrieval can be used to investigate within-city PM 2.5 variability. ► Low pollution days exhibit higher spatial variability of AOD and PM 2.5 then moderate pollution days. ► AOD spatial variability within urban area is higher during the lower wind speed conditions. - The correlation between PM 2.5 and AOD decreases as AOD resolution is degraded. The new high-resolution MAIAC AOD retrieval has the potential to capture PM 2.5 variability at the intra-urban scale.

Barn Owl Productivity Response to Variability of Vole Populations.

Directory of Open Access Journals (Sweden)

Petr Pavluvčík

Full Text Available We studied the response of the barn owl annual productivity to the common vole population numbers and variability to test the effects of environmental stochasticity on their life histories. Current theory predicts that temporal environmental variability can affect long-term nonlinear responses (e.g., production of young both positively and negatively, depending on the shape of the relationship between the response and environmental variables. At the level of the Czech Republic, we examined the shape of the relationship between the annual sum of fledglings (annual productivity and vole numbers in both non-detrended and detrended data. At the districts' level, we explored whether the degree of synchrony (measured by the correlation coefficient and the strength of the productivity response increase (measured by the regression coefficient in areas with higher vole population variability measured by the s-index. We found that the owls' annual productivity increased linearly with vole numbers in the Czech Republic. Furthermore, based on district data, we also found that synchrony between dynamics in owls' reproductive output and vole numbers increased with vole population variability. However, the strength of the response was not affected by the vole population variability. Additionally, we have shown that detrending remarkably increases the Taylor's exponent b relating variance to mean in vole time series, thereby reversing the relationship between the coefficient of variation and the mean. This shift was not responsible for the increased synchrony with vole population variability. Instead, we suggest that higher synchrony could result from high food specialization of owls on the common vole in areas with highly fluctuating vole populations.

Millijansky radio variability in SDSS stripe 82

Energy Technology Data Exchange (ETDEWEB)

Hodge, J. A.; Becker, R. H. [University of California, 1 Shields Avenue, Davis, CA 95616 (United States); White, R. L. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Richards, G. T., E-mail: hodge@mpia.de [Drexel University, 3141 Chestnut Street, Philadelphia, PA 19104 (United States)

2013-06-01

We report on a blind survey for extragalactic radio variability that was carried out by comparing two epochs of data from the Faint Images of the Radio Sky at Twenty centimeters survey with a third epoch from a new 1.4 GHz survey of SDSS Stripe 82. The three epochs are spaced seven years apart and have an overlapping area of 60 deg{sup 2}. We uncover 89 variable sources down to the millijansky level, 75 of which are newly identified, and we find no evidence for transient phenomena. This new sample of variable sources allows us to infer an upper limit to the mean characteristic timescale of active galactic nucleus radio variability of 14 yr. We find that only 1% of extragalactic sources have fractional variability f {sub var} > 3, while 44% of Galactic sources vary by this much. The variable sample contains a larger fraction of quasars than a comparable non-variable control sample, though the majority of the variable sources appear to be extended galaxies in the optical. This implies that either quasars are not the dominant contributor to the variability of the sample, or that the deep optical data allow us to detect the host galaxies of some low-z quasars. We use the new, higher resolution data to report on the morphology of the variable sources. Finally, we show that the fraction of sources that are variable remains constant or increases at low flux densities. This may imply that next generation radio surveys with telescopes like Australian Square Kilometer Array Pathfinder and MeerKAT will see a constant or even increasing fraction of variable sources down into the sub-millijansky regime.

77 FR 20354 - Meetings; Sunshine Act

Science.gov (United States)

2012-04-04

... storage tank containing flammable vinyl fluoride (VF). The VF vapor from interconnected, in-service... record of this incident. The Board will also consider whether to approve the CSB's draft 2012-2016...

