WorldWideScience

Sample records for vergara lope valorar

  1. Daniel Vergara Lope and Carlos Monge Medrano: two pioneers of high altitude medicine.

    Science.gov (United States)

    Rodríguez de Romo, Ana Cecilia

    2002-01-01

    Daniel Vergara Lope from Mexico and Carlos Monge Medrano from Peru were brilliant scientists in their own countries. Both scientists studied high altitude physiology and defined the physiological and anatomical mechanisms of adaptation to high elevations. The Mexican physiologist proposed his ideas 40 years before his Peruvian counterpart. This paper studies the contribution of Vergara Lope and Monge Medrano to the understanding of high altitude medicine and proposes explanations of why history has given priority to Monge, whereas Vergara Lope is relegated to anonymity.

  2. Daniel Vergara Lope y Thomas Holmes Ravenhill: dos figuras olvidadas en la historia de la fisiología de altura

    Directory of Open Access Journals (Sweden)

    Oscar Pamo Reyna

    2005-07-01

    Full Text Available Daniel Vergara Lope (1865-1938, médico mexicano, fue un pionero de los estudios de la fisiología del habitante de las grandes alturas en la última década del siglo XIX. Y, Thomas Holmes Ravenhill (1881-1952, médico inglés, fue el primero en describir las variantes clínicas del mal de montaña agudo ("puna" o "soroche" en 1913. Sin embargo, ambas contribuciones pasaron desapercibidas, aparentemente, para los investigadores del siglo XX pero que han sido rescatadas recientemente. (Rev Med Hered 2005;16:208-217.

  3. Interview of Antonio Vergara Fernandez about the First Beam

    CERN Multimedia

    Antonio Vergara Fernandez

    2008-01-01

    Antonio Vergara Fernandez : Engineer of the LHC commissioning Questions asked : 1. What does it take to start up the LHC machine? 2. What's the plan for 1st injection day? 3. How do you feel about this?

  4. The LOPES experiment

    Energy Technology Data Exchange (ETDEWEB)

    Link, Katrin, E-mail: katrin.link@kit.edu [Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik, 76021 Karlsruhe (Germany); Apel, W.D. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Arteaga, J.C. [Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik, 76021 Karlsruhe (Germany); Asch, T. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Prozessdatenverarbeitung und Elektronik (Germany); Baehren, L. [Radboud University Nijmegen, Department of Astrophysics (Netherlands); Bekk, K. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Bluemer, J. [Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik, 76021 Karlsruhe (Germany); Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Bozdog, H. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Buchholz, P. [Universitaet Siegen, Fachbereich Physik (Germany); Buitink, S. [Radboud University Nijmegen, Department of Astrophysics (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); INAF Torino, Istituto di Fisica dello Spazio Interplanetario (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Daumiller, K. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Souza, V. de [Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik, 76021 Karlsruhe (Germany); Doll, P.; Engel, R. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany)

    2011-03-15

    Cosmic ray particles hit the Earth's atmosphere and induce extensive air showers (EAS). These EAS mainly consist of electrons and positrons that produce radio emission due to their interaction with the Earth's magnetic field. Measuring this radio emission is the purpose of the LOPES (LOFAR Prototype Station) experiment. LOPES is located at Campus North of the Karlsruhe Institute of Technology at the same site as the EAS particle detector KASCADE-Grande. Since the first measurements in 2003, LOPES was improved by various experimental setups and could establish the radio technique. By now, detailed studies of the measured radio signal are performed, like the behaviour of the lateral distribution or the polarization of the electric field. Furthermore, with LOPES the dependence of the radio pulse on properties of the incoming cosmic ray, like primary energy, primary mass, or incoming direction is investigated. In this article we describe the different LOPES setups, next we explain our standard analysis procedure and then we discuss some highlights of our recent results.

  5. De Lorca a Lope

    Directory of Open Access Journals (Sweden)

    Andrés Soria Olmedo

    2016-01-01

    Full Text Available Lorca atendió a Lope de diversos modos. Como director de La Barraca dirigió Fuenteovejuna y El caballero de Olmedo para un público popular y rural, La dama boba para el público urbano de Buenos Aires, Madrid y Barcelona, y Peribáñez y el Comendador de Ocaña para el experimental Club Teatral Anfistora, acomodando los textos y la escenografía a cada contexto. Como dramaturgo y poeta integró en su obra una serie de alusiones significativas de Lope.

  6. Antílope

    Directory of Open Access Journals (Sweden)

    Pedro Anderson Martinho Moçambique

    2015-10-01

    Full Text Available Essa espécie de antílope só é encontrada em território angolano, sendo assim um símbolo nacional. Segundo a mitologia africana é símbolo de vivacidade, velocidade e beleza - Angola.

  7. Cosmic Ray Air Shower Detection with LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Haungs, A. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany)], E-mail: haungs@ik.fzk.de; Apel, W.D.; Arteaga, J.C. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Asch, T. [Inst. Prozessdatenverarb. und Elektronik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Badea, A.F. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Baehren, L. [ASTRON, 7990 AA Dwingeloo (Netherlands); Bekk, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie, 53010 Bonn (Germany); Bluemer, J. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe, D-76021 Karlsruhe (Germany); Bozdog, H. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, P.O. Box Mg-6, RO-7690 Bucharest (Romania); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen, 57068 Siegen (Germany); Buitink, S. [Dept. of Astrophysics, Radboud University Nijmegen, 6525 ED Nijmegen (Netherlands); Butcher, H. [ASTRON, 7990 AA Dwingeloo (Netherlands); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Cossavella, F. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe, D-76021 Karlsruhe (Germany); Daumiller, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Di Pierro, F. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy)] (and others)

    2008-01-15

    LOPES is set up at the location of the KASCADE-Grande extensive air shower experiment in Karlsruhe, Germany and aims to investigate radio pulses from extensive air showers experimentally and theoretically. Data taken during half a year of operation of 10 LOPES antennas (LOPES-10), triggered by EAS observed with KASCADE-Grande have been analysed. We report about the results of correlations with shower parameters present in the radio signals measured by LOPES-10. The extended setup LOPES-30 consists of 30 antennas which have an absolute calibration and the data of which will be compared with expectations from detailed Monte-Carlo simulations. In addition, LOPES operates antennas of a different type (LOPES{sup STAR}) which are optimized for an application at the Pierre Auger Observatory.

  8. Air shower radio detection with LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Bluemer, J; Apel, W D; Arteaga, J C; Badea, F; Bekk, K; Bozdog, H; Daumiller, K [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Asch, T [Inst. Prozessdatenverarbeitung und Elektronik, Forschungszentrum Karlsruhe (Germany); Auffenberg, J [Fachbereich Physik, Universitaet Wuppertal (Germany); Baehren, L; Butcher, H [ASTRON, Dwingeloo (Netherlands); Bertaina, M; Chiavassa, A [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Biermann, P L [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Brancus, I M [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Brueggemann, M; Buchholz, P [Fachbereich Physik, Universitaet Siegen (Germany); Buitink, S [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Cossavella, F; Souza, V de [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany)], E-mail: Johannes.Bluemer@ik.fzk.de (and others)

    2008-07-15

    LOPES is an array of 30 radio antenna co-located with the KASCADE-Grande extensive air shower detector in Karlsruhe, Germany. It is designed as a digital radio interferometer for the detection of radio emission from extensive air showers. LOPES features high bandwidth and fast data processing. A unique asset is the concurrent operation with KASCADE-Grande. We report about the progress in understanding the radio signals measured by LOPES. In addition, the status and further perspectives of LOPES and the large scale application of this novel detection technique are sketched.

  9. Recent results of the LOPES experiment

    Energy Technology Data Exchange (ETDEWEB)

    Haungs, A., E-mail: haungs@ik.fzk.d [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Apel, W.D. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Arteaga, J.C. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe, D-76021 Karlsruhe (Germany); Asch, T. [Inst. Prozessdatenverarb. und Elektronik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Badea, F. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Baehren, L. [Dept. of Astrophysics, Radboud University Nijmegen, 6525 ED Nijmegen (Netherlands); Bekk, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie, 53010 Bonn (Germany); Bluemer, J. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe, D-76021 Karlsruhe (Germany); Bozdog, H. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, P.O. Box Mg-6, RO-7690 Bucharest (Romania); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen, 57068 Siegen (Germany); Buitink, S. [Dept. of Astrophysics, Radboud University Nijmegen, 6525 ED Nijmegen (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Istituto di Fisica dello Spazio Interplanetario, INAF, 10133 Torino (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Cossavella, F. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe, D-76021 Karlsruhe (Germany); Daumiller, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany)

    2009-12-15

    LOPES measures radio pulses from extensive air showers and aims to calibrate the emitted signal in the primary energy range of 10{sup 16}-10{sup 18} eV. LOPES, a digital radio interferometer using high bandwidths and fast data processing, is set up at the location of the KASCADE-Grande extensive air shower experiment in Karlsruhe, Germany and profits from the reconstructed air shower observables of KASCADE-Grande. We report about recent analysis results of the radio signals measured by LOPES.

  10. Lope and the Battle-Speech

    Directory of Open Access Journals (Sweden)

    Juan Carlos Iglesias-Zoido

    2013-05-01

    Full Text Available This article analyzes the way in which Lope de Vega conceives in his theater the pre-battle harangue, the most characteristic speech in ancient and renaissance historiography. Having this aim in mind, I have analyzed the role played by this type of speech in a group of plays dealing with historical and military subjects. These plays were written in a period when Lope was particularly interested in historical issues: La Santa Liga (1598-1603, Arauco domado (1599, El asalto de Mastrique (1595-1606 and Los Guanches de Tenerife (1604-1606.

  11. Analysis of inclined showers measured with LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Saftoiu, A. [National Institute of Physics and Nuclear Engineering Bucharest (Romania)], E-mail: allixme@gmail.com; Apel, W.D. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Arteaga, J.C. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Asch, T. [Inst. Prozessdatenverarbeitung und Elektronik, Forschungszentrum Karlsruhe (Germany); Auffenberg, J. [Fachbereich Physik, Universitaet Wuppertal (Germany); Badea, F. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Baehren, L. [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Bekk, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita, Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Bluemer, J. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Bozdog, H. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering Bucharest (Romania); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen (Germany); Buitink, S. [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita, Torino (Italy); Istituto di Fisica dello Spazio Interplanetario, INAF Torino (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita, Torino (Italy); Cossavella, F. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Daumiller, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany)] (and others)

    2009-06-01

    In the present study, we analyze the radio signal from inclined air showers recorded by LOPES-30 in coincidence with KASCADE-Grande. LOPES-30 consists of 30 East-West oriented digital antennas, which are amplitude calibrated by an external source. Radio emission from air showers is considered a geomagnetic effect. Inclined events provide a larger range of values for geomagnetic angle (angle between shower axis and geomagnetic field direction) than vertical showers and thus more information on the emission processes can be gathered. In order to have the geometry of the air shower we use the reconstruction provided by the KASCADE-Grande particle detectors array. Analyzing events observed by both LOPES and the extended part of the KASCADE array, Grande, gives the possibility to test in particular the capability and efficiency of radio detection of more distant events. The results are compared with a previous analysis of inclined events recorded by the initial 10 antenna set-up, LOPES-10, in coincidence with the Grande array.

  12. Actividad editorial en torno al tricentenario de Lope de Vega

    Directory of Open Access Journals (Sweden)

    María José Zamora Muñoz

    2016-01-01

    Full Text Available En 1935 se celebró el tricentenario de la muerte de Lope de Vega. En este trabajo se presentan las ediciones de las obras de Lope de Vega y los estudios en torno a su figura y obra publicados aquel año.

  13. Air shower measurements with the LOPES radio antenna array

    Energy Technology Data Exchange (ETDEWEB)

    Haungs, A. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany)], E-mail: andreas.haungs@ik.fzk.de; Apel, W.D. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Arteaga, J.C. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Asch, T. [Inst. Prozessdatenverarbeitung und Elektronik, Forschungszentrum Karlsruhe (Germany); Auffenberg, J. [Fachbereich Physik, Universitaet Wuppertal (Germany); Badea, F. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Baehren, L. [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Bekk, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita, Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie, Bonn (Germany); Bluemer, J. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Bozdog, H. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen (Germany); Buitink, S. [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita, Torino (Italy); Istituto di Fisica dello Spazio Interplanetario, INAF, Torino (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita, Torino (Italy); Cossavella, F. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Daumiller, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany)] (and others)

    2009-06-01

    LOPES is set up at the location of the KASCADE-Grande extensive air shower experiment in Karlsruhe, Germany and aims to measure and investigate radio pulses from extensive air showers. Since radio waves suffer very little attenuation, radio measurements allow the detection of very distant or highly inclined showers. These waves can be recorded day and night, and provide a bolometric measure of the leptonic shower component. LOPES is designed as a digital radio interferometer using high bandwidths and fast data processing and profits from the reconstructed air shower observables of KASCADE-Grande. The LOPES antennas are absolutely amplitude calibrated allowing to reconstruct the electric field strength which can be compared with predictions from detailed Monte-Carlo simulations. We report about the analysis of correlations present in the radio signals measured by the LOPES 30 antenna array. Additionally, LOPES operates antennas of a different type (LOPES{sup STAR}) which are optimized for an application at the Pierre Auger Observatory. Status, recent results of the data analysis and further perspectives of LOPES and the possible large scale application of this new detection technique are discussed.

  14. The neutron lifetime experiment PENeLOPE

    Energy Technology Data Exchange (ETDEWEB)

    Schreyer, Wolfgang [Technische Universitaet Muenchen (Germany); Collaboration: PENeLOPE-Collaboration

    2015-07-01

    The neutron lifetime τ{sub n}=880.3±1.1 s is an important parameter in the Standard Model of particle physics and in Big Bang cosmology. Several systematic corrections of previously published results reduced the PDG world average by several σ in the last years and call for a new experiment with complementary systematics. The experiment PENeLOPE, currently under construction at the Physik-Department of Technische Universitaet Muenchen, aims to determine the neutron lifetime with a precision of 0.1 s. It will trap ultra-cold neutrons in a magneto-gravitational trap using a large superconducting magnet and will measure their lifetime by both neutron counting and online proton detection. This presentation gives an overview over the latest developments of the experiment.

  15. Adília Lopes – ironista

    Directory of Open Access Journals (Sweden)

    Rosa Maria Martelo

    2004-10-01

    Full Text Available O nome Adília Lopes tanto designa uma leitora profundamente interessada pela tradição poética erudita como uma assumida “poetisa pop”. E enquanto a primeira gosta de recordar referências fundamentais da Modernidade, de Rimbaud a Apollinaire, de Cesário a Pessoa, derivando para Sophia, Herberto Helder ou Sylvia Plath, ou facilmente recua no tempo literário ocidental até Diderot, S. João da Cruz e Virgílio, a segunda parece valorizar mais todo um outro universo de escrita, no qual avultam os contos infantis, as leituras da adolescência, o folhetinesco e o fait-divers das revistas femininas. Sem nunca pôr de parte as referências literárias de Adília-leitoraerudita, é sobretudo este o mundo que a “poetisa pop” gosta de reescrever, mostrando até que ponto ele é atravessado por uma insidiosa crueldade e tornando indistintas as fronteiras que o separavam (separam? da Literatura. Entre cultura erudita e cultura de massas, entre referências eruditas e uma linguagem muito próxima dos registros orais pouco vigiados, usando um verso que, por vezes, parece premeditadamente distraído num ritmo muito fácil, Adília Lopes faz apelo à memória de um mundo adolescente onde o bem e o mal, o alto e o baixo, o bom e o mau gosto pareciam irredutivelmente distintos, para tudo indiferenciar, agora, com dessacralizadora ironia. 

  16. Entre la religión y la política: Hernán Vergara Delgado. In memoriam.

    Directory of Open Access Journals (Sweden)

    César Augusto Ayala Diago.

    2000-06-01

    Full Text Available El artículo trata de reconstruir y analizar algunos instantes de la vida pública del psiquiatra y teólogo colombiano Hernán Vergara Delgado (muerto el 21 de julio de 1999, en particular aquéllos que lo marcaron y que pasaron a ser referentes obligatorios en su vida y obra: el "Movimiento Testimonio", entre 1949 y 1957; su posterior lucha contra la politica demográfica del presidente Carlos Lleras Restrepo; y, finalmente, su vinculación con la Anapo, en la década del sesenta. El artículo analiza el paso de Vergara por este movimiento politico, considerado por él como el único comprometido en el desmonte de las medidas anticonceptivas del Frente Nacional. El artículo demuestra que la influencia espiritual de Vergara en Rojas Pinilla fue decisiva para que el general no reclamara el triunfo electoral de 1970.

  17. GOYA LOPES - Journey of a Creator

    Directory of Open Access Journals (Sweden)

    Maria Auxiliadora dos Santos Goya Lopes

    2016-06-01

    Full Text Available This article presents the launching of a fashion and decoration trend linked to the African and/or Afro-Brazilian world. It was created with the purpose of meeting the market demands that envisioned a brand with this cultural identity. It is a biographical text illustrated with photos and drawings from the author's artistic production. The article is developed in three parts: the author’s motivation since her childhood when she discovered she had a distinctive way of drawing; her training as a plastic artist and designer; and her entrepreneurship strategy to successfully develop and market a fabric stamping pattern with its own personality.The contribution of this AfroBrazilian pioneering design work paved the way for the examination of a new style that has not yet been sufficiently explored in the fashion world. The article reflects on the experience of Goya Lopes as an artist, designer and businesswoman, portraying her career and training, and also how the motivation throughout her life contributed to the creation of this authored work.

  18. An Approach to the Topic of Cheating in some Comedies by Lope de Vega

    Directory of Open Access Journals (Sweden)

    Juan Antonio Martínez Berbel

    2015-05-01

    Full Text Available This paper gives an overview of the different mechanisms of deception in the plays of Lope de Vega. The typology of these delusions is reviewed and then applied to several Lope de Vega’s plays.

  19. Lope de Vega y el Greco: 'Ut pictura poesis' en el Toledo del siglo XVII

    NARCIS (Netherlands)

    Sánchez Jiménez, A.; Olivares, J.

    2011-01-01

    Lope de Vega boasted of having praised all the poets and painters of his time, and although that is mostly true, Lope never praised or even mentioned some great painters whom he must necessarily have met. This article studies Lope's relationship with one of those painters, El Greco, by comparing a

  20. Measurement of radio emission from extensive air showers with LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Hoerandel, J.R., E-mail: j.horandel@astro.ru.n [Radboud University Nijmegen, Department of Astrophysics, P.O. Box 9010, 6500 GL Nijmegen (Netherlands); Apel, W.D. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Arteaga, J.C. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Asch, T. [IPE, Forschungszentrum Karlsruhe (Germany); Badea, F. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Baehren, L. [Radboud University Nijmegen, Department of Astrophysics, P.O. Box 9010, 6500 GL Nijmegen (Netherlands); Bekk, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita di Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Bluemer, J. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Bozdog, H. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen (Germany); Buitink, S. [Radboud University Nijmegen, Department of Astrophysics, P.O. Box 9010, 6500 GL Nijmegen (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita di Torino (Italy); Istituto di Fisica dello Spazio Interplan etario, INAF Torino (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita di Torino (Italy); Cossavella, F. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Daumiller, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Souza, V. de [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany)

    2011-02-21

    A new method is explored to detect extensive air showers: the measurement of radio waves emitted during the propagation of the electromagnetic shower component in the magnetic field of the Earth. Recent results of the pioneering experiment LOPES are discussed. It registers radio signals in the frequency range between 40 and 80 MHz. The intensity of the measured radio emission is investigated as a function of different shower parameters, such as shower energy, angle of incidence, and distance to shower axis. In addition, new antenna types are developed in the framework of LOPES{sup star} and new methods are explored to realize a radio self-trigger algorithm in real time.

  1. Mujeres y criados, una comedia recuperada de Lope de Vega

    Directory of Open Access Journals (Sweden)

    García-Reidy, Alejandro

    2013-12-01

    Full Text Available Lope de Vega’s corpus of plays is one of the most studied of Spanish Baroque theater, although it still presents numerous problems that need to be solved. In this article I study the extant manuscript of a play entitled Mujeres y criados in relation to a play by Lope of the same title, which several catalogues consider lost. In the first part of my paper I prove Lope’s authorship of the play based on internal elements of the text and the manuscript’s relation to several seventeenth-century documents. In the second part of this article I study the most relevant characteristics of this play. I focus my attention on the traits of the urban comedy it presents, the subversion of certain themes —such as social hierarchies or honor— that takes place and the predominant role Lope gave women in the play’s plot.El corpus dramático de Lope de Vega es uno de los más estudiados en el teatro barroco español, pero todavía encierra numerosas lagunas que quedan por aclarar. En el presente trabajo estudio el manuscrito que se conserva de una comedia titulada Mujeres y criados en relación con una comedia homónima de Lope que varios catálogos dan por perdida. En la primera parte demuestro la autoría lopesca de la obra a partir de elementos internos del texto y de la relación que guarda el manuscrito con noticias proporcionadas por documentación de la época. En la segunda parte del artículo estudio las características más relevantes de esta comedia, destacando su inserción en el género de la comedia urbana, la subversión que se lleva a cabo de ciertos temas, como las jerarquías sociales o el honor, y el papel predominante que Lope concede a las mujeres en la trama de la obra.

  2. Radio detection of cosmic ray air showers with LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Huege, T.; Apel, W.D. [IK, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); Asch, T. [IPE, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); Badea, A.F. [IK, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); Baehren, L. [ASTRON, 7990 AA Dwingeloo (Netherlands); Bekk, K. [IK, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); Bercuci, A. [Nat. Inst. of Physics and Nuclear Eng., 7690 Bucharest (Romania); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie, 53121 Bonn (Germany); Bluemer, J. [IK, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); IEKP, Universitaet Karlsruhe, 76021 Karlsruhe (Germany); Bozdog, H. [IK, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); Brancus, I.M. [Nat. Inst. of Physics and Nuclear Eng., 7690 Bucharest (Romania); Buitink, S. [Dpt. Astrophysics, Radboud Univ., 6525 ED Nijmegen (Netherlands); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen, 57072 Siegen (Germany); Butcher, H. [ASTRON, 7990 AA Dwingeloo (Netherlands); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Cossavella, F. [IEKP, Universitaet Karlsruhe, 76021 Karlsruhe (Germany); Daumiller, K. [IK, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); Di Pierro, F. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy)] (and others)

    2007-03-15

    In the last few years, radio detection of cosmic ray air showers has experienced a true renaissance, becoming manifest in a number of new experiments and simulation efforts. In particular, the LOPES project has successfully implemented modern interferometric methods to measure the radio emission from extensive air showers. LOPES has confirmed that the emission is coherent and of geomagnetic origin, as expected by the geosynchrotron mechanism, and has demonstrated that a large scale application of the radio technique has great potential to complement current measurements of ultra-high energy cosmic rays. We describe the current status, most recent results and open questions regarding radio detection of cosmic rays and give an overview of ongoing research and development for an application of the radio technique in the framework of the Pierre Auger Observatory.

  3. The LOPES experiment - Recent results, status and perspectives

    Energy Technology Data Exchange (ETDEWEB)

    Huege, T., E-mail: tim.huege@kit.edu [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Apel, W.D. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Arteaga, J.C. [Karlsruhe Institute of Technology (KIT) - Campus South, Institut fuer Experimentelle Kernphysik (Germany); Asch, T. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Prozessdatenverarbeitung und Elektronik (Germany); Baehren, L. [Radboud University Nijmegen, Department of Astrophysics (Netherlands); Bekk, K. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell& #x27; Universita Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Bluemer, J. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Karlsruhe Institute of Technology (KIT) - Campus South, Institut fuer Experimentelle Kernphysik (Germany); Bozdog, H. [Karlsruhe Institute of Technology (KIT) - Campus North, Institut fuer Kernphysik (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Buchholz, P. [Universitaet Siegen, Fachbereich Physik (Germany); Buitink, S. [Radboud University Nijmegen, Department of Astrophysics (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell& #x27; Universita Torino (Italy); INAF Torino, Istituto di Fisica dello Spazio Interplanetario (Italy); and others

    2012-01-11

    The LOPES experiment at the Karlsruhe Institute of Technology has been taking radio data in the frequency range from 40 to 80 MHz in coincidence with the KASCADE-Grande air shower detector since 2003. Various experimental configurations have been employed to study aspects such as the energy scaling, geomagnetic dependence, lateral distribution, and polarization of the radio emission from cosmic rays. The high quality per-event air shower information provided by KASCADE-Grande has been the key to many of these studies and has even allowed us to perform detailed per-event comparisons with simulations of the radio emission. In this article, we give an overview of results obtained by LOPES, and present the status and perspectives of the ever-evolving experiment.

  4. Rendering potential wearable robot designs with the LOPES gait trainer.

    Science.gov (United States)

    Koopman, B; van Asseldonk, E H F; van der Kooij, H; van Dijk, W; Ronsse, R

    2011-01-01

    In recent years, wearable robots (WRs) for rehabilitation, personal assistance, or human augmentation are gaining increasing interest. To make these devices more energy efficient, radical changes to the mechanical structure of the device are being considered. However, it remains very difficult to predict how people will respond to, and interact with, WRs that differ in terms of mechanical design. Users may adjust their gait pattern in response to the mechanical restrictions or properties of the device. The goal of this pilot study is to show the feasibility of rendering the mechanical properties of different potential WR designs using the robotic gait training device LOPES. This paper describes a new method that selectively cancels the dynamics of LOPES itself and adds the dynamics of the rendered WR using two parallel inverse models. Adaptive frequency oscillators were used to get estimates of the joint position, velocity, and acceleration. Using the inverse models, different WR designs can be evaluated, eliminating the need to build several prototypes. As a proof of principle, we simulated the effect of a very simple WR that consisted of a mass attached to the ankles. Preliminary results show that we are partially able to cancel the dynamics of LOPES. Additionally, the simulation of the mass showed an increase in muscle activity but not in the same level as during the control, where subjects actually carried the mass. In conclusion, the results in this paper suggest that LOPES can be used to render different WRs. In addition, it is very likely that the results can be further optimized when more effort is put in retrieving proper estimations for the velocity and acceleration, which are required for the inverse models. © 2011 IEEE

  5. Investigations of the radio signal of inclined showers with LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Saftoiu, A., E-mail: allixme@gmail.com [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Apel, W.D. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik, 76021 Karlsruhe (Germany); Arteaga, J.C. [Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik, 76021 Karlsruhe (Germany); Asch, T. [Karlsruhe Institute of Technology (KIT), Institut fuer Prozessdatenverarbeitung und Elektronik, 76021 Karlsruhe (Germany); Baehren, L. [Radboud University Nijmegen, Department of Astrophysics (Netherlands); Bekk, K. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik, 76021 Karlsruhe (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell& #x27; Universita Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Bluemer, J. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik, 76021 Karlsruhe (Germany); Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik, 76021 Karlsruhe (Germany); Bozdog, H. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik, 76021 Karlsruhe (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Buchholz, P. [Universitaet Siegen, Fachbereich Physik (Germany); Buitink, S. [Radboud University Nijmegen, Department of Astrophysics (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell& #x27; Universita Torino (Italy); INAF Torino, Istituto di Fisica dello Spazio Interplanetario (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell& #x27; Universita Torino (Italy); and others

    2012-01-11

    We report in this paper on an analysis of 20 months of data taken with LOPES. LOPES is radio antenna array set-up in coincidence with the Grande array, both located at the Karlsruhe Institute of Technology, Germany. The data used in this analysis were taken with an antenna configuration composed of 30 inverted V-shape dipole antennas. We have restricted the analysis to a special selection of inclined showers - with zenith angle {theta}>40{sup Ring-Operator }. These inclined showers are of particular interest because they are the events with the largest geomagnetic angles and are therefore suitable to test emission models based on geomagnetic effects.The reconstruction procedure of the emitted radio signal in EAS uses as one ingredient the frequency-dependent antenna gain pattern which is obtained from simulations. Effects of the applied antenna model in the calibration procedure of LOPES are studied. In particular, we have focused on one component of the antenna, a metal pedestal, which generates a resonance effect, a peak in the amplification pattern where it is the most affecting high zenith angles, i.e. inclined showers. In addition, polarization characteristics of inclined showers were studied in detail and compared with the features of more vertical showers for the two cases of antenna models, with and without the pedestal.

  6. First clinical results with the new innovative robotic gait trainer LOPES

    NARCIS (Netherlands)

    Nikamp-Simons, Corien Diana Maria; van Asseldonk, Edwin H.F.; Folkersma, Marjanne; van den Hoek, Joelle; Postma, Martijn; Buurke, Jaap

    The results of five chronic stroke patients in a first explorative training study using the new robotic device LOPES are presented. Conclusions Positive effects of gait training in LOPES were found in four out of five subjects. Future study will focus on including larger sample sizes and introducing

  7. Lope y Boccalini: Tres sonetos de Tomé de Burguillos

    Directory of Open Access Journals (Sweden)

    Arellano, Ignacio

    2012-12-01

    Full Text Available The article analyzes three sonnets of Lope against Traiano Boccalini included in the Rhymes of Tomé de Burguillos, showing the need to compare the Lope´s text with the italian original version of Ragguagli di Parnaso, not with spanish translation of Perez de Sousa, because in this translation are deleted essential passages to understand the game of wit of Lope. These three sonnets are a good example of the complexity of this exercise of conceptism in Lope, whose poetry can not be described as plain, simple and clear: it is a difficult poetry full of games, intertextual allusions and references that should be clarified applying the type of appropiate reading.Se analizan tres sonetos de Lope contra el italiano Traiano Boccalini, incluidos en las Rimas de Tomé de Burguillos, mostrando la necesidad de comparar el texto de Lope con el de los Ragguagli di Parnaso, en su versión original italiana, y no en la traducción de Perez de Sousa, que elimina pasajes necesarios para entender los juegos de Lope. Estos tres sonetos son buena muestra de la complejidad que puede tener este ejercicio de agudeza de Lope, cuya poesía no se puede calificar sin más de llana, sencilla o clara: es una poesía conceptista llena de juegos, alusiones y referencias intertextuales que deben ser aclaradas si se quiere aplicar a estos poemas el tipo de lectura que exigen.

  8. The Bestiary in Lope de Vega’s Sacramental Plays

    Directory of Open Access Journals (Sweden)

    Enrique Duarte Lueiro

    2017-05-01

    Full Text Available In the critical bibliography referred to Lope de Vega, the scholar usually finds the image of this author as a forerunner of Calderón. A good strategy to verify this impression is through partial studies as this devoted to the analysis of the bestiary in the sacramental plays. This article analyses the bestiary assigned to Christ, the devil and others more eclectic references ascribed to metaphorical expressions, or biblical characters. In short, the author proves that there is a strategy of performance through associative nets (that combines biblical text, patristic references, emblems, sculpture and painting laying down the way to the magnificense of Calderón.

  9. En el tricentenario de Lope de Vega: «La Dorotea» de Eduardo Marquina

    Directory of Open Access Journals (Sweden)

    Antonella Russo

    2016-01-01

    Full Text Available En enero de 1935, en el Teatro Cómico de Madrid, Eduardo Marquina estrena La Dorotea. Comedia en verso, en tres jornadas, inspirada en la famosa obra de Lope de Vega. El presente estudio pretende analizar la pieza del dramaturgo catalán, sus relaciones intertextuales con el texto del Fénix, así como su significado y recepción en el contexto del tricentenario de la muerte de Lope.

  10. Metodología para valorar los costos externos de la accidentalidad en proyectos de transporte

    OpenAIRE

    Márquez Díaz, Luis Gabriel

    2010-01-01

    Este artículo formula una metodología para mejorar la valoración de los costos externos de la accidentalidad en la evaluación económica de proyectos de transporte. Se revisan las causas, las variables y las acciones determinantes en la accidentalidad de tránsito; se esbozan algunas técnicas de pronóstico, y se hace un planteamiento para calcular los costos totales y marginales de la accidentalidad. Se propone valorar el costo externo de la accidentalidad de tránsito según el análisis de las e...

  11. Proton detection in the neutron lifetime experiment PENeLOPE

    Energy Technology Data Exchange (ETDEWEB)

    Tietze, Christian [Technische Universitaet Muenchen, Physik Department E18 (Germany); Collaboration: PENeLOPE-Collaboration

    2015-07-01

    Although neutron lifetime plays an important role in the Standard Model of particle physics, τ{sub n} is not very precisely know and often discussed. The official PDG mean value has been lowered during the last years by more than 6σ to the new value of 880.3 ± 1.1 s. The new precision experiment PENeLOPE, which is currently developed at Technische Universitaet Muenchen, will help to clear this up. Ultra-cold neutrons are lossless stored in a magneto-gravitational trap, formed by superconducting coils. The combined determination of τ{sub n} by counting the surviving neutrons after each storage cycle on one side and in-situ detection of the decay protons on the other side together with a very good handle on systematic errors leads to an unprecedented precision of the neutron lifetime value of 0.1s. This contribution will give an overview of the challenges concerning proton detection under the exceptional requirements of this experiment. The developed concept of using avalanche photodiodes for direct proton detection will be presented as well as results from first measurements with a prototype detector read out by particular developed electronics.

  12. Aracnologias - As tecituras de Penélope

    Directory of Open Access Journals (Sweden)

    Cristina Stevens

    2009-12-01

    Full Text Available Análise da personagem Penélope, de Homero, e a transformação ousada de Joyce dessa representação clássica da fidelidade feminina em Molly Bloom, a esposa infiel, sexualizada, trivial, lírica. Essas duas personagens são comparadas com sua mais recente recriação em The Penelopiad (2005, da escritora canadense Margaret Atwood. Uma importante categoria analítica dos estudos feministas e de gênero, a questão da voz é enfatizada na presente análise; essa personagem feminina é objeto da narrativa masculina (A Odisseia e Ulisses, mas no romance de Atwood essa personagem é sujeito de sua narrativa, elaborando uma tecitura “penelopeana” transgressora da versão clássica. Focalizaremos também o poder do silêncio na narrativa de autoria feminina, através do monólogo interior de Molly e da voz que fala do mundo dos mortos em The Penelopiad. Os conceitos de “abjeto” e “linguagem semiótica” de Kristeva são base para nosso trabalho, o qual problematiza a aparente imagem de passividade dessas mulheres que buscam o controle sobre suas vidas.

  13. Recent Results from KASCADE-Grande and LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Kampert, K.-H., E-mail: kampert@uni-wuppertal.d [Fachbereich Physik, Universitaet Wuppertal, 42097 Wuppertal (Germany); Apel, W.D. [Institut fuer Kernphysik, Forschungszentrum, Karlsruhe, D-76021 Karlsruhe (Germany); Arteaga, J.C. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe, D-76021 Karlsruhe (Germany); Asch, T. [Inst. Prozessdatenverarb. und Elektronik, Forschungszentrum Karlsruhe, D-76021 Karlsruhe (Germany); Badea, F. [Institut fuer Kernphysik, Forschungszentrum, Karlsruhe, D-76021 Karlsruhe (Germany); Baehren, L. [Dept. of Astrophysics, Radboud University Nijmegen, 6525 ED Nijmegen (Netherlands); Bekk, K. [Institut fuer Kernphysik, Forschungszentrum, Karlsruhe, D-76021 Karlsruhe (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie, 53010 Bonn (Germany); Bluemer, J. [Institut fuer Kernphysik, Forschungszentrum, Karlsruhe, D-76021 Karlsruhe (Germany); Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe, D-76021 Karlsruhe (Germany); Bozdog, H. [Institut fuer Kernphysik, Forschungszentrum, Karlsruhe, D-76021 Karlsruhe (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, P.O. Box Mg-6, RO-7690 Bucharest (Romania); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen, 57068 Siegen (Germany); Buitink, S. [Dept. of Astrophysics, Radboud University Nijmegen, 6525 ED Nijmegen (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Istituto di Fisica dello Spazio Interplanetario, INAF, 10133 Torino (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita, 10125 Torino (Italy); Cossavella, F. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe, D-76021 Karlsruhe (Germany); Daumiller, K. [Institut fuer Kernphysik, Forschungszentrum, Karlsruhe, D-76021 Karlsruhe (Germany)

    2009-05-15

    KASCADE-Grande is an extensive air-shower experiment located at Forschungszentrum Karlsruhe, Germany. Main parts of the experiment are the Grande array spread over an area of 700x700 m{sup 2}, the original KASCADE array covering 200x200 m{sup 2} with unshielded and shielded detectors, and additional muon tracking devices. This multi-detector system allows to investigate the energy spectrum, composition, and anisotropies of cosmic rays in the energy range up to 1 EeV. LOPES is co-located at the same site to measure radio pulses from extensive air showers in coincidence with KASCADE-Grande. It consists of 30 digital antennas operated in different geometrical configurations. Read out is performed at high bandwidths and rate data processing with the aim to calibrate the emitted signal in the primary energy range of 10{sup 16}-10{sup 18} eV by making use of reconstructed air-shower observables of KASCADE-Grande. An overview on the performance of both experiments will be given and recent analysis results be reported.

  14. LOPES-3D: An antenna array for full signal detection of air-shower radio emission

    Energy Technology Data Exchange (ETDEWEB)

    Apel, W.D. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik (Germany); Arteaga, J.C. [Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik (Germany); Baehren, L. [Radboud University Nijmegen, Department of Astrophysics (Netherlands); Bekk, K. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Bluemer, J. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik (Germany); Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik (Germany); Bozdog, H. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Buchholz, P. [Universitaet Siegen, Fachbereich Physik (Germany); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); INAF Torino, Instituto di Fisica dello Spazio Interplanetario (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Daumiller, K. [Karlsruhe Institute of Technology (KIT), Institut fuer Kernphysik (Germany); Souza, V. de [Karlsruhe Institute of Technology (KIT), Institut fuer Experimentelle Kernphysik (Germany); and others

    2012-12-22

    To better understand the radio signal emitted by extensive air-showers and to further develop the radio detection technique of high-energy cosmic rays, the LOPES experiment was reconfigured to LOPES-3D. LOPES-3D is able to measure all three vectorial components of the electric field of radio emission from cosmic ray air showers. The additional measurement of the vertical component ought to increase the reconstruction accuracy of primary cosmic ray parameters like direction and energy, provides an improved sensitivity to inclined showers, and will help to validate simulation of the emission mechanisms in the atmosphere. LOPES-3D will evaluate the feasibility of vectorial measurements for large scale applications. In order to measure all three electric field components directly, a tailor-made antenna type (tripoles) was deployed. The change of the antenna type necessitated new pre-amplifiers and an overall recalibration. The reconfiguration and the recalibration procedure are presented and the operationality of LOPES-3D is demonstrated.

  15. Vulgo, imitación y natural en el 'Arte nuevo de hacer comedias' de Lope de Vega

    NARCIS (Netherlands)

    Sánchez Jiménez, A.

    2011-01-01

    This article clarifies some of the paradoxes in Lope de Vega’s Arte nuevo de hacer comedias (1609) explaining them in the context of Lope’s literary career. In particular, we examine how Lope uses the heavily laden words ‘vulgo’ and ‘natural’ to obtain the benevolence of his audience, but also to

  16. Prof. Hugo de Souza Lopes and the modern system of Sarcophagidae (Diptera

    Directory of Open Access Journals (Sweden)

    Yurij G. Verves

    1989-01-01

    Full Text Available Prof. Dr. Hugo de Souza Lopes is one of the authors of the phylogenetic classification of Sarcophagidae, especially Sarcophaginae. In this paper I present the taxonomic key of the tribes of Sarcophaginae according to his opinion; a list of the 48 genera and subgenera and the 356 species described by Prof. Lopes; and a review of subtribal construction of tribe Sarcophagini with a key of the subtribes. One new subtribe Boettcheriiscina Verves, subtr. nov. and two new monotypic genera (Mufindia Verves, gen. nov., and Sabiella Verves, gen. nov. are described. The role of Prof. Lopes in the knowledge of taxonomy and ecology of American, Oriental, Australian and Oceanic Sarcophagidae is illumined.

  17. Pactar con el diablo en la escena europea: Christopher Marlowe y Lope de Vega

    OpenAIRE

    Fernández Rodríguez, Natalia

    2017-01-01

    Casi en el mismo momento, Christopher Marlowe, en Inglaterra, y Lope de Vega, en España, compusieron sendas piezas dramáticas en las que se incluía el motivo del pacto con el demonio: Fausto y La gran columna fogosa. Marlowe, fascinado por la leyenda del Doctro Fausto, la llevó a las tablas en forma de tragedia, inaugurando y clausurando a la vez el camino escénico del tema en tierras inglesas. Lope, por su parte, extrajo toda la savia dramática que pudo de una leyenda hagiográfica vinculada ...

  18. En el tricentenario de Lope de Vega : "La Dorotea" de Eduardo Marquina

    OpenAIRE

    Antonella Russo

    2016-01-01

    En enero de 1935, en el Teatro Cómico de Madrid, Eduardo Marquina estrena La Dorotea. Comedia en verso, en tres jornadas, inspirada en la famosa obra de Lope de Vega. El presente estudio pretende analizar la pieza del dramaturgo catalán, sus relaciones intertextuales con el texto del Fénix, así como su significado y recepción en el contexto del tricentenario de la muerte de Lope. In January 1935, at the Teatro Cómico in Madrid, Eduardo Marquina premieres La Dorotea. Comedia en verso, en tr...

  19. Acción Española and Lope de Vega's Tricentenary

    Directory of Open Access Journals (Sweden)

    Marta García Peña

    2015-01-01

    Full Text Available In 1935 the tricentenary of Lope de Vega’s death took place. Numerous public and private institutions organized various acts to pay tribute to the playwright. Acción Española celebrated the anniversary with a series of lectures prioritizing the doctrinal content over the cultural one. In its homage this royalist association contributed to mythologize Lope de Vega’s times and life. Both were considered political models to transform the present and build the future.

  20. Entrevista a Antonio Álamo: Dramaturgo y director del teatro Lope De Vega

    National Research Council Canada - National Science Library

    Valerio Durán

    2012-01-01

    Antonio Álamo es mucho más que un dramaturgo. Desde 2004 es el director del Teatro Lope de Vega de Sevilla, una faceta que deja entrever sus inquietudes por la escena teatral, la novela, y su pasión por los clásicos de siempre...

  1. Design and Evaluation of the LOPES Exoskeleton Robot for Interactive Gait Rehabilitation

    NARCIS (Netherlands)

    Veneman, J.F.; Kruidhof, R.; Hekman, Edsko E.G.; Ekkelenkamp, R.; van Asseldonk, Edwin H.F.; van der Kooij, Herman

    2007-01-01

    This paper introduces a newly developed gait rehabilitation device. The device, called LOPES, combines a freely translatable and 2-D-actuated pelvis segment with a leg exoskeleton containing three actuated rotational joints: two at the hip and one at the knee. The joints are impedance controlled to

  2. LOPES: Selective control of gait functions during the gait rehabilitation of CVA patients

    NARCIS (Netherlands)

    Ekkelenkamp, R.; Veneman, J.F.; van der Kooij, Herman

    2005-01-01

    LOPES aims for an active role of the patient by selective and partial support of gait functions during robotic treadmill training sessions. Virtual model control (VMC) was applied to the robot as an intuitive method for translating current treadmill gait rehabilitation therapy programs into robotic

  3. Raymundo Faoro, leitor de Simões Lopes Neto e de Ramiro Barcellos

    OpenAIRE

    Araújo, Homero Vizeu; Fischer, Luís Augusto

    2014-01-01

    Este trabalho procura revelar momentos cruciais do pensamento de Raymundo Faoro em seus dois ensaios dedicados à obra de Simões Lopes Neto e à de Ramiro Barcelos, nos quais ficariam demonstradas a ousadia e a erudição de um ensaísta disposto a estabelecer nexos entre a ficção e o processo social.

  4. Test de campo para valorar la resistencia de los músculos del tronco

    Directory of Open Access Journals (Sweden)

    Casto Juan-Recio

    2014-09-01

    Full Text Available El Biering-Sorensen test (BST, el Side Bridge test (SBT y el Ito test (IT son tres de los test de campo más utilizados para medir la resistencia de los músculos del tronco. El objetivo de este estudio fue analizar la fiabilidad absoluta y relativa de los test referidos, así como valorar el efecto de la antropometría de los participantes en el rendimiento en las pruebas. En el estudio participaron 27 jóvenes varones (23,5 ± 4,0 años y físicamente activos. Los participantes realizaron dos sesiones de registro en las que ejecutaron los tres test (recuperación de 8 min entre pruebas y donde se midieron diversas variables antropométricas. La fiabilidad relativa fue buena, con ICC mayores de 0.80 en todos los test, pero no así la fiabilidad absoluta, con SEM que oscilaron entre el 13,36 % en el BST y el 19,89 % en el IT. El IT mostró una correlación negativa con la masa (r= – ,475; p= ,014 y el diámetro bileocrestal (r = – ,404; p = ,040 y el SBT una correlación negativa con la masa (r = –,610; p = ,001, el diámetro bileocrestal (r = –,546; p = ,004, el diámetro biacromial (r= - ,456; p = ,019 y el índice acromioiliaco (r= –,413; p = ,036. Los datos de fiabilidad ab-soluta cuestionan la utilidad de estas pruebas en programas de entrenamiento donde los participantes tienen poco margen de mejora. Además, si se realizan comparaciones entre sujetos es importante tener en cuenta sus diferencias antropométricas, ya que durante la ejecución de los test el cuerpo se utiliza como instrumento de medida.

  5. Miguel Hernández y la poesía de Lope (1935-1936

    Directory of Open Access Journals (Sweden)

    Francisco Javier Díez de Revenga

    2016-01-01

    Full Text Available La publicación de los sonetos incluidos en El rayo que no cesa puso de relieve que Miguel Hernández aprendió a construirlos en los clásicos de nuestro Siglo de Oro y, entre ellos, quizá más aún que en ningún otro, en Lope de Vega, al que por aquellos años seguía igualmente de forma muy fiel en sus dramas Los hijos de la piedra y El labrador de más aire. En El rayo que no cesa logró, sin embargo, una cierta independencia y originalidad al conseguir revitalizar un esquema clásico y al obtener de él resultados óptimos en todos y cada uno de los poemas que componen su libro publicado en 1936, tras las conmemoraciones del centenario de Lope en 1935.

  6. Self-triggering readout system for the neutron lifetime experiment PENeLOPE

    Energy Technology Data Exchange (ETDEWEB)

    Gaisbauer, D., E-mail: d.gaisbauer@tum.de [Technische Universität München, Garching (Germany); Konorov, I. [Technische Universität München, Garching (Germany); Steffen, D. [CERN, Geneva (Switzerland); Paul, S. [Technische Universität München, Garching (Germany)

    2016-07-11

    The aim of PENeLOPE (Precision Experiment on Neutron Lifetime Operating with Proton Extraction) at the Forschungsreaktor München II is a high-precision measurement of the neutron lifetime and thereby an improvement of the parameter's precision by one order of magnitude. In order to achieve a higher accuracy, modern experiments naturally require state-of-the-art readout electronics, as well as high-performance data acquisition systems. This paper presents the self-triggering readout system designed for PENeLOPE which features a continuous pedestal tracking, configurable signal detection logic, floating ground up to 30 kV, cryogenic environment and the novel Switched Enabling Protocol (SEP). The SEP is a time-division multiplexing transport level protocol developed for a star network topology.

  7. Self-triggering readout system for the neutron lifetime experiment PENeLOPE

    Science.gov (United States)

    Gaisbauer, D.; Konorov, I.; Steffen, D.; Paul, S.

    2016-07-01

    The aim of PENeLOPE (Precision Experiment on Neutron Lifetime Operating with Proton Extraction) at the Forschungsreaktor München II is a high-precision measurement of the neutron lifetime and thereby an improvement of the parameter's precision by one order of magnitude. In order to achieve a higher accuracy, modern experiments naturally require state-of-the-art readout electronics, as well as high-performance data acquisition systems. This paper presents the self-triggering readout system designed for PENeLOPE which features a continuous pedestal tracking, configurable signal detection logic, floating ground up to 30 kV, cryogenic environment and the novel Switched Enabling Protocol (SEP). The SEP is a time-division multiplexing transport level protocol developed for a star network topology.

  8. CoTEx - Coil tests for the neutron lifetime experiment PENeLOPE

    Energy Technology Data Exchange (ETDEWEB)

    Gaisbauer, Dominic [Technische Universitaet Muenchen, Physikdepartment E18 (Germany); Collaboration: PENeLOPE-Collaboration

    2014-07-01

    PENeLOPE is an experiment with ultra-cold neutrons (UCN) for determining their lifetime in a magneto-gravitational trap with special designed superconducting coils developed at Technische Universitaet Muenchen. It is designed to have a precision of up to 'pm 0.1s. Due to their unique characteristics all coils for the trap have to be trained and tested in a preliminary experiment called CoTEx before they can be inserted into PENeLOPE. The poster highlights the results of the first welded coil stack delivered in December 2013. A short overview of CoTEx in general and the slow control and quench detection of CoTEx are also presented.

  9. El dramaturgo como novelador: La prudente venganza de Lope de Vega

    OpenAIRE

    Fernández Cifuentes, María Ángeles

    2011-01-01

    «La culpa la tuvo Marta de Nevares», afirma Antonio Carreño ante la decisión de Lope de Vega de escribir cuatro novelas cortas y dedicarlas a Marcia Leonarda, alter ego de Marta de Nevares Santoyo. Rondaba Lope los cincuenta y cuatro años cuando conoce a Marta, veintiocho años menor, en una fiesta poética presidida por ella. La relación amorosa se prolonga durante más de una década, tomando un rumbo trágico en sus últimos años: la Amarilis de sus poemas enferma y pierde la vist...

  10. El tema de la ceguera en la literatura religiosa de Lope

    Directory of Open Access Journals (Sweden)

    Lezcano Tosca, Hugo

    2004-12-01

    Full Text Available In baroque literature, el desengaño is a commonplace that gets a large development. El desengaño means that man realizes that everything he can see is «vanas sombras». In this article, the question of blindness in Lope de Vega's religious poetry is studied through three different aspects: first, blindness of the self in religious poetry is considered as a transformation «a lo divino» of petrarchist lover blindness. Secondly, the divine call is studied in some literary and religious texts, like Saint August Confessions, or Lope de Vega's Soliloquios. Finally, the different methods used by the Society of Jesus to finish with man's blindness (compositio loci, emblems are analysed.En la literatura barroca, el desengaño se convierte en un lugar común que recibe un amplio desarrollo. El desengaño consiste en que el hombre se da cuenta de que lo que ve con sus ojos es falso, puesto que las bellezas de la tierra sólo son «vanas sombras». En este artículo se estudia el tema de la ceguera en la literatura religiosa de Lope, teniendo en cuenta tres aspectos diferentes: en primer lugar, se analiza la ceguera del yo de la literatura religiosa como transformación «a lo divino» de la ceguera del enamorado petrarquista. En segundo lugar, se estudia en qué consiste la llamada divina en algunos textos religiosos y literarios, como las Confesiones de San Agustín o los Soliloquios de Lope. Por último, se estudian los métodos que emplea la Compañía de Jesús (composición de lugar, libros de emblemas para acabar con la ceguera del hombre.

  11. Adília Lopes and Sylvia Plath: a body in difference

    Directory of Open Access Journals (Sweden)

    Ana Beatriz Affonso Penna

    2017-06-01

    Full Text Available This article intends to discuss the works of the poets Adília Lopes and Sylvia Plath based upon the relations between body and writing, with focus on gender issues. For this discussion, Henri Bergson’s and Gilbert Simondon’s reflections on the notion of image will be employed.--- DOI: http://dx.doi.org/10.22409/abriluff.2017n18a391

  12. Theory and Practice in Lope and Moratín: The New Comedy, 'La Comedia Nueva

    Directory of Open Access Journals (Sweden)

    Saneleuterio Temporal, Elia

    2012-07-01

    Full Text Available In this article, for the first time, two Spanish influent dramatic theories are critically related: Lope de Vega and Leandro Fernández de Moratín. Two centuries separate their creations, but both tried to renew the scene with their poetic, both sought a «new comedy» to break with immediately preceding theatre traditions. The dramatic works of either author, in fact, are very different in extension: Lope wrote more than four hundred titles, while Moratín only five. They are respectively the most prolific and international Spanish dramatic poet and one of the most moderate among the recognized Spanish authors, but they have in common a peculiar aspiration: they want their works to reflect the reality of the world. Paraphrasing Lope, comoedia speculum humanae vitae could be used as the headword of both. Taking Arte nuevo de hacer comedias (1609 and La comedia nueva o el café (1792 as a starting point, the article analyzes both authors’ theatre, contextualized in their respective historical moments.

  13. Self-triggering readout system for the neutron lifetime experiment PENeLOPE

    Energy Technology Data Exchange (ETDEWEB)

    Gaisbauer, Dominic; Steffen, Dominik [Technische Universitaet Muenchen (Germany); Collaboration: PENeLOPE-Collaboration

    2015-07-01

    The aim of PENeLOPE is a high-precision measurement of the neutron lifetime and thereby an increase of the parameter's precision by one order of magnitude. In order to achieve an increasingly higher accuracy, modern experiments naturally require state-of-the-art readout electronics, as well as high-performance data acquisition systems. This talk therefore presents the readout system for the neutron lifetime experiment PENeLOPE, which is currently being designed at the department of physics at Technische Universitaet Muenchen. The system's readout chain involves preamplifier, shaper, sampling ADC, and a data processing stage implemented on field programmable gate arrays (FPGAs). Due to the incorporated signal detection, the system is able to process data from 1,000 self-triggering channels, each of which is hit by 10 particles/sec. The corresponding data rate of 1.5 MB/sec is transferred to the outside of the experiment by a high-speed optical interface, which has been developed to meet the special experimental requirements of PENeLOPE. The main focus of the talk is set on the performance and tests of the trigger algorithm as well as on characteristics and properties of the optical interface.

  14. Método para valorar la concentración y la capacidad antioxidante del ácido úrico

    OpenAIRE

    Campos, Carlos; Guzmán, Rodrigo; López Fernández, María Encarnación; Casado Moragón, Ángela

    2010-01-01

    La presente invención se refiere a un método para valorar la concentración y la capacidad antioxidante del ácido úrico en muestras ya sean biológicas, en muestras procedentes de la industria alimentaria, en cosméticos ... Además mediante la presente invención se permite determinar la capacidad antioxidante sin la contribución del ácido úrico y la capacidad antioxidante total de una muestra.

