WorldWideScience

Sample records for varying barrier function

  1. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...... barrier integrity, factors influencing the penetration of the skin, influence of wet work, and guidance for prevention and saving the barrier. Distinguished researchers have contributed to this book, providing a comprehensive and thorough overview of the skin barrier function. Researchers in the field...

  2. Performance of Traffic Noise Barriers with Varying Cross-Section

    Directory of Open Access Journals (Sweden)

    Sanja Grubeša

    2011-05-01

    Full Text Available The efficiency of noise barriers largely depends on their geometry. In this paper, the performance of noise barriers was simulated using the numerical Boundary Element Method (BEM. Traffic noise was particularly considered with its standardized noise spectrum adapted to human hearing. The cross-section of the barriers was varied with the goal of finding the optimum shape in comparison to classical rectangular barriers. The barrier performance was calculated at different receiver points for a fixed barrier height and source position. The magnitude of the insertion loss parameter was used to evaluate the performance change, both in one-third octave bands and as the broadband mean insertion loss value. The proposed barriers of varying cross-section were also compared with a typical T-shape barrier of the same height.

  3. Harmonic functions with varying coefficients

    Directory of Open Access Journals (Sweden)

    Jacek Dziok

    2016-05-01

    Full Text Available Abstract Complex-valued harmonic functions that are univalent and sense preserving in the open unit disk can be written in the form f = h + g ‾ $f=h+\\overline{g}$ , where h and g are analytic. In this paper we investigate some classes of univalent harmonic functions with varying coefficients related to Janowski functions. By using the extreme points theory we obtain necessary and sufficient convolution conditions, coefficients estimates, distortion theorems, and integral mean inequalities for these classes of functions. The radii of starlikeness and convexity for these classes are also determined.

  4. Skin Barrier Function and Allergens

    DEFF Research Database (Denmark)

    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan

    2016-01-01

    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due...

  5. Compilation of Instantaneous Source Functions for Varying ...

    African Journals Online (AJOL)

    Compilation of Instantaneous Source Functions for Varying Architecture of a Layered Reservoir with Mixed Boundaries and Horizontal Well Completion Part IV: Normal and Inverted Letter 'h' and 'H' Architecture.

  6. Compilation of Instantaneous Source Functions for Varying ...

    African Journals Online (AJOL)

    Compilation of Instantaneous Source Functions for Varying Architecture of a Layered Reservoir with Mixed Boundaries and Horizontal Well Completion Part III: B-Shaped Architecture with Vertical Well in the Upper Layer.

  7. Functional barriers: Properties and evaluation

    NARCIS (Netherlands)

    Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.

    2005-01-01

    Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of

  8. Tracking time-varying coefficient-functions

    DEFF Research Database (Denmark)

    Nielsen, Henrik Aalborg; Nielsen, Torben Skov; Joensen, Alfred K.

    2000-01-01

    is a combination of recursive least squares with exponential forgetting and local polynomial regression. It is argued, that it is appropriate to let the forgetting factor vary with the value of the external signal which is the argument of the coefficient functions. Some of the key properties of the modified method...... are studied by simulation...

  9. Tracking Time-Varying Coefficient-Functions

    DEFF Research Database (Denmark)

    Nielsen, Henrik Aalborg; Nielsen, Torben Skov; Joensen, Alfred K.

    1999-01-01

    of recursive least squares with exponential forgetting and local polynomial regression. However, it is argued, that it is appropriate to let the forgetting factor vary with the value of the external signal shich is argument of the coeffieient-functions.The properties of the modified method are sutdied...... by simulation. A particular feature is that this effectiv forgetting factor will adapt to the bandwidth used so that the effective number of observtions behind the estimates will be almost independent of the actual bandwidth or of the type of bandwidth selection used (fixed or nearest neighbour). The choice...

  10. Varying-coefficient functional linear regression

    OpenAIRE

    Wu, Yichao; Fan, Jianqing; Müller, Hans-Georg

    2010-01-01

    Functional linear regression analysis aims to model regression relations which include a functional predictor. The analog of the regression parameter vector or matrix in conventional multivariate or multiple-response linear regression models is a regression parameter function in one or two arguments. If, in addition, one has scalar predictors, as is often the case in applications to longitudinal studies, the question arises how to incorporate these into a functional regression model. We study...

  11. Functional Piezocrystal Characterisation under Varying Conditions

    Directory of Open Access Journals (Sweden)

    Xiaochun Liao

    2015-12-01

    Full Text Available Piezocrystals, especially the relaxor-based ferroelectric crystals, have been subject to intense investigation and development within the past three decades, motivated by the performance advantages offered by their ultrahigh piezoelectric coefficients and higher electromechanical coupling coefficients than piezoceramics. Structural anisotropy of piezocrystals also provides opportunities for devices to operate in novel vibration modes, such as the d36 face shear mode, with domain engineering and special crystal cuts. These piezocrystal characteristics contribute to their potential usage in a wide range of low- and high-power ultrasound applications. In such applications, conventional piezoelectric materials are presently subject to varying mechanical stress/pressure, temperature and electric field conditions. However, as observed previously, piezocrystal properties are significantly affected by a single such condition or a combination of conditions. Laboratory characterisation of the piezocrystal properties under these conditions is therefore essential to fully understand these materials and to allow electroacoustic transducer design in realistic scenarios. This will help to establish the extent to which these high performance piezocrystals can replace conventional piezoceramics in demanding applications. However, such characterisation requires specific experimental arrangements, examples of which are reported here, along with relevant results. The measurements include high frequency-resolution impedance spectroscopy with the piezocrystal material under mechanical stress 0–60 MPa, temperature 20–200 °C, high electric AC drive and DC bias. A laser Doppler vibrometer and infrared thermal camera are also integrated into the measurement system for vibration mode shape scanning and thermal conditioning with high AC drive. Three generations of piezocrystal have been tested: (I binary, PMN-PT; (II ternary, PIN-PMN-PT; and (III doped ternary, Mn

  12. Functional Piezocrystal Characterisation under Varying Conditions.

    Science.gov (United States)

    Liao, Xiaochun; Qiu, Zhen; Jiang, Tingyi; Sadiq, Muhammad R; Huang, Zhihong; Demore, Christine E M; Cochran, Sandy

    2015-12-02

    Piezocrystals, especially the relaxor-based ferroelectric crystals, have been subject to intense investigation and development within the past three decades, motivated by the performance advantages offered by their ultrahigh piezoelectric coefficients and higher electromechanical coupling coefficients than piezoceramics. Structural anisotropy of piezocrystals also provides opportunities for devices to operate in novel vibration modes, such as the d36 face shear mode, with domain engineering and special crystal cuts. These piezocrystal characteristics contribute to their potential usage in a wide range of low- and high-power ultrasound applications. In such applications, conventional piezoelectric materials are presently subject to varying mechanical stress/pressure, temperature and electric field conditions. However, as observed previously, piezocrystal properties are significantly affected by a single such condition or a combination of conditions. Laboratory characterisation of the piezocrystal properties under these conditions is therefore essential to fully understand these materials and to allow electroacoustic transducer design in realistic scenarios. This will help to establish the extent to which these high performance piezocrystals can replace conventional piezoceramics in demanding applications. However, such characterisation requires specific experimental arrangements, examples of which are reported here, along with relevant results. The measurements include high frequency-resolution impedance spectroscopy with the piezocrystal material under mechanical stress 0-60 MPa, temperature 20-200 °C, high electric AC drive and DC bias. A laser Doppler vibrometer and infrared thermal camera are also integrated into the measurement system for vibration mode shape scanning and thermal conditioning with high AC drive. Three generations of piezocrystal have been tested: (I) binary, PMN-PT; (II) ternary, PIN-PMN-PT; and (III) doped ternary, Mn:PIN-PMN-PT. Utilising

  13. Photoluminescence study of InGaN/GaN double quantum wells with varying barrier widths

    CERN Document Server

    Ryu, M Y; Shin, E J; Lee, J I; Yu, S K; Oh, E S; Park, Y J; Park, H S; Kim, T I

    2000-01-01

    We report the results of photoluminescence (PL) and time-resolved PL studies on InGaN/GaN double quantum well (DQW) samples with different barrier widths. The barrier-width dependence of the PL emission energy and intensity are discussed. The PL as a function of excitation density can be well explained in terms of the quantum-confined Stark effect (QCSE). The temporal behavior of the PL was also studied. As the barrier width increases, the decay times tau sub 1 and tau sub 2 , decrease from 1.02 ns and 6.99 ns to 0.32 ns and 1.09 ns, respectively. The PL efficiency and the decay lifetime depend on the barrier width.

  14. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups ...

  15. Permanent isolation surface barrier: Functional performance

    Energy Technology Data Exchange (ETDEWEB)

    Wing, N.R.

    1993-10-01

    This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release.

  16. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  17. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

  18. Adherence and barriers to colorectal cancer screening varies among Arab Americans from different countries of origin.

    Science.gov (United States)

    Talaat, Nizar

    2015-01-01

    Arab-Americans (ArA) in Michigan, USA had the lowest colorectal cancer screening (CRCS) in 2008 compared to the state's general population (45.6% vs. 60.8%). The adherence rate and barriers to CRCS have been identified in a previous study; however, these differences have been not examined among ArA from different countries of origin. Community-based study through a survey filled by 130 Arab-Americans aged ⩾50years. Demographic information and information about CRC screening knowledge were obtained. Responses were compared between the two largest population groups (Lebanese and Yemenis). The majority of the participants (80%) were from Lebanon (52.3%) and Yemen (27.7%). Majority of the Yemenis group have never been screened for CRC (72.2% vs. 27.9%, peducation level, health insurance and access to primary care physicians. Unscreened Lebanese had a higher family history of CRCS (31.6% vs. 0%, p=0.002). The most common reported barrier for both groups was the misconception that CRCS is not necessary (62% for Yemenis & 42% for Lebanese, p=0.197). Unscreened Yemenis were more unaware about CRCS (46% vs. 11%, p=0.002). CRC screening rates vary among Arab-Americans from different countries of origin. Physicians should consider the country of origin when recommending CRC screening to Arab-Americans. Copyright © 2015 Arab Journal of Gastroenterology. Published by Elsevier B.V. All rights reserved.

  19. Partially linear varying coefficient models stratified by a functional covariate

    KAUST Repository

    Maity, Arnab

    2012-10-01

    We consider the problem of estimation in semiparametric varying coefficient models where the covariate modifying the varying coefficients is functional and is modeled nonparametrically. We develop a kernel-based estimator of the nonparametric component and a profiling estimator of the parametric component of the model and derive their asymptotic properties. Specifically, we show the consistency of the nonparametric functional estimates and derive the asymptotic expansion of the estimates of the parametric component. We illustrate the performance of our methodology using a simulation study and a real data application.

  20. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  1. Does the HI Mass Function Vary with Environment?

    Science.gov (United States)

    Minchin, Robert F.

    2017-01-01

    Based on analysis of a large dataset from the ALFALFA survey, Jones et al. (2016) recently claimed that the slope of the HI mass function is constant across different galactic environments, defined by their density. They point out that this finding is “perplexing” given that many previous studies have found that the HI mass functions of groups of galaxies have flat slopes, while the general field has a relatively steep slope. I argue that the analysis of Jones et al., and similar analyses in the past, is flawed as they examine the HI mass function of the galaxies found in environments with a given density, summed across the survey, not the HI mass function actually present in the individual structures at that density. If the position of the knee in the HI mass function were to vary between these structures, then the slope of the HI mass function found by summing across all of the structures with a given density would be steeper than the slope actually found in the individual structures. For example, if a survey were to contain three groups of galaxies, all with flat HI mass functions, but with the ‘knee’, at the mass of the largest galaxy in the group, at 108, 109 and 1010 solar masses, then the summed HI mass function would appear to have a knee at 1010 solar masses and a steep slope below this, rather than the flat slope that is actually present in the individual environments. It is not possible, therefore, to say from the analysis of Jones et al. that there is no dependence of the HI mass function on environment. This scenario explains the “seemingly contradictory findings” of Jones et al. and the earlier studies of individual groups as being due to differences in what is being studies, without having to invoke methodological errors in the derivation of the HI mass function.The Arecibo Observatory is operated by SRI International under a cooperative agreement with the National Science Foundation (AST-1100968), and in alliance with Ana G. M

  2. Barrier Functionality of Porcine and Bovine Brain Capillary Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Ailar Nakhlband

    2011-09-01

    Full Text Available Introduction: To date, isolated cell based blood-brain barrier (BBB models have been widely used for brain drug delivery and targeting, due to their relatively proper bioelectrical and permeability properties. However, primary cultures of brain capillary endothelial cells (BCECs isolated from different species vary in terms of bioelectrical and permeability properties. Methods: To pursue this, in the current investigation, primary porcine and bovine BCECs (PBCECs and BBCECs, respectively were isolated and used as an in vitro BBB model. The bioelectrical and permeability properties were assessed in BCECs co-cultured with C6 cells with/without hydrocortisone (550 nM. The bioelectrical properties were further validated by means of the permeability coefficients of transcellular and paracellular markers. Results: The primary PBCECs displayed significantly higher trans-endothelial electrical resistance (~900 W.cm2 than BBCECs (~700 W.cm2 - both co-cultured with C6 cells in presence of hydrocortisone. Permeability coefficients of propranolol/diazepam and mannitol/sucrose in PBCECs were ~21 and ~2 (×10-6 cm.sec-1, where these values for BBCECs were ~25 and ~5 (×10-6 cm.sec-1. Conclusion: Upon our bioelectrical and permeability findings, both models display discriminative barrier functionality but porcine BCECs seem to provide a better platform than bovine BCECs for drug screening and brain targeting.

  3. Access and Barriers to Healthcare Vary among Three Neighboring Communities in Northern Honduras

    Directory of Open Access Journals (Sweden)

    Catherine A. Pearson

    2012-01-01

    Full Text Available Objective. The aim of this study is to describe and compare access and barriers to health services in three proximal yet topographically distinct communities in northern Honduras served by the nonprofit organization the Honduras Outreach Medical Brigada Relief Effort (HOMBRE. Methods. Study personnel employed a 25-item questionnaire in Spanish at the point of care during HOMBRE clinics in Coyoles, Lomitas, and La Hicaca (N=220. We describe and compare the responses between sites, using Chi-squared and Fisher Exact tests. Results. Respondents in Lomitas demonstrated the greatest limitations in access and greatest barriers to care of all sites. Major limitations in access included “never” being able to obtain a blood test, obtain radiology services, and see a specialist. Major barriers were cost, distance, facility overcrowding, transportation, being too ill to go, inability to take time off work, and lack of alternate childcare. Conclusions. Despite being under the same local health authority, geographically remote Honduran communities experience greater burdens in healthcare access and barriers than neighboring communities of the same region.

  4. Concepts for Functional Restoration of Barrier Islands

    Science.gov (United States)

    2009-09-01

    shrimp require tidal circulation and gradient in salinity within estuaries as a part of their juvenile growth cycle, which is promoted by the presence of...dynamically stable in that the barrier island is designed to allow morphologic evolution through time via migration and overwash, as long as the storm...island dimen- sions (width and elevation) required to maintain morphologic form and increase the potential for island recovery after a storm. For

  5. Predictions of barrier island berm evolution in a time-varying storm climatology

    Science.gov (United States)

    Plant, Nathaniel G.; Flocks, James; Stockdon, Hilary F.; Long, Joseph W.; Guy, Kristy K.; Thompson, David M.; Cormier, Jamie M.; Smith, Christopher G.; Miselis, Jennifer L.; Dalyander, P. Soupy

    2014-01-01

    Low-lying barrier islands are ubiquitous features of the world's coastlines, and the processes responsible for their formation, maintenance, and destruction are related to the evolution of smaller, superimposed features including sand dunes, beach berms, and sandbars. The barrier island and its superimposed features interact with oceanographic forces (e.g., overwash) and exchange sediment with each other and other parts of the barrier island system. These interactions are modulated by changes in storminess. An opportunity to study these interactions resulted from the placement and subsequent evolution of a 2 m high sand berm constructed along the northern Chandeleur Islands, LA. We show that observed berm length evolution is well predicted by a model that was fit to the observations by estimating two parameters describing the rate of berm length change. The model evaluates the probability and duration of berm overwash to predict episodic berm erosion. A constant berm length change rate is also predicted that persists even when there is no overwash. The analysis is extended to a 16 year time series that includes both intraannual and interannual variability of overwash events. This analysis predicts that as many as 10 or as few as 1 day of overwash conditions would be expected each year. And an increase in berm elevation from 2 m to 3.5 m above mean sea level would reduce the expected frequency of overwash events from 4 to just 0.5 event-days per year. This approach can be applied to understanding barrier island and berm evolution at other locations using past and future storm climatologies.

  6. Parameter selection in the Green's function parabolic equation for outdoor sound propagation over varied terrain

    Science.gov (United States)

    Cooper, Jennifer L.

    2003-10-01

    There is a need for a method to predict the attenuation of sound over a varied terrain and for realistic weather conditions. Parabolic equation based propagation codes can deal successfully with a sound speed that is a function of height (as could be caused by wind or temperature gradients) as well as varying ground heights and impedances. The ability to predict the received sound levels for a set of digitized terrain and sound speed data is desired. The accuracy of the Green's function parabolic equation (GFPE) has already been confirmed for propagation over flat ground with a slowly varying sound speed profile and/or with atmospheric turbulence. The approach here will be to compare to a benchmark solution for each different kind of terrain (i.e. flat, slope, step, barrier) with constant sound speed to verify the numeric code and to define the limits of accuracy in the GFPE for these situations. The GFPE is based on a one-way wave equation, so the numerical model will not be able to accurately predict the pressure behind multiple barriers or for other situations in which backward reflections can affect the received pressure. We will define the additional limits to the applicability of this model based on many comparisons with analytical solutions for propagation beyond barriers with constant sound speed. The sloping terrain will be treated as a series of stairsteps---a digitized ground height. Buildings and steps will be merely larger stairsteps. Although the GFPE has already been documented, as well as wide angle parabolic equations (PEs) and PEs using conformal mapping or similar rudimentary stair-stepping terrain maps, a PE that works with large discontinuities has not been documented, nor has there been work on a propagation model over complicated terrain profiles (in the past most work has been done in underwater acoustics for oceans with a sloping bottom condition but no variation in the slope was presented). The main emphasis here will be on the assumptions

  7. The flux-flux correlation function for anharmonic barriers

    NARCIS (Netherlands)

    Goussev, Arseni; Schubert, Roman; Waalkens, Holger; Wiggins, Stephen

    2010-01-01

    The flux-flux correlation function formalism is a standard and widely used approach for the computation of reaction rates. In this paper we introduce a method to compute the classical and quantum flux-flux correlation functions for anharmonic barriers essentially analytically through the use of the

  8. The adaptative response of jaw muscles to varying functional demands

    NARCIS (Netherlands)

    Grünheid, T.; Langenbach, G.E.J.; Korfage, J.A.M.; Zentner, A.; van Eijden, T.M.G.J.

    2009-01-01

    Jaw muscles are versatile entities that are able to adapt their anatomical characteristics, such as size, cross-sectional area, and fibre properties, to altered functional demands. The dynamic nature of muscle fibres allows them to change their phenotype to optimize the required contractile function

  9. Regulation of the Intestinal Barrier Function by Host Defense Peptides.

    Science.gov (United States)

    Robinson, Kelsy; Deng, Zhuo; Hou, Yongqing; Zhang, Guolong

    2015-01-01

    Intestinal barrier function is achieved primarily through regulating the synthesis of mucins and tight junction (TJ) proteins, which are critical for maintaining optimal gut health and animal performance. An aberrant expression of TJ proteins results in increased paracellular permeability, leading to intestinal and systemic disorders. As an essential component of innate immunity, host defense peptides (HDPs) play a critical role in mucosal defense. Besides broad-spectrum antimicrobial activities, HDPs promotes inflammation resolution, endotoxin neutralization, wound healing, and the development of adaptive immune response. Accumulating evidence has also indicated an emerging role of HDPs in barrier function and intestinal homeostasis. HDP deficiency in the intestinal tract is associated with barrier dysfunction and dysbiosis. Several HDPs were recently shown to enhance mucosal barrier function by directly inducing the expression of multiple mucins and TJ proteins. Consistently, dietary supplementation of HDPs often leads to an improvement in intestinal morphology, production performance, and feed efficiency in livestock animals. This review summarizes current advances on the regulation of epithelial integrity and homeostasis by HDPs. Major signaling pathways mediating HDP-induced mucin and TJ protein synthesis are also discussed. As an alternative strategy to antibiotics, supplementation of exogenous HDPs or modulation of endogenous HDP synthesis may have potential to improve intestinal barrier function and animal health and productivity.