Gowdy phenomenology in scale-invariant variables

International Nuclear Information System (INIS)

Andersson, Lars; Elst, Henk van; Uggla, Claes

2004-01-01

The dynamics of Gowdy vacuum spacetimes is considered in terms of Hubble-normalized scale-invariant variables, using the timelike area temporal gauge. The resulting state space formulation provides for a simple mechanism for the formation of 'false' and 'true spikes' in the approach to the singularity, and a geometrical formulation for the local attractor

Association of Lutzomyia longipalpis (Diptera: Psychodidae population density with climate variables in Montes Claros, an area of American visceral leishmaniasis transmission in the state of Minas Gerais, Brazil

Directory of Open Access Journals (Sweden)

Érika Monteiro Michalsky

2009-12-01

Full Text Available In the present paper, we evaluate the relationship between climate variables and population density of Lutzomyia longipalpis in Montes Claros, an area of active transmission of American visceral leishmaniasis (AVL in Brazil. Entomological captures were performed in 10 selected districts of the city, between September 2002-August 2003. A total of 773 specimens of L. longipalpiswere captured in the period and the population density could be associated with local climate variables (cumulative rainfall, average temperature and relative humidity through a mathematical linear model with a determination coefficient (Rsqr of 0.752. Although based on an oversimplified statistical analysis, as far as the vector is concerned, this approach showed to be potentially useful as a starting point to guide control measures for AVL in Montes Claros.

Comparison of climate envelope models developed using expert-selected variables versus statistical selection

Science.gov (United States)

Brandt, Laura A.; Benscoter, Allison; Harvey, Rebecca G.; Speroterra, Carolina; Bucklin, David N.; Romañach, Stephanie; Watling, James I.; Mazzotti, Frank J.

2017-01-01

Climate envelope models are widely used to describe potential future distribution of species under different climate change scenarios. It is broadly recognized that there are both strengths and limitations to using climate envelope models and that outcomes are sensitive to initial assumptions, inputs, and modeling methods Selection of predictor variables, a central step in modeling, is one of the areas where different techniques can yield varying results. Selection of climate variables to use as predictors is often done using statistical approaches that develop correlations between occurrences and climate data. These approaches have received criticism in that they rely on the statistical properties of the data rather than directly incorporating biological information about species responses to temperature and precipitation. We evaluated and compared models and prediction maps for 15 threatened or endangered species in Florida based on two variable selection techniques: expert opinion and a statistical method. We compared model performance between these two approaches for contemporary predictions, and the spatial correlation, spatial overlap and area predicted for contemporary and future climate predictions. In general, experts identified more variables as being important than the statistical method and there was low overlap in the variable sets (0.9 for area under the curve (AUC) and >0.7 for true skill statistic (TSS). Spatial overlap, which compares the spatial configuration between maps constructed using the different variable selection techniques, was only moderate overall (about 60%), with a great deal of variability across species. Difference in spatial overlap was even greater under future climate projections, indicating additional divergence of model outputs from different variable selection techniques. Our work is in agreement with other studies which have found that for broad-scale species distribution modeling, using statistical methods of variable

Cancer Related-Knowledge - Small Area Estimates

Science.gov (United States)

These model-based estimates are produced using statistical models that combine data from the Health Information National Trends Survey, and auxiliary variables obtained from relevant sources and borrow strength from other areas with similar characteristics.

Variation of runoff source areas under different soil wetness ...

African Journals Online (AJOL)

Runoff source areas can serve as focus areas for water quality monitoring and catchment management. In this study, a conceptual form of the Soil Conservation Service Curve Number method (SCS-CN) is used to define variable-source runoff areas in a meso-scale catchment in the Zagros mountain region, southwest of ...

Does early verbal fluency decline after STN implantation predict long-term cognitive outcome after STN-DBS in Parkinson's disease?