  15. Procedimiento para medir y valorar la eficiencia empresarial en el CAI Arrocero Sur del Jíbaro.

    Directory of Open Access Journals (Sweden)

    Boris Luis Rodríguez Rodríguez

    2007-06-01

    Full Text Available En la presente investigación titulada Procedimiento para medir y valorar la eficiencia empresarial en el CAI Arrocero “Sur del Jíbaro” se realiza un amplio análisis de la bibliografía, basado en dos variables fundamentales, procedimientos específicos y eficiencia empresarial definiendo como objetivo la necesidad que existe de desarrollar un procedimiento específico para medir y valorar la eficiencia. Es por ello que se propone un procedimiento específico, a través de la siguiente secuencia de pasos lógicos: Identificación de los indicadores de eficiencia, importancia de los indicadores según expertos, comportamiento de los indicadores en la organización, determinación del indicador general de eficiencia, valoración integral de la eficiencia en la organización. Resulta de gran utilidad práctica para la empresa el cálculo del IGE pues permite desde el punto de vista cuantitativo brindar una información de cómo está la empresa partiendo de la importancia relativa de cada uno de los indicadores y el comportamiento de ellos en el marco de la empresa, comprobando que el indicador general de eficiencia no se comporta de manera uniforme en todas las Unidades Empresariales de Base (UEB.

  16. Fake insanes and fools: another way of playing (without disguise) in Lope de Vega's theatre

    OpenAIRE

    José Enrique López Martínez

    2014-01-01

    Abstract:In this work I study the theme of fake insanity and foolishness in Spanish Baroque Drama, starting with the work of Lope de Vega. In the first place, I consider some important sources in Italian Drama, specially Grazzini’s La Spiritata and Girolamo Bargagli’s La Pellegrina. Afterwards, I analyse in chronological order some of Lope’s plays that introduce this theme in Hispanic Theater, written at the turn of the XVIIth Century, such as Los locos de Valencia and El mármol de Felisardo;...

  17. Lope y sus públicos: estrategias para el éxito

    OpenAIRE

    Díez-Borque, J. M. (José María)

    2010-01-01

    El teatro en el siglo XVII, frente a lo que ocurría con otros géneros literarios, tenía una importante rentabilidad económica, especialmente en el caso de Lope de Vega, con el triunfo de su comedia. Ello supone que el éxito, la dependencia de su público, cuanto más extenso mejor, se convirtieron en factores centrales en la creación literaria. Como no estaba claramente asumida la rentabilidad económica de la literatura, van a entrar en oposición conceptos como normas de la po...

  18. Fake insanes and fools: another way of playing (without disguise in Lope de Vega's theatre

    Directory of Open Access Journals (Sweden)

    José Enrique López Martínez

    2014-05-01

    Full Text Available Abstract:In this work I study the theme of fake insanity and foolishness in Spanish Baroque Drama, starting with the work of Lope de Vega. In the first place, I consider some important sources in Italian Drama, specially Grazzini’s La Spiritata and Girolamo Bargagli’s La Pellegrina. Afterwards, I analyse in chronological order some of Lope’s plays that introduce this theme in Hispanic Theater, written at the turn of the XVIIth Century, such as Los locos de Valencia and El mármol de Felisardo; until many late plays by Lope and other playwrights that kept on reproducing the literary elements of those early comedias. In this survey, I examine the metatheatrical sense of fake insanity, the dramatic subgenres where it was featured, its importance for the plots, and its relation to other forms of dramatic deception, like the woman in male disguise and the nobleman as servant; as well as some dramatic and literary devices it relied on: the different kinds of simulated madness, its discoursive features, and the motif of the fake wedding. Resumen:En este trabajo se analiza el desarrollo del tema de la locura y la simpleza fingida en el teatro barroco español, a partir de la obra de Lope de Vega. Primero, se consideran algunos importantes antecedentes italianos, especialmente las obras La Spiritata, de Grazzini, y La Pellegrina, de Girolamo Bargagli. Después, se analizan con detalle y en orden cronológico algunas comedias del Fénix escritas en la última década del siglo XVI y primera del XVII en que introduce este tema en el teatro hispánico, como Los locos de Valencia o El mármol de Felisardo, hasta mencionar varias obras tardías del propio Lope y otros autores que continuaron reproduciendo los recursos de aquellas comedias tempranas. En este recorrido, se hace énfasis en el carácter metateatral de la locura fingida, los subgéneros dramáticos en la que fue incluida, importancia argumental, formas de caracterización y relación con

  19. Do Narratives Require Romances? Narration and Versification in Two Plays by Lope de Vega (1610

    Directory of Open Access Journals (Sweden)

    Daniele Crivellari

    2015-01-01

    Full Text Available Starting from some observations about ll. 305-312 of Arte nuevo de hacer comedias, this article aims to analyze the relationship between metrics (and more specifically the use of romances and the dramatic structure in two plays written by Lope in 1610, i.e., La hermosa Ester and La buena guarda. Through the study of the interaction of polymetry and the other criteria of the «cuadros», this article focuses mainly on the semantic, structural and thematic functions of the verses to find out how each stanza reveals its possibilities within the intrinsic versatility of dramatic language.

  20. Proxemia y espacio dramático en el teatro pastoril del primer Lope de Vega

    OpenAIRE

    Francisco Sáez Raposo

    2016-01-01

    En el presente trabajo se analiza el modo en el que Lope de Vega se sirve de la proxemia a la hora de (re)crear el espacio dramático en el que transcurren los argumentos de sus primeras comedias pastoriles. El empleo que los actores hacen de las distancias en el escenario, unido a la gestualidad y el sonido (a veces real, a veces referido), evoca en la imaginación del espectador un espacio que, por otra parte, le es familiar, aunque sea conceptualmente, ya que son piezas pertenecientes a un g...

  1. Power relationships and conflicts between families and individuals: Lope de Vega’s Los enemigos en casa

    Directory of Open Access Journals (Sweden)

    Fausta Antonucci

    2013-05-01

    Full Text Available Los enemigos en casa is a comedy written by Lope de Vega that has been scarcely studied. The plot focuses on the enmity among two sevillian families and the serious problems it causes to a couple of lovers belonging to the rival fa­milies. The article examines how Lope dramatizes intergenerational discord, showing paternal authoritarism’s excess, and most of all, the way it states the improper idea of familiar honor that’s displayed by paternal uncles, along the same lines of the arcaical role of patruus.

  2. Il mito di Lope de Aguirre in due opere della drammaturgia franchista e postfranchista

    Directory of Open Access Journals (Sweden)

    Arianna Fiore

    2016-12-01

    Full Text Available Twentieth-century Spanish theatre is often inspired by the figure of Lope de Aguirre, with motifs and modes that change depending on time, considering 1939 and 1975 two crucial watershed moments in the cultural history of the Iberian Peninsula. The dramatic works analysed date back precisely to the years of Franco’s dictatorship and the democratic period: in 1941 Gonzalo Torrente Ballester was the first twentieth-century dramatist to devote a text, entitled Lope de Aguirre, to the life of the Basque conqueror. The work, for reasons that will be explored in the present essay, was never staged in Franco’s time: Ballester’s Aguirre is a romantic hero who defies the king to defeat the injustices which he is forced to witness, and everyone, men, women, blacks, indios, will at last be free under his red-black banner. Dona Elvira, Imaginate Euskadi (1985, by Ignacio Amestoy Egiguren, is the first published work in the democratic era. It can be read as a great metaphor of the Basque issue, the tragedy of Euskadi and the climate of violence and tension that characterized the Basque Country in the 1980s.

  3. [Lopes vs. Brazil case: Psychiatry and international human rights law in the real life].

    Science.gov (United States)

    Sobredo, Laura D

    2016-05-01

    In order to understand and adjust to the legal obligations that rule our professional practice as psychiatrists, it is useful to know the regulatory framework and its internal logic. The analysis of the case "Ximenes Lopes vs Brazil" (2006), from the Inter-American Court of Human Rights, intends to be, within this work, a contribution to understand those norms. The Inter-American Court of Human Rights conducts litigation that decides on the responsibility of Member States in alleged violations of human rights. Court sentences reflect the way judges interpret norms, solve conflicts between citizens and States, order reparations and control compliance with international obligations of States. "Ximenes Lopes vs Brazil" is the first judgement by the Inter-American Court of Human Rights against the State of Brazil and is also the first one that addresses the issue of mental disability. In that judgement the Inter-American System sanctions a democratic State, emphasizing the effective access to Justice among historically and structurally discriminated groups, in this particular case people with mental disability.

  4. Measuring the radio emission of cosmic ray air showers with LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Schroeder, F.G., E-mail: Frank.Schroeder@kit.ed [Institut fuer Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Apel, W.D. [Institut fuer Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Arteaga, J.C. [Institut fuer Experimentelle Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Asch, T. [Institut fuer Prozessdatenverarbeitung und Elektronik, Karlsruhe Institute of Technology (KIT) (Germany); Badea, F. [Institut fuer Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Baehren, L. [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Bekk, K. [Institut fuer Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Bluemer, J. [Institut fuer Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Institut fuer Experimentelle Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Bozdog, H. [Institut fuer Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, Bucharest (Romania); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen (Germany); Buitink, S. [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Istituto di Fisica dello Spazio Interplanetario, INAF Torino (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Cossavella, F. [Institut fuer Experimentelle Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Daumiller, K. [Institut fuer Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany); Souza, V. de [Institut fuer Experimentelle Kernphysik, Karlsruhe Institute of Technology (KIT) (Germany)

    2010-05-21

    When ultra high energy cosmic rays hit the atmosphere, they produce a shower of millions of secondary particles. Thereby the charged particles in the shower emit a radio pulse whilst deflected in the Earth's magnetic field. LOPES is a digital antenna array measuring these radio pulses in the frequency range from 40 to 80 MHz. It is located at the site of and triggered by the air shower experiment KASCADE-Grande at Karlsruhe Institute of Technology (KIT), Germany. In its present configuration, it consists of 15 east-west-polarized and 15 north-south-polarized, absolutely calibrated short dipole antennas, as well as 10 LPDAs (with two channels each). Furthermore, it serves as a test bench for technological developments, like new antenna types or a radio-based self-triggering (LOPES{sup STAR}). To achieve a good angular reconstruction and to digitally form a beam into the arrival direction of the shower, it has a precise time calibration.

  5. La femme et sa lutte de libération dans l'oeuvre d'Henri Lopes ...

    African Journals Online (AJOL)

    politician and writer, one can easily glean, through Lopes' works, a complete picture of despotic postcolonial mismanagement of political affairs coupled with a dire dearth of humanism. Literary works such as Tribaliques (Tribaliks, 1971), La nouvelle Romance (The New Romance, 1976), Sans tam-tam (Without Drum, 1977) ...

  6. Entre recital y charla: El acto creador y unos apuntes sobre “Penélope”

    Directory of Open Access Journals (Sweden)

    Marta Rojas Porras

    2004-01-01

    Full Text Available Este texto expone algunas de mis ideas y experiencias como escritora y las ejemplifica con poemas de mi producción. Enmarcada en ese contexto; se plantea una lectura personal de mi poema Penélope, el cual se lee en décimo año de la Educación General Básica

  7. Design and evaluation of the LOPES exoskeleton robot for interactive gait rehabilitation.

    Science.gov (United States)

    Veneman, Jan F; Kruidhof, Rik; Hekman, Edsko E G; Ekkelenkamp, Ralf; Van Asseldonk, Edwin H F; van der Kooij, Herman

    2007-09-01

    This paper introduces a newly developed gait rehabilitation device. The device, called LOPES, combines a freely translatable and 2-D-actuated pelvis segment with a leg exoskeleton containing three actuated rotational joints: two at the hip and one at the knee. The joints are impedance controlled to allow bidirectional mechanical interaction between the robot and the training subject. Evaluation measurements show that the device allows both a "patient-in-charge" and "robot-in-charge" mode, in which the robot is controlled either to follow or to guide a patient, respectively. Electromyography (EMG) measurements (one subject) on eight important leg muscles, show that free walking in the device strongly resembles free treadmill walking; an indication that the device can offer task-specific gait training. The possibilities and limitations to using the device as gait measurement tool are also shown at the moment position measurements are not accurate enough for inverse-dynamical gait analysis.

  8. Lope de puntillas: el estreno del ballet «Laurencia» en Leningrado (1939

    Directory of Open Access Journals (Sweden)

    Maria Chiginskaya

    2016-01-01

    Full Text Available Este artículo trata sobre el ballet Laurencia, basado en la obra de Lope de Vega Fuenteovejuna, estrenado en Leningrado (URSS en 1939, y explica cómo un experimento arriesgado, que consistía en convertir una antigua obra dramática española en ballet moderno soviético, fue coronado por el éxito. El trabajo muestra también cómo y por qué en la URSS surgió un particular interés hacia la dramaturgia española, y explora la historia de las representaciones más emblemáticas de Fuenteovejuna en el escenario ruso.

  9. Polarizing Ultra-Cold Neutrons for the Superconducting Trap PENeLOPE

    Science.gov (United States)

    Picker, R.; Schreyer, W.; Haas, F.; Hartmann, F. J.; Losekamm, M.; Paul, S.; Stoepler, R.; Tietze, C.

    2014-03-01

    PENeLOPE (Precision Experiment on the Neutron Lifetime Operating with Proton Extraction) is a novel experiment to measure the lifetime of the free neutron. It features magneto-gravitational storage of ultra-cold neutrons; only one spin state of the neutrons can be stored magnetically, hence a polarization system is necessary. In contrast to most other magnetic storage experiments, the magnetic field is ramped up from zero after filling, which results in a complete spatial and energetic separation of the two spin states; this allows the use of novel techniques in cleaning the trap from the unwanted spin state in addition to pre-polarization. A polarization of 99.98% should be achievable.

  10. Radio emission of energetic cosmic ray air showers: Polarization measurements with LOPES

    Energy Technology Data Exchange (ETDEWEB)

    Isar, P.G. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany)], E-mail: gina.isar@ik.fzk.de; Apel, W.D. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Arteaga, J.C. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Asch, T. [Inst. Prozessdatenverarbeitung und Elektronik, Forschungszentrum Karlsruhe (Germany); Auffenberg, J. [Fachbereich Physik, Universitaet Wuppertal (Germany); Badea, F. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Baehren, L. [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Bekk, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Bertaina, M. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Biermann, P.L. [Max-Planck-Institut fuer Radioastronomie Bonn (Germany); Bluemer, J. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Bozdog, H. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering Bucharest (Romania); Brueggemann, M.; Buchholz, P. [Fachbereich Physik, Universitaet Siegen (Germany); Buitink, S. [Department of Astrophysics, Radboud University Nijmegen (Netherlands); Cantoni, E. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Istituto di Fisica dello Spazio Interplanetario, INAF Torino (Italy); Chiavassa, A. [Dipartimento di Fisica Generale dell' Universita Torino (Italy); Cossavella, F. [Institut fuer Experimentelle Kernphysik, Universitaet Karlsruhe (Germany); Daumiller, K. [Institut fuer Kernphysik, Forschungszentrum Karlsruhe (Germany)] (and others)

    2009-06-01

    LOPES is a radio antenna array co-located with the Karlsruhe Shower Core and Array DEtector, KASCADE-Grande in Forschungszentrum Karlsruhe, Germany, which provides well-calibrated trigger information and air shower parameters for primary energies up to 10{sup 18}eV. By the end of 2006, the radio antennas were re-configured to perform polarization measurements of the radio signal of cosmic ray air showers, recording in the same time both, the East-West and North-South polarization directions of the radio emission. The main goal of these measurements is to reconstruct the polarization characteristics of the emitted signal. This will allow a detailed comparison with theoretical predictions. The current status of these measurements is reported here.

  11. From Comedy to the Sacramental Play: from Honor to Forgiveness in Lope de Vega

    Directory of Open Access Journals (Sweden)

    J. Enrique Duarte Lueiro

    2017-11-01

    Full Text Available The author of this article reviews the critical bibliography of the sacramental plays by Lope to show how scholars have always considered that this writer adapted elements and resources taken from his comedies into the sacramental plays. Actually, this article analyses the code of honor relevant in comic comedies and tragedies with different results. But this convention is also coherent with the sacramental genre, because it is supported by images and biblical metaphors and, in this case, they force a determined end. Equally, we have to take into consideration that the playwright employs other means specific of the auto sacramental to allow the allegory to operate and connect its two allegorical levels.

  12. An allegedly wicked sonnet by Lope de Vega (Duerme el sol de Belisa en noche escura and its source

    Directory of Open Access Journals (Sweden)

    Ignacio Arellano

    2011-12-01

    Full Text Available The paper examines the humorous and satirical value of the sonnet «The Portrait of a Lady after her death», included in Rimas de Tomé de Burguillos, the last book of Lope de Vega. Other lyrical interpretations are discussed and details are given concerning its source of inspiration, which is a joke recorded by Juan Rufo in his Six hundred apothegms (Seiscientas apotegmas.

  13. Self-triggering readout system for the neutron lifetime experiment PENeLOPE

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, Dominik [Technische Universitaet Muenchen (Germany); Collaboration: PENeLOPE-Collaboration

    2014-07-01

    Modern experiments permanently improve the precision of parameters in nuclear and particle physics. Besides high-performance detectors, state-of-the-art readout electronics and recent data acquisition systems contribute substantially to the increasingly better accuracy. This talk therefore presents the readout system, which is being designed for the neutron lifetime experiment PENeLOPE, currently under construction at Technische Universitaet Muenchen. The system*s readout chain involves preamplifier, shaper, sampling ADC, and a data processing stage implemented on field programmable gate arrays (FPGAs). The FPGAs perform the task of online data analysis and formatting and are able to transfer data to a computer via a high-speed Ethernet connection. An advanced algorithm enables them to calculate the pedestal for every single channel online, and to reliably detect all signals above noise. Due to this incorporated signal detection, the triggerless system is able to process and to format pulse shapes from around 1,000 channels simultaneously, each of which is hit by 10 particles/sec. This corresponds to a data rate of 1.5 MB/sec, which is read out to a computer where the pulse shapes are available for further analysis. In the talk, performance and first tests of this readout system are presented in detail.

  14. Proxemia y espacio dramático en el teatro pastoril del primer Lope de Vega

    Directory of Open Access Journals (Sweden)

    Francisco Sáez Raposo

    2016-01-01

    Full Text Available En el presente trabajo se analiza el modo en el que Lope de Vega se sirve de la proxemia a la hora de (recrear el espacio dramático en el que transcurren los argumentos de sus primeras comedias pastoriles. El empleo que los actores hacen de las distancias en el escenario, unido a la gestualidad y el sonido (a veces real, a veces referido, evoca en la imaginación del espectador un espacio que, por otra parte, le es familiar, aunque sea conceptualmente, ya que son piezas pertenecientes a un género completamente codificado. Asimismo, el dramaturgo parece combinar estos efectos multisensoriales con el recurso a técnicas pictóricas, empleadas de manera destacada en el paisajismo, para crear una sensación de profundidad y perspectiva escénicas con las que seducir la mente del público. Aunque se prestará atención especial al empleo de estos recursos a la hora de (recrear los espacios rústicos o naturales, por ser los primordiales, no se olvidarán los civiles o aldeanos, a pesar de que resultan anecdóticos en los argumentos de las obras analizadas.

  15. Lope de Vega and the Fortune of the «juego del soldado»

    Directory of Open Access Journals (Sweden)

    Germán Vega García-Luengos

    2017-11-01

    Full Text Available From the end of the XVI century and throughout the XVII, testimonies about the well-known «Juego del soldado» are abundant and varied in every genre, specially in dramatic one, given its inherent theatricality. Among the authors who used it, where it figures names such as Calderón, Luis Vélez or Sor Juana Inés de la Cruz, Lope de Vega stands out. Everything points that he was responsible for the beginning of this story, worthy of being studied in more detail. Moreover, he is the author with more cases registered, until five, which belong to different periods, genres (theatre, lyric and tale and treatments (profane and religious, and which point to the subsequent lines of development. In short, the use of this pastime by the Fénix reveals once more its ability to turn everything into literature, as well as its status as a pioneer and «trendsetter».

  16. Variations of «Drama Historial» (Historical Drama in Lope de Vega

    Directory of Open Access Journals (Sweden)

    Joan Oleza Simó

    2013-10-01

    Full Text Available Starting from the presentation of the principles underlying the current research and that link it to previous studies —principles which deal with the concept and features of drama historial (historic drama in Lope de Vega—, the essay focuses on the distinction of two fundamental modes of drama historial: the commemoration of famous historical events on the one hand, and moral conflict analysis, almost always of private nature and exploding in specific historical circumstances, on the other hand. These two major strategies of significance, the one being characteristic of a collective memory, associated with the identity of the nascent nation, and the other one exploring private identity, their subjectivity and their conflicts, constitute the two major branches of Lope’s drama historial. In exceptional cases, this diversification of strategies can be seen with precision in variations on the same subject. Such is the case of plays dedicated to the figure of the king of Portugal João II, two of which, the First and the Second part of The Perfect Prince, are a clear commemoration of famous public events, in this case about an exemplary king, while the third, the tragedy of The Duke of Viseo, is a detailed analysis of an ethical-political conflict which stresses the clash of individual subjects, and especially that between the King and the Duke of Viseo. The differences in the dramatic strategies followed in these works determine a completely different image of the historical figure of the king, who appears as a perfect prince in the first and second dramas, and as a man capable of perversion and injustice in the third.

  17. Locos y bobos fingidos: otra forma de representar (sin disfraz) en el teatro de Lope de Vega

    OpenAIRE

    López Martínez, José Enrique

    2014-01-01

    En este trabajo se analiza el desarrollo del tema de la locura y la simpleza fingida en el teatro barroco español, a partir de la obra de Lope de Vega. Primero, se consideran algunos importantes antecedentes italianos, especialmente las obras La Spiritata, de Grazzini, y La Pellegrina, de Girolamo Bargagli. Después, se analizan con detalle y en orden cronológico algunas comedias del Fénix escritas en la última década del siglo XVI y primera del XVII en que introduce este tema en el tea...

  18. Pragmatismo y heroísmo en “el asalto de Mastrique” de Lope de Vega

    OpenAIRE

    Martínez Bennecker, Juan B.

    2014-01-01

    En este trabajo se realiza un estudio general de El asalto de Mastrique por el príncipe de Parma de Lope de Vega, una “comedia de cerco”, por desgracia poco conocida. El motivo recurrente de la pieza es la guerra y la obsesión del príncipe de Parma es el asalto y conquista de Mastrique. Partimos de una introducción, que da paso a la descripción de la comedia y al análisis de los elementos fundamentales, como son: el contenido, el lenguaje con sus recursos artísticos y los personajes. In th...

  19. The effect of environment on development and survival of pupae of the necrophagous fly Ophyra albuquerquei Lopes (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Ferreira Krüger

    2011-09-01

    Full Text Available The effect of environment on development and survival of pupae of the necrophagous fly Ophyra albuquerquei Lopes (Diptera, Muscidae. Species of Ophyra Robineau-Desvoidy, 1830 are found in decomposing bodies, usually in fresh, bloated and decay stages. Ophyra albuquerquei Lopes, for example, can be found in animal carcasses. The influence of environmental factors has not been evaluated in puparia of O. albuquerquei. Thus, the focus of this work was motivated by the need for models to predict the development of a necrophagous insect as a function of abiotic factors. Colonies of O. albuquerquei were maintained in the laboratory to obtain pupae. On the tenth day of each month 200 pupae, divided equally into 10 glass jars, were exposed to the environment and checked daily for adult emergence of each sample. We concluded that the high survival rate observed suggested that the diets used for rearing the larvae and maintaining the adults were appropriate. Also, the data adjusted to robust generalized linear models and there were no interruptions of O. albuquerquei pupae development within the limits of temperatures studied in southern Rio Grande do Sul, given the high survival presented.Efeito de fatores ambientais sobre o desenvolvimento e sobrevivência de pupas de Ophyra albuquerquei Lopes (Diptera, Muscidae. Espécies de Ophyra Robineau-Desvoidy, 1830 são encontradas em corpos em decomposição, usualmente nas fases fresca, inchamento e murcha. Entre estas espécies, Ophyra albuquerquei Lopes, 1985 pode ser encontrada em carcaças de ratos e coelhos. A influência de fatores ambientais sobre pupas de O. albuquerquei não tinha sido avaliada até o momento. Desta maneira, o foco deste trabalho foi motivado pela necessidade por modelos de previsão do desenvolvimento de insetos necrófagos em função de fatores abióticos. Colônias de O. albuquerquei foram mantidas em laboratório para a obtenção de pupas. Até o décimo dia de cada mês, 200

  20. Este livro/foi escrito/ por mim Adília Lopes: uma vida deforma a poesia

    Directory of Open Access Journals (Sweden)

    Lúcia Evangelista

    2010-12-01

    Full Text Available The works of portuguese poet Adília Lopes, in her bio-graphy, appears as a demonstration of one life in the deleuzean meaning that through language distorts the discursive structures of power in our contemporaneity. In her, the issue of biopolitics, brought by Foucault, arises as thematic of her texts, but is also in the poem´s textual tension itself. Life is brought to poetry to the point of deformity. It is the intensity of a life itself that contaminates the poem and places poetry as institution into question.

  1. Lope de Vega, in the short story crossroad: maxims and aphorisms in Novelas a Marcia Leonarda (1621 y 1624

    Directory of Open Access Journals (Sweden)

    Emilio Blanco

    2016-06-01

    Full Text Available This article tries to explain the different political conception that emerges from the paratexts that precede the Novels to Marcia Leonarda. The references to “scientific men” and “aphorisms” in 1621 means that Lope first decided to follow tacitist ideas as a personal strategy to grow in the Court of the new King. The only mention of “maxims” in 1624, as well as in other preliminary Lope’s texts, indicates that he soon rejected the political and tacitist authors in order to return to traditional political theory.

  2. Julia Lopes de Almeida e a educação brasileira no fim do século XIX: um estudo sobre o livro escolar Contos infantis

    Directory of Open Access Journals (Sweden)

    Diana Vidal Gonçalves

    2004-01-01

    Full Text Available The article intents to investigate the production of school books in Brazil, at the end of nineteen century. It begins by asking whether Julia Lopes de Almeida, famous Brazilian writer and feminist, is an intruder in the educational field or not. To answer the question the article explores Contos infantis, written by Julia and her sister Adelina Lopes Vieira, in its contents and structure. Then it analyses the story of their family, lived part in Brazil and part in Portugal. It concludes by claming attention to the importance of the confluence of these two approaches to understand the schooling projects existent in the Brazilian society at that time.

  3. The «Comedia de Miseno», Source of «La pobreza estimada»: From Don Juan Manuel and Loyola to Lope de Vega

    Directory of Open Access Journals (Sweden)

    Daniel Fernández Rodríguez

    2013-10-01

    Full Text Available This paper studies the influence of the Comedia de Miseno on La pobreza estimada, by Lope de Vega. A careful study of both comedias shows a deep intertextual relationship between the play by Lope and the Comedia de Miseno, discovered by Stefano Arata. The Comedia de Miseno was written at the end of the 16th century by Loyola, an almost unknown author. This paper also shows the influence of the ejemplo XXV from El conde Lucanor on the Comedia de Miseno. At the same time, it rejects the direct influence of the ejemplo XXV on La pobreza estimada, as previously thought by critics.

  4. De Las Cantigas alfonsinas al teatro de Lope de Vega : el caso de Tudía

    Directory of Open Access Journals (Sweden)

    Manuel López Fernández

    2006-01-01

    Full Text Available El sustantivo Tudía abarca un amplio abanico de acepciones ligadas todas ellas a nuestro medievo. Tudía es una advocación mariana que figura en las cantigas de Alfonso el Sabio, donde el rey nos dice que ya existía una iglesia con el mismo nombre. Además, Tudía nos sirve para denominar una leyenda, una vicaría de la Orden de Santiago y, como no, un topónimo serrano de Extremadura. Hablaremos aquí de estos y otros aspectos apoyándonos en la historia y en la literatura hasta ver su impronta en el teatro de Lope de Vega.The name «Tudía» covers a wide range of meaning, all them related to the Middle Ages. «Tudía» is one of the names of the Virgin included in the medieval poems to St. Mary written by Alfonso X. The Castilian king also mentions that there was already a church named after her. Moreover, «Tudía» is also used to refer to a leged, to a vicarage of St. James’s Order and, it is of course, a mountain place name from Extremadura. Here we will develop these and some others aspects having into account both history and literature and their influence on Lope de Vega’s theatre.

  5. A propósito de La doncella Teodor, una comedia de viaje de Lope de Vega

    Directory of Open Access Journals (Sweden)

    Madroñal, Abraham

    2011-06-01

    Full Text Available Having been written and represented around 1610-1612 and taking place in the city of Toledo, La doncella Teodor is a comedy that belongs to Lope de Vega’s «Toledo cycle». However, this is only a pretext to take the spectator on a journey to the courts of Oran, Persia and Constantinople, exotic places where a maidservant named Teodor gains the admiration of wise men. In an attempt to offer an explanation to certain overlooked aspects, notes have been added to the text of this comedy.La doncella Teodor es una comedia que pertenece al «ciclo toledano» de Lope de Vega, porque se escribe y representa hacia 1610-1612 y porque se sitúa en origen en la ciudad de Toledo. Sin embargo, será solo un pretexto para que el espectador viaje a las cortes de Orán, Persia y Constantinopla, lugares exóticos donde una doncella de nombre Teodor causará la admiración de los sabios. Se aportan algunas notas al texto de la comedia, que intentan ofrecer una explicación a aspectos desatendidos.

  6. The effect of environment on development and survival of pupae of the necrophagous fly Ophyra albuquerquei Lopes (Diptera, Muscidae

    Directory of Open Access Journals (Sweden)

    Rodrigo Ferreira Krüger

    2011-09-01

    Full Text Available The effect of environment on development and survival of pupae of the necrophagous fly Ophyra albuquerquei Lopes (Diptera, Muscidae. Species of Ophyra Robineau-Desvoidy, 1830 are found in decomposing bodies, usually in fresh, bloated and decay stages. Ophyra albuquerquei Lopes, for example, can be found in animal carcasses. The influence of environmental factors has not been evaluated in puparia of O. albuquerquei. Thus, the focus of this work was motivated by the need for models to predict the development of a necrophagous insect as a function of abiotic factors. Colonies of O. albuquerquei were maintained in the laboratory to obtain pupae. On the tenth day of each month 200 pupae, divided equally into 10 glass jars, were exposed to the environment and checked daily for adult emergence of each sample. We concluded that the high survival rate observed suggested that the diets used for rearing the larvae and maintaining the adults were appropriate. Also, the data adjusted to robust generalized linear models and there were no interruptions of O. albuquerquei pupae development within the limits of temperatures studied in southern Rio Grande do Sul, given the high survival presented.

  7. Variants, Layers of Authorial Intervention, and Texts in Lope de Vega’s La buena guarda and La encomienda bien guardada autograph manuscript

    Directory of Open Access Journals (Sweden)

    Stefania Capoia

    2014-01-01

    Full Text Available In this article I study, analyze and classify the variant readings and the different layers of authorial intervention that appear in Lope de Vega’s La buena guarda and La encomienda bien guardada manuscript. I contend that the second version of the work should be edited, a possibility thus far neglected by modern editors.

  8. Alejandro García Reidy, Las musas rameras. Oficio dramático y conciencia profesional en Lope de Vega

    Directory of Open Access Journals (Sweden)

    Antonio Carreño

    2015-01-01

    Full Text Available Review of Alejandro García Reidy, Las musas rameras. Oficio dramático y conciencia profesional en Lope de Vega, Iberoamericana / Vervuert (Colección escena Clásica, 2, Madrid / Frankfurt am Main, 2013, 440 pp. ISBN: 9788484897439.

  9. "Casta Susana": el baño de Susana, voyeurismo y écfrasis en un soneto de Lope de Vega

    NARCIS (Netherlands)

    Sánchez Jiménez, A.

    2010-01-01

    This article explores the possibilities of the critical term ekphrasis as it is nowadays applied to the study of Golden Age Spanish literature. We study the appearance of the topic of Susanna and the Elders in Lope de Vega’s works, with a particular emphasis in a 1621 sonnet on the subject. After

  10. Un fondo semidesconocido de obras (¿y una cuarteta autógrafa? de Lope: la Bibliotheca Bodmeriana

    Directory of Open Access Journals (Sweden)

    Daniele Crivellari

    2016-01-01

    Full Text Available El presente trabajo ofrece noticias detalladas a propósito de un fondo de obras de Lope de Vega semidesconocido hasta la fecha, el de la Fundación Martin Bodmer de Ginebra (Suiza. El artículo consta de dos partes: en la primera, después de presentar brevemente la Bibliotheca Bodmeriana, se reseñan todos los textos no dramáticos del Fénix custodiados en la fundación, señalando sus peculiaridades bibliográficas. En la segunda parte se analiza una cuarteta manuscrita (un romancillo de heptasílabos asonantados en -é que encabeza la edición de 1625 de los Triunfos divinos con otras rimas sacras para averiguar si esos versos fueron escritos de puño y letra por el Fénix, tal y como han afirmado algunos estudiosos.

  11. LOPED study: looking for an early diagnosis in a late-onset Pompe disease high-risk population.

    Science.gov (United States)

    Musumeci, O; la Marca, G; Spada, M; Mondello, S; Danesino, C; Comi, G P; Pegoraro, E; Antonini, G; Marrosu, G; Liguori, R; Morandi, L; Moggio, M; Massa, R; Ravaglia, S; Di Muzio, A; Filosto, M; Tonin, P; Di Iorio, G; Servidei, S; Siciliano, G; Angelini, C; Mongini, T; Toscano, A

    2016-01-01

    A multicentre observational study was aimed to assess the prevalence of late-onset Pompe disease (LOPD) in a large high-risk population, using the dried blood spot (DBS) as a main screening tool. 17 Italian neuromuscular centres were involved in the late-onset Pompe early diagnosis (LOPED) study. Inclusion criteria were: (1) age ≥5 years, (2) persistent hyperCKaemia and (3) muscle weakness at upper and/or lower limbs (limb-girdle muscle weakness, LGMW). Acid α-glucosidase (GAA) activity was measured separately on DBS by fluorometric as well as tandem mass spectrometry methods. A DBS retest was performed in patients resulted positive at first assay. For the final diagnosis, GAA deficiency was confirmed by a biochemical assay in skeletal muscle, whereas genotype was assessed by GAA molecular analysis. In a 14-month period, we studied 1051 cases: 30 positive samples (2.9%) were detected by first DBS screening, whereas, after retesting, 21 samples were still positive. Biochemical and molecular genetic studies finally confirmed LOPD diagnosis in 17 cases (1.6%). The median time from the onset of symptoms/signs to diagnosis was 5 years. Among those patients, 35% showed presymptomatic hyperCKaemia and 59% showed hyperCKaemia+LGMW, whereas 6% manifested with LGMW. LOPED study suggests that GAA activity should be accurately screened by DBS in all patients referring for isolated hyperCKaemia and/or LGMW. A timely diagnosis was performed in five patients with presymptomatic hyperCKaemia, but two had already manifested with relevant changes on muscle morphology and MRI. Consequently, enzyme replacement therapy was started in 14/17 patients, including the 2 patients still clinically presymptomatic but with a laboratory evidence of disease progression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  12. Signature of the Collaboration Agreement between THE UNITED NATIONS INSTITUTE FOR TRAINING AND RESEARCH (UNITAR), by Mr Carlos Lopes (UN Assistant Secretary-General and Executive Director of UNITAR) and by the Director General of CERN, Mr Robert Aymar

    CERN Multimedia

    Claudia Marcelloni

    2008-01-01

    Signature of the Collaboration Agreement between THE UNITED NATIONS INSTITUTE FOR TRAINING AND RESEARCH (UNITAR), by Mr Carlos Lopes (UN Assistant Secretary-General and Executive Director of UNITAR) and by the Director General of CERN, Mr Robert Aymar

  13. Las últimas voluntades de Lope Gómez de Marzoa: un ome poderoso y muy emparentado en la cibdad de Santiago

    Directory of Open Access Journals (Sweden)

    Rubio Martínez, Amparo

    2016-12-01

    Full Text Available The aim of this paper is to make known the last wills of Lope Gómez de Marzoa, city councilor and public notary of Santiago de Compostela. Apart from analising his testamentary dispositions, some of the less well-known aspects of his biography will be briefl y studied. This will be done specially trying to clarify his family roots and his role as businessman and member of urban elites in Galicia during the 15th century. Besides, this essay will make reference to some of the litigations in which he, and, above all, his heirs were involved. Finally, the article makes public new documents that allow to reconstruct the last moments and wills of Lope Gómez de Marzoa. KEY WORDS: testaments, urban elites, business, Santiago de Compostela, 15th century.El objetivo del presente trabajo consiste en dar a conocer las últimas voluntades del regidor y notario compostelano Lope Gómez de Marzoa. Además de analizar sus disposiciones testamentarias, se estudiarán brevemente algunos de los aspectos menos conocidos de su biografía, tratando de clarificar especialmente sus orígenes familiares y su papel como hombre de negocios y miembro de las élites urbanas en la Galicia del siglo XV. Asimismo, se hará referencia a algunos de los pleitos en los que se vieron inmersos tanto él como, sobre todo, sus herederos. Finalmente, se publican los nuevos documentos que permiten reconstruir los últimos momentos y voluntades de Lope Gómez de Marzoa. [gl] O obxectivo do presente traballo consiste en dar a coñecer as últimas vontades do rexedor e notario compostelán Lope Gómez de Marzoa. Ademais de analizar as súas disposicións testamentarias, estudaranse brevemente algún dos aspectos menos coñecidos da súa biografía, tratando de clarificar especialmente as súas orixes familiares e o seu papel como home de negocios e membro das elites urbanas na Galicia do século XV. Así mesmo, faráse referencia a algúns dos preitos nos que se viron inmersos tanto el

  14. La desaparecida Capillade don Lope de Mendoza: nuevos datos sobre sus retablos, los sepulcros, su coro alto y la sacristía

    Directory of Open Access Journals (Sweden)

    Fernández González, Alberto

    2005-12-01

    Full Text Available Very little precise information remains on the exact characteristics of the no longer existing early medieval chapel founded by Archbishop Lope de Mendoza in the Cathedral of Santiago. Following the discovery of new documentary findings including descriptions, contracts, wills and a significant map of 1739, interesting facts about certain aspects of its architecture and tombs have been brought to light and, above all, we are able to reconstruct the furnishing of this important cathedral enclosure.

    De la desaparecida capilla bajomedieval que el arzobispo don Lope de Mendoza fundó en la catedral de Santiago apenas tenemos información precisa que permita conocer adecuadamente sus características. A partir del hallazgo de nuevas noticias documentales, que incluyen descripciones, contratos, testamentos y un significativo plano de 1739, se pueden aportar interesantes datos sobre algunos aspectos de su arquitectura y sepulcros y, sobre todo, reconstruir el amueblamiento de este importante recinto catedralicio.

  15. «Que también sé yo hacer bailes»: Lope de Vega and the dramatic dance

    Directory of Open Access Journals (Sweden)

    Francisco Sáez Raposo

    2012-12-01

    Full Text Available This paper analyzes the significance and consequences of Lope de Vega’s status as a legend when it comes to accepting his authorship of a few short plays, given that critics tend to demand extra proof in this matter, sometimes going beyond reasonable philological demands. I will also defend the idea that Lope was an author of dramatic dances, one of the subgenres which critics have always been reluctant to link with his name. To this end, I will cite evidence to prove that ‘el Fénix’ not only felt an interest in these sort of plays but also composed some which were staged in courtly performances in the early 1630s.

  16. Lope de Vega de ultratumba: tres calas fantasmales en la recepción póstuma del Fénix

    Directory of Open Access Journals (Sweden)

    Antonio Sánchez Jiménez

    2016-01-01

    Full Text Available Este trabajo estudia una curiosa serie de apariciones lopescas que nos muestra la influencia póstuma del Fénix a lo largo de varios siglos, abarcando diversos países europeos. Concretamente, estudiamos el fantasma de Lope en textos literarios de la Holanda del siglo xvii, de la Francia decimonónica y de la España de comienzos del siglo xx, en lo que constituye un fenómeno lo suficientemente extendido como para que podamos hablar de una tendencia. El corpus que la recoge es inconexo, pues no parece que los tres autores que nos ocupan se hubieran leído los unos a los otros; sin embargo, en todos podemos analizar el uso del fantasma de Lope para observar el modo en que esos escritores leyeron al Fénix, y para examinar la recepción de la obra lopesca analizando estos fantasmales homenajes.

  17. A comparison of the cosmic-ray energy scales of Tunka-133 and KASCADE-Grande via their radio extensions Tunka-Rex and LOPES

    Directory of Open Access Journals (Sweden)

    W.D. Apel

    2016-12-01

    Full Text Available The radio technique is a promising method for detection of cosmic-ray air showers of energies around 100PeV and higher with an array of radio antennas. Since the amplitude of the radio signal can be measured absolutely and increases with the shower energy, radio measurements can be used to determine the air-shower energy on an absolute scale. We show that calibrated measurements of radio detectors operated in coincidence with host experiments measuring air showers based on other techniques can be used for comparing the energy scales of these host experiments. Using two approaches, first via direct amplitude measurements, and second via comparison of measurements with air shower simulations, we compare the energy scales of the air-shower experiments Tunka-133 and KASCADE-Grande, using their radio extensions, Tunka-Rex and LOPES, respectively. Due to the consistent amplitude calibration for Tunka-Rex and LOPES achieved by using the same reference source, this comparison reaches an accuracy of approximately 10% – limited by some shortcomings of LOPES, which was a prototype experiment for the digital radio technique for air showers. In particular we show that the energy scales of cosmic-ray measurements by the independently calibrated experiments KASCADE-Grande and Tunka-133 are consistent with each other on this level.

  18. «Que es gente que come arroz, / pasas, higos y alcuzcuz»: the Construction of the Stereotyped Moorish Figure in Nine Plays by Lope de Vega

    Directory of Open Access Journals (Sweden)

    Benedetta Belloni

    2013-05-01

    Full Text Available Nine are the plays by Lope de Vega in which the Moorish figure can be considered as an active dramatic character. In them, the Fénix presents to the audience a character which is basically a distorted image of the real social subject: the author seems to rely on the features of a disfigured «puppet», conceived by some levels of the socio-political environment of the time, in order to adjust the character to his own theatrical logic and present it from a comical perspective. Lope carries out his dramatic purpose through the use of four parameters: the choice of arabic names, the process of conversion to Christianity, the references to drinking wine and eating pork and, finally, the use of the moorish jargon. This paper focuses therefore on the observation of the stereotyped attributes that constitute the backbone of each of those figures, and reflects also about the meaning of the comical procedure that Lope manages in all the works of the analysed corpus.

  19. «Lope de Vega’s La hermosa Ester», a Tentative Reconstruction of Space in the Play

    Directory of Open Access Journals (Sweden)

    Marc Vitse

    2017-05-01

    Full Text Available This article aims to describe and characterize space in Lope de Vega’s biblical play La hermosa Ester (1610. With the exception of two comic interludes found respectively in cuadros E and H and set in a hamlet near to the Persian capital, the remaining 11 cuadros are set in the city of Susa. The city is represented by a palace with a garden, a throne room and the king’s chambers as well as an urban space (Jewish quarter, the favorite minister’s residence, and streets, both of which are linked by a square that is situated in front of the palace, a square that is of prime importance in the dramatic action. In contrast to Danielle Crivellari’s recent study on space in the work, this new proposed reconstruction, fashioned according to implicit stage directions, brings to light the dubious fragility of spacial elements when considering the play’s system of segmentation, that can find firmer bases in the metrics

  20. Fenología de algunas especies que son alimento para la pava aliblanca Penélope albipennis

    Directory of Open Access Journals (Sweden)

    Joaquín R. Martos

    2008-12-01

    Full Text Available En la Reserva Ecológica Privada Chaparrí, Chongoyape (Lambayeque se evaluó la fenología (desarrollo vegetativo, floración y fructificación de 17 especies vegetales que alimentan a la pava aliblanca (Penélope albipennis Taczanowski. Las evaluaciones fueron mensuales entre julio 2004 y junio 2005, en tres zonas denominadas: bosque seco de planicie, bosque seco de quebrada húmeda y bosque seco de ladera. La temperatura tuvo correlación con el desarrollo vegetativo, floración y fructificación. De las 17 especies evaluadas, 6 especies (35,3% estuvieron disponibles como alimento de la pava aliblanca durante todo el año, en tanto que de las 11 especies restantes (64,7% fueron de carácter estacional; durante todo el año la pava aliblanca dispone de oferta alimenticia de alguna de las especies evaluadas.

  1. Incidência e fatores de risco da retinopatia da prematuridade no Hospital Universitário Onofre Lopes, Natal (RN - Brasil Incidence and risk factors of retinopathy of prematurity in University Hospital Onofre Lopes, Natal (RN - Brazil

    Directory of Open Access Journals (Sweden)

    Aline Macêdo Pinheiro

    2009-08-01

    Full Text Available OBJETIVOS: Determinar a incidência de retinopatia da prematuridade e avaliar os principais fatores de risco implicados no seu desenvolvimento. MÉTODOS: Estudo coorte retrospectivo de base hospitalar realizado no período de janeiro de 2004 a dezembro de 2006, no Hospital Universitário Onofre Lopes, Natal (RN - Brasil. A amostra foi composta por 663 recém-nascidos, com idade gestacional 20 dias (p=0,022; ORaj=3,40; IC= 1,19-9,69 e a transfusão sanguínea (p=0,022; ORaj=2,06; IC= 1,11-3,83 são fatores independentes de risco para a doença. CONCLUSÕES: O estudo demonstra uma alta incidência da patologia no serviço. O baixo peso ao nascer, um tempo prolongado de oxigenoterapia, bem como a transfusão sanguínea são fatores associados ao desenvolvimento da retinopatia da prematuridade. Idade gestacional não é um dado confiável para a triagem dos neonatos realizada pelo setor.PURPOSES: To determine the incidence of retinopathy of prematurity and assess the main risk factors involved in its development. METHODS: Retrospective cohort study carried out from January 2004 to December 2006, at University Hospital Onofre Lopes, Natal (RN - Brazil. The sample was composed of 663 newborns, with less than or equal to 36 weeks of gestational age and/or birth weight less than or equal to 1,500 g, submitted to the protocol of retinopathy of prematurity in the ophthalmology department of the hospital. The variables were: gender, birth weight, gestational age, duration of oxygen therapy, mechanical ventilation, sepsis and blood transfusion. Data were analyzed through the chi-squared test, Fisher's exact test and logistic regression model. RESULTS: Of the 663 cases, retinopathy of prematurity occurred in 414 (62.4%. Of the total sample, 338 (51.0% were male and 282 (42.5% female. Mean and standard deviation of weight, gestational age and duration of oxygen therapy were, respectively, 1,334.9 ± 345.6 g, 31.9 ± 2.3 weeks and 10.0 ± 14.0 days. The

  2. Validación de una prueba para evaluar la capacidad de percibir, expresar y valorar emociones en niños de la etapa infantil

    Directory of Open Access Journals (Sweden)

    José Miguel MESTRE NAVAS

    2011-01-01

    Full Text Available La Educación Emocional, independientemente de la etapa educativa, tiene una importante misión en la meta de todo proyecto educativo, el proceso de socialización de las generaciones más jóvenes. Sin embargo, es importante que los programas aplicados también sean evaluados con una medida válida y fiable de la progresión del desarrollo cognitivo¿emocional de los niños. En una muestra de 138 alumnos de la etapa infantil (3¿6 años este trabajo pone a prueba un instrumento para la evaluación de la capacidad para percibir, valorar y expresar emociones (según es definida por el modelo de Mayer & Salovey, 1997, 2007. Además de la prueba fueron desarrollados criterios externos evaluados por el profesorado sobre diversas cuestiones relacionadas con la adaptación personal y social de los niños. Los principales resultados parecen apuntar a que los niños de 3 a 6 años que mejor puntúan en la percepción y valoración de emociones básicas son percibidos por sus profesores como mejor adaptados a las normas escolares, con un mejor control de la impulsividad, un mejor rendimiento académico y una menor conflictividad. También es importante hacer notar que el estudio de evaluación está en fases iniciales y que tiene ciertas limitaciones al no ser controladas algunas variables importantes como la personalidad y la capacidad verbal. No obstante, se quisiera hacer notar el entusiasmo generalizado de los niños al realizar la prueba.

  3. O “Senhor absoluto dos Sertoes”. O “Capitao preto” José Lopes, a Amazônia e o Cabo Verde

    Directory of Open Access Journals (Sweden)

    Rafael Chambouleyron

    2008-01-01

    Full Text Available Este artículo discute las experiencias del cabo-verdiano José Lopes, figura influyente en los sertones de Río Negro, en la Amazonia de final del siglo XVII e inicio del siglo XVIII. Se trata de entender de qué manera su inserción en el mundo amazónico estuvo determinada no sólo por las redes de poder en las cuales se insertó, sino también en las especificidades de la sociedad y de la experiencia histórica cabo-verdiana de aquel momento.

  4. Propuesta para desarrollar las destrezas con criterios de desempeño mediados por el empleo de las TICs en el aula, en el área de Lengua y Literatura de acuerdo a la actualización curricular, en los alumnos del 4to. EGB paralelo A de la escuela Pedro de Vergara del cantón Gualaquiza de la provincia de Morona Santiago, durante el año lectivo 2011-2012

    OpenAIRE

    Barzallo Buele, Elsa Piedad; Quichimbo Pucha, Mónica Cecilia

    2012-01-01

    Encontrándonos en pleno siglo XXI con el auge de las nuevas Tecnologías de la Información y Comunicación (TICs) y su aplicación en el campo educativo, no como algo eventual y pasajero sino como herramientas que aún tienen mucho que aportar en pro de la enseñanza y del aprendizaje. Deteniendo la mirada en nuestro contexto referencial, en el nivel de Educación General Básica del centro educativo Fiscomisional "Pedro de Vergara" del cantón Gualaquiza, muchas son las deficiencias y necesidades...

  5. «Escribía / después de haber los libros consultado»: a propósito de Lope y los novellieri, un estado de la cuestión

    Directory of Open Access Journals (Sweden)

    Juan Ramón Muñoz

    2012-12-01

    Full Text Available El estudio que sigue constituye la primera parte de un ensayo más amplio en el que se pretende ofrecer un estado de la cuestión de la relación intertextual de Lope de Vega con los novellieri. En esta primera parte, pues, se realiza un panorama de la situación, ejemplificado con un caso concreto y, dentro del repaso de los estudios más significativos de la relación autor-autor, se analiza el de Lope con Giovanni Boccaccio.

  6. Los casos de conciencia en la novela pastoril del Siglo de Oro: casuismo y probabilismo en la Arcadia (1598 de Lope de Vega

    Directory of Open Access Journals (Sweden)

    Sánchez Jiménez, Antonio

    2014-06-01

    Full Text Available La Arcadia (1598 de Lope de Vega’s Arcadia (1598 was one of the most successful books in Lope’s already exceptional career, but, in spite of that success, modern critics insist in their criticism of the work, which they see as disorganized and superficial. In order to explain this contrast between these complaints and Arcadia’s success in Early-Modern times, we analyze one of the aspects of the work that critics reject the most: characterization, in particular of the two protagonists, the shepherds Anfriso and Belisarda, as well as some secondary characters. We claim that Golden Age readers must have appreciated the Arcadia’s characters partly because Lope designed them following a way of thinking typical of the time but profoundly strange to ours: moral theology’s casuistry and probabilism. In this context we examine the novel’s «cases» in detail, explaining how they must have been read and enjoyed at the time. In addition, this contextualization allows us to explore the reasons behind Lope’s interest for casuistry, and to relate this way of thinking to his experience as a playwright.La Arcadia (1598 de Lope de Vega fue uno de los libros más exitosos de la ya monstruosa carrera del Fénix, pero pese a ello la crítica actual insiste en criticar la obra tachándola de desorganizada y superficial. Para explicar el desfase entre estas críticas y el contrastable éxito de la Arcadia en su tiempo, este trabajo analiza uno de los aspectos más censurados por los estudiosos: la construcción de los personajes del libro, concretamente la de los dos protagonistas, los pastores Anfriso y Belisarda, y la de algunos personajes secundarios. En particular, proponemos que el lector áureo debió de apreciar los personajes de la Arcadia porque estaban diseñados de acuerdo con un hábito mental típico de la época, pero totalmente ajeno a nuestro modo de pensar, el casuismo y probabilismo de la teología moral. En este contexto examinamos en

  7. TLC y empleo. Algunas consideraciones teóricas e históricas para valorar las posiciones en torno al debate del TLC (Centroamérica, República Dominicana y EE.UU) y el empleo

    OpenAIRE

    Solano Solano, Mario A

    2011-01-01

    El análisis del impacto previsible del TLC sobre los niveles, tipo y clase de empleo, así como de la situación que enfrentará la clase trabajadora exige un claro análisis teórico y económico que posibilite valorar la viabilidad de las diversas posiciones que se observan. Resulta a todas luces reduccionista, simplificador y hasta manipulador, reducir el debate al tema de la creación de empleos sin examinar la calidad probable de los mismos y aislándolos de otros temas estrechamente rela...

  8. Diseño y validación de un instrumento de observación para valorar la toma de decisiones en la acción de recepción en voleibol

    OpenAIRE

    Manuel Conejero Suárez; Fernando Claver Rabaz; Carmen Fernández-Echeverría; Jara González-Silva; M. Perla Moreno Arroyo

    2017-01-01

    El objetivo del presente estudio fue diseñar y validar un instrumento de observación para medir la toma de decisiones en la acción de recepción en jugadores de voleibol en etapas de formación. El instrumento elabo-rado es una adaptación del GPAI (Game Performance Assessment Instrument) creado por Oslin, Mitchell, y Griffin (1998) en la dimensión toma de decisiones, en el que se establecen una serie de criterios que permiten valorar la toma de decisione...