  10. Regulation of the intestinal barrier function by host defense peptides

    Directory of Open Access Journals (Sweden)

    Kelsy eRobinson

    2015-11-01

    Full Text Available Intestinal barrier function is achieved primarily through regulating the synthesis of mucins and tight junction proteins, which are critical for maintaining optimal gut health and animal performance. An aberrant expression of tight junction proteins results in increased paracellular permeability, leading to intestinal and systemic disorders. As an essential component of innate immunity, host defense peptides (HDPs play a critical role in mucosal defense. Besides broad-spectrum antimicrobial activities, HDPs promotes inflammation resolution, endotoxin neutralization, wound healing, and the development of adaptive immune response. Accumulating evidence has also indicated an emerging role of HDPs in barrier function and intestinal homeostasis. HDP deficiency in the intestinal tract is associated with barrier dysfunction and dysbiosis. Several HDPs were recently shown to enhance mucosal barrier function by directly inducing the expression of multiple mucins and tight junction proteins. Consistently, dietary supplementation of HDPs often leads to an improvement in intestinal morphology, production performance, and feed efficiency in livestock animals. This review summarizes current advances on the regulation of epithelial integrity and homeostasis by HDPs. Major signaling pathways mediating HDP-induced mucin and tight junction protein synthesis are also discussed. As an alternative strategy to antibiotics, supplementation of exogenous HDPs or modulation of endogenous HDP synthesis may have potential to improve intestinal barrier function and animal health and productivity.

  11. Surfactants have multi-fold effects on skin barrier function.

    Science.gov (United States)

    Lemery, Emmanuelle; Briançon, Stéphanie; Chevalier, Yves; Oddos, Thierry; Gohier, Annie; Boyron, Olivier; Bolzinger, Marie-Alexandrine

    2015-01-01

    The stratum corneum (SC) is responsible for the barrier properties of the skin and the role of intercorneocyte skin lipids, particularly their structural organization, in controlling SC permeability is acknowledged. Upon contacting the skin, surfactants interact with the SC components leading to barrier damage. To improve knowledge of the effect of several classes of surfactant on skin barrier function at three different levels. The influence of treatments of human skin explants with six non-ionic and four ionic surfactant solutions on the physicochemical properties of skin was investigated. Skin surface wettability and polarity were assessed through contact angle measurements. Infrared spectroscopy allowed monitoring the SC lipid organization. The lipid extraction potency of surfactants was evaluated thanks to HPLC-ELSD assays. One anionic and one cationic surfactant increased the skin polarity by removing the sebaceous and epidermal lipids and by disturbing the organization of the lipid matrix. Another cationic surfactant displayed a detergency effect without disturbing the skin barrier. Several non-ionic surfactants disturbed the lipid matrix organization and modified the skin wettability without any extraction of the skin lipids. Finally two non-ionic surfactants did not show any effect on the investigated parameters or on the skin barrier. The polarity, the organization of the lipid matrix and the lipid composition of the skin allowed describing finely how surfactants can interact with the skin and disturb the skin barrier function.

  12. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  13. Typical diffusion behaviour in packaging polymers - Application to functional barriers

    NARCIS (Netherlands)

    Dole, P.; Feigenbaum, A.E.; Cruz, C. de la; Pastorelli, S.; Paseiro, P.; Hankemeier, T.; Voulzatis, Y.; Aucejo, S.; Saillard, P.; Papaspyrides, C.

    2006-01-01

    When plastics are collected for recycling, possibly contaminated articles might be recycled into food packaging, and thus the contaminants might subsequently migrate into the food. Multilayer functional barriers may be used to delay and to reduce such migration. The contribution of the work reported

  14. A class of univalent functions with varying arguments

    Directory of Open Access Journals (Sweden)

    K. S. Padmanabhan

    1992-01-01

    Full Text Available f(z=z+∑m=2∞amzm is said to be in V(θn if the analytic and univalent function f in the unit disc E is nozmalised by f(0=0, f′(0=1 and arg an=θn for all n. If further there exists a real number β such that θn+(n−1β≡π(mod2π then f is said to be in V(θn,β. The union of V(θn,β taken over all possible sequence {θn} and all possible real number β is denoted by V. Vn(A,B consists of functions f∈V such thatDn+1f(zDnf(z=1+Aw(z1+Bw(z,−1≤A

  15. The Functional Requirements and Design Basis for Information Barriers

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, James L.

    2012-05-01

    This report summarizes the results of the Information Barrier Working Group workshop held at Sandia National Laboratory in Albuquerque, NM, February 2-4, 1999. This workshop was convened to establish the functional requirements associated with warhead radiation signature information barriers, to identify the major design elements of any such system or approach, and to identify a design basis for each of these major elements. Such information forms the general design basis to be used in designing, fabricating, and evaluating the complete integrated systems developed for specific purposes.

  16. Barrier function of the coelomic epithelium in the developing pancreas.

    Science.gov (United States)

    Guo, Ping; Preuett, Barry; Krishna, Prasadan; Xiao, Xiangwei; Shiota, Chiyo; Wiersch, John; Gaffar, Iliana; Tulachan, Sidhartha; El-Gohary, Yousef; Song, Zewen; Gittes, George

    2014-11-01

    Tight spatial regulation of extracellular morphogen signaling within the close confines of a developing embryo is critical for proper organogenesis. Given the complexity of extracellular signaling in developing organs, together with the proximity of adjacent organs that use disparate signaling pathways, we postulated that a physical barrier to signaling may exist between organs in the embryo. Here we describe a previously unrecognized role for the embryonic coelomic epithelium in providing a physical barrier to contain morphogenic signaling in the developing mouse pancreas. This layer of cells appears to function both to contain key factors required for pancreatic epithelial differentiation, and to prevent fusion of adjacent organs during critical developmental windows. During early foregut development, this barrier appears to play a role in preventing splenic anlage-derived activin signaling from inducing intestinalization of the pancreas-specified epithelium. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. Model Predictive Control of Nonlinear Parameter Varying Systems via Receding Horizon Control Lyapunov Functions

    National Research Council Canada - National Science Library

    Sznaier, Mario

    2001-01-01

    .... In this chapter we propose a suboptimal regulator for nonlinear parameter varying, control affine systems based upon the combination of model predictive and control Lyapunov function techniques...

  18. Intestinal barrier function and the brain-gut axis.

    Science.gov (United States)

    Alonso, Carmen; Vicario, María; Pigrau, Marc; Lobo, Beatriz; Santos, Javier

    2014-01-01

    The luminal-mucosal interface of the intestinal tract is the first relevant location where microorganism-derived antigens and all other potentially immunogenic particles face the scrutiny of the powerful mammalian immune system. Upon regular functioning conditions, the intestinal barrier is able to effectively prevent most environmental and external antigens to interact openly with the numerous and versatile elements that compose the mucosal-associated immune system. This evolutionary super system is capable of processing an astonishing amount of antigens and non-immunogenic particles, approximately 100 tons in one individual lifetime, only considering food-derived components. Most important, to develop oral tolerance and proper active immune responses needed to prevent disease and inflammation, this giant immunogenic load has to be managed in a way that physiological inflammatory balance is constantly preserved. Adequate functioning of the intestinal barrier involves local and distant regulatory networks integrating the so-called brain-gut axis. Along this complex axis both brain and gut structures participate in the processing and execution of response signals to external and internal changes coming from the digestive tract, using multidirectional pathways to communicate. Dysfunction of brain-gut axis facilitates malfunctioning of the intestinal barrier, and vice versa, increasing the risk of uncontrolled immunological reactions that may trigger mucosal and brain low-grade inflammation, a putative first step to the initiation of more permanent gut disorders. In this chapter, we describe the structure, function and interactions of intestinal barrier, microbiota and brain-gut axis in both healthy and pathological conditions.

  19. Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

    Directory of Open Access Journals (Sweden)

    David eBueno

    2014-10-01

    Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

  20. Lipids and skin barrier function - a clinical perspective

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

    2008-01-01

    The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...... and healthy controls have suggested a possible role for ceramide 1 and to some extent ceramide 3 in the pathogenesis of the disease. Therapies used in diseases involving barrier disruption have been sparely investigated from a lipid perspective. It has been suggested that ultraviolet light as a treatment...

  1. The relationship between skin function, barrier properties, and body-dependent factors.

    Science.gov (United States)

    Dąbrowska, A K; Spano, F; Derler, S; Adlhart, C; Spencer, N D; Rossi, R M

    2017-10-23

    Skin is a multilayer interface between the body and the environment, responsible for many important functions, such as temperature regulation, water transport, sensation, and protection from external triggers. This paper provides an overview of principal factors that influence human skin and describes the diversity of skin characteristics, its causes and possible consequences. It also discusses limitations in the barrier function of the skin, describing mechanisms of absorption. There are a number of in vivo investigations focusing on the diversity of human skin characteristics with reference to barrier properties and body-dependent factors. Skin properties vary among individuals of different age, gender, ethnicity, and skin types. In addition, skin characteristics differ depending on the body site and can be influenced by the body-mass index and lifestyle. Although one of the main functions of the skin is to act as a barrier, absorption of some substances remains possible. Various factors can alter human skin properties, which can be reflected in skin function and the quality of everyday life. Skin properties and function are strongly interlinked. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Crossing the entropy barrier of dynamical zeta functions

    Energy Technology Data Exchange (ETDEWEB)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).

  3. Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

    Directory of Open Access Journals (Sweden)

    Pasricha J

    1991-01-01

    Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

  4. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  5. Analysis of nonstationarity in renal autoregulation mechanisms using time-varying transfer and coherence functions

    DEFF Research Database (Denmark)

    Chon, Ki H; Zhong, Yuru; Moore, Leon C

    2008-01-01

    The extent to which renal blood flow dynamics vary in time and whether such variation contributes substantively to dynamic complexity have emerged as important questions. Data from Sprague-Dawley rats (SDR) and spontaneously hypertensive rats (SHR) were analyzed by time-varying transfer functions...

  6. Constructions of Strict Lyapunov Functions for Discrete Time and Hybrid Time-Varying Systems

    OpenAIRE

    Malisoff, Michael; Mazenc, Frédéric

    2006-01-01

    We provide explicit closed form expressions for strict Lyapunov functions for time-varying discrete time systems. Our Lyapunov functions are expressed in terms of known nonstrict Lyapunov functions for the dynamics and finite sums of persistency of excitation parameters. This provides a discrete time analog of our previous continuous time Lyapunov function constructions. We also construct explicit strict Lyapunov functions for systems satisfying nonstrict discrete time analogs of the conditio...

  7. New Trends in Quantitative Assessment of the Corneal Barrier Function

    Directory of Open Access Journals (Sweden)

    Anton Guimerà

    2014-05-01

    Full Text Available The cornea is a very particular tissue due to its transparency and its barrier function as it has to resist against the daily insults of the external environment. In addition, maintenance of this barrier function is of crucial importance to ensure a correct corneal homeostasis. Here, the corneal epithelial permeability has been assessed in vivo by means of non-invasive tetrapolar impedance measurements, taking advantage of the huge impact of the ion fluxes in the passive electrical properties of living tissues. This has been possible by using a flexible sensor based in SU-8 photoresist. In this work, a further analysis focused on the validation of the presented sensor is performed by monitoring the healing process of corneas that were previously wounded. The obtained impedance measurements have been compared with the damaged area observed in corneal fluorescein staining images. The successful results confirm the feasibility of this novel method, as it represents a more sensitive in vivo and non-invasive test to assess low alterations of the epithelial permeability. Then, it could be used as an excellent complement to the fluorescein staining image evaluation.

  8. Bile duct epithelial tight junctions and barrier function

    Science.gov (United States)

    Rao, R.K.; Samak, G.

    2013-01-01

    Bile ducts play a crucial role in the formation and secretion of bile as well as excretion of circulating xenobiotic substances. In addition to its secretory and excretory functions, bile duct epithelium plays an important role in the formation of a barrier to the diffusion of toxic substances from bile into the hepatic interstitial tissue. Disruption of barrier function and toxic injury to liver cells appear to be involved in the pathogenesis of a variety of liver diseases such as primary sclerosing cholangitis, primary biliary cirrhosis and cholangiocarcinoma. Although the investigations into understanding the structure and regulation of tight junctions in gut, renal and endothelial tissues have expanded rapidly, very little is known about the structure and regulation of tight junctions in the bile duct epithelium. In this article we summarize the current understanding of physiology and pathophysiology of bile duct epithelium, the structure and regulation of tight junctions in canaliculi and bile duct epithelia and different mechanisms involved in the regulation of disruption and protection of bile duct epithelial tight junctions. This article will make a case for the need of future investigations toward our understanding of molecular organization and regulation of canalicular and bile duct epithelial tight junctions. PMID:24665411

  9. Blood-aqueous Barrier Function in a Patient With Choroideremia

    Directory of Open Access Journals (Sweden)

    Muh-Shy Chen

    2010-02-01

    Full Text Available The purpose was to determine whether there was a breakdown of the blood-aqueous barrier in a patient with choroideremia. A 27-year-old man with typical choroideremia underwent standardized ophthalmo-logical evaluation, including quantitative measurement of aqueous flare intensity, by a laser flare-cell meter. The results showed areas of atrophy of the choriocapillaries and retinal pigment epithelium in the mid-periphery and posterior pole, although not in the macula. Fluorescein angiography showed areas of loss of the choriocapillaries and retinal pigment epithelium. The fovea was spared with a surrounding zone of hy-perfluorescence. Electroretinography showed a subnormal photopic amplitude and extinguished scotopic response. Electrooculography revealed that the light peak/dark trough ratio was reduced. Goldmann perimetry showed constricted peripheral fields. Laser photometry showed an increase in the aqueous flare intensity in both eyes, as compared with normal subjects. We conclude that the function of the blood-aqueous barrier might be affected in patients with choroideremia.

  10. Functional Food Market Development in Serbia: Motivations and Barriers

    Directory of Open Access Journals (Sweden)

    Žaklina Stojanović

    2013-11-01

    Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.

  11. Gradual Suppression of Transcytosis Governs Functional Blood-Retinal Barrier Formation.

    Science.gov (United States)

    Chow, Brian Wai; Gu, Chenghua

    2017-03-22

    Blood-central nervous system (CNS) barriers partition neural tissues from the blood, providing a homeostatic environment for proper neural function. The endothelial cells that form blood-CNS barriers have specialized tight junctions and low rates of transcytosis to limit the flux of substances between blood and CNS. However, the relative contributions of these properties to CNS barrier permeability are unknown. Here, by studying functional blood-retinal barrier (BRB) formation in mice, we found that immature vessel leakage occurs entirely through transcytosis, as specialized tight junctions are functional as early as vessel entry into the CNS. A functional barrier forms only when transcytosis is gradually suppressed during development. Mutant mice with elevated or reduced levels of transcytosis have delayed or precocious sealing of the BRB, respectively. Therefore, the temporal regulation of transcytosis governs the development of a functional BRB, and suppression of transcytosis is a principal contributor for functional barrier formation. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Food Derived Bioactive Peptides and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Olga Martínez-Augustin

    2014-12-01

    Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  13. Food derived bioactive peptides and intestinal barrier function.

    Science.gov (United States)

    Martínez-Augustin, Olga; Rivero-Gutiérrez, Belén; Mascaraque, Cristina; Sánchez de Medina, Fermín

    2014-12-09

    A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF) whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  14. Sleep restriction impairs blood-brain barrier function.

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong

    2014-10-29

    The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.

  15. Rax regulates hypothalamic tanycyte differentiation and barrier function in mice

    Science.gov (United States)

    Miranda-Angulo, Ana L.; Byerly, Mardi S.; Mesa, Janny; Wang, Hong; Blackshaw, Seth

    2013-01-01

    The wall of the ventral third ventricle is composed of two distinct cell populations: tanycytes and ependymal cells. Tanycytes regulate many aspects of hypothalamic physiology, but little is known about the transcriptional network that regulates their development and function. We observed that the retina and anterior neural fold homeobox transcription factor (Rax) is selectively expressed in hypothalamic tanycytes, and showed a complementary pattern of expression to markers of hypothalamic ependymal cells, such as Rarres2 (retinoic acid receptor responder). To determine whether Rax controls tanycyte differentiation and function, we generated Rax haploinsufficient mice and examined their cellular and molecular phenotype in adulthood. These mice appeared grossly normal, but careful examination revealed a thinning of the third ventricular wall and reduction of both tanycyte and ependymal markers. These experiments show that Rax is required for hypothalamic tanycyte and ependymal cell differentiation. Rax haploinsufficiency also resulted in the ectopic presence of ependymal cells in the α2 tanycytic zone, where few ependymal cells are normally found, suggesting that Rax is selectively required for α2 tanycyte differentiation. These changes in the ventricular wall were associated with reduced diffusion of Evans Blue tracer from the ventricle to the hypothalamic parenchyma, with no apparent repercussion on the gross anatomical or behavioral phenotype of these mice. In conclusion, we have provided evidence that Rax is required for the normal differentiation and patterning of hypothalamic tanycytes and ependymal cells, as well as for maintenance of the cerebrospinal fluid-hypothalamus barrier. PMID:23939786

  16. Mechanotransduction at the basis of endothelial barrier function

    Science.gov (United States)

    Gulino-Debrac, Danielle

    2013-01-01

    Destabilization of cell-cell contacts involved in the maintenance of endothelial barrier function can lead to increased endothelial permeability. This increase in endothelial permeability results in an anarchical movement of fluid, solutes and cells outside the vasculature and into the surrounding tissues, thereby contributing to various diseases such as stroke or pulmonary edema. Thus, a better understanding of the molecular mechanisms regulating endothelial cell junction integrity is required for developing new therapies for these diseases. In this review, we describe the mechanotransduction mechanism at the basis of adherens junction strengthening at endothelial cell-cell contacts. More particularly, we report on the emerging role of α-catenin and EPLIN that act as a mechanotransmitter of myosin-IIgenerated traction forces. The interplay between α-catenin, EPLIN and the myosin-II machinery initiates the junctional recruitment of vinculin and α-actinin leading to a drastic remodeling of the actin cytoskeleton and to cortical actin ring reshaping. The pathways initiated by tyrosine phosphorylation of VE-cadherin at the basis of endothelial cell–cell junction remodeling is also reported, as it may be interrelated to α-catenin/ EPLIN-mediated mechanotransduction mechanisms. We also describe the junctional mechanosensory complex composed of PECAM-1, VE-cadherin and VEGFR2 that is able to transmit signaling pathway under the onset of shear stress. This mechanosensing mechanism, involved in the earliest events promoting atherogenesis, is required for endothelial cell alignment along flow direction. PMID:24665386

  17. Estimation of Time-Varying Coherence and Its Application in Understanding Brain Functional Connectivity

    Directory of Open Access Journals (Sweden)

    Cheng Liu

    2010-01-01

    Full Text Available Time-varying coherence is a powerful tool for revealing functional dynamics between different regions in the brain. In this paper, we address ways of estimating evolutionary spectrum and coherence using the general Cohen's class distributions. We show that the intimate connection between the Cohen's class-based spectra and the evolutionary spectra defined on the locally stationary time series can be linked by the kernel functions of the Cohen's class distributions. The time-varying spectra and coherence are further generalized with the Stockwell transform, a multiscale time-frequency representation. The Stockwell measures can be studied in the framework of the Cohen's class distributions with a generalized frequency-dependent kernel function. A magnetoencephalography study using the Stockwell coherence reveals an interesting temporal interaction between contralateral and ipsilateral motor cortices under the multisource interference task.

  18. Optimum Design of Multi-Function Robot Arm Gripper for Varying Shape Green Product

    Directory of Open Access Journals (Sweden)

    Razali Zol Bahri

    2016-01-01

    Full Text Available The project focuses on thorough experimentally studies of the optimum design of Multi-function Robot Arm Gripper for varying shape green product. The purpose of this project is to design a few of robot arm gripper for multi-functionally grip a green product with varying shape. The main character of the gripper is that it can automated adjust its finger to suit with the shape of the product. An optimum design of multi-function robot arm gripper is verified through experimental study. The expected result is a series of analytical results on the proposal of gripper design and material that will be selected for the gripper. The analysis of the gripper design proposal by using ANSYS and CATIA software is described in detail in this paper.

  19. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  20. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

  1. Barriers to Eating Traditional Foods Vary by Age Group in Ecuador With Biodiversity Loss as a Key Issue.

    Science.gov (United States)

    Penafiel, Daniela; Termote, Celine; Lachat, Carl; Espinel, Ramon; Kolsteren, Patrick; Van Damme, Patrick

    2016-04-01

    To document the perceptions of indigenous peoples for the sustainable management of natural resources against malnutrition. Initially 4 and then 12 interviews were conducted with 4 different age groups. Eight rural villages in Guasaganda, central Ecuador, were studied in 2011-2012. A total of 75 people (22 children, 18 adolescents, 20 adults, and 15 elders). Benefits, severity, susceptibility, barriers, cues to action, and self-efficacy of eating traditional foods. Qualitative content analysis was completed using NVivo software. Initial analysis was inductive, followed by a content analysis directed by the Health Belief Model. Coding was completed independently by 2 researchers and kappa statistics (κ ≥ 0.65) were used to evaluate agreement. Healthy perceptions toward traditional foods existed and differed by age. Local young people ate traditional foods for their health benefits and good taste; adults cultivated traditional foods that had an economic benefit. Traditional knowledge used for consumption and cultivation of traditional foods was present but needs to be disseminated. Nutrition education in schools is needed that supports traditional knowledge in younger groups and prevents dietary changes toward unhealthy eating. Increased production of traditional food is needed to address current economic realities. Copyright © 2016 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  2. Probiotic Bacteria Induce Maturation of Intestinal Claudin 3 Expression and Barrier Function

    Science.gov (United States)

    Patel, Ravi M.; Myers, Loren S.; Kurundkar, Ashish R.; Maheshwari, Akhil; Nusrat, Asma; Lin, Patricia W.