Science.gov (United States)

Borden, Alaina; Wallon, David; Lefaucheur, Romain; Derrey, Stéphane; Fetter, Damien; Verin, Marc; Maltête, David

2014-11-15

An early and transient verbal fluency (VF) decline and impairment in frontal executive function, suggesting a cognitive microlesion effect may influence the cognitive repercussions related to subthalamic nucleus deep brain stimulation (STN-DBS). Neuropsychological tests including semantic and phonemic verbal fluency were administered both before surgery (baseline), the third day after surgery (T3), at six months (T180), and at an endpoint multiple years after surgery (Tyears). Twenty-four patients (mean age, 63.5 ± 9.5 years; mean disease duration, 12 ± 5.8 years) were included. Both semantic and phonemic VF decreased significantly in the acute post-operative period (44.4 ± 28.2% and 34.3 ± 33.4%, respectively) and remained low at 6 months compared to pre-operative levels (decrease of 3.4 ± 47.8% and 10.8 ± 32.1%) (P < 0.05). Regression analysis showed phonemic VF to be an independent factor of decreased phonemic VF at six months. Age was the only independent predictive factor for incident Parkinson's disease dementia (PDD) (F (4,19)=3.4, P<0.03). An acute post-operative decline in phonemic VF can be predictive of a long-term phonemic VF deficit. The severity of this cognitive lesion effect does not predict the development of dementia which appears to be disease-related. Copyright © 2014 Elsevier B.V. All rights reserved.

Decline in verbal fluency after subthalamic nucleus deep brain stimulation in Parkinson's disease: a microlesion effect of the electrode trajectory?

Science.gov (United States)

Le Goff, Floriane; Derrey, Stéphane; Lefaucheur, Romain; Borden, Alaina; Fetter, Damien; Jan, Maryvonne; Wallon, David; Maltête, David

2015-01-01

Decline in verbal fluency (VF) is frequently reported after chronic deep brain stimulation (DBS) of the subthalamic nucleus (STN) in Parkinson disease (PD). We investigated whether the trajectory of the implanted electrode correlate with the VF decline 6 months after surgery. We retrospectively analysed 59 PD patients (mean age, 61.9 ± 7; mean disease duration, 13 ± 4.6) who underwent bilateral STN-DBS. The percentage of VF decline 6 months after STN-DBS in the on-drug/on-stimulation condition was determined in respect of the preoperative on-drug condition. The patients were categorised into two groups (decline and stable) for each VF. Cortical entry angles, intersection with deep grey nuclei (caudate, thalamic or pallidum), and anatomical extent of the STN affected by the electrode pathway, were compared between groups. A significant decline of both semantic and phonemic VF was found after surgery, respectively 14.9% ± 22.1 (P < 0.05) and 14.2% ± 30.3 (P < 0.05). Patients who declined in semantic VF (n = 44) had a left trajectory with a more anterior cortical entry point (56 ± 53 versus 60 ± 55 degree, P = 0.01) passing less frequently trough the thalamus (P = 0.03). Microlesion of left brain regions may contribute to subtle cognitive impairment following STN-DBS in PD.

Prevalence of vertebral fractures and quality of life in a sample of postmenopausal Brazilian women with osteoporosis.

Science.gov (United States)

de Oliveira Ferreira, Néville; da Silva, Raimunda Beserra; Arthuso, Michael; Pinto-Neto, Aarão Mendes; Caserta, Nelson; Costa-Paiva, Lúcia

2012-01-01

The prevalence of vertebral fracture was high in postmenopausal Brazilian osteoporotic women; quality of life was impaired regardless of vertebral fractures, despite a direct correlation between the number of vertebral fractures and a worse quality of life score. The purpose of this study is to evaluate the prevalence of vertebral fractures (VF), quality of life (QOL), association between number of VF and QOL scores, and correlate the factors associated with QOL in a sample of postmenopausal Brazilian women with osteoporosis. A cross-sectional study of 126 postmenopausal osteoporotic women aged 55-80 years was conducted. Women were interviewed about sociodemographic and clinical data, responded to QUALEFFO-41 questionnaire, and underwent vertebral radiography to measure the anterior, mean, and posterior height at each vertebra (T4 to L5). VF were classified as anterior wedge, posterior wedge, central collapse, and crush. Data was expressed as means (±SD) and frequencies, Mann-Whitney or Student's T tests were used to compare means, and odds ratio and 95 % confidence interval were used for multiple regression analysis. Values were significant when P value obesity, unemployment, sedentary lifestyle, low level of school education, and non-use of osteoporosis drugs. There was a high prevalence of VF in Brazilian postmenopausal women with osteoporosis. QOL was impaired regardless of VF, despite a direct correlation between number of VF and a worse QOL score.