  9. Valorar la precisión gestual y la fijación postural en la práctica deportiva mediante un instrumento de observación de la lateralidad motriz LATMO

    OpenAIRE

    Castañer Balcells, Marta; Andueza Azcona, Juan Antonio

    2008-01-01

    La lateralidad o hemidominancia corporal es un factor clave para el análisis de las habilidades motrices en la práctica deportiva. A pesar de la existencia de un buen número de tests y pruebas para valorar la lateralidad consideramos no del todo exhaustivas las aportaciones clásicas de valoración de la lateralidad puesto que sólo atienden a habilidades de manipulación, de praxia fina y de acciones cotidianas, en detrimento de las habilidades de estabilidad y de locomoción (Gallahue y Cleland ...

  10. Descripci??n del aceler??metro como m??todo para valorar la actividad f??sica en los diferentes periodos de la vida: revisi??n sistem??tica

    OpenAIRE

    Aguilar Cordero, M. J.; A. M. Sánchez López; Guisado Barrilao; R. Rodriguez Blanque; J. Noack Segovia; M. D. Pozo Cano

    2014-01-01

    Introducci??n: La acelerometr??a, se muestra como una de las t??cnicas m??s fiables, en el registro y almacenamiento de la cantidad y el nivel de actividad f??sica, realizada por cada persona y en un periodo de tiempo determinado. Objetivo: Esta revisi??n tiene como objetivo describir y analizar los principales art??culos que utilizan este m??todo para valorar la actividad f??sica. M??todo: Los art??culos seleccionados para ser incluidos en esta revisi??n se identificaron a trav??s de los sig...

  11. Evaluación de la eficacia del Sistema de Triage Manchester como herramienta para valorar y clasificar las urgencias pediátricas del Hospital Universitario Central de Asturias

    OpenAIRE

    García Artime, Marta

    2014-01-01

    Estudio observacional, descriptivo y retrospectivo, cuyo objetivo principal es: "Valorar la eficacia del Sistema de Triage Manchester en una unidad de Urgencias de Pediatría de un hospital de tercer nivel analizando la correlación entre el nivel de prioridad de MTS y los recursos utilizados e ingreso hospitalario" y objetivos secundarios: valoración específica en subcategorías definidas(Fiebre, dolor abdominal, Llanto o irritabilidad, Menores de 3 meses) y evaluación de los indicadores de ca...

  12. LAS IMPLICANCIAS ARQUEOLÓGICAS DEL DIARIO DE PERO LOPES DE SOUSA (1531 DURANTE SU VIAJE AL RÍO DE LA PLATA Y AL DELTA INFERIOR DEL RÍO PARANÁ / The archaeological implications of the Diary of Pero Lopes de Souza (1531 during his trip to the La Plata Riv

    Directory of Open Access Journals (Sweden)

    Gustavo Politis

    2014-12-01

    Full Text Available Normal 0 21 false false false ES-AR X-NONE X-NONE En este trabajo se estudia el diario del explorador portugués Pero Lopes de Souza en 1531 al Río de la Plata y al delta Inferior del río Paraná desde una perspectiva histórica y arqueológica. Este relato es el único documento de la época escrito en tiempo real por un testigo directo de los acontecimientos que describe y por lo tanto es una fuente de calidad superlativa para conocer los primeros momentos de la exploración europea en el Río de la Plata y para abordar el estudio de los indígenas que habitaban el área a principios del siglo XVI. En este artículo se resumirán y discutirán las observaciones de Lopes de Sousa en el contexto de la historia del Río de La Plata en la primera mitad del siglo XVI y de las investigaciones arqueológicas recientes.   Palabras clave: chana-timbú, arqueología del NEA, crónicas siglo XVI       Abstract In this paper the diary of the Portuguese explorer Pero Lopes de Sousa to the La Plata River and to the Lower Delta of the Paraná River is analyzed from a historical and archaeological perspective. This narrative is the only document written in real time from a direct witness of the accounts he described. Therefore it is a unique high-quality source to know about the early times of the European Conquest to the La Plata River and to approach the study of the indigenous people of the area at the beginning of the XVI Century. In this article, the observations and comments from Lopes de Souza are summarized and analyzed within the context of the history of the first half of the XVI Century and in the light of the recent archaeological investigations. Keywords: chaná-timbú, archaeology of Northeastern Argentina, XVI Century Chronicles 

  13. Arquivo pessoal: proposta de implantação de gestão documental no acervo do cartunista Byrata Lopes

    Directory of Open Access Journals (Sweden)

    Everton Tolves de Almeida

    2015-12-01

    Full Text Available Este artigo relata a implantação de um projeto de arquivo, estruturado no acervo do cartunista Byrata Lopes. No arquivo pessoal do cartunista constam documentos das mais variadas tipologias, como desenhos, fotografias e primeiras edições de suas revistas. O método utilizado para a coleta de dados foi por meio de entrevistas, facilitando uma comunicação mais abrangente sobre a estrutura do arquivo e a estrutura organizacional do acervo. O objetivo geral foi elaborar uma proposta de implantação de organização no arquivo pessoal do cartunista. Este projeto irá mostrar que um arquivo é muito mais que documentos: é história.

  14. El tapiz de Penélope continúa restauración del Palacio Abacial de Alcalá la Real

    Directory of Open Access Journals (Sweden)

    Santiago Quesada García

    2002-12-01

    Full Text Available La rehabilitación de este palacio característico de la Baja Andalucía representa un episodio añadido a su abigarrada historia, que el autor imagina como un lienzo entreverado de acontecimientos diversos que han enriquecido paulatinamente su urdimbre constructiva. Su artículo aspira a documentar y justificar la labor de tejido y deshilado que ha ejercido sobre el monumento histórico, como si de un mítico tapiz de Penélope se tratara. El texto, además, tiene a bien detenerse en los pormenores de las técnicas empleadas en el trenzado de sus nuevos mimbres.

  15. Enredos/desenredos de Berenice e Penélope: paralelo entre as personagens de O Manto de Marcia Tiburi e Odisséia de Homero

    Directory of Open Access Journals (Sweden)

    Alexandre Veloso de Abreu

    2011-12-01

    Full Text Available Neste artigo são analisadas as relações intertextuais entre o romance O manto, de Márcia Tiburi e Odisséia, de Homero. Através de uma sofisticada estratégia de elaboração ficcional, a autora contemporânea constrói densas metáforas sobre o ato de escrever, elegendo Penélope como uma espécie de ur-tessitura. Nos fragmentos gravados de Berenice se faz e se desfaz a narrativa, perpetuando a escrita como essencial ato de sempre se refazer, idêntico ao exercício da rainha de Ítaca de enredar e desenredar sua tela.Palavras-chave: Romance; Intertextualidade; Epopeia; Narratologia; Metalinguagem.

  16. «Beneméritos cruzados de la cultura española»: el tricentenario de Lope en el ámbito conservador español

    Directory of Open Access Journals (Sweden)

    Víctor García Ruiz

    2016-01-01

    Full Text Available En este trabajo se analizan diversas reacciones ante el Tricentenario lopiano que tienen en común su procedencia del ámbito conservador. Concretamente, las de Felipe Lluch, desde la crítica teatral; Joaquín de Entrambasaguas, desde la revista Fénix dedicada al Tricentenario; Eduardo Marquina, desde la creación escénica; y la revista católica Cruz y Raya. Se concluye que, a la altura de 1935, el tono y las posturas de estos testimonios conservadores coinciden sustancialmente con las aspiraciones de los sectores liberales en la construcción de un Lope popular y nacional.

  17. Diogo Lopes Pacheco. Acción política y diplomacia entre Portugal y Castilla en el siglo XV

    Directory of Open Access Journals (Sweden)

    Fátima Regina FERNANDES

    2009-12-01

    Full Text Available RESUMEN: Nuestra intención es analizar algunos conceptos como política exterior y diplomacia en la vida medieval ibérica a partir del estudio de un caso concreto: el del noble Diogo Lopes Pacheco. Portugués, consejero de muchos reyes, con fuertes lazos genealógicos con Casalla, participó intensamente en las diferencias diplomáticas entre los dos reinos y dio muestras de una extraordinaria capacidad de adaptación a las transformaciones estructurales que se estaban produciendo en la época y a las acciones relacionadas con la guerra civil entre los partidarios de Pedro 1 y los trastarnaristas, y participó también en las controversias por el trono castellano entre las Coronas de Portugal y de Castilla, en la periferia de la Guerra de los Cien Años.ABSTRACT: We intend to develop a work of analysis of some concepts such as that of foreign affairs and diplomacy in Iberian medieval life, from the study of an specific case, that of the nobleman Diogo Lopes Pacheco. Portuguese, Counselor of many Kings, with strong genealogical ties in Castile, he was deeply involved in the diplomatic disputes between the two kingdoms and displayed the most extraordinary capacity to adapt to the structural transformations that were occurring in the period, as weii as to the moves related to the civil war between propetrists and pro-trastamarists, and the disputes over the Castiiian throne between the realms of Portugal and Castile, at the periphery of the Hundred Years War.

  18. The ruby-crowned tanager Tachyphonus coronatus Vieillot, 1822 (Passeriformes: Thraupidae) as a new host for Isospora ramphoceli Berto, Flausino, Luz, Ferreira, Lopes, 2010 in Brazil.

    Science.gov (United States)

    Rodrigues, Mariana Borges; de Pinho, Irlane Faria; da Silva, Lidiane Maria; Lopes, Bruno doBomfim; Luz, Hermes Ribeiro; Ferreira, Ildemar; Lopes, Carlos Wilson Gomes; Berto, Bruno Pereira

    2017-06-01

    Despite 12 coccidian species had been recorded from passerines of the Thraupidae family, none of them has been reported in the Parque Nacional do Itatiaia, in Southeastern Brazil. This locality is a protected area with a high degree of vulnerability, and is considered a "conservation island" of biodiversity. The aim of the current work was describe Isospora ramphoceli Berto, Flausino, Luz, Ferreira, Lopes, 2010 from ruby-crowned tanagers Tachyphonus coronatus Vieillot, 1822 in the Parque Nacional do Itatiaia. The oocysts of I. ramphoceli are subspheroidal, 23.1 × 22.1 μm, with smooth, bilayered wall. Micropyle, oocyst residuum and polar granule are absent. Sporocysts are ellipsoidal or ovoidal, 16.2 × 10.8 μm. Stieda body is knob-like and substieda body is large and homogeneous. Sporocyst residuum is composed of many scattered granules. Sporozoites are vermiform with a posterior refractile body and a nucleus. In addition to new locality, this is the first description of I. ramphoceli from T. coronatus.

  19. A tecelagem lírica de uma Penélope moderna: a alquimia dos nós, de Yêda Schmaltz

    Directory of Open Access Journals (Sweden)

    Paulo Antônio Vieira Júnior

    2015-12-01

    Full Text Available A alquimia dos nós (1979, of Yêda Schmaltz, reinvents the myth of Penelope in Homer's record, in the Odisseia. Through a female view, the constant lyrical voice in the book, especially in the first part, "Fios (O livro de Penélope," develops the lyrical account of his union with Odysseus, the period suffering the absence of her husband and his return. The main change in the identity of Penelope from Schmaltz arises from reflection and treatment in relation to her sexuality and disenchantment to descry the beloved man when he returns. The verses that compose this work, often use the metaphor of weaving and fabric to characterize the lyrical voice as belonging to the heroine of the mythological past. But the metaphoric weaving also alludes  to Penelope´s  lonely  sexuality   and to the activity exercised by her, work with ingrain and poetic writing. This study undertakes reading the verses of Schmaltz from the considerations set on the metaphor of weaving and literary erotic consciousness developed by Hughes Liborel (1997, Ana Maria Machado (2001, Octavio Paz (2001 and Angélica Soares (1999.

  20. «ABC» en el tricentenario de Lope de Vega: una utilización del Fénix y su obra con fines ideológicos

    Directory of Open Access Journals (Sweden)

    María Álvarez Álvarez

    2016-01-01

    Full Text Available La celebración del tricentenario de la muerte de Lope de Vega en 1935 puso de actualidad el nombre del autor, que pasó a ser habitual en la prensa de la época. Del estudio del tratamiento que autor y obra recibieron ese año en el diario madrileño ABC, periódico conservador y promonárquico, obtenemos un ejemplo perfecto de una práctica que fue muy habitual durante este año: utilizar la obra y la figura del dramaturgo con fines ideológicos, para asociarlo con determinados valores y enviar así un mensaje que poco o nada tenía que ver con él. A través del estudio de artículos, noticias y reseñas teatrales, pretendemos mostrar el uso que ABC hizo del Fénix en su tricentenario y la imagen que de él y su obra buscó promover.

  1. Intervención cognitivo conductual en adultos mayores : retos y dificultades en la adaptación de una terapia de grupo manualizada /

    OpenAIRE

    Vergara-Lope Tristán, Samana sustentante.

    2009-01-01

     tesis que para obtener el grado de Doctor en Psicología, presenta Samana Vergara-Lope Tristán ; asesor Ana Luisa González-Celis Rangel. 271 páginas. Doctorado en Psicología UNAM, Facultad de Psicología, 2009

  2. El obispo Lope de Barrientos y la sociedad judeoconversa : su intervención en el debate doctrinal en torno a la "Sentencia-Estatuto" de Pero Sarmiento

    Directory of Open Access Journals (Sweden)

    Enrique Cantera Montenegro

    1997-01-01

    Full Text Available El proceso de integración de los judeoconversos en la sociedad hispanocristiana resultó profundamente controvertido, y constituyó una de las cuestiones más relevantes de la Castilla del siglo xv. Los años centrales de la centuria decimoquinta estuvieron marcados por una interesante polémica doctrinal en torno a la llamada «Sentencia-Estatuto» de Pero Sarmiento, que ordenaba la exclusión de los judíos y de los judeoconversos de todos los oficios públicos de la ciudad de Toledo. En este debate intervino el obispo de Cuenca Lope de Barrientos, una de las personalidades más destacadas del panorama político y eclesiástico de la Castilla de mediados del siglo xv. Junto a otras destacadas figuras del momento (Fernán Díaz de Toledo, Alonso de Cartagena, Juan de Torquemada, Barrientos defendió la plena integración de los judeoconversos en la sociedad hispanocristiana, así como la necesidad de tolerancia hacia ios recién convertidos al cristianismo en tanto durase el proceso de adoctrinamiento en su nueva religión. El debate se prolongó durante la segunda mitad del siglo xv, imponiéndose a la larga quienes propugnaban la adopción de medidas restrictivas para con la actuación pública de los cristianos nuevos, que cristalizarían en el apartamiento de los judaizantes y de sus descendientes del ejercicio de oficios públicos y en la aparición de los «estatutos de limpieza de sangre», ya en vísperas de la Modernidad.The integration process of the jewish converts in the christian spanish society was highiy controversial and it suppoused one of the most relevant sub¡ects in the Castile of the XV century. The central years of that century were characterized by an interesting doctrinal debate around the so —called Pero Sarmiento's «Sentencia-Estatuto», that ordered the exclusión of jewish and convert jewish from all civil service jobs of the city of Toledo. The bishop of Cuenca, Lope de Barrientos, one of the most relevant

  3. Penélopes do século XX: a cultura popular revisitada Twentieth-century Penelopes: popular culture revisited

    Directory of Open Access Journals (Sweden)

    Cleci Eulalia Favaro

    2010-01-01

    Full Text Available No processo de ocupação das chamadas Velhas Colônias italianas do Rio Grande do Sul, os imigrantes construíram um corpo de valores positivos, destinado a servir de suporte emocional e veículo de comunicação externa. Por meio do bordado de imagens e inscrições sobre panos de parede ou panos de cozinha em tecidos rústicos, as mulheres contribuíram para alimentar o sonho de uma vida melhor. Desejo de todos, realização de alguns, as penélopes do século XX deixaram naqueles objetos testemunhos de um modo de fazer, pensar e agir: museus locais e exposições estimulam o resgate de antigas técnicas e temas de bordado; os produtos, comercializados nas feiras e festas regionais, convertem-se em renda para mulheres excluídas, pela idade, do mercado de trabalho formal.During their settlement of the so-called Old Italian Colonies of Rio Grande do Sul, immigrants constructed a set of positive values that were to serve as an emotional support and a means of outside communication. When women immigrants embroidered images and sayings on wall hangings or kitchen towels made of rustic fabric, they helped nourish the dream of a better life, sought by all and achieved by some. The objects crafted by these twentieth-century Penelopes bear witness to a way of doing, thinking, and acting. Local museums and exhibits have fostered the recovery of old-time embroidery techniques and themes; sold at open-air markets and regional festivals, these products represent income for women whose age excludes them from the formal labor market.

  4. JUAN M. LOPE BLANCH. El habla de Diego de Ordaz. Contribución a la historia del español americano. México, UNAM. 1985. 233 p.

    Directory of Open Access Journals (Sweden)

    J. L. R.

    1988-06-01

    Full Text Available Este libro reúne los trabajos publicados por Lope Blanch en revistas especializadas y homenajes académicos acerca del idiolecto de este importante americano nacido en tierras leonesas hacia 1480, colonizador de las Antillas, expedicionario a Tierra Firme y a Cuba, conquistador de México y explorador del Orinoco. La base documental está constituida por siete cartas autógrafasque L.B. publica al final del libro en una cuidadosa transcripción que corrige defectos de una edición anterior.

  5. Validez de cuatro cuestionarios para valorar la actividad física en adolescentes españoles Validity of four questionnaires to assess physical activity in Spanish adolescents

    Directory of Open Access Journals (Sweden)

    David Martínez-Gómez

    2009-12-01

    Full Text Available Objetivos: Es necesario conocer la actividad física que realizan los adolescentes españoles para valorar cómo la falta de este hábito afecta al incremento de la prevalencia de la obesidad. Por ello, para medir la actividad física en estas edades es imprescindible tener instrumentos de medición válidos. El objetivo de este estudio fue evaluar la validez de cuatro cuestionarios de fácil aplicabilidad (las preguntas enKid y FITNESSGRAM, el cuestionario PACE y una escala comparativa para medir la actividad física en adolescentes españoles, utilizando como criterio un acelerómetro. Métodos: 232 adolescentes rellenaron los cuestionarios y usaron durante siete días el acelerómetro ActiGraph. Se utilizó la correlación de Spearman (rho para comparar los resultados de los cuestionarios y la actividad física total, moderada, vigorosa y moderada a vigorosa obtenida por el acelerómetro. Resultados: Todos los cuestionarios obtuvieron correlaciones moderadas en comparación con la actividad física total (rho=0,36-0,43 y moderada a vigorosa obtenidas por el acelerómetro (rho=0,34-0,46 en el total de la muestra. Se encontraron correlaciones más altas al comparar los cuestionarios con la actividad física vigorosa (rho=0,42-0,51 que con la moderada (rho=0,15-0,17. La pregunta FITNESSGRAM y el cuestionario PACE obtuvieron débiles correlaciones en las chicas, mientras que la pregunta enKid y la escala comparativa obtuvieron correlaciones moderadas para chicos y chicas. Conclusiones: Los cuatro cuestionarios presentan una aceptable validez para valorar la actividad física de la población adolescente española.Objectives: The physical activity (PA levels of Spanish adolescents must be determined to assess how the lack of PA may affect the increasing prevalence of obesity. Thus, to assess PA in this age range valid measurement instruments are essential. The aim of this study was to evaluate the validity of four easily applied questionnaires

  6. Educación y tecnologías de la información y la comunicación ¿es posible valorar la diversidad en el marco de la tendencia homogeneizadora?

    Directory of Open Access Journals (Sweden)

    GEORGINA VIVANCO

    2015-01-01

    Full Text Available Este artículo reflexiona críticamente sobre la incorporación de las tecnologías de la información y la comunicación (TIC en la educación, cuestionando la posibilidad de valorar la diversidad en la actual tendencia homogeneizadora de las políticas educacionales. A partir de una investigación bibliográfica, se relevan los contextos de las políticas y programas de incorporación de las TIC en la educación y las lógicas que las sustentan. Se propone contribuir con una perspectiva cultural para abordar el aprendizaje escolar con tecnologías digitales, dentro de marcos de igualdad democrática pero con orientación a la diversidad cultural. Se parte explorando el escenario de globalización y cómo este condiciona la racionalidad que subyace a las políticas públicas en educación. También se reflexiona sobre cómo las TIC han dejado de ser un medio, para convertirse en un ecosistema comunicativo que favorece nuevas subjetividades y formas de estar en el mundo. Finalmente, se enfatiza la necesidad de profundizar la dimensión cultural en la incorporación de las tecnologías en la educación y su articulación transversal con las dimensiones pedagógicas y de inclusión social.

  7. «Cantaron desta suerte...». Functions of Music in the Mistery Play «Bodas entre el alma y el amor divino», by Lope de Vega, Religious Transposition of the Royal Weddings of 1599

    Directory of Open Access Journals (Sweden)

    María Asunción Flórez Asensio

    2013-05-01

    Full Text Available In 1599 Lope de Vega atended the festivities organised in Valencia to celebrate the double royal wedding between Felipe III and his sister Isabel Clara Eugenia with the Archdukes Margaret and Albert of Austria. This historical event was transformed into a religious occasion. This auto reflects a «divine» version of the facts. Included at the end of Book II of El peregrino en su patria, published five years later, this  auto (as well as the others included in the collection allow us to confirm not only that Lope uses music more in his mystery plays than in his comedies, but also that at this early time he had already started to experiment with a series of musical elements that, after being developed by Calderón, came to be characteristic of Spanish Golden Age theatre.

  8. Lope and the Creation of Contemporary Heroes: «La nueva victoria de don Gonzalo de Córdoba» y «La nueva victoria del marqués de Santa Cruz»

    Directory of Open Access Journals (Sweden)

    Teresa Ferrer Valls

    2013-05-01

    Full Text Available Lope defended the usefulness of history presented on stage, that is, theatre’s function of preserving and creating a collective memory. In the case of La nueva victoria de don Gonzalo and La nueva victoria del marqués de Santa Cruz, this playwright dramatized military events that took place immediately before the composition of these plays. In this article i will analyze the fundamental traits of those texts in relation to Lope’s desire to please his patrons and, at the same time, to participate in the making of a Spanish national identity, which intensified during the first years of king Philip IV’s reign through different media, among them painting and theatre. This paper ends reflecting on the risk assumed by the playwright when dealing with recent political events. This is exemplified by the existing news about the prohibition of a play by Lope, nowadays lost, related to the death of the king of Sweden, in which the protagonists of the two aforementioned plays are also referenced.

  9. Extraction of Forest Dynamics and Biophysical Parameters Using LiDAR and PolInSAR Data Fusion Approach (A Case Study of Lope National Park, Gabon)

    Science.gov (United States)

    Pourshamsi, M.

    2016-12-01

    Forests play a vital role in the global carbon cycle (Balzter et al., 2005). They store large amounts of carbon in the form of biomass (Balzter et al., 2008). Biomass is the key forest parameters (Mette et al., 2004) due to its relevance to the global carbon cycle modelling and international programmes aimed at reducing greenhouse gas emissions from deforestation and forest degradations (REDD) in tropical areas. Direct measurement of biomass in the field is time consuming and expensive at it requires destructive sampling. Remote sensing approaches are indispensable to map large areas routinely, overcoming some of the limitations of the field measurement approach. However, remote sensing technique alone is not able to estimate biomass directly. Forest biomass can be estimated indirectly from some other forest parameters extracted more accurately from the remotely sensed images; such parameters are collectively known as vertical structure and include tree height, forest canopy height, canopy density braches and stems in a given area. Knowledge of vertical structure is a key factor for quantifying the terrestrial carbon cycle effectively (Mette et al., 2004, Balzter et al., 2007, Gama et al., 2010). Several approaches have been proposed for the biomass estimation from forest vertical structural parameters, but there are still large uncertainties in biomass maps and hence carbon models. In the near future different types of satellite missions are going to be launched to provide data for testing new approaches in terms of improving the accuracy of extracted parameters. The two key missions that are planned to be launched are ESA's BIOMASS (P-band radar) and NASA's GEDI (LiDAR). In my PhD a novel approach will be developed and tested for a site within Lope National Park in Gabon in support of these forthcoming missions by fusing airborne Polarimetric SAR Interferometry (PolInSAR) datasets acquired by the L band NASA's UAVSAR instrument, LiDAR datasets acquired by the

  10. Incidência e fatores de risco da retinopatia diabética em pacientes do Hospital Universitário Onofre Lopes, Natal-RN

    Directory of Open Access Journals (Sweden)

    Garcia Carlos Alexandre de Amorim

    2003-01-01

    Full Text Available OBJETIVO: Estudar a incidência e fatores de risco (tempo de doença e presença de hipertensão arterial sistêmica para retinopatia diabética em 1002 pacientes encaminhados pelo Programa de Diabetes do Hospital Universitário Onofre Lopes no período de 1992 - 1995. MÉTODOS: Estudo retrospectivo de pacientes com diagnóstico de diabetes mellitus encaminhados ao Setor de Retina do Departamento de Oftalmologia pelo Programa de Diabetes do Hospital Universitário e submetido, sob a supervisão do autor, a exame oftalmológico, incluindo medida da acuidade visual corrigida (tabela de Snellen, biomicroscopia do segmento anterior e posterior, tonometria de aplanação e oftalmoscopia binocular indireta sob midríase (tropicamida 1% + fenilefrina 10%. Foi realizada análise dos prontuários referente ao tempo de doenças e diagnostico clínico de hipertensão arterial sistêmica. RESULTADOS: Dos 1002 diabéticos examinados (em 24 deles a fundoscopia foi inviável, 978 foram separados em 4 grupos: sem retinopatia diabética (SRD, 675 casos (69,01%; com retinopatia diabética não proliferativa (RDNP, 207 casos (21,16%; com retinopatia diabética proliferativa (RDP, 70 casos (7,15%; e pacientes já fotocoagulados (JFC, 26 casos (2,65%. Do total, 291 eram do sexo masculino (29% e 711 do sexo feminino (71%. Os 4 grupos foram ainda avaliados quanto ao sexo, a faixa etária, a acuidade visual, tempo de doença, presença de catarata e hipertensão arterial sistêmica e comparados entre si. Com relação ao tipo de diabetes, 95 eram do tipo I (9,4%, 870 pacientes eram do tipo II (86,8%, e em 37 casos (3,7% o tipo de diabetes não foi determinado. CONCLUSÕES: Comprovou-se que os pacientes com maior tempo de doença tinham maior probabilidade de desenvolver retinopatia diabética, e que a hipertensão arterial sistêmica não constituiu fator de risco em relação à diminuição da acuidade visual nos pacientes hipertensos.

  11. Diseño y verificación de un instrumento para registrar las necesidades de los padres en cuanto a apoyo personal e institucional. CSNP (Cuestionario para valorar la situación y las necesidades de los padres de niños con discapacidad)

    OpenAIRE

    Eckert, Andreas

    2009-01-01

    La situación de las familias de niños con necesidades educativas especiales se caracteriza por numerosas particularidades que crean necesidades específicas dentro de la familia. La comprensión de estas necesidades permite a los profesionales organizar más servicios orientados a la familia. El “Cuestionario para valorar las Necesidades de los Padres de niños con necesidades educativas especiales (CSNP)”, es un cuestionario enfocado principalmente a recoger las necesidades personales de los pad...

  12. “I’m in the Hospice, god”: problematizations about the madness, the hospice and the psychiatry in the diary of Maura Lopes Cançado (Brazil, 1959-60

    Directory of Open Access Journals (Sweden)

    Yonissa Wadi

    2017-12-01

    Full Text Available The writer Maura Lopes Cançado circulated in the world of the psychiatric hospitals between the 1950s, 1960s and 1970s. During one of hospitalizations (1959-1960, the third time in the National Psychiatric Center, a hospital complex in Rio de Janeiro, the writer wrote a diary that was later published as the book Hospice is God-Diary I. The bond between the live lived by her and the fiction, which the narrator transited in her diary, creating a unique work from the perspective of academic commentators and literary critics. In the history field of madness and psychiatry, this work offers new possibilities for understanding the configuration of psychiatric care, scientific and therapeutic practices and the various subjects that circulated in the world of Brazilians psychiatric hospitals, in the 1950s, operating a displacement in relation to traditional places of enunciation that are known. In this article, I chose to observe the problematizations of Maura about the institutional daily life and the fact of writing a diary, which oscillate between teaching others and the care of the self. Therefore, I did an enunciative analysis of the narrative, that values the things that were said by her as one of the truths about the psychiatric hospital, medical science and its practices, the mad and the madness.

  13. De nuevo sobre el significado iconográfico de Las hilanderas de Velázquez: ¿fábula de Aracne o Penélope hilando?

    Directory of Open Access Journals (Sweden)

    Martín del Burgo, Lorenzo

    2006-02-01

    Full Text Available The objective of the present essay is to discover the iconographic meaning of Velázquez’s The spinners. The starting point is the painting’s interpretation established by Diego Angulo Íñiguez as “Fable of Arachne”. This interpretation is discussed and corrected. Also the identification of The spinners with the painting Fable of Arachne in Don Pedro de Arce’s inventory, published by María Luisa Caturla, is revised. The conclusion is that, in Velázquez’s The spinners’ scene, we can see to Penelope spinning, with her servants, under Pallas Athena’s protection.En el presente artículo se pretende establecer el significado iconográfico de Las hilanderas de Velázquez. Partiendo de la interpretación del cuadro establecida por Diego Angulo Íñiguez como “Fábula de Aracne”, se discute y corrige dicha interpretación. Asimismo se cuestiona la identificación de Las hilanderas con la Fábula de Aracne del inventario de don Pedro de Arce, descubierto por María Luisa Caturla. Se concluye que lo que la escena de Las hilanderas nos muestra es a Penélope hilando, en compañía de sus sirvientas, bajo la protección de Palas Atenea.

  14. Achados da fundoscopia e alterações do pé diabético em pacientes do Hospital Universitário Onofre Lopes/UFRN Fundoscopic alterations and diabetic foot in patients of Hospital Universitário Onofre Lopes/UFRN

    Directory of Open Access Journals (Sweden)

    Damaso de Araújo Chacon

    2005-01-01

    é e 47,62% tinham algum grau de neuropatia diabética. Observou-se que a retinopatia diabética não proliferativa, nos seus diversos graus de comprometimento apresentou-se com percentuais em torno de 80% junto às lesões do pé diabético, seja isquêmico ou neuropático. Dos pacientes que tinham retinopatia 60,46% tinham alterações biomecânicas dos pés. CONCLUSÃO: Concluiu-se que a RDNP leve foi mais freqüente nas lesões do pé diabético isquêmico, enquanto a RDNP severa mostrou-se mais presente no pé diabético neuropático.PURPOSE: To identify diabetic foot abnormal changes caused by microvascular events and fundoscopy eye lesions due to diabetic retinopathy. METHODS: A survey was performed with 76 diabetic patients from the Hospital Onofre Lopes out-patient department of ophtalmology and vascular surgery. To evaluate the diabetic foot the patients were submmited to an individual interview using Fontaine classification. The vascular test used was Semmes-Weinstein monofilament. Refraction and eye fundoscopy were acomplished in all patients to arrange the diabetic retinopathy.The study results consisted in characterized the group as age,time of disease and glicose level. The second analyse was performed with association tests among the selected secondary study results. " Statística Versão 5,1997 " was the software available. RESULTS: From 76 diabetics patients 97% had age higher than 40 years. 65% had more than 10 years of time disease. 72,72% obtained glicose level>100mg/dl. 55,5% had some degree of diabetic retinopathy against 44,74% had not. About the diabetic foot abnormalities, 59,93% had ischemic damages and 41,07% had not signs. 58,82% had neuropathic foot and there were 41,18% patients without diabetic neuropathy signs. Talking about the diabetic retinopathy population, 78,57% had ischemic foot and 47,62% had neuropathic foot. It was seen 80% of no proliferative diabetic retinopathy in all diabetics foot ( isquemic and neuropathic.The patients

  15. Modelos educativos de nobre e rei na Crônica de D. JOÃO I, de Fernão Lopes - doi: 10.4025/actascieduc.v32i1.9471

    Directory of Open Access Journals (Sweden)

    Adriana Maria de Souza Zierer

    2010-08-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabela normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} Normal 0 21 false false false MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabela normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} A partir do momento em que ascendeu ao poder político por meio do Movimento de Avis (1383-1385, D. João e seus filhos estimularam a produção de obras que indicavam modelos de comportamento voltados à educação da corte e conhecidos como Prosa Moralística. A Crónica de D. João I, escrita por Fernão Lopes após a morte desse monarca, com o objetivo de legitimar o seu poder e o de sua descendência, também se constitui em manual educativo, pois propõe modelos ideais de comportamento da nobreza e da monarquia. A "nova nobreza" deveria estar ligada à "causa nacional" e o "novo monarca" deveria possuir uma série de virtudes incontestáveis, que ultrapassassem a condição de bastardia de D. João I e o apresentassem como novo modelo de monarca. Portanto, os dois heróis e modelos educativos do cronista Fernão Lopes são o nobre Nuno Álvares Pereira, associado à imagem do cavaleiro arturiano Galaaz, e o rei D. João, o Messias de Lisboa, que "salvou" aquela cidade do domínio castelhano. As rela

  16. Absolute Calibration of the Lopes Antenna System

    NARCIS (Netherlands)

    Nehls, S.; Bähren, L.; Buitink, S.J.; Falcke, H.D.E.; Horneffer, K.H.A.; Kuijpers, J.M.E.; Lafebre, S.J.; Nigl, A.; Petrovic, J.

    2006-01-01

    Radio emission in extensive air showers arises from an interaction with the geomagnetic field and is subject of theoretical studies. This radio emission has advantages for the detection of high energy cosmic rays compared to secondary particle or fluorescence measurement methods. Radio antennas like

  17. A urdimenta de penélope

    Directory of Open Access Journals (Sweden)

    José Reis Correia

    2006-06-01

    Full Text Available PENELOPE’S LOOM. In this text we discuss the challenges, foundations and perplexities an urbanist encounters in his/her commitment to build an urban praxis in the context of the enlarged city. First we take a look at urban management: its actions, tools and functional incoherencies, guiding reflection towards the ethical underpinnings of an urban planner’s actions. In the second part we examine the systemic identity of urban space and encourage a re-evaluation of the basic factors that build the legibility patterns of this identity – particularly the limits, dynamics and tensions – in the search of a link to an urbanistic praxis that is at once perceptive and operative.

  18. Ingrid Galster, Aguirre o La posteridad arbitraria: La rebelión del conquistador vasco Lope de Aguirre en historiografía y ficción histórica (1561-1992), Bogotá, Universidad Javeriana, 2011, 844 p.

    OpenAIRE

    Montenegro, Giovanna

    2012-01-01

    En 1996 la Profesora Ingrid Galster publicó la versión alemana de su estudio sobre la historia de la recepción del  "loco," "tirano," "peregrino" y conquistador vasco Lope de Aguirre, conocido por su rebelión contra la Corona Española en 1561 y su intención de fundar una monarquía en tierras Iberoamericanas. La versión original de Galster fue escrita como una tesis requerida para obtener su cátedra en Letras Hispánicas en la Universidad de Eichstätt. Finalmente en 2011, 15 años después de su ...

  19. Gender and Community Empowerment in a Post-Conflict Context: The Case of Vergara, Cundinamarca (Colombia

    Directory of Open Access Journals (Sweden)

    Leonardo Güiza Suárez

    2016-06-01

    We will argue that the environmental community participation has been an instrument for rural women’s empowerment in a post-conflict context while making a positive contribution to the consolidation of best practices of environmental governance in a gender perspective.

  20. "Vergara" and the Complexities of Teacher Employment Policies. ECS Education Policy Analysis

    Science.gov (United States)

    Rowland, Julie

    2015-01-01

    Teaching quality is a crucial factor in student success, contributing to students' short- and long-term learning opportunities. High-quality teaching not only contributes to the improvement of student test scores and graduation rates but also gives students a "strong foundation from which to advance and achieve" in the future. Long term,…

  1. Modelos educativos de nobre e rei na Crónica de D. João I, de Fernão Lopes = Educational models for nobles and kings in Fernão Lopes’s John I’s Chronicles

    Directory of Open Access Journals (Sweden)

    Adriana Maria de Souza Zierer

    2010-01-01

    Full Text Available A partir do momento em que ascendeu ao poder político por meio do Movimento de Avis (1383-1385, D. João e seus filhos estimularam a produção de obras que indicavam modelos de comportamento voltados à educação da corte e conhecidos como Prosa Moralística. A Crónica de D. João I, escrita por Fernão Lopes após a morte desse monarca, com o objetivo de legitimar o seu poder e o de sua descendência, também se constitui em manual educativo, pois propõe modelos ideais de comportamento da nobreza e da monarquia. A “nova nobreza” deveriaestar ligada à “causa nacional” e o “novo monarca” deveria possuir uma série de virtudes incontestáveis, que ultrapassassem a condição de bastardia de D. João I e o apresentassem como novo modelo de monarca. Portanto, os dois heróis e modelos educativos do cronista Fernão Lopes são o nobre Nuno Álvares Pereira, associado à imagem do cavaleiro arturiano Galaaz, e o rei D. João, o Messias de Lisboa, que “salvou” aquela cidade do domínio castelhano. As relações entre nobreza e monarquia propostas na Crónica indicam a centralização do poder e disciplinarização dos nobres pela monarquia.When he achieved political power through the Avis movement (1383-1385, John I and his sons stimulated the production of literary works, known as “Moralistic prose,” that furnished behavior patterns within the context of education at the royal court. Fernão Lopes’s John I’s Chronicles, written after the monarch’s death tried to legitimize his power and the power of his descendants. It was also an educational manual since it provided ideal models for the behavior of nobles and kings. The "new nobility" should be involved with the "national cause" and the "new king" should show incontestable virtues that would be beyond the illegitimacy status of John I. The latter would be indicated as a new royalty model. Therefore, the two heroesand educational models of the chronicler Fernão Lopes

  2. Women and their struggle for emancipation in Lopes' works | Mwepu ...

    African Journals Online (AJOL)

    Sa manière particulière de l'aborder consiste à placer une voix révolutionnaire dans la bouche des femmes elles-mêmes qui parlent de leur condition et cherchent des solutions, bien que l'auteur soit lui-même un homme. Keywords: La femme africaine, la mission, la quête de l'émancipation. Tydskrif vir Letterkunde Vol.

  3. Cardiotoxicity of Senna occidentalis in sheep ( Ovis aries ) | Lopes ...

    African Journals Online (AJOL)

    Dianthrone, the main toxic component of S. occidentalis, is known to impair mitochondrial oxidative phosphorylation, leading to myofiber degeneration. In this study, fifteen ewes were fed 0%, 2% or 4% of seeds of S. occidentalis for 63 days. Non-specific markers of myocyte injury and electrocardiograms were undertaken at ...

  4. Lopes i Afflek pobili vse rekordõ

    Index Scriptorium Estoniae

    2004-01-01

    Kuldse Vaarika antiauhinna (Golden Raspberry) saajad eelmise aasta halvimate filmitööde eest. Esmakordselt antiauhinna 24aastase ajaloo kestel võitis kõikides tähtsamates kategooriates üks film - "Gigli"

  5. Design and evaluation of the gait rehabilitation robot lopes

    NARCIS (Netherlands)

    Veneman, J.F.

    2007-01-01

    The goal of the work presented in this thesis was to realize a robotic device that is able provide suitable gait training to stroke patients. It is believed that motor training in general, but specifically for stroke patients should be intensive and task-specific in order to reach optimal outcome.

  6. Contrasting fortunes: lope in the uk/Shakespeare in Spain Contrasting fortunes: lope in the uk/Shakespeare in Spain

    Directory of Open Access Journals (Sweden)

    Keith Gregor

    2008-04-01

    Full Text Available In April 2004 the RSC began a season of five plays chosen from the vast, and still largely unexplored corpus of Spanish “Golden Age” drama. Laurence Boswell, who had received plaudits and also the Olivier Award for the SGA season he had conducted at The Gate theatre in London in 1992, was once again appointed to initiate audiences at Stratford, London and the provinces in the subtleties of the comedia form. And though at least two of the plays selected—Cervantes’s Pedro, the Great Pretender (directed by Mike Alfreds and the Mexican nun Sor Juana Inés de la Cruz’s House of Desires (directed by Nancy Meckler—had never been performed on the mainstream British stage, the pre-season hype and, naturally, Boswell himself were confident that the “plot-driven stories” of each of the plays, stories showing “essential human situations, like couples struggling with very recognizable dilemmas of love” (Boswell 2004, were what put them at the very centre of the European folk drama genre. In April 2004 the RSC began a season of five plays chosen from the vast, and still largely unexplored corpus of Spanish “Golden Age” drama. Laurence Boswell, who had received plaudits and also the Olivier Award for the SGA season he had conducted at The Gate theatre in London in 1992, was once again appointed to initiate audiences at Stratford, London and the provinces in the subtleties of the comedia form. And though at least two of the plays selected—Cervantes’s Pedro, the Great Pretender (directed by Mike Alfreds and the Mexican nun Sor Juana Inés de la Cruz’s House of Desires (directed by Nancy Meckler—had never been performed on the mainstream British stage, the pre-season hype and, naturally, Boswell himself were confident that the “plot-driven stories” of each of the plays, stories showing “essential human situations, like couples struggling with very recognizable dilemmas of love” (Boswell 2004, were what put them at the very centre of the European folk drama genre.

  7. A Teoria da Imagem como Explicação para a Atribuição de Pesos em Critérios de DecisãoThe Image Theory as Explanation for the Attribution of Values in Criteria for DecisionLa Teoría de la Imagen como Explicación para la Valorar los Criterios de Decisión

    Directory of Open Access Journals (Sweden)

    ESTIVALETE, Vânia de Fátima Barros

    2008-09-01

    task (complexity of the task and information’s quality were inserted with intention to test variations in the use of decision makers’ information. It was concluded that the individuals commit greater intentionally number of trespasses in the attribution of weights, that is, transgress axioms of the multicriterial method to choose one previous defined alternative. There is, also, no relation between the linearity of the process and the trespasses, discarding the linearity as an explanation for the trespasses. The result of this study supplies indications to prove that the decision makers have strong conceptual values in its structure of knowledge at the beginning the decision process, and that, these values guide the subsequent process all.RESUMENEste estudio tiene por finalidad determinar cómo las personas utilizan las informaciones en un proceso de toma de decisiones cuando tienen interés en lograr resultados previamente establecidos. Se utilizó una tarea decisoria multicriterio, resuelta con la ayuda de un SAD. El método de investigación fue experimental, con grupos experimentales, dividido por grado de conocimiento sobre el objeto de la decisión (coches del pueblo. También se incluyeron en el experimento otras dos variables independientes, la calidad de la información y la complejidad de la tarea. Las tres variables, una de sujeto (grado de conocimiento y dos de tarea (complejidad de la tarea y la calidad de la información se incluyeron con la finalidad de experimentar variaciones en el uso de la información por parte de los decisores. Se concluyó que los individuos cometen mayor número de transgresiones intencionalmente al valorar o sea, hay una transgresión de los axiomas del método multicriterio para seleccionar determinada alternativa. Tampoco hay relación entre la linealidad del proceso y las transgresiones, excluyéndose la linealidad como explicación para las transgresiones. El resultado de este estudio proporciona indicios para comprobar

  8. Evaluacion de un protocolo para valorar situaciones de desproteccion infantil: la opinion de los tecnicos

    National Research Council Canada - National Science Library

    Martin, Eduardo; Aciego de Mendoza, Ramon

    2011-01-01

    El objetivo de este trabajo es conocer la valoracion que los tecnicos municipales hacen de un protocolo cuyo objetivo es unificar, en los diferentes municipios de la isla de Tenerife, el procedimiento...

  9. Cómo valorar los sistemas de propiedad a partir de datos arqueológicos

    Directory of Open Access Journals (Sweden)

    Gilman, Antonio

    1997-12-01

    Full Text Available Processual archaeologists have been reluctant to address the nature of prehistoric property regimes. Ethnological evidence suggests a predictable development of such regimes over the evolutionary range of human societies. Examination of patterns of elite expenditure and household consumption can be used to evaluate such evolutionary scenarios in concrete cases.

    Los arqueólogos procesuales han sido remisos a ocuparse de la naturaleza de los regimenes prehistóricos de propiedad. La evidencia etnológica sugiere un desarrollo predecible de tales regimenes en el curso de la escala evolutiva de las sociedades humanas. El examen de los patrones relativos a los gastos de la elite y del consumo familiar puede usarse para evaluar tales escenarios evolutivos en casos concretos.

  10. Estudios etnográficos de las políticas públicas en contextos educativos

    OpenAIRE

    Peláez-Paz, Carlos; Jociles, María Isabel

    2014-01-01

    Carlos Peláez-Paz y María Isabel Jociles (Eds.). AUTORES: Martha Vergara Fregoso, Nancy Leticia Hernández, Rosa Evelia Carpio Domínguez, Josefina Madrigal Luna, Ana Cláudia Gomes de Souza, Carmen Osuna, Noemí Cabrera Morales, Bálint-Ábel Bereményi, Patricia López Giménez, José Castilla Segura, Adela Franzé Mudanó, Cecilia Diez, Rosane Kreusburg Molina, Rodrigo Alberto Lopes, Elena Gil Álvarez, Elena Vaquerizo Gómez, María Luisa Jiménez Rodrigo, Manuel A. Río Ruiz, Manuel Caro Cabr...

  11. Diseño de un Focus Group para valorar la competencia mediática en escenarios familiares

    Directory of Open Access Journals (Sweden)

    Natalia González Fernández

    2012-08-01

    Full Text Available Normal 0 21 false false false En este trabajo nos proponemos obtener información en profundidad, valiosa e ilustradora sobre el concepto que se tiene en los escenarios familiares acerca de la competencia en comunicación mediática, sobre todo en familias con hijos en proceso de formación (educación infantil y primaria, pues en estos entornos es especialmente relevante el concepto de competencia mediática por su valor y su potencial en el ámbito de la educación. El método de investigación para obtener esta información es el de la técnica del Grupo de Discusión o Focus group. Nuestra propuesta metodológica parte del convencimiento de que la competencia mediática comporta el conocimiento y manejo tanto de conceptos como de procedimientos y actitudes relacionados con seis dimensiones básicas (Ferrés, 2007. Implica el conocimiento y uso de lenguajes, de tecnología, de procesos de producción y distribución, de procesos de percepción e interacción, de ideología y valores, y por último de aspectos estéticos. A partir de tales dimensiones hemos estructurado las preguntas para los Grupos de Discusión. El resultado final de nuestra investigación ha sido la composición validada de un guión de entrevista grupal, guión que puede ser aplicado a una muestra más amplia a nivel nacional o en diferentes comunidades autónomas.

  12. Evaluación por competencias: una alternativa para valorar el desempeño docente universitario

    Directory of Open Access Journals (Sweden)

    Martha Alicia López Lasso

    2013-01-01

    Full Text Available El texto muestra los resultados del análisis del impacto de los procesos de evaluación del desempeño pedagógico de los docentes de la Universidad de Nariño. Investigación realizada con una muestra de 580 informantes: directivos, docentes y estudiantes de las sede Pasto y subsedes de Ipiales, Tumaco y Túquerres; a través de encuestas semi-estructuradas, el estudio evaluativo-descriptivo-propositivo explora la apreciación y el discurso de los informantes utilizando una metódica de examen sobre las derivaciones de la valoración del desempeño docente, cuyos hallazgos se triangulan con los resultados de la reflexión sistemática en torno a las realidades teóricas referentes al tema de la indagación y, se produce el tejido documental síntesis que culmina con una propuesta alternativa a manera de Plan de Mejora.

  13. SATISCORE: un cuestionario para valorar la satisfacción del paciente tras cirugía cardiaca

    Directory of Open Access Journals (Sweden)

    Rafael Llorens-León

    2014-10-01

    Conclusiones: SATISCORE es una herramienta válida, fiable y sencilla, útil en la valoración de la satisfacción del paciente con cirugía cardiaca, que puede servir para el seguimiento del paciente intervenido a corto, mediano y largo plazo.

  14. ¿Cómo valorar las componentes de la calidad de vida en los países en desarrollo?

    Directory of Open Access Journals (Sweden)

    Lafuente Lechuga, Matilde

    2007-01-01

    Full Text Available Este trabajo se inscribe dentro de una nueva corriente de investigación económica que aboga por aproximar la calidad de vida a partir de un conjunto informativo complejo, conteniendo elementos tradicionales de valoración económica basados en el bienestar material, como la renta per capita, pero que extiende el ámbito de evaluación a otros aspectos que están relacionados con la salud, la educación, la calidad del medio ambiente, el acceso a nuevas tecnologías o la relación con la actividad laboral, entre otros. A partir de la información estadística contenida en los Indicadores sobre el desarrollo Mundial, del Banco Mundial, y en los Informes sobre desarrollo humano, del Programa de Naciones Unidas para el Desarrollo, pretendemos estimar los perfiles de la calidad de vida de los países menos desarrollados. La técnica de agregación utilizada es el Análisis Factorial, que nos permite identificar la estructura latente a los diferentes indicadores de calidad de vida.

  15. Contribuciones metodológicas para valorar la multifuncionalidad de la agricultura campesina en la Meseta Purépecha

    Directory of Open Access Journals (Sweden)

    DANTE ARIEL AYALA-ORTIZ

    2009-01-01

    Full Text Available En este artículo se ofrece un análisis de la multifuncionalidad de la agricultura (MFA campesina en la Meseta Purépecha de Michoacán (México, con el objetivo de identificar algunos de sus componentes y contribuir al desarrollo de una metodología adecuada para su valoración. Entre las innovaciones metodológicas propuestas destacan los métodos desarrollados para: 1 estimar oferta de bienes sin mercados a partir de esquemas de valoración contingente; 2 aproximarse a evaluar la calidad de vida, y 3 medir la diversificación del riesgo en el ingreso de hogares rurales.

  16. ¿Cómo valorar las componentes de la calidad de vida en los países en desarrollo?

    OpenAIRE

    Lafuente Lechuga, Matilde; Losa Carmona, Antonio; García Luque, Olga

    2007-01-01

    Este trabajo se inscribe dentro de una nueva corriente de investigación económica que aboga por aproximar la calidad de vida a partir de un conjunto informativo complejo, conteniendo elementos tradicionales de valoración económica basados en el bienestar material, como la renta per capita, pero que extiende el ámbito de evaluación a otros aspectos que están relacionados con la salud, la educación, la calidad del medio ambiente, el acceso a nuevas tecnologías o la relación con la actividad lab...

  17. Cancer in Angola, resources and strategy for its control | Lopes | Pan ...

    African Journals Online (AJOL)

    However, 9 000 new cases of cancer are diagnosed each year.The most common types of cancer are: cancer of the cervix, breast, prostate, esophagus, stomach and head and neck, as well as cancers with infectious origin, such as Kaposi?s sarcoma and liver and bladder cancer. The foundation for developing national ...

  18. Performance-based adaptive assistance for different subtasks of walking in LOPES II

    NARCIS (Netherlands)

    Bayón, Cristina; Fricke, S.S.; Rocon, E.; van der Kooij, H.; van Asseldonk, E.H.F.

    2017-01-01

    1.INTRODUCTION Robotic gait training is a promising tool to improve walking ability after stroke, however, therapeutic effect might largely depend on the type of robotic gait trainer and control algorithm that is used [1]. Therapy should be task-specific and promote active participation as this is

  19. Performance-based adaptive assistance for different subtasks of walking in LOPES II

    NARCIS (Netherlands)

    Bayón, Cristina; Fricke, S.S.; Rocon, E.; van der Kooij, H.; van Asseldonk, E.H.F.

    2017-01-01

    1. INTRODUCTION Robotic gait training is a promising tool to improve walking ability after stroke, however, therapeutic effect might largely depend on the type of robotic gait trainer and control algorithm that is used [1]. Therapy should be task-specific and promote active participation as this is

  20. Lope on YouTube: Film Analysis and Amateur Video Production in a "Comedia" Course

    Science.gov (United States)

    Patterson, Charles

    2015-01-01

    Teachers of early modern theater often recognize that it is difficult for today's generation of students to approach old dramatic works as actual plays instead of written texts. Two methods for dealing with this difficulty have emerged in recent decades. On the one hand, some teachers have increasingly emphasized the value of performance…

  1. Tres comedias de Lope de Vega y una relación en episodios

    Directory of Open Access Journals (Sweden)

    Marta Villarino

    2000-11-01

    Full Text Available Este trabajo se propone estudiar la reescritura de una relación de sucesos que se inserta en un texto dramático como anclaje verosimilizador pero que al mismo tiempo permite difundir masivamente el contenido de un texto destinado a un público reducido y privilegiado, mientras da cuenta de las formas de celebrar la fiesta barroca.

  2. O Sexo do Desejo: Margaret Atwood reescreve Penélope

    OpenAIRE

    Bebiano, Adriana

    2008-01-01

    Os mitos e as figuras mitológicas da cultura clássica constituem um corpus particularmente fértil dentro da literatura ocidental, uma vez que, ao longo de séculos, têm estado na origem de muitas novas histórias e reconfigurações. cada época e cultura específicas os reescreve num movimento de transgressão que se apropria das histórias e das figuras do passado para produzir configurações que traduzem o momento histórico e a cultura que as reescreve. no contexto da literatura inglesa – i.e., da ...

  3. Lope de Vega and the Conquest of Spanish Theater in the Netherlands

    NARCIS (Netherlands)

    Blom, F.R.E.; van Marion, O.

    2017-01-01

    This contribution focuses on Lope’s conquest of Amsterdam’s Grand Theater in the 40s and 50s of the seventeenth century. Focusing on creative industries, we analyze the producer’s side for Lope’s “invasion” in the Netherlands, and the channels that were developed in order to faciltate the new

  4. [The formative role of the laboratory in teaching the science of physiology].

    Science.gov (United States)

    Guevara-Guzmán, Rosalinda; Urrutia Aguilar, María Esther

    2014-12-01

    Physiology teaching began with Claudius Galenus (c. 126-199 AD), known as Galen, who is considered the initiator of experimental physiology. This discipline was consolidated in the XIX century with the discoveries of Claude Bernard, which influenced the way of teaching this discipline in universities, independently from Anatomy. In Mexico, physiology teaching started in 1580. It was at the beginning of the XIX century when Valentín Gómez Farías created the professorship in Medical Sciences and Daniel Vergara Lope carried out its consolidation when he implemented a lab course. Doctor José Joaquín Izquierdo established that this subject ought to be taught by teachers with experience in research. Undoubtedly, formative physiology teaching carried out in labs must strengthen the application of method and scientific methodology in students. In this symposium, we put forward that the change in physiology teaching must promote multidisciplinary research in students, who will formulate a research question and develop an experimental model that will let them integrate their basic knowledge of physiology, pharmacology, biochemistry, and functional anatomy under the supervision of a research teacher.