    2012-01-01

    An immature intestinal epithelial barrier may predispose infants and children to many intestinal inflammatory diseases, such as infectious enteritis, inflammatory bowel disease, and necrotizing enterocolitis. Understanding the factors that regulate gut barrier maturation may yield insight into strategies to prevent these intestinal diseases. The claudin family of tight junction proteins plays an important role in regulating epithelial paracellular permeability. Previous reports demonstrate that rodent intestinal barrier function matures during the first 3 weeks of life. We show that murine paracellular permeability markedly decreases during postnatal maturation, with the most significant change occurring between 2 and 3 weeks. Here we report for the first time that commensal bacterial colonization induces intestinal barrier function maturation by promoting claudin 3 expression. Neonatal mice raised on antibiotics or lacking the toll-like receptor adaptor protein MyD88 exhibit impaired barrier function and decreased claudin 3 expression. Furthermore, enteral administration of either live or heat-killed preparations of the probiotic Lactobacillus rhamnosus GG accelerates intestinal barrier maturation and induces claudin 3 expression. However, live Lactobacillus rhamnosus GG increases mortality. Taken together, these results support a vital role for intestinal flora in the maturation of intestinal barrier function. Probiotics may prevent intestinal inflammatory diseases by regulating intestinal tight junction protein expression and barrier function. The use of heat-killed probiotics may provide therapeutic benefit while minimizing adverse effects. PMID:22155109

  3. Human intestinal barrier function in health and disease

    NARCIS (Netherlands)

    König, Julia; Wells, Jerry; Cani, Patrice D.; García-Ródenas, Clara L.; MacDonald, Tom; Mercenier, Annick; Whyte, Jacqueline; Troost, Freddy J.; Brummer, Robert-Jan

    2016-01-01

    The gastrointestinal tract consists of an enormous surface area that is optimized to efficiently absorb nutrients, water, and electrolytes from food. At the same time, it needs to provide a tight barrier against the ingress of harmful substances, and protect against a reaction to omnipresent

  4. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.

  5. Static Response of Functionally Graded Material Plate under Transverse Load for Varying Aspect Ratio

    Directory of Open Access Journals (Sweden)

    Manish Bhandari

    2014-01-01

    Full Text Available Functionally gradient materials (FGM are one of the most widely used materials in various applications because of their adaptability to different situations by changing the material constituents as per the requirement. Nowadays it is very easy to tailor the properties to serve specific purposes in functionally gradient material. Most structural components used in the field of engineering can be classified as beams, plates, or shells for analysis purposes. In the present study the power law, sigmoid law and exponential distribution, is considered for the volume fraction distributions of the functionally graded plates. The work includes parametric studies performed by varying volume fraction distributions and aspect ratio. The FGM plate is subjected to transverse UDL (uniformly distributed load and point load and the response is analysed.

  6. State and Trait Components of Functional Connectivity: Individual Differences Vary with Mental State.

    Science.gov (United States)

    Geerligs, Linda; Rubinov, Mikail; Cam-Can; Henson, Richard N

    2015-10-14

    Resting-state functional connectivity, as measured by functional magnetic resonance imaging (fMRI), is often treated as a trait, used, for example, to draw inferences about individual differences in cognitive function, or differences between healthy or diseased populations. However, functional connectivity can also depend on the individual's mental state. In the present study, we examined the relative contribution of state and trait components in shaping an individual's functional architecture. We used fMRI data from a large, population-based human sample (N = 587, age 18-88 years), as part of the Cambridge Centre for Aging and Neuroscience (Cam-CAN), which were collected in three mental states: resting, performing a sensorimotor task, and watching a movie. Whereas previous studies have shown commonalities across mental states in the average functional connectivity across individuals, we focused on the effects of states on the pattern of individual differences in functional connectivity. We found that state effects were as important as trait effects in shaping individual functional connectivity patterns, each explaining an approximately equal amount of variance. This was true when we looked at aging, as one specific dimension of individual differences, as well as when we looked at generic aspects of individual variation. These results show that individual differences in functional connectivity consist of state-dependent aspects, as well as more stable, trait-like characteristics. Studying individual differences in functional connectivity across a wider range of mental states will therefore provide a more complete picture of the mechanisms underlying factors such as cognitive ability, aging, and disease. The brain's functional architecture is remarkably similar across different individuals and across different mental states, which is why many studies use functional connectivity as a trait measure. Despite these trait-like aspects, functional connectivity varies over

  7. Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function

    NARCIS (Netherlands)

    Ottman, N.; Reunanen, J.; Meijerink, M.; Pietila, T.E.; Kainulainen, V.; Klievink, J.; Huuskonen, L.; Aalvink, S.; Skurnik, M.; Boeren, S.; Satokari, R.; Mercenier, A.; Palva, A.; Smidt, H.; Vos, W.M. De; Belzer, C.

    2017-01-01

    Gut barrier function is key in maintaining a balanced response between the host and its microbiome. The microbiota can modulate changes in gut barrier as well as metabolic and inflammatory responses. This highly complex system involves numerous microbiota-derived factors. The gut symbiont

  8. Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function

    NARCIS (Netherlands)

    Ottman, Noora; Reunanen, Justus; Meijerink, Marjolein; Pietila, Taija E.; Kainulainen, Veera; Klievink, Judith; Huuskonen, Laura; Aalvink, Steven; Skurnik, Mikael; Boeren, Sjef; Satokari, Reetta; Mercenier, Annick; Palva, Airi; Smidt, Hauke; Vos, de Willem M.; Belzer, Clara

    2017-01-01

    Gut barrier function is key in maintaining a balanced response between the host and its microbiome. The microbiota can modulate changes in gut barrier as well as metabolic and inflammatory responses. This highly complex system involves numerous microbiota-derived factors. The gut symbiont

  9. Topical Hesperidin Improves Epidermal Permeability Barrier Function and Epidermal Differentiation in Normal Murine Skin

    Science.gov (United States)

    Hou, Maihua; Man, Mona; Man, Wenyan; Zhu, Wenyuan; Hupe, Melanie; Park, Kyungho; Crumrine, Debra; Elias, Peter M.; Man, Mao-Qiang

    2012-01-01

    Orange peel extract appears to exhibit beneficial effects on skin whitening, inflammation, UVB protection, as well as keratinocyte proliferation. In the present study, we determine whether topical hesperidin influences epidermal permeability barrier function and its underlying mechanisms. Hairless mice were treated topically with 2% hesperidin or 70% ethanol alone twice daily for 6 days. At the end of treatment, basal barrier function as well as transepidermal water loss (TEWL) was measured 2 and 4 hours post barrier disruption. Epidermal proliferation and differentiation were evaluated by immunohistochemical staining and Western blot analysis. Additionally, lamellar body density and secretion were assessed by electron microscopy. Although there were no significant differences in basal barrier function, in comparison to control animals, topical hesperidin significantly accelerated barrier recovery at both 2 and 4 hours after acute barrier abrogation. Enhanced barrier function in hesperidin-treated skin correlated with stimulation of both epidermal proliferation and differentiation, as well as enhanced lamellar body secretion. These results indicate that topical hesperidin enhances epidermal permeability barrier homeostasis at least in part due to stimulation of epidermal proliferation, differentiation, as well as lamellar body secretion. PMID:22509829

  10. Barrier function in reconstructed epidermis and its resemblance to native human skin

    NARCIS (Netherlands)

    Ponec, M.; Gibbs, S.; Pilgram, G.; Boelsma, E.; Koerten, H.; Bouwstra, J.; Mommaas, M.

    2001-01-01

    One of the prerequisites for the use of human skin equivalents for scientific and screening purposes is that their barrier function is similar to that of native skin. Using human epidermis reconstructed on de-epidermized dermis we demonstrated that the formation of the stratum corneum (SC) barrier

  11. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  12. Gradually-varied flow profiles in open channels analytical solutions by using Gaussian hypergeometric function

    CERN Document Server

    Jan, Chyan-Deng

    2014-01-01

    Gradually-varied flow (GVF) is a steady non-uniform flow in an open channel with gradual changes in its water surface elevation. The evaluation of GVF profiles under a specific flow discharge is very important in hydraulic engineering. This book proposes a novel approach to analytically solve the GVF profiles by using the direct integration and Gaussian hypergeometric function. Both normal-depth- and critical-depth-based dimensionless GVF profiles are presented. The novel approach has laid the foundation to compute at one sweep the GVF profiles in a series of sustaining and adverse channels, w

  13. Statins Promote Cardiac Infarct Healing by Modulating Endothelial Barrier Function Revealed by Contrast-Enhanced Magnetic Resonance Imaging

    NARCIS (Netherlands)

    Leenders, Geert J.; Smeets, Mirjam B.; van den Boomen, Maaike; Berben, Monique; Nabben, Miranda; van Strijp, Dianne; Strijkers, Gustav J.; Prompers, Jeanine J.; Arslan, Fatih; Nicolay, Klaas; Vandoorne, Katrien

    2018-01-01

    Objective The endothelium has a crucial role in wound healing, acting as a barrier to control transit of leukocytes. Endothelial barrier function is impaired in atherosclerosis preceding myocardial infarction (MI). Besides lowering lipids, statins modulate endothelial function. Here, we

  14. A globally convergent Lagrange and barrier function iterative algorithm for the traveling salesman problem.

    Science.gov (United States)

    Dang, C; Xu, L

    2001-03-01

    In this paper a globally convergent Lagrange and barrier function iterative algorithm is proposed for approximating a solution of the traveling salesman problem. The algorithm employs an entropy-type barrier function to deal with nonnegativity constraints and Lagrange multipliers to handle linear equality constraints, and attempts to produce a solution of high quality by generating a minimum point of a barrier problem for a sequence of descending values of the barrier parameter. For any given value of the barrier parameter, the algorithm searches for a minimum point of the barrier problem in a feasible descent direction, which has a desired property that the nonnegativity constraints are always satisfied automatically if the step length is a number between zero and one. At each iteration the feasible descent direction is found by updating Lagrange multipliers with a globally convergent iterative procedure. For any given value of the barrier parameter, the algorithm converges to a stationary point of the barrier problem without any condition on the objective function. Theoretical and numerical results show that the algorithm seems more effective and efficient than the softassign algorithm.

  15. A Lagrange multiplier and Hopfield-type barrier function method for the traveling salesman problem.

    Science.gov (United States)

    Dang, Chuangyin; Xu, Lei

    2002-02-01

    A Lagrange multiplier and Hopfield-type barrier function method is proposed for approximating a solution of the traveling salesman problem. The method is derived from applications of Lagrange multipliers and a Hopfield-type barrier function and attempts to produce a solution of high quality by generating a minimum point of a barrier problem for a sequence of descending values of the barrier parameter. For any given value of the barrier parameter, the method searches for a minimum point of the barrier problem in a feasible descent direction, which has a desired property that lower and upper bounds on variables are always satisfied automatically if the step length is a number between zero and one. At each iteration, the feasible descent direction is found by updating Lagrange multipliers with a globally convergent iterative procedure. For any given value of the barrier parameter, the method converges to a stationary point of the barrier problem without any condition on the objective function. Theoretical and numerical results show that the method seems more effective and efficient than the softassign algorithm.

  16. Evidence in support of Gaussian mixture models for sparse time varying ocean acoustic response functions.

    Science.gov (United States)

    Gendron, Paul J

    2017-04-01

    A hierarchical Gaussian mixture model has been proposed to characterize sparse space-time varying shallow water acoustic response functions [Gendron, J. Acoust. Soc. Am. 139, 1923-1937 (2016)]. Considered here is an extension of this model to a uniform linear vertical array in order to provide an empirical validation of the mixture model for receivers of small aperture. An acoustic environment between source and moving receiver is predicated on a small proportion of relatively coherent paths obeying an ensemble frequency-angle-Doppler distribution. Provided are quantile-quantile plots of the discrete mixture model versus the empirical channel coefficients that lend credence to its use as a sparse model for acoustic response functions.

  17. FUNCTIONAL PERFORMANCE, PARTICIPATION AND AUTONOMY AFTER DISCHARGE FROM PROSTHETIC REHABILITATION : BARRIERS, FACILITATORS AND OUTCOMES

    NARCIS (Netherlands)

    van Twillert, Sacha; Stuive, Ilse; Geertzen, Jan H. B.; Postema, Klaas; Lettinga, Ant T.

    2014-01-01

    Objective: To examine functional performance, participation and autonomy after discharge from prosthetic rehabilitation and to identify the barriers and facilitators affecting these outcomes. Design: Concurrent mixed-methods design. Quantitative and qualitative data were collected at discharge from

  18. Kinetin Improves Barrier Function of the Skin by Modulating Keratinocyte Differentiation Markers

    OpenAIRE

    An, Sungkwan; CHA, HWA JUN; Ko, Jung-Min; Han, Hyunjoo; Kim, Su Young; Kim, Kyung-Suk; Lee, Song Jeong; AN, IN-SOOK; Kim, Sangwon; Youn, Hae Jeong; Ahn, Kyu Joong; Kim, Soo-Yeon

    2017-01-01

    Background Kinetin is a plant hormone that regulates growth and differentiation. Keratinocytes, the basic building blocks of the epidermis, function in maintaining the skin barrier. Objective We examined whether kinetin induces skin barrier functions in vitro and in vivo. Methods To evaluate the efficacy of kinetin at the cellular level, expression of keratinocyte differentiation markers was assessed. Moreover, we examined the clinical efficacy of kinetin by evaluating skin moisture, transepi...

  19. Interleukin-13 promotes expression of Alix to compromise renal tubular epithelial barrier function.

    Science.gov (United States)

    Xu, Chen; Sun, Guangdong; Yang, Jie; Sun, Qianmei; Tong, Zhaohui

    2015-05-01

    The epithelial barrier dysfunction plays a critical role in a number of kidney diseases. The mechanism is unclear. Alix is a protein involving in protein degradation in epithelial cells. This study aims to investigate that interleukin (IL)-13 inhibits Alix to compromise the kidney epithelial barrier function. In this study, the murine collecting duct cell line (M-1) was cultured in Transwell inserts to investigate the significance of Alix in compromising the epithelial barrier functions. T cell (Teff cells) proliferation assay was employed to assess the antigenicity of ovalbumin (OVA) that was transported across the M-1 monolayer barrier. The results showed that M-1 cells express Alix. Exposure to interleukin (IL)-13 markedly decreased the expression of Alix in M-1 cells, which compromised the M-1 monolayer barrier functions by showing the increases in the permeability to OVA. Over-expression of Alix abolished the IL-13-induced M-1 monolayer barrier dysfunction. Knockdown of Alix significantly increased M-1 monolayer permeability. The OVA collected from the Transwell basal chambers induced the OVA-specific T cell proliferation. We conclude that IL-13 compromises M-1 epithelial barrier functions via inhibiting Alix expression. © 2015 International Federation for Cell Biology.

  20. Inhibition of Murine Pulmonary Microvascular Endothelial Cell Apoptosis Promotes Recovery of Barrier Function under Septic Conditions

    Directory of Open Access Journals (Sweden)

    Lefeng Wang

    2017-01-01

    Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.

  1. Bayesian switching factor analysis for estimating time-varying functional connectivity in fMRI.

    Science.gov (United States)

    Taghia, Jalil; Ryali, Srikanth; Chen, Tianwen; Supekar, Kaustubh; Cai, Weidong; Menon, Vinod

    2017-07-15

    There is growing interest in understanding the dynamical properties of functional interactions between distributed brain regions. However, robust estimation of temporal dynamics from functional magnetic resonance imaging (fMRI) data remains challenging due to limitations in extant multivariate methods for modeling time-varying functional interactions between multiple brain areas. Here, we develop a Bayesian generative model for fMRI time-series within the framework of hidden Markov models (HMMs). The model is a dynamic variant of the static factor analysis model (Ghahramani and Beal, 2000). We refer to this model as Bayesian switching factor analysis (BSFA) as it integrates factor analysis into a generative HMM in a unified Bayesian framework. In BSFA, brain dynamic functional networks are represented by latent states which are learnt from the data. Crucially, BSFA is a generative model which estimates the temporal evolution of brain states and transition probabilities between states as a function of time. An attractive feature of BSFA is the automatic determination of the number of latent states via Bayesian model selection arising from penalization of excessively complex models. Key features of BSFA are validated using extensive simulations on carefully designed synthetic data. We further validate BSFA using fingerprint analysis of multisession resting-state fMRI data from the Human Connectome Project (HCP). Our results show that modeling temporal dependencies in the generative model of BSFA results in improved fingerprinting of individual participants. Finally, we apply BSFA to elucidate the dynamic functional organization of the salience, central-executive, and default mode networks-three core neurocognitive systems with central role in cognitive and affective information processing (Menon, 2011). Across two HCP sessions, we demonstrate a high level of dynamic interactions between these networks and determine that the salience network has the highest temporal

  2. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  3. Skin Barrier Function and Its Importance at the Start of the Atopic March

    Directory of Open Access Journals (Sweden)

    Mary Beth Hogan

    2012-01-01

    Full Text Available Atopic dermatitis can be due to a variety of causes from nonatopic triggers to food allergy. Control of egress of water and protection from ingress of irritants and allergens are key components of cutaneous barrier function. Current research suggests that a degraded barrier function of the skin allows the immune system inappropriate access to environmental allergens. Epidermal aeroallergen exposure may allow sensitization to allergen possibly initiating the atopic march. Further research into connections between epidermal barrier function and possible allergen sensitization will be important to undertake. Future clinical trials focused on skin barrier protection may be of value as a possible intervention in prevention of the initiation of the atopic march.

  4. Memory for faces and voices varies as a function of sex and expressed emotion.

    Directory of Open Access Journals (Sweden)

    Diana S Cortes

    Full Text Available We investigated how memory for faces and voices (presented separately and in combination varies as a function of sex and emotional expression (anger, disgust, fear, happiness, sadness, and neutral. At encoding, participants judged the expressed emotion of items in forced-choice tasks, followed by incidental Remember/Know recognition tasks. Results from 600 participants showed that accuracy (hits minus false alarms was consistently higher for neutral compared to emotional items, whereas accuracy for specific emotions varied across the presentation modalities (i.e., faces, voices, and face-voice combinations. For the subjective sense of recollection ("remember" hits, neutral items received the highest hit rates only for faces, whereas for voices and face-voice combinations anger and fear expressions instead received the highest recollection rates. We also observed better accuracy for items by female expressers, and own-sex bias where female participants displayed memory advantage for female faces and face-voice combinations. Results further suggest that own-sex bias can be explained by recollection, rather than familiarity, rates. Overall, results show that memory for faces and voices may be influenced by the expressions that they carry, as well as by the sex of both items and participants. Emotion expressions may also enhance the subjective sense of recollection without enhancing memory accuracy.

  5. Aggregation pattern transitions by slightly varying the attractive/repulsive function.

    Science.gov (United States)

    Cheng, Zhao; Zhang, Hai-Tao; Chen, Michael Z Q; Zhou, Tao; Valeyev, Najl V

    2011-01-01

    Among collective behaviors of biological swarms and flocks, the attractive/repulsive (A/R) functional links between particles play an important role. By slightly changing the cutoff distance of the A/R function, a drastic transition between two distinct aggregation patterns is observed. More precisely, a large cutoff distance yields a liquid-like aggregation pattern where the particle density decreases monotonously from the inside to the outwards within each aggregated cluster. Conversely, a small cutoff distance produces a crystal-like aggregation pattern where the distance between each pair of neighboring particles remains constant. Significantly, there is an obvious spinodal in the variance curve of the inter-particle distances along the increasing cutoff distances, implying a legible transition pattern between the liquid-like and crystal-like aggregations. This work bridges the aggregation phenomena of physical particles and swarming of organisms in nature upon revealing some common mechanism behind them by slightly varying their inter-individual attractive/repulsive functions, and may find its potential engineering applications, for example, in the formation design of multi-robot systems and unmanned aerial vehicles (UAVs).

  6. Aggregation pattern transitions by slightly varying the attractive/repulsive function.

    Directory of Open Access Journals (Sweden)

    Zhao Cheng

    Full Text Available Among collective behaviors of biological swarms and flocks, the attractive/repulsive (A/R functional links between particles play an important role. By slightly changing the cutoff distance of the A/R function, a drastic transition between two distinct aggregation patterns is observed. More precisely, a large cutoff distance yields a liquid-like aggregation pattern where the particle density decreases monotonously from the inside to the outwards within each aggregated cluster. Conversely, a small cutoff distance produces a crystal-like aggregation pattern where the distance between each pair of neighboring particles remains constant. Significantly, there is an obvious spinodal in the variance curve of the inter-particle distances along the increasing cutoff distances, implying a legible transition pattern between the liquid-like and crystal-like aggregations. This work bridges the aggregation phenomena of physical particles and swarming of organisms in nature upon revealing some common mechanism behind them by slightly varying their inter-individual attractive/repulsive functions, and may find its potential engineering applications, for example, in the formation design of multi-robot systems and unmanned aerial vehicles (UAVs.

  7. Positive Selection or Free to Vary? Assessing the Functional Significance of Sequence Change Using Molecular Dynamics.