Characteristics associated with virologic failure in high-risk HIV-positive participants with prior failure: a post hoc analysis of ACTG 5251.

Science.gov (United States)

Robbins, Gregory K; Cohn, Susan E; Harrison, Linda J; Smeaton, Laura; Moran, Laura; Rusin, David; Dehlinger, Marjorie; Flynn, Theresa; Lammert, Sara; Wu, Albert W; Safren, Steven A; Reynolds, Nancy R

2016-07-01

Patients with prior virologic failure (VF) are at an increased risk of subsequent failure, emergence of resistance, and death. This analysis identifies outcomes and correlates of VF in a high-risk population. A5251 was designed to evaluate an enhanced adherence counseling intervention delivered by nurses from a central call site on virologic suppression. Due to slow enrollment, the study was closed prematurely and revised study endpoints were evaluated (week 24 VF (HIV-1 RNA ≥200 copies/ml) and non-perfect adherence (antiretroviral regimen changes were three and the co-morbidity in this population was higher than typical for HIV clinical trials. At week 24 (n = 41), 24 (59%) failed to reach virologic suppression (HIV-1 RNA perceptions (IPQ-B) were associated with week 24 non-adherence. Early clinical assessments (week 12 HIV-RNA ≥200 copies/mL and non-perfect adherence) as well as higher depression and adverse illness perceptions were associated with week 24 VF. In this high-risk population, the proportion of participants with suboptimal adherence and VF was unacceptably high. Interventions to address this treatment gap are clearly needed. Depression and a higher illness perception score, failure to achieve virologic suppression by week 12, and less than perfect adherence could be used to target individuals for early interventions in treatment-experienced, high-risk individuals at high risk for VF.

Sea Surface Temperature and Ocean Color Variability in the South China Sea

Science.gov (United States)

Conaty, A. P.

2001-12-01

The South China Sea is a marginal sea in the Southeast Asian region whose surface circulation is driven by monsoons and whose surface currents have complex seasonal patterns. Its rich natural resources and strategic location have made its small islands areas of political dispute among the neighboring nations. This study aims to show the seasonal and interannual variability of sea surface temperature and ocean color in South China Sea. It makes use of NOAA's Advanced Very High Resolution Radiometer (AVHRR) satellite data sets on sea surface temperature for the period 1981-2000 and NASA's Nimbus-7 Coastal Zone Color Scanner (CZCS) and Sea-viewing Wide Field-of-view Sensor (SeaWiFS) satellite data sets on pigment concentration (ocean color) for the period 1981-1996 and 1997-2000, respectively. Transect lines were drawn along several potential hotspot areas to show the variability in sea surface temperature and pigment concentration through time. In-situ data on sea surface temperature along South China Sea were likewise plotted to see the variability with time. Higher seasonal variability in sea surface temperature was seen at higher latitudes. Interannual variability was within 1-3 Kelvin. In most areas, pigment concentration was higher during northern hemisphere winter and autumn, after the monsoon rains, with a maximum of 30 milligrams per cubic meter.

Temporal relationship between climate variability, Prosopis juliflora ...

African Journals Online (AJOL)

Normalized Difference Vegetation Index (NDVI) data derived from moderate resolution imaging spectroradiometer (MODIS) 250 m satellite imageries for 2000 to 2014 were used to determine the temporal dynamics of P. juliflora invasion in the study area. Both temperature and rainfall trends showed marked variability over ...