  5. La evaluación docente en la Universidad del Caribe, un mecanismo para valorar la práctica docente con su modelo educativo

    OpenAIRE

    López Pensado, Virgilio

    2012-01-01

    La evaluación al desempeño docente es una de las estrategias medulares para lograr la calidad de la enseñanza en las instituciones educativas en general, y en la educación superior en lo particular, sin embargo, los ejercicios realizados en diversas universidades del país se han centrado más en la intención administrativa que formativa; en este contexto, el objetivo de este trabajo es presentar el proceso de la evaluación docente desarrollado en la Universidad del Caribe desde una postura f...

  6. Validación de una prueba para evaluar la capacidad de percibir, expresar y valorar emociones en niños de la etapa infantil

    OpenAIRE

    Mestre Navas, José Miguel; Rocío GUIL BOZAL; Fátima MARTÍNEZ-CABAÑAS RODRÍGUEZ; Cristina LARRÁN ESCANDÓN; Gabriel GONZÁLEZ DE LA TORRE BENÍTEZ

    2011-01-01

    La Educación Emocional, independientemente de la etapa educativa, tiene una importante misión en la meta de todo proyecto educativo, el proceso de socialización de las generaciones más jóvenes. Sin embargo, es importante que los programas aplicados también sean evaluados con una medida válida y fiable de la progresión del desarrollo cognitivo¿emocional de los niños. En una muestra de 138 alumnos de la etapa infantil (3¿6 años) este trabajo pone a prueba un instrumento para la evaluación de la...

  7. Rolling revisado: utilización del rolling para valorar y tratar la coordinación y control neuromuscular del core y extremidades en atletas

    Directory of Open Access Journals (Sweden)

    Barbara J. Hoogenboom

    2017-05-01

    Full Text Available Rolling es un patrón de movimiento raramente utilizado por los fisioterapeutas para la evaluación e intervención de pacientes con función neurológica normal. El Rolling, como destreza motriz adulta, combina el uso de las extremidades superiores, core y extremidades inferiores con el movimiento coordinado en el paso de una postura a otra. El Rolling se lleva a cabo partiendo de la posición prona a posición supina y viceversa, aunque el método utilizado varía entre adultos. Desde la perspectiva de la habilidad de completar tareas o la simetría bilateral, el Rolling puede ser beneficioso para el uso de atletas que realizan deportes de rotación parcial tales como el golf, el lanzamiento, el tenis, y los deportes con torsión como la danza, la gimnasia, y el patinaje artístico. Además, cuando es usado como técnica de intervención, los patrones del Rolling tienen la capacidad de influir en disfunciones de la parte superior del cuerpo, core y parte inferior. Aplicando los principios de la facilitación neuromuscular propioceptiva (FNP, el terapeuta puede asistir a pacientes y clientes que son incapaces de completar un patrón de Rolling. Algunos ejemplos citados en el artículo incluyen separación/elongación, compresión, y contacto manual para facilitar el propio Rolling. Los autores defienden que el uso terapéutico de los patrones de desarrollo del Rolling con las técnicas derivadas de FNP es un distintivo en la rehabilitación de pacientes con disfunciones neurológicas que pueden ser también utilizados en la rehabilitación músculo-esquelética de forma creativa y efectiva. Se han obtenido los resultados preliminares de una exploración del mecanismo por el que el Rolling puede influir en la estabilidad y existen evidencias recientes disponibles. El propósito de este comentario clínico es describir las técnicas de análisis, evaluación y tratamiento de disfunción, usando casos ejemplos que incorporan el Rolling.

  8. Erythrocytes labelling for to value bleeding of digestive tract in pediatrics; Marcacion de eritrocitos para valorar sangrado de tubo digestivo en pediatria

    Energy Technology Data Exchange (ETDEWEB)

    Mora, R. [Instituto Nacional de Pediatria, Av. Insurgentes Sur 700 C, Col. Insurgentes Cuicuilco, Mexico D.F. (Mexico)

    2002-07-01

    The erythrocytes labelling has been facilitated by several factors: a) They are the cellular elements more abundant in the blood (5 x 10{sup 9} / ml blood). b) They are easy to be isolated and manipulated In vitro and they are not very sensitive to the physical or chemical damages. c) They do not depend on energy or nutritious requirements as another cellular elements In vitro. d) With respect to another cells they show an easier labelling with radionuclides due to the availability of a variety of transporter mechanisms and of internal hemoglobin which is rich in active metal with multiple union sites. The erythrocytes are biconcave disks without nucleus composed by a 65% water, 32% hemoglobin and a 3% by lipids and proteins which form the stroma.The hemoglobin is the most important component of erythrocytes, it contains 4 heme groups and one globin molecule (with molecular weight of 68000) and fix iron covalently with 4 atoms of nitrogenated porfyrin. The oxygen is reversibly joined to iron. The hemoglobin does not experiment re-synthesis or degradation during its lifetime in the erythrocyte. It has been stipulated that the diagnostic applications in nuclear medicine are: a) That the radionuclide should have a high intensity of emission with an adequate energy for the image, with minimum particulate radiation and a half life time average similar to the length of the study that is carried out. b) That the radionuclide is joined firmly to the In vivo cells without altering physical and biochemical properties of the cells and their function In vitro. c) That the radionuclide once incorporated to the interior of cell must not be liberated during the study neither reused after of destruction. A quick procedure is now found available for labelling erythrocytes with {sup 99m} Tc offering a high performance and quality labelling. This is narrowly related to the {sup 99m} Tc chemistry understanding. (Author)

  9. Rolling revisado: utilización del rolling para valorar y tratar la coordinación y control neuromuscular del core y extremidades en atletas

    OpenAIRE

    Barbara J. Hoogenboom; Michael L. Voight

    2017-01-01

    Rolling es un patrón de movimiento raramente utilizado por los fisioterapeutas para la evaluación e intervención de pacientes con función neurológica normal. El Rolling, como destreza motriz adulta, combina el uso de las extremidades superiores, core y extremidades inferiores con el movimiento coordinado en el paso de una postura a otra. El Rolling se lleva a cabo partiendo de la posición prona a posición supina y viceversa, aunque el método utilizado varía entre adultos. Desde la perspectiva...

  10. Application of thermography to assess the adequacy training in elite athletes; Aplicacion de la termografia para valorar la adecuacion del entrenamiento en deportistas de elite

    Energy Technology Data Exchange (ETDEWEB)

    Jover, A.; Salvador, R.; Cibrian, R.; Gonzalez-Pena, R.; Minguez, M. F.; Pino, L.; Lopez de la O, F. J.; Guillen, J.; Reinado, D.; Cortina, T.; Chinillach, N.; Dalmases, F.; Romero, C.; Martinez-Celorio, R.; Diez, S.; Rosello, J.; Reinado, D.; Cortina, T.; Chinillach, N.; Dalmases, F.; Romero, C.; Martinez-Celorio, R.; Diez, S.; Rosello, J.

    2011-07-01

    Thermography is a technique that allows to know the body surface temperature by infrared radiation, making it a completely non-invasive technique, without physical contact. The differences in body temperature in different parts of the body naturally shown in the thermo gram and given that sport can alter the temperature distribution is imaging technique can help to analyze the effect of training on muscle and determine if it has been appropriate and correct.

  11. Propuesta de una ecuación lineal para valorar la velocidad de crecimiento somático a partir de la masa corporal de ratas machos Wistar

    Directory of Open Access Journals (Sweden)

    Marco Antonio Cossio-Bolanos

    2012-04-01

    Full Text Available Introducción: Para conocer el grado de maduración biológica de los roedores es necesaria la aplicación de métodos invasivos y no-invasivos, para lo cual los estudios que engloban diversas cepas de ratas necesitan de procedimientos simples de manera de controlar los efectos de confusión que la maduración biológica pudiera ocasionar. Objetivos: Determinar la velocidad de crecimiento (VC de ratas machos Wistar a partir de la masa corporal y proponer ecuaciones de regresión lineal para predecir el pico de velocidad de crecimiento (PVC. Diseño: Estudio longitudinal de cohorte. Institución: Universidad Estadual de Campinas, São Paulo, Brasil, Departamento de Farmacología. Métodos: De un total de 101 ratas, se seleccionó de forma probabilística-aleatoria (tablas aleatorias 25 ratas machos Wistar de 3 semanas de vida (21 días de edad. Se evaluó la masa corporal (g cada semana, hasta las 16 semanas de vida. Para el análisis estadístico se utilizó la estadística descriptiva de la media aritmética (X y desviación estándar (DE. Para determinar las diferencias significativas entre las edades se usó ANOVA para medidas repetitivas (p<0,001 y para correlacionar las variables de edad, peso y PVC se utilizó (r de Pearson (p<0,001. La predicción del PVC se efectuó a través del análisis de regresión lineal simple y múltiple StepWise (p<0,001. Principales medidas de resultados: Velocidad de crecimiento; propuesta de ecuaciones de regresión lineal para predecir el pico de velocidad de crecimiento. Resultados: Los resultados muestran que la velocidad de crecimiento evaluada a través de la masa corporal se presentó alrededor de los 42 días de vida. Con dichos resultados se generó tres ecuaciones de regresión lineal simple y múltiple, donde el coeficiente de determinación (R² para el modelo 1 fue 0,99, para el modelo 2, 0,89 y para el modelo 3, 0,99, respectivamente. Estas ecuaciones permiten predecir la proximidad y el alejamiento del PVC de ratas machos Wistar y los resultados pueden ser interpretados a través de 14 niveles. Conclusiones: El PVC se produjo a los 42 días de vida y las ecuaciones de regresión lineal generadas a partir del peso corporal y la edad permitieron predecir el grado de maduración somática de ratas machos Wistar.

  12. Asimetría y curtosis en el modelo binomial para valorar opciones reales: caso de aplicación para empresas de base tecnológica

    Directory of Open Access Journals (Sweden)

    Gastón Silverio Milanesi

    2013-07-01

    Full Text Available El trabajo propone un modelo de valoración de opciones reales con base en el modelo binomial utilizando la transformación de Edgeworth (Rubinstein, 1998 para incorporar momentos estocásticos de orden supe- rior, especialmente para ciertos tipos de organizaciones, como empresas de base tecnológica, donde no se dispone de cartera de activos financieros gemelos, comparables de mercado y procesos estocásticos no gaussianos. Primero, se presenta el desarrollo formal del modelo, luego su aplicación sobre la valuación de spin-off tecnológico universitario, sensibilizando asimetría-curtosis y exponiendo el impacto en el valor del proyecto. Finalmente, se concluye sobre limitaciones y ventajas de la propuesta de valoración que resume la simplicidad del modelo binomial e incorporando momentos de orden superior en subyacentes con pro- cesos no normales.

  13. Asimetría y curtosis en el modelo binomial para valorar opciones reales: caso de aplicación para empresas de base tecnológica

    Directory of Open Access Journals (Sweden)

    Gastón Silverio Milanesi

    2013-01-01

    Full Text Available El trabajo propone un modelo de valoración de opciones reales con base en el modelo binomial utilizando la transformación de Edgeworth (Rubinstein, 1998 para incorporar momentos estocásticos de orden superior, especialmente para ciertos tipos de organizaciones, como empresas de base tecnológica, donde no se dispone de cartera de activos financieros gemelos, comparables de mercado y procesos estocásticos no gaussianos. Primero, se presenta el desarrollo formal del modelo, luego su aplicación sobre la valuación de spin-off tecnológico universitario, sensibilizando asimetría-curtosis y exponiendo el impacto en el valor del proyecto. Finalmente, se concluye sobre limitaciones y ventajas de la propuesta de valoración que resume la simplicidad del modelo binomial e incorporando momentos de orden superior en subyacentes con procesos no normales.

  14. Programar una radio social en la universidad: el Propósito Penélope de UniRadio

    Directory of Open Access Journals (Sweden)

    Paloma Contreras Pulido

    2014-01-01

    Full Text Available Las radios universitarias españolas han logrado un sitio con nombre propio en el panorama comunicativo actual del país. Esto ha sido debido al incremento de número de emisoras que se han creado en casi una treintena de universidades en España, así como al trabajo coordinado y colaborativo entre ellas. Pero además, estas radios se están convirtiendo en plataformas de expresión para numerosos colectivos, asociaciones y ONGs que encuentran en ellas no sólo un lugar para informar o dar a conocer acciones puntuales, sino la posibilidad de transformar su propia realidad. Por tanto, podemos hablar de emisoras universitarias que se enmarcan dentro del modelo de Comunicación para el cambio social, que, más que buscar productos de mucha envergadura y el impacto masivo en las audiencias, trataría de mejorar la vida de las personas y su contexto a través de su participación activa de las mismas en el medio. Este es el modelo elegido por UniRadio, la radio de la Universidad de Huelva, donde a través del proyecto denominado “Propósito Penélope” pretende desarrollar una programación que sea la red donde se teja un entramado colaborativo local que parte del seno mismo de la radio de una institución como la universidad.

  15. CHARACTERIZATION OF THE RISCK AREAS IN PETRÓPOLIS - A CASE STUDY OF THE LOPES TROVÃO COMMUNITY

    Directory of Open Access Journals (Sweden)

    Stella Peres Mendes

    2005-05-01

    Full Text Available Nature models the environment, provoking several physical processes as massmovements, erosion and sedimentation. Human action tends to intensify and accelerateenvironmental impacts, that become harmful to society, causing accidents that, depending onthe intensity, can cause tragedies.Mass movements are one of the processes that can cause more damages to the physicalenvironment and to society. According to Hamblin and Christiansen (1998, mass movementsinclude all types of collapses on the slopes. There are several types of mass movements, butlandslides are the most important ones, because it possess several condition factors and areevents that cause more problems to society.The increase of the urbanization Rio de Janeiro State causes the occupation of theslopes in an irregular and disordered way, resulting settlement, considerable environmentalimpacts on the controlling factors of the natural processes, causing other impacts, such asmass movements, that degrade not only the landscape, as well as people's life (Oliveira,2000.Some authors call the attention to the fact that the environmental degradation is, bydefinition, a social problem (Blaike and Brookfield, 1987. Some environmental processes, asleaching, erosion, mass movements and floods can happen with or without the humanintervention. In this way, characterizing physical processes, as environmental degradation, isto take into consideration social approaches that relate land use, or at least, with the potentialof several use types (Cunha and Guerra, 2003.

  16. Experimentación dramatúrgica en Rojas Zorrilla: alternancia y simultaneidad espacial en Los trabajos de Tobías

    Directory of Open Access Journals (Sweden)

    Rubiera Fernández, Javier

    2007-06-01

    Full Text Available This article aims to analyse the technique used by Rojas Zorilla in a religious comedy of biblical derivation to represent, in a parallel way, dramatic actions that are simultaneously developed in very separate dramatic spaces. Although basing his approach on ancient stage procedures, by combining these with modern techniques the result is of such originality that we consider it to be «experimentation». In order to properly value his creative method, a close comparison is made between the biblical narrative, a sixteenth century auto, and a comedy by Lope de Vega that address the same subject.El objetivo de este artículo es analizar la técnica empleada por Rojas Zorrilla, en una comedia religiosa de fuente bíblica, para representar de modo paralelo acciones dramáticas que se desarrollan simultáneamente en espacios dramáticos muy alejados. A pesar de basarse en procedimientos escénicos antiguos, al combinarlo con técnicas modernas el resultado es de tal originalidad que lo calificamos de «experimentación». Para valorar debidamente su modo de componer, se hace una estrecha comparación con el relato bíblico, con un auto del siglo XVI y con una comedia de Lope de Vega que tratan el mismo tema.

  17. Análisis de los Indicadores de Emisiones de Gases de Efecto Invernadero para Valorar Proyectos de Energía Renovable en Sistemas Eléctricos, Caso de Colombia

    Directory of Open Access Journals (Sweden)

    Marco Alejandro Berrío-Monsalve

    2014-12-01

    Full Text Available La contribución técnica presenta una discusión acerca los indicadores definidos por la UNFCCC y apropiados para aplicar en proyectos de generación eléctrica en Latinoamérica. Se hace énfasis en el posible uso de indicadores para incentivar el uso de tecnologías de generación renovables y mitigar la emisión de gases con efecto invernadero a la atmósfera, en proyectos que se encuentren en fase operativa. Adicionalmente, se presenta un nuevo indicador (El del Costo Social del Carbono- SCC- diferente a los definidos por la UNFCCC. Finalmente se centra la discusión en la aplicación de los indicadores en el caso Colombiano y como la correcta valoración de las emisiones de CO2, permite una mayor penetración a las tecnologías de generación renovables como la eólica.

  18. Una propuesta práctica para entender, valorar y discernir los enfoques de la enseñanza (A Practical Proposal for Understanding, Evaluating and Discerning the Approaches to Teaching

    Directory of Open Access Journals (Sweden)

    Alicia Ros-Garrido

    2015-03-01

    Full Text Available Resumen: La finalidad del artículo es proporcionar una propuesta metodológica para facilitar la comprensión, la valoración y poder discernir los enfoques de la enseñanza propuestos por Fenstermacher y Soltis (1998. En primer lugar se hace referencia a diversas maneras de concebir y clasificar las teorías de enseñanza. En segundo lugar se resaltan los aspectos clave de los enfoques de la enseñanza: los elementos que intervienen en cualquier proceso de enseñanza; la “manera” de entender la enseñanza; el concepto de persona educada; la compatibilidad o incompatibilidad entre los enfoques; y se ofrece una síntesis de los aspectos más destacados de cada enfoque. En tercer lugar se realiza la propuesta metodológica a desarrollar con el alumnado. Por último, la conclusión es que la finalidad del proceso de enseñanza-aprendizaje define el enfoque de enseñanza asumido y/o puesto en práctica por el profesorado. Abstract: The purpose of the article is to provide a methodology to facilitate the understanding, evaluation and to discern the teaching approaches proposed by Fenstermacher and Soltis (1998. First, several ways of conceiving and classifying the theories of teaching are mentioned. Secondly the key aspects of teaching approaches are highlighted: the elements involved in any process of education; the way teaching is understood; the concept of educated person; compatibility or incompatibility between approaches; and a summary of the most important aspects of each approach is provided. Thirdly a methodological proposal to be developed with students is outlined. Finally, it is concluded that the purpose of the teaching-learning process defines the approach to teaching adopted and/or implemented by teachers.

  19. Criterios que deben valorar los tribunales cubanos para evaluar la veracidad del testimonio emitido por el menor entre tres y seis años de edad, víctima de abuso sexual

    OpenAIRE

    Yoruanys Suñez Tejera; Wendy Vera Denis

    2014-01-01

    En la actualidad, una de las cuestiones más debatidas en relación con el testimonio es la tarea que han de realizar el investigador, el fiscal y los jueces al momento de valorarlo, sobre todo los últimos, en tanto son los responsables de dictar un fallo, acto que resulta trascendental por las consecuencias legales que implica. Lo expresado se aprecia sobre todo cuando se trata de determinar si los descargos de los menores entre tres y seis años de edad, víctimas de abuso sexual, coinciden con...

  20. El Museo de la Educación de la Universidad de La Laguna: Recordar el pasado para valorar el presente. // Education Museum of the University of La Laguna Remembering the past to value the present.

    Directory of Open Access Journals (Sweden)

    Ana Vega Navarro

    2013-12-01

    Full Text Available (ES La creación del Museo de la Educación de La Universidad de La Laguna (MEDULL es la respuesta a la inquietud por recuperar, conservar y dar a conocer el patrimonio histórico educativo de Canarias. El MEDULL cuenta desde sus inicios con el apoyo del Vicerrectorado de Relaciones Universidad y Sociedad, que lo incorpora dentro de su organigrama como Aula Cultural, así como de la Dirección General de Patrimonio Histórico del Gobierno de Canarias. Su exposición permanente está ubicada en la Facultad de Educación. La exposición se organiza en torno a dos aulas (una de los años 40-50 y otra de los años 70 y permite a los visitantes conocer no sólo los materiales de enseñanza utilizados en esas décadas, sino también diferentes aspectos de la vida del alumnado y de los docentes. Las actividades del Museo forman parte de la formación del alumnado de la Facultad de Educación, y son el objeto de proyectos de trabajo del alumnado de Educación Primaria. y Secundaria que nos visita. // (EN The foundation of the Education Museum of La Laguna University (MEDULL is a response to the desire to recover, preserve and show the general public the educational heritage of the Canary Islands. The MEDULL has been supported from its beginnings by the Vice-Rector’s Office for University-Society relations, which has included the museum in its organizational chart as Cultural Classroom. The MEDULL is also supported by the General Directorate of Historical Heritage of the Canary Government. The permanent exhibition of the museum is in the Faculty of Education. The exhibition is organized around two classrooms (one from the 1940s and 1950s and the other from the 1970s and allows visitors not only to know the teaching materials used in those times, but also different aspects of the life of students and teachers. The activities of the museum are part of the training of the Faculty of Education students, and are the subject of work projects of the primary and secondary school students who visit us.

  1. Premisas para la elaboración de una herramienta para valorar la calidad de vida en las personas mayores Prerequisites for the development of a tool to assess the quality of life in the elderly

    Directory of Open Access Journals (Sweden)

    José Antonio Iglesias Guerra

    2010-06-01

    Full Text Available El interés por la calidad de vida ha existido desde tiempos inmemorables. Sin embargo, la aparición del concepto y la preocupación por su evaluación sistemática y científica es relativamente reciente. La idea, que comienza a popularizarse en la década de los años 60 del siglo XX, se ha convertido hoy en un concepto utilizado en ámbitos muy diversos, como la salud, la educación, la economía, la política y el mundo de los servicios en general. Pero aún existe una falta de consenso sobre la definición del constructo. La calidad de vida tiene una dimensión objetiva y otra subjetiva. Ésta última está estrechamente vinculada a la satisfacción con la vida experimentada por las personas mayores tanto desde un punto de vista sincrónico como diacrónico, y tiene carácter multidimensional, complejidad y coyunturalidad. Las principales dificultades para la construcción de instrumentos que valoren la calidad de vida de las personas mayores se presentan desde las vías conceptual, metodológica e instrumental. No obstante, el término calidad de vida debe empapar las intervenciones sobre estos grupos de edad, por lo que ofrecemos algunas recomendaciones para su elaboración.Interest in quality of life has existed since time immemorial, however, the emergence of the concept as such, and concern for the systematic and scientific evaluation of it is relatively recent. The idea, which begins to become popular in the 60s, has now become a concept used in very diverse areas such as health, education, economics, politics and the world of services in general. But in the twenty-first century, there remains a lack of consensus on the definition of the concept. The quality of life has an objective and a subjective dimension. The latter is closely linked to life satisfaction experienced by the elderly both from a synchronic point of view as diachronic, and is considered multidimensional, complex and situational. The main difficulties for the construction of instruments to assess quality of life of older people from the street presents conceptual, methodological and instrumental. However, the term quality of life interventions should soak these age groups, so we offer some recommendations for its development.

  2. Criterios que deben valorar los tribunales cubanos para evaluar la veracidad del testimonio emitido por el menor entre tres y seis años de edad, víctima de abuso sexual

    Directory of Open Access Journals (Sweden)

    Yoruanys Suñez Tejera

    2014-04-01

    Full Text Available En la actualidad, una de las cuestiones más debatidas en relación con el testimonio es la tarea que han de realizar el investigador, el fiscal y los jueces al momento de valorarlo, sobre todo los últimos, en tanto son los responsables de dictar un fallo, acto que resulta trascendental por las consecuencias legales que implica. Lo expresado se aprecia sobre todo cuando se trata de determinar si los descargos de los menores entre tres y seis años de edad, víctimas de abuso sexual, coinciden con la verdad material, por lo que es propósito de la presente investigación determinar los criterios que faciliten realizar dicha labor. El trabajo caracteriza psicológica y socialmente al menor víctima de abuso sexual, por lo que los métodos utilizados son el de análisis y síntesis, y el de deducción-inducción. Las técnicas empleadas son la revisión bibliográfica y el análisis de documentos. Como resultados, se determinan los criterios psicosociales que se deben considerar para evaluar la veracidad del testimonio emitido por el menor entre tres y seis años de edad, víctima de abuso sexual.

  3. Nueva metodología para valorar la calidad de las aguas superficiales para su uso como clase 2 en Costa Rica New methodology for evaluating the surface waters quality to be used as Class 2 in Costa Rica

    Directory of Open Access Journals (Sweden)

    Guillermo Calvo-Brenes

    2013-06-01

    Full Text Available Para determinar la calidad de las aguas superficiales se utilizan distintos indicadores físicoquímicos, microbiológicos y biológicos, así como índices de calidad. El reglamento costarricense contempla el uso de dos índices: uno se basa en la determinación de la fauna bentónica y el otro es el Indice Holandés.  Este último requiere únicamente el análisis de tres indicadores físicoquímicos de calidad, lo cual puede generar algún grado de ambigüedad y falta de robustez. Es por ello que es conveniente no descartar el uso de otros índices recomendados en la literatura. La mayoría de ellos requiere la transformación de los indicadores en valores adimensionados (SI en una escala de 0 a 100. En esta investigación, para el cálculo del SI se utilizaron las fórmulas mencionadas por Cude, Nasirian, Dinius, Prakash, Prati, Walski-Parker y Stoner. Los distintos SI así generados deben mostrar un comportamiento que varíe en una escala de 0 a 100, lo cual a su vez también debe concordar con los valores de permisibilidad reportados en nuestro reglamento para cada indicador. En general, a mayor concentración de un indicador en particular, mayor la tendencia del SI hacia 0, lo que representa un mayor grado de contaminación de los ríos.  El objetivo de esta investigación fue verificar la aplicabilidad de dichas fórmulas matemáticas para la obtención del SI y su posible aplicación en Costa Rica, considerando nuestro entorno ambiental y nuestra reglamentación. La aplicación se hizo específicamente para la clase 2 mencionada en el reglamento costarricense. Al analizar las distintas fórmulas de cálculo propuestas por varios investigadores, se encontró que la mayoría son apropiadas para las zonas a las que hacen referencia sus autores y en general son diferentes de nuestro entorno ambiental. También, algunas de ellas son para usos específicos de las aguas superficiales y además los valores de permisibilidad empleados difieren de los indicados por nuestra legislación, lo cual hace inviable su uso en nuestro país. Fue necesario, por tanto, proponer nuevas fórmulas de cálculo para la determinación del SI que sean aplicables a Costa Rica y acordes con su legislación. Fue necesario también proponer una nueva categorización de la calidad del agua clase 2 que, además, se puede utilizar con cualquier índice que se desee evaluar.The surface water quality determination is based through the analysis of a fair amount of physic chemicals, microbiological and biological water quality variables, as well as water quality indexes. The Costa Rican regulation considers the use of two indexes: one based on benthic invertebrate analysis and the other on the Water Quality Holland Classification Index. The last one requires only three physic chemical variables that could generate some ambiguity and lack of strength in that index. It is therefore recommended not to discard the use of other indexes mentioned in the literature. Most of them require transforming the unit’s variable as dimensionless (SI in a 0-100 scale. For the SI calculation, the Cude, Nasiriam, Dinius, Prakash, Prati, Walski-Parker and Stoner formulas were used. The SI should show a 0-100 scale variation. As a rule, the more concentration of a variable, the more tendency to 0 of the SI, which it is expected to have a close relationship with Costa Rican regulations.  The objective of this research was to verify the aplicability of calculation formulas in order to obtain the SI and its posible aplication in our country, considering our own environment and regulations. All the analysis were focused on Class 2 mentioned in our national regulation. After the analysis of different formulas proposed by researchers, it was found that most of them were appropiate for their own environment but not for ours. Some are appropiate for different types of waters and their regulations are different for our country. It was necessary to propose new ways of calculating the SI for our country and to propose a new way of categorizing the quality of the Class 2 that is also useful for the aplication of several indexes.

  4. A Role for Experiment in Using the Law of Inertia to Explain the Nature of Science: A Comment on Lopes Celho

    Science.gov (United States)

    Kalman, Calvin

    2009-01-01

    The whole mode of Galileo's discovery of the Law of Inertia is an excellent exemplar of the Nature of Science. The law can, moreover be shown to be a direct consequence of the hypothesis that space is homogeneous and isotropic and time is homogeneous.

  5. Edible Encounters and the Formation of Self in Baltasar Lopes' Chiquinho and Paulina Chiziane's Niketche: uma história de poligamia

    Directory of Open Access Journals (Sweden)

    Isabel P.B. Fêo Rodrigues

    2016-04-01

    Full Text Available Food tropes remain potent literary devices to both dissimulate political critique and revitalize individual agency. In what follows, we propose a comparative analysis of Baltasar Lopes’ Chiquinho and Paulina Chiziane’s Niketche: uma história de poligamia that examines their respective literary use of food. Through food tropes both authors navigate their respective worlds of change where scarcity and abundance coexist as constant reminders that sustenance is not merely a part of their modern realities, but fully embedded into their search for self-fulfillment and self-realization. Through this scope, it is argued that food tropes allow the authors to unmask the fractures within colonial and post-colonial modalities of oppression. Lastly, we ultimately suggest that food tropes provide a space in which characters embark on a return journey to “wholeness” and self-liberation.This article is published under a CC-BY license https://creativecommons.org/licenses/by/3.0/

  6. Estudio de la evolución de subpoblaciones linfocíticas en sangre periférica y órganos linfoides de cabra (Capra hircus) / Mª Esperanza Navarro Escayola ; directoras Mª Rosa Caro Vergara, Mª del Carmen Gallego Ruiz ; ponente Vicente Vicente Ortega.

    OpenAIRE

    Navarro Escayola, María Esperanza; Caro Vergara, María Rosa; Gallego Ruiz, María del Carmen

    1997-01-01

    Tesis-Universidad de Murcia. MEDICINA ESPINARDO. DEPOSITO. MU-Tesis 500. Consulte la tesis en: BCA. GENERAL. Fac. Veterinaria. Departamentos. E002B T.70. Consulte la tesis en: BCA. GENERAL. ARCHIVO UNIVERSITARIO. T.M.-1480.

  7. Il compasso geometrico e militare di Galileo Galilei testi, annotazioni e disputa negli scritti di G. Galilei, M. Bernegger e B. Capra

    CERN Document Server

    1992-01-01

    Il compasso geometrico e militare / di Roberto Vergara Caffarelli - Le operazioni del compasso geometrico e militare / Galileo Galilei - Annotazioni / Mattia Bernaggeri - Usus et fabrica circini cuiusdam proportionis / Baldassarre Capra - Difesa contro alle calunnie ed imposture di Baldassar Capra.

  8. A new species of Petersitocoroides Brailovsky (Hemiptera: Heteroptera: Coreidae: Coreini) from Peru.

    Science.gov (United States)

    Cruces, Luis; Brailovsky, Harry

    2014-08-11

    Petersitocoroides vergarae, a new species from Peru, is described and placed in the tribe Coreini (Heteroptera). Dorsal illustrations and drawings of the pronotum, head and male genitalia, as well as a key to the known species, are provided. 

  9. Signature of a Collaboration agreement between Unitar & CERN.

    CERN Multimedia

    Pierre Gildemyn

    2012-01-01

    Signature of agreement with Mr Carlos Lopes (UNITAR) and Prof Rolf Heuer (CERN). From left to right : Einar Bjorgo, Francesco Pisano, Calors Lopes, Rolf Heuer, Maurizio Bona, Frédéric Hemmer, Olivier Van Damme

  10. No me preguntes cómo pasa el tiempo

    Directory of Open Access Journals (Sweden)

    José Uribe Castro

    1989-04-01

    Full Text Available Kalendario manual y guia de forasteros en Santafé de Bogotá [,] capital del Nuevo Reyno de Granada. para el año de 1806. Antonio Joseph García de la Guardia, Banco de la República, Bogotá , 1988. Almanaque de Bogotá y guía de forasteros. José María Vergara y Vergara. Carvajal S.A., Cali, 1988.

  11. Progress in air shower radio measurements : detection of distant events

    NARCIS (Netherlands)

    Bähren, L.; Buitink, S.J.; Falcke, H.D.E.; Horneffer, K.H.A.; Kuijpers, J.M.E.; Lafebre, S.J.; Nigl, A.; Petrovic, J.; Singh, K.

    2006-01-01

    Data taken during half a year of operation of 10 LOPES antennas (LOPES-10), triggered by EAS observed with KASCADE-Grande have been analysed. We report about the analysis of correlations of radio signals measured by LOPES-10 with extensive air shower events reconstructed by KASCADE-Grande, including

  12. Enfermedad y muerte de Don Gonzalo Jiménez de Quesada

    Directory of Open Access Journals (Sweden)

    Fernando Serpa Florez

    1997-12-01

    Full Text Available

    La lepra es una enfermedad que se caracteriza por la insidia de su presencia, su lenta evolución y la progresiva incapacidad que en sus víctimas causa.

    Esto y el temor que ha infundido desde tiempos bíblicos, han hecho que ante ella se haya mantenido una actitud ambivalente de negación hasta donde es posible y de rechazo irracional a quien la padece, por temor al contagio.

    Ejemplo de ello es el aura de sagrado misterio que envuelve la leyenda de los padecimientos del Adelantado don Gonzalo Jiménez de Quesada (1509-1579, conquistador del Nuevo Reino de Granada y fundador de Santafé de Bogotá en el año de 1538, muerto a la edad, avanzada para la época, de setenta años.

    No se puede afirmar, en forma definitiva, que el conquistador fuera leproso. Se acepta, acogiendo el argumento de autoridad que tiene el primer historiador médico entre nosotros, don Pedro María Ibáñez, quien escribió en 1884, en las Memorias para la Historia de la Medicina en Santa Fe, que en “1579 falleció en la ciudad de Mariquita, y de mal de lepra o elefancía de los

    Coincide ello con lo que consigna don José María Vergara y Vergara en su Cuadro Cronológico de la Nueva Granada (hoi Estados Unidos de Colombia, desde los cipas hasta nuestros días (se ha conservado la ortografía usada a mediados del siglo XIX, preconizada por don Andrés Bello, estudio publicado en 1866, en que informa que a poco de posesionarse el tercer Presidente del Nuevo Reino, don Lope Díez Aux de Armendáriz: “ocurrió la muerte del adelantado Gonzalo Jiménez de Quesada que tuvo lugar en Mariquita el 16 de febrero de 1579, a la edad de ochenta años no cumplidos (sic, i de enfermedad de lepra (…” (2.

    Estos conceptos fueron debatidos por contemporáneos de Vergara y de Ibáñez como el doctor Juan de Dios Carrasquilla aduciendo, entre otros argumentos, que la lepra no fue mencionada por los coetáneos del conquistador. Y que la sífilis, com

  13. Estudio comparado de El animal de Hungría de Lope de Vega y The winter’s tale de Shakespeare : sus raíces y su contextualización genérica /

    OpenAIRE

    Follett Michell, Christopher John

    2013-01-01

     tesis que para obtener el grado de Doctorado en Letras, presenta Christopher John Follett Michell ; tutores principales de tesis Jorge Alcázar Bravo, Margit Frenk Freund, Tatiana Bubnova. 277 páginas. Doctorado en Letras Universidad Nacional Autónoma de México, 2013 Programa de Posgrado en Letras

  14. Novas (reconfigurações no Ministério da Educação: entre o fio de Ariadne e a mortalha de Penélope

    Directory of Open Access Journals (Sweden)

    Giovani Ferreira Bezerra

    2014-01-01

    Full Text Available La publicación del decreto n. 7.690, el 2 de marzo 2012, induce al fortalecimiento del debate acerca de las políticas públicas en el escenario educativo brasileño, principalmente en la inclusión escolar de personas discapacitadas, señalando una nueva disposición en el Ministerio de Educación (MEC. En el actual contexto, se extingue la Secretaría de Educación Especial ( S EESP , y sus funciones se trasladan a la mosaica Secretaría de Educación Continuada, Alfabetización, Diversidad e Inclusión ( S ECADI . Comprender el impacto de tal reestructuración ministerial en la continuidad del proyecto inclusivo en nuestro país es el propósito de este trabajo, que, para ello, recupera notas históricas y metáforas griegas, con intento de desentrañar, planteando posiciones valorativas sobre el tema, contradicciones entrelazadas en el proceso de (reconfiguración política del MEC

  15. El paisaje como recurso turístico de la ciudad. Una propuesta metodológica para valorar el papel de la planificación del territorio en el caso de Las Palmas de Gran Canaria / The landscape as a city tourism resource. A methodological for assessing...

    Directory of Open Access Journals (Sweden)

    Santiago Hernández Torres

    2014-12-01

    Full Text Available Se propone una metodología para la valoración de las relaciones entre la ciudad, el turismo y la planificación del territorio desde la perspectiva del paisaje y el medio ambiente. Para ello, analizamos como las estrategias de mejora de la competitividad turística de las ciudades tienen su traslación en la planificación urbanística de los ayuntamientos y la relación o integración de los elementos que configuran ambientalmente el espacio urbano. Con este objeto genérico, se selecciona el ejemplo de Las Palmas de Gran Canaria como laboratorio de experiencias de ordenación del espacio, mediante las cuales puede observarse los indicadores y dificultades en el tratamiento de la calidad ambiental. Nos interesa distinguir cómo estos elementos ambientales se planifican como recursos turísticos y la relevancia que tienen en las estrategias públicas de la ordenación del territorio.A methodology is proposed to asses the relations among the city, tourism, and spatial planning from landscape and environmental perspective. To do this, we analyse how strategies to improve touristic competitiveness in the cities can be applied to spatial planning. To this end, the example of Las Palmas de Gran Canaria is selected, as a laboratory of spatial planning experiences, by which the indicators and difficulties in the environmental quality can be observed. We are interested in distinguishing how this environmental elements are planned as tourism resources and their level of importance in spatial planning.

  16. Cuadro de mando integral para el diseño y validación de instrumentos para valorar el desempeño académico de docentes The balance score card for the construction and validation of instruments to measure professors'academic performance

    Directory of Open Access Journals (Sweden)

    Alexis Tejedor de León

    2010-01-01

    Full Text Available La valoración de la labor docente es un pilar de la acreditación universitaria. En un momento, particularmente sensible relacionado a esta tendencia global y a la imagen que emerge de las diferentes unidades académicas y adminsitrativas, se torna importante, no solamente, recolocar el asunto de conocer si éstas ponen en práctica aquello que realmente enseñan, sino también conocer el grado de satisfacción de los" stakeholders" sobre los procesos de enseñanza-aprendizaje a nivel universitario. En este contexto, esta investigación tiene como objetivo diseñar y validar instrumentos dirigidos a explorar el entorno de la labor académica del docente universitario del Centro Regional de Veraguas de la Universidad Tecnológica de Panamá, considerando como ejes dimensionales la planificación, el desarrollo y las actividades psicopedagógicas propias de la labor académica. Para la realización de la investigación se utilizó la metodología del Cuadro de Mando Integral en las etapas de planificación estratégica del programa de evaluación académico y se utilizó la técnica Delphi para la validación de contenido y de constructo de los instrumentos. En la validación de la confiabilidad se determinó el valor Alpha de Cronbach utilizándose el programa para la PC de SPSS® para la toma de decisones.The evaluation of faculty work is a pillar in university accreditation. Moreover, particularly in a period sensitive to this tendency of faculty work evaluation and the image that emerges from the different academic and administrative units, it is important not only to restate the subject of whether what is taught is also put into practice, but also to know the degree of satisfaction expressed by the stakeholders in the teaching and learning process at the higher education level. In this context, the research aim is to develop and validate the instruments directed to explore the internal academic environment of the faculty at the Veraguas Regional Center Technological University of Panama; considering as dimensional axes the organization, development, and the psycho-pedagogic properties of academic work. For the research execution, the Balance Score Card methodology was used in the stages of strategic planning and program evaluation; the Delphi technique was used to validate the content and for the construction of the instruments. The validation of the reliability value was established through Cronbach's alpha value by using the SPSS® for decision making.

  17. Design and validation of a questionnaire to examine the quality of public sport service employees of Association of Municipalities in Extremadura DISEÑO Y VALIDACIÓN DE UN CUESTIONARIO PARA VALORAR LA LÓGICA DOMINANTE SOBRE LA CALIDAD DE SERVICIOS DEPORTIVOS EN EMPLEADOS DE MANCOMUNIDADES DE MUNICIPIOS EXTREMEÑAS

    Directory of Open Access Journals (Sweden)

    Alberto Blázquez Manzano

    2011-11-01

    Full Text Available Abstract This article describes the design and validation of a specific questionnaire to know the views of managers and sports facilitators on the elements and purposes should focus quality activities of associations of municipalities in Extremadura in the area of ​ ​dynamic sports and the degree of usefulness, and difficulty beneficiaries in the development and implementation of service charters in place. The results showed an adaptation of the content and wording of questions and items as appropriate in both the average (> .81 and the value of V Aiken (> .88.Resumen En este artículo se describe el diseño y validación de un cuestionario específico para conocer la opinión de gerentes y dinamizadores deportivos relativo a los elementos y finalidades que deben centrar las acciones de calidad de las mancomunidades de municipios de Extremadura en el área de dinamización deportiva, así como el grado de utilidad, beneficiarios y dificultad en la elaboración y aplicación de las cartas de servicio implantadas. Los resultados señalaron una adecuación del contenido y redacción de las preguntas y los ítems como muy adecuados tanto en el promedio (>.81 como en el valor de la V de Aiken (>.88.

  18. Utilización del cuestionario European Quality of Life-5 Dimensions (EQ-5D para valorar la variación de la calidad de vida relacionada con la salud debida a la gripe Use of European Quality of Life-5 Dimensions (EQ-5D questionnary to value the health related quality of life variation because of influenza

    Directory of Open Access Journals (Sweden)

    Roberto Pradas Velasco

    2009-04-01

    Full Text Available Objetivo: Describir el estado de salud autopercibido y la calidad de vida relacionada con la salud (CVRS de individuos sanos en edad laboral, medir el cambio experimentado con el padecimiento de la gripe y valorarlo en términos monetarios. Método: Estudio observacional descriptivo mediante cuestionarios administrados a 50 individuos, en edad laboral, infectados por el virus de la gripe durante el año epidemiológico 2004-2005 y residentes en domicilios particulares de la ciudad de Logroño (España. Los pacientes completaron los cuestionarios en dos ocasiones: con gripe y una vez restablecidos. Se efectuó un análisis de las variables sociodemográficas, las dimensiones y los indicadores de CVRS del cuestionario European Quality of Life-5 Dimensions (EQ-5D. Los índices de utilidad de la CVRS se emplearon para el cálculo de los años de vida ajustados por calidad (AVAC perdidos. Resultados: Por término medio, la reducción del índice de la CVRS debida al padecimiento de la gripe varió entre 0,37 y 0,65, en una escala que va del 0 (muerte al 1 (salud perfecta. Una epidemia de gripe, sobre un grupo de 100.000 individuos, puede suponer una pérdida de 137 AVAC, que valorados en términos monetarios ascenderían a 2.722.609 euros. Conclusiones: "Actividades cotidianas" es la dimensión EQ-5D que más empeoró, mientras que «ansiedad/depresión» fue la menos afectada. La gripe ocasiona importantes pérdidas de CVRS en la población en edad laboral. Los resultados monetarios del análisis de sensibilidad estuvieron comprendidos en intervalos cuya amplitud fue de más de 5 veces el valor medio.Objective: To describe self-perceived health status and health-related quality of life (HRQoL in healthy individuals of working age, to measure changes due to influenza infection, and to evaluate the effect of influenza infection on HRQoL in monetary terms. Method: We performed a descriptive observational study through questionnaires administered to 50 patients of working age infected with the influenza virus during the epidemiologic year 2004-2005 and living in private homes of the city of Logroño (Spain. The patients completed the questionnaires twi with and without influenza. The dimensions and HRQoL indicators of the European Quality of Life-5 Dimensions (EQ-5D questionnaire were evaluated. HRQoL utility indices were used to calculate lost quality-adjusted life years (QALYs. Results: On average, the reduction in the HRQoL utility index caused by influenza infection was between 0.37 and 0.65, on a scale from 0 (death to 1 (perfect health. An influenza epidemic in 100,000 individuals could imply a loss of 137 QALYs, which in monetary terms could represent 2,722,609€. Conclusions: The EQ-5D dimension most negatively affected by influenza was «daily activities" while the least affected dimension was "anxiety/depression». Influenza causes substantial losses in HRQoL among the population of working age. The results of the sensitivity analysis of the monetary effects of influenza infection yielded intervals showing a range of more than 5 times the mean value.

  19. Aplicación en el ámbito del rendimiento deportivo de un método de análisis biomecánico para valorar la ejecución técnica del salto zancada de gimnasia rítmica

    OpenAIRE

    Rodríguez Galán, Mónica

    2013-01-01

    La capacidad de ejecutar una buena técnica es un factor importante en deportes de alto componente estético como es la Gimnasia Rítmica. Los saltos específicos de este deporte son elementos que lo caracterizan, debido a la muestra de flexibilidad y belleza estética que aportan a la gimnasta. Pero el qué nos hace tener una técnica de ejecución óptima para lograr la máxima calidad de salto es algo que se puede descubrir mediante el estudio y el análisis de la técnica que nos pr...

  20. Determination of uranium and {sup 2}10Po in the river Odiel to assess the radioactive impact of acid mine drainage; Determinacion de uranio y {sup 2}10Po en el rio Odiel para valorar el impacto radiactivo de los drenajes acidos mineros

    Energy Technology Data Exchange (ETDEWEB)

    Manjon, G.; Lehritani, M.; Mantero, J.; Diaz Frances, I.; Garcia-Tenorio, R.

    2013-07-01

    Since 1986 this research group has been monitoring of radioactive environmental impact in the estuary of the river Odiel, generated by the factories of production of phosphoric acid from Huelva, that emitting NORM waste. Once closed factories, is observed a second source of contamination: mining drains. To verify this source have been studied concentration levels of natural radionuclides in the waters and sediments of the river Odiel, in areas that are incorporated drains. (Author)

  1. Center of Excellence for Individualization of Therapy for Breast Cancer

    Science.gov (United States)

    2008-04-01

    5-FU resistance in metastatic breast cancer. San Antonio Breast Cancer Symposium . 2006. Ref Type: Abstract Collado,M., Gil,J., Efeyan,A., Guerra ...cancer - a new therapeutic opportunity. Nat. Rev. Cancer 5, 505-515. Miller,L.D., Smeds,J., George,J., Vega ,V.B., Vergara,L., Ploner,A., Pawitan,Y., Hall

  2. Visión hermenéutica de las letras mexicanas

    Directory of Open Access Journals (Sweden)

    Sergio Díaz

    2016-05-01

    Full Text Available Reseña del libro Vergara Mendoza Gloria, Flores Flores Ociel, (coords. (2013. Hermenéutica de la literatura mexicana contemporánea. México: Universidad Autónoma Metropolitana. 404 p.p.

  3. U.S.-Brazil Cooperation: Working Together to Shape the Global Strategic Environment

    Science.gov (United States)

    2013-03-01

    U.S.-Brazil Cooperation: Working Together to Shape The Global Strategic Environment by Colonel Rodrigo Pereira Vergara...Cooperation: Working Together to Shape The Global Strategic Environment 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR...cooperation by strengthening convergences and building complementary forms of activity to shape a more favorable global strategic environment . 15

  4. Improve Tenure with Better Measures of Teacher Effectiveness

    Science.gov (United States)

    Jacobs, Sandi

    2016-01-01

    Just a few years ago, tenure appeared low on the reform list for state policy makers and district administrators, viewed as too hot an issue politically to challenge. But it was front and center in the 2014 landmark "Vergara v. California" lawsuit, which challenged teacher tenure and related policies. Yet whether to grant tenure or not…

  5. Design of compliantly actuated exo-skeleton for an impedance controlled gait trainer robot

    OpenAIRE

    van der Kooij, Herman; Veneman, J.F.; Ekkelenkamp, R.; IEEE Engineering in Medicine

    2006-01-01

    We have designed and built a lower extremity powered exo-skeleton (LOPES) for the training of post-stroke patients. This paper describes the philosophy behind the design of LOPES (Fig. 1), motivates the choices that have been made and gives some exemplary results of the ranges of mechanical impedances that can be achieved.

  6. Design of compliantly actuated exo-skeleton for an impedance controlled gait trainer robot

    NARCIS (Netherlands)

    van der Kooij, Herman; Veneman, J.F.; Ekkelenkamp, R.; IEEE Engineering in Medicine,

    2006-01-01

    We have designed and built a lower extremity powered exo-skeleton (LOPES) for the training of post-stroke patients. This paper describes the philosophy behind the design of LOPES (Fig. 1), motivates the choices that have been made and gives some exemplary results of the ranges of mechanical

  7. Design of a compliantly actuated exo-skeleton for an impedance controlled gait trainer robot.

    Science.gov (United States)

    van der Kooij, Herman; Veneman, Jan; Ekkelenkamp, Ralf

    2006-01-01

    We have designed and built a lower extremity powered exo-skeleton (LOPES) for the training of post-stroke patients. This paper describes the philosophy behind the design of LOPES, motivates the choices that have been made and gives some exemplary results of the ranges of mechanical impedances that can be achieved.

  8. Cis regius, a new species of Cis Latreille (Coleoptera: Ciidae) from Southern Africa.

    Science.gov (United States)

    Orsetti, Artur; Lopes-Andrade, Cristiano

    2016-07-19

    Cis Latreille is the most diverse genus of Ciidae with 350 species and a worldwide distribution (Oliveira et al. 2013). It houses more than a half of the described ciid species, but the available phylogenetic analyses based on molecular data suggest that Cis is polyphyletic (Buder et al. 2008; Lopes-Andrade & Grebennikov 2015). Currently, there is no thoroughly accepted subgeneric classification for Cis and parts of the species are organized into artificial species-groups (Lawrence 1971; Lopes-Andrade et al. 2003; Lopes-Andrade 2008; Oliveira et al. 2013).

  9. Greek “Hapax Legomena” and Latin Neologisms Translations in the Interlineal Latin Translation of the Book of Job in the Complutense Polyglot Bible

    Directory of Open Access Journals (Sweden)

    José Francisco García Juan

    2017-07-01

    Full Text Available The Complutensian Polyglot Bible (1514-1517, sponsored by the Cardinal Francisco Jiménez de Cisneros (1436-1517, reckons on interline translations for the Septuaginta column. Conceived as a Bible for research, the young man magister artium Juan de Vergara (1492-1557 accomplished the Latin interline interpretatio of the Book of Job, which has not been republished since the 16th Century and of which we make known in this article the translation procedures used with the Greek “hápax legómena” and the Latin neologisms minted by Vergara are released, as singular expressions of fidelity to the interline literalism and the interpretative realization of the Bible text.

  10. Ensayo de un diccionario de la literatura colombiana

    Directory of Open Access Journals (Sweden)

    Néstor Madrid Malo

    1967-04-01

    Full Text Available Según Arango Ferrer nuestra crítica literaria nació en el siglo XVII, y no de cualquier modo sino en la obra didáctica Arte de sérmones de fray Martín de Velasco, publicada en Cádiz (1677 y en México (1728 ". Pero, de remontar a entonces los orígenes de nuestra crítica, hay que convenir en que no halló terreno fértil -por evidente sustracción de materia criticable- pues es preciso esperar hasta bien promediado el siglo XIX para encontrar al verdadero fundador de la critica literaria en Colombia: José María Vergara y Vergara (1831-1872.

  11. Reference: 160 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available loping severe infection symptoms in a high percentage of... lesions. The shmt1-1 mutants were more susceptible than control plants to infection with biotrophic and necrotrophic pathogens, deve

  12. Disease: H00111 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available loping countries. Typhoid is transmitted through ingestion of contaminated water or food and characterized b...Dumdum municipality, West Bengal, India, 2007: evidence for foodborne and waterbo

  13. The CI-Flow Project: A System for Total Water Level Prediction from the Summit to the Sea

    Science.gov (United States)

    2011-11-01

    HEATHER MOSER, AMI ARTHUR, CARRIE LANGSTON, RANDALL KOLAR, YANG HONG, KENDRA DRESBACK, EVAN TROMBLE, HUMBERTO VERGARA, RICHARD A LUETTICH JR., BRIAN...technically capable of producing simulations for any given location, thus enabling the system to pro - vide routine water quantity information from the...erations within the next few years. These programs create a federal backbone of NOAA-supported pro - grams that, for the most part, are available nationally

  14. Optical properties on thermally evaporated and heat-treated ...

    Indian Academy of Sciences (India)

    Author Affiliations. M E Sánchez-Vergara1 M Rivera2 R A Torres-García1 C O Perez-Baeza1 E A Loza-Neri1. Facultad de Ingeniería, Universidad Anáhuac México Norte, Avenida Universidad Anáhuac 46, Col. Lomas Anáhuac, 52786, Huixquilucan, Estado de México, México; Instituto de Física, Dpto. Materia Condensada ...

  15. Cell Calcium and the Control of Membrane Transport. Annual Symposium of the Society of General Physiologists (40th) Held in Woods Hole, Massachusetts on September 3-7, 1986.

    Science.gov (United States)

    1986-01-01

    Atif embrane Tran sport Chapter 9 A Chemical Link in Excitation-Contraction Coupling in Skel- etal Muscle Julio !ergara, Kamlesh Asotra, and Michael...Physiology. The Cardiovascular System. R. M. Berne . N. Sperelakis, and S. R. Geiger. editors. American Physiological Society. Washington. DC. 1: 1! 3...lour’ial of flubl~l l/ Ow/hc1 ’Ii 160:[)S27-9530.( Chapter 9 A Chemical Link in Excitation-Contraction Coupling in Skeletal Muscle Julio Vergara, Kamlesh

  16. Experiencias Educativas: Actividades de ocio como propuesta educativa.

    OpenAIRE

    Hus, Vlasta; Rižnar, Majda

    2015-01-01

    Colección ReSed. Es un artículo de ReSed Nº 3, perteneciente al monográfico Crisis Social, Educación y Desarrollo Profesional. Coordinación del Monográfico: Dra. Montserrat Vargas Vergara Dirección de ReSed: Dra. A-Beatriz Pérez-González

  17. Measurement of Wavelength-Resolved Light Absorption by Aerosols Utilizing a UV-VIS Extinction Cell

    OpenAIRE

    Schnaiter, Martin; Schmid, Otmar; Petzold, Andreas; Fritzsche, Lutz; Klein, Karl-Friedrich; Andreae, Meinrat O.; Helas, Günther; Thielmann, Axel; Gimmler, Melanie; Möhler, Ottmar; Linke, Claudia; Schurath, Ulrich

    2005-01-01

    The principle, technical details, and performance of the long path extinction spectrometer (LOPES), a new folded-path extinction cell with a spectral range from the mid-UV (200 nm) to the near infrared (1015 nm), is presented. Using nonabsorbing glass beads the measured extinction spectrum of LOPES was validated by Mie calculations and was compared with scattering coefficients in the visible measured by a three-color integrating nephelometer (TSI, mod. 3563). For absorbin...