    Directory of Open Access Journals (Sweden)

    Jane R Allison

    Full Text Available Evolutionary arms races between pathogens and their hosts may be manifested as selection for rapid evolutionary change of key genes, and are sometimes detectable through sequence-level analyses. In the case of protein-coding genes, such analyses frequently predict that specific codons are under positive selection. However, detecting positive selection can be non-trivial, and false positive predictions are a common concern in such analyses. It is therefore helpful to place such predictions within a structural and functional context. Here, we focus on the p19 protein from tombusviruses. P19 is a homodimer that sequesters siRNAs, thereby preventing the host RNAi machinery from shutting down viral infection. Sequence analysis of the p19 gene is complicated by the fact that it is constrained at the sequence level by overprinting of a viral movement protein gene. Using homology modeling, in silico mutation and molecular dynamics simulations, we assess how non-synonymous changes to two residues involved in forming the dimer interface-one invariant, and one predicted to be under positive selection-impact molecular function. Interestingly, we find that both observed variation and potential variation (where a non-synonymous change to p19 would be synonymous for the overprinted movement protein does not significantly impact protein structure or RNA binding. Consequently, while several methods identify residues at the dimer interface as being under positive selection, MD results suggest they are functionally indistinguishable from a site that is free to vary. Our analyses serve as a caveat to using sequence-level analyses in isolation to detect and assess positive selection, and emphasize the importance of also accounting for how non-synonymous changes impact structure and function.

  8. Executive Functioning, Barriers to Adherence, and Nonadherence in Adolescent and Young Adult Transplant Recipients.

    Science.gov (United States)

    Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L

    2016-08-01

    OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence.  METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures.  RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence.  CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Arctigenin from Fructus Arctii (Seed of Burdock Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Directory of Open Access Journals (Sweden)

    Hee Soon Shin

    2015-01-01

    Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

  10. Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Science.gov (United States)

    Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

    2015-01-01

    Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018

  11. [The epidermis as metabolically active tissue: regulation of lipid synthesis by the barrier function].

    Science.gov (United States)

    Proksch, E

    1990-03-01

    Numerous investigations have shown that the lipids of the horny layer play an important role in the epidermal barrier function. These lipids consist of sphingolipids, cholesterol, and free fatty acids in nearly equimolar proportions. If the barrier function is disturbed--i.e. in case of lipid extraction or a diet deficient of essential fatty acids--we find an increased synthesis of free fatty acids, cholesterol, and non-saponifiable lipides in the epidermis. Covering the skin with a Latex wrap prevents an increased lipid synthesis. The synthesis of cholesterol depending on the barrier function is regulated by the enzyme HMG CoA reductase. The regulation process involves both the quantity and the activity (phosphorylation) of the enzyme. Acute disruption of the permeability barrier results in an increased synthesis of cholesterol in the lower epidermis, whereas in case of chronic barrier disorders, the specific increase takes place in the upper dermis. A reduction of the cholesterol synthesis by the HMG CoA reductase inhibitor Lovastatin leads to a disturbed permeability barrier and epidermal hyperplasia.

  12. P-Glycoprotein Function at the Blood-Brain Barrier: Effects of Age and Gender

    NARCIS (Netherlands)

    van Assema, D.M.E.; Lubberink, J.M.; Boellaard, R.; Schuit, R.C.; Windhorst, A.D.; Scheltens, P.; Lammertsma, A.A.; van Berckel, B.N.M.

    2012-01-01

    Purpose: P-glycoprotein (Pgp) is an efflux transporter involved in transport of several compounds across the blood-brain barrier (BBB). Loss of Pgp function with increasing age may be involved in the development of age-related disorders, but this may differ between males and females. Pgp function

  13. Modulation of Human Airway Barrier Functions during Burkholderia thailandensis and Francisella tularensis Infection Running Title: Airway Barrier Functions during Bacterial Infections

    Directory of Open Access Journals (Sweden)

    Cornelia Blume

    2016-08-01

    Full Text Available The bronchial epithelium provides protection against pathogens from the inhaled environment through the formation of a highly-regulated barrier. In order to understand the pulmonary diseases melioidosis and tularemia caused by Burkholderia thailandensis and Fransicella tularensis, respectively, the barrier function of the human bronchial epithelium were analysed. Polarised 16HBE14o- or differentiated primary human bronchial epithelial cells (BECs were exposed to increasing multiplicities of infection (MOI of B. thailandensis or F. tularensis Live Vaccine Strain and barrier responses monitored over 24–72 h. Challenge of polarized BECs with either bacterial species caused an MOI- and time-dependent increase in ionic permeability, disruption of tight junctions, and bacterial passage from the apical to the basolateral compartment. B. thailandensis was found to be more invasive than F. tularensis. Both bacterial species induced an MOI-dependent increase in TNF-α release. An increase in ionic permeability and TNF-α release was induced by B. thailandensis in differentiated BECs. Pretreatment of polarised BECs with the corticosteroid fluticasone propionate reduced bacterial-dependent increases in ionic permeability, bacterial passage, and TNF-α release. TNF blocking antibody Enbrel® reduced bacterial passage only. BEC barrier properties are disrupted during respiratory bacterial infections and targeting with corticosteroids or anti-TNF compounds may represent a therapeutic option.

  14. Analysis of noise in quartz crystal oscillators by using slowly varying functions method.

    Science.gov (United States)

    Brendel, R; Ratier, N; Couteleau, L; Marianneau, G; Guillemot, P

    1999-01-01

    By using formal manipulation capability of commercially available symbolic calculation code, it is possible to automatically derive the characteristic polynomial describing the conditions for oscillation of a circuit. The analytical expression of the characteristic polynomial is obtained through an encapsulation process starting from the SPICE netlist description of the circuit: by using a limited number of simple transformations, the initial circuit is progressively transformed in a simplified standard form. In this method, the nonlinear component is described by its large signal admittance parameters obtained from a set of SPICE transient simulations of larger and larger amplitude. The encapsulation process involving linear and nonlinear components as well as noise sources leads to a perturbed characteristic polynomial. In the time domain, the perturbed characteristic polynomial becomes a nonlinear nonautonomous differential equation. By using an extension of the slowly varying functions method, this differential equation is transformed into a nonlinear differential system with perturbation terms as the right-hand side. Eventually, solving this system with classical algorithms allows one to obtain both amplitude and phase noise spectra of the oscillator.

  15. A search for parameters of universal sub-barrier fusion excitation function

    Energy Technology Data Exchange (ETDEWEB)

    Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)

    2016-11-15

    Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)

  16. The lectin-like domain of complement receptor 3 protects endothelial barrier function from activated neutrophils.

    Science.gov (United States)

    Tsikitis, Vassiliki L; Morin, Nicole A; Harrington, Elizabeth O; Albina, Jorge E; Reichner, Jonathan S

    2004-07-15

    The adhesion of neutrophils to endothelial cells is a central event leading to diapedesis and involves the binding of the I-domain of beta(2) integrins (CD11/CD18) to endothelial ICAMs. In addition to the I-domain, the beta(2) integrin complement receptor 3 (CR3) (CD11b/CD18) contains a lectin-like domain (LLD) that can alter leukocyte functions such as chemotaxis and cytotoxicity. The present study demonstrates that, in contrast to the CR3 I-domain, Ab blockade of the CR3 LLD has no role in mediating neutrophil-induced loss of endothelial barrier function. However, activation of CR3 with the LLD agonist beta-glucan protects the barrier function of endothelial cells in the presence of activated neutrophils and reduces transendothelial migration without affecting adhesion of the neutrophils to the endothelium. The LLD site-specific mAb VIM12 obviates beta-glucan protection while activation of the LLD by VIM12 cross-linking mimics the beta-glucan response by both preserving endothelial barrier function and reducing neutrophil transendothelial migration. beta-glucan has no direct effect on endothelial cell function in the absence of activated neutrophils. These findings demonstrate that signaling through the CR3 LLD prevents neutrophil-induced loss of endothelial barrier function and reduces diapedesis. This suggests that the LLD may be a suitable target for oligosaccharide-based anti-inflammatory therapeutics.

  17. Hypoxia Inducible Factor (HIF Hydroxylases as Regulators of Intestinal Epithelial Barrier FunctionSummary

    Directory of Open Access Journals (Sweden)

    Mario C. Manresa

    2017-05-01

    Full Text Available Human health is dependent on the ability of the body to extract nutrients, fluids, and oxygen from the external environment while at the same time maintaining a state of internal sterility. Therefore, the cell layers that cover the surface areas of the body such as the lung, skin, and gastrointestinal mucosa provide vital semipermeable barriers that allow the transport of essential nutrients, fluid, and waste products, while at the same time keeping the internal compartments free of microbial organisms. These epithelial surfaces are highly specialized and differ in their anatomic structure depending on their location to provide appropriate and effective site-specific barrier function. Given this important role, it is not surprising that significant disease often is associated with alterations in epithelial barrier function. Examples of such diseases include inflammatory bowel disease, chronic obstructive pulmonary disease, and atopic dermatitis. These chronic inflammatory disorders often are characterized by diminished tissue oxygen levels (hypoxia. Hypoxia triggers an adaptive transcriptional response governed by hypoxia-inducible factors (HIFs, which are repressed by a family of oxygen-sensing HIF hydroxylases. Here, we review recent evidence suggesting that pharmacologic hydroxylase inhibition may be of therapeutic benefit in inflammatory bowel disease through the promotion of intestinal epithelial barrier function through both HIF-dependent and HIF-independent mechanisms. Keywords: Epithelial Barrier, Inflammatory Bowel Disease, Hypoxia, Hypoxia-Inducible Factor (HIF Hydroxylases

  18. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  19. Staphylococcal enterotoxin B suppresses Alix and compromises intestinal epithelial barrier functions.

    Science.gov (United States)

    Yan, Hao; Yi, Haitao; Xia, Lixin; Zhan, Zhenke; He, Weiyi; Cao, Jijuan; Yang, Ping-Chang; Liu, Zhigang

    2014-04-09

    The epithelial barrier dysfunction plays a critical role in the pathogenesis of a broad array of immune diseases. Alix protein is involved in the endolysosome system. This study aims to elucidate the role of Alix in the maintenance of epithelial barrier function. The results showed that Alix was detected in T84 cells at both mRNA and protein levels. Exposure to Staphylococcal enterotoxin B (SEB) markedly suppressed the expression of Alix in T84 cells, which could be blocked by knocking down the Toll like receptor 2. The exposure to SEB did not affect the TER, but markedly increased the permeability of T84 monolayers to OVA; the OVA passing through T84 monolayers still preserved the antigenicity manifesting inducing antigen specific T cells proliferation. Alix protein plays a critical role in the maintenance of the barrier function of T84 monolayers.

  20. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Science.gov (United States)

    Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei

    2016-01-01

    Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P bifidobacterium significantly decreased the production of IL-6 and TNF-α (P bifidobacterium pretreatment up-regulated occludin, claudin-3 and ZO-1 expression (P bifidobacterium decreased the incidence of NEC from 88 to 47% (P bifidobacterium treated rats (P bifidobacterium attenuated the increase in intestinal permeability (P bifidobacterium may protect against intestinal barrier dysfunction both in vitro and in NEC. This protective effect is associated with inhibition of proinflammatory cytokine secretion, suppression of zonulin protein release and improvement of intestinal TJ integrity.

  1. Microbial products induce claudin-2 to compromise gut epithelial barrier function.

    Directory of Open Access Journals (Sweden)

    Xiaoyu Liu

    Full Text Available The epithelial barrier dysfunction is an important pathogenic feature in a number of diseases. The underlying mechanism is to be further investigated. The present study aims to investigate the role of tight junction protein claudin-2 (Cldn2 in the compromising epithelial barrier function. In this study, the expression of Cldn2 in the epithelial layer of mice and patients with food allergy was observed by immunohistochemistry. The induction of Cldn2 was carried out with a cell culture model. The Cldn2-facilitated antigen internalization was observed by confocal microscopy. The epithelial barrier function in the gut epithelial monolayer was assessed by recording the transepithelial resistance and assessing the permeability to a macromolecular tracer. The results showed that the positive immune staining of Cldn2 was observed in the epithelial layer of the small intestine that was weakly stained in naïve control mice, and strongly stained in sensitized mice as well as patients with food allergy. Exposure to cholera toxin or Staphylococcal enterotoxin B induced the expression of Cldn2 in HT-29 or T84 cells. Cldn2 could bind protein antigen to form complexes to facilitate the antigen transport across the epithelial barrier. Blocking Cldn2 prevented the allergen-related hypersensitivity the intestine. We conclude that the tight junction protein Cldn2 is involved in the epithelial barrier dysfunction.

  2. Modelling of migration from multi-layers and functional barriers: Estimation of parameters

    NARCIS (Netherlands)

    Dole, P.; Voulzatis, Y.; Vitrac, O.; Reynier, A.; Hankemeier, T.; Aucejo, S.; Feigenbaum, A.

    2006-01-01

    Functional barriers form parts of multi-layer packaging materials, which are deemed to protect the food from migration of a broad range of contaminants, e.g. those associated with reused packaging. Often, neither the presence nor the identity of the contaminants is known, so that safety assessment

  3. Effects of cadmium chloride on the paracellular barrier function of intestinal epithelial cell lines

    NARCIS (Netherlands)

    Duizer, E.; Gilde, A.J.; Versantvoort, C.H.M.; Groten, J.P.

    1999-01-01

    In the present study we characterized the functional and structural disruption of the paracellular barrier of intestinal epithelium in vitro in relation to cytotoxicity after apical Cd2+ exposure. For that purpose filter-grown Caco-2 and IEC-18 cells were apically exposed to 5 to 100 μM CdCl2 for 4

  4. Intestinal epithelial barrier function and tight junction proteins with heat and exercise

    DEFF Research Database (Denmark)

    Dokladny, Karol; Zuhl, Micah N; Moseley, Pope L

    2016-01-01

    (passive hyperthermia) heat stress on tight junction barrier function in in vitro and in vivo (animals and humans) models. Our secondary focus is to review changes in tight junction proteins in response to exercise or hyperthermic conditions. Finally, we discuss some pharmacological or nutritional...

  5. Cichorium intybus root extract: A "vitamin D-like" active ingredient to improve skin barrier function.

    Science.gov (United States)

    Maia Campos, P M B G; G Mercurio, D; O Melo, M; Closs-Gonthier, B

    2017-02-01

    During the aging process, the human skin suffers many alterations including dryness, skin barrier function damage. The skin barrier function is important to the prevention of skin alterations and maintenance of homeostasis. So, the objective of this study was to assess the clinical efficacy on skin barrier function of Cichorium intybus root extract in cosmetic formulations with or without UV filters. Fifty women, aged between 45 and 60 years, were divided into two groups. One group received vehicle formulations containing UV filters, and the other group received formulations without UV filters. Both groups received a formulation containing the extract and the vehicle. The formulations were applied twice daily to the upper arms after washing with sodium lauryl sulphate. Transepidermal water loss (TEWL) and skin microrelief were evaluated before and after a 14- and 28-day period of treatment. The control regions and regions where the vehicles were applied showed an increase in the TEWL. For the formulations containing the extract, decreased TEWL and improved microrelief were observed when compared to the vehicle and control areas after a 28-day period. In conclusion, Cichorium intybus root extract showed protective and restructuring effects on the skin and stands out as an innovative ingredient to improve skin barrier function.

  6. Lactulose as a marker of intestinal barrier function in pigs after weaning

    NARCIS (Netherlands)

    Wijtten, P.J.A.; Verstijnen, J.J.; Kempen, van T.A.T.G.; Perdok, H.B.; Gort, G.; Verstegen, M.W.A.

    2011-01-01

    Intestinal barrier function in pigs after weaning is almost exclusively determined in terminal experiments with Ussing chambers. Alternatively, the recovery in urine of orally administered lactulose can be used to assess intestinal permeability in living animals. This experiment was designed to

  7. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function.

    Science.gov (United States)

    Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis; Park, Kyungho; Roelandt, Truus; Oda, Yuko; Hupe, Melanie; Crumrine, Debra; Lee, Hae-Jin; Gschwandtner, Maria; Thyssen, Jacob P; Trullas, Carles; Tschachler, Erwin; Feingold, Kenneth R; Elias, Peter M

    2013-02-01

    Systemic antagonists of the histamine type 1 and 2 receptors (H1/2r) are widely used as anti-pruritics and central sedatives, but demonstrate only modest anti-inflammatory activity. Because many inflammatory dermatoses result from defects in cutaneous barrier function, and because keratinocytes express both Hr1 and Hr2, we hypothesized that H1/2r antagonists might be more effective if they were used topically to treat inflammatory dermatoses. Topical H1/2r antagonists additively enhanced permeability barrier homeostasis in normal mouse skin by the following mechanisms: (i) stimulation of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased inflammation and enhanced barrier function. These results could shift current paradigms of antihistamine utilization from a predominantly systemic to a topical approach.

  8. Caspase-1 Activation Protects Lung Endothelial Barrier Function during Infection-Induced Stress

    Science.gov (United States)

    Alvarez, Diego F.; Housley, Nicole; Koloteva, Anna; Zhou, Chun; O’Donnell, Kristen

    2016-01-01

    Dysregulated activation of the inflammasome–caspase-1–IL-1β axis elicits damaging hyperinflammation during critical illnesses, such as pneumonia and sepsis. However, in critical illness models of Salmonella infection, burn, or shock, caspase-1 inhibition worsens outcomes. These paradoxical effects suggest that caspase-1 drives novel protective responses. Whether the protective effects of caspase-1 activation involve canonical immune cell and/or nonimmune cell responses is unknown. The objective of this study was to test the hypothesis that, in addition to its recognized proinflammatory function, caspase-1 initiates protective stress responses in nonimmune cells. In vivo, lung epithelial and endothelial barrier function and inflammation were assessed in mice infected with Pseudomonas aeruginosa in the presence or absence of a caspase-1 inhibitor. Lung endothelial barrier function was assessed ex vivo in isolated, perfused rat lungs infected with P. aeruginosa in the presence or absence of a caspase-1 inhibitor. Endothelial barrier function during P. aeruginosa infection was assessed in vitro in cultured rat wild-type pulmonary microvascular endothelial cells (PMVECs) or recombinant PMVECs engineered to decrease caspase-1 expression. We demonstrated in vivo that caspase-1 inhibition in P. aeruginosa–infected mice ameliorated hyperinflammation, but, counterintuitively, increased pulmonary edema. Ex vivo, caspase-1 inhibition increased pulmonary permeability in P. aeruginosa–infected isolated rat lungs. To uncouple caspase-1 from its canonical inflammatory role, we used cultured rat PMVECs in vitro and discovered that genetic knockdown of caspase-1 accelerated P. aeruginosa–induced barrier disruption. In conclusion, caspase-1 is a sentinel stress-response regulator that initiates proinflammatory responses and also initiates novel response(s) to protect PMVEC barrier function during pneumonia. PMID:27119735

  9. The effect of environmental humidity and temperature on skin barrier function and dermatitis

    DEFF Research Database (Denmark)

    Engebretsen, K A; Johansen, J D; Kezic, S

    2016-01-01

    existing dermatoses. We searched the literature for studies that evaluated the mechanisms behind this phenomenon. Commonly used meteorological terms such as absolute humidity, relative humidity and dew point are explained. Furthermore, we review the negative effect of low humidity, low temperatures...... and different seasons on the skin barrier and on the risk of dermatitis. We conclude that low humidity and low temperatures lead to a general decrease in skin barrier function and increased susceptible towards mechanical stress. Since pro-inflammatory cytokines and cortisol are released by keratinocytes...

  10. Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function.

    Science.gov (United States)

    Ottman, Noora; Reunanen, Justus; Meijerink, Marjolein; Pietilä, Taija E; Kainulainen, Veera; Klievink, Judith; Huuskonen, Laura; Aalvink, Steven; Skurnik, Mikael; Boeren, Sjef; Satokari, Reetta; Mercenier, Annick; Palva, Airi; Smidt, Hauke; de Vos, Willem M; Belzer, Clara

    2017-01-01

    Gut barrier function is key in maintaining a balanced response between the host and its microbiome. The microbiota can modulate changes in gut barrier as well as metabolic and inflammatory responses. This highly complex system involves numerous microbiota-derived factors. The gut symbiont Akkermansia muciniphila is positively correlated with a lean phenotype, reduced body weight gain, amelioration of metabolic responses and restoration of gut barrier function by modulation of mucus layer thickness. However, the molecular mechanisms behind its metabolic and immunological regulatory properties are unexplored. Herein, we identify a highly abundant outer membrane pili-like protein of A. muciniphila MucT that is directly involved in immune regulation and enhancement of trans-epithelial resistance. The purified Amuc_1100 protein and enrichments containing all its associated proteins induced production of specific cytokines through activation of Toll-like receptor (TLR) 2 and TLR4. This mainly leads to high levels of IL-10 similar to those induced by the other beneficial immune suppressive microorganisms such as Faecalibacterium prausnitzii A2-165 and Lactobacillus plantarum WCFS1. Together these results indicate that outer membrane protein composition and particularly the newly identified highly abundant pili-like protein Amuc_1100 of A. muciniphila are involved in host immunological homeostasis at the gut mucosa, and improvement of gut barrier function.

  11. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function

    DEFF Research Database (Denmark)

    Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis

    2013-01-01

    antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...

  12. Building barriers.

    Science.gov (United States)

    Turksen, Kursad

    2017-10-02

    Formation of tissue barriers starts in early development where it is critical for normal cell fate selection, differentiation and organogenesis. Barrier maintenance is critical to the ongoing function of organs during adulthood and aging. Dysfunctional tissue barrier formation and function at any stage of the organismal life cycle underlies many disease states.