Evaluation of the U.S. Geological Survey Landsat burned area essential climate variable across the conterminous U.S. using commercial high-resolution imagery

Science.gov (United States)

Vanderhoof, Melanie; Brunner, Nicole M.; Beal, Yen-Ju G.; Hawbaker, Todd J.

2017-01-01

The U.S. Geological Survey has produced the Landsat Burned Area Essential Climate Variable (BAECV) product for the conterminous United States (CONUS), which provides wall-to-wall annual maps of burned area at 30 m resolution (1984–2015). Validation is a critical component in the generation of such remotely sensed products. Previous efforts to validate the BAECV relied on a reference dataset derived from Landsat, which was effective in evaluating the product across its timespan but did not allow for consideration of inaccuracies imposed by the Landsat sensor itself. In this effort, the BAECV was validated using 286 high-resolution images, collected from GeoEye-1, QuickBird-2, Worldview-2 and RapidEye satellites. A disproportionate sampling strategy was utilized to ensure enough burned area pixels were collected. Errors of omission and commission for burned area averaged 22 ± 4% and 48 ± 3%, respectively, across CONUS. Errors were lowest across the western U.S. The elevated error of commission relative to omission was largely driven by patterns in the Great Plains which saw low errors of omission (13 ± 13%) but high errors of commission (70 ± 5%) and potentially a region-growing function included in the BAECV algorithm. While the BAECV reliably detected agricultural fires in the Great Plains, it frequently mapped tilled areas or areas with low vegetation as burned. Landscape metrics were calculated for individual fire events to assess the influence of image resolution (2 m, 30 m and 500 m) on mapping fire heterogeneity. As the spatial detail of imagery increased, fire events were mapped in a patchier manner with greater patch and edge densities, and shape complexity, which can influence estimates of total greenhouse gas emissions and rates of vegetation recovery. The increasing number of satellites collecting high-resolution imagery and rapid improvements in the frequency with which imagery is being collected means greater opportunities to utilize these sources

Evaluation of Visual Field and Imaging Outcomes for Glaucoma Clinical Trials (An American Ophthalomological Society Thesis).

Science.gov (United States)

Garway-Heath, David F; Quartilho, Ana; Prah, Philip; Crabb, David P; Cheng, Qian; Zhu, Haogang

2017-08-01

To evaluate the ability of various visual field (VF) analysis methods to discriminate treatment groups in glaucoma clinical trials and establish the value of time-domain optical coherence tomography (TD OCT) imaging as an additional outcome. VFs and retinal nerve fibre layer thickness (RNFLT) measurements (acquired by TD OCT) from 373 glaucoma patients in the UK Glaucoma Treatment Study (UKGTS) at up to 11 scheduled visits over a 2 year interval formed the cohort to assess the sensitivity of progression analysis methods. Specificity was assessed in 78 glaucoma patients with up to 11 repeated VF and OCT RNFLT measurements over a 3 month interval. Growth curve models assessed the difference in VF and RNFLT rate of change between treatment groups. Incident progression was identified by 3 VF-based methods: Guided Progression Analysis (GPA), 'ANSWERS' and 'PoPLR', and one based on VFs and RNFLT: 'sANSWERS'. Sensitivity, specificity and discrimination between treatment groups were evaluated. The rate of VF change was significantly faster in the placebo, compared to active treatment, group (-0.29 vs +0.03 dB/year, P <.001); the rate of RNFLT change was not different (-1.7 vs -1.1 dB/year, P =.14). After 18 months and at 95% specificity, the sensitivity of ANSWERS and PoPLR was similar (35%); sANSWERS achieved a sensitivity of 70%. GPA, ANSWERS and PoPLR discriminated treatment groups with similar statistical significance; sANSWERS did not discriminate treatment groups. Although the VF progression-detection method including VF and RNFLT measurements is more sensitive, it does not improve discrimination between treatment arms.

SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction.

Science.gov (United States)

Boehringer, Tim; Bugert, Peter; Borggrefe, Martin; Elmas, Elif

2014-10-01

Mutations in the SCN5A gene encoding the Nav1.5 channel α-subunit are known to be risk factors of arrhythmia, including Brugada Syndrome and Long QT syndrome subtype 3. The present study focused on the role of SCN5A variants in the development of ventricular fibrillation (VF) during acute myocardial infarction (AMI). Since VF during AMI is the major cause of sudden death in the Western world, SCN5A mutations represent genetic risk factors for sudden death. By exon re-sequencing, the entire coding region and flanking intron regions were sequenced in 46 AMI/VF+ patients. In total, nine single nucleotide variants were identified of which four represented common single nucleotide polymorphisms (SNPs; 87G>A, 1673A>G, IVS16‑6C>T and 5457T>A). Only five rare variants were identified, each in only one patient. Only two of the rare variants represented missense mutations (3578G>A and 4786T>A). The common SNPs and the missense mutations were also genotyped using polymerase chain reaction methods in 79 AMI/VF‑ patients and 480 healthy controls. The SNPs did not demonstrate significant differences in allele and genotype frequencies between the study groups. The 3578G>A mutation was identified in one out of the 480 controls, whereas the 4786T>A mutation was not present in AMI/VF- patients and controls. In conclusion, the majority of AMI/VF+ patients demonstrated a wild type sequence or common SNPs in SCN5A. Only two out of 46 (4.3%) AMI/VF+ patients revealed mutations that may be involved in Nav1.5 dysfunction and VF. However, this requires further functional validation.

Dicty_cDB: [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VF (Link to library) VFB603 (Link to dictyBase) - - - Contig-U16505-1 VFB603Z (Link... to Original site) - - VFB603Z 496 - - - - Show VFB603 Library VF (Link to library) Clone ID VFB603 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16505-1 Original site URL http://dict...al 4.0 %: cytoskeletal 4.0 %: vesicles of secretory system 4.0 %: endoplasmic reticulum >> prediction for VF

Vertebral fracture prevalence among Greek healthy middle-aged postmenopausal women: association with demographics, anthropometric parameters, and bone mineral density.

Science.gov (United States)

Lambrinoudaki, Irene; Flokatoula, Maria; Armeni, Eleni; Pliatsika, Paraskevi; Augoulea, Areti; Antoniou, Aris; Alexandrou, Andreas; Creatsa, Maria; Panoulis, Constantinos; Dendrinos, Spyridon; Papacharalambous, Xenofon

2015-01-01

The prevalence of skeletal fractures shows a marked geographic variability; however, data regarding the Greek population remain limited. To evaluate the frequency of asymptomatic vertebral fractures (VFs), and potential risk factors, in a large sample of Greek postmenopausal women. A cross-sectional study at the University Menopause Clinic. Four hundred fifty-four postmenopausal women aged 35 to 80 years, with an average menopausal age of 9.2±7.1 years. They included medical history, anthropometric and biochemical parameters, bone mineral density (BMD) at lumbar spine (LS) and femoral neck (FN), and LS lateral radiographs. Lumbar spine lateral radiographs were evaluated according to quantitative procedures, aiming to identify VFs. Anthropometric and biochemical parameters and values of BMD were compared according to the presence of VFs. A total of 37 (8.15%) women had at least one VF. Lumbar spine and FN-osteoporosis was identified in up to 23.1% and 40.9% subjects with prevalent VFs, respectively. The prevalence of VFs was largely associated with age, with women aged 60 years or more presenting an up to fourfold risk compared with younger women. Moreover, the presence of VFs was associated with higher menopausal age, advanced age at menarche, a history of early menopause, and prolonged lactation. Lower LS-BMD and, especially, FN-BMD were negatively associated with VF prevalence (prevalent VF vs. no VF: LS-BMD, 0.89±0.16 g/cm(2) vs. 0.98±0.16 g/cm(2), p=.010; FN-BMD, 0.72±0.10 g/cm(2) vs. 0.81±0.12 g/cm(2), p=.008). Asymptomatic VFs are common among Greek healthy middle-aged postmenopausal women. More than 50% subjects with prevalent VFs present with normal BMD or osteopenia. Age and bone density classification at the FN presented the strongest association with the prevalence of VFs. Copyright © 2015 Elsevier Inc. All rights reserved.