  18. A new species of Litopeltis Hebard, 1920 from Rio de Janeiro, Brazil (Blattodea, Blaberidae, Epilamprinae with a key to males and geographical distribution of the remaining species of the genus

    Directory of Open Access Journals (Sweden)

    Leonardo Oliveira Cardoso da Silva

    2014-06-01

    Full Text Available This contribution describes a new species of Litopeltis from Brazil, L. teresopolitensis sp. n., which shows similarities with L. paineirensis Lopes & Oliveira, 2010 and L. ribeiropretano Lopes & Oliveira, 2010. It differs in characters of morphology genitalia and configuration, with the median sclerite bearing microspines on the sclerotic apex. A map showing the geographic distribution of the Brazilian species and a key to males of the other species of the genus are also presented.

  19. Insulin restores L-arginine transport requiring adenosine receptors activation in umbilical vein endothelium from late-onset preeclampsia.

    Science.gov (United States)

    Salsoso, R; Guzmán-Gutiérrez, E; Sáez, T; Bugueño, K; Ramírez, M A; Farías, M; Pardo, F; Leiva, A; Sanhueza, C; Mate, A; Vázquez, C; Sobrevia, L

    2015-03-01

    Preeclampsia is associated with impaired placental vasodilation and reduced endothelial nitric oxide synthase (eNOS) activity in the foetoplacental circulation. Adenosine and insulin stimulate vasodilation in endothelial cells, and this activity is mediated by adenosine receptor activation in uncomplicated pregnancies; however, this activity has yet to be examined in preeclampsia. Early onset preeclampsia is associated with severe placental vasculature alterations that lead to altered foetus growth and development, but whether late-onset preeclampsia (LOPE) alters foetoplacental vascular function is unknown. Vascular reactivity to insulin (0.1-1000 nmol/L, 5 min) and adenosine (1 mmol/L, 5 min) was measured in KCl-preconstricted human umbilical vein rings from normal and LOPE pregnancies using a wire myograph. The protein levels of human cationic amino acid transporter 1 (hCAT-1), adenosine receptor subtypes, total and Ser¹¹⁷⁷- or Thr⁴⁹⁵-phosphorylated eNOS were detected via Western blot, and L-arginine transport (0-1000 μmol/L L-arginine, 3 μCi/mL L-[³H]arginine, 20 s, 37 °C) was measured in the presence or absence of insulin and adenosine receptor agonists or antagonists in human umbilical vein endothelial cells (HUVECs) from normal and LOPE pregnancies. LOPE increased the maximal L-arginine transport capacity and hCAT-1 and eNOS expression and activity compared with normal conditions. The A(2A) adenosine receptor (A(2A)AR) antagonist ZM-241385 blocked these effects of LOPE. Insulin-mediated umbilical vein ring relaxation was lower in LOPE pregnancies than in normal pregnancies and was restored using the A(2A)AR antagonist. The reduced foetoplacental vascular response to insulin may result from A(2A)AR activation in LOPE pregnancies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. El mundo del libro : abril de 1968

    Directory of Open Access Journals (Sweden)

    Agustín Rodríguez Garavito

    1968-04-01

    Full Text Available Se presentan reseñas de los siguiente autores y textos: -Echeverri Mejía, Óscar. Diccionario abreviado de la lengua española -Vergara, Hernán. El complejo de layo -León Rey, José Antonio. Díalogos extraordinario -Administración y desarrollo -Cortés ahumada, Ernesto. Los Amantes -Nannetti Concha, Guillermo. Código de ética administrativa -Uslar Pietri, Arturo. Barrabás y otros cuentos

  1. El mundo del libro: Julio de 1961

    Directory of Open Access Journals (Sweden)

    Agustín Rodríguez Garavito

    1961-07-01

    Full Text Available Se presentan reseñas de las siguientes obras y autores: Casi un sueño; Vergara Díaz, Lucía. Los molinos del viento; Cortés Ahumada, Ernesto. Apuntaciones críticas sobre el lenguaje bogotano; José Cuervo, Rufino. La españa que se refleja en sus escritores; Gil Tovar, F. Extraño caso de amor; Pavictich, Esteban. Jose Ortega y Gasset; Ferrater Mora, J. Radiografía cordial de América; Carpio, Campio.

  2. Un sabio, un crítico y una catedral

    Directory of Open Access Journals (Sweden)

    Helcias Martán Góngora

    1968-06-01

    Full Text Available En la constelación de humanistas, formada por Caro y Cuervo, Vergara y Pérez Triana, la luminaria quizás menos conocida, en Colombia, se apellida Uricoechea. Su nombre no cede en méritos ante los integrantes de la brigada científica, que ilustraron la Expedición Botánica, bajo el comando del gaditano Mutis. Más polifacético que Rufino J . Cuervo Y de mayor versatilidad que el sabio Caldas, ciertamente, don Ezequiel no fue un profeta en su tierra.

  3. Jesuitas, masones y conspiradores: dramas bogotanos a mediados del siglo XIX

    Directory of Open Access Journals (Sweden)

    Mario García Molina

    1996-01-01

    Full Text Available Durante el agitado período del medio siglo decimonónico la actividad teatral bogotana fue mínima. El aporte nacional al teatro bogotano entre 1848 y 1853 se limita a tres obras escritas y a las actividades de un grupo de estudiantes y profesores. Las obras son: Miguel de Cervantes, de José Caicedo Rojas; El Misionero, de Eladio Vergara; y Jacobo Molai, de Santiago Pérez. Sólo se conservan los textos de las dos últimas ya que fueron impresas en libro.

  4. Papel do fisioterapeuta nos cuidados paliativos

    OpenAIRE

    Cruz, Helena Alexandra Gomes

    2015-01-01

    Relatório de Prática Clínica apresentado à Escola Superior de Saúde Dr. Lopes Dias do Instituto Politécnico de Castelo Branco para cumprimento dos requisitos necessários à obtenção do grau de Mestre em Cuidados Paliativos. Este relatório insere-se no 2º ano do Mestrado em Cuidados Paliativos da Escola Superior de Saúde Dr. Lopes Dias, do Instituto Politécnico de Castelo Branco e tem como finalidade descrever o percurso desenvolvido no 3º semestre do Mestrado, como requisito à obte...

  5. News Letter: European Geophysical Society

    Science.gov (United States)

    1998-03-01

    Mass and energy fluxes over a pine forest cano - py: energy and water balance closure, and intra-annual variations in water and radiation use...ALBIACH, J.C.; GOMEZ LAHOZ, M.; FANJUL, E.A.; ALFONSO-MUNOYERRO, M.A.; LOPEZ MALDONADO , J.D. A wave forecasting system for the Spanish harbours 09...LICHTENEGGER, H. 240, 241 LOPES, I. LIEBAULT, F. 143 LOPES, J.F. LIEBERMANN, S.S. 177 LOPEZ MALDONADO , LIECHTI, D. 272 LOPEZ, A. LIFERMANN, A. 126

  6. Estudio de problemas de gestacion en Chamaeleo calyptratus

    National Research Council Canada - National Science Library

    Sanz Tolon, Aida Victoria; Vicente Rubiano, Marina; Ortega Martin, Cristina; Alvarez-Carrion, Beatriz

    2009-01-01

    ... de la familia Chamaleonidae existe. El diagnostico se basa principalmente en una anamnesis completa, examen fisico exhaustivo, anadiendo pruebas complementarias, principalmente de diagnostico por imagen, para poder valorar las causas...

  7. Índice hiperbárico en la prevención primaria de las complicaciones hipertensivas del embarazo de alto riesgo

    National Research Council Canada - National Science Library

    Alfonso Otero González; Silvia Uribe Moya; Ivan Gilberto Arenas Moncaleano; María Paz Borrajo Prol; María Jesús García García; Luis López Sánchez

    2015-01-01

    ... escasamente difundido. Objetivo: Valorar la utilidad del índice hiperbárico en la prevención primaria de las complicaciones hipertensivas del embarazo en un área sanitaria. Material y métodos...

  8. Evaluacion de bibliotecas universitarias: un modelo de avance y desarrollo

    National Research Council Canada - National Science Library

    Tarango, Javier; Hernandez-Orozco, Guillermo

    2009-01-01

    ... (sociedad del conocimiento). El modelo teorico de evaluacion bibliotecaria que se propone en este documento representa una alternativa innovadora para valorar a la biblioteca en una dimension mas objetiva, trascendente...

  9. Conocimientos, actitudes y prácticas frente a la sexualidad en estudiantes admitidos a los programas presenciales diurnos en la Universidad Francisco de Paula SantanderConocimientos, actitudes y prácticas frente a la sexualidad en estudiantes admitidos a los programas presenciales diurnos en la Universidad Francisco de Paula SantanderConocimientos, actitudes y prácticas frente a la sexualidad en estudiantes admitidos a los programas presenciales diurnos en la Universidad Francisco de Paula Santander

    National Research Council Canada - National Science Library

    Patricia Vélez-Laguado

    2010-01-01

    .... En este estudio descriptivo, se pretendió valorar los conocimientos, actitudes y prácticas de los estudiantes adolescentes frente a la sexualidad, mediante una encuesta aplicada a 206 universitarios de ambos sexos, en edad promedio de 17...

  10. Desarrollo y pruebas psicométricas del Instrumento "cuidar" - versión corta para medir la competencia de cuidado en el hogar

    National Research Council Canada - National Science Library

    Gloria Mabel Carrillo González; Beatriz Sánchez Herrara; Vargas Rosero Elizabeth

    2016-01-01

    ...: Desarrollar y realizar pruebas psicométricas del instrumento "CUIDAR" versión abreviada para valorar la competencia para el cuidado en el hogar de una persona con enfermedad crónica. Método...

  11. Auscultación en la arteriopatía periférica

    OpenAIRE

    Cebrià Iranzo, M. Àngels

    2010-01-01

    La auscultación de las grandes arterias permite valorar procesos estenosantes o aneurismas. En condiciones normales o de flujo laminar los pulsos arteriales no deben revelar sonidos (soplos, vibración de la pared vascular, etc.).

  12. Los portafolios digitales grupales: un estudio diacrónico en la Universidad Pablo Olavide (2009-2015) = The group e-portfolio: A diachronic study at University Pablo de Olavide in Spain (2009-2015)

    National Research Council Canada - National Science Library

    Eloy López Meneses; Esteban Vázquez-Cano; Alicia Jaén Martínez

    2017-01-01

    ...). Estas experiencias consisten en el empleo de portafolios grupales dentro y fuera de las clases con el objeto de que propio estudiante pueda valorar sus logros, las dificultades y las evidencias en el...

  13. Perfil farmacocinético-farmacodinámico del cefditoreno en suero y orina tras una dosis única y en pautas de dos o tres veces al día en voluntarios sanos: estudio de fase I

    National Research Council Canada - National Science Library

    Gimeno, M. J; Quetglas, E. G; Honorato, Jesús; Campanero, M.A; Azanza Perea, José Ramón; Sádaba Díaz de Rada, Belén; Coronel, Paúl

    2007-01-01

    El objetivo del estudio fue valorar la farmacocinética, la farmacodinámica y la tolerabilidad digestiva del cefditoreno pivoxilo en 20 voluntarios varones adultos sanos tras su administración cada 8 horas...

  14. DIAGNÓSTICO Y PROPUESTA DE GESTIÓN DE LAS ACTIVIDADES DE MANTENIMIENTO DEL SISTEMA SEMAFÓRICO DE BOGOTÁ D.C

    National Research Council Canada - National Science Library

    Jose Ignacio Rodriguez Molano; Miguel Ángel Martínez Cárdenas

    2015-01-01

    .... En este sentido, se caracterizó, identificó y evaluó el despliegue de los contratos interadministrativos que se ejecutan actualmente, mediante visitas de campo que permitieron valorar el estado actual del sistema...

  15. EVALUACION DEL IMPACTO AMBIENTAL EN OBRAS VIALES

    National Research Council Canada - National Science Library

    Wilfredo Martínez D

    2014-01-01

    El presente artículo es escrito, con el propósito de proporcionar elementos técnicos que contribuyan para orientar a los equipos de trabajo multidisciplinario, en valorar objetivamente los impactos ambientales provocados...

  16. Control borroso para la valoracion del impacto ambiental generado por contaminantes emergentes en aguas residuales hospitalarias

    National Research Council Canada - National Science Library

    Leadina Sánchez Barboza

    2015-01-01

    ... -fármacos- en aguas residuales hospitalarias, por lo que este trabajo propone valorar el impacto de dichos contaminantes mediante un sistema de inferencia borrosa, utilizando el toolbox fuzzy logic de MATLAB...

  17. Metodos estadisticos de evaluacion de la concordancia y la reproducibilidad de pruebas diagnosticas

    National Research Council Canada - National Science Library

    Cortes-Reyes, Edgar; Rubio-Romero, Jorge Andres; Gaitan-Duarte, Hernando

    2010-01-01

    Introduccion: en la evaluacion de la utilidad de una prueba diagnostica, se requiere en algunas situaciones valorar la reproducibilidad de los resultados o la concordancia de los mismos al compararla...

  18. Case report

    African Journals Online (AJOL)

    abp

    7 oct. 2013 ... Miyagui T, Luchemback L, Do Canto Teixeira G and Lopes de. Azevedo LK . Meningeal carcinomatosis as the initial. Manifestation of a gallbladder Adenocarcinoma associated with a Krukenberg tumor. Rev Hosp Clín Fac Med. 2003 ; 58. (3):169-172. PubMed | Google Scholar. 7. Jain V, Guptay K, Kudvay ...

  19. First-Trimester Serum Acylcarnitine Levels to Predict Preeclampsia: A Metabolomics Approach

    Directory of Open Access Journals (Sweden)

    Maria P. H. Koster

    2015-01-01

    Full Text Available Objective. To expand the search for preeclampsia (PE metabolomics biomarkers through the analysis of acylcarnitines in first-trimester maternal serum. Methods. This was a nested case-control study using serum from pregnant women, drawn between 8 and 14 weeks of gestational age. Metabolites were measured using an UPLC-MS/MS based method. Concentrations were compared between controls (n=500 and early-onset- (EO- PE (n=68 or late-onset- (LO- PE (n=99 women. Metabolites with a false discovery rate <10% for both EO-PE and LO-PE were selected and added to prediction models based on maternal characteristics (MC, mean arterial pressure (MAP, and previously established biomarkers (PAPPA, PLGF, and taurine. Results. Twelve metabolites were significantly different between EO-PE women and controls, with effect levels between −18% and 29%. For LO-PE, 11 metabolites were significantly different with effect sizes between −8% and 24%. Nine metabolites were significantly different for both comparisons. The best prediction model for EO-PE consisted of MC, MAP, PAPPA, PLGF, taurine, and stearoylcarnitine (AUC = 0.784. The best prediction model for LO-PE consisted of MC, MAP, PAPPA, PLGF, and stearoylcarnitine (AUC = 0.700. Conclusion. This study identified stearoylcarnitine as a novel metabolomics biomarker for EO-PE and LO-PE. Nevertheless, metabolomics-based assays for predicting PE are not yet suitable for clinical implementation.

  20. Selective control of gait subtasks in robotic gait training : Foot clearance support in stroke survivors with a powered exoskeleton

    NARCIS (Netherlands)

    Koopman, B.; Van Asseldonk, E.H.F.; Van der Kooij, H.

    2013-01-01

    Background Robot-aided gait training is an emerging clinical tool for gait rehabilitation of neurological patients. This paper deals with a novel method of offering gait assistance, using an impedance controlled exoskeleton (LOPES). The provided assistance is based on a recent finding that, in the

  1. Selective control of gait subtasks in robotic gait training: foot clearance support in stroke survivors with a powered exoskeleton

    NARCIS (Netherlands)

    Koopman, Bram; van Asseldonk, Edwin H.F.; van der Kooij, Herman

    2013-01-01

    Background Robot-aided gait training is an emerging clinical tool for gait rehabilitation of neurological patients. This paper deals with a novel method of offering gait assistance, using an impedance controlled exoskeleton (LOPES). The provided assistance is based on a recent finding that, in the

  2. Quantum Transport

    Science.gov (United States)

    1993-05-14

    realized from NAND gates and inverters through an application of De Miorgans law of Boolean algebra . This law states .43 - -• - B. where A and B are two...whepend s lineal ondve lope r tie . Thissouin ha s nth :4: beenivesometigaed and remains for fuituresioks o thicn ss F. uiiy: Pa--ii ’e-ose Fiure 3rs giesm

  3. Painlevé analysis and some solutions of variable coefficient Benny ...

    Indian Academy of Sciences (India)

    researchers have shown considerable interest in studying variable coefficient nonlinear equations. Various methods like inverse scattering transformation (IST) [1,2], ... loped a highly algorithmic method known as the Lie point symmetry method (group .... where ϵ is the group parameter, which leaves the system invariant.

  4. Caregivers' willingness‑to‑pay for a topical anesthetic cream for ...

    African Journals Online (AJOL)

    2013-09-17

    Sep 17, 2013 ... Lopes AB, Galleta DF. Consumer perceptions and willingness to pay for intrinsically motivated online content. J Manage Inf Syst 2006;23:203‑31. 40. Parvez E, Stinson J, Boon H, Goldman J, Shah V, Taddio A. Mothers' beliefs about analgesia during childhood immunization. Paediatr Child Health 2010 ...

  5. Historia de la gramatica espanola en America Uruguay. A proposito de Francisco Gamez Marin

    National Research Council Canada - National Science Library

    Zamorano Aguilar, Alfonso

    2005-01-01

    ..., gramatica, Uruguay. *** LA CODIFICACION del espanol en America supone un reto y, a la vez, una fuente de investigacion muy importante para el historiador y para el historiografo de la linguistica, sobre todo, por la escasez de trabajos realizados, mas alla de los estudios de Sebeok (1968; especificamente, vol. IV), Rabanales (1978), Parodi (1981), Lope ...

  6. Ambiguous Allegories

    DEFF Research Database (Denmark)

    Kluge, Sofie

    2012-01-01

    or dramatic bagatelles meant to divert a decadent royal audience interested in nothing but idle amorous intrigues and pretty words. In fact, we find some of Lope and Calderón’s most solemn involvements with the tragic among the serious mythological comedias. Not fullblown realizations of the tragedia patética...

  7. A novel approach for classification of abnormalities in digitized ...

    Indian Academy of Sciences (India)

    Schild H H 2005 Mammography, breast ultrasound, and magnetic resonance imaging for surveillance of women at high familial risk for breast cancer. J. Clin. Oncol. 23(33): 8469–8476. Lopes R and Betrouni N 2009 Fractal and multifractal analysis: A review. Med. Image Anal. 13: 634–649. Matsubara T, Yamazaki D, Fujita ...

  8. Compliant actuation of rehabilitation robots

    NARCIS (Netherlands)

    Vallery, Heike; Veneman, J.F.; van Asseldonk, Edwin H.F.; Ekkelenkamp, R.; Buss, Martin; van der Kooij, Herman

    2008-01-01

    This article discusses the pros and cons of compliant actuation for rehabilitation robots on the example of LOPES, focusing on the cons. After illustrating the bandwidth limitations, a new result has been derived: if stability in terms of passivity of the haptic device is desired, the renderable

  9. Natural Rights and Power in the Spanish Comedia after the Conquest

    DEFF Research Database (Denmark)

    Simonsen, Karen-Margrethe

    2016-01-01

    This article investigates the status of natural rights in Lope de Vega's drama "The New World Discovered by Christopher Columbus" ("El nuevo mundo descubierto por Cristóbal Colón") (1598-1603). It argues that the tragicomedy (' la comedia') is a genre that is able to reflect discourses of natural...

  10. Book Review Field Guide to the Birds of Macaronesia: Azores ...

    African Journals Online (AJOL)

    Book Review Field Guide to the Birds of Macaronesia: Azores, Madeira, Canary Islands, Cape Verde By Eduardo Garcia-del-Rey (2011). Ricardo Jorge Lopes. Abstract. Lynx Edicions, Montseny, 8, E-08193 Bellaterra, Barcelona, Spain 342 pages, including 150 colour plates and >230 detailed distribution maps, hardcover

  11. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics. S E De S Pinto. Articles written in Pramana – Journal of Physics. Volume 73 Issue 6 December 2009 pp 999-1009. Synchronization and suppression of chaos in non-locally coupled map lattices · R M Szmoski S E De S Pinto M T Van Kan A M Batista R L Viana S R Lopes.

  12. Research@ARL: Network Sciences

    Science.gov (United States)

    2013-03-01

    Lancet Neurol. 1, 22—30. Lopes da Silva, F., Blanes, W., Kalitzin, S.N., Parra, J., Suffczyn- ski , P., Velis, D.N., 2003. Epilepsies as dynamical...aidphylogen- etically controlled evolutionary analyses in this taxon. golden M. caudata black-capped M. camtschatica alpine M. marmota hoary M. caligata Olympic

  13. Enhancing capacity of research ethics review committees

    African Journals Online (AJOL)

    involving human subjects is relatively new in deve loping countries compared with the technologically advanced nations of .... geographical location. Training needs assessment and ethics sensitisation .... by an accredited ERC is necessary for researchers to obtain access to data held by the New Zealand health information.

  14. In vivo antifungal activity of neem oil and aqueous extracts against ...

    African Journals Online (AJOL)

    In vivo antifungal activity of neem oil and aqueous extracts against leaf spot disease caused by Cercospora abelmoschii on okra. Aricléia De Moraes Catarino, Antonia Alice Costa Rodrigues, João Victor Jansen De Queiroz, Luciano Marinho Furtado, Leilson Lopes Santos Silva Silva ...

  15. Marker list: QM101523 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101523 Brassica oleracea Brassicaceae BoCL1770s SNP GCTTCCTTTCACATGCTCCTCT CCTGGAATCGTGCTTGATGTT CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ...

  16. Marker list: QM101505 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101505 Brassica oleracea Brassicaceae BoCL1037s SNP CAGCATGGAAAATATGGGGAAC AAAAGCATCTACTCGGCTCCA CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ...

  17. Marker list: QM101526 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101526 Brassica oleracea Brassicaceae BoCL1824s SNP GGAACTTCCCTCGAGAGTCAAA AAACTTCAGTTCAGGGCATGG CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ...

  18. Marker list: QM101648 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101648 Brassica oleracea Brassicaceae BoCL7289s SNP CGTGTATGAGAAGGGGAGGAAT ATCAAGGCCTTCTGCAAAACC CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ...

  19. Marker list: QM101512 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101512 Brassica oleracea Brassicaceae BoCL1384s SNP GAAGAACAAAGTGGCGGCTATT CATGGTTGATGGCTTCATACG CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC04 ... 10.1007/s10681-012-0847-1 ...

  20. Marker list: QM101634 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM101634 Brassica oleracea Brassicaceae BoCL6244s SNP CTATGTCGATAATGCCGGTGAA TGTGATCTTAACGGCGATGGT CY (deve...loped from 'Early Fuji') x BB (derived from 'Green Dome 115') ... ChrC05 ... 10.1007/s10681-012-0847-1 ...

  1. Dicty_cDB: CHM769 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available loping Seed cDNA Library UCRCS09 Citrus sinensis cDNA clone UCRCS09-8E08-I15-1-5.g,...genomic clone CSU-K33r.25G4, DNA sequence. 50 0.062 1 CX053834 |CX053834.1 UCRCS09_8E08_g Ruby Orange Deve

  2. Untitled

    Indian Academy of Sciences (India)

    It was discarded for. AgBr shortly after because of the latter's higher sensitivity and wider Spectral response. Although microscopic theories of the photographic process Were deve- loped by Gurney and Mott (1938) to be modified by Mitchell in 1946, the difference in material properties was not understocd until recently.

  3. Orthorhombic rational approximants for decagonal quasicrystals

    Indian Academy of Sciences (India)

    Unknown

    taken to the intuitively appealing concept of a periodic lattice in diverse ways. The advantage that the well deve- loped tools of crystallography can be put to ..... explain the lattice parameter data for orthorhombic app- roximants. Finally, the most important aspect is that the actual structural arrangement follows the Fibonacci.

  4. Establishment of Eucalyptus grandis W. Hill ex Maiden in vitro using ...

    African Journals Online (AJOL)

    (Ed.) Biotecnologia Florestal. Editora UFV, Viçosa, Minas Gerais,. Brasil. Balba H (2007). Review of strobilurin fungicide chemicals. J. Environ. Sci. Health. Part. B. 42(4):441-51. Borges SR, Xavier A, Oliveira LS de, Lopes AP, Otoni WC (2011). Multiplicação in vitro de clones híbridos de Eucalyptus globulus. Rev. Àrvore.

  5. Transnational Education in the Late Nineteenth Century: Brazil, France and Portugal Connected by a School Museum

    Science.gov (United States)

    Vidal, Diana Gonçalves

    2017-01-01

    This article focuses on the circulation of a single artefact, the "Museu Escolar Brasileiro" (Brazilian School Museum) and its use in education through the pedagogical method of object lessons. Concentrating on the activities of particular individuals and enterprises (Menezes Vieira, Oliveira Lopes and Maison Deyrolle), within three…

  6. Browse Title Index - African Journals Online

    African Journals Online (AJOL)

    Items 8201 - 8250 of 11090 ... NF Vieira, MAP Silva, YAA Martins, DG Souza, MS Lima, GR Placido, M Caliari. Vol 12, No 17 (2013), Physicochemical and sensory .... RW de Sousa Aguiar, DR Brito, M de Mendonca Lopes, GR dos Santos, CM Sousa, EMM da Silva, J Didonet. Vol 10, No 38 (2011), Physiological and molecular ...

  7. Browse Title Index - African Journals Online

    African Journals Online (AJOL)

    Items 5151 - 5200 of 11090 ... B Saeed, Y Durrani, H Gul, A Said, S Wahab, M Ayub, A Muhammad, B Haleema, I Ahmad. Vol 14, No 5 (2015) .... Priscila Oliveira Silva, Leonardo Monteiro Ribeiro, Maria Olívia Mercadante Simões, Paulo Sérgio Nascimento Lopes, Teddy Marques Farias, Queila Souza Garcia. Vol 15, No 36 ...

  8. Effects of whole body vibration intervention on handgrip strength of ...

    African Journals Online (AJOL)

    Effects of whole body vibration intervention on handgrip strength of Brazilian healthy soldiers. Danielle Soares Morel, Eloá Moreira-Marconi, Samuel Brandão Sobrinho Neto, Laisa Liane Paineiras Domingos, Patrícia Lopes de Souza, Danúbia da Cunha de Sá Caputo, Glenda Dias Costa, Cláudia Ferreira de Figueiredo, ...

  9. Photoluminescence, trap states and thermoluminescence decay ...

    Indian Academy of Sciences (India)

    Administrator

    Photoluminescence; thermoluminescence; kinetic data; persistence luminescence. 1. Introduction. M2MgSi2O7 (Sr, Ca) doped with Eu2+ and Dy3+ phosphor has shown quite good long lasting behaviour. Silicate phosphors have few advantages over previously deve- loped aluminate long lasting phosphors on chemical ...

  10. Sapucaia nuts ( Lecythis pisonis ) modulate the hepatic ...

    African Journals Online (AJOL)

    Sapucaia nuts (Lecythis pisonis) modulate the hepatic inflammatory and antioxidant metabolism activity in rats fed high-fat diets. Marcos Vidal Martins, Izabela Maria Montezano de Carvalho, Mônica Maria Magalhães Caetano, Renata Celi Lopes Toledo, Antônio Avelar Xavier, José Humberto de Queiroz ...

  11. Assessing Attitude to and Knowledge of Entrepreneurship among ...

    African Journals Online (AJOL)

    First Lady

    comprising affection (feeling and emotion), cognition (thought and belief) and conations (action and behaviour) (Lope-Phihie and Bagheri, 2011). Therefore, for anybody to succeed in a choosing career, the three dimensions must work together. With people with hearing impairment, there seems to be a disconnect of the.

  12. Dimensión social de la malaria

    Directory of Open Access Journals (Sweden)

    Amparo Lotero Botero

    1992-01-01

    Full Text Available Salud y desarrollo. Aspectos socioeconómicos de la malaria en Colombia. Elssy Bonilla Castro, Luz Stella Kuratomi, Penélope Rodríguez, Alejandro Rodríguez. Plaza y Janés Editores, Bogotá, 1991, 262 págs.

  13. Removal of some metal ions from aqueous solution using orange ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... 1Department of Pure and Industrial Chemistry, University of Port Harcourt, P.M.B. 5323, Port Harcourt, Rivers State,. Nigeria. 2 Department ... removal of heavy metals from contaminated soil and waste water. A number of technologies have been deve- loped over the years to remove toxic metals from water.

  14. Pontificio Colegio Español de San José de Roma. Aproximación a su historia [Reseña

    OpenAIRE

    Tineo, P. (Primitivo)

    2011-01-01

    Reseña de Vicente Cárcel Ortí– Lope Rubio Parrado, "Pontificio Colegio Español de San José de Roma. Aproximación a su historia", Pontificio Colegio Español, Roma, 2010, Ed. Sígueme, Salamanca 2010, 400 pp.

  15. Effect of surface modification and hybridization on dynamic ...

    Indian Academy of Sciences (India)

    But after service, the treat- ment and disposal of these materials as solid waste has become a serious problem. To overcome this, efforts are ... loped natural fibre-reinforced composites. Pothan et al. (1997) investigated on mechanical, failure and aging cha- racteristics of short banana fibre reinforced polyester compo-.

  16. Thermogravimetry-evolved gas analysis–mass spectrometry system ...

    Indian Academy of Sciences (India)

    Unknown

    –MS) system has been deve- loped. This system consists of a .... holder is connected to a data acquisition system (34970A,. M/s Agilent) for direct ..... could generate a fairly big O2 peak (corresponding Y-axis in a.u. is not shown in figure 5).

  17. An effective disinfection protocol for plant regeneration from shoot tip ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... induced to form adventitious roots. The plantlets were maintained in the same medium and extra time of illumination so that their rooting systems may be deve- loped properly. The in vitro grown plantlets were then planted in 1.5 inches plastic trays with peat moss, vermiculite and perlite mixture (1:1:1 ratio) ...

  18. Microbiological and chemical assessment of spring water from a ...

    African Journals Online (AJOL)

    GREG

    2013-06-20

    Jun 20, 2013 ... quate interventions, waterborne diseases pandemic or epidemic can happen and increase dramatically (Ford and Colwell, 1996). The major concern of people in deve- loping countries is that of obtaining clean water. In Africa and Asia, most of the large cities utilize surface water but many millions of people ...

  19. Insecticidal activity of four medicinal plant extracts against Tribolium ...

    African Journals Online (AJOL)

    Administrator

    2006-05-16

    May 16, 2006 ... Nascimento IR, Murata AT, Bortoli SA, Lopes LM (2004). Insecticidal activity of chemical constituents from Aristolochia pubescens against. Aticarsia gemmatalis larvae. Pest Manag. Sci. 60: 413-6. Papachristos DP, Stamopoulos DC (2002). Repellent, toxic and reproduction inhibitory effects of essential oil ...

  20. 120_647 - 6_CHM 027 Ibrahim

    African Journals Online (AJOL)

    userpc

    Industrial Chemistry and the management of. Bayero University, Kano for providing the entire necessary laboratory facilities required for the research. REFERENCES. Barbosa, N. R., Pittella, F., Dutra, R.C., Junior,. D.D., Lopes, M.T.P. (2009). Antioxidant and Cytotoxic Activities of Centella asiatica (L) Urb. Int. J. Mol. Sci. 10:.

  1. Who.t Chemico.1 Engineering ?

    African Journals Online (AJOL)

    cess, start-up and attaining production at rated capacity takes a considerable time especially if the process is conducted for the first time. The stages enumerated above are but a brief outline of a general nature, usually followed in deve- loping a new process or venture. Some of the steps, especially the pilot plant idea, may ...

  2. Suiformes conservation: a study case of strategies for DNA utilization

    Indian Academy of Sciences (India)

    [Oliveira-Monteiro N., Lopes-Rodrigues V., Bastos E. and Guedes-Pinto H. 2013 Suiformes conservation: a study case of strategies for DNA utilization. J. Genet. 92, e49–e52. ... WGA technology (Barker et al. 2004; Bergen et al. 2005 ..... unprocessed food by PCR amplification of a new specific DNA fragment. J. Anim. Sci.

  3. African Journal of Biotechnology - Vol 12, No 5 (2013)

    African Journals Online (AJOL)

    Fruit maturation and in vitro germination of macaw palm embryos · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Priscila Oliveira Silva, Leonardo Monteiro Ribeiro, Maria Olívia Mercadante Simões, Paulo Sérgio Nascimento Lopes, Teddy Marques Farias, Queila ...

  4. Molecular markers for drought tolerance in bread wheat

    African Journals Online (AJOL)

    aghomotsegin

    2013-05-22

    May 22, 2013 ... this stress arises from the changes in cellular gene expression profile ... loped through breeding for wide or specific adaptation. (Fisher et al. ..... Drought stress response in wheat, physiological and Molecular analysis of resistance and sensitive genotypes. Plant Cell Environ. 29:2143-2152. Rashed MA ...

  5. Ultrastructure of antennal sensillae of the samsum ant ...

    African Journals Online (AJOL)

    Jane

    2010-10-11

    Oct 11, 2010 ... However, the basiconic sensillae that have been described in Drosophila melanogaster (Shanbhag et al., 1999), phorid fly, Pseudacteon tricuspis (Chen and. Fadamiro, 2008) and Phoracantha semipunctata (Lopes et al., 2002) have not been observed in P. sennaarensis. Heavy density of non-porous ...

  6. Author Details

    African Journals Online (AJOL)

    Lopes, Ricardo Jorge. Vol 83, No 1 (2012) - Articles Book Review Field Guide to the Birds of Macaronesia: Azores, Madeira, Canary Islands, Cape Verde By Eduardo Garcia-del-Rey (2011) Abstract. ISSN: 0030-6525. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's ...

  7. (Gossypium hirsutum L. race latifolium H.) cultivars and inbred lines ...

    African Journals Online (AJOL)

    Jane

    2010-12-13

    Dec 13, 2010 ... Adriana Gonela1, Giselly Figueiredo Lacanallo1, Leonel Domingos Moiana2, António. Chamuene2, Lorenna Lopes de Sousa1 and Luana Mieko Darben1. 1Universidade Estadual de Maringá, Programa de Pós-graduação em Genética e Melhoramento, Campus. Universitário, Av. Colombo, 5790, Bloco ...

  8. Tropical Journal of Pharmaceutical Research - Vol 16, No 2 (2017)

    African Journals Online (AJOL)

    Physical training improves cardiopulmonary functional capacity and increases cytokine IL-10 levels in individuals with Chagas disease · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Wania S Lopes, Érika C Ferreira, Suelen S Silva, Fernanda Tomiotto- Pellissier, ...

  9. Involvement of Human Estrogen Related Receptor Alpha 1 (hERR 1) in Breast Cancer and Hormonally Insensitive Disease

    Science.gov (United States)

    2002-08-01

    and Hertz, J. E. (1997) Mol. Endocrino !. 11, 342-352 43. Burbach, J. P. H., Lopes do Silva, S., Cox, J. J., Adan, R. A. H., Cooney, A. J., 12. Shigeta... Endocrino ). 172, 223-233 50. Allegra, J. C., Lipprman, H. E., Thompson, E. B., Simon, R., Barlockc, A., Green, 22. Tremoblay, G. B., Kunath, T

  10. Hydrology of southwestern encinal oak ecosystems: A review and more

    Science.gov (United States)

    Gerald J. Gottfried; Peter F. Ffolliott; Daniel G. Neary

    2007-01-01

    Information about the hydrology of oak ecosystems of the southwestern United States and northern Mexico is lacking (Lopes and Ffolliott 1992, Baker et al. 1995) even though the woodlands and savannas cover more than 31,000 square miles. These ecosystems generally are found between 4,000 and 7,300 feet in elevation. Precipitation occurs in the winter and summer and...

  11. 12.30 pm Realizing the Demographic Dividend in Africa Venue

    International Development Research Centre (IDRC) Digital Library (Canada)

    Timothée Fruhauf

    2013-03-24

    Mar 24, 2013 ... Venue: Palais des Congrès, Sofitel Abidjan Hotel Ivoire. Chair: H.E. Mr. Carlos Lopes, United Nations Under-Secretary-. General and Executive Secretary of the United Nations Economic ... Industry, Kingdom of Thailand and Chairman of the Board of. Executive Directors, Bangkok Bank Public Company ...

  12. Relevance of whole body vibration exercise in sport: a short review ...

    African Journals Online (AJOL)

    Danielle Soares Morel, Carla da Fontoura Dionello, Eloá Moreira-Marconi, Samuel Brandão- Sobrinho-Neto, Laisa Liane Paineiras-Domingos, Patrícia Lopes Souza, Danúbia da Cunha Sá-Caputo, Glenda Dias, Claudia Figueiredo, Roberto Carlos Resende Carmo, Patrícia de Castro Paiva, Cintia Renata ...

  13. 1492-IJBCS-Article-Céline Dan

    African Journals Online (AJOL)

    hp

    Pasteur, 28 Rue Goethe 67083 Strasbourg. Cedex France, 23 p. White JT. 1992. Vegetation history and logging disturbance: Effects of rain forests mammals in Lope reserve, Gabon. (with special emphasis on elephants and apes). Ph.D. thesis. University of. Edimburg, 250 p. Yongo OD. 2002. Contribution aux études.

  14. National and international astronomical activities in Chile (1849-2001). (German Title: Nationale und internationale astronomische Aktivitäten in Chile (1849-2001))

    Science.gov (United States)

    Duerbeck, Hilmar W.

    The history of the Chilean National Observatory, beginning with its origins out of Gilliss' US Naval Expedition to the Southern Hemisphere, over its directors Moesta, Vergara, Obrecht, Ristenpart to the middle of the 20th century, as well as the astronomical development at the Universidad Católica, are described. Besides these national activities, various international expeditions, which aimed at the observations of solar eclipses, the Venus transit of 1882, and the Mars opposition of 1907 were carried out, a six-week photometric project of Harvard Observatory in the north of Chile, and the decade-long spectroscopic Mills expedition of Lick Observatory in Santiago. Finally, a brief overview of the evolution and the actual state of the international observatories Cerro Tololo, La Silla and Paranal, as well as Las Campanas is given.

  15. Modelling the hydrologic response of a mesoscale Andean watershed to changes in land use patterns for environmental planning

    Science.gov (United States)

    Stehr, A.; Aguayo, M.; Link, O.; Parra, O.; Romero, F.; Alcayaga, H.

    2010-05-01

    A multidisciplinary approach is followed for analysis of the effect of changes in land use patterns on the hydrologic response of the Vergara watershed (4340 km2) located in central Chile. Probable future land use scenarios were generated using heuristic rules and logistic regression models, in order to identify and represent the main pressure on the watershed, namely forestation of extensive areas used for agriculture with rapid growing exotic species. The hydrologic response of the watershed was computed with a physically based distributed precipitation-runoff model, which was calibrated and validated for the current observed scenario. Results show that mean annual discharge increase with agricultural land use and diminish with forest coverage. Thus, implementation of protection laws for native species conservation and regulated land use change are strongly recommended

  16. Fixed-point Theorem and the Nishida-Nirenberg Method in Solving Certain Nonlinear Singular Partial Differential Equations

    Directory of Open Access Journals (Sweden)

    Jose Ernie C. Lope

    2013-12-01

    Full Text Available In their 2012 work, Lope, Roque, and Tahara considered singular nonlinear partial differential equations of the form tut = F(t; x; u; ux, where the function F is assumed to be continuous in t and holomorphic in the other variables. They have shown that under some growth conditions on the coefficients of the partial Taylor expansion of F as t 0, the equation has a unique solution u(t; x with the same growth order as that of F(t; x; 0; 0. Koike considered systems of partial differential equations using the Banach fixed point theorem and the iterative method of Nishida and Nirenberg. In this paper, we prove the result obtained by Lope and others using the method of Koike, thereby avoiding the repetitive step of differentiating a recursive equation with respect to x as was done by the aforementioned authors.

  17. Comparative morphology and identification key for females of nine Sarcophagidae species (Diptera with forensic importance in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Karine Pinto e Vairo

    2015-09-01

    Full Text Available ABSTRACTThe identification of female flesh flies was always considered a difficult task since morphological descriptions and keys for females are rare. Even in a forensic entomology framework, where females play a major role, female flesh flies are usually not identified. In order to fill this gap in Southern Brazil fauna we provide detailed descriptions and key for the female of nine species included in four genera: Microcerella halli (Engel, Oxysarcodexia paulistanensis (Mattos, Oxysarcodexia riograndensis (Lopes, Peckia (Euboettcheria australis (Townsend, Peckia(Euboettcheria florencioi (Prado and Fonseca, Peckia (Pattonella intermutans (Walker, Peckia(Pattonella resona (Lopes, Peckia (Sarcodexia lambens (Wiedemann, and Sarcophaga(Bercaea africa (Wiedemann. These species are distinguished mainly by genital characters as tergite 6 divided or undivided, presence of tergite 8, spermatheca morphology and vaginal plate shape.

  18. Octavio Paz

    OpenAIRE

    2015-01-01

    Note portant sur l’auteur Por razones que no escaparán al lector apenas recorra estas páginas, y también para subrayar mis deudas con nuestros clásicos, el título de este volumen de mis obras es el de una novela de Lope de Vega: El peregrino en su patria. Mi peregrinación no fue, como la del personaje de Lope, por ciudades y campos; fue un viaje mental realizado en la soledad de mi cuarto. Este libro reúne mis escritos sobre México en los dominios de la antropología y la historia, la moral y...

  19. Consciência fonológica e desempenho geral na leitura. Que relação? Estudo com alunos dos 2º e 3º anos de escolaridade

    OpenAIRE

    Figueira, Ana Paula Couceiro; universidade de coimbra; Botelho, António Roberto; Faculdade de Psicologia e de Ciências da Educação da Universidade de Coimbra (UC)

    2017-01-01

    O objetivo do presente artigo é testar a validade de conteúdo e concorrente da Prolec-R (FIGUEIRA; LOPES, n.d., versão de investigação), explorando as relações com uma prova de consciência fonológica (síntese de fonemas), da bateria SICOLE-R (FIGUEIRA; LOBO; LOPES; JIMÉNEZ, n.d., versão investigação). O referencial teórico baseia-se na avaliação dos processos cognitivos envolvidos na leitura (perspetivas de JIMENEZ; CUETOS), em que as duas baterias utilizadas assumem avaliar tais processos, s...

  20. Utilização de terapêutica e hidratação subcutânea em pacientes com doença crónica avançada

    OpenAIRE

    Esteves, Rita Mónica Barata

    2013-01-01

    Relatório de prática clínica apresentado à Escola Superior de Saúde Dr. Lopes Dias do Instituto Politécnico de Castelo Branco para cumprimento dos requisitos necessários à obtenção do grau de mestre em Cuidados Paliativos. O presente relatório surge, no âmbito do 1º Mestrado de Cuidados Paliativos da Escola Superior Saúde Dr. Lopes Dias (ESALD), do Instituto Politécnico de Castelo Branco, numa abordagem pormenorizada e reflexiva da prática clínica, norteada pela consecução de obje...

  1. Francisco Giralte y el sepulcro del obispo Gutierre de Carvajal

    Directory of Open Access Journals (Sweden)

    Vasallo Toranzo, Luis

    2013-12-01

    Full Text Available The high valuation placed on the tomb of Bishop Gutierre de Carvajal, sculpted by Francisco de Giralte, resulted in a lawsuit for which the most important artists from Toledo, Alcalá and Madrid were called to testify. Their testimonies, made during the crucial moment when Berruguete died and the court arrived at Madrid are very useful for understanding the artistic appreciation of a work. Thus, relevant artists of the period –Pompeyo Leoni, Nicolás Vergara el Viejo, Jácome Trezo or Juan Bautista de Toledo– attested to the perfect technique, the beauty of the carving, the multiplicity of personages represented next to the dead Bishop, and the wish to achieve their portrait likenesses.La alta tasación alcanzada por el sepulcro del obispo Gutierre de Carvajal, obra de Francisco Giralte, motivó un pleito al que fueron llamados los principales artistas de Toledo, Alcalá y Madrid. Sus testimonios, realizados en el crucial momento en que se produjo la muerte de Berruguete y llegó la corte a Madrid, son muy útiles para conocer la estimación artística de una obra, de la que personajes como Pompeyo Leoni, Nicolás de Vergara el Viejo, Jácome Trezo o Juan Bautista de Toledo ponderaron la perfección técnica, la belleza de su talla, la multiplicación de personajes representados junto al finado y la voluntad retratística presente en todos ellos.

  2. 20 Years of Publications on Relationship Marketing in Brazil: An Analysis of the 1992 Academic Production a 2012

    Directory of Open Access Journals (Sweden)

    Luiz Henrique Lima Faria

    2014-03-01

    Full Text Available This work, using as sample the ENANPAD`s annals and the periodics RAE and RAUSP, analyzed the academic production on relationship marketing from 1992 to 2012. For this, we used, as basis methodological, six aspects observed in the study de Almeida, Lopes and Pereira (2006, which provided comparisons of results, allowing to build an overview of 20 years of research on relationship marketing in Brazil.    

  3. Villes durables intelligentes | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    17 mars 2016 ... Elsa Estevez, Nuno Vasco Lopes et Tomasz Janowski. On prévoit que de 2014 à 2050, la population urbaine mondiale devrait croître de 63 pour cent, comparativement à une croissance de la population mondiale globale de 32 pour cent pendant la même période. Les mégapoles comptant plus de 20 ...

  4. Proceedings of the International Wire and Cable Symposium (31st) Held at Cherry Hill, New Jersey, on November 16, 17 and 18, 1982.

    Science.gov (United States)

    1982-11-01

    phenomenon is espe - knowledge of the factors that place a limit to both cially emphasized in NEXT measurements due to the the number of systems as well...resistance and expansion-contraction property. dese - The paper discusses a control cable which plays the role loped after various evaluation tests. of...dip zinc-coated strio and sheet of -ii Td~CKNOLE0GEENTSunalloyed steels, DIN 1716? (1977). The aultnors wish to thank 4.P. de Bruijin for 14. Syllabus

  5. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 264 ... I Sobrino, N Dias, I Muñoz, F Salmerón, D Varela. Vol 11, No 1 (2012), Diversity of ... C Conand, F Michonneau, G Paulay, H Bruggemann. Vol 12, No 2 (2013), Do they ... G Penha-Lopes, S Xavier, J Okondo, S Cannicci, E Fondo, S Ferreira, C Macamo, A Macia, S Mwangi, J Paula. Vol 5, No 2 (2006) ...

  6. Land of kleptocracy

    National Research Council Canada - National Science Library

    Walter D Connor

    1983-01-01

    ... frauds of our lime, as this line honk O UW [I m By / ,\\1. Sint/s /r Sr//, 316 lope, .9S LAND OF KLEPTOCRACY WALTER D, CONNOR "'[hose who are not willing lo accept corruption and who prefer lo wage an open baule with it are doomed to Lois is a center conclusion of excursion through Soviet economic life, from which one galLers that these nay-s...

  7. feasibilty of zein proteins, simple sequence repeats and phenotypic

    African Journals Online (AJOL)

    journal

    Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT). 2005. Quality protein maize: Targets poorest in Africa. URL http:/ /www. cimmyt.org Accessed 9 September,. 2010. Coleman, C.E., Clore, A.M., Ranch, .J.P.,. Higgins, R., Lopes, M.A. and Larkins, B.A.. 1997. Expression of a mutant α-zein creates the floury-2 ...

  8. Maternal and Cord Blood Plasma sEng and TGF-β1 in Patients with Hypertensive Disorders of Pregnancy: A Pilot Study in a South Indian Population.

    Science.gov (United States)

    Vinayagam, Vickneshwaran; Bobby, Zachariah; Habeebullah, Syed; Chaturvedula, Latha; Bharadwaj, Shruthi K

    2017-03-01

    Hypertensive Disorders of Pregnancy (HDP) are one of the most widespread complications of pregnancy that affects both mother and foetus. It has been observed that in Preeclampsia, the release of soluble angiogenic factors from the ischemic placenta into maternal plasma plays a crucial role in the pathogenesis. To assess the plasma Soluble Endoglin (sEng) and Transforming Growth Factor (TGF-β1) levels in various types of HDP and to correlate the levels of these markers with the pregnancy outcome. A total of 128 pregnant women were recruited and the study was carried out for a period of three years. Cord blood and maternal blood plasma levels of sEng and TGF-β1 were analysed by ELISA kits in Control Pregnant Women (CPW), Gestational Hypertension (GH), Early Onset Preeclampsia (EOPE), Late Onset Preeclampsia (LOPE), and Eclampsia (E) during third trimester. The Gestational Age (GA) at the time of delivery and Birth Weight (BW) of the baby also were also evaluated. The circulating levels of maternal and cord blood sEng were significantly higher in EOPE and E compared to CPW and GH. However, the maternal and cord blood levels of TGF-β1 were significantly lower in LOPE and E when compared to CPW and GH. The GA and BW of the baby were found to be significantly lower in EOPE and E compared to CPW, GH and LOPE. Also, a negative correlation was observed between sEng levels with pregnancy outcome; GA and BW. And also, a positive correlation was found between TGF-β1 and pregnancy outcome. A generalised angiogenic imbalance and poor birth outcomes were observed in HDP. There is a spectrum of biochemical derangements related to angiogenesis in GH, EOPE, LOPE and E.

  9. Pouteria gardneriana Radlk

    African Journals Online (AJOL)

    PRISCILA FERNANDA

    2016-12-07

    Dec 7, 2016 ... Massard CL, Fonseca AH (2004). Carrapatos e doenças transmitidas comuns ao homem e aos animais. A Hora Veterinária 23:15-23. Monteiro JR, Albuquerque UP, Araújo EL (2005).Taninos: Uma abordagem da química á ecologia. Quím. Nova. 28(5):892-896. Rocha WS, Lopes RM, Silva DB, Viera RF, ...

  10. Technologies for Developing Predictive Atomistic and Coarse-Grained Force Fields for Ionic Liquid Property Prediction

    Science.gov (United States)

    2008-07-29

    parameters for the cation of (A) were derived from the work of Canongia Lopes and Padua1 for linear phosphonium cations and applied to the cyclic...Experimental Subsection Α. Project Justification and Synthetic Target Selection: Hydrazinium Salts as Potential Energetic Material Candidate...component anion or cation. 2-Hydroxyethyl-Hydrazinium Salts : Justification for the choice of the specific cation for investigation: Salts based

  11. Pequeña biografía: Don Miguel de Cervantes

    Directory of Open Access Journals (Sweden)

    Fernando Serpa Flórez

    1963-01-01

    Full Text Available Alcalá de Henares, ciudad castellana. Su puerta amurallada trae memorias de épocas guerreras. Sus calles, de casas vetustas, con penumbrosos soportales, guardan recuerdos de caballeros y caballería. Su ilustre universidad dio luces a mil brillantes forjadores del siglo de oro español: Lope de Vega, Ignacio de Loyola, Antonio Pérez, Francisco de Quevedo y Villegas...

  12. Eugenia 'negativa', psiquiatria e catolicismo: embates em torno da esterilização eugênica no Brasil 'Negative' eugenics, psychiatry, and Catholicism: clashes over eugenic sterilization in Brazil

    Directory of Open Access Journals (Sweden)

    Robert Wegner

    2013-03-01

    Full Text Available Analisa o diálogo do eugenista Renato Kehl com um grupo de psiquiatras brasileiros que, no início da década de 1930, aproximaram-se da chamada eugenia negativa. Entusiasmados com as pesquisas e a aplicação de medidas eugênicas em países como os EUA e a Alemanha, autores como Ernani Lopes, Ignácio da Cunha Lopes, Alberto Farani e Antonio Carlos Pacheco e Silva elegeram a religião católica como empecilho para que o Brasil pudesse seguir caminho semelhante, especialmente quanto à resistência à implantação da esterilização dos ditos 'degenerados' que passara a vigorar na Alemanha em 1934. O artigo mapeia as diferentes estratégias propostas pelos autores para dialogar com a Igreja católica.The article analyzes the dialogue between eugenicist Renato Kehl and a group of Brazilian psychiatrists who turned their interest to so-called negative eugenics in the early 1930s. Enthused about research into eugenics and the application of eugenic methods in countries such as the United States and Germany, authors like Ernani Lopes, Ignácio da Cunha Lopes, Alberto Farani, and Antonio Carlos Pacheco e Silva blamed Catholicism for impeding Brazil from moving in a similar direction, especially the church's resistance to the sterilization of 'degenerates', which entered into effect in Germany in 1934. The article charts the various strategies these authors proposed for engaging in dialogue with the Catholic Church.

  13. Comparison of serum soluble edoglin (sEng) level in eary onset preeclampsia, late onset preeclampsia and normal pregnant woman

    OpenAIRE

    Akbar, Muhammad Ilham Aldika; Herdiyantini, Mita; Aditiawarman, Aditiawarman

    2017-01-01

    Objectives: This study aimed to compare the serum levels of soluble Endoglin (s-Eng) between early onset preeclampsia, late onset preeclampsia and normal pregnant women.Materials and Methods: This was an analytic observational study (Cross-Sectional) performed on 39 pregnant women with early-onset preeclampsia (EO-PE), late-onset preeclampsia (LO-PE), and normal pregnancy. The patients were consecutively chosen in Dr. Soetomo Hospital, Airlangga University Hospital and Dr. M. Soewandhi Hospit...