  13. Barrier Lyapunov function-based model-free constraint position control for mechanical systems

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seong Ik; Ha, Hyun Uk; Lee, Jang Myung [Pusan National University, Busan (Korea, Republic of)

    2016-07-15

    In this article, a motion constraint control scheme is presented for mechanical systems without a modeling process by introducing a barrier Lyapunov function technique and adaptive estimation laws. The transformed error and filtered error surfaces are defined to constrain the motion tracking error in the prescribed boundary layers. Unknown parameters of mechanical systems are estimated using adaptive laws derived from the Lyapunov function. Then, robust control used the conventional sliding mode control, which give rise to excessive chattering, is changed to finite time-based control to alleviate undesirable chattering in the control action and to ensure finite-time error convergence. Finally, the constraint controller from the barrier Lyapunov function is designed and applied to the constraint of the position tracking error of the mechanical system. Two experimental examples for the XY table and articulated manipulator are shown to evaluate the proposed control scheme.

  14. Fatty acid synthase modulates intestinal barrier function through palmitoylation of mucin 2.

    Science.gov (United States)

    Wei, Xiaochao; Yang, Zhen; Rey, Federico E; Ridaura, Vanessa K; Davidson, Nicholas O; Gordon, Jeffrey I; Semenkovich, Clay F

    2012-02-16

    The intestinal mucus barrier prevents pathogen invasion and maintains host-microbiota homeostasis. We show that fatty acid synthase (FAS), an insulin-responsive enzyme essential for de novo lipogenesis, helps maintain the mucus barrier by regulating Mucin 2, the dominant mucin in the colon and a central component of mucus. Inducible Cre recombinase-directed inactivation of the FAS gene in the colonic epithelium of mice is associated with disruptions in the intestinal mucus barrier as well as increased intestinal permeability, colitis, systemic inflammation, and changes in gut microbial ecology. FAS deficiency blocked the generation of palmitoylated Mucin 2, which must be S-palmitoylated at its N terminus for proper secretion and function. Furthermore, a diabetic mouse model exhibited lower FAS levels and a decreased mucus layer, which could be restored with insulin treatment. Thus, the role of FAS in maintaining intestinal barrier function may explain the pathogenesis of intestinal inflammation in diabetes and other disorders. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Local burn injury impairs epithelial permeability and antimicrobial peptide barrier function in distal unburned skin.

    Science.gov (United States)

    Plichta, Jennifer K; Droho, Steve; Curtis, Brenda J; Patel, Parita; Gamelli, Richard L; Radek, Katherine A

    2014-06-01

    Our objective was to characterize the mechanisms by which local burn injury compromises epithelial barrier function in burn margin, containing the elements necessary for healing of the burn site, and in distal unburned skin, which serves as potential donor tissue. Experimental mouse scald burn injury. University Research Laboratory. C57/Bl6 Male mice, 8-12 weeks old. To confirm that dehydration was not contributing to our observed barrier defects, in some experiments mice received 1 mL of saline fluid immediately after burn, while a subgroup received an additional 0.5 mL at 4 hours and 1 mL at 24 hours following burn. We then assessed skin pH and transepidermal water loss every 12 hours on the burn wounds for 72 hours postburn. Burn margin exhibited increased epidermal barrier permeability indicated by higher pH, greater transepidermal water loss, and reduced lipid synthesis enzyme expression and structural protein production up to 96 hours postburn. By contrast, antimicrobial peptide production and protease activity were elevated in burn margin. Skin extracts from burn margin did not exhibit changes in the ability to inhibit bacterial growth. However, distal unburned skin from burned mice also demonstrated an impaired response to barrier disruption, indicated by elevated transepidermal water loss and reduced lipid synthesis enzyme and structural protein expression up to 96 hours postburn. Furthermore, skin extracts from distal unburned skin exhibited greater protease activity and a reduced capacity to inhibit bacterial growth of several skin pathogens. Finally, we established that antimicrobial peptide levels were also altered in the lung and bladder, which are common sites of secondary infection in burn-injured patients. These findings reveal several undefined deficiencies in epithelial barrier function at the burn margin, potential donor skin sites, and organs susceptible to secondary infection. These functional and biochemical data provide novel insights into

  16. Functional tight junction barrier localizes in the second layer of the stratum granulosum of human epidermis.

    Science.gov (United States)

    Yoshida, Kazue; Yokouchi, Mariko; Nagao, Keisuke; Ishii, Ken; Amagai, Masayuki; Kubo, Akiharu

    2013-08-01

    Mammalian epidermis has two diffusion barriers, the stratum corneum (SC) and tight junctions (TJs). We reported previously that a single living cell layer exists between the SC and TJ-forming keratinocytes in mice; however, the exact location of the TJ barrier in human epidermis has not been defined. To investigate the precise distribution of epidermal TJs in relation to various cell-cell junction proteins and the SC and to clarify the barrier function of TJs against macromolecules in human skin. The localization of various junctional proteins was investigated in human skin sections and in the roofs of bullae formed by ex vivo exfoliative toxin (ET) treatment in three dimensions. ET and single-chain variable fragments (scFv) against desmoglein 1 were used as large diffusion probes. Human stratum granulosum (SG) cells have a distinct distribution of TJ, adherens junction, and desmosome proteins in the uppermost three layers (SG1-SG3 from the surface inward). Ex vivo injection of ET or scFv demonstrated that only SG2-SG2 junctions function as a TJ barrier, limiting the inside-out diffusion of these proteins. The roofs of bullae formed by ex vivo ET treatment consisted of SC, SG1 cells, and TJ-forming SG2 cells, probably mimicking bulla formation in bullous impetigo. Human epidermis has three SG cell layers with distinct properties just beneath the SC, of which only SG2 cells have functional TJs. Our results suggest that human epidermal TJs between SG2 cells form a paracellular diffusion barrier against soluble proteins, including immunoglobulins and bacterial toxins. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  17. Bivariate functional data clustering: grouping streams based on a varying coefficient model of the stream water and air temperature relationship

    Science.gov (United States)

    H. Li; X. Deng; Andy Dolloff; E. P. Smith

    2015-01-01

    A novel clustering method for bivariate functional data is proposed to group streams based on their water–air temperature relationship. A distance measure is developed for bivariate curves by using a time-varying coefficient model and a weighting scheme. This distance is also adjusted by spatial correlation of streams via the variogram. Therefore, the proposed...

  18. The masticatory system under varying functional load. Part 1: structural adaptation of rabbit jaw muscles to reduced masticatory load

    NARCIS (Netherlands)

    Vreeke, M.; Langenbach, G.E.J.; Korfage, J.A.M.; Zentner, A.; Grünheid, T.

    2011-01-01

    Skeletal muscle fibres can change their myosin heavy-chain (MyHC) isoform and cross-sectional area, which determine their contraction velocity and maximum force generation, respectively, to adapt to varying functional loads. In general, reduced muscle activity induces transition towards faster

  19. Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.

    Science.gov (United States)

    Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard

    2016-01-01

    Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.

  20. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling.

    Science.gov (United States)

    Wang, Kai; Jin, Xiaolu; Chen, Yifan; Song, Zehe; Jiang, Xiasen; Hu, Fuliang; Conlon, Michael A; Topping, David L

    2016-05-07

    Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE) on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ) loci occludin and zona occludens (ZO)-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet) exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.

  1. Barrier distributions and scattering

    Energy Technology Data Exchange (ETDEWEB)

    Timmers, H.; Leigh, J.R.; Dasgupta, M.; Hinde, D.J.; Mein, J.C.; Morton, C.R.; Newton, J.O. [Department of Nuclear Physics, Australian National University, Canberra, ACT 0200 (Austria); Rowley, N. [Centre de Recherches Nucleaires, 23 Rue du Loess, F-67037 Strasbourg CEDEX 2 (France); Stefanini, A.M.; Ackermann, D.; Corradi, L.; He, J.H. [INFN, Laboratori Nazionali di Legnaro, Legnaro (PD) (Italy); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F. [Universita di Padova and INFN Sezione di Padova, Padova (Italy)

    1997-10-01

    The extraction of representations of the fusion barrier distribution from backward-angle, quasi-elastic, elastic and transfer excitation functions is discussed. Such excitation functions have been measured for {sup 16}O, {sup 32}S and {sup 40}Ca projectiles incident on a variety of targets. The results are compared with representations obtained from fusion excitation functions. Varying in their sensitivity, all representations show evidence of the barrier structure. Differences between the scattering and the fusion representations can be related to the effects of coupling to residual, weak reaction channels. (author)

  2. Functional diversity response to hardwood forest management varies across taxa and spatial scales.

    Science.gov (United States)

    Murray, Bryan D; Holland, Jeffrey D; Summerville, Keith S; Dunning, John B; Saunders, Michael R; Jenkins, Michael A

    2017-06-01

    Contemporary forest management offers a trade-off between the potential positive effects of habitat heterogeneity on biodiversity, and the potential harm to mature forest communities caused by habitat loss and perforation of the forest canopy. While the response of taxonomic diversity to forest management has received a great deal of scrutiny, the response of functional diversity is largely unexplored. However, functional diversity may represent a more direct link between biodiversity and ecosystem function. To examine how forest management affects diversity at multiple spatial scales, we analyzed a long-term data set that captured changes in taxonomic and functional diversity of moths (Lepidoptera), longhorned beetles (Coleoptera: Cerambycidae), and breeding birds in response to contemporary silvicultural systems in oak-hickory hardwood forests. We used these data sets to address the following questions: how do even- and uneven-aged silvicultural systems affect taxonomic and functional diversity at the scale of managed landscapes compared to the individual harvested and unharvested forest patches that comprise the landscapes, and how do these silvicultural systems affect the functional similarity of assemblages at the scale of managed landscapes and patches? Due to increased heterogeneity within landscapes, we expected even-aged silviculture to increase and uneven-aged silviculture to decrease functional diversity at the landscape level regardless of impacts at the patch level. Functional diversity responses were taxon-specific with respect to the direction of change and time since harvest. Responses were also consistent across patch and landscape levels within each taxon. Moth assemblage species richness, functional richness, and functional divergence were negatively affected by harvesting, with stronger effects resulting from uneven-aged than even-aged management. Longhorned beetle assemblages exhibited a peak in species richness two years after harvesting

  3. Hydrophobicity of mucosal surface and its relationship to gut barrier function.

    Science.gov (United States)

    Qin, Xiaofa; Caputo, Francis J; Xu, Da-Zhong; Deitch, Edwin A

    2008-03-01

    Loss of the gut barrier has been implicated in the pathogenesis of the multiple organ dysfunction syndrome, and, thus, understanding the intestinal barrier is of potential clinical importance. An important, but relatively neglected, component of the gut barrier is the unstirred mucus layer, which through its hydrophobic and other properties serves as an important barrier to bacterial and other factors within the gut lumen. Thus, the goal of this study was to establish a reproducible method of measuring mucosal hydrophobicity and test the hypothesis that conditions that decrease mucosal hydrophobicity are associated with increased gut permeability. Hydrophobicity was measured in various segments of normal gut by measuring the contact angle of an aqueous droplet placed on the mucosal surface using a commercial goniometer. Second, the effect of the mucolytic agent N-acetyl cysteine on mucosal hydrophobicity and gut permeability was measured, as was the effects of increasing periods of in vivo gut ischemia on these parameters. Gut ischemia was induced by superior mesenteric artery occlusion, and gut permeability was measured by the mucosal-to-serosal passage of fluoresceine isothiocyanate-dextran (4.3 kDa) (FD4) across the everted sacs of ileum. Intestinal mucosal hydrophobicity showed a gradual increase from the duodenum to the end of the ileum and remained at high level in the cecum, colon, and rectum. Both N-acetyl cysteine treatment and ischemia caused a dose-dependent decrease in mucosal hydrophobicity, which significantly correlated increased gut permeability. Mucosal hydrophobicity of the intestine can be reproducibly measured, and decreases in mucosal hydrophobicity closely correlate with increased gut permeability. These results suggest that mucosal hydrophobicity can be a reliable method of measuring the barrier function of the unstirred mucus layer and a useful parameter in evaluating the pathogenesis of gut barrier dysfunction.

  4. Vibration control for a rigid-flexible manipulator with full state constraints via Barrier Lyapunov Function

    Science.gov (United States)

    Cao, Fangfei; Liu, Jinkun

    2017-10-01

    Considering full state constraints, this paper designs a boundary controller for a two-link rigid-flexible manipulator via Barrier Lyapunov Function. The dynamic model of the two-link rigid-flexible manipulator is described by coupled ordinary differential equations- partial differential equations (ODEs-PDEs). Based on the original model without neglecting the high-frequency modes, boundary controller is proposed to regulate the joint positions and eliminate the elastic vibration simultaneously. To ensure that the full state constraints which include position, speed and vibration constraints are not transgressed, a Barrier Lyapunov Function is employed in the proposed controller. The asymptotic stability of the closed-loop system is rigorously proved by the LaSalle's Invariance Principle. Simulations are given to verify the effectiveness of the proposed controller with state constraints.

  5. Promoting effect of lactoferrin on barrier function and epithelial differentiation of human keratinocytes.

    Science.gov (United States)

    Uchida, Ryo; Aoki, Reiji; Aoki-Yoshida, Ayako; Tajima, Atsushi; Takayama, Yoshiharu

    2017-02-01

    The purpose of this study was to elucidate the effects of bovine lactoferrin on keratinocyte differentiation and barrier function. Addition of bovine lactoferrin to differentiating HaCaT human keratinocytes led to increased transepithelial electrical resistance (TER), a marker of epithelial barrier function. This elevation was followed by upregulation of two differentiation markers, involucrin and filaggrin. The expression level of sterol regulatory element-binding protein-1 was also enhanced by bovine lactoferrin. The lactoferrin-induced upregulation of involucrin and filaggrin expression were confirmed in normal human epidermal keratinocytes (NHEK). Treatment with SB203580, a p38 mitogen-activated protein kinase (MAPK) α inhibitor, impaired the upregulation of involucrin and filaggrin expression in response to lactoferrin. The elevation of p38 MAPK phosphorylation was further enhanced by lactoferrin in the initial stage of differentiation of HaCaT keratinocytes. The findings suggest that bovine lactoferrin promotes epithelial differentiation by a p38-MAPK-dependent mechanism.

  6. FOXF1 maintains endothelial barrier function and prevents edema after lung injury.

    Science.gov (United States)

    Cai, Yuqi; Bolte, Craig; Le, Tien; Goda, Chinmayee; Xu, Yan; Kalin, Tanya V; Kalinichenko, Vladimir V

    2016-04-19

    Multiple signaling pathways, structural proteins, and transcription factors are involved in the regulation of endothelial barrier function. The forkhead protein FOXF1 is a key transcriptional regulator of embryonic lung development, and we used a conditional knockout approach to examine the role of FOXF1 in adult lung homeostasis, injury, and repair. Tamoxifen-regulated deletion of both Foxf1 alleles in endothelial cells of adult mice (Pdgfb-iCreER/Foxf1(-/-)) caused lung inflammation and edema, leading to respiratory insufficiency and death. Deletion of a single Foxf1 allele made heterozygous Pdgfb-iCreER/Foxf1(+/-)mice more susceptible to acute lung injury. FOXF1 abundance was decreased in pulmonary endothelial cells of human patients with acute lung injury. Gene expression analysis of pulmonary endothelial cells with homozygous FOXF1 deletion indicated reduced expression of genes critical for maintenance and regulation of adherens junctions. FOXF1 knockdown in vitro and in vivo disrupted adherens junctions, enhanced lung endothelial permeability, and increased the abundance of the mRNA and protein for sphingosine 1-phosphate receptor 1 (S1PR1), a key regulator of endothelial barrier function. Chromatin immunoprecipitation and luciferase reporter assays demonstrated that FOXF1 directly bound to and induced the transcriptional activity of the S1pr1 promoter. Pharmacological administration of S1P to injured Pdgfb-iCreER/Foxf1(+/-)mice restored endothelial barrier function, decreased lung edema, and improved survival. Thus, FOXF1 promotes normal lung homeostasis and repair, in part, by enhancing endothelial barrier function through activation of the S1P/S1PR1 signaling pathway. Copyright © 2016, American Association for the Advancement of Science.

  7. Endothelium-Derived 5-Methoxytryptophan Protects Endothelial Barrier Function by Blocking p38 MAPK Activation.

    Directory of Open Access Journals (Sweden)

    Ling-Yun Chu

    Full Text Available The endothelial junction is tightly controlled to restrict the passage of blood cells and solutes. Disruption of endothelial barrier function by bacterial endotoxins, cytokines or growth factors results in inflammation and vascular damage leading to vascular diseases. We have identified 5-methoxytryptophan (5-MTP as an anti-inflammatory factor by metabolomic analysis of conditioned medium of human fibroblasts. Here we postulated that endothelial cells release 5-MTP to protect the barrier function. Conditioned medium of human umbilical vein endothelial cells (HUVECs prevented endothelial hyperpermeability and VE-cadherin downregulation induced by VEGF, LPS and cytokines. We analyzed the metabolomic profile of HUVEC conditioned medium and detected 5-MTP but not melatonin, serotonin or their catabolites, which was confirmed by enzyme-linked immunosorbent assay. Addition of synthetic pure 5-MTP preserved VE-cadherin and maintained barrier function despite challenge with pro-inflammatory mediators. Tryptophan hydroxylase-1, an enzyme required for 5-MTP biosynthesis, was downregulated in HUVECs by pro-inflammatory mediators and it was accompanied by reduction of 5-MTP. 5-MTP protected VE-cadherin and prevented endothelial hyperpermeability by blocking p38 MAPK activation. A chemical inhibitor of p38 MAPK, SB202190, exhibited a similar protective effect as 5-MTP. To determine whether 5-MTP prevents vascular hyperpermeability in vivo, we evaluated the effect of 5-MTP administration on LPS-induced murine microvascular permeability with Evans blue. 5-MTP significantly prevented Evans blue dye leakage. Our findings indicate that 5-MTP is a new class of endothelium-derived molecules which protects endothelial barrier function by blocking p38 MAPK.

  8. Aging enhances maceration-induced ultrastructural alteration of the epidermis and impairment of skin barrier function.

    Science.gov (United States)

    Minematsu, Takeo; Yamamoto, Yuko; Nagase, Takashi; Naito, Ayumi; Takehara, Kimie; Iizaka, Shinji; Komagata, Kazunori; Huang, Lijuan; Nakagami, Gojiro; Akase, Tomoko; Oe, Makoto; Yoshimura, Kotaro; Ishizuka, Tadao; Sugama, Junko; Sanada, Hiromi

    2011-06-01

    Skin maceration is recognized as a risk factor for the development of certain skin lesions. In health care settings, incontinence-associated skin maceration is highly prevalent in the elderly. However, the effect of senescence on maceration has not been fully elucidated. To reveal the enhancement of the maceration-induced ultrastructural alteration and barrier function of the epidermis by aging. Skin maceration was reproduced by exposure to agarose gel in human and rat. The ultrastructural alterations in human and rat tissue were observed by transmission electron microscopy. The skin barrier function was evaluated by noninvasive methods in human, and by the transdermal penetration of small- and large-fluorescent molecules in rat. In order to reveal the effect of aging on the skin maceration, we compared these parameters between young and aged rats. In macerated skin, we observed expansion of the interstices of the stratum corneum, spinosum, and basale of the epidermis; disruption of the intercellular lipid structure in the stratum corneum; a decreased number of cell processes in the stratum spinosum and basale. The transdermal penetration test in the rat using two types of fluorescein indicated that maceration disrupted skin barrier function. Furthermore, senescence-enhanced ultrastructural and functional alterations were revealed in the rodent studies. This study demonstrates that aging enhances skin maceration. Considering that maceration is a risk factor for the skin damage, the development of technology to promote skin barrier recovery after maceration in the elderly is warranted. Copyright © 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  9. Mendelian randomization analysis of a time-varying exposure for binary disease outcomes using functional data analysis methods.

    Science.gov (United States)

    Cao, Ying; Rajan, Suja S; Wei, Peng

    2016-12-01

    A Mendelian randomization (MR) analysis is performed to analyze the causal effect of an exposure variable on a disease outcome in observational studies, by using genetic variants that affect the disease outcome only through the exposure variable. This method has recently gained popularity among epidemiologists given the success of genetic association studies. Many exposure variables of interest in epidemiological studies are time varying, for example, body mass index (BMI). Although longitudinal data have been collected in many cohort studies, current MR studies only use one measurement of a time-varying exposure variable, which cannot adequately capture the long-term time-varying information. We propose using the functional principal component analysis method to recover the underlying individual trajectory of the time-varying exposure from the sparsely and irregularly observed longitudinal data, and then conduct MR analysis using the recovered curves. We further propose two MR analysis methods. The first assumes a cumulative effect of the time-varying exposure variable on the disease risk, while the second assumes a time-varying genetic effect and employs functional regression models. We focus on statistical testing for a causal effect. Our simulation studies mimicking the real data show that the proposed functional data analysis based methods incorporating longitudinal data have substantial power gains compared to standard MR analysis using only one measurement. We used the Framingham Heart Study data to demonstrate the promising performance of the new methods as well as inconsistent results produced by the standard MR analysis that relies on a single measurement of the exposure at some arbitrary time point. © 2016 WILEY PERIODICALS, INC.