A Cost-Constrained Sampling Strategy in Support of LAI Product Validation in Mountainous Areas

Directory of Open Access Journals (Sweden)

Gaofei Yin

2016-08-01

Full Text Available Increasing attention is being paid on leaf area index (LAI retrieval in mountainous areas. Mountainous areas present extreme topographic variability, and are characterized by more spatial heterogeneity and inaccessibility compared with flat terrain. It is difficult to collect representative ground-truth measurements, and the validation of LAI in mountainous areas is still problematic. A cost-constrained sampling strategy (CSS in support of LAI validation was presented in this study. To account for the influence of rugged terrain on implementation cost, a cost-objective function was incorporated to traditional conditioned Latin hypercube (CLH sampling strategy. A case study in Hailuogou, Sichuan province, China was used to assess the efficiency of CSS. Normalized difference vegetation index (NDVI, land cover type, and slope were selected as auxiliary variables to present the variability of LAI in the study area. Results show that CSS can satisfactorily capture the variability across the site extent, while minimizing field efforts. One appealing feature of CSS is that the compromise between representativeness and implementation cost can be regulated according to actual surface heterogeneity and budget constraints, and this makes CSS flexible. Although the proposed method was only validated for the auxiliary variables rather than the LAI measurements, it serves as a starting point for establishing the locations of field plots and facilitates the preparation of field campaigns in mountainous areas.

Vortex Flow in the Right Atrium Surrogates Supraventricular Arrhythmia and Thrombus After Atriopulmonary Connection-Type Fontan Operation: Vortex Flow Analysis Using Conventional Cine Magnetic Resonance Imaging.

Science.gov (United States)

Shiina, Yumi; Inai, Kei; Takahashi, Tatsunori; Shimomiya, Yamato; Ishizaki, Umiko; Fukushima, Kenji; Nagao, Michinobu

2018-02-01

We developed a novel imaging technique, designated as vortex flow (VF) mapping, which presents a vortex flow visually on conventional two-dimensional (2D) cine MRI. Using it, we assessed circumferential VF patterns and influences on RA thrombus and supraventricular tachycardia (SVT) in AP connection-type Fontan circulation. Retrospectively, we enrolled 27 consecutive patients (25.1 ± 9.2 years) and 7 age-matched controls who underwent cardiac MRI. Conventional cine images acquired using a 1.5-Tesla scanner were scanned for axial and coronal cross section of the RA. We developed "vortex flow mapping" to demonstrate the ratio of the circumferential voxel movement at each phase to the total movement throughout a cardiac cycle towards the RA center. The maximum ratio was used as a magnitude of vortex flow (MVF%) in RA cine imaging. We also measured percentages of strong and weak VF areas (VFA%). Furthermore, in 10 out of 27, we compared VF between previous CMR (3.8 ± 1.5 years ago) and latest CMR. Of the patients, 15 had cardiovascular complications (Group A); 12 did not (Group B). A transaxial image showed that strong VFA% in Group A was significantly smaller than that in Group B or controls. A coronal view revealed that strong VFA% was also smaller, and weak VFA% was larger in Group A than in Group B or controls (P < 0.05, and P < 0.05). Maximum MVF% in Group A was significantly smaller than in other groups (P < 0.001). Univariate logistic analyses revealed weak VFA% on a coronal image, and serum total bilirubin level as factors affecting cardiovascular complications (Odds ratio 1.14 and 66.1, 95% CI 1.004-1.30 and 1.59-2755.6, P values < 0.05 and < 0.05, respectively). Compared to the previous CMR, smaller maximum VMF%, smaller strong VFA%, and larger weak VFA% were identified in the latest CMR. Circumferentially weak VFA% on a coronal image can be one surrogate marker of SVT and thrombus in AP connection-type Fontan circulation. This simple VF

Dynamic plastic buckling of shells: a reconsideration of the Vaughan--Florence analysis

International Nuclear Information System (INIS)

Horvay, G.; Veluswami, M.A.; Stockton, F.D.