  14. FACES CAMP DE EVA PERÓN PARA UM BIOGRAFEMA HOMOCULTURAL

    OpenAIRE

    Mitidieri, André Luis; Universidade Estadual de Santa Cruz

    2015-01-01

    Amparados em pesquisa bibliográfica, fundamentada nos aportes teóricos de Beatriz Sarlo, Denilson Lopes, Roland Barthes e Susan Sontag, definimos o biografema homocultural camp e o relacionamos à protagonista do romance Santa Evita, de Tomás Eloy Martínez (1995), bem como a intervenções críticas do autor sobre outras representações de Eva Perón.

  15. Navigation Functions for Dynamical, Nonholonomically Constrained Mechanical Systems

    Science.gov (United States)

    2006-01-01

    26. Koditschek DE (1987) Robot Control Systems. In: Encyclopedia of Artificial Inteligence . John Wiley and Sons, Inc. 902–923 27. Bloch A...function over the configuration space. We focus our interest on “ artificial cost functions” introduced by a designer to encode some desired behavior as...global specification through the 136 Gabriel A. D. Lopes and Daniel E. Koditschek introduction of a Navigation Function (NF) [6] — an artificial

  16. Can biosimilars help achieve the goals of US health care reform?

    OpenAIRE

    Boccia R; Jacobs I; Popovian R; de Lima Lopes Jr G

    2017-01-01

    Ralph Boccia,1 Ira Jacobs,2 Robert Popovian,3 Gilberto de Lima Lopes Jr4 1Center for Cancers and Blood Disorders, Bethesda, MD, 2Global Medical Affairs, Pfizer Inc., New York, NY, 3US Government Relations, Pfizer Inc., Washington, DC, 4Sylvester Comprehensive Cancer Center, University of Miami, Miami, FL, USA Abstract: The US Patient Protection and Affordable Care Act (ACA) aims to expand health care coverage, contain costs, and improve health care quality. Accessibility and affordability of ...

  17. Mechanisms Regulating Plasma Cell Persistence in Health and Autoimmunity

    Science.gov (United States)

    2011-04-01

    periodontal disease or rheumatoid arthritis . Our findings in toto reveal a reciprocal relationship between plasma cells and their supporting stroma...dissolve continuously inflamed, pathogenic plasma cell tissue sites as is found in rheumatoid arthritis and many other plasma cell mediated diseases...cells unite in the early response against T-independent blood-borne particulate antigens. Immunity 14, 617-629 (2001). 10. Lopes-Carvalho, T., Foote , J

  18. Sobre el texto y la Autoría de la comedia «Dineros son calidad»

    Directory of Open Access Journals (Sweden)

    Alfonso D'Agostino

    2013-07-01

    Full Text Available En años recientes la comedia Dineros son calidad ha sido adjudicada a Andrés de Claramonte: la obra se lee en dos testigos antiguos: en la Parte XXIV de las comedias de Lope de Vega (Zaragoza, 1633, y en un manuscrito anónimo de la Biblioteca Nacional de Madrid. Ambos textos están plagados de lagunas y errores, pero la versión del manuscrito parece alejarse más del perfil auténtico de la comedia, constituyendo una refundición parcial donde no es imposible (aunque tampoco se puede demostrar que haya intervenido Claramonte, mientras que el texto de la Parte, estudiado en sus características textuales (léxicas, estilísticas, métricas, dramáticas permite considerar muy probable la atribución tradicional a Lope.In recent years the comedy Dineros son calidad has been attributed to Andrés de Claramonte: the play can be read in two ancient codices: in the Parte XXIV of the comedies by Lope de Vega (Zaragoza, 1633 and in an anonymous manuscript at the National Library of Madrid. Both texts are full of errors and gaps, but the version in the manuscript appears to be farther from the original form of the comedy, and constitutes a partial rewriting where it is not impossible (although it cannot be proven that Claramonte may have intervened, while the text in the Parte, studied in its textual features (lexical, stylistic, metrical, dramatic allows to consider the traditional attribution to Lope as highly likely.

  19. Hechtiella lopesi sp. n. from São Paulo state, Brazil (Siphonaptera: Rhopalopsyllidae

    Directory of Open Access Journals (Sweden)

    Lindolpho Rocha Guimaräes

    1993-12-01

    Full Text Available Descriptions are given of the male and female of Hechtiella lopesi sp. n., collected on Proechimys sp. and Tayra barbara from Boracéia Ecological Station, Salesópolis, São Paulo State, Brazil. The new species is discussed in relation to Hechtiella lakoi and Hechtiella nitidus, species previously included in the genus Polygenis. The name is a tribute to the late Brazilian entomologist, Prof. Hugo de Souza Lopes.

  20. Artful Resources: Adaptation and Reconstruction in Drama

    Directory of Open Access Journals (Sweden)

    Edward Friedman

    2017-05-01

    Full Text Available There is an obvious relation between the imitation and adaptation of literary works. The focus of the essay is the adaptation of early Spanish modern works —including Don Quijote and plays by Cervantes, Lope de Vega, and Juan Ruiz de Alarcón— and Miguel de Unamuno’s Niebla into dramatic texts in English. Adaptation becomes a method of reading, analysis, and interpretation, as well as a form of communication among authors.

  1. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Danielle Soares Morel, Eloá Moreira-Marconi, Samuel Brandão Sobrinho Neto, Laisa Liane Paineiras Domingos, Patrícia Lopes de Souza, Danúbia da Cunha de Sá Caputo, Glenda Dias Costa, Cláudia Ferreira de Figueiredo, Roberto Carlos Resende Carmo, Patrícia de Castro de Paiva, Cintia Renata Sousa Gonçalves, ...

  2. Estudio de eficacia y coste en la electroestimulación medular como tratamiento de la angina refractaria Cost-effectiveness study of medullary electrostimulation for the management of refractory angina

    OpenAIRE

    Mayo, M.; J. Pallarés; C. Villalaín; A. Moreno-Gázquez; M. A. Canos; L. Almenar

    2004-01-01

    Objetivo: Valorar la evolución de los pacientes, de nuestro hospital, diagnosticados de angina refractaria y tratada con estimulación eléctrica medular (EEM) cervical desde 1994-2002, además de valorar los costes asociados a dicho tratamiento y su relación coste/beneficio. Material y métodos: Estudio retrospectivo de 12 pacientes observando su evolución a lo largo de 8 años con controles clínicos periódicos, objetivándose tanto en la historia previa como posterior al implante, las siguientes ...

  3. Errores Congénitos del Metabolismo en edad pediátrica

    OpenAIRE

    Baña Souto, Ana María

    2013-01-01

    Los Errores Congénitos del Metabolismo son trastornos poco frecuentes de forma aislada pero en su conjunto suponen un capítulo relevante de la patología pediátrica. Los objetivos de este trabajo incluyen: • Valorar el impacto de la introducción del cribado neonatal ampliado mediante espectrometría de masas en tándem en nuestra comunidad. • Valorar la repercusión del diagnóstico y tratamiento precoz en la morbilidad y mortalidad de los pacientes con Errores Congénitos del ...

  4. Eficacia de la terapia Votja en el progreso motor de niños de riesgo biológico

    OpenAIRE

    Fernández Rego, Francisco Javier

    2015-01-01

    Objetivo Valorar la eficacia del método Vojta en el progreso motor de los niños prematuros en los primeros 18 meses de edad corregida y comparar su eficacia frente a otros métodos de Fisioterapia, así como valorar el efecto del tratamiento con Vojta en la calidad del desarrollo motor grueso. Metodología Estudio longitudinal, con dos grupos de tratamiento fisioterápico en Atención Temprana. Grupo Experimental (GE) formado por 47 niños prematuros tratados con el método Vojta y Grup...

  5. Estudio de las pruebas diagnósticas en la alergia inmediata selectiva a amoxicilina

    OpenAIRE

    Ruano Pérez, Francisco Javier

    2011-01-01

    [ES] La hipótesis de trabajo es determinar si con las pruebas diagnósticas utilizadas en la práctica clínica diaria, es posible establecer en los pacientes con reacciones de hipersensibilidad a antibióticos β-lactámicos el diagnóstico de la alergia inmediata selectiva a amoxicilina. Esta hipótesis nos lleva a plantearnos los siguientes objetivos: 1) Valorar la prevalencia de alergia inmediata selectiva a amoxicilina en los pacientes con alergia a β-lactámicos. 2) Valorar la utilidad ...

  6. Hipercalciuria idiopática asintomática. Influencia sobre la salud del hueso y criterios diagnósticos en lactantes

    OpenAIRE

    Rubio Torrents, María del Carmen

    2015-01-01

    Introducción. La hipercalciuria idiopática (HC), puede ocasionar una disminución de la densidad mineral ósea (DMO). Por otro lado, se desconoce la influencia que podría tener la alimentación (lactancia materna (LM), artificial alta en proteína (AP) y baja en proteína (BP)) sobre la calciuria durante la lactancia. Objetivos: Valorar el efecto de la HC en niños sanos asintomáticos sobre la DMO a los 7 años. Y valorar la influencia del tipo de alimentación durante la lactancia sobre la excre...

  7. Lumbàlgia crònica inespecífica. Tests físics per detectar-la. Prova pilot

    OpenAIRE

    Jubany Güell, Júlia; Vallejo Cuéllar, Lisímaco; Barbany Cairó, Joan Ramon

    2011-01-01

    Objectiu: Valorar la capacitat de detecció de la lumbàlgia crònica inespecífica que tenen els indicadors: proporcionalitat dels temps de resistència entre extensors, flexors i musculatura lateral; temps de resistència dels extensors, Sorensen test i la fatigabilitat mitjançant electromiografia (EMG) per superfície. Igualment, valorar la influència sobre aquests indicadors que tenen les variables gènere, talla i pes. Disseny: Estudi pilot amb grup de control. Mesura mitjançant tres tests i EMG...

  8. Lumbalgia crónica inespecífica. Tests físicos para detectarla. Prueba piloto

    OpenAIRE

    Júlia Jubany Güell; Lisímaco Vallejo Cuéllar; Joan Ramon Barbany Cairó

    2011-01-01

    Objetivo: Valorar la capacidad de detección de la lumbalgia crónica inespecífica que tienen los indicadores: proporcionalidad de los tiempos de resistencia entre extensores, flexores y musculatura lateral; tiempo de resistencia de los extensores, Sorensen test y la fatigabilidad mediante electromiografía (EMG) por superficie. Igualmente, valorar la influencia sobre estos indicadores que tienen las variables género, talla y peso. Diseño: Estudio piloto con grupo de control. Medición mediante t...

  9. La leflunomida, una alternativa válida para el tratamiento de la uveítis crónica anterior asociada a la Artritis Idiopática Juvenil

    OpenAIRE

    Molina Almela, Clara

    2012-01-01

    Donada la manca de consens davant el tractament de la uveítis crònica anterior (UCA) associada a la artritis idiopàtica juvenil (AIJ), aquest treball té com a objectiu valorar la possible eficàcia de la leflunomida (LFN) en aquesta malaltia. Per a això es va valorar la resposta al tractament de forma retrospectiva de 13 pacients amb UCA associada a AIJ de la cohort de 417 pacients de l'Hospital Universitari Vall d'Hebron. Els resultats obtinguts suggereixen que la LFN pot ser una alternativa ...

  10. Consumo de alimentos e ingesta de energía y nutrientes en adultos residentes en Vizcaya : condicionantes antropométricos y sociodemográficos

    OpenAIRE

    Urieta Guijarro, Inés

    2004-01-01

    Los objetivos del presente estudio eran valorar el consumo de alimentos de adultos de Vizcaya y su aproximación a las pautas recomendadas, valorar el consumo de energía y nutrientes y analizar las diferencias en función de distintos factores así como las condiciones que favorecen tener mejores hábitos alimentarios y una ingesta de energía y nutrientes más próxima a la aconsejada. El método aplicado ha sido el de registro de consumo de alimentos durante tres días, incluyendo un domingo. Para v...

  11. Evaluación del estado nutricional y del riesgo cardiovascular en adolescentes del término municipal de Moratalla (Murcia)

    OpenAIRE

    López Delgado, Juan Félix

    2016-01-01

    Los objetivos generales del presente estudio son los siguientes: a) Valorar el estado de salud a través de medidas antropométricas, clínicas y de competencia motriz de una muestra de adolescentes del término municipal de Moratalla (Murcia). b) Valorar su estado nutricional. c) Y los objetivos específicos: 1. Conocer los hábitos alimentarios del colectivo, detección de posibles hábitos inadecuados e intentar mejorarlos. 2. Detectar las carencias nutricionales, tanto de macro...

  12. Aspectos que ayudan a medir el impacto en la inversión realizada por una universidad en e-learning

    OpenAIRE

    Meza-Bolaños, Doris Verónica; Compañ, Patricia; Satorre Cuerda, Rosana

    2016-01-01

    Las universidades deben invertir grandes esfuerzos tanto económicos como organizativos en adaptar sus sistemas de información para poder dar respuesta a las necesidades del uso de plataformas elearning. Antes de que una universidad decida apostar por invertir en estos métodos, habría que hacer un estudio exhaustivo de cómo se puede valorar el impacto de esa inversión. El objetivo de la investigación es valorar diferentes metodologías de medición del impacto de e-learning para determinar un mo...

  13. Sevofluorano en la anestesia general del perro

    OpenAIRE

    Villalobos Núñez, Carmen María

    2011-01-01

    Para la realización de esta Tesis se han recogido datos de anestesias clínicas realizadas con sevofluorano, con el objeto de valorar los efectos de este agente anestésico en el sistema cardiorrespiratorio. Para ello se han recogido diversos parámetros cardiovasculares y respiratorios monitorizados durante toda la técnica anestésica, así como los tiempos de recuperación, con el objetivo de valorar la duración y calidad de la anestesia. El objetivo de esta Tesis es el estudio de validez clínica...

  14. Estudio de la neuropatía periférica mediante el test cuantitativo sensorial en pacientes con radiculopatía secundaria a hernia discal lumbar

    OpenAIRE

    García Sáiz, Irene

    2017-01-01

    La radiculopatía secundaria a hernia discal lumbar es una de las causas más prevalentes de lumbociatalgia crónica, y frecuente motivo de consulta en las Unidades de Dolor. Con frecuencia, esta entidad no es fácil de valorar, lo que puede dificultar el tratamiento. Conocer los mecanismos nociceptivos y valorar de forma objetiva el dolor neuropático secundario, es de gran importancia para optimizar el tratamiento de estos pacientes. El Test Cuantitativo Sensorial (QST) se esta...

  15. Análisis de la conversación aplicada a la enseñanza del francés lengua extranjera

    OpenAIRE

    Pombo Casal, Soraya

    2014-01-01

    El objetivo de este trabajo es analizar las estrategias que se emplean en la enseñanza de la conversación en una clase de francés lengua extranjera y valorar en qué medida el Análisis de la Conversación puede contribuir a mejorar la fluidez conversacional y valorar los progresos de la competencia comunicativa de los estudiantes. Desarrollamos un proyecto de investigación-acción a partir del diseño de actividades y de la recogida de datos en el aula siguiendo la metodología participante-observ...

  16. Análisis de la conversación aplicada a la enseñanza del francés lengua extranjera

    OpenAIRE

    Pombo Casal, Soraya

    2014-01-01

    Traballo de Fin de Máster en Lingüística Aplicada. Curso 2013-2014 El objetivo de este trabajo es analizar las estrategias que se emplean en la enseñanza de la conversación en una clase de francés lengua extranjera y valorar en qué medida el Análisis de la Conversación puede contribuir a mejorar la fluidez conversacional y valorar los progresos de la competencia comunicativa de los estudiantes. Desarrollamos un proyecto de investigación-acción a partir del diseño de actividades y de la rec...

  17. Incapacidad vocal en docentes de la provincia de Huelva Voice handicap in Huelva's teachers

    OpenAIRE

    Francisco Javier Barbero-Díaz; Carlos Ruiz-Frutos; Amaranto del Barrio Mendoza; Eladia Bejarano Domínguez; Antonio Alarcón Gey

    2010-01-01

    Introducción: La prevalencia de trastornos de la voz en docentes en nuestro entorno se sitúa entre el 34% y 57%. Desde el año 2006 la patología por nódulos de las cuerdas vocales se considera enfermedad profesional. El Índice de Incapacidad Vocal es una herramienta validada para valorar el menoscabo asociado a la disfonía que percibe la persona. Objetivos: Valorar el impacto de la disfonía y las posibles diferencias en la incapacidad vocal entre factores relacionados con la disfonía. Material...

  18. Sarchophagid flies (Insecta, Diptera from pig carcasses in Minas Gerais, Brazil, with nine new records from the Cerrado, a threatened Neotropical biome

    Directory of Open Access Journals (Sweden)

    Cátia A. Mello-Patiu

    2014-06-01

    Full Text Available Sarchophagid flies (Insecta, Diptera from pig carcasses in Minas Gerais, Brazil, with nine new records from the Cerrado, a threatened Neotropical biome. The diversity of the Sarcophagidae fauna of the Cerrado biome, also know as the Brazilian Savanna, is still underestimated. In this research we collected flies in the state of Minas Gerais, Brazil, during a Forensic Entomology experiment. Samples were collected throughout the decomposition process of domestic pig (Sus scrofa Linnaeus carcasses, and the experiments were conducted in areas of pasture and semideciduous forest. A total of 85,694 adult flesh flies belonging to 57 species were collected from all carcasses. New records for nine species of Sarcophaginae are provided, including the first record of Blaesoxipha (Acridiophaga caridei (Brèthes, 1906 to Brazil, and new occurrences of the following species for the Cerrado and/or for the state of Minas Gerais: Blaesoxipha (Acanthodotheca acridiophagoides (Lopes & Downs, 1951, Malacophagomyia filamenta (Dodge, 1964, Nephochaetopteryx orbitalis (Curran & Walley, 1934, Nephochaetopteryx cyaneiventris Lopes, 1936, Nephochaetopteryx pallidiventris Townsend, 1934, Oxysarcodexia occulta Lopes, 1946, Ravinia effrenata (Walker, 1861 and Sarcophaga (Neobellieria polistensis (Hall, 1933.

  19. Elastic properties of ascending aorta in women with previous pregnancy complicated by early- or late-onset pre-eclampsia.

    Science.gov (United States)

    Orabona, R; Sciatti, E; Vizzardi, E; Bonadei, I; Valcamonico, A; Metra, M; Frusca, T

    2016-03-01

    To evaluate the elastic properties of the ascending aorta in women with a previous pregnancy complicated by early-onset (EO) or late-onset (LO) pre-eclampsia (PE) and the correlation with gestational age (GA), systolic/diastolic blood pressure (SBP/DBP) and mean uterine artery pulsatility index (UtA-PI) at diagnosis of the disease as well as with birth weight of the neonate. Thirty women who had a previous pregnancy complicated by EO-PE, 30 with a previous pregnancy complicated by LO-PE and 30 normal controls were selected retrospectively from our electronic database and then recalled for assessment from 6 months to 4 years after delivery. Data regarding GA, SBP/DBP and mean UtA-PI at the diagnosis of PE were obtained from medical records. At our assessment, aortic M-mode and tissue Doppler imaging (TDI) parameters were measured. Aortic diameters were assessed at end-diastole at four levels: Valsalva sinuses, sinotubular junction, tubular tract and aortic arch. Aortic compliance, distensibility, stiffness index (SI), Peterson's elastic modulus (EM), pulse-wave velocity and M-mode strain were calculated using standard formulae. Aortic expansion velocity, early and late diastolic retraction velocities and peak systolic tissue strain (TDI-ϵ) were determined. Aortic diameters at the four levels were significantly greater in both EO-PE and LO-PE groups than in controls. Aortic compliance and distensibility and TDI-ϵ were lower in EO-PE than in LO-PE (P  = 0.001, P  = 0.002 and P  = 0.011, respectively) and controls (P  = 0.037, P  = 0.044 and P  = 0.013, respectively). SI and EM were higher in EO-PE than in LO-PE (P  = 0.001 and P  pregnancy complicated by EO-PE, but not in those with LO-PE. Copyright © 2015 ISUOG. Published by John Wiley & Sons Ltd. Copyright © 2015 ISUOG. Published by John Wiley & Sons Ltd.

  20. LA MEDICINA EN LA LITERATURA ESPAÑOLA DEL SIGLO DE ORO

    Directory of Open Access Journals (Sweden)

    Agustín Albarracín

    1985-08-01

    Full Text Available

    (Conferencia en un prólogo, tres actos y un epílogo.

    PROLOGO

    El título de la conferencia que se me ha asignado, reza así: La medicina en la literatura española del Siglo de Oro. Ambicioso y desmesurado proyecto, que desde este instante debo limitar, justificando ante vosotros mi decisión de restringirlo intencionadamente a la figura y obra teatral de Lope de Vega. Y lo hago así, por múltiples razones. En primer término, porque la copia de autores y géneros literarios que el Seiscientos abarca, precisaría para su consideración un tiempo y un espacio que exceden con mucho mis posibilidades. De otra, y sobre todo, porque pienso que Lope de Vega constituye el sumo paradigma de lo que aquella literatura representa: la expresión verbal y escrita del alma popular , el venero donde calmar la sed intensa de acción propia de aquel pueblo y la gubia y el escoplo capaces de plasmar en fábula dramática sus sentimientos e ideas, su visión del mundo y de la vida, dándoles sentido nacional al identificarse con ellas. Ha escrito muy finamente Ruiz Ramón que lo decisivo del triunfo de Lope como dramaturgo, "estriba en su concepto del teatro, al que va indisolublemente adscrita su visión - ¡,Pura intuición? - de la finalidad del teatro como arte para el pueblo. Lope tuvo que darse cuenta de que el público era el pueblo o, invirtiendo el orden de las palabras, de que el pueblo era el único público auténtico.

    Nobles y villanos, hombres y mujeres, cultos e incultos coincidían en sentir y en pensar la vida como española. Ese modo o estilo de vivir y desvivir la existencia empieza Lope por captarlo en sí mismo, en su propia sensibilidad. Lope de Vega, en el centro mismo del vivir de su tiempo, testigo de excepción de los afanes -voliciones y 'noliciones' - de su época, y, actos, también de excepción, de unos ideales y unas creencias, se convierte en intérprete de la colectividad por el simple

  1. 67. Rotura crónica contenida de aneurisma de aorta abdominal: Un diagnóstico infrecuente

    Directory of Open Access Journals (Sweden)

    M.T. González López

    2012-04-01

    Conclusión: La detección de una rotura crónica contenida de AAA obliga a un tratamiento urgente-preferente, ya que supone un riesgo vital evidente, permitiendo en estos casos, dada la estabilidad del paciente, planear la estrategia quirúrgica y valorar un tratamiento endovascular frente al quirúrgico.

  2. Aplicación de la ortopantomografía al estudio de la simetría del desarrollo mandibular en niños con mordida cruzada unilateral

    OpenAIRE

    Diéguez Pérez, Montserrat

    2012-01-01

    El objetivo de este estudio es el análisis de las radiografías panorámicas de una muestra de niño/as con mordida cruzada unilateral, para valorar las posibles alteraciones del desarrollo mandibular que puede ocasionar la maloclusión.

  3. Función renal, estado de volemia y furosemida en diálisis peritoneal

    National Research Council Canada - National Science Library

    Francisco Cirera Segura; Jesús Lucas Martín Espejo; Antonia Concepción Gómez Castilla; María Ángeles Ojeda Guerrero

    2013-01-01

    ... en diálisis peritoneal y su evolución en función al uso de furosemida. El objetivo secundario fue valorar si la furosemida puede mejorar el estado de volumen. Material y métodos: Se realizó...

  4. Valoración no invasiva de la sobrecarga hepática de hierro en pacientes con hemocromatosis

    Directory of Open Access Journals (Sweden)

    J.C. Spina

    2014-01-01

    La RM es fundamental en el diagnóstico de la hemocromatosis, especialmente en la fase subclínica. Contribuye a definir la severidad de la sobrecarga de hierro hepático y a valorar la respuesta al tratamiento, evitando procedimientos invasivos.

  5. Prevalencia de hiponatremia en pacientes mayores de 65 años que sufren una caída intrahospitalaria

    Directory of Open Access Journals (Sweden)

    Carmen Lobo-Rodríguez

    2016-05-01

    Conclusiones: Dado que la hiponatremia puede considerarse un factor de riesgo de caídas, sería importante valorar la inclusión de la determinación de sodio sérico dentro de las estrategias de prevención de caídas en ancianos.

  6. Indoor airborne microbial load in a Spanish University (University of Murcia, Spain).

    OpenAIRE

    Soto Pino, Teresa; García Murcia, Rosa M.; Franco Sánchez, Alejandro; Vicente Soler, Jerónima; Cansado Vizoso, José; Gacto Fernández, Mariano José

    2009-01-01

    Se realiza un análisis microbiológico del aire mediante muestras recogidas por un método de impacto, analizando variables (bacterias y hongos) en presencia o ausencia de personal para valorar la contaminación que produce la actividad humana.

  7. Hacia una educación infantil de calidad

    Directory of Open Access Journals (Sweden)

    Ana Lupita Chaves Salas

    2004-01-01

    Full Text Available El artículo analiza las funciones que cumple la educación infantil dentro de la sociedad y da a conocer algunos criterios de calidad para valorar los programas dirigidos a la educación del niño y la niña menor de seis años

  8. Diferencias de género en pacientes con obesidad mórbida tributarios de cirugía bariátrica

    OpenAIRE

    Camacho-Laraña, Manuel; Alcalá-Pérez, Visitación; Nieves-Alcalá, Sonia

    2015-01-01

    El objetivo de este estudio fue valorar las diferencias por género de los pacientes con obesidad mórbida, candidatos a cirugía bariátrica. La muestra se compone de 441 pacientes evaluados mediante entrevista clínica, el Examen Internacional de los

  9. Una fecha de C-14 para los campos de urnas de la meseta Oriental

    Directory of Open Access Journals (Sweden)

    María Luisa CERDEÑO

    2009-10-01

    Full Text Available En esta breve comunicación queremos valorar las posibilidades de aceptación que puede ofrecer la fecha de C-14 de 950 a.C. obtenida en el nivel inferior del yacimiento de La Coronilla (Molina de Aragón, Guadalajara, correspondiente a un asentamiento de Campos de Urnas de la zona1.

  10. Programa de intervención dietético-nutricional para la promoción de la salud en el lugar de trabajo en una empresa de la ciudad de Huesca, España

    National Research Council Canada - National Science Library

    Munar-Gelabert, Marta; Puzo-Foncillas, José; Sanclemente, Teresa

    .... El objetivo de este trabajo fue llevar a cabo una intervención dietético-nutricional en una empresa con 35 trabajadores de Huesca, con comedor propio, y valorar la eficacia de la misma.Material y Métodos: Tras la valoración...

  11. Estudio piloto sobre una tarea para medir la creatividad musical

    National Research Council Canada - National Science Library

    Javier Valverde; Mercedes Ferrando; Marta Sáinz; Gloria Soto; Lola Prieto

    2015-01-01

    La creatividad es un fenómeno complejo que se expresa en los distintos ámbitos de la actuación humana. Un importante impedimento a la hora de valorar la creatividad musical es la experiencia con la que cuenta el alumno...

  12. Dureza complexométrica del agua. Ejercicio 3.

    OpenAIRE

    Milla González, Miguel

    2013-01-01

    Ejercicio sencillo de aplicación del análisis complexométrico de la dureza del agua. En este ejercicio se determina el volumen de valorante AEDT necesario para valorar un volumen determinado de disolución de Mg(II). Los datos son aleatorios.

  13. 167. Estenosis mitral funcional y recurrencia de insuficiencia tras anuloplastia en la insuficiencia mitral isquémica crónica

    Directory of Open Access Journals (Sweden)

    C.E. Martín López

    2010-01-01

    Conclusiones: La anuloplastia mitral aporta una corrección efectiva y durable de la insuficiencia mitral isquémica crónica. Esta técnica puede inducir estenosis mitral funcional durante el ejercicio, debiéndose valorar, a largo plazo, un posible impacto adverso en la clase funcional y supervivencia.

  14. Vulnerabilidad cognitiva en trastornos mentales

    National Research Council Canada - National Science Library

    Londoño-Arredondo, Nora H

    2011-01-01

    ... y valorar el mundo. En numerosos trastornos mentales se ha manifestado la existencia de dicha vulnerabilidad. En la depresion se han relacionado los pensamientos autorreferidos negativos absolutos y generalizados sobre uno mismo, el mundo y el futuro, con los episodios depresivos; se considera que las personas son vulnerables a este trastorno cu...

  15. Factores psicológicos del adolescente y su incidencia en el abandono escolar

    OpenAIRE

    Barbero Zurita, Nuria

    2016-01-01

    El objetivo de mi estudio es valorar la persistencia de los factores determinantes del riesgo de abandono escolar centrándonos en los factores psicológicos de riesgo y su relación con los factores socioeconómicos, absentismo y rendimiento académico e

  16. The Susceptibility and Behavioral Response of Anopheles Albimanus Weidemann and Anopheles Vestitipennis Dyar and Knab (Diptera: Culicidae) to Insecticides in Northern Belize, Central America

    Science.gov (United States)

    1999-01-01

    Columbian Mayan culture that emerged in the lowland areas of the Yucatan Peninsula from 4500 to 1050 BP (before present) (Merrill, 1993; Thompson, 1972...1976. Criterio epidemiologico para valorar las proebas de susceptibilidad de Anopheles a insecticidas y la importancia del fenomeno de la excitation que

  17. The wavefront of the radio signal emitted by cosmic ray air showers

    Energy Technology Data Exchange (ETDEWEB)

    Apel, W.D.; Bekk, K.; Blümer, J.; Bozdog, H.; Daumiller, K.; Doll, P.; Engel, R. [Institut für Kernphysik, Karlsruhe Institute of Technology (KIT), Hermann-von-Helmholtz-Platz 1, 76344 Eggenstein-Leopoldshafen (Germany); Arteaga-Velázquez, J.C. [Instituto de Física y Matemáticas, Universidad Michoacana, Edificio C-3, Cd. Universitaria, C.P. 58040 Morelia, Michoacán (Mexico); Bähren, L.; Falcke, H. [ASTRON, Oude Hoogeveensedijk 4, 7991 PD Dwingeloo (Netherlands); Bertaina, M.; Cantoni, E.; Chiavassa, A.; Pierro, F. Di [Dipartimento di Fisica, Università degli Studi di Torino, Via Giuria 1, 10125 Torino (Italy); Biermann, P.L. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, 53121 Bonn (Germany); Brancus, I.M. [National Institute of Physics and Nuclear Engineering, Str. Reactorului no. 30, P.O. Box MG-6, Bucharest-Magurele (Romania); De Souza, V. [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador São-Carlense 400, Pq. Arnold Schmidt, São Carlos (Brazil); Fuchs, B. [Institut für Experimentelle Kernphysik, Karlsruhe Institute of Technology (KIT), Hermann-von-Helmholtz-Platz 1, 76344 Eggenstein-Leopoldshafen (Germany); Gemmeke, H. [Institut für Prozessdatenverarbeitung und Elektronik, Karlsruhe Institute of Technology (KIT), Hermann-von-Helmholtz-Platz 1, 76344 Eggenstein-Leopoldshafen (Germany); Grupen, C., E-mail: frank.schroeder@kit.edu [Faculty of Natural Sciences and Engineering, Universität Siegen, Walter-Flex-Straße 3, 57072 Siegen (Germany); and others

    2014-09-01

    Analyzing measurements of the LOPES antenna array together with corresponding CoREAS simulations for more than 300 measured events with energy above 10{sup 17} eV and zenith angles smaller than 45{sup o}, we find that the radio wavefront of cosmic-ray air showers is of approximately hyperbolic shape. The simulations predict a slightly steeper wavefront towards East than towards West, but this asymmetry is negligible against the measurement uncertainties of LOPES. At axis distances ∼> 50 m, the wavefront can be approximated by a simple cone. According to the simulations, the cone angle is clearly correlated with the shower maximum. Thus, we confirm earlier predictions that arrival time measurements can be used to study the longitudinal shower development, but now using a realistic wavefront. Moreover, we show that the hyperbolic wavefront is compatible with our measurement, and we present several experimental indications that the cone angle is indeed sensitive to the shower development. Consequently, the wavefront can be used to statistically study the primary composition of ultra-high energy cosmic rays. At LOPES, the experimentally achieved precision for the shower maximum is limited by measurement uncertainties to approximately 140 g/c {sup 2}. But the simulations indicate that under better conditions this method might yield an accuracy for the atmospheric depth of the shower maximum, X{sub max}, better than 30 g/c {sup 2}. This would be competitive with the established air-fluorescence and air-Cherenkov techniques, where the radio technique offers the advantage of a significantly higher duty-cycle. Finally, the hyperbolic wavefront can be used to reconstruct the shower geometry more accurately, which potentially allows a better reconstruction of all other shower parameters, too.

  18. From self-identity to universality: a reading of Henri Lopes’ works

    Directory of Open Access Journals (Sweden)

    P.K. Mwepu

    2007-07-01

    Full Text Available Born in Kinshasa, Democratic Republic of Congo, yet a citizen of Congo-Brazzaville, Henri Lopes is one of those African writers who were not only educated in Europe (France but also lived there while writing a certain portion of their literary work. Being an influential political figure in his country, the author expresses his vision of an independent Africa through his literary works such as “Tribaliques” 1 (1971, “La nouvelle romance” (1976, “Sans tam-tam” (1977 and “Le pleurer-rire” (1982. However, from 1990, Lopes distances his writings from general political issues. In “Le chercheur d’Afriques” (1990 and “Le lys et le flamboyant” (1997, he veers into a new ideological direction, predominantly embedded in issues pertaining to existence: the quest for identity and issues related to hybridisation are recurrent themes and objects of scrutiny. It is clear that this biological approach serves as a pretext for the author to perform an in-depth interrogation of the complex issues of the universal in the context of a modern and globalising world. In his works, human blood and race represent an important aspect of culture; the blending of different cultures is an essential element for the construction of society. A community founded on cultural diversity is thus depicted as dynamic, strong and sustainable. One wonders whether the author is not describing his own life experiences through fiction. This might indeed be the case, considering that Lopes himself is a person of mixed origins, herein referred to as a “métis”. However, the experience described by the author, who lives in France, transcends race; it addresses the modern debate on the issue of cultural hybridisation.

  19. Una conversación trasatlántica: Benito Pérez Galdós y Domingo A. Galdós en La estrella de Panamá (1889-1901

    Directory of Open Access Journals (Sweden)

    De Armas, Frederick

    2015-12-01

    Full Text Available During the last two decades of the nineteenth century, two figures of Cuban origin help to transform La estrella de Panamá, a small newspaper from the hard to reach Isthmus. José Gabriel Duque with the editorial collaboration of Domingo A. Galdós, the son of Benito Pérez Galdós’ first cousin, will include new cultural material to the paper. This article studies Benito’s presence in this newspaper starting in 1889 which begins a transatlantic dialogue with his American relative and with the readers of the paper. Several phases of this connection are discussed as well as works such as Venecia, Vergara, Los condenados and Electra. The essay concludes with 1901 when Domingo Galdós leaves the newspaper to return to Cuba after the war of independence, having fulfilled the tasks imposed on him by José Martí.Durante las últimas dos décadas del siglo diecinueve, dos figuras procedentes de Cuba transforman La estrella de Panamá, un pequeño periódico del lejano Istmo. José Gabriel Duque con la colaboración editorial de Domingo A. Galdós, hijo de un primo hermano de Benito Pérez Galdós, irá añadiendo elementos culturales al periódico. Este ensayo estudia la presencia de don Benito en este periódico, que comienza en 1889 cuando entabla un diálogo trasatlántico con su pariente americano y los lectores del periódico. Se apuntan varias facetas de este diálogo y se estudia la presencia de obras tales como Venecia, Vergara, Los condenados y Electra. Este análisis abarca hasta 1901 cuando Domingo Galdós deja el periódico para regresar a Cuba después de la guerra y habiendo cumplido los dictados de José Martí.

  20. A Revolução Mexicana nas gravuras do Museu de Arte de Santa Catarina: entre aparição e nostalgia (Axe VI, Symposium 23)

    OpenAIRE

    Pereira, Lucésia

    2010-01-01

    Pesquisa desenvolvida na Universidade Federal de Santa Catarina com recursos do CNPq.; The present article has the purpose to study a set of engravings donated in 1961 by the mexican president Adolfo Lopes Mateus to the then called Museu de Arte Moderna de Florianópolis. We have known by its authorship that part of the images of this set of engravings belongs to an specific history of engraving in Mexico, very representative of the production of TGP – Taller de Grafica Popular (Atelier of Pop...

  1. The same Independence: the public performance of a unitarian partisan (Pernambuco, 1822-1823

    Directory of Open Access Journals (Sweden)

    Ariel Feldman

    2014-01-01

    Full Text Available This article analyzes the public performance of the monk Miguel do Sacramento Lopes Gama in the periodic press between 1822 and 1823. The compositions of monk Miguel intended to construct the ideology that - since the unity of the Portuguese-Brazilian kingdom was broken - the sovereignty needed to pass to a new political unit, Brazil. Known in the Northern provinces as Rio de Janeiro's Project, this ideology was the basis of a conception of nation, foreseeing very reduced provincial powers if compared to the previous period - the legality of the "vintista" constitutionalism.

  2. Relação entre os estágios do ciclo de vida empresarial na qualidade da informação contábil divulgada nas empresas brasileiras.

    OpenAIRE

    COSTA, W. B.

    2015-01-01

    Resumo da Dissertação: Esta dissertação busca identificar se os diferentes Estágios de Ciclo de Vida (ECVs) afetam a qualidade da informação contábil nas empresas brasileiras. Segundo pesquisas internacionais, os diferentes ECVs influenciam a qualidade da informação contábil. Aqui, foram empregadas as métricas de relevância, tempestividade e conservadorismo, de maneira semelhante às utilizadas por Lopes (2009) para verificar a qualidade da informação contábil. Para identificar os Estágios de ...

  3. Ciclo de vida para el aprendizaje por compartición de conocimientos entre sistemas inteligentes autónomos

    OpenAIRE

    Ierache, Jorge Salvador; García Martínez, Ramón

    2008-01-01

    En este artículo se describe el trabajo de investigación que en la actualidad se está desarrollando dentro del área de “Sistemas Inteligentes Autónomos”. El objetivo principal de este trabajo es la continuación y profundización de la arquitectura LOPE (Learning by Observation in Planning Environments) con la incorporación de un ciclo de vida de aprendizaje compuesto de distintos layers que acompañan el aprendizaje del agente desde las teorías del creador, las teorías que se generan como produ...

  4. Sustained effect of resistance training on blood pressure and hand grip strength following a detraining period in elderly hypertensive women: a pilot study

    OpenAIRE

    Nascimento, Dahan da Cunha; Tibana, Ramires Alsamir; Benik, Franklin M; Fontana, Keila Elizabeth; Neto, Frederico Ribeiro; de Santana, Frederico Santos; Santos-Neto, Leopoldo; Silva, Renato André Sousa; Silva, Alessandro Oliveira; Farias, Darlan Lopes; Balsamo, Sandor; Prestes, Jonato

    2014-01-01

    Dahan da Cunha Nascimento,1,5,8 Ramires Alsamir Tibana,1,8 Franklin M Benik,2 Keila Elizabeth Fontana,3 Frederico Ribeiro Neto,8 Frederico Santos de Santana,5,8 Leopoldo Santos-Neto,4 Renato André Sousa Silva,1,5,6 Alessandro Oliveira Silva,1,7 Darlan Lopes Farias,1,7 Sandor Balsamo,4,5,8 Jonato Prestes1 1Postgraduate Program in Physical Education, Catholic University of Brasilia, Brasilia, Brazil; 2Department of Kinesiology and Sports Studies Graduate Program, Eastern Illinois Uni...

  5. Development, characterization, and skin delivery studies of related ultradeformable vesicles: transfersomes, ethosomes, and transethosomes

    OpenAIRE

    Ascenso, Andreia; Raposo, Sara; Batista, Cátia; Cardoso, Pedro; Mendes, Tiago; Praça, Fabíola Garcia; Bentley, Maria Vitória Lopes Badra; Simões, Sandra

    2015-01-01

    Andreia Ascenso,1 Sara Raposo,1 Cátia Batista,2 Pedro Cardoso,2 Tiago Mendes,2 Fabíola Garcia Praça,3 Maria Vitória Lopes Badra Bentley,3 Sandra Simões1 1Instituto de Investigação do Medicamento (iMed.ULisboa), 2Faculdade de Farmácia, Universidade de Lisboa, Lisboa, Portugal; 3Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Monte ...

  6. A VISÃO DA EQUIPE DE ENFERMAGEM SOBRE SEUS REGISTROS

    OpenAIRE

    Lorena Mara Nóbrega de Azevêdo; Aline Galúcio de Oliveira; Fernanda Aparecida Soares Malveira; Cecília Nogueira Valença; Edilma de Oliveira Costa; Raimunda Medeiros Germano

    2012-01-01

    El objetivo fue conocer la percepción de enfermeros acerca de sus registros y cómo están hechos. Estudio descriptivo, exploratorio, cualitativo, realizado en el Hospital Universitario Onofre Lopes en Natal/RN, Brasil, con 15 profesionales de equipo de enfermería. La recolección de datos ocurrió con entrevistas semiestructuradas sometidas a análisis de contenido temática. Los profesionales perciben sus registros como herramienta indispensable al servicio, cuyas funciones abarcan la comunicació...

  7. How do Category Managers Manage?

    DEFF Research Database (Denmark)

    Hald, Kim Sundtoft; Sigurbjornsson, Tomas

    2013-01-01

    The aim of this research is to explore the managerial role of category managers in purchasing. A network management perspective is adopted. A case based research methodology is applied, and three category managers managing a diverse set of component and service categories in a global production...... firm is observed while providing accounts of their progress and results in meetings. We conclude that the network management classification scheme originally deve loped by Harland and Knight (2001) and Knight and Harland (2005) is a valuable and fertile theoretical framework for the analysis...... of the role of the category manager in purchasing....

  8. Uncertainty Analysis of Consequence Management (CM) Data Products.

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, Brian D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Eckert-Gallup, Aubrey Celia [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Cochran, Lainy Dromgoole [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Kraus, Terrence D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Fournier, Sean Donovan [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Allen, Mark B. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Schetnan, Richard Reed [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Simpson, Matthew D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Okada, Colin E. [Remote Sensing Lab. (RSL), Nellis AFB, Las Vegas, NV (United States); Bingham, Avery A. [Remote Sensing Lab. (RSL), Nellis AFB, Las Vegas, NV (United States)

    2018-01-01

    The goal of this project is to develop and execute methods for characterizing uncertainty in data products that are deve loped and distributed by the DOE Consequence Management (CM) Program. A global approach to this problem is necessary because multiple sources of error and uncertainty from across the CM skill sets contribute to the ultimate p roduction of CM data products. This report presents the methods used to develop a probabilistic framework to characterize this uncertainty and provides results for an uncertainty analysis for a study scenario analyzed using this framework.

  9. CLARICE LISPECTOR: “DEVANEIO E EMBRIAGUEZ DUMA RAPARIGA”

    Directory of Open Access Journals (Sweden)

    Rafael Pacheco Lanes Ribeiro (UFJF

    2015-03-01

    Full Text Available

    Este artigo propõe-se a examinar o conto “Devaneio e embriaguez duma rapariga”, de Clarice Lispector, que integra a obra Laços de família, publicada nos anos 60, antes do auge dos movimentos feministas. Será realizada uma análise da personagem feminina sob o prisma de um referencial teórico voltado para questões de gênero, assim, este trabalho dialogou com as considerações de Constância Lima Duarte (2003, Guacira Lopes Louro (1997 e Simone Beauvoir (1980.

  10. Towards a Net Zero Building Cluster Energy Systems Analysis for a Brigade Combat Team Complex

    Science.gov (United States)

    2010-05-01

    building enve- lope, ventilation, advanced “low exergy ” heating and cooling systems, central energy plants with co- This material is declared a work of the...from the mains increases from centralized to decentralized by 21% or 4.3 GWh/yr. The fact that heat is a local commodity with a lower exergy factor...and electricity is a non-local commod- ity with an exergy factor of 1 that cannot be stored easily like heat, indicates that this is a good path to

  11. I Festival Internacional do Dia do Refugiado

    OpenAIRE

    Lomeu, Rafael

    2016-01-01

    ‘’Me chamam de clandestino, sem papel, imigrante, refugiado, sem destino Nunca pelo meu nome’’ Ruivo Lopes Este relato etnográfico faz parte de um esforço coletivo dos alunos da disciplina “Etnografias Urbanas: fronteiras, economias e afeto” que, enquanto a Universidade de São Paulo encontrava-se em greve, foram para as ruas e colheram impressões sobre o cenário político brasileiro atual em diferentes espaços urbanos. Desta forma, articulamos o conhecimento construído em sala de aula, a parti...

  12. The Epistle of Amarilis to Belardo, a Missive from Mestizo Peru to Spain

    Directory of Open Access Journals (Sweden)

    Jordi Aladro Font

    2015-05-01

    Full Text Available This article is a new interpretation of the Epistle of Amarilis to Belardo. Using a close reading of text and a detailed analysis of the text’s sources, we discover that it is more than just a complaint from one of Lope’s female admirers, finding that the letter by Amarilis, in the tradition of El Inca Garcilaso, is the Peruvian mestizo’s cry (Amarilis for «another» homeland ­—«Spain», as symbolized by Lope.

  13. SO I FELT BUTTERFLIES IN MY STOMACH: ON STAGE, THE HEAD OF THE ENGLISH DEPARTMENT: A STUDY ABOUT IDENTITY AND EVALUATION

    OpenAIRE

    CÉLIA ELISA ALVES DE MAGALHÃES

    2013-01-01

    Este estudo investiga a construção identitária do professor coordenador de inglês, com enfoque na avaliação. O arcabouço teórico fundamenta-se no conceito de identidade pelo viés de teorias do socioconstrucionismo (Bhabha, 1994; Bucholtz e Hall, 2003, 2005; Moita Lopes, 2002, 2003) e da Sociologia (Bauman, 2005; Giddens, 1999; Hall, 1992), concebendo a construção de identidades como um processo desenvolvido discursivamente na interação. As interações são analisadas a partir das noções de enqu...

  14. [Elena de Cespedes: The eventful life of a XVI century surgeon].

    Science.gov (United States)

    Carrillo Esper, Raúl; Carrillo Córdova, Jorge Raúl; Carrillo Córdova, Luis Daniel; Carrillo Córdova, Dulce María; Carrillo Córdova, Carlos Alberto

    2015-01-01

    Throughout the history of surgery there have been exceptional cases of surgeons around the world. One of them is Elena/o of Cespedes. Born as a girl, this hermaphrodite dedicated all his life to acting as a man, doing jobs that were only for men such as a soldier, peasant, and surgeon. She was the first licensed surgeon in Spain and maybe in all Europe. She married a woman and then was tried for sodomy by the Spanish Inquisition commanded by inquisitor Lope de Mendoza. She was founded guilty and punished with 200 lashes and a 10-year service at a hospital, dressed as a woman.

  15. Burnout e engagement nos médicos dos Hospitais do grande Porto

    OpenAIRE

    Campos, Gisela Ferraz Santos

    2013-01-01

    Dissertação apresentada ao Instituto Politécnico do Porto para obtenção do Grau de Mestre em Gestão das Organizações, Ramo de Gestão de Empresas Orientada por: Prof. Doutor Eduardo Manuel Lopes de Sá e Silva Coorientada por: Mestre Adalmiro Álvaro Malheiro de Castro Andrade Pereira Esta dissertação inclui as críticas e sugestões feitas pelo júri. O burnout é considerado como uma das possíveis consequências do stress profissional, que assinala a dificuldade do indivíduo em...

  16. Parámetros radiológicos de la semilla de 125i modelo 6711 en función del radio del cilindro de plata.

    OpenAIRE

    Rodriguez, César Farid; Chica, Luis G.; Nerio, Ubaldo R.

    2004-01-01

    Se analizan las siguientes distribuciones de tasa de dosis, D'(r,θ), determinadas mediante el código Penélope para la semilla de 125I modelo 6711: La calculada por Nerio et.al. [17] para la semilla con radio del cilindro de plata, Rcp, estándar y la determinada aquí para la misma semilla con Rcp 0.10 mm. A estas tasas de dosis se les aplica en coordenadas cilíndricas el formalismo TG-43 de la AAPM [5], para expresar matemáticamente la tasa de dosis alrededor de una semilla de 125I. Se les det...

  17. Em busca de novos papeis : imagens da mulher leitora no Brasil (1890-1920)

    OpenAIRE

    Barbara Heller

    1997-01-01

    Resumo: Mulheres leitoras, dos mais diversos matizes -- brancas, mulatas, ricas e instruídas, pobres e ignorantes fazem parte do universo de vários romances escritos entre o final do século XIX e as primeiras décadas do século XX, como se pode observar nas obras de França Júnior, Coelho Neto, Machado de Assis, Valentim Magalhães, Lima Barreto, Júlia Lopes de Almeida, Adolfo Caminha e Rachei de Queirós. Embora ficcionais, essas leitoras parecem sugerir a lenta e tortuosa trajetória das brasile...

  18. Media Subjects on Body Image in the Teenagers´s Point of View: A Teaching Proposal of Critical Reading (ESP

    Directory of Open Access Journals (Sweden)

    Aline Provedel Dib

    2011-07-01

    Full Text Available This article analyzes an activity included in a group of pedagogical practices that aimed at the discussion about the construction of standardized concepts concerning beauty by the media. The interactions took place in an English classroom during the third quarter of 2007, in a senior high class of the Nursery course of a federal institution. We will present the students’ answers to a questionnaire developed by a web site called MEDIA AWARENESS NETWORK when analyzing the data. The theoretical approach includes the voices of Bakhtin (2003 and Vygotsky (1973, 1998, 2001 and as research methodology we will follow the ethnographical method (Erickson, 1984, Moita Lopes, 1996.

  19. Representações de luto e lamentação em fontes medievais peninsulares da Idade Média e início da Idade Moderna

    Directory of Open Access Journals (Sweden)

    Marta Miriam Ramos Dias

    2016-09-01

    Full Text Available This study intends to highlight  the depictions of mourning in written and iconographic sources from the late period of the Middle Ages. In the first part of this article, excerpts belonging to the synods, to the chronicles of Fernão Lopes and to the Siete Partidas of Alfonso X were analyzed regarding the ecclesiastical requirements and popular customs. In the second part, the tomb of Gomes Martins Silvestre and the painted planks from the tomb of Sancho Sáiz de Carrillo were also submitted to analysis.

  20. Esta é minha carta ao mundo

    Directory of Open Access Journals (Sweden)

    Fernanda Mourão

    2009-01-01

    Full Text Available A partir da primeira carta de Emily Dickinson (1830-1886 a Thomas Higginson, que então seria seu “preceptor” e interlocutor para sempre, este texto propõe uma leitura da obra da escritora norte-americana a partir do biografema da carta e da ideia de sua obra como “carta ao mundo” – conforme um de seus mais famosos poemas –, com todas as implicações trazidas pelo termo, e à luz das teorias de Roland Barthes, Maurice Blanchot e Silvina Rodrigues Lopes, entre outros.

  1. Estratégias das empresas de trabalho temporário em contexto de crise atual

    OpenAIRE

    Soares, Vânia Isabel Rocha

    2015-01-01

    Dissertação apresentada ao Instituto Superior de Contabilidade e Administração do Porto para obtenção do Grau de Mestre em Gestão das Organizações, Ramo de Gestão de Empresas Orientada por Professor Doutor Eduardo Manuel Lopes Sá e Silva Coorientada pelo Mestre Adalmiro Álvaro Malheiro de Castro Andrade Pereira Esta dissertação inclui as críticas e sugestões feitas pelo Júri. No contexto atual de crise económica e financeira da economia portuguesa e internacional, marcado por grandes...

  2. Spains Dramatic Conquest of the Dutch Republic. Rodenburgh as a Literary Mediator of Spanish Culture

    Directory of Open Access Journals (Sweden)

    Tim Vergeer

    2016-12-01

    Full Text Available Theodore Rodenburgh was in an exceptional position to become a literary mediator of Spanish poetics. He introduced the comedia nueva in the Dutch Republic at the beginning of the seventeenth century. This article investigates specifically how Rodenburgh dealt with Lope de Vega’s poetics, transforming them to make them fit the Dutch literary tradition. Through translation, adaptation and acculturation, the Iberian comedias became Dutch tragicomedies, plays that would become most popular in the Dutch Republic. Rodenburgh’s endeavours mark the initial phase of the transfer of the comedia nueva to the Dutch Republic.

  3. Universalidad e intertextualidad en Gastón Baquero : (la raíz, el tronco y las ramas : España, Cuba e Hispanoamérica en el árbol de su poesía)

    OpenAIRE

    Aradas Blanco, Diana

    2014-01-01

    [ES]Esta tesis trata sobre la huella de la literatura española, cubana e hispanoamericana en la poesía de Gastón Baquero. La presencia de la literatura española se vertebra en torno a tres etapas: la literatura medieval, la renacentista y barroca (con autores como Garcilaso de la Vega, Fray Luis de León, San Juan de la Cruz, Santa Teresa de Jesús, Góngora, Calderón de la Barca, Quevedo, Lope de Vega, o Cervantes) y el periodo comprendido desde el Romanticismo (con alusiones a Bécquer o Espron...

  4. Relatório de estágio auditoria financeira

    OpenAIRE

    Caiado, Rui Miguel Sousa

    2016-01-01

    O presente relatório integra a fase final do Mestrado em Auditoria Empresarial e Pública do Instituto Superior de Contabilidade e Administração de Coimbra, com o objetivo principal de apresentar as tarefas desenvolvidas ao longo do estágio realizado em Viseu, na sociedade A. Figueiredo Lopes, M. Figueiredo & Associados, SROC, Lda., por um período de 6 meses. Abordando a auditoria financeira, este relatório encontra-se dividido em três capítulos. No primeiro capítulo é efetuado ...