  10. Facing two faces: Defense activation varies as a function of personal relevance.

    Science.gov (United States)

    Bublatzky, Florian; Alpers, Georg W

    2017-04-01

    It can be unsettling to be watched by a group of people, and when they express anger or hostility, this can prime defensive behavior. In contrast, when others smile at us, this may be comforting. This study tested to which degree the impact of facial expressions (happy, neutral, and angry) varies with the personal relevance of a social situation. Modelling a triadic situation, two faces looked either directly at the participant, faced each other, or they were back to back. Results confirmed that this variation constitutes a gradient of personal relevance (directed frontally > towards > away), as reflected by corresponding defensive startle modulation and autonomic nervous system activity. This gradient was particularly pronounced for angry faces and it was steeper in participants with higher levels of social anxiety. Thus, sender-recipient constellations modulate the processing of facial emotions in favor of adequate behavioral responding (e.g., avoidance) in group settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. An Evaluation of Lag Schedules of Reinforcement During Functional Communication Training: Effects on Varied Mand Responding and Challenging Behavior.

    Science.gov (United States)

    Adami, Summer; Falcomata, Terry S; Muething, Colin S; Hoffman, Katherine

    2017-09-01

    We evaluated the effects of lag schedules of reinforcement during functional communication training (FCT) on the varied use of mands and challenging behavior by two individuals diagnosed with autism. Specifically, we compared the effects of Lag 0 and Lag 1 schedules of reinforcement during FCT. The results showed that each participant exhibited increases in varied mand responding during FCT with the Lag 1 schedule of reinforcement relative to Lag 0; challenging behavior remained low during both FCT lag conditions relative to baseline. Results are discussed in terms of treatment implications relating to FCT and the potential prevention and/or mitigation of clinical relapse during challenges to treatment.

  12. Checkpoint Kinase 1 Activation Enhances Intestinal Epithelial Barrier Function via Regulation of Claudin-5 Expression.

    Directory of Open Access Journals (Sweden)

    Akihiro Watari

    Full Text Available Several stressors are known to influence epithelial tight junction (TJ integrity, but the association between DNA damage and TJ integrity remains unclear. Here we examined the effects of daunorubicin and rebeccamycin, two anti-tumor chemicals that induce DNA damage, on TJ integrity in human intestinal epithelial cells. Daunorubicin and rebeccamycin dose-dependently enhanced transepithelial electrical resistance (TER and decreased flux of the 4 kDa FITC-dextran in Caco-2 cell monolayer. Daunorubicin- or rebeccamycin-induced enhancement of the TJ barrier function partly rescued attenuation of the barrier function by the inflammatory cytokines TNF-α and IFN-γ. Daunorubicin and rebeccamycin increased claudin-5 expression and the product was distributed in the actin cytoskeleton fraction, which was enriched with TJ proteins. Caffeine, which is an inhibitor of ataxia telangiectasia mutated protein (ATM and ataxia telangiectasia mutated and Rad3-related protein (ATR, and the Chk1 inhibitor inhibited the TER increases induced by daunorubicin and rebeccamycin, whereas a Chk2 inhibitor did not. Treatment with Chk1 siRNA also significantly inhibited the TER increases. Induction of claudin-5 expression was inhibited by Chk1 inhibitor and by siRNA treatment. Our results suggest that Chk1 activation by daunorubicin and rebeccamycin induced claudin-5 expression and enhanced TJ barrier function in Caco-2 cell monolayer, which suggests a link between DNA damage and TJ integrity in the human intestine.

  13. [Barriers and challenges of the functional healthcare risk management units in hospitals of Madrid health service].

    Science.gov (United States)

    Pardo-Hernández, A; Navarro-Royo, C; Arguedas-Sanz, R; Albeniz-Lizarraga, C; Morón-Merchante, J

    2014-01-01

    To identify the barriers and challenges for the effective development of risk management units in hospitals of the Madrid Health Service. Descriptive cross-sectional study aimed at the management teams and members of the functional units of 31 hospitals in the Madrid Health Service. A self-administered questionnaire requesting answers in free text was used, identifying up to five barriers and challenges, and their prioritization by awarding from 1-5 points according to their importance. A discourse analysis was then conducted, grouping common themes and sorting them according to their score. The overall response rate was 94%. The most frequently identified barriers were lack of time (21%), inadequate safety culture (13%), lack of publication of their activities (10%), and lack of training (10%). The most important challenge was developing the training (18%), followed by improving the culture (17%), communication of safety activities (11%), and achieve leadership from the managers of the services (11%). According to the study conditions, the main identified barrier identified was the lack of available time, and the principal challenge found was promoting a proactive learning culture. Copyright © 2013 SECA. Published by Elsevier Espana. All rights reserved.

  14. Extended Thomas-Fermi kinetic energy density functional with spatially varying effective mass in d=1,2,3 dimensions

    Science.gov (United States)

    Berkane, K.; Bencheikh, K.

    2005-08-01

    For first-principles density functional theory of a many fermion system, the determination of the kinetic energy functional is important. We consider N independent fermions with spatially varying effective mass in two dimensions, we derive the corresponding kinetic energy density using the ℏ semiclassical approach. Our result reduces, as expected, to the one obtained in the literature for a constant effective mass. We examine the analytical expressions of the position dependent effective mass terms in the kinetic energy density functional with respect to the dimensionality d=1,2,3 of the space.

  15. The Protein Corona of PEGylated PGMA-Based Nanoparticles is Preferentially Enriched with Specific Serum Proteins of Varied Biological Function.

    Science.gov (United States)

    Naidu, Priya S R; Norret, Marck; Smith, Nicole M; Dunlop, Sarah A; Taylor, Nicolas L; Fitzgerald, Melinda; Iyer, K Swaminathan

    2017-11-14

    The composition of the protein corona formed on poly(ethylene glycol)-functionalized (PEGylated) poly(glycidyl methacrylate) (PGMA) nanoparticles (NPs) was qualitatively and quantitatively compared to the protein corona on non-PEGylated PGMA NPs. Despite the reputation of PEGylated NPs for stealth functionality, we demonstrate the preferential enrichment of specific serum proteins of varied biological function in the protein corona on PEGylated NPs when compared to non-PEGylated NPs. Additionally, we suggest that the base material of polymeric NPs plays a role in the preferential enrichment of select serum proteins to the hard corona.

  16. Prefrontal structure varies as function of pain symptoms in patients with chronic fatigue syndrome

    NARCIS (Netherlands)

    Schaaf, M.E. van der; Lange, F.P. de; Schmits, I.C.; Geurts, D.E.M.; Roelofs, K.; Meer, J.W.M. van der; Toni, I.; Knoop, H.

    2017-01-01

    Background: Chronic fatigue syndrome (CFS) is characterized by severe fatigue persisting for at least 6 months and leading to considerable impairment in daily functioning. Neuroimaging studies of CFS patients have revealed alterations in prefrontal brain morphology. However, it remains to be

  17. Prefrontal Structure Varies as a Function of Pain Symptoms in Chronic Fatigue Syndrome

    NARCIS (Netherlands)

    Schaaf, M.E. van der; Lange, F.P. de; Schmits, I.C.; Geurts, D.E.M.; Roelofs, K.; Meer, J.W.M. van der; Toni, I.; Knoop, H.

    2017-01-01

    AbstractBackground Chronic fatigue syndrome (CFS) is characterized by severe fatigue persisting for ≥6 months and leading to considerable impairment in daily functioning. Neuroimaging studies of patients with CFS have revealed alterations in prefrontal brain morphology. However, it remains to

  18. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Directory of Open Access Journals (Sweden)

    Shimon Bershtein

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the

  19. Suitability of polystyrene as a functional barrier layer in coloured food contact materials.

    Science.gov (United States)

    Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy

    2015-01-01

    Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.

  20. The varied functions of aluminium-activated malate transporters-much more than aluminium resistance.

    Science.gov (United States)

    Palmer, Antony J; Baker, Alison; Muench, Stephen P

    2016-06-15

    The ALMT (aluminium-activated malate transporter) family comprises a functionally diverse but structurally similar group of ion channels. They are found ubiquitously in plant species, expressed throughout different tissues, and located in either the plasma membrane or tonoplast. The first family member identified was TaALMT1, discovered in wheat root tips, which was found to be involved in aluminium resistance by means of malate exudation into the soil. However, since this discovery other family members have been shown to have many other functions such as roles in stomatal opening, general anionic homoeostasis, and in economically valuable traits such as fruit flavour. Recent evidence has also shown that ALMT proteins can act as key molecular actors in GABA (γ-aminobutyric acid) signalling, the first evidence that GABA can act as a signal transducer in plants. © 2016 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  1. The RNAi Universe in Fungi: A Varied Landscape of Small RNAs and Biological Functions.

    Science.gov (United States)

    Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M

    2017-09-08

    RNA interference (RNAi) is a conserved eukaryotic mechanism that uses small RNA molecules to suppress gene expression through sequence-specific messenger RNA degradation, translational repression, or transcriptional inhibition. In filamentous fungi, the protective function of RNAi in the maintenance of genome integrity is well known. However, knowledge of the regulatory role of RNAi in fungi has had to wait until the recent identification of different endogenous small RNA classes, which are generated by distinct RNAi pathways. In addition, RNAi research on new fungal models has uncovered the role of small RNAs and RNAi pathways in the regulation of diverse biological functions. In this review, we give an up-to-date overview of the different classes of small RNAs and RNAi pathways in fungi and their roles in the defense of genome integrity and regulation of fungal physiology and development, as well as in the interaction of fungi with biotic and abiotic environments.

  2. THE EFFECTS OF VARIED TENSIONS OF KINESIOLOGY TAPING ON QUADRICEPS STRENGTH AND LOWER LIMB FUNCTION.

    Science.gov (United States)

    de Jesus, Julio Fernandes; Franco, Yuri Rafael Dos Santos; Nannini, Stella Bispo; Nakaoka, Gustavo Bezerra; Dos Reis, Amir Curcio; Bryk, Flavio Fernandes

    2017-02-01

    Kinesiology Taping (KT) may promote changes in muscle strength and motor performance, topics of great interest in the sports-medicine sciences. These characteristics are purported to be associated with the tension generated by the KT on the skin. However, the most suitable tension for the attainment of these strength and performance effects has not yet been confirmed. The purpose of the present study was to analyze the effects of different tensions of KT on the isometric contraction of the quadriceps and lower limb function of healthy individuals over a period of seven days. Blind, randomized, clinical trial. One hundred and thirty healthy individuals were distributed into the following five groups: control (without KT); KT0 (KT without tension); KT50; KT75 and KT100 (approximately 50%, 75% and 100% tension applied to the tape, respectively). Assessments of isometric quadriceps strength were conducted using a hand held dynamometer. Lower limb function was assessed through Single Hop Test for Distance, with five measurement periods: baseline; immediately after KT application; three days after KT; five days after KT; and 72h after KT removal (follow-up). There were no statistically significant differences ( p  > 0.05) at any of the studied periods on participants' quadriceps strength nor in the function of the lower dominant limb, based on comparisons between the control group and the experimental groups. KT applied with different tensions did not produce modulations, in short or long-term, on quadriceps' strength or lower limb function of healthy individuals. Therefore, this type of KT application, when seeking these objectives, should be reconsidered. 1b.

  3. THE EFFECTS OF VARIED TENSIONS OF KINESIOLOGY TAPING ON QUADRICEPS STRENGTH AND LOWER LIMB FUNCTION

    Science.gov (United States)

    Franco, Yuri Rafael dos Santos; Nannini, Stella Bispo; Nakaoka, Gustavo Bezerra; dos Reis, Amir Curcio; Bryk, Flavio Fernandes

    2017-01-01

    Background Kinesiology Taping (KT) may promote changes in muscle strength and motor performance, topics of great interest in the sports-medicine sciences. These characteristics are purported to be associated with the tension generated by the KT on the skin. However, the most suitable tension for the attainment of these strength and performance effects has not yet been confirmed. Hypothesis/Purpose The purpose of the present study was to analyze the effects of different tensions of KT on the isometric contraction of the quadriceps and lower limb function of healthy individuals over a period of seven days. Study Design Blind, randomized, clinical trial. Methods One hundred and thirty healthy individuals were distributed into the following five groups: control (without KT); KT0 (KT without tension); KT50; KT75 and KT100 (approximately 50%, 75% and 100% tension applied to the tape, respectively). Assessments of isometric quadriceps strength were conducted using a hand held dynamometer. Lower limb function was assessed through Single Hop Test for Distance, with five measurement periods: baseline; immediately after KT application; three days after KT; five days after KT; and 72h after KT removal (follow-up). Results There were no statistically significant differences (p > 0.05) at any of the studied periods on participants’ quadriceps strength nor in the function of the lower dominant limb, based on comparisons between the control group and the experimental groups. Conclusion KT applied with different tensions did not produce modulations, in short or long-term, on quadriceps’ strength or lower limb function of healthy individuals. Therefore, this type of KT application, when seeking these objectives, should be reconsidered. Level of Evidence 1b PMID:28217419

  4. Masticatory function parameters in patients with varying degree of mandibular bone resorption.

    Science.gov (United States)

    Marcello-Machado, Raissa Micaella; Bielemann, Amália Machado; Nascimento, Gustavo Giacomelli; Pinto, Luciana de Rezende; Del Bel Cury, Altair Antoninha; Faot, Fernanda

    2017-07-01

    This cross-sectional study analyzes how bone resorption affects the masticatory function and investigates the relation between perceived and measured masticatory function. Thirty complete dentures wearers were divided in two groups according to mandible bone atrophy based on the classification criteria from Cawood & Howell. Retention and stability of the mandibular complete denture, masticatory performance (MP) indexes (X_50 and B) and masticatory efficiency (ME, sieves 4 and 2.8) were evaluated. Geriatric Oral Health Assessment Index (GOHAI) and Dental Impact on Daily Living (DIDL) questionnaires were completed by the patients. A strong correlation between bone atrophy and poor retention was found (P=0.0132). Neither masticatory performance indexes nor GOHAI and DIDL domains showed statistical differences (P>0.05) when patients were compared according to the atrophy criteria. Mandibular length showed a negative correlation with ME4, showing a positive association (R2=0.17, β=-0.67, P=0.029). Mandibular denture retention was significantly correlated with MPB (P=0.01) and ME2.8 (P=0.01). GOHAI showed a positive association between the physical and the functional domains and ME2.8 (R2=0.17; β=1.22; P=0.02). DIDL showed a negative association between ME4 and oral comfort domain (R2=0.16; β=-2.94; P=0.02). Mandibular bone height does not directly affect the masticatory function and is inversely correlated with the self-perceived masticatory ability. Copyright © 2016 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.

  5. Evidence of Dynamic Crustal Deformation in Tohoku, Japan, From Time-Varying Receiver Functions

    Science.gov (United States)

    Porritt, R. W.; Yoshioka, S.

    2017-10-01

    Temporal variation of crustal structure is key to our understanding of Earth processes on human timescales. Often, we expect that the most significant structural variations are caused by strong ground shaking associated with large earthquakes, and recent studies seem to confirm this. Here we test the possibility of using P receiver functions (PRF) to isolate structural variations over time. Synthetic receiver function tests indicate that structural variation could produce PRF changes on the same order of magnitude as random noise or contamination by local earthquakes. Nonetheless, we find significant variability in observed receiver functions over time at several stations located in northeastern Honshu. Immediately following the Tohoku-oki earthquake, we observe high PRF variation clustering spatially, especially in two regions near the beginning and end of the rupture plane. Due to the depth sensitivity of PRF and the timescales over which this variability is observed, we infer this effect is primarily due to fluid migration in volcanic regions and shear stress/strength reorganization. While the noise levels in PRF are high for this type of analysis, by sampling small data sets, the computational cost is lower than other methods, such as ambient noise, thereby making PRF a useful tool for estimating temporal variations in crustal structure.

  6. A new function for parietal epithelial cells: a second glomerular barrier.

    Science.gov (United States)

    Ohse, Takamoto; Chang, Alice M; Pippin, Jeffrey W; Jarad, George; Hudkins, Kelly L; Alpers, Charles E; Miner, Jeffrey H; Shankland, Stuart J

    2009-12-01

    The functional role of glomerular parietal epithelial cells (PECs) remains poorly understood. To test the hypothesis that PECs form an impermeable barrier to filtered protein through the formation of tight junctions (TJ), studies were performed in normal animals and in the anti-glomerular basement membrane (GBM) model of crescentic nephritis. Electron microscopy showed well-defined TJ between PECs in normal mice, which no longer could be identified when these cells became extensively damaged or detached from their underlying Bowman's basement membrane. The TJ proteins claudin-1, zonula occludens-1, and occludin stained positive in PECs; however, staining decreased in anti-GBM disease. To show that these events were associated with increased permeability across the PEC-Bowman's basement membrane barrier, control and diseased animals were injected intravenously with either Texas red-conjugated dextran (3 kDa) or ovalbumin (45 kDa) tracers. As expected, both tracers were readily filtered across the glomerular filtration barrier and taken up by proximal tubular cells. However, when the glomerular filtration barrier was injured in anti-GBM disease, tracers were taken up by podocytes and PECs. Moreover, tracers were also detected between PECs and the underlying Bowman's basement membrane, and in many instances were detected in the extraglomerular space. We propose that together with its underlying Bowman's basement membrane, the TJ of PECs serve as a second barrier to protein. When disturbed following PEC injury, the increase in permeability of this layer to filtered protein is a mechanism underlying periglomerular inflammation characteristic of anti-GBM disease.

  7. Control of cAMP in lung endothelial cell phenotypes. Implications for control of barrier function.

    Science.gov (United States)

    Stevens, T; Creighton, J; Thompson, W J

    1999-07-01

    Pulmonary microvascular endothelial cells (PMVECs) form a more restrictive barrier to macromolecular flux than pulmonary arterial endothelial cells (PAECs); however, the mechanisms responsible for this intrinsic feature of PMVECs are unknown. Because cAMP improves endothelial barrier function, we hypothesized that differences in enzyme regulation of cAMP synthesis and/or degradation uniquely establish an elevated content in PMVECs. PMVECs possessed 20% higher basal cAMP concentrations than did PAECs; however, increased content was accompanied by 93% lower ATP-to-cAMP conversion rates. In PMVECs, responsiveness to beta-adrenergic agonist (isoproterenol) or direct adenylyl cyclase (forskolin) activation was attenuated and responsiveness to phosphodiesterase inhibition (rolipram) was increased compared with those in PAECs. Although both types of endothelial cells express calcium-inhibited adenylyl cyclase, constitutive PMVEC cAMP accumulation was not inhibited by physiological rises in cytosolic calcium, whereas PAEC cAMP accumulation was inhibited 30% by calcium. Increasing either PMVEC calcium entry by maximal activation of store-operated calcium entry or ATP-to-cAMP conversion with rolipram unmasked calcium inhibition of adenylyl cyclase. These data indicate that suppressed calcium entry and low ATP-to-cAMP conversion intrinsically influence calcium sensitivity. Adenylyl cyclase-to-cAMP phosphodiesterase ratios regulate cAMP at elevated levels compared with PAECs, which likely contribute to enhanced microvascular barrier function.

  8. Topical Formulation Containing Beeswax-Based Nanoparticles Improved In Vivo Skin Barrier Function.

    Science.gov (United States)

    Souza, Carla; de Freitas, Luis Alexandre Pedro; Maia Campos, Patrícia Maria Berardo Gonçalves

    2017-10-01

    Lipid nanoparticles have shown many advantages for treatment/prevention of skin disorders with damaged skin barrier function. Beeswax is a favorable candidate for the development of nanosystems in the cosmetic and dermatological fields because of its advantages for the development of products for topical application. In the present study, beeswax-based nanoparticles (BNs) were prepared using the hot melt microemulsion technique and incorporated to a gel-cream formulation. The formulation was subsequently evaluated for its rheological stability and effect on stratum corneum water content (SCWC) and transepidermal water loss (TEWL) using in vivo biophysical techniques. BNs resulted in mean particle size of 95.72 ± 9.63 nm and zeta potential of -9.85 ± 0.57 mV. BN-loaded formulation showed shear thinning behavior, well adjusted by the Herschel-Bulkley model, and a small thixotropy index that were stable for 28 days at different temperatures. BN-loaded formulation was also able to simultaneously decrease the TEWL and increase the SCWC values 28 days after treatment. In conclusion, the novel beeswax-based nanoparticles showed potential for barrier recovery and open the perspective for its commercial use as a novel natural active as yet unexplored in the field of dermatology and cosmetics for treatment of skin diseases with damaged skin barrier function.