1979-01-01

A study aimed at extending the VF analysis to encompass axial variation of the impulse load revealed that the Ω 2 term may not be neglected, because it constitutes the only restraint on the motion that is caused by the departure from axial uniformity. This suggested reconsidering also the original VF analysis, for axial uniformity, with the Ω 2 term retained. It is found that the maximum amplification is drastically reduced by retention of the Ω 2 term, by a factor close to 3 in VF's example, and is reached in a time about 25% below that given by VF. Their critical mode number is only slightly shifted: from n = 16 to n = 17. Various ramifications of the numerical integration scheme are also explored. It is found that about N = 20000 integration steps is optimal

Induced Monoculture in Axelrod Model with Clever Mass Media

Science.gov (United States)

Rodríguez, Arezky H.; Del Castillo-Mussot, M.; Vázquez, G. J.

A new model is proposed, in the context of Axelrod's model for the study of cultural dissemination, to include an external vector field (VF) which describes the effects of mass media on social systems. The VF acts over the whole system and it is characterized by two parameters: a nonnull overlap with each agent in the society and a confidence value of its information. Beyond a threshold value of the confidence, there is induced monocultural globalization of the system lined up with the VF. Below this value, the multicultural states are unstable and certain homogenization of the system is obtained in opposite line up according to that we have called negative publicity effect. Three regimes of behavior for the spread process of the VF information as a function of time are reported.

Factors contributing to radiocaesium variability in upland sheep flocks in west Cumbria (United Kingdom)

International Nuclear Information System (INIS)

Beresford, N.A.; Barnett, C.L.; Wright, S.M.; Howard, B.J.; Crout, N.M.J.

2007-01-01

Following the Chernobyl accident in 1986, restrictions were placed on the movement and slaughter of sheep within upland areas of the UK because radiocaesium activity concentrations in their meat exceeded 1000 Bq kg -1 fresh weight. Some farms remain under restriction in 2007. From 1991 to 1993 detailed studies were conducted on three sheep farms within the restricted area of west Cumbria to systematically assess the various parameters which may contribute to the observed variability in radiocaesium activity concentrations within sheep flocks. This paper reports the spatial variation in soil and vegetation activity concentrations across the grazed areas at these farms and determines the influence of grazing behaviour on variability in 137 Cs activity concentrations between individual sheep within the flocks. Together with previously reported results, these new data are used to draw conclusions on the factors determining variability within the three flocks. However, the factors are too site specific to be able to generalise the findings to other farms within the restricted areas of the UK

Variable Selection Strategies for Small-area Estimation Using FIA Plots and Remotely Sensed Data

Science.gov (United States)

Andrew Lister; Rachel Riemann; James Westfall; Mike Hoppus

2005-01-01

The USDA Forest Service's Forest Inventory and Analysis (FIA) unit maintains a network of tens of thousands of georeferenced forest inventory plots distributed across the United States. Data collected on these plots include direct measurements of tree diameter and height and other variables. We present a technique by which FIA plot data and coregistered...

ÂNGELO, Vitor Amorim de; VILLA, Marco Antonio (Orgs. O Partido dos Trabalhadores e a política brasileira (1980-2006: uma história revisitada. São Carlos(SP: Editora: EdUFSCar, 2009 (275p.

Directory of Open Access Journals (Sweden)

REA Editor

2009-09-01

Full Text Available