  5. Two new species of Xestoblatta Hebard, 1916 from Brazil, a redescription of Xestoblatta roppai Rocha e Silva Albuquerque & Fraga, 1975 and a key for the species of the buscki group (Blattodea, Ectobiidae, Blattellinae)

    Science.gov (United States)

    Silva-da-Silva, Luiz Rafael; Lopes, Sonia Maria

    2015-01-01

    Abstract Two new species of Xestoblatta from northern Brazil are described, Xestoblatta buhrnheimi sp. n. and Xestoblatta rondonensis sp. n., included in the buscki group Gurney (1939), and new characters are added to the description of Xestoblatta mamorensis Lopes & Oliveira, 2006. Xestoblatta roppai Rocha e Albuquerque-Silva & Fraga, 1975, from midwestern Brazil is redescribed, including its genital characters which were not previously described. Additionally, a key for the species of this group is provided, and photographs are given of the species in the habitus, of tergal modifications, and of the genitalia. PMID:26487828

  6. Análise da concepção de ciência de futuros professores de biologia brasileiros e portugueses

    OpenAIRE

    Silva, Paloma R.; Araújo, Elaine Sandra Nicolini Nabuco de; Carvalho, Graça Simões de; Caldeira, Ana Maria de Andrade

    2013-01-01

    Segundo a perspectiva salvacionista, a Ciência e a Tecnologia (CT) sempre são desenvolvidas para solucionar os problemas da humanidade. Percebemos que nesta ideia está arraigada uma concepção linear de progresso, isto é, que o desenvolvimento científico promove o desenvolvimento tecnológico, que implica em desenvolvimento econômico, promovendo, portanto, desenvolvimento social (González, Lopes e Luján, 1996). Entretanto, o desenvolvimento CT não pode ser considerado livre de valores e interes...

  7. Diseño e implementación de una aplicación informática para la observación de las interacciones sociales en ambientes naturales

    OpenAIRE

    López López, José Antonio

    2016-01-01

    Existen múltiples aplicaciones informáticas (Perea, 2008) para registrar conductas perceptibles que el desarrollo tecnológico actual ha posibilitado, pero la gran mayoría de los programas informáticos tienen problemas en facilitar la: observación, codificación, registro y análisis en contextos naturales; esto hace que dificulten la labor de los investigadores (Hernández-Mendo, Castellano, Camerino, Jonsson, Blanco-Villaseñor, Lopes, y Anguera, 2014). Este trabajo se inscribe en el marco de...

  8. Ciência e consciência, conhecimento e liberdade

    Directory of Open Access Journals (Sweden)

    Luiz Roberto Alves

    2012-08-01

    Full Text Available No tempo de novas tramas tecnológicas e riscos globais, o pensamento científico elaborado na experiência brasileira celebra um texto memorável de pouco mais de 40 anos: Ciência e libertação, do físico nuclear J. Leite Lopes. O presente ensaio perscruta esse pensamento, que se comunica com a crítica científica horrorizada com os escombros do pós-guerra e se projeta numa visão de ruptura epistemológica em vista da realidade social. Tal movimento de política científica se converte em proposta de gestão do conhecimento. A atitude metodológica deste ensaio busca textos que testemunham o entre e o pós-guerra do século XX e em contribuições das ciências da natureza e da cultura dirigidos à construção da sociedade democrática. A obra de Leite Lopes reside aí, como um feixe de linguagens a serviço da mudança social e do efetivo desenvolvimento do Brasil e da América Latina.At the time of new technological schemes and global risks, scientific thinking developed in the Brazilian experience celebrates a memorable text of little more than 40 years: Science and Liberation, written by the nuclear physicist J. Leite Lopes. This paper investigates this thought, which communicates with the critical scientific horrified by the rubble of postwar and design a vision of epistemological rupture in view of social reality. This movement becomes a proposal for a management of knowledge. The methodological approach of this essay seeks texts that bear witness to and from post-war twentieth century, and contributions from the natural sciences and culture aimed at building a democratic society. The work of Leite Lopes lies there like a bunch of languages in the service of social change and the effective development of Brazil and Latin America.

  9. IFIN - HH contribution at the Pierre Auger observatory

    Science.gov (United States)

    Brancus, I. M.; Saftoiu, A.

    2017-06-01

    Since 2000, in collaboration with KIT, Germany, the research of Astroparticle Physics has developed in IFIN-HH Bucharest. Romanian researchers participated in large international experiments, KASCADE Grande and LOPES, for investigating cosmic rays. New experimental devices have been built in IFIN-HH Bucharest for measuring the cosmic ray muons. Based on the experience and results gained over that time, Romanian researchers became part of the Pierre Auger Collaboration, the largest complex experiment for the investigation of Extensive Air Showers. The contribution of IFIN-HH is focused on the studies of cosmic rays using radio antennae and the measuring of cosmic muons using detectors based on new technology.

  10. The New Art of Writing Plays in This Time: Spanish Golden Age Comedy

    Directory of Open Access Journals (Sweden)

    Branka Kalenić Ramšak

    2011-12-01

    Full Text Available This article presents the context of Spanish Golden Age art, especially drama, in which Félix Lope de Vega played an indispensable role. His comedy defied the rules of classical drama and sought to find a new and independent path within Baroque aesthetics. The golden age of Spanish art, especially literature, began right at the transition between the fi fteenth and sixteenth centuries, when poets, writers, and playwrights created a number of excellent works that qualitatively placed Spanish literature in an entirely new light. Since then, its contribution to laying the foundations for the modern age of European literature has been indispensable. During the Baroque period the Spanish world turned into a theatrum mundi; reality was becoming increasingly apparent, and life was a dream. Artists were looking for refuge either in the spiritual aesthetic of extreme alienation or in hermetic mockery of burlesque reality, which often led to harsh grotesque. However, for the artist, the most important freedom was still creativity. Through the entire sixteenth century, the Spanish theater combined classical satirical theater and popular art. Various types of drama, all referred to by the generic term “comedy,” were performed in corrales ‘urban courtyards’. The Comedia de corral had a dual objective: to entertain a heterogeneous audience and to address those more educated about the deeper issues of human existence. The Spanish theater received a final image with the comedies of Lope de Vega, who was also the founder of a new dramatic style and the most fruitful playwright of all time worldwide. His comedy has become a new drama form, based on the Spanish literary tradition but also classified in Baroque art aesthetics. The New Art of Writing Plays in Th is Time (1609 is a theoretical text by Lope de Vega on a new comedy, which he finally separated from Aristotle’s Poetics. In the text he indicated a revolutionary position for his time; namely

  11. The Identity of Culex (Melanoconion) taeniopus Dyar and Knab and Related Species with Notes on the Synonymy and Description of a New Species (Diptera, Culicidae)

    Science.gov (United States)

    1980-01-01

    821774, J. F. Reinert (No. 107 136), 5 9 (USNM). S&I PauZo: Iguape, Porto de Ribeira , 17 Mr 76, 0. S. Lopes, 1 d (USNM). TAXONOMIC DISCUSSION. As...pupal, 12 larval). MEXI co. Il’abasco: Cardenas, "Colegio Superior de Agricultura Tropical", 20 mm, 15 Jul 70, D. & K. Schroeder (MEX 564), 2 9 (USNM...Marinkelle (COM 595), 1 Q (USNM). ECUADOR. Nape, Coca: Apr-May 65, L. E. Pena G. (ECU 8, 91), 1 d, 17 9 (USNM). EsmeraZdas: San Lorenzo, 14-18 Aug 72, M

  12. Avaliação das concentrações séricas de adiponectina e sua correlação com obesidade e endocardiose de valva mitral em cães

    OpenAIRE

    Fabrício Lorenzini Aranha Machado

    2012-01-01

    A obesidade é definida como acúmulo excessivo de gordura corpórea, derivada de um desequilíbrio crônico entre energia ingerida e gasta. Neste desequilíbrio estão relacionados fatores como estilo de vida (dieta e atividade física), alterações neuro-endócrinas e fatores hereditários (MARQUES-LOPES et al., 2004). A obesidade não acomete apenas seres humanos, tornando-se um elemento importante de estudos e pesquisas, inclusive em animais de companhia como cães e gatos. O diagnóstico da obesidade ...

  13. Mário Schenberg: Physicist, politician and art critic

    Energy Technology Data Exchange (ETDEWEB)

    Guzzo, M. M., E-mail: guzzo@ifi.unicamp.br [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas - UNICAMP, Rua Sérgio Buarque de Holanda, 777, 13083-859 Campinas, SP Brazil (Brazil); Reggiani, N. [Pontifícia Universidade Católica de Campinas, PUC-Campinas, Rod. D. Pedro I, km 136, 13086-900 Campinas, SP Brazil (Brazil)

    2015-12-17

    Mário Schenberg is considered one of the greatest theoretical physicists of Brazil. He worked in different fields of physics including thermodynamics, quantum mechanics, statistical mechanics, general relativity, astrophysics and mathematics. He was assistant of the Ukrainian naturalized Italian physicist Gleb Wataghin and worked with prestigious physicists like as the Brazilians José Leite Lopes and César Lattes, the Russian-born American George Gamow and the Indian astrophysicist Subrahmanyan Chandrasekhar. Besides, he was also an active politician and critic of art.

  14. Procedimentos substantivos em auditoria financeira

    OpenAIRE

    Santos, Ana Sofia Pires dos

    2014-01-01

    O presente relatório visa a conclusão do mestrado em Auditoria e Análise Financeira, cujo tema é Auditoria Financeira e procura apresentar as tarefas desenvolvidas por mim, durante o estágio curricular, enquanto assistente de auditoria na empresa Rosa Lopes Gonçalves Mendes & Associados, SROC, Lda., no Entroncamento durante 22 semanas. O relatório é composto por quatro capítulos em que nos primeiros três capítulos faço uma abordagem teórica geral à auditoria financeira, cujo objetivo é a i...

  15. Task Organizing for Urban Combat

    Science.gov (United States)

    1978-06-09

    states that "I • ...- • •v•Z’- quad, must fight in a large city, it should be renfo ..rz i - Engineer Cqrr’-’ct Operatlons, FM 5-100, states that, " MOBA ...reliably task organize his unit for combat. 90 The nn’ibsrs ~ sa pr r3to Sbi dev&Loped in thAZ atudy should be tested in MOBA scenrocsqti AtnSzvohr P~ ames...Heidelberg, Chief of Historical Section, Us AKýrm bap, 17 July 1952. Ketron, Inc. GaMing Models for Military Operations in Bailt-Up Areas- MOBA .. October

  16. A numerical study on the influence of slope and curvature on smoke flow in special section tunnel with natural ventilation

    Science.gov (United States)

    Wang, Wenzhou; Zhou, Xianping; Liu, Zhigang; Liu, Ya; Liu, Wanfu; Hong, Li

    2017-09-01

    In this study, a special section tunnel model was established by using FDS (Fire Dynamics Simulator). The influences of lope and curvature on smoke flow under natural ventilation have been studied. The results showed that under the condition of natural ventilation, the slope has some influences on the smoke flow in special section tunnel. The smoke spreading speed is accelerated along the upstream direction and decrease along the downstream direction due to buoyancy effect of slope. The steeper the tunnel, the more obvious the buoyancy effect. The curvature has little effect on the flow of flue gas.

  17. Quasi-Newton methods for the acceleration of multi-physics codes

    CSIR Research Space (South Africa)

    Haelterman, R

    2017-08-01

    Full Text Available -Structure Interaction Problems in Blood Flows ESAIM: Mathematical Modelling and Numerical Analysis 37/4, pp. 631–647 (2003) [18] M.A. Gomez-Ruggiero, J.M. Martinez, The Column-Updating Method for solving nonlinear equations in Hilbert space. RAIRO Mathematical Modelling..., pp. 750–755 (2017) [21] C.T. Kelley, Iterative methods for linear and nonlinear equations. Frontiers Appl. Math., SIAM, Philadelphia (1995) [22] V.L.R. Lopes, J.M. Martinez, Convergence properties of the Inverse Column-Updating Method. Optim. Methods...

  18. Coupling of partitioned physics codes with quasi-Newton methods

    CSIR Research Space (South Africa)

    Haelterman, R

    2017-03-01

    Full Text Available –51 (1997) [10] M.A. Gomez-Ruggiero, J.M. Martinez, The Column-Updating Method for solving nonlinear equations in Hilbert space. RAIRO Mathematical Modelling and Numerical Analysis 26, pp. 309–330 (1992) [11] R. Haelterman, Analytical Study of the Least...). [14] V.L.R. Lopes, J.M. Martinez, Convergence properties of the Inverse Column-Updating Method. Optim. Methods Softw. 6, pp. 127–144 (1995) [15] J.M. Martinez, L.S. Ochi, Sobre Dois Metodos de Broyden. Mat. Apl. Comput. 1/2, pp. 135–143 (1982) [16] J...

  19. La inconsistencia de la reserva de revalorización de activos

    Directory of Open Access Journals (Sweden)

    Miguel Díaz Llanes

    2014-03-01

    Full Text Available En el presente artículo analizamos los impactos que sobre la empresa, su contabilidad y su gestión tiene la Ley 16/2012, conocida como ley de Revalorización de Activos. Lo hacemos desde diversas ópticas: Económico-Empresarial, Financiera, Fiscal y Contable. En el campo de la contabilidad exponemos los impactos sobre las diferentes partidas del Balance, de la Cuenta de Pérdidas y Ganancias; así como los efectos sobre el Análisis Contable. Este punto es fundamental para valorar las consecuencias que sobre la liquidez, la solvencia y la rentabilidad tiene la mencionada ley así como sus efectos en el funcionamiento diario de la empresa. Nos permite, además, valorar la capacidad de endeudamiento y de financiación de la compañía.

  20. Estudio comparativo de la presión arterial invasiva frente a la presión arterial no invasiva. Valoración de la diferencia

    OpenAIRE

    Simarro Blasco, J.A.; Noheda Blasco, M.C.; Bascuñana Blasco, M.; Noheda Recuenco, M.; Tolmo Aranda, I.; Romero Carralero, M.I.

    2011-01-01

    En la práctica clínica, la tensión arterial es un parámetro importante en la valoración hemodinámica del paciente crítico. Existen dos formas de medición: Presión Invasiva (PI) y Presión No Invasiva (PNI). Como objetivos nos planteamos comparar la diferencia entre ambas formas de medición, valorar las posibles diferencias por la localización arterial, edad y sexo, valorar la influencia de la ventilación mecánica, drogas inotrópicas y antecedentes personales en la diferencia de Presión arteria...

  1. La excomunión: Su presencia en los Estatutos de la Universidad de Salamanca (S. XV

    Directory of Open Access Journals (Sweden)

    Pilar VALERO GARCÍA

    2009-12-01

    Full Text Available En estrecha relación con el carácter que por esta época —siglo XV— distingue al Estudio salmantino, su condición de pontificio, es como puede entenderse, desde nuestra perspectiva, y valorar su justificación histórica, la incorporación, como factor correctivo o de disuasión, de la excomunión en la normativa de Estatutos y Constituciones.

  2. El cáncer colorrectal en España. Costes por incapacidad temporal y opciones preventivas desde las empresas

    Directory of Open Access Journals (Sweden)

    M.T. Vicente-Herrero

    2013-04-01

    Conclusiones: Sirvan los resultados para valorar la utilidad de la implantación de estrategias de apoyo a la sanidad pública para una mayor reducción de la prevalencia, mortalidad y mejora de la calidad de vida de los afectados y sus familias, junto con un ahorro económico derivado de la reducción de la IT derivada del cáncer colorrectal.

  3. Influencia del diagnóstico precoz con resonancia magnética del infarto cerebral agudo en la función global de salud y en los costes de la atención del paciente

    OpenAIRE

    Parody Rua, Elizabeth

    2013-01-01

    Objetivos: El ictus isquémico tiene altas tasas de mortalidad y discapacidad. El diagnóstico radiológico pretende diferenciar el infarto de la hemorragia cerebral. Hay dos estrategias de diagnóstico por imagen: tomografía computarizada (TC) y resonancia magnética (RM). El objetivo de este estudio es valorar la influencia de TC o RM en los resultados y costes del manejo de los pacientes con isquemia cerebral aguda (ICA).

  4. Valoración de un gel de clorhexidina en el control del dolor postextracción dental

    OpenAIRE

    López López, José; Roselló Llabrés, Xavier; Jané Salas, Enric

    1998-01-01

    Presentamos un estudio doble ciego practicado en 248 extracciones (premolares y molares) para valorar la utilidad de un gel de clorhexidrina en el control del dolor postextracción dental, en la necesidad de medicación analgésica adicional y en la presencia o no de alveolitis. El grupo que utiliza el gel como coadyuvante en la extracción presenta un menor dolor con una p

  5. Densitometría ósea

    Directory of Open Access Journals (Sweden)

    V. Edith Miranda, Dra.

    2013-01-01

    En ambos casos se transforma el valor de la DMO en desviaciones estándar (DE respecto al valor medio poblacional. Este estudio permite así valorar el riesgo relativo de presentar fractura antes de que se produzcan e iniciar medidas preventivas, confirmar el diagnóstico de fragilidad ósea ante la presencia de fractura o bien monitorizar respuesta a tratamientos de osteoporosis.

  6. Métodos centrados en el aprendizaje, implicación del alumno y percepción del contexto de aprendizaje en estudiantes universitarios

    OpenAIRE

    Gargallo López, Bernardo; Pérez Pérez, Cruz; Jiménez Rodríguez, Miguel Ángel; Martínez Hervás, Noelia; Giménez Beut, Juan Antonio

    2017-01-01

    En este trabajo s e pretend a valorar la incidencia de m todos centrados en el aprendizaje sobre diversas capacidades/habilidades del estudiante y sobre su percepci n del entorno de aprendizaje dise ado por el profesor. La muestra estuvo constituida por 126 estudiantes de primer curso de la Uni - versidad Cat lica de Valencia de tres grupos cursando grados de Maestro de Educaci n Primaria y Educaci n Infantil, siendo impartida la materia de los grupos de Prima...

  7. Sarcoidosis en la infancia. Una rara enfermedad sistémica

    Directory of Open Access Journals (Sweden)

    Antonio Zamora-Chávez

    2016-03-01

    Conclusiones: Se resalta la importancia de considerar el diagnóstico de sarcoidosis en los pacientes con hepatomegalia, adenopatías, daño pulmonar difuso, eritema nodoso, masa testicular e hipercalcemia, así como la necesidad del abordaje multidisciplinario para valorar el compromiso orgánico múltiple y el inicio oportuno de la terapia con esteroides, con el fin de evitar la progresión de la enfermedad.

  8. Patrón circadiano de la presión arterial en la hipertensión arterial refractaria : influencia de la administración temporalizada del tratamiento

    OpenAIRE

    Nieto Pol, Enrique

    2014-01-01

    Con el desarrollo de la monitorización ambulatoria de la presión arterial (MAPA), se ha podido profundizar en el conocimiento de la variabilidad de la misma, tanto en su componente intrínseco como en el perfil circadiano (actividad-descanso), lo que permite valorar su importancia clínica en relación con la morbimortalidad cardiovascular.

  9. IModelo teórico determinístico para análisis de la disponibilidad estacional del agua en cuencas hidrográficas con datos discretos de caudales

    OpenAIRE

    Vargas-Fallas, Luis Carlos

    2010-01-01

    Proyecto de graduación (Doctorado en Ciencias Naturales para el Desarrollo. Énfasis en Manejo de Recursos Naturales) Instituto Tecnológico de Costa Rica, Universidad Estatal a Distancia, Universidad Nacional, Doctorado en Ciencias Naturales para el Desarrollo, 2010 Las áreas de recarga de las aguas, originalmente cubiertas por bosques han sido intensamente modificados para dar paso a actividades forestales, agropecuarias, urbanas e industriales; sin valorar la afectación sobre ...

  10. La Educación Social en las políticas públicas de bienestar: programas, experiencias e iniciativas pedagógico-sociales en los servicios sociales comunitarios

    OpenAIRE

    Varela Crespo, Laura

    2013-01-01

    La Tesis responde a un propósito fundamental: describir y valorar el quehacer socioeducativo de los servicios sociales comunitarios en tres municipios de Andalucía (San Juan de Alfarache), Cataluña (San Adriá de Besós) y Galicia (Culleredo), analizando los programas que promueven y el perfil profesional de los/as educadores/as sociales, tanto en sus planteamientos teóricos como en sus opciones metodológicas.

  11. Efectos sobre variables antropom??tricas y de fuerza de dos programas de entrenamiento de contrastes a corto plazo en jugadores j??venes de deportes colectivos

    OpenAIRE

    Izquierdo Velasco, Jos?? Mar??a

    2011-01-01

    265 p. El objetivo fundamental del presente estudio es establecer y valorar los efectos de dos tipos de entrenamiento de contrastes de 6 semanas de duraci??n sobre diferentes factores de fuerza m??xima y fuerza explosiva, as?? como en variables antropom??tricas en diferentes jugadores de categor??a juvenil de deportes colectivos: f??tbol, baloncesto, balonmano y voleibol. A su vez, y con los datos iniciales (pretest), se analizan las diferencias existentes en dichas variables valorando por...

  12. Fiabilidad y validez externa de un cuestionario de conocimiento sobre riesgo y enfermedad cardiovascular en pacientes que acuden a farmacias comunitarias de España

    Directory of Open Access Journals (Sweden)

    Pedro Amariles

    2016-11-01

    Conclusiones: Acorde con el coeficiente de correlación intraclase, el cuestionario orientado a valorar el conocimiento sobre el RCV y enfermedad cardiovascular tiene una fiabilidad entre aceptable y excelente, lo cual, sumado a la validación previa, indica que dicho instrumento cumple los criterios de validez y fiabilidad. Además, el cuestionario evidencia capacidad de relacionar un aumento en el conocimiento con una intervención educativa, característica que complementa su validez externa.

  13. ESTUDIO RIESGOS LABORALES EN CENTRO DE TRABAJO HUNE

    OpenAIRE

    Canosa-Ferrío, María Belén

    2012-01-01

    Identificar todos los riesgos posibles que sufren los trabajadores de la Delegación , establecer los procedimientos adecuados de trabajo, valorar los riesgos según la metodología del INSHT y establecer medidas preventivas y correctoras. Conocer de la eficacia del sistema de gestión OHSAS 18001 implantado en HUNE . Identificar los fallos preventivos más habituales en la delegación.

  14. COMPARECENCIA ANTE LA COMISIÓN DE EDUCACIÓN DEL PARLAMENTO DE ANDALUCÍA

    Directory of Open Access Journals (Sweden)

    Francisco Cuadrado Muñoz

    2009-11-01

    Es necesario un compromiso con la evaluación en todos los ámbitos del sistema educativo andaluz, porque nos permite valorar lo que hacemos y reorientar nuestro trabajo. En una sociedad moderna y democrática, no cabe la autocomplacencia, la acomodación o el ocultamiento, y es necesario rendir cuentas de lo que se hace y los resultados que se obtienen ante los poderes públicos.

  15. A practical comparison of agile web frameworks

    OpenAIRE

    Díaz Clavijo, David

    2014-01-01

    [ES] Los web frameworks son herramientas para mejorar el desarrollo y mantenimiento de sitios web. Aprender a utilizar un framework requiere varios meses y existen más de 100 web frameworks. Por ello es interesante que haya estudios que muestren sus diferencias. En este proyecto se realizó una comparativa de web frameworks para valorar sus diferencias, debilidades y fortalezas. Para seleccionar los web frameworks se utilizaron variables como las estadísticas de uso, popularidad y resultados e...

  16. Cervicoartrosis: efectividad de un tratamiento fisioterápico convencional

    OpenAIRE

    Pérez Navarro, Mario; García Madrid, José Luis; Pérez Albert, José María; Martínez Fuentes, Juan

    2005-01-01

    El objetivo de este estudio consiste en valorar la efectividad de un tratamiento de fisioterapia convencional para la cervicoartrosis (microondas, tracción cervical, movilización activa, masaje e higiene postural). Para su realización, se han seleccionado 32 pacientes (26 mujeres y 6 hombres) diagnosticados de cervicoartrosis. Se han valorado factores como el dolor y el balance articular. Tras analizar los resultados, concluimos que el tratamiento planteado es efectivo en la patol...

  17. The Atterberg limits and their significance in the ceramic and brick industries

    Directory of Open Access Journals (Sweden)

    Sembenelli, P.

    1966-12-01

    Full Text Available Not availableLos límites de consistencia de Atterberg suministran los elementos para una rigurosa clasificación de las arcillas y para valorar muchas de sus propiedades. Pueden emplearse con utilidad para emprender un estudio riguroso, bien de los materiales destinados a la industria cerámica y de los ladrillos, o bien para proyectar las plantas de producción, integrando o sustituyendo algunos criterios todavía en uso.

  18. La memoria biocultural

    OpenAIRE

    Halffter Salas, Gonzalo

    2009-01-01

    En los últimos años se ha manifestado una tendencia creciente a valorizar el conocimiento tradicional de la naturaleza, incluyendo su manejo y conservación. Este conocimiento, transmitido en forma oral en aquellos pueblos que conservan su estructura social y tradiciones, constituye un verdadero patrimonio o memoria biocultural. Para los ideólogos y ecólogos profesionales puede resultar especialmente interesante conocer y aprender a valorar esta memoria biocultural. En esta nota comentamos dos...

  19. ¿Está relacionada la ansiedad rasgo con la mejora de la aptitud

    OpenAIRE

    Cervantes, Julio; Parrado Romero, Eva; Capdevila Ortís, Lluís

    2012-01-01

    Introducción y objetivo: Los datos que manifiestan la variación interindividual de la aptitud cardiorrespiratoria basada en el VO2max tras las intervenciones de entrenamiento son de suma importancia para el estado de salud. El objetivo principal de este estudio fue valorar si la ansiedad rasgo puede influir en la aptitud cardiorrespiratoria a partir de un entrenamiento de ejercicio aeróbico controlado. Método: Doce estudiantes fueron divididos en dos grupos: uno de entrenamient...

  20. Adaptaciones cardiacas hemodinámicas, estructurales y funcionales a un programa de ejercicio físico supervisado durante el embarazo: ensayo clínico aleatorizado = Hemodynamic, structural and functional cardiac adaptations in a supervised physical exercise program during pregnancy: a randomized controlled trial

    OpenAIRE

    Perales Santaella, María

    2014-01-01

    Introducción: Diversos cambios ocurren en el sistema cardiovascular materno durante el embarazo, lo que genera un gran estrés sobre este sistema especialmente durante el tercer trimestre, pudiendo acentuarse en presencia de determinados factores de riesgo. Los objetivos de este estudio fueron, valorar las adaptaciones cardiovasculares producidas por un programa específico de ejercicio físico; su seguridad sobre el sistema cardiovascular materno y los resultados del embarazo; y su eficacia en ...

  1. Efectos del ataque de fitófagos perforadores en el fruto de la encina (Quercus rotundifolia Lam.)

    OpenAIRE

    Soria Iglesias, Francisco Javier; Cano Sánchez, Esperanza; Ocete Rubio, María Elvira

    1996-01-01

    En el presente trabajo se realizan pruebas de germinación de frutos de encina (Quercus rotundifolia Lam.) afectadas por los fitófagos Curculio elephas Gyll. (COL., CURCULIONIDAE) y las especies del género Cydia, C. penkleriana (D. & Schiff.) y C. fagiglandana (Zel.) (LER, TORTRICIDAE). También recoge una serie de mediciones del fruto cuya finalidad es valorar los daños directos de estas especies.

  2. Fractura de pelvis con hernia “trans-ilíaca”

    National Research Council Canada - National Science Library

    Fontg Manzano, F; Orient López, F; Fernández Mariscal, E; Sañudo Martín, I

    2009-01-01

    ... ipsilateral. En radiografía simple ( fig. 1 ) se evidenciaba fractura por arrancamiento de la porción anterior del ala ilíaca incluyendo la totalidad de la espina ilíaca anterosuperior y parte de la anteroinferior. Para detallar mejor la lesión y valorar el compromiso de tejidos blandos se realizó Resonancia Magnética ( fig. 2 y 3 ) donde se ob...

  3. Estudio del proceso de pinturas de serie en SEAT sobre tres nuevos sustratos.

    OpenAIRE

    De Medrano Palomeras, Beatriz

    2016-01-01

    Este trabajo consiste en hacer un estudio comparativo de la situación actual del proceso de pinturas de serie en SEAT variando los sustratos, es decir, el tipo de chapa o los tratamientos superficiales que llevan estas. Para valorar si mejoran o no la situación actual se realizan diferentes ensayos, como por ejemplo de corrosión o adherencia.

  4. La evolución del Ciclo Superior de Administración y finanzas, y su adaptación a la actualidad empresarial

    OpenAIRE

    Moro-Guijarro, Marta María

    2012-01-01

    En este trabajo se realiza el análisis del cambio curricular del Ciclo Superior LOGSE de Administración y Finanzas a Ciclo LOE, partiendo de su evolución previa y de su situación actual, con el fin de valorar si las modificaciones que presenta son más adecuadas a las necesidades actuales de la empresa y pueden favorecer la introducción de sus titulados en el mercado laboral.

  5. Las redes sociales y el espíritu emprendedor en la empresa

    OpenAIRE

    Romo Toral, Natalia

    2014-01-01

    El Trabajo de Fin de Grado tiene como objetivo valorar las oportunidades que ofrecen las redes sociales a las empresas para desarrollar su espíritu emprendedor a nivel corporativo en relación a sus clientes. Departamento de Organización de Empresas y Comercialización e Investigación de Mercados Grado en Marketing e Investigación de Mercados

  6. Intervención mediante fisioterapia manual y educativa en pacientes con hemofilia y artropatía degenerativa.

    OpenAIRE

    Cuesta Barriuso, Rubén

    2013-01-01

    Objetivo. Valorar la eficacia de dos tratamientos de Fisioterapia en pacientes con artropatía hemofílica de codo, rodilla o tobillo. Participantes. 31 pacientes con artropatía hemofílica fueron aleatoriamente asignados a 3 grupos: 11 (terapia manual), 10 (Fisioterapia educativa) y 10 (control). Intervención. Durante 12 semanas, se realizaron dos tratamientos: uno con terapia manual (2 sesiones semanales); y otro con sesiones educativas y ejercicios domiciliarios diarios. Tres evaluador...

  7. Control borroso para la valoración del impacto ambiental generado por contaminantes emergentes en aguas residuales hospitalarias

    OpenAIRE

    Leadina Sánchez Barboza

    2015-01-01

    La valoración de impactos ambientales está sujeta a imprecisión, vaguedad y subjetividad. Estas características son extensivas al impacto generado por la presencia de contaminantes emergentes -fármacos- en aguas residuales hospitalarias, por lo que este trabajo propone valorar el impacto de dichos contaminantes mediante un sistema de inferencia borrosa, utilizando el toolbox fuzzy logic de MATLAB®, aplicando el sistema experto Mamdani. Los conjuntos borrosos de entrada se establecieron a part...

  8. Evaluación de las instalaciones deportivas escolares desde el punto de vista de la salud

    National Research Council Canada - National Science Library

    Cabello Oliveros, E; Cabra de la Torre, N

    2006-01-01

    ... de Educación Física. El resultado es un instrumento que hemos denominado ¿Fichas de evaluación de instalaciones deportivas escolares desde el punto de vista de la salud¿. Instrumento que nos permitirá valorar las instalaciones deportivas escolares desde esa perspectiva y cuya utilización y posterior análisis de los datos queda debidamente explicitado en este trabajo.

  9. Introducción de filtros biológicos en peceras del Acuario Nacional de Cuba.

    OpenAIRE

    Olaechea-Juárez, A.; González, E.; Guitart-Pérez-Puelles, B.

    1994-01-01

    En el Acuario Nacional de Cuba se exhiben especies de peces e invertebrados marinos, en peceras que tradicionalmente funcionan con circulación constante de agua de mar. Desde 1991 se comenzaron a introducir filtros biodegradables los cuales han dado un buen resultado, aunque teóricamente no son recomendados para acuarios de grandes volúmenes. El presente trabajo tiene como objetivo el de valorar las experiencias obtenidas con la introducción de filtros de fondo en peceras ...

  10. Suitability of three different tools for the assessment of methodological quality in ex post facto studies

    Directory of Open Access Journals (Sweden)

    Alexander Jarde

    2012-01-01

    Full Text Available No hay todavía un candidato claro a la hora de elegir una herramienta para valorar la calidad metodológica de estudios no experimentales en revisiones sistemáticas y meta-análisis. Nuestro propósito es analizar en profundidad las características psicométricas de las tres herramientas de evaluación de este tipo más comprensivas publicadas hasta el 2010. Seleccionamos estas herramientas de una revisión sistemática previa, y aplicamos cada una de ellas para valorar la calidad de 10 estudios prospectivos, 10 estudios retrospectivos con cuasi control y 10 estudios transversales. La fiabilidad entre jueces para los dos primeros diseños mencionados es moderada sólo en una de las herramientas seleccionadas, y moderada a alta en todas ellas para los estudios transversales. El acuerdo entre herramientas es en general bajo, pese a que los aspectos inferidos muestran que tienen un solapamiento conceptual relativamente bueno en la mayoría de las dimensiones. De acuerdo con estos resultados recomendamos dos herramientas para valorar estudios transversales, ya que consideramos que las herramientas aplicables a estudios prospectivos o retrospectivos con cuasi control requieren análisis adicionales. Los 30 aspectos concretos que hemos inferido de los ítems de las tres herramientas analizadas pueden usarse como punto de partida para desarrollar una nueva herramienta de este tipo.

  11. A influência das normas nos processos de trabalho: o caso da Prefeitura Municipal de Panambi-RS

    Directory of Open Access Journals (Sweden)

    Denise Dexheimer

    2013-01-01

    Full Text Available Este artigo identifica como as normas explícitas na cultura organizacional influenciam os processos de trabalho dos funcionários públicos da Prefeitura Municipal de Panambi/RS. Após a caracterização da organização, no referencial teórico encontram-se algumas definições sobre tipos de organizações, cultura organizacional, normas e processos de trabalho. Em termos metodológicos, com base em Vergara (2009 o estudo classifica-se quanto aos fins como uma pesquisa descritiva. Quanto aos meios, o estudo se classifica como pesquisa de campo, pesquisa bibliográfica e pesquisa documental. Foram aplicadas 18 questões com 30 funcionários da referida Prefeitura a fim de verificar qual era a percepção que os funcionários possuíam sobre as normas vigentes, assim como identificar quais normas reguladoras que mais dificultavam o andamento dos processos de trabalho. Após esses diagnósticos foram propostas estratégias que possam viabilizar um melhor e mais eficiente processo de práticas na Prefeitura Municipal de Panambi/RS. Com a conclusão do trabalho, percebeu-se o quanto as normas organizacionais influenciam os processos de trabalho, afetando diretamente os serviços prestados pela organização, podendo determinar os resultados e desempenhos organizacionais.

  12. Una Colombia imaginada

    Directory of Open Access Journals (Sweden)

    Miguel A. Ramiro Avilés

    2014-01-01

    Full Text Available José Antonio Osorio Lizarazo, José Félix Fuenmayor y Manuel Francisco Sliger Vergara escribieron, respectivamente, Barranquilla 2132, Una triste aventura de 14 sabios y Viajes interplanetarios en Zepelines que tendrán lugar el año 2009. Se trata de tres novelas de ciencia ficción que fueron publicadas en Colombia en la década de 1930. En estas obras se perfila una Colombia imaginada, muchas veces deseada y, por suerte o desgracia, nunca alcanzada. El objetivo de este texto es presentar las propuestas de reforma política anunciadas por estos tres autores en sus obras de ciencia ficción, centrando la atención en la obra de José Antonio Osorio Lizarazo por ser la más compleja y elaborada de las tres, así como por estar directamente ligada al pensamiento político de Jorge Eliécer Gaitán.

  13. National and international astronomical activities in Chile 1849--2002

    Science.gov (United States)

    Duerbeck, H. W.

    2003-03-01

    At all times and in many ways, Chilean astronomy has been influenced externally, either by astronomical expeditions from other parts of the world, or by astronomers that immigrated from other countries. We outline the history of the Chilean National Observatory, beginning with its origins out of Gilliss' US Naval Expedition to the Southern Hemisphere, over its directors Moesta, Vergara, Obrecht, Ristenpart to the middle of the 20th century, as well as the astronomical development at the Universidad Católica. In addition, various international expeditions, which aimed at observations of solar eclipses, the Venus transit of 1882, and the Mars opposition of 1907, were carried out. While a major photometric project of Harvard Observatory was active for only six weeks in the north of Chile, the spectroscopic Mills expedition of Lick Observatory in Santiago lasted several decades, and the solar observatory of the Smithsonian Astrophysical Observatory near Calama even longer. Finally we give a brief overview of the evolution and the actual state of the international observatories Cerro Tololo, La Silla, Paranal, and Las Campanas.

  14. Una Colombia imaginada

    Directory of Open Access Journals (Sweden)

    Miguel A. Ramiro Avilés

    2013-12-01

    Full Text Available José Antonio Osorio Lizarazo, José Félix Fuenmayor y Manuel Francisco Sliger Vergara escribieron, respectivamente, Barranquilla 2132, Una triste aventura de 14 sabios y Viajes interplanetarios en Zepelines que tendrán lugar el año 2009. Se trata de tres novelas de ciencia ficción que fueron publicadas en Colombia en la década de 1930. En estas obras se perfila una Colombia imaginada, muchas veces deseada y, por suerte o desgracia, nunca alcanzada. El objetivo de este texto es presentar las propuestas de reforma política anunciadas por estos tres autores en sus obras de ciencia ficción, centrando la atención en la obra de José Antonio Osorio Lizarazo por ser la más compleja y elaborada de las tres, así como por estar directamente ligada al pensamiento político de Jorge Eliécer Gaitán.

  15. Da Fome à Vontade de Comer: uma análise dos instrumentos para medida de satisfação do consumidor de lojas de alimentação

    Directory of Open Access Journals (Sweden)

    Cassundé, Fernanda Roda de Souza Araújo

    2014-05-01

    Full Text Available The literature suggests that the practice of research of consumer satisfaction has become an important action for businesses because it can provide information necessary for future decision making more consistent as regards to marketing and sales. In this sense, it is common to find many food shops adopting tools with the objective of evaluating consumer satisfaction. This paper analyses the instruments used by such stores from the standpoint of scientific methodology, seeking to know if those instruments are elaborated in accordance with what scientific methodology advocates and if they are able to measure the satisfaction of the consumers. Thus, in order to enable the study, forms were collected in a food court of a large shopping centre in the Metropolitan Region of Recife and the analysis of each one was based on a framework of categories for analysis of forms for measuring consumer satisfaction, drawn from theory discussed by authors such Oliveira Moraes (1994, Babbie (1999 , Gil (1999 , Richardson (1999 , Malhotra (2001 , Vergara (2009 and Vieira (2009 .

  16. [Presence of Haemagogus equinus Theobald, 1903 (Diptera: Culicidae), in Soledad and Malambo, in the Province of Atlántico, Colombia].

    Science.gov (United States)

    Maestre-Serrano, Ronald; Vergara-Sanchez, Consuelo; Berrueco-Rodriguez, Guillermo; Bello-Novoa, Betsy; Brochero, Helena

    2008-03-01

    Yellow fever is a serious illness public health importance and is transmitted by mosquitoes of the genera Haemagogus and Sabethes in the rural and forest environments, and by Aedes aegypti in the urban setting. In Colombia, Haemagogus janthinomys and H. equinus are considered efficient vectors of this viral disease. The presence of the mosquito Haemagogus equinus was recorded over an 8 year period, in the periurban areas of the Soledad and Malambo municipalities (Atlantico Province) of northern Colombia. The data was obtained from records of the entomological collections from two collection sites: (1) 14 larva traps located at the Erneasto Cortissoz airport in the municipality of Soledad between 1997--2005 and (2) 10 larva traps located at Vergara and Velasco Batallion in the municipality of Malambo in 2005. Haemogogus equinus was reported for the first time in Soledad in 1998. In the following 8 years, 197 larvae were reported. The individuals were found sharing the trap with Aedes aegypti, Culex nigripalpus and Uranotaenia lowii. In Malambo, the first discovery of H.equinus occurred in 2005, with a total of 641 larvae. No other Culicidae were associated with it. The presence of H. equinus in larvitraps located near the urban zone, shows adaptation to the use of artificial containers as larval habitats, Urbanization of this species in zones with a high Ae. aegypti infestation index increases the potential introduction of sylvan yellow fever virus and constitutes a risk for re-emergence of urban cycles of yellow fever.

  17. Formulation of price strategies in the software sector: outsourcing of development and maintenance software product case

    Directory of Open Access Journals (Sweden)

    Antonio Cezar Bornia

    2008-07-01

    Full Text Available The main goal of this article is to discuss the formulation of price strategies in the software sector. In the intention of reaching the proposed goal, strategies models of prices are introduced along with the procedure to the formulation of price strategies, composed by five stages: external and internal analyses, consolidation, positioning, price strategy formalization and market attendance. As for the methodology, the study is classified as qualitative, exploratory, descriptive, documental, of field and case study, according to the approach of Vergara (1998. In the case study, the model to the formulation of price strategies is applied in a company’s software sector, being analyzed the outsourcing of development and maintenance software product. As main contributions, it is highlighted the price procedure application that emphasizes strategic price logic and prices strategies formulations, with base in the analysis of five main factors: quality, comparison with the competition, company life cycle, product life cycle and characteristics of the segment-objective. Based on the analyzed factors, a possible strategy to be adopted considering the characteristics of the product and the company is the price strategy and superior value. Key-words: Pricing Strategies. Price Formulation. Software Enterprises.

  18. Turismo rural, una alternativa para el desarrollo social, económico y medio ambiental del campo

    Directory of Open Access Journals (Sweden)

    Carlos González Iturriaga

    2004-11-01

    Full Text Available El proyecto desarrollado por la Unión Temporal sdm Ltda.-Corporación Austral, con recursos del pademer del Ministerio de Agricultura y Desarrollo Rural en los municipios de Nimaima y Vergara, en el departamento de Cundinamarca, fomentó la gestión empresarial de las comunidades, logrando la organización comunitaria y la creación de empresas prestadoras de servicios turísticos, entre las cuales se encuentran las empresas comunitarias "Asoaventura" y "Asematur", cuyo resultado final es la formación, diseño y comercialización de paquetes de turismo agroecológico. Dicho proyecto ha beneficiado a 85 familias, y actualmente se desarrolla una segunda etapa, orientada al mejoramiento de la calidad de los servicios ofrecidos y a la inclusión de más beneficiarios. En el artículo se describen, a grandes rasgos, las características de los municipios objeto, así como el desarrollo y resultados del mismo.

  19. O estresse no trabalho uma análise teórica de seus conceitos e suas inter relações

    Directory of Open Access Journals (Sweden)

    Luciano Zille Pereira

    2010-10-01

    Full Text Available Este estudo objetiva aprofundar o entendimento sobre o estresse e suas implicações, abordando o tema em relação aos seus elementos conceituais, incluindo as tipologias, mecanismos, fisiologia, principais sintomas, correntes teóricas que orientam as pesquisas na área, bem como resultados de pesquisas (SEYLE, 1936, 1956; COUTO, 1987; COOPER et al.,1988; KARASEK e TORRES, 1996; LEVI, 2003 e 2005; ZILLE, 2005; GUYTON e HALL, 2006. Do ponto de vista metodológico, em relação aos fins, este estudo enquadra-se como uma pesquisa de natureza descritiva e em relação aos meios, como uma pesquisa bibliográfica (VERGARA, 2006; GONÇALVES, C. A. e MEIRELLES, A. M, 2004. Como conclusões apresentam-se considerações que relacionam as manifestações de estresse e suas implicações no cotidiano dos trabalhadores, ressaltando a teoria e os resultados das pesquisas que serviram de referência para este estudo.

  20. A influência das normas nos processos de trabalho: o caso da Prefeitura Municipal de Panambi-RS

    Directory of Open Access Journals (Sweden)

    Denise Dexheimer

    2013-05-01

    Full Text Available Este artigo identifica como as normas explícitas na cultura organizacional influenciam os processos de trabalho dos funcionários públicos da Prefeitura Municipal de Panambi/RS. Após a caracterização da organização, no referencial teórico encontram-se algumas definições sobre tipos de organizações, cultura organizacional, normas e processos de trabalho. Em termos metodológicos, com base em Vergara (2009 o estudo classifica-se quanto aos fins como uma pesquisa descritiva. Quanto aos meios, o estudo se classifica como pesquisa de campo, pesquisa bibliográfica e pesquisa documental. Foram aplicadas 18 questões com 30 funcionários da referida Prefeitura a fim de verificar qual era a percepção que os funcionários possuíam sobre as normas vigentes, assim como identificar quais normas reguladoras que mais dificultavam o andamento dos processos de trabalho. Após esses diagnósticos foram propostas estratégias que possam viabilizar um melhor e mais eficiente processo de práticas na Prefeitura Municipal de Panambi/RS. Com a conclusão do trabalho, percebeu-se o quanto as normas organizacionais influenciam os processos de trabalho, afetando diretamente os serviços prestados pela organização, podendo determinar os resultados e desempenhos organizacionais.

  1. Freshwater monsoon related inputs in the Japan Sea: a diatom record from IODP core U1427

    Science.gov (United States)

    Ventura, C. P. L.; Lopes, C.

    2016-12-01

    Monsoon rainfall is the life-blood of more than half the world's population. Extensive research is being conducted in order to refine projections regarding the impact of anthropogenic climate change on these systems. The East Asian monsoon (EAM) plays a significant role in large-scale climate variability. Due to its importance to global climate and world's population, there is an urgent need for greater understanding of this system, especially during past climate changes. The input of freshwater from the monsoon precipitation brings specific markers, such as freshwater diatoms and specific diatom ecological assemblages that are preserved in marine sediments. Freshwater diatoms are easily identifiable and have been used in the North Pacific to reconstruct environmental conditions (Lopes et al 2006) and flooding episodes (Lopes and Mix, 2009). Here we show preliminary results of freshwater diatoms records that are linked with river discharge due to increase land rainfall that can be derived from Monsoon rainfall. We extend our preliminary study to the past 400ky.

  2. RESEARCH AND DEVELOPMENT AND STOCK PRICES OF BRAZILIAN COMPANIES: AN EMPIRICAL STUDY

    Directory of Open Access Journals (Sweden)

    Aridelmo José Campanharo Teixeira

    2012-09-01

    Full Text Available The aim of the present study is to identify the relationship between spending on research and development (R&D and the stock price of Brazilian companies listed for trading on the São Paulo Stock Exchange (Bovespa, following on the studies of Lopes (2001;2002 and Rezende (2005 about the value-relevance of accounting information in Brazil. This empirical-analytic study was based on the model of Collins et al. (1997, which is a proxy for the Residual Income Valuation (RIV model of Ohlson (1995, and on the classification of technological intensity in the study of Chan et al. (1990, carried out in the United States. The sample consisted of Brazilian firms with shares traded on the Bovespa between 1996 and 2006. By means of multiple regressions we identified that R&D spending is not statistically significant for the stock prices of the firms analyzed. These conclusions do not corroborate the findings of Chan et al. (1990, but do provide support for the studies of Ohlson (1995 and Lopes (2001; 2002 and complement the study by Rezende (2005, since our results indicate that earnings is statistically significant for stock price, with a positive relationship even after deducting R&D spending accounted for as expense. The situation is different for book value, which ceased being statistically significant and being related with stock price after deducting R&D spending accounted for as investment.

  3. Phonological awareness and general performance in reading: What’s the relation? A study with 2nd and 3rd year fundamental school students

    Directory of Open Access Journals (Sweden)

    Ana Paula Couceiro Figueira

    2017-01-01

    Full Text Available The objective of this study was to test the content and concurrent validity of Prolec-R (FIGUEIRA; LOPES, n.d., investigation version, exploring the relations as a proof of phonological awareness (phoneme synthesis, SICOLE-R evaluation (FIGUEIRA; LOBO; LOPES; JIMÉNEZ, n.d., investigation version. The theoretical background comprises the evaluation of cognitive processes involved in reading (JIMENEZ’S and CUETOS’S perspectives, in which the two tests employed assume too evaluate such processes, and are considered concurrent procedures. Both are destined to children from 6 to 12 years old. The methodology used, for exploration and accessibility, a sample containing children from the 2nd and 3rd year of elementary school, from the public and education systems in Coimbra and Beira Interior Norte. The results revealed the existence of a positive and significant relation between the reading of words, reading of pseudo words, grammatical structures, punctuation marks and sentence comprehension (PROLEC-R and the phoneme synthesis (SICOLE-R.

  4. The wavefront of the radio signal emitted by cosmic ray air showers

    CERN Document Server

    Apel, W D; Bähren, L; Bekk, K; Bertaina, M; Biermann, P L; Blümer, J; Bozdog, H; Brancus, I M; Cantoni, E; Chiavassa, A; Daumiller, K; de Souza, V; Di Pierro, F; Doll, P; Engel, R; Falcke, H; Fuchs, B; Gemmeke, H; Grupen, C; Haungs, A; Heck, D; Hörandel, J R; Horneffer, A; Huber, D; Huege, T; Isar, P G; Kampert, K -H; Kang, D; Krömer, O; Kuijpers, J; Link, K; Luczak, P; Ludwig, M; Mathes, H J; Melissas, M; Morello, C; Oehlschläger, J; Palmieri, N; Pierog, T; Rautenberg, J; Rebel, H; Roth, M; Rühle, C; Saftoiu, A; Schieler, H; Schmidt, A; Schröder, F G; Sima, O; Toma, G; Trinchero, G C; Weindl, A; Wochele, J; Zabierowski, J; Zensus, J A

    2014-01-01

    Analyzing measurements of the LOPES antenna array together with corresponding CoREAS simulations for more than 300 measured events with energy above $10^{17}$eV and zenith angles smaller than $45^\\circ$, we find that the radio wavefront of cosmic-ray air showers is of hyperbolic shape. At axis distances $\\gtrsim 50$m, the wavefront can be approximated by a simple cone. According to the simulations, the cone angle is clearly correlated with the shower maximum. Thus, we confirm earlier predictions that arrival time measurements can be used to study the longitudinal shower development, but now using a realistic wavefront. Moreover, we show that the hyperbolic wavefront is compatible with our measurement, and we present several experimental indications that the cone angle is indeed sensitive to the shower development. Consequently, the wavefront can be used to statistically study the primary composition of ultra-high energy cosmic rays. At LOPES, the experimentally achieved precision for the shower maximum is lim...

  5. Fronteiras do corpo político: a invenção do corpo abjeto em “A caolha”

    Directory of Open Access Journals (Sweden)

    Alex dos Santos Guimarães

    2014-12-01

    Full Text Available A partir da análise do conto A caolha, de Júlia Lopes de Almeida, examinamos a construção do corpo feminino ligado à sua inserção sociocultural nos limites fixados pelo sistema patriarcal dominante em seu contexto de produção. Problematizando as margens a partir das fronteiras abertas pela construção de um corpo abjeto, dentro do discurso da autora, analisamos os limites da representação dentro de uma perspectiva política de gênero. From the analysis of the short story A caolha, written by Julia Lopes de Almeida, we examine the construction of the female body connected to its socio-cultural integration within the limits set by the dominant patriarchal system in its context. Discussing the limits of the borders opened by the construction of an abject body, within the discourse of the author, we analyse the edges of representation within a political perspective of gender.

  6. Status of the forensically important genus Ophyra (Diptera: Muscidae in Argentina Estado del género de importancia forense Ophyra (Diptera: Muscidae en Argentina

    Directory of Open Access Journals (Sweden)

    Luciano D. Patitucci

    2010-06-01

    Full Text Available The genus Ophyra Robineau-Desvoidy is a necrophagous group of Muscidae distributed in warm climates worldwide. The information here presented is based on the compilation of distributional data obtained from material of different collections and bibliography for Argentina. Ophyra albuquerquei Lopes, Ophyra capensis (Wiedemann, Ophyra chalcogaster (Wiedemann and Ophyra solitaria Albuquerque were recorded for the first time for the country. A key for the Argentinean species is presented. Biological and forensic data of species are discussed.El género Ophyra Robineau-Desvoidy es un grupo de múscidos necrófagos distribuidos en los climas cálidos de todo el mundo. La información aquí presentada se basa en la recopilación de datos de distribución, obtenida a partir del material de diferentes colecciones y bibliografía para la Argentina. Ophyra albuquerquei Lopes, Ophyra capensis (Wiedemann, Ophyra chalcogaster (Wiedemann y Ophyra solitaria Albuquerque se registraron por primera vez para el país. Se presenta una clave para las especies argentinas. Se discuten los datos biológicos y forenses de las distintas especies.

  7. Text linguistics: memory and representation

    Directory of Open Access Journals (Sweden)

    Leonor Lopes Fávero

    2012-12-01

    Full Text Available Text Linguistics originates in Brazil in the 80s of the twentieth century. The first work that we know of is from 1981, authored by Prof. Ignacio Antonio Neiss, entitled Por uma gramática textua, which was followed by two other in 1983: Linguística textual: o que é e como se faz, by Prof. Luiz Antônio Marcuschi and Linguística textual: introdução by Leonor Lopes Favero and Ingedore Villaça Koch. Professor Neiss shows how initial attempts to textual linguistics, were generally related to structural and generative grammars. The work of Prof. Marcuschi focuses on the analysis of some text definitions and on the study of theoretical aspects in relation to their applicability. Leonor Lopes Favero and Ingedore V. Koch aim to provide the Brazilian reader with an overview of text linguistics in Europe, a recent branch of language science then. This work is part of the History of Linguistic Ideas, part of the Cultural History, which seeks to identify how at different times , a social reality is constructed, designed, and enlightened (Chartier, 1990.

  8. The new latin american historical novel: the deconstruction of a demonized profile built bythe chronicles between the years of 1559 and 1561.

    Directory of Open Access Journals (Sweden)

    Gilmei Francisco Fleck

    2017-12-01

    Full Text Available By analyzing the literary piece Lope de Aguirre: Crónicas (1559-1561, by Mampel González and Escadell Tur (1981 we aim to verify this European conqueror profile that names the book. With the main focus on Aguirre, the six chronicles related in the book present the trajectory and the happenings in Pedro de Ursúa’s expedition, in 1560, in which he had the mission of finding the treasures of El Dorado. When he established a vital link with Peru region, Aguirre, in a letter do the Spanish Crown, denaturalizes himself from his domains, a fact that coincides with a pre-declaration of Independence of the American territory. Due to the course the expedition has taken, Aguirre is betrayed by his fellows, the ones who wrote texts full of convictions against the fragmented character. Based on that, this bibliographical investigation tries to recover Aguirre’s discursive image in the chronicles mentioned in order to, comparatively with the data from these chronicles, make reference to the historical novels like Daimón, by Abel Posse (1978 and Lope de Aguirre: Príncipe de la Libertad, by Miguel Otero Silva (1979.