  9. Reactive oxygen species modulate the barrier function of the human glomerular endothelial glycocalyx.

    Directory of Open Access Journals (Sweden)

    Anurag Singh

    Full Text Available Reactive oxygen species (ROS play a key role in the pathogenesis of proteinuria in glomerular diseases like diabetic nephropathy. Glomerular endothelial cell (GEnC glycocalyx covers the luminal aspect of the glomerular capillary wall and makes an important contribution to the glomerular barrier. ROS are known to depolymerise glycosaminoglycan (GAG chains of proteoglycans, which are crucial for the barrier function of GEnC glycocalyx. The aim of this study is to investigate the direct effects of ROS on the structure and function of GEnC glycocalyx using conditionally immortalised human GEnC. ROS were generated by exogenous hydrogen peroxide. Biosynthesis and cleavage of GAG chains was analyzed by radiolabelling (S(35 and (3H-glucosamine. GAG chains were quantified on GEnC surface and in the cell supernatant using liquid chromatography and immunofluorescence techniques. Barrier properties were estimated by measuring trans-endothelial passage of albumin. ROS caused a significant loss of WGA lectin and heparan sulphate staining from the surface of GEnC. This lead to an increase in trans-endothelial albumin passage. The latter could be inhibited by catalase and superoxide dismutase. The effect of ROS on GEnC was not mediated via the GAG biosynthetic pathway. Quantification of radiolabelled GAG fractions in the supernatant confirmed that ROS directly caused shedding of HS GAG. This finding is clinically relevant and suggests a mechanism by which ROS may cause proteinuria in clinical conditions associated with high oxidative stress.

  10. Caspase-14 Expression Impairs Retinal Pigment Epithelium Barrier Function: Potential Role in Diabetic Macular Edema

    Directory of Open Access Journals (Sweden)

    Selina Beasley

    2014-01-01

    Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.

  11. Topical hesperidin prevents glucocorticoid-induced abnormalities in epidermal barrier function in murine skin.

    Science.gov (United States)

    Man, George; Mauro, Theodora M; Kim, Peggy L; Hupe, Melanie; Zhai, Yongjiao; Sun, Richard; Crumrine, Debbie; Cheung, Carolyn; Nuno-Gonzalez, Almudena; Elias, Peter M; Man, Mao-Qiang

    2014-09-01

    Systemic and topical glucocorticoids (GC) can cause significant adverse effects not only on the dermis, but also on epidermal structure and function. In epidermis, a striking GC-induced alteration in permeability barrier function occurs that can be attributed to an inhibition of epidermal mitogenesis, differentiation and lipid production. As prior studies in normal hairless mice demonstrated that topical applications of a flavonoid ingredient found in citrus, hesperidin, improve epidermal barrier function by stimulating epidermal proliferation and differentiation, we assessed here whether its topical applications could prevent GC-induced changes in epidermal function in murine skin and the basis for such effects. When hairless mice were co-treated topically with GC and 2% hesperidin twice-daily for 9 days, hesperidin co-applications prevented the expected GC-induced impairments of epidermal permeability barrier homoeostasis and stratum corneum (SC) acidification. These preventive effects could be attributed to a significant increase in filaggrin expression, enhanced epidermal β-glucocerebrosidase activity and accelerated lamellar bilayer maturation, the last two likely attributable to a hesperidin-induced reduction in stratum corneum pH. Furthermore, co-applications of hesperidin with GC largely prevented the expected GC-induced inhibition of epidermal proliferation. Finally, topical hesperidin increased epidermal glutathione reductase mRNA expression, which could counteract multiple functional negative effects of GC on epidermis. Together, these results show that topical hesperidin prevents GC-induced epidermal side effects by divergent mechanisms. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Effects of Varied Shear Correction on the Thermal Vibration of Functionally-Graded Material Shells in an Unsteady Supersonic Flow

    Directory of Open Access Journals (Sweden)

    Chih Chiang Hong

    2017-03-01

    Full Text Available A model is presented for functionally-graded material (FGM, thick, circular cylindrical shells under an unsteady supersonic flow, following first-order shear deformation theory (FSDT with varied shear correction coefficients. Some interesting vibration results of the dynamics are calculated by using the generalized differential quadrature (GDQ method. The varied shear correction coefficients are usually functions of FGM total thickness, power law index, and environment temperature. Two parametric effects of the environmental temperature and FGM power law index on the thermal stress and center deflection are also presented. The novelty of the paper is that the maximum flutter value of the center deflection amplitude can be predicted and occurs at a high frequency of applied heat flux for a supersonic air flow.

  13. Brain barriers and functional interfaces with sequential appearance of ABC efflux transporters during human development

    DEFF Research Database (Denmark)

    Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.

    2017-01-01

    Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....

  14. The influence of executive functions on spatial biases varies during the lifespan.

    Science.gov (United States)

    Takio, Fiia; Koivisto, Mika; Hämäläinen, Heikki

    2014-10-01

    Many perceptual processes, such as language or face perception, are asymmetrically organised in the hemispheres already in childhood. These asymmetries induce behaviourally observable spatial biases in which the observer perceives stimuli in one of the hemispaces more efficiently or more frequently than in the other one. Another source for spatial biases is spatial attention which is also asymmetrically organised in the hemispheres. The bias induced by attention is directed towards the right side, which is clearly demonstrated by patients with neglect but also in lesser degree by healthy observers in cognitively loading situations. Recent findings indicate that children and older adults show stronger spatial biases than young adults. We discuss how the development of executive functions might contribute to the manifestation of spatial biases during the lifespan. We present a model in which the interaction between the asymmetrical perceptual processes, the age-related development of the lateralised spatial attention and the development of the executive functions influence spatial perceptual performance and in which the development and decline of the executive processes during the lifespan modify the spatial biases. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. The influence of executive functions on spatial biases varies during the lifespan

    Directory of Open Access Journals (Sweden)

    Fiia Takio

    2014-10-01

    Full Text Available Many perceptual processes, such as language or face perception, are asymmetrically organised in the hemispheres already in childhood. These asymmetries induce behaviourally observable spatial biases in which the observer perceives stimuli in one of the hemispaces more efficiently or more frequently than in the other one. Another source for spatial biases is spatial attention which is also asymmetrically organised in the hemispheres. The bias induced by attention is directed towards the right side, which is clearly demonstrated by patients with neglect but also in lesser degree by healthy observers in cognitively loading situations. Recent findings indicate that children and older adults show stronger spatial biases than young adults. We discuss how the development of executive functions might contribute to the manifestation of spatial biases during the lifespan. We present a model in which the interaction between the asymmetrical perceptual processes, the age-related development of the lateralised spatial attention and the development of the executive functions influence spatial perceptual performance and in which the development and decline of the executive processes during the lifespan modify the spatial biases.

  16. Tesmilifene modifies brain endothelial functions and opens the blood-brain/blood-glioma barrier.

    Science.gov (United States)

    Walter, Fruzsina R; Veszelka, Szilvia; Pásztói, Mária; Péterfi, Zoltán A; Tóth, András; Rákhely, Gábor; Cervenak, László; Ábrahám, Csongor S; Deli, Mária A

    2015-09-01

    Tesmilifene, a tamoxifen analog with antihistamine action, has chemopotentiating properties in experimental and clinical cancer studies. In our previous works, tesmilifene increased the permeability of the blood-brain barrier (BBB) in animal and culture models. Our aim was to investigate the effects of tesmilifene on brain microvessel permeability in the rat RG2 glioma model and to reveal its mode of action in brain endothelial cells. Tesmilifene significantly increased fluorescein extravasation in the glioma. Short-term treatment with tesmilifene reduced the resistance and increased the permeability for marker molecules in a rat triple co-culture BBB model. Tesmilifene also affected the barrier integrity in brain endothelial cells co-cultured with RG2 glioblastoma cells. Tesmilifene inhibited the activity of P-glycoprotein and multidrug resistance-associated protein-1 efflux pumps and down-regulated the mRNA expression of tight junction proteins, efflux pumps, solute carriers, and metabolic enzymes important for BBB functions. Among the possible signaling pathways that regulate BBB permeability, tesmilifene activated the early nuclear translocation of NFκB. The MAPK/ERK and PI3K/Akt kinase pathways were also involved. We demonstrate for the first time that tesmilifene increases permeability marker molecule extravasation in glioma and inhibits efflux pump activity in brain endothelial cells, which may have therapeutic relevance. Tesmilifene, a chemopotentiator in experimental and clinical cancer studies increases vascular permeability in RG2 glioma in rats and permeability for marker molecules in a culture model of the blood-brain barrier. Tesmilifene inhibits the activity of efflux pumps and down-regulates the mRNA expression of tight junction proteins, transporters, and metabolic enzymes important for the blood-brain barrier functions, which may have therapeutic relevance. © 2015 International Society for Neurochemistry.

  17. Glutamine supplementation improves intestinal barrier function in a weaned piglet model of Escherichia coli infection.

    Science.gov (United States)

    Ewaschuk, Julia B; Murdoch, Gordon K; Johnson, Ian R; Madsen, Karen L; Field, Catherine J

    2011-09-01

    The weaning period is associated with an increased prevalence of gastrointestinal infection in many species. Glutamine (Gln) has been shown to improve intestinal barrier function and immune function in both in vivo and in vitro models. The objective of the present study was to determine the effect of dietary Gln supplementation on intestinal barrier function and intestinal cytokines in a model of Escherichia coli infection. We randomised 21-d-old piglets (n 20) to nutritionally complete isonitrogenous diets with or without Gln (4·4 %, w/w) for 2 weeks. Intestinal loops were isolated from anaesthetised pigs and inoculated with either saline or one of the two E. coli (K88AC or K88 wild-type)-containing solutions. Intestinal tissue was studied for permeability, cytokine expression, fluid secretion and tight-junction protein expression. Animals receiving Gln supplementation had decreased potential difference (PD) and short-circuit current (I(sc)) in E. coli-inoculated intestinal loops (PD 0·628 (SEM 0·151) mV; I(sc) 13·0 (SEM 3·07) μA/cm(2)) compared with control-fed animals (PD 1·36 (SEM 0·227) mV; I(sc) 22·4 (SEM 2·24) μA/cm(2)). Intestinal tissue from control, but not from Gln-supplemented, animals responded to E. coli with a significant increase in mucosal cytokine mRNA (IL-1β, IL-6, transforming growth factor-β and IL-10). Tight-junction protein expression (claudin-1 and occludin) was reduced with exposure to E. coli in control-fed animals and was not influenced in Gln-supplemented piglets. Gln supplementation may be useful in reducing the severity of weaning-related gastrointestinal infections, by reducing the mucosal cytokine response and altering intestinal barrier function.

  18. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  19. Abnormal barrier function in the pathogenesis of ichthyosis: therapeutic implications for lipid metabolic disorders.

    Science.gov (United States)

    Elias, Peter M; Williams, Mary L; Feingold, Kenneth R

    2012-01-01

    Ichthyoses, including inherited disorders of lipid metabolism, display a permeability barrier abnormality in which the severity of the clinical phenotype parallels the prominence of the barrier defect. The pathogenesis of the cutaneous phenotype represents the consequences of the mutation for epidermal function, coupled with a "best attempt" by affected epidermis to generate a competent barrier in a terrestrial environment. A compromised barrier in normal epidermis triggers a vigorous set of metabolic responses that rapidly normalizes function, but ichthyotic epidermis, which is inherently compromised, only partially succeeds in this effort. Unraveling mechanisms that account for barrier dysfunction in the ichthyoses has identified multiple, subcellular, and biochemical processes that contribute to the clinical phenotype. Current treatment of the ichthyoses remains largely symptomatic: directed toward reducing scale or corrective gene therapy. Reducing scale is often minimally effective. Gene therapy is impeded by multiple pitfalls, including difficulties in transcutaneous drug delivery, high costs, and discomfort of injections. We have begun to use information about disease pathogenesis to identify novel, pathogenesis-based therapeutic strategies for the ichthyoses. The clinical phenotype often reflects not only a deficiency of pathway end product due to reduced-function mutations in key synthetic enzymes but often also accumulation of proximal, potentially toxic metabolites. As a result, depending upon the identified pathomechanism(s) for each disorder, the accompanying ichthyosis can be treated by topical provision of pathway product (eg, cholesterol), with or without a proximal enzyme inhibitor (eg, simvastatin), to block metabolite production. Among the disorders of distal cholesterol metabolism, the cutaneous phenotype in Congenital Hemidysplasia with Ichthyosiform Erythroderma and Limb Defects (CHILD syndrome) and X-linked ichthyosis reflect metabolite

  20. Abnormal barrier function in the pathogenesis of ichthyosis: Therapeutic implications for lipid metabolic disorders☆

    Science.gov (United States)

    Elias, Peter M.; Williams, Mary L.; Feingold, Kenneth R.

    2013-01-01

    Ichthyoses, including inherited disorders of lipid metabolism, display a permeability barrier abnormality in which the severity of the clinical phenotype parallels the prominence of the barrier defect. The pathogenesis of the cutaneous phenotype represents the consequences of the mutation for epidermal function, coupled with a “best attempt” by affected epidermis to generate a competent barrier in a terrestrial environment. A compromised barrier in normal epidermis triggers a vigorous set of metabolic responses that rapidly normalizes function, but ichthyotic epidermis, which is inherently compromised, only partially succeeds in this effort. Unraveling mechanisms that account for barrier dysfunction in the ichthyoses has identified multiple, subcellular, and biochemical processes that contribute to the clinical phenotype. Current treatment of the ichthyoses remains largely symptomatic: directed toward reducing scale or corrective gene therapy. Reducing scale is often minimally effective. Gene therapy is impeded by multiple pitfalls, including difficulties in transcutaneous drug delivery, high costs, and discomfort of injections. We have begun to use information about disease pathogenesis to identify novel, pathogenesis-based therapeutic strategies for the ichthyoses. The clinical phenotype often reflects not only a deficiency of pathway end product due to reduced-function mutations in key synthetic enzymes but often also accumulation of proximal, potentially toxic metabolites. As a result, depending upon the identified pathomechanism(s) for each disorder, the accompanying ichthyosis can be treated by topical provision of pathway product (eg, cholesterol), with or without a proximal enzyme inhibitor (eg, simvastatin), to block metabolite production. Among the disorders of distal cholesterol metabolism, the cutaneous phenotype in Congenital Hemidysplasia with Ichthyosiform Erythroderma and Limb Defects (CHILD syndrome) and X-linked ichthyosis reflect metabolite

  1. Energetic Study of Clusters and Reaction Barrier Heights from Efficient Semilocal Density Functionals

    Directory of Open Access Journals (Sweden)

    Guocai Tian

    2017-06-01

    Full Text Available The accurate first-principles prediction of the energetic properties of molecules and clusters from efficient semilocal density functionals is of broad interest. Here we study the performance of a non-empirical Tao-Mo (TM density functional on binding energies and excitation energies of titanium dioxide and water clusters, as well as reaction barrier heights. To make a comparison, a combination of the TM exchange part with the TPSS (Tao–Perdew–Staroverov–Scuseria correlation functional—called TMTPSS—is also included in this study. Our calculations show that the best binding energies of titanium dioxide are predicted by PBE0 (Perdew–Burke–Ernzerhof hybrid functional, TM, and TMTPSS with nearly the same accuracy, while B3LYP (Beck’s three-parameter exchange part with Lee-Yang-Parr correlation, TPSS, and PBE (Perdew–Burke–Ernzerhof yield larger mean absolute errors. For excitation energies of titanium and water clusters, PBE0 and B3LYP are the most accurate functionals, outperforming the performance of semilocal functionals due to the nonlocality problem suffered by the latter. Nevertheless, TMTPSS and TM functionals are still good accurate semilocal methods, improving upon the commonly-used TPSS and PBE functionals. We also find that the best reaction barrier heights are predicted by PBE0 and B3LYP, thanks to the nonlocality incorporated into these two hybrid functionals, but TMTPSS and TM are obviously more accurate than SCAN (Strongly Constrained and Appropriately Normed, TPSS, and PBE, suggesting the good performance of TM and TMTPSS for physically different systems and properties.

  2. Pharmacokinetics and pharmacodynamics of oral tolvaptan in patients with varying degrees of renal function

    Science.gov (United States)

    Shoaf, Susan E; Bricmont, Patricia; Mallikaarjun, Suresh

    2014-01-01

    The selective vasopressin V2–receptor antagonist tolvaptan is eliminated almost exclusively by non-renal mechanisms. As renal impairment can influence the pharmacokinetics of drugs even when eliminated by non-renal mechanisms, we evaluated the effect of renal insufficiency on the pharmacokinetics/pharmacodynamics of tolvaptan. Thirty-seven patients were grouped by a 24-h creatinine clearance (CrCL) and evaluated for 48 h after a single 60 mg oral dose in the fasting state. Mean tolvaptan exposure was 90% higher in the under 30-ml/min group compared with the over 60-ml/min group with individual values significantly but negatively correlated with increasing baseline CrCL. There was a greater and more rapid increase in urine output and free water clearance in the over 60-ml/min compared with the renal impaired groups, but they returned to baseline more quickly. Serum sodium increased more rapidly in the over 60 as opposed to the under 30-ml/min group, but overall maximum increases were similar across groups. Small decreases in mean CrCL and small increases in mean serum creatinine/potassium were independent of baseline CrCL. The percent fractional free water clearance with respect to CrCL was significantly but negatively correlated with increasing baseline CrCL. No unexpected adverse events were reported. Thus, renal impairment attenuated the increase in 24-h urine volume and free water clearance caused by tolvaptan, consistent with decreased nephron function in renal impairment. The delay in serum sodium increase was consistent with the longer duration needed to excrete sufficient water to cause the increase. PMID:24048380

  3. Prefrontal Structure Varies as a Function of Pain Symptoms in Chronic Fatigue Syndrome.

    Science.gov (United States)

    van der Schaaf, Marieke E; De Lange, Floris P; Schmits, Iris C; Geurts, Dirk E M; Roelofs, Karin; van der Meer, Jos W M; Toni, Ivan; Knoop, Hans

    2017-02-15

    Chronic fatigue syndrome (CFS) is characterized by severe fatigue persisting for ≥6 months and leading to considerable impairment in daily functioning. Neuroimaging studies of patients with CFS have revealed alterations in prefrontal brain morphology. However, it remains to be determined whether these alterations are specific for fatigue or whether they relate to other common CFS symptoms (e.g., chronic pain, lower psychomotor speed, and reduced physical activity). We used magnetic resonance imaging to quantify gray matter volume (GMV) and the N-acetylaspartate and N-acetylaspartylglutamate/creatine ratio (NAA/Cr) in a group of 89 women with CFS. Building on previous reports, we tested whether GMV and NAA/Cr in the dorsolateral prefrontal cortex are associated with fatigue severity, pain, psychomotor speed, and physical activity, while controlling for depressive symptoms. We also considered GMV and NAA/Cr differences between patients with CFS and 26 sex-, age-, and education-matched healthy controls. The presence of pain symptoms was the main predictor of both GMV and NAA/Cr in the left dorsolateral prefrontal cortex of patients with CFS. More pain was associated with reduced GMVs and NAA/Cr, over and above the effects of fatigue, depressive symptoms, physical activity, and psychomotor speed. In contrast to previous reports and despite a large representative sample, global GMV did not differ between the CFS and healthy control groups. CFS, as diagnosed by Centers for Disease Control and Prevention criteria, is not a clinical entity reliably associated with reduced GMV. Individual variation in the presence of pain, rather than fatigue, is associated with neuronal alterations in the dorsolateral prefrontal cortex of patients with CFS. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  4. The role of barrier function of mucous membranes in allergic diseases and sublingual allergen-specific immunotherapy

    Directory of Open Access Journals (Sweden)

    Oksana M. Kurbacheva

    2017-01-01

    Full Text Available Currently one of the factors of allergy predisposition is the increase in barrier permeability of the mucous membranes of the respiratory system and the gastrointestinal tract (GIT. It defines the probability of an emergence of an allergic response. To understand the mechanisms of the interaction of the mucous membranes of different systems that explain their common function is undoubtedly necessary for discussion of this problem. The features of microbiome influence and the changes of the microbiome state during the formation of the immune response to the contact with allergens are of particular interest. The structure of the epithelial barrier of the airwaysand GIT, and mechanisms of allergen transport through barrier systems with the subsequent interaction with the cells (? associated with barrier fabrics have been considered. The possible role of the barrier function of mucous membranes in conducting sublingual allergen-specific immunotherapy (SLIT is discussed. 

  5. Modelling altered revenue function based on varying power consumption distribution and electricity tariff charge using data analytics framework

    Science.gov (United States)

    Zainudin, W. N. R. A.; Ramli, N. A.

    2017-09-01

    In 2010, Energy Commission (EC) had introduced Incentive Based Regulation (IBR) to ensure sustainable Malaysian Electricity Supply Industry (MESI), promotes transparent and fair returns, encourage maximum efficiency and maintains policy driven end user tariff. To cater such revolutionary transformation, a sophisticated system to generate policy driven electricity tariff structure is in great need. Hence, this study presents a data analytics framework that generates altered revenue function based on varying power consumption distribution and tariff charge function. For the purpose of this study, the power consumption distribution is being proxy using proportion of household consumption and electricity consumed in KwH and the tariff charge function is being proxy using three-tiered increasing block tariff (IBT). The altered revenue function is useful to give an indication on whether any changes in the power consumption distribution and tariff charges will give positive or negative impact to the economy. The methodology used for this framework begins by defining the revenue to be a function of power consumption distribution and tariff charge function. Then, the proportion of household consumption and tariff charge function is derived within certain interval of electricity power. Any changes in those proportion are conjectured to contribute towards changes in revenue function. Thus, these changes can potentially give an indication on whether the changes in power consumption distribution and tariff charge function are giving positive or negative impact on TNB revenue. Based on the finding of this study, major changes on tariff charge function seems to affect altered revenue function more than power consumption distribution. However, the paper concludes that power consumption distribution and tariff charge function can influence TNB revenue to some great extent.