  9. Critical reading: integrating principles of critical discourse analysis and gender studies Critical reading: integrating principles of critical discourse analysis and gender studies

    Directory of Open Access Journals (Sweden)

    Viviane Heberle

    2008-04-01

    Full Text Available Reading has become the most important skill in EFL teaching in Brazil, if we consider factors such as students’ needs in our globalized contemporary society, institutional support, teacher demands and learning-teaching conditions in our elementary and secondary schools. The interest in reading can be observed in the large number of different publications in the area and in the priority given to it in the new national curriculum parameters for foreign language teaching. Besides, several master’s and doctoral programs in Applied Linguistics or Language Studies in Brazil include research in reading as one of their main areas, specially since the development of the National ESP Project in Brazil (Moita Lopes, 1996. Reading has become the most important skill in EFL teaching in Brazil, if we consider factors such as students’ needs in our globalized contemporary society, institutional support, teacher demands and learning-teaching conditions in our elementary and secondary schools. The interest in reading can be observed in the large number of different publications in the area and in the priority given to it in the new national curriculum parameters for foreign language teaching. Besides, several master’s and doctoral programs in Applied Linguistics or Language Studies in Brazil include research in reading as one of their main areas, specially since the development of the National ESP Project in Brazil (Moita Lopes, 1996.

  10. 'Ya la comedia es un mapa': Cervantes y la teatralización del espacio geográfico

    Directory of Open Access Journals (Sweden)

    Jörg Dünne

    2012-08-01

    Full Text Available The article is concerned with an analysis of how the Spanish Golden Age comedy and the staging of geographical space are related. The example of a "comedia de santos" by Miguel de Cervantes, El Rufián dichoso, will show that its author, like Shakespeare or Lope de Vega, introduces a predominantly geographical meaning into the traditional topos of the theatrum mundi; moreover, he uses the theatre scene and maps for constituting other spaces that cannot be visualized directly and that might be called "metageographical" spaces. Thus, Baroque literature opens the way for a new technique of spatial imaginationEl artículo se propone analizar la relación entre la comedia española del Siglo de Oro y la puesta en escena del espacio geográfico. Al ejemplo de una "comedia de santos" de Miguel de Cervantes, El Rufián dichoso, quisiéramos mostrar, que su autor, como Shakespeare o Lope de Vega, introduce una significación prioritariamente geográfica en el topos tradicional del theatrum mundi; pero además utiliza la escena y los mapas para constituir otros espacios que no pueden ser visualizados directamente y que uno podría llamar espacios "metageográficos". Así, la literatura barroca da lugar a una nueva técnica de la imaginación espacial

  11. De venta en venta hasta El Quijote. Un viaje europeo por la literatura de Mesón

    Directory of Open Access Journals (Sweden)

    Joan Oleza

    2007-12-01

    Full Text Available On these pages travel from the Canterbury Tales to the Quijote going from inn to inn throughout a European literary geography. We stop and lodge in the italian series of novelle (Sacchetti, Bandello, in the Chevalry Poems of the Renaissance (Pulci, Ariosto, in the Sixteenth Century theatre (from Gil Vicente to Lope de Rueda and the Intronati di Siena, in the Comedia Nueva and especially in the comedias de meson de Lope de Vega, in the Elizabethan Theatre (Shakesperare above all, in the Guzmán de Alfarache, in La ilustre fregona (the novel and also the commedy, and so on until the Quijote, where the multiple experience of inns and roads is closely examined. At every stop I reflecton the changing sense of the inn as the stage where a whole discourse on life and litterature is being shaped. In the particular case of Don Quijote, a real culmination point of all that european journey, the inn manages to gather a multiplicity of meanings that rank it with other great cultural instruments: the street, the book, the forum, the theatre.

  12. San Isidro, de labrador medieval a patrón renacentista y barroco en la Villa y Corte

    Directory of Open Access Journals (Sweden)

    Fernández Montes, Matilde

    2001-06-01

    Full Text Available The author discusses the evolution of the portrayal of Madrid's patron saint, Isidre, from the peasant holy man working his first posthumous miracles in the late 13th century to the canonized saint of the 17th century. On the one hand, hagiographers transformed and completed his life and miracles in order to fit them into the contemporary model of sainthood and, at the same time, meet society's expectations of the saint —especially those of Madrid's oligarchy, who monopolized the cult. On the other hand, because of Lope de Vega's portrayals of Isidre, the saint became very popular among the lower classes in the countryside as well as in the city.

    Se estudia la evolución que San Isidro sufre desde sus primeros milagros póstumos, de finales del siglo XIII, cuando aparece como un santo de carácter agrícola, hasta llegar a su canonización en el XVII. Su vida y milagros, por una parte, son transformados y completados por los hagiógrafos para ajustarse al modelo de santidad y las demandas de la sociedad del momento, especialmente por la oligarquía madrileña que monopolizaba su culto, mientras que por otra, gracias a las versiones de Lope de Vega, se acerca y extiende el personaje entre las clases populares, tanto urbanas como rurales.

  13. Ser professora, ser mulher: um estudo sobre concepções de gênero e sexualidade para um grupo de alunas de pedagogia Teachers or women: an analysis of the concepts of gender and sexuality among a group of pedagogy students

    Directory of Open Access Journals (Sweden)

    Ana Paula Costa

    2011-08-01

    Full Text Available Este trabalho tem por objetivo investigar as concepções de relações de gênero de um grupo de alunas do curso de Pedagogia que já atuam na educação escolar como professoras. Para a realização desta pesquisa qualitativa, de tipologia analítico-descritiva, foi utilizada uma entrevista semiestruturada com as universitárias escolhidas. A construção e a análise do objeto têm como fundamentação teórica os estudos de Michel Foucault, Joan Scott e Guacira Lopes Louro. Constatamos que, em um processo de "acomodação" e "resistência", as categorias "mulher" e "professora" se fundem, o que obscurece, em certa medida, a atuação da professora como profissional da educação.This study aims to investigate the concepts of gender of a group of students from the Faculty of Education, who already work as teachers in schools. For this research, a qualitative and analytic-descriptive typology, we used a semi-structured interview with the students. The construction and analysis of the object were based on theoretical studies of Michel Foucault, Joan Scott and Guacira Lopes Louro. We found that these teachers lack a training in theories and discussions focusing on sexuality and gender issues.

  14. First Trimester Aneuploidy Screening Program for Preeclampsia Prediction in a Portuguese Obstetric Population

    Directory of Open Access Journals (Sweden)

    Cláudia Teixeira

    2014-01-01

    Full Text Available Objective. To evaluate the performance of a first trimester aneuploidy screening program for preeclampsia (PE prediction in a Portuguese obstetric population, when performed under routine clinical conditions. Materials and Methods. Retrospective cohort study of 5672 pregnant women who underwent routine first trimester aneuploidy screening in a Portuguese university hospital from January 2009 to June 2013. Logistic regression-based predictive models were developed for prediction of PE based on maternal characteristics, crown-rump length (CRL, nuchal translucency thickness (NT, and maternal serum levels of pregnancy-associated plasma protein-A (PAPP-A and free beta-subunit of human chorionic gonadotropin (free β-hCG. Results. At a false-positive rate of 5/10%, the detection rate for early-onset (EO-PE and late-onset (LO-PE PE was 31.4/45.7% and 29.5/35.2%, respectively. Although both forms of PE were associated with decreased PAPP-A, logistic regression analysis revealed significant contributions from maternal factors, free β-hCG, CRL, and NT, but not PAPP-A, for prediction of PE. Conclusion. Our findings support that both clinical forms of EO-PE and LO-PE can be predicted using a combination of maternal history and biomarkers assessed at first trimester aneuploidy screening. However, detection rates were modest, suggesting that models need to be improved with additional markers not included in the current aneuploidy screening programs.

  15. “Deceiving with the Truth”, Arte Nuevo, L. 319

    Directory of Open Access Journals (Sweden)

    Víctor de Lama

    2011-06-01

    Full Text Available The rhetorical device called “deceiving with the truth” (l. 319 et seq. described by Lope de Vega in the Arte Nuevo de hacer comedias has been misinterpreted ever since Morel Fatio confused it with another device mentioned by Lope a little earlier in the text (vv. 300-301, i. e. that of the need for a surprise ending. Later commentators such as H. Rennert and A. Castro, J. de José Prades, J. M. Rozas, F. Pedraza and J. Roso Díaz failed to interpret Lope’s verses correctly, despite the fact that G. T. Northrup (1929-1930 had already offered the keys to an appropriate interpretation. In the meantime, the procedure of “deceiving with the truth” has been unconvincingly identified in works such as La Celestina and dramatic texts of the sixteenth century. In order to confirm its long tradition, the article documents the device’s origin in Terence’s comedies and its use in the Middle Ages and in works such as Don Quixote.

  16. A Spanish Episode of the Thirty Years war: The Embassy of Marquis of Cadreita near Holy Roman Empire and the approach to the Elector of Saxony (1629-1631

    Directory of Open Access Journals (Sweden)

    Fernando Negredo del Cerro

    2015-12-01

    Full Text Available In 1629, taking advantage of the trip to the Infanta Maria to marry the son of Emperor Ferdinand III-future, the Spanish Monarchy Holy Empire sent a new ambassador: Don Lope Aux Díez de Armendáriz, Marquis Cadreita I, to cover the ordinary vacancy in that court had left the Marquis de Aytona following his move to Flanders. Their mission seemed to not go beyond (and so far has understood historiography to strengthen the Spanish position in Vienna collaborating with other agents posted there. However, our research aims to show that, to rush events in the aftermath of Regensburg, the main business that ended up going Don Lope was no other than to try to redirect the relations with Saxony, Dresden possibly using, if necessary, to prevent uncompromising policy of Ferdinand II provoke agreement with Gustavus Adolphus Lutheran Elector. The details of this embassy are the focus of this article, not for a scholarship itch, but because we believe that the lack of this and other similar events far removed from the traditional image of the seventeenth-century Spain, greatly distorts the perception of the Thirty Years War and the role played in it by the Catholic monarchy.

  17. A ESCOLA INFANTIL E O CINEMA

    Directory of Open Access Journals (Sweden)

    Tanea Regina Pereira

    2012-07-01

    Full Text Available http://dx.doi.org/10.5007/1980-4512.2012n26p108 Ao perceber o entusiasmo das crianças pelo cinema e tendo entrado em contato com a obra de Teixeira, Lopes e Larrosa (2006, tive certeza de que esta arte tinha o poder de abrir nossos olhos, nossa mente para um mundo sem fronteiras, no qual podemos viajar tal qual acontece em nossa imaginação quando lemos os livros. Com estas ferramentas podemos ir para o passado e para o futuro; para o Sol, para a Lua ou para o mar; posso ser branco, negro ou amarelo; posso passar de bruxa feia e fada madrinha num instante; posso ser líder, rei, presidente ou vilão. Abstract Seeing the children's enthusiasm for film and having come into contact with the work of Teixeira Lopes and Larrosa (2006, I knew that art had the power to open our eyes, our minds to a world without borders, in which can travel just as in our imagination when we read books. With these tools we can go into the past and the future, for the sun to the moon or the sea, could be white, black or yellow, can I go from ugly witch and fairy godmother in an instant, can be a leader, king, President or villain.

  18. Titan’s mid-latitude surface region from Cassini/VIMS data: Implications on the composition

    Science.gov (United States)

    Solomonidou, Anezina; Coustenis, Athena; M. C Lopes, Rosaly; Malaska, Michael; Rodriguez, Sebastien; Drossart, Pierre; Elachi, Charles; Schmitt, Bernard; Philippe, Sylvain; Janssen, Michael A.; Hirtzig, Mathieu; Wall, Stephen D.; Lawrence, Kenneth J.; Altobelli, Nicolas; Bratsolis, Emmanuel; Radebaugh, Jani; Stephan, Katrin; Brown, Robert H.; Le Mouélic, Stephane; Le Gall, Alice; Villanueva, Edward; Bloom, Anthony; Witasse, Olivier; Matsoukas, Christos; Schoenfeld, Ashley

    2017-10-01

    We investigate the surface of Titan using spectro-imaging near-infrared data from the Cassini Visual and Infrared Mapping Spectrometer (VIMS). We apply a radiative transfer code to first determine the contributions of atmospheric haze to the Titan spectrum and then derive the surface albedo (Solomonidou et al. 2014; 2016). We focus here on the geological major units identified in Lopes et al. (2010, 2016), Malaska et al. (2016) and Radebaugh et al. (2016) from Synthetic Aperture Radar (SAR), data including mountains, different types of plains, labyrinths, impact craters, dune fields, and alluvial fans. We find that all regions classified as being the same geomorphological unit in SAR exhibit a coherent spectral response after the VIMS data analysis, thus suggesting a good correlation in the classification between SAR and VIMS. The Huygens landing site appears to be compositionally similar to one type of plains unit (variable plains), suggesting similar plain formation mechanisms. We have sub-categorized the VIMS data into three albedo categories (high, medium, low). By matching the extracted albedos with candidate materials for Titan’s surface (GhoSST database), we find that all regions of interest fall into one out of three main types of major candidate constituents: water ice, tholin-like material, or an unknown, very dark material. This suggests that Titan’s surface is possibly dominated by tholin-like material and a very dark unknown (most likely organic) material, and that most of the surface is covered by atmospheric/organic deposits. Water ice is also present at a number of regions as major constituent at latitudes higher than 30N and 30S. The surface albedo differences and similarities among the various geomorphological units constrain the implications for the geological processes that govern Titan’s surface and interior (e.g. aeolian, fluvial, sedimentary, lacustrine, cryovolcanic, tectonic).References: Lopes et al.: Icarus, 205, 540-558, 2010; Lopes

  19. Advances in Bayesian Model Based Clustering Using Particle Learning

    Energy Technology Data Exchange (ETDEWEB)

    Merl, D M

    2009-11-19

    Recent work by Carvalho, Johannes, Lopes and Polson and Carvalho, Lopes, Polson and Taddy introduced a sequential Monte Carlo (SMC) alternative to traditional iterative Monte Carlo strategies (e.g. MCMC and EM) for Bayesian inference for a large class of dynamic models. The basis of SMC techniques involves representing the underlying inference problem as one of state space estimation, thus giving way to inference via particle filtering. The key insight of Carvalho et al was to construct the sequence of filtering distributions so as to make use of the posterior predictive distribution of the observable, a distribution usually only accessible in certain Bayesian settings. Access to this distribution allows a reversal of the usual propagate and resample steps characteristic of many SMC methods, thereby alleviating to a large extent many problems associated with particle degeneration. Furthermore, Carvalho et al point out that for many conjugate models the posterior distribution of the static variables can be parametrized in terms of [recursively defined] sufficient statistics of the previously observed data. For models where such sufficient statistics exist, particle learning as it is being called, is especially well suited for the analysis of streaming data do to the relative invariance of its algorithmic complexity with the number of data observations. Through a particle learning approach, a statistical model can be fit to data as the data is arriving, allowing at any instant during the observation process direct quantification of uncertainty surrounding underlying model parameters. Here we describe the use of a particle learning approach for fitting a standard Bayesian semiparametric mixture model as described in Carvalho, Lopes, Polson and Taddy. In Section 2 we briefly review the previously presented particle learning algorithm for the case of a Dirichlet process mixture of multivariate normals. In Section 3 we describe several novel extensions to the original

  20. O PROFISSIONAL DE RECURSOS HUMANOS E AS SUAS COMPETÊNCIAS ESTRATÉGICAS PARA O NEGÓCIO.

    Directory of Open Access Journals (Sweden)

    Ediane Gomes Eduardo

    2017-06-01

    Full Text Available É possível constatar a complexidade de abordamos o tema de estratégia se atrelarmos este a outro tema: competências. Os profissionais que atuam com o RH, fundamentais por serem agentes de mudanças, poderiam ser vistos além de uma área de apoio? A partir deste questionamento fora realizada a fundamentação teórica, no qual o intuito foi identificar autores que pudessem contribuir com a proposta do artigo que seria o de identificar as competências que tornariam o profissional e sua atuação na empresa como algo estratégico. Para tanto, utilizou-se compreensões acerca do tema defendidos por autores como Villas Boas e Andrade (2009 e Godoy (2008 que transitam por ideias acerca de competências e ainda Andrade e Amboni (2011 que relata vantagem competitiva e sua relação com estratégia. Como método de pesquisa foi utilizado o teste de evocação de palavras, apresentado por Vergara (2008 como metodologia, do qual participaram 100 pessoas, posteriormente divididos em dois grupos, nos quais 50 eram profissionais que atuam com RH (perfil1 e outros 50 que eram gestores de áreas afins (perfil 2. Como resultado, foi possível identificar que existe uma maior necessidade de clareza sobre estratégia e cultura organizacional para as áreas, para que posteriormente as competências individuais possam ser potencializadas e transformadas em competências organizacionais, pois assim tornam-se vantagem competitiva.    It is possible to notice a relevant complexity of the strategy theme if we link it to another one: competencies. Can professionals who work within the Human Resources (HR area, central professionals for being considered agents of change, be seen more than professionals in a support area? Based on this questioning, this research, in which the goal was to identify which competencies of the professionals who work in the HR sector can take them to a strategic profile going beyond professionals from a simple area of support,

  1. FOTOGRAFÍA Y PAISAJE CONTEMPORÁNEO: CONCEPTOS Y MÉTODOS

    Directory of Open Access Journals (Sweden)

    Ignacio Bisbal Grandal

    2011-05-01

    Full Text Available RESUMEN La Mission Photographique de la DATAR (Délégation à l’Aménagement du Territoire et à l’Action Régionale se creó en 1984. Su labor consistió originalmente en "representar el paisaje francés de los años 80". Los más de 200.000 negativos que se realizaron suscitaron un amplio debate y sentaron buena parte de las bases del estudio contemporáneo del paisaje en Francia. El presente artículo analiza el modo en que este hito en la fotografía del paisaje ha permitido el desarrollo de dos conceptos fundamentales en el paisaje contemporáneo. El primero es el de paisaje intermedio o cotidiano, aquel cuyo valor no reside en su belleza o historia, sino en el hecho de constituir reflejo exacto de la vida de sus habitantes. El segundo concepto, directamente vinculado al paisaje intermedio, es el de dinámica de paisaje, es decir, el paisaje concebido como transcurso, en el que su esencia se aprecia únicamente a través del cambio y la transformación. Estos dos conceptos resultan ser una clave determinante en el desarrollo de métodos de análisis fotográfico del paisaje. Su aplicación resulta especialmente interesante en el caso de los paisajes abandonados u obsoletos. Por medio del trabajo fotográfico realizado por Camilo José Vergara en los guetos estadounidenses se analiza el modo en que estos conceptos se aplican de modo integrado.SUMMARY The Mission Photographique of DATAR (Délégation à l’Aménagement du Territoire et à l’Action Régionale - Agency for Spatial Planning and Regional Action was established in 1984. Its work was originally to "represent the French landscape of the 1980’s". Over 200,000 film negatives were produced and caused wide debate, laying much of the foundations of the contemporary study of landscape in France. This article examines how this milestone in landscape photography has allowed the development of two key concepts in contemporary landscape. The first is the intermediate, or everyday

  2. [Robot-aided training in rehabilitation].

    Science.gov (United States)

    Hachisuka, Kenji

    2010-02-01

    Recently, new training techniques that involve the use of robots have been used in the rehabilitation of patients with hemiplegia and paraplegia. Robots used for training the arm include the MIT-MANUS, Arm Trainer, mirror-image motion enabler (MIME) robot, and the assisted rehabilitation and measurement (ARM) Guide. Robots that are used for lower-limb training are the Rehabot, Gait Trainer, Lokomat, LOPES Exoskeleton Robot, and Gait Assist Robot. Robot-aided therapy has enabled the functional training of the arm and the lower limbs in an effective, easy, and comfortable manner. Therefore, with this type of therapy, the patients can repeatedly undergo sufficient and accurate training for a prolonged period. However, evidence of the benefits of robot-aided training has not yet been established.

  3. «Os Mistérios do Além no Antigo Egipto» : questões sobre a exploração museológica de um quadro conceptual

    Directory of Open Access Journals (Sweden)

    Rogério Ferreira de Sousa

    2008-01-01

    Full Text Available This article aims to point out the possibilities offered by a theoretical frame to the development of an exhibition plan. The «Mysteries of the Beyond in Ancient Egypt», the subject of the exhibition that took place in the Casa-Museu Teixeira Lopes from 26th February to the 26th of March of 2008, are here discussed from a theoretical point of view, in order to identify the guidelines that should have been present in the museological treatment of the Egyptian collection of Museu de História Natural da Universidade do Porto. The problems raised by the lack of scientific criteria adopted in the museological work are thus the main topic of our discussion.

  4. A Fiandeira do Assaí em “Era um Poaeiro”, de Alfredo Marien

    OpenAIRE

    Navarro, Eliziane Fernanda; Cocco, Marta Helena

    2014-01-01

    Dentre vários aspectos mítico-simbólicos existentes na obra Era um Poaieiro, de Alfredo Marien, este estudo se detém na presença do arquétipo da Fiandeira e sua respectiva remitologização, iniciando pela história das Moiras e Parcas, passando por e dando destaque para a personagem Penélope, de Homero, até chegar a Teresa, personagem da referida obra mato-grossense, com o objetivo de contribuir para ampliar o campo de leituras a ela relacionadas. Este artigo está fundamentado nos pressupostos ...

  5. Atomistic Force Field for Pyridinium-Based Ionic Liquids: Reliable Transport Properties

    DEFF Research Database (Denmark)

    Voroshylova, I. V.; Chaban, V. V.

    2014-01-01

    Reliable force field (FF) is a central issue in successful prediction of physical chemical properties via computer simulations. This work introduces refined FF parameters for six popular ionic liquids (ILs) of the pyridinium family (butylpyridinium tetrafluoroborate, bis(trifluoromethanesulfonyl)......Reliable force field (FF) is a central issue in successful prediction of physical chemical properties via computer simulations. This work introduces refined FF parameters for six popular ionic liquids (ILs) of the pyridinium family (butylpyridinium tetrafluoroborate, bis...... and elevated temperature. The developed atomistic models provide a systematic refinement upon the well-known Canongia LopesPadua (CL&P) FF. Together with the original CL&P parameters the present models foster a computational investigation of ionic liquids....

  6. Poetry SLAMS - Literacy Literacies of Reexistence in/to the Contemporary World

    Directory of Open Access Journals (Sweden)

    Cynthia Agra de Brito Neves

    2017-10-01

    Full Text Available A brand new phenomenon of oral and performative poetry known as slam is currently flourishing. It is a competition in which poets from the suburbs have their voices to be heard and remark everyday adversities in a socially engaged way. Addressing themes such as racism, violence, drugs, chauvinism, and sexism, those battles require a politicized audience, a listening and an active thinking. The slammers incorporate “voices from the margin” (HALL, 2003, “from the South” (MOITA LOPES, 2006, or “from the body” (DE CERTEAU, 1994. Moreover, by reciting authorial poems to a panel of five judges chosen among members of the audience, slammers became agents of a literacy of re-existence (SOUZA, 2011. The winner takes the books!

  7. O “heróico cinema português” : 1930-1950

    Directory of Open Access Journals (Sweden)

    Carla Patrícia Silva Ribeiro

    2011-01-01

    Full Text Available The decades of the thirties and forties of the portuguese twentieth century are, within the rather irregular path of national cinema, the era of greater regularity. Indeed, it was this interwar period which saw considerable development of national cinematic life. This proved to be a dynamic time, both in terms of production, with the advent of sound films and national producers and their studios, both as regards to consumption, with the proliferation of cinemas; there was still the advent of magazines, like Kino, Imagem or Cinéfilo, and the emergence of important portuguese filmmakers – António Lopes Ribeiro, Leitão de Barros, Jorge Brum do Canto, Chianca Garcia – producing relevant cinematographic works. Therefore, this article aims to present the national cinematographic project, enabling a clearer understanding of its development, in the period of construction of Estado Novo.

  8. The self and the new language: identities and foreign language learning and teaching

    Directory of Open Access Journals (Sweden)

    Letícia Coroa do Couto

    2012-01-01

    Full Text Available Students’ attitudes towards a FL they are learning can have considerable influence on the language acquisition process. Identities determine how teachers’ and students’ relationship with the world is built across time and space (NORTON, 2000, and so they permeate the whole teaching/learning process. They also bear a close relationship with the context, and are socially constructed, thus influencing actions and interactions, while also being influenced by them (HALL, 2000; MOITA LOPES, 2003; NORTON, 2000; SILVA, 2000; WOODWARD, 2000. The goal of this work is to sensitize  the agents in the FL teaching/learning process to the importance of the issue of identities. Thus, further research may be carried out for a better understanding of this complex web of relationships and (reconstructions that can influence the whole FL teaching/learning process, and thereby advance improvements to it.

  9. H1N1 in dialysis units: Prevention and management

    Directory of Open Access Journals (Sweden)

    Karkar Ayman

    2010-01-01

    Full Text Available Dialysis patients are at increased risk of contracting influenza A H1N1 and deve-loping serious illness. Increasing the awareness of dialysis patients and continuous education and training of medical staff on early recognition and management of influenza A H1N1 can help in saving the life of patients. Antiviral drugs and influenza vaccines are effective in providing ade-quate immunity in dialysis patients with strict implementation of infection control policies and procedures can help in preventing and controlling the dissemination of influenza A H1N1 in dia-lysis units. We report a case of a patient who presented with HINI influenza and developed acute kidney injury during his hospitalization and his course with disease.

  10. COMPARED AESTHETICS FLASHES: READING CAPE-VERDEAN IMAGES

    Directory of Open Access Journals (Sweden)

    Simone Caputo Gomes

    2010-11-01

    Full Text Available The essay presents, according to the theoretical line of Comparative Aesthetics, a gallery of Cape Verdean's paintings and texts to be read throughout  the relationship between literature and painting, in order to demonstrate how the male and female points of view perceive the images of women and their daily lives. Writers Fátima Bettencourt, Manuel Lopes, Maria Margarida Mascarenhas, Oswaldo Osório, Vasco Martins, Vera Duarte will dialogue among themselves and with the painters of Armando do Rosário, Kiki Lima, Misá, Sandro Brito, Tchalê Figueira and Tony Barbosa, from diverse visions of social situation of the social context of women in Cape Verde, under the inspiration or challenge to the canonical Botticelli Venus.

  11. Sarcophagidae (Diptera de importancia forense en la puna de Catamarca, Argentina: a ovoviviparidad como ventaja en condiciones de extrema aridez Sarcophagidae (Diptera of forensic importance at a high altitude desert in Catamarca, Argentina: ovoviviparity as an advantage under extreme arid conditions

    Directory of Open Access Journals (Sweden)

    Fernando H. Aballay

    2011-12-01

    Full Text Available A pesar de ser fauna necrófaga y de estar presentes en cadáveres humanos, los Sarcophagidae no suelen utilizarse en estudios forenses debido a la dificultad en su identificación y la poca información sobre su biología. En este trabajo, se identificaron las especies de Sarcophagidae asociadas a cadáveres y se estudió su relación con los estados de descomposición. Se analizaron las preferencias por los sustratos cadavéricos (cerdo y llama y las condiciones microambientales (sol y sombra en un ambiente de altura (3.600 msnm, durante la primavera. Se utilizaron dos cadáveres de cerdo dispuestos al sol y a la sombra y un cadáver de llama dispuesto al sol. Se colectaron 597 individuos pertenecientes a cinco especies de Sarcophagidae: M. antofagastensis Mulieri, Mariluis & Aballay (n=347, M. quimaliensis (Lopes (n=117, M. rusca (Hall (n=32, M. penai (Lopes (n=5 y M. aulacophyto Pape (n=96. Tanto M. antofagastensis, como M. quimaliensis fueron las únicas especies con colonización efectiva y representaron el 78% del total de adultos colectados. Microcerella antofagastensis fue la colonizadora primaria. Ambas especies respondieron de forma similar ante las condiciones microambientales y prefirieron el cadáver de cerdo. Se discute la importancia de M. antofagastensis y M. quimaliensis, como especies indicadoras y las posibles ventajas de la ovoviviparidad frente a otras especies ovíparas, en condiciones de extrema aridez.Despite their prevalence in human corpses during decomposition, Sarcophagidae are not frequently used in forensic studies due to the difficulty in their identification and to the lack of information on their biology. In this paper, we identified the species of Sarcophagidae associated to corpses and studied their relationship to decomposition stages. We analyzed preferences for different cadaveric substrates (pig and lama and microenvironmental conditions (shade, sun at a site located at 3600 m.a.s.l. during the spring. Two

  12. Note e recensioni

    Directory of Open Access Journals (Sweden)

    Autori Vari

    2012-05-01

    Full Text Available Volumi Kendall L. Walton, Mimesi come far finta [Chiara Bisignano] • Nick Zangwill, La metafisica della bellezza [Filippo Focosi] • Dominic McIver Lopes, A Philosophy of Computer Art [Elisa Caldarola] • Jacques Rancière, Béla Tarr, le temps d’après [Domenico Spinosa] • Stefano Marino, Un intreccio dialettico. Teoresi, estetica, etica e metafisica in Theo­dor W. Adorno [Marco Jacobsson] • Antonio Somaini, Ejzenštejn. Il cinema, le arti, il montaggio [Marie Rebecchi] • Aa.Vv., Alla fine delle cose. Contributi a una storia critica delle immagini [Marie Rebecchi]Convegni Merleau-Ponty et l’esthétique aujourd-hui, Università degli Studi di Milano, 5-6 maggio 2011 [Pietro Conte

  13. O professor de inglês para negócios: reflexos de uma identidade em construção = The business english teacher: reflexes of an identity under construction

    Directory of Open Access Journals (Sweden)

    Sá, Elisa Mattos de

    2011-01-01

    Full Text Available Este artigo tem como principal objetivo refletir sobre a identidade do professor de inglês para negócios, considerando-se a identidade como um processo construído pelas relações que os sujeitos estabelecem entre si em situações de interação social (Moita Lopes, 2003; Hall, 2000; Rajagopalan, 1998, pela linguagem, lugar onde o ser humano se constitui como sujeito e constrói sua realidade (Bakhtin, 1981. Pensado qualitativamente, este trabalho apresenta excertos de uma entrevista semi-estruturada baseada no modelo de Bereckzky (2009, nos quais pode-se perceber reflexos identitários de um professor de inglês para negócios, identidade essa negociada e renegociada nas relações que o professor estabelece com seus alunos e suas práticas de ensino

  14. Assistance protocol for venous ulcers patients: validation of contents

    Directory of Open Access Journals (Sweden)

    Daniele Vieira Dantas

    2013-07-01

    Full Text Available Venous ulcers require complex treatment and are responsible for significant morbidity and mortality rates. This study aims at identifying aspects validated by the jury for the preparation of an assistance protocol for venous ulcer sufferers. It is a descriptive and quantitative research, with 39 professionals (30 nurses, 7 doctors and two physiotherapists, held at the Onofre Lopes University Hospital, between April and July/2010. Data collection began through a questionnaire checklist. Analysis was performed through Statistical Package for Social Science 15.0, assessing compliance with guidelines. Results were the compositional aspects of the protocol: assessment of patient and lesion history/documentation, wound care/perilesional skin, dressing suggestion, use of antibiotics and pain treatment, surgical treatment/medication, improving venous return and relapse prevention, patient referral, professional training and referral/counter-referral. It was concluded that to compose the protocol, aspects related to diagnosis, treatment and injury prevention must be considered.

  15. El Monasterio de San Isidoro del Campo en Santiponce (Sevilla)

    OpenAIRE

    Mateo Gómez, Isabel; López-Yarto Elizalde, Amelia; Ruíz Hernando, José Antonio

    1997-01-01

    El monasterio de San Isidoro recibe su advocación del célebre santo sevillano que, según la tradición, fue enterrado en aquel lugar. Sobre la ermita que guardaba su memoria, Alonso Pérez de Guzmán. "Guzmán el Bueno", y su mujer, María Alfonso Coronel, edificaron un monasterio en 1298, que entregaron a la orden del císter. En 22 de septiembre de 1431, a causa de la relajación de costumbres. tomaban posesión los jerónimos de Fray Lope de Olmedo. a quien se lo había entregado e...

  16. Revision of Polietina Schnabl & Dziedzicki (Diptera, Muscidae and considerations on its new systematic position

    Directory of Open Access Journals (Sweden)

    Márcia Souto Couri

    1997-01-01

    Full Text Available Polietina Schnabl & Dziedzicki, 1911 has been placed in different subfamilies mainly based on chaetotaxy and general morphology of adults. This genus has most recently been placed in Reinwardtiinae on the basis of larval characters. The male terminalia, however, indicates that Polietina is phylogenetically close to the basal group of Muscinae. By the analysis of all available type material, the genus and nine species are redescribed: P. bicolor Albuquerque; P. distincta Couri & Lopes; P. flavithorax (Stein; P. major Albuquerque; P. minor Albuquerque; P. orbitalis (Stein; P. rubella (Wulp; P. steini (Enderlein and P. concinna (Wulp which is revalided and lectotype designated. Neotypes are proposed to Polietina flavithorax and to Polietina orbitalis. Polietina wulpi is proposed as a new species. A key is also presented.

  17. Del libro de las polémicas: La bardolatría, el caracol y los cangrejos: una polémica sobre la poesía de Guillermo Valencia. Una polémica sobre la poesía de Guillermo Valencia

    Directory of Open Access Journals (Sweden)

    Vicente Pérez Silva

    1980-06-01

    Full Text Available A las plumas de Lope de Azuero y Bernardo Arias Trujillo se agrega ahora la de Eduardo Carranza, entusiasta animador y destacado exponente del grupo de poetas denominado Piedra y Cielo, y "uno de los temperamentos más poéticos que ha tenido nuestro país", al decir atinado de Andrés Holguín. Carranza, dueño de una extraordinaria capacidad para el canto -son múltiples sus creaciones poéticas- también arremetió contr a el maestro Guillermo Valencia, considerado por la mayoría del pueblo culto de Colombia como "el máximo poeta de la patria".

  18. Alinhavando nós: considerações sobre o simbólico na escrita feminina do trauma de guerra em A casa das sete mulheres, de Letícia Wierzchowski.

    Directory of Open Access Journals (Sweden)

    Denise Borille de Abreu

    2015-06-01

    Full Text Available O presente artigo propõe aproximações entre estudos literários e psicanalíticos para um maior entendimento do trauma gerado nas mulheres pela guerra e da particularidade da escrita feminina do trauma de guerra, tomando-se como exemplo a narrativa A casa das sete mulheres, de Leticia Wierzchowski. O objetivo principal deste ensaio é mostrar como se dá o processo de simbolização do trauma de guerra através da escrita feminina, comparada aqui ao ato de tecer, atividade que remonta às moiras gregas descritas por Hesíodo e à personagem Penélope, da Odisséia de Homero.

  19. LA POESÍA EN EL AULA: UNA PROPUESTA DIDÁCTICA

    Directory of Open Access Journals (Sweden)

    Isabel Gallardo Álvarez

    2010-01-01

    Full Text Available Impartir poesía en el aula ha sido, para muchos docentes, un trabajo difícil y a veces ininteligible. Ello puede deberse a la estructura y al contenido de este género lírico, que se especializa en emitir emociones y no en contar acciones o ideas. Es por eso que este artículo pretende darle herramientas al docente de Español, para que se adentre en el género lírico y pueda guiar al estudiantado a una lectura lúdica, dialógica, plurisignificativa y creativa, tal y como lo solicitan los programas vigentes de Español en Costa Rica. Por ello, se presenta un ejemplo de análisis, usando el poema Penélope de Marta Rojas que pretende ser un modelo para discutir y mejorar en el aula de Español.

  20. A lâmpada do desejo: uma leitura do conto “A fuga” de Clarice Lispector

    Directory of Open Access Journals (Sweden)

    Flávia Aninger de Barros Rocha

    2017-06-01

    Full Text Available No presente trabalho propõe-se a analisar o conto A Fuga, de Clarice Lispector, escrito em 1940 e publicado em A Bela e a Fera (1979, à luz dos conceitos freudianos do Princípio do Prazer e do Princípio da Realidade e outras ideias também desenvolvidas no texto O Mal-Estar na Civilização (1930. Além disso, tomaremos como referências da representação feminina para a protagonista do conto em estudo, a personagem Sara, do Antigo Testamento, Sofia, personagem do romance Atire em Sofia, de Sônia Coutinho (1989 e Penélope, personagem clássica de Homero.

  1. Localization of the candidate gene d-amino acid oxidase outside the refined 1-cM region of spinocerebellar ataxia 2

    Energy Technology Data Exchange (ETDEWEB)

    Auburger, G.; Gispert, S.; Lunkes, A. [Univ. Hospital, Duesseldorf (Germany)] [and others

    1995-10-01

    Spinocerebellar ataxia 2 (SCA2) is one form of the neurodegenerative autosomal dominant cerebellar ataxias and has been linked to chromosome 12q in 25 previously described and 13 new families from a founder collective of {ge}500 patients in Holguin, Cuba. Although SCA2 in most patients cannot be distinguished from other spinocerebellar ataxias by clinical criteria, in some patients it exhibits a particular phenotype with early neuropathy/late slow saccades and late myoclonus. Autopsy in 11 patients demonstrated olivo-ponto-cerebellar atrophy with a selective sparing of the dentate nucleus. Complete allelic association within the Holguin population was established with the microsatellite D12S105, and the candidate region was determined to be within a 6-cM region distal to the marker D12S84, contrasting previous reports by Pulst and Lopes-Cendes and according to preliminary data between D12S84 and D12S1329. 17 refs., 1 fig., 1 tab.

  2. Clínica de animais de companhia e espécies exóticas: pododermatite ulcerativa em aves e mamíferos exóticos

    OpenAIRE

    Costa, Inês Arriaga da

    2014-01-01

    Este relatório tem como base o estágio curricular desenvolvido na clínica veterinária Vetolaias, como culminar do Mestrado Integrado em Medicina Veterinária da Universidade de Évora, na área de clínica de animais exóticos e de companhia, sob a orientação do Dr. Hugo Lopes. O relatório é composto por duas partes: descrição das atividades desenvolvidas nas várias áreas clínicas e um breve tratamento estatístico das mesmas; revisão bibliográfica subordinada ao tema pododermatite u...

  3. Cuidados paliativos em cuidados intensivos

    OpenAIRE

    Fonseca, Sandrina Fernandes de Andrade

    2012-01-01

    Relatório de prática clínica apresentado à Escola Superior de Saúde Dr. Lopes Dias do Instituto Politécnico de Castelo Branco para cumprimento dos requisitos necessários à obtenção do grau de mestre em Cuidados Paliativos Os cuidados paliativos constituem uma modalidade decorrente da necessidade emergente de melhorar a assistência no fim da vida do doente com doença avançada e incurável e aos seus familiares. Dadas as características complexas das intervenções e às suas articulações conjun...

  4. Improving CLOPE’s Profit Value and Stability with an Optimized Agglomerative Approach

    Directory of Open Access Journals (Sweden)

    Yefeng Li

    2015-06-01

    Full Text Available CLOPE (Clustering with sLOPE is a simple and fast histogram-based clustering algorithm for categorical data. However, given the same data set with the same input parameter, the clustering results by this algorithm would possibly be different if the transactions are input in a different sequence. In this paper, a hierarchical clustering framework is proposed as an extension of CLOPE to generate stable and satisfactory clustering results based on an optimized agglomerative merge process. The new clustering profit is defined as the merge criteria and the cluster graph structure is proposed to optimize the merge iteration process. The experiments conducted on two datasets both demonstrate that the agglomerative approach achieves stable clustering results with a better profit value, but costs much more time due to the worse complexity.

  5. Two new species of Tribonium Saussure, 1862 (Blattodea, Blaberidae, Zetoborinae, with a key to males of the genus

    Directory of Open Access Journals (Sweden)

    Leonardo de Oliveira Cardoso da Silva

    2015-05-01

    Full Text Available This contribution describes and illustrates the male genitalia of two new species of Blaberidae collected in the state of Minas Gerais, Brazil: T. caldensis sp. n. resembles T. neospectrum Lopes, 1978, differing in the coloration, size and genitalia; and T. morroferrensis sp. n., which resembles T. guttulosum (Walker, 1868 but also differs in the size and coloration of specimen and genital pieces morphology. The genital plates were removed after dissection of the posterior part of the abdomen, and were stored in microvials containing glycerin, attached to the respective exemplar in the collection of the Museu Nacional of Rio de Janeiro, Brazil. A key to males of the species of the genus is also presented. Illustrations of T. neospectrum and T. guttulosum are provided to clarify the comparisons with the new species described here.

  6. Mechanisms of Secrets and Secrecy in «El secretario confuso» by Jacinto Cordeiro

    Directory of Open Access Journals (Sweden)

    Mariela Insúa Cereceda

    2015-11-01

    Full Text Available This article studies the mechanism of secrets and secrecy in El secretario confuso (1634, comedy by Jacinto Cordeiro; he is a playwright that belongs to the group of lusitan authors that write in Spanish during the Dual Monarchy period (1580-1640. This work, that can be included in the secretario subtype of comedia palatina genre —based on the infatuation between a noble lady and her secretary— shows thematic and structural coincidences with the main comedies of this moda­lity —El perro del hortelano by Lope de Vega and El vergonzoso en palacio by Tirso de Molina—, but providing new variations to this corpus focussed on the communicational dynamics of remaining silent, concealing and declaring love between the different characters.

  7. Revista de tesis de la Facultad de Medicina de Bogotá

    Directory of Open Access Journals (Sweden)

    Facultad de Medicina Revista

    1943-04-01

    Full Text Available La prueba de la histamina para el diagnóstico precoz de la lepra. Tesis de grado, declarada Meritoria. 1942. - Por Antonio Jasbon Mantilla / Tratamiento qulrúrgico de las glomerulonefritis. Tesis de grado, declarada meritoria. 1942. - Por Lope Carvajal Peralta / Contribución al tratamiento de la osteomielitis por el bacteriofago Estafilococcico.  Tesis de grado. 1942. - Por Manuel J. Gutiérrez H. / Clorurraquia, cloremia total y plasmatica en 200 casos patologicos. Tesis de grado. 1942. - Por Luis Enrique Peña P. / Estudio clínico y anatomopatológico de las verrugas y nodulos subcutáneos de la bartonellosis humana o enfermedad de carrion. Tesis de grado. 1942. - Por Aurelio Benavides D.

  8. Results from and prospects for the Auger Engineering Radio Array

    Directory of Open Access Journals (Sweden)

    van den Berg A.M.

    2013-06-01

    Full Text Available The Auger Engineering Radio Array (AERA is one of the low-energy enhancements of the Pierre Auger Observatory. AERA is based on experience obtained with the LOPES and CODALEMA experiments in Europe and aims to study in the MHz region the details of the emission mechanism of radio signals from extensive air showers. The data from AERA will be used to assess the sensitivity of MHz radiation to the mass composition of cosmic rays. Because of its energy threshold at 2 × 1017 eV the dip region in the cosmic-ray flux spectrum can be studied in detail. We present first results of AERA and of its prototypes and we provide an outlook towards the future.

  9. L'autre feminine: De la passivité à l'action

    Directory of Open Access Journals (Sweden)

    Carlos A. Garduño Comparán

    2013-05-01

    Full Text Available Dans ce texte, la notion du féminin est explorée à travers deux schémas présents dans l'œuvre de Ricœur, celui de l'épopée et celui de la tragédie, symbolisés par les figures de Pénélope et Antigone. Par la suite, on proposera Médée comme un exemple qui s'adapte de manière appropriée à la problématique des études de genre, interprété par rapport aux développements de La Métaphore vive sur la ressemblance et la substitution, et au processus de la mimèsis dans Temps et récit.  

  10. Evaluación de sustratos en un cultivo de lechuga bajo un sistema hidropónico en el municipio de Pasto

    OpenAIRE

    Elizabeth Marcela Guerrero; Juan Camilo Revelo; Orlando Benavides; Germán Chaves; Carlos Álvaro Moncayo

    2014-01-01

    La horticultura es un importante renglón económico en Nariño, este proyecto se realizó como una alternativa para mejorar la producción y calidad de lechuga. En el Centro Internacional de Producción Limpia Lope - SENA - Regional Nariño, se realizó la evaluación de los sustratos fibra de coco y cascarilla de arroz con sus respectivas mezclas bajo un sistema hidropónico sobre una estructura en forma de “A” para la producción de lechuga (Lactuca sativa L.) en un área de 10 metros2 para un total d...

  11. El surrealism de la poesía Lorquiana y su interpretación

    Directory of Open Access Journals (Sweden)

    Branka Kalenić Ramšak

    2001-12-01

    Full Text Available Federico García Lorca, pasados los cien años de su nacimiento, sigue siendo uno de los poetas españoles mas conocidos, traducidos, leídos y recitados en el mundo. Su imagen de juglar moderno se ha convertido en un fenómeno cultural hispánico, o mejor dicho, en uno de los tópicos españoles. Su obra poética ha ido cobrando a lo largo de este siglo dimensiones de una obra clásica española, comparable a la de Cervantes, de Lope de Vega o de Luis de Góngora. Su lenguaje poético, brotado de la vieja tierra mediterranea, nos ha hechizado a todos y su metáfora presagiosa todavia nos estremece al hacernos sentir el misterio de la vida y de la muerte.

  12. La palabra sentenciosa del gaucho. Ejemplos elocuentes: Blau Nunes y Martín Fierro

    OpenAIRE

    Sisca, Alicia Lidia

    2014-01-01

    João Simões Lopes Neto y José Hernández tradujeron, en Blau Nunes y en Martín Fierro, la expresión sentenciosa del gaucho elevando a plano universal las experiencias regionales de sus vidas paradigmáticas. El lenguaje propio del hombre de la región gaucha, sea en la prosa de Contos Gauchescos o en los versos del Martín Fierro, confiere valor de realidad y perdurable eficacia al contenido de ese hablar sentencioso. La sabiduría del gaucho es fruto y síntesis de sus dramáticas vivencias que por...

  13. A “Volta do Real” e as formas do realismo no cinema contemporâneo: o trauma em Caché e A Fita Branca; o abjeto em Anticristo; o banal em Mutum

    Directory of Open Access Journals (Sweden)

    Marília Xavier Lima

    2010-12-01

    Full Text Available Esta pesquisa busca compreender o resgate do realismo no cinema contemporâneo, tomando como ponto chave a evocação do real feita de duas maneiras: uma, através do trauma elucidado por Hal Foster com base nas artes visuais e a outra por meio do “sublime do banal” exposto por Denilson Lopes. Para tal, foram discutidos os filmes Caché e A Fita Branca, do diretor Michael Haneke para explicitar o real no trauma; o Anticristo de Lars Von Trier para o caso do real no abjeto; e, por fim, no cenário brasileiro, o filme Mutum de Sandra Kogut no que tange ao “sublime do banal”. Procurando, dessa forma, compreender os elementos estéticos do realismo cinematográfico contemporâneo.

  14. La cruzada particular de un maestre de la Orden de Alcántara (1394

    Directory of Open Access Journals (Sweden)

    José Enrique LÓPEZ DE COCA CASTAÑER

    2013-03-01

    Full Text Available Historia de la expedición contra el reino nazarí de Granada dirigida por Martín Yáñez de Barbudo, maestre de la orden de Alcántara, en la primavera de 1394. El desafío que el maestre envió al emir Muhammad VII, en contra de la voluntad del rey Enrique III. La estancia de Martín Yáñez en la ciudad de Córdoba: la expedición caballeresca se convierte en un movimiento de masas. El último intento de evitar la guerra: la entrevista del Maestre con los hermanos Alonso y Diego Fernández de Córdoba en Alcalá la Real. La matanza de Puerto Lope. Leyendas sobre Martín Yáñez de Barbudo. La aventura del maestre de Alcántara y las cruzadas populares.

  15. El erotismo en La vega del Parnaso

    OpenAIRE

    Villarino,Edith Marta

    2011-01-01

    El amor, que en las comedias del Siglo de Oro suele ser el móvil de la acción y el origen de la complicación en la trama, fue el eje en torno del cual giró la vida de Lope de Vega, quien luego de pasar por experiencias de innumerables matices lo transformó en el motor de la voz escritural de sus poemas, piezas dramáticas y cartas personales. Joan Oleza (1990: 207), cuando define la comedia urbana del primer período de producción lopesca, tiene en cuenta su carácter vital y fest...

  16. Contra lo justo : l’Arte nuevo de hacer comedias (1609 ou l’invention de la liberté

    Directory of Open Access Journals (Sweden)

    Milagros Torres

    2013-03-01

    Full Text Available Ce travail explore la notion de gusto, en tant que pilier de la nouveauté qui apparaît dans Arte nuevo de hacer comedias en este tiempo (1609. Prenant sa source chez Aristote, un esprit subtil de liberté, après avoir conquis les corrales, inspire l’ouvrage théorique de Lope. Le corps y joue un rôle essentiel : une esthétique gestuelle novatrice, des jeux visuels et auditifs, une image corporelle audacieuse qui explore l’imaginaire sensoriel et érotique, une nouvelle intelligence de la scène, osée et prudente à la fois, soumise à l’empire de la fantaisie.

  17. Nephrotic syndrome and Guillan-barre syndrome: A rare association in child

    Directory of Open Access Journals (Sweden)

    Bouyahia Olfa

    2010-01-01

    Full Text Available Only few cases of nephrotic syndrome associated with Guillain-Barre Syndrome (GBS have been reported in the adult and pediatric literature. A 3-year-old boy was initially admitted to our hospital following five days of progressive weakness of his extremities, fatigue, right leg pain and numbness. There was no past history of renal or neurological disease. Cerebro-spinal fluid studies showed a protein level of 92 mg/dL and a white cell count of 1 per high-power field. The diagnosis of GBS was verified with a nerve conduction velocity test as well as. The GBS symptoms improved gradually on intravenous immunoglobulin. Three weeks later, he deve-loped severe proteinuria and edema; laboratory investigation showed nephrotic syndrome which responded to steroid therapy. Renal biopsy showed minimal change glomerulonephritis. He re-mained free of proteinuria during his 20 months of follow-up.

  18. Processos de perda e luto: continuidade de cuidados

    OpenAIRE

    Viegas, Marlene Isabel Lopes

    2013-01-01

    Relatório de prática clínica apresentado à Escola Superior de Saúde Dr. Lopes Dias do Instituto Politécnico de Castelo Branco para cumprimento dos requisitos necessários à obtenção do grau de mestre em Cuidados Paliativos. O presente Relatório de Prática Clínica surge no âmbito do I Mestrado em CP da ESALD do IPCB é constituído por duas partes. Na primeira parte é relatada a forma como decorreu a prática clínica e a avaliação dos objetivos, sendo feita uma constante reflexão crítica sobre ...

  19. Políticas e práticas de gestão de pessoas: peculiaridades de uma estrutura organizacional remota

    Directory of Open Access Journals (Sweden)

    Lindolfo Galvão de Albuquerque

    2009-08-01

    Full Text Available Este artigo teve como principal objetivo investigar como as especificidades na gestão de pessoas são elucidadas dentro de uma empresa com estrutura organizacional remota, distante de grandes centros urbanos. Caracteriza-se como qualitativo, exploratório, baseado em estudo de caso único, cujo nível proposto de análise é o organizacional. O levantamento de campo envolveu um grupo formado pelos níveis de direção, gerência, profissionais de RH, supervisão e coordenação da Mineração Rio do Norte. Para a coleta dos dados primários, foram realizadas dezenove entrevistas em profundidade e observações nas áreas operacionais; para os secundários, análise de documentos fornecidos pela empresa. Foram utilizadas as técnicas de análises de conteúdo, documental e a metodologia reflexiva. A fundamentação teórica contemplou quatro temas, dos quais foram extraídas as categorias de análise, consideradas por Vergara (2005, como oriundas de grade fechada. Seus resultados demonstram que as políticas e práticas específicas de gestão de pessoas favorecem a criação de uma cultura de contribuição, desenvolvimento e solidariedade nas relações entre as pessoas. Os gestores exercem influência direta no comprometimento organizacional, permitindo que os valores e a identidade organizacional sejam compartilhados por todos, dentro e fora do contexto de trabalho.

  20. “The Cultural Links between Galicia and Ireland Continue to Flourish Today”: An Interview with the Director of the Irish Centre for Galician Studies (UCC Martín Veiga

    Directory of Open Access Journals (Sweden)

    Verónica Membrive Pérez

    2017-03-01

    Full Text Available Dr. Martín Veiga Alonso is Director of the Irish Centre for Galician Studies and lecturer and co-ordinator of the Higher Diploma in Arts (Spanish at the Department of Spanish, Portuguese and Latin American Studies at University College Cork. His main areas of research include contemporary Galician and Irish travel writing and poetry, with special focus on the Galician poet Antón Avilés de Taramancos, about whom he has published Escribir na multitude: a obra literaria de Antón Avilés de Taramancos (2014, Antón Avilés de Taramancos (2003, Biografía sonora de Avilés de Taramancos (2009, Cantos caucanos (2003 and the edited volume Raiceiras e vento. A obra poética de Antón Avilés de Taramancos (2003. Veiga is co-editor of Galicia 21: Journal of Contemporary Galician Studies and has recently edited a special issue devoted to the works of the Galician poet and essayist Xavier Queipo (2013. Furthermore, Martín Veiga is also a prolific translator and poet, and his volumes of poetry have received important awards. His collections are Tempo van de porcelana (1990, As últimas ruínas (1994, Espiral Maior Prize, Ollos de ámbar (2005, Esquío Prize and Fundaxes (2006, Fiz Vergara Vilariño Prize. In this interview, held at University College Cork in July 2015, we discussed the historical vocation of Galician literature to look towards Ireland, as well as the role and activities of the Irish Centre for Galician Studies at UCC and the relevance and future of Galician Studies in Ireland and Europe.