  6. Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

    Science.gov (United States)

    Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

    2017-08-01

    Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Quantum entanglement of helium-like systems with varying-Z: compact state-of-the-art CI wave functions

    Science.gov (United States)

    López-Rosa, S.; Esquivel, R. O.; Plastino, A. R.; Dehesa, J. S.

    2015-09-01

    In this work we have performed state-of-the-art configuration-interaction (CI) calculations to determine the linear and von Neumann entanglement entropies for the helium-like systems with varying nuclear charge Z in the range 1≤slant Z≤slant 10. The focus of the work resides on determining accurate entanglement values for 2-electron systems with the lowest computational cost through compact CI-wave functions. Our entanglement results for the helium atom fully agree with the results obtained with higher quality wave functions of the Kinoshita type (Dehesa [5]). We find that the correlation energy is linearly related to the entanglement measures associated with the linear and von Neumann entropies of the single-particle reduced density matrizes, which sheds new light on the physical implications of entanglement in helium-like systems. Moreover, we report CI-wave-function-based benchmark results for the entanglement values for all members of the helium isoelectronic series with an accuracy similar to that of Kinoshita-type wave functions. Finally, we give parametric expressions of the linear and von Neumann entanglement measures for two-electron systems as Z varies from 1 to 10.

  8. A fast method to produce strong NFC films as a platform for barrier and functional materials.

    Science.gov (United States)

    Osterberg, Monika; Vartiainen, Jari; Lucenius, Jessica; Hippi, Ulla; Seppälä, Jukka; Serimaa, Ritva; Laine, Janne

    2013-06-12

    In this study, we present a rapid method to prepare robust, solvent-resistant, nanofibrillated cellulose (NFC) films that can be further surface-modified for functionality. The oxygen, water vapor, and grease barrier properties of the films were measured, and in addition, mechanical properties in the dry and wet state and solvent resistance were evaluated. The pure unmodified NFC films were good barriers for oxygen gas and grease. At a relative humidity below 65%, oxygen permeability of the pure and unmodified NFC films was below 0.6 cm(3) μm m(-2) d(-1) kPa(-1), and no grease penetrated the film. However, the largest advantage of these films was their resistance to various solvents, such as water, methanol, toluene, and dimethylacetamide. Although they absorbed a substantial amount of solvent, the films could still be handled after 24 h of solvent soaking. Hot-pressing was introduced as a convenient method to not only increase the drying speed of the films but also enhance the robustness of the films. The wet strength of the films increased due to the pressing. Thus, they can be chemically or physically modified through adsorption or direct chemical reaction in both aqueous and organic solvents. Through these modifications, the properties of the film can be enhanced, introducing, for example, functionality, hydrophobicity, or bioactivity. Herein, a simple method using surface coating with wax to improve hydrophobicity and oxygen barrier properties at very high humidity is described. Through this modification, the oxygen permeability decreased further and was below 17 cm(3) μm m(-2) d(-1) kPa(-1) even at 97.4% RH, and the water vapor transmission rate decreased from 600 to 40 g/m(2) day. The wax treatment did not deteriorate the dry strength of the film. Possible reasons for the unique properties are discussed. The developed robust NFC films can be used as a generic, environmentally sustainable platform for functional materials.

  9. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model

    Science.gov (United States)

    Gschwandtner, M; Mildner, M; Mlitz, V; Gruber, F; Eckhart, L; Werfel, T; Gutzmer, R; Elias, P M; Tschachler, E

    2013-01-01

    Background Defects in keratinocyte differentiation and skin barrier are important features of inflammatory skin diseases like atopic dermatitis. Mast cells and their main mediator histamine are abundant in inflamed skin and thus may contribute to disease pathogenesis. Methods Human primary keratinocytes were cultured under differentiation-promoting conditions in the presence and absence of histamine, histamine receptor agonists and antagonists. The expression of differentiation-associated genes and epidermal junction proteins was quantified by real-time PCR, Western blot, and immunofluorescence labeling. The barrier function of human skin models was tested by the application of biotin as tracer molecule. Results The addition of histamine to human keratinocyte cultures and organotypic skin models reduced the expression of the differentiation-associated proteins keratin 1/10, filaggrin, and loricrin by 80–95%. Moreover, the addition of histamine to skin models resulted in the loss of the granular layer and thinning of the epidermis and stratum corneum by 50%. The histamine receptor H1R agonist, 2-pyridylethylamine, suppressed keratinocyte differentiation to the same extent as did histamine. Correspondingly, cetirizine, an antagonist of H1R, virtually abrogated the effect of histamine. The expression of tight junction proteins zona occludens-1, occludin, claudin-1, and claudin-4, as well as that of desmosomal junction proteins corneodesmosin and desmoglein-1, was down-regulated by histamine. The tracer molecule biotin readily penetrated the tight junction barrier of skin cultures grown in the presence of histamine, while their diffusion was completely blocked in nontreated controls. Conclusions Our findings suggest a new mechanism by which mast cell activation and histamine release contribute to skin barrier defects in inflammatory skin diseases. PMID:23157658

  10. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

    DEFF Research Database (Denmark)

    Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

    2006-01-01

    Atopic disease, including atopic dermatitis (eczema), allergy and asthma, has increased in frequency in recent decades and now affects approximately 20% of the population in the developed world. Twin and family studies have shown that predisposition to atopic disease is highly heritable. Although...... dermatitis. This work establishes a key role for impaired skin barrier function in the development of atopic disease....... most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...

  11. Stereodynamic tetrahydrobiisoindole “NU-BIPHEP(O”s: functionalization, rotational barriers and non-covalent interactions

    Directory of Open Access Journals (Sweden)

    Golo Storch

    2016-07-01

    Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.

  12. Reducing the Charge Carrier Transport Barrier in Functionally Layer-Graded Electrodes.

    Science.gov (United States)

    Zhang, Yanyan; Malyi, Oleksandr I; Tang, Yuxin; Wei, Jiaqi; Zhu, Zhiqiang; Xia, Huarong; Li, Wenlong; Guo, Jia; Zhou, Xinran; Chen, Zhong; Persson, Clas; Chen, Xiaodong

    2017-11-20

    Lithium-ion batteries (LIBs) are primary energy storage devices to power consumer electronics and electric vehicles, but their capacity is dramatically decreased at ultrahigh charging/discharging rates. This mainly originates from a high Li-ion/electron transport barrier within a traditional electrode, resulting in reaction polarization issues. To address this limitation, a functionally layer-graded electrode was designed and fabricated to decrease the charge carrier transport barrier within the electrode. As a proof-of-concept, functionally layer-graded electrodes composing of TiO2 (B) and reduced graphene oxide (RGO) exhibit a remarkable capacity of 128 mAh g(-1) at a high charging/discharging rate of 20 C (6.7 A g(-1) ), which is much higher than that of a traditionally homogeneous electrode (74 mAh g(-1) ) with the same composition. This is evidenced by the improvement of effective Li ion diffusivity as well as electronic conductivity in the functionally layer-graded electrodes. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Sunscreens, oxidative stress and antioxidant functions in marine organisms of the Great Barrier Reef.

    Science.gov (United States)

    Dunlap, W C; Shick, J M; Yamamoto, Y

    1999-01-01

    An overview of the biochemical photophysiology of tropical, reef-building corals is presented with a discussion on the biosynthetic relationship between natural UV-absorbing sunscreens and certain antioxidant functions in marine organisms. Our studies reveal that marine organisms, including 'UV-extremophilic' bacteria, are a rich source of novel antioxidants having potential for the development of commercial and biomedical applications. Novel sunscreening agents derived from tropical marine organisms of the Great Barrier Reef are in development. New marine-derived antioxidants are being isolated for testing as chemopreventatives in a variety of oxidatively degenerative diseases.

  14. Semiclassical construction of Green's functions for multidimensional systems with barrier tunneling

    Science.gov (United States)

    Kay, Kenneth G.

    2017-10-01

    We develop a treatment that divides phase space into regions bounded by surfaces and forms the energy-dependent semiclassical Green's function from short classical trajectory segments confined to the individual regions. We use this to generalize Bogomolny's quantization method to systems with barrier tunneling. Combined with an appropriate treatment of tunneling amplitudes, this yields a unified semiclassical framework that uses ordinary, real trajectories in classically allowed regions and imaginary-time trajectories in forbidden regions to obtain energies, decay rates, and wave functions for arbitrary states of multidimensional systems undergoing tunneling. Because the trajectory segments in the allowed region are short, components in the Green's function expression can be numerically evaluated using semiclassical initial value methods, yielding a promising approach for practical calculations.

  15. Reasons, Motivational Factors and Perceived Personal Barriers to Engagement in Physical Activity During Pregnancy Vary Within the BMI Classes - The Prenatal Prevention Project Germany.

    Science.gov (United States)

    Bauer, Carina; Graf, Christine; Platschek, Anna Maria; Strüder, Heiko Klaus; Ferrari, Nina

    2017-09-05

    International data indicate that approximately only 20.0% of pregnant women reach physical activity recommendations (≥150 minutes/week). To find ways for increasing physical activity, the reasons for exercising, motivational factors and barriers need to be determined. The aim of this pilot study was to identify these factors in respect to Body-Mass-Index-classification in German pregnant women. 61 women (32.7±4.8 years, 13.3±3.4 weeks of gestation) participated in this study. Before pregnancy 10.0% of women were underweight, 58.3% normal weight, 18.3% overweight and 13.4% obese. Standardized questionnaires were used to evaluate the above mentioned factors. "Fun" was one of the main reasons for being active in underweight/normal weight compared to overweight/obese women (53.7% vs. 10.5%; p=0.002), while "burning fat" was more important in overweight/obese women (9.8% vs. 36.8%; p=0.027). According to motivational factors differences occurred in "calorie burning" (7.3% underweight/normal weight vs. 31.6% overweight/obese; p=0.025) and "fat burning" (7.3% underweight/normal weight vs. 47.4% overweight/obese; p=0.001). Regarding barriers for being active, "tiredness" was more often a barrier in overweight/obese (63.2%) compared to normal weight/underweight women (31.7%; p=0.022). Pregnant women should be given tailored advice/motivation according to pre-pregnancy BMI. However, larger studies are necessary to evaluate these factors on pregnant women's physical activity level.

  16. War experiences, general functioning and barriers to care among former child soldiers in Northern Uganda: the WAYS study.

    Science.gov (United States)

    Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio

    2014-12-01

    Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

    Science.gov (United States)

    Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

    2015-01-13

    Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

  18. Multistability of neural networks with discontinuous non-monotonic piecewise linear activation functions and time-varying delays.

    Science.gov (United States)

    Nie, Xiaobing; Zheng, Wei Xing

    2015-05-01

    This paper is concerned with the problem of coexistence and dynamical behaviors of multiple equilibrium points for neural networks with discontinuous non-monotonic piecewise linear activation functions and time-varying delays. The fixed point theorem and other analytical tools are used to develop certain sufficient conditions that ensure that the n-dimensional discontinuous neural networks with time-varying delays can have at least 5(n) equilibrium points, 3(n) of which are locally stable and the others are unstable. The importance of the derived results is that it reveals that the discontinuous neural networks can have greater storage capacity than the continuous ones. Moreover, different from the existing results on multistability of neural networks with discontinuous activation functions, the 3(n) locally stable equilibrium points obtained in this paper are located in not only saturated regions, but also unsaturated regions, due to the non-monotonic structure of discontinuous activation functions. A numerical simulation study is conducted to illustrate and support the derived theoretical results. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Modulation of p-glycoprotein transport function at the blood-brain barrier.

    Science.gov (United States)

    Bauer, Björn; Hartz, Anika M S; Fricker, Gert; Miller, David S

    2005-02-01

    The central nervous system (CNS) effects of many therapeutic drugs are blunted because of restricted entry into the brain. The basis for this poor permeability is the brain capillary endothelium, which comprises the blood-brain barrier. This tissue exhibits very low paracellular (tight-junctional) permeability and expresses potent, multispecific, drug export pumps. Together, these combine to limit use of pharmacotherapy to treat CNS disorders such as brain cancer and bacterial or viral infections. Of all the xenobiotic efflux pumps highly expressed in brain capillary endothelial cells, p-glycoprotein handles the largest fraction of commonly prescribed drugs and thus is an obvious target for manipulation. Here we review recent studies focused on understanding the mechanisms by which p-glycoprotein activity in the blood-brain barrier can be modulated. These include (i) direct inhibition by specific competitors, (ii) functional modulation, and (iii) transcriptional modulation. Each has the potential to specifically reduce p-glycoprotein function and thus selectively increase brain permeability of p-glycoprotein substrates.

  20. Functional and cytometric examination of different human lung epithelial cell types as drug transport barriers.

    Science.gov (United States)

    Min, Kyoung Ah; Rosania, Gus R; Kim, Chong-Kook; Shin, Meong Cheol

    2016-03-01

    To develop inhaled medications, various cell culture models have been used to examine the transcellular transport or cellular uptake properties of small molecules. For the reproducible high throughput screening of the inhaled drug candidates, a further verification of cell architectures as drug transport barriers can contribute to establishing appropriate in vitro cell models. In the present study, side-by-side experiments were performed to compare the structure and transport function of three lung epithelial cells (Calu-3, normal human bronchial primary cells (NHBE), and NL-20). The cells were cultured on the nucleopore membranes in the air-liquid interface (ALI) culture conditions, with cell culture medium in the basolateral side only, starting from day 1. In transport assays, paracellular transport across all three types of cells appeared to be markedly different with the NHBE or Calu-3 cells, showing low paracellular permeability and high TEER values, while the NL-20 cells showed high paracellular permeability and low TEER. Quantitative image analysis of the confocal microscope sections further confirmed that the Calu-3 cells formed intact cell monolayers in contrast to the NHBE and NL-20 cells with multilayers. Among three lung epithelial cell types, the Calu-3 cell cultures under the ALI condition showed optimal cytometric features for mimicking the biophysical characteristics of in vivo airway epithelium. Therefore, the Calu-3 cell monolayers could be used as functional cell barriers for the lung-targeted drug transport studies.

  1. Contacting co-culture of human retinal microvascular endothelial cells alters barrier function of human embryonic stem cell derived retinal pigment epithelial cells.

    Science.gov (United States)

    Skottman, H; Muranen, J; Lähdekorpi, H; Pajula, E; Mäkelä, K; Koivusalo, L; Koistinen, A; Uusitalo, H; Kaarniranta, K; Juuti-Uusitalo, K

    2017-10-01

    Here we evaluated the effects of human retinal microvascular endothelial cells (hREC) on mature human embryonic stem cell (hESC) derived retinal pigment epithelial (RPE) cells. The hESC-RPE cells (Regea08/017, Regea08/023 or Regea11/013) and hREC (ACBRI 181) were co-cultured on opposite sides of transparent membranes for up to six weeks. Thereafter barrier function, small molecule permeability, localization of RPE and endothelial cell marker proteins, cellular fine structure, and growth factor secretion of were evaluated. After co-culture, the RPE specific CRALBP and endothelial cell specific von Willebrand factor were appropriately localized. In addition, the general morphology, pigmentation, and fine structure of hESC-RPE cells were unaffected. Co-culture increased the barrier function of hESC-RPE cells, detected both with TEER measurements and cumulative permeability of FD4 - although the differences varied among the cell lines. Co-culturing significantly altered VEGF and PEDF secretion, but again the differences were cell line specific. The results of this study showed that co-culture with hREC affects hESC-RPE functionality. In addition, co-culture revealed drastic cell line specific differences, most notably in growth factor secretion. This model has the potential to be used as an in vitro outer blood-retinal barrier model for drug permeability testing. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Functional Two-Dimensional Coordination Polymeric Layer as a Charge Barrier in Li–S Batteries

    KAUST Repository

    Huang, Jing-Kai

    2018-01-04

    Ultrathin two-dimensional (2D) polymeric layers are capable of separating gases and molecules based on the reported size exclusion mechanism. What is equally important but missing today is an exploration of the 2D layers with charge functionality, which enables applications using the charge exclusion principle. This work demonstrates a simple and scalable method of synthesizing a free-standing 2D coordination polymer Zn2(benzimidazolate)2(OH)2 at the air–water interface. The hydroxyl (−OH) groups are stoichiometrically coordinated and implement electrostatic charges in the 2D structures, providing powerful functionality as a charge barrier. Electrochemical performance of the Li–S battery shows that the Zn2(benzimidazolate)2(OH)2 coordination polymer layers efficiently mitigate the polysulfide shuttling effects and largely enhance the battery capacity and cycle performance. The synthesis of the proposed coordination polymeric layers is simple, scalable, cost saving, and promising for practical use in batteries.

  3. How hormones influence composition and physiological function of the brain-blood barrier.

    Science.gov (United States)

    Hampl, R; Bičíková, M; Sosvorová, L

    2015-01-01

    Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.

  4. Functional, interactive and critical health literacy: Varying relationships with control over care and number of GP visits.

    Science.gov (United States)

    van der Heide, Iris; Heijmans, Monique; Schuit, A Jantine; Uiters, Ellen; Rademakers, Jany

    2015-08-01

    The aim of this study is to examine the extent to which functional, interactive and critical health literacy are associated with patients' perceived control over care and frequency of GP visits. Data from the Dutch 'National Panel of People with Chronic Illness or Disability' was used (N=2508). Health literacy was assessed by the Functional, Communicative and Critical Health Literacy measure. Perceived control over care was indicated by perceived ability to organize care, interact with providers and to perform self-care. By multivariate linear and logistic regression analyses, associations between health literacy and perceived control over care and subsequently frequency of GP visits were studied. Mainly interactive health literacy was associated with patients' perceived ability to organize care, interact with healthcare providers and perform self-care, whereas only functional health literacy was associated with number of GP visits. The results imply that some patients' may be less able to exert control over their care because of lower health literacy. Functional, interactive and critical health literacy vary in their relevance for patients' ability to exert control. Initiatives for strengthening patients' role in healthcare may be improved by paying attention to patients' health literacy, specifically functional and interactive health literacy. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Hybridization between two cryptic filamentous brown seaweeds along the shore: analysing pre- and postzygotic barriers in populations of individuals with varying ploidy levels.

    Science.gov (United States)

    Montecinos, Alejandro E; Guillemin, Marie-Laure; Couceiro, Lucia; Peters, Akira F; Stoeckel, Solenn; Valero, Myriam

    2017-07-01

    We aimed to study the importance of hybridization between two cryptic species of the genus Ectocarpus, a group of filamentous algae with haploid-diploid life cycles that include the principal genetic model organism for the brown algae. In haploid-diploid species, the genetic structure of the two phases of the life cycle can be analysed separately in natural populations. Such life cycles provide a unique opportunity to estimate the frequency of hybrid genotypes in diploid sporophytes and meiotic recombinant genotypes in haploid gametophytes allowing the effects of reproductive barriers preventing fertilization or preventing meiosis to be untangle. The level of hybridization between E. siliculosus and E. crouaniorum was quantified along the European coast. Clonal cultures (568 diploid, 336 haploid) isolated from field samples were genotyped using cytoplasmic and nuclear markers to estimate the frequency of hybrid genotypes in diploids and recombinant haploids. We identified admixed individuals using microsatellite loci, classical assignment methods and a newly developed Bayesian method (XPloidAssignment), which allows the analysis of populations that exhibit variations in ploidy level. Over all populations, the level of hybridization was estimated at 8.7%. Hybrids were exclusively observed in sympatric populations. More than 98% of hybrids were diploids (40% of which showed signs of aneuploidy) with a high frequency of rare alleles. The near absence of haploid recombinant hybrids demonstrates that the reproductive barriers are mostly postzygotic and suggests that abnormal chromosome segregation during meiosis following hybridization of species with different genome sizes could be a major cause of interspecific incompatibility in this system. © 2017 John Wiley & Sons Ltd.

  6. Functional differential inclusions and dynamic behaviors for memristor-based BAM neural networks with time-varying delays

    Science.gov (United States)

    Cai, Zuowei; Huang, Lihong

    2014-05-01

    In this paper, we formulate and investigate a class of memristor-based BAM neural networks with time-varying delays. Under the framework of Filippov solutions, the viability and dissipativity of solutions for functional differential inclusions and memristive BAM neural networks can be guaranteed by the matrix measure approach and generalized Halanay inequalities. Then, a new method involving the application of set-valued version of Krasnoselskii' fixed point theorem in a cone is successfully employed to derive the existence of the positive periodic solution. The dynamic analysis in this paper utilizes the theory of set-valued maps and functional differential equations with discontinuous right-hand sides of Filippov type. The obtained results extend and improve some previous works on conventional BAM neural networks. Finally, numerical examples are given to demonstrate the theoretical results via computer simulations.

  7. RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

    Science.gov (United States)

    Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

    2014-01-01

    ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

  8. The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.

    2009-09-01

    A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected

  9. How gut transcriptional function of Drosophila melanogaster varies with the presence and composition of the gut microbiota.

    Science.gov (United States)

    Bost, Alyssa; Franzenburg, Soeren; Adair, Karen L; Martinson, Vincent G; Loeb, Greg; Douglas, Angela E

    2017-11-07

    Despite evidence from laboratory experiments that perturbation of the gut microbiota affects many traits of the animal host, our understanding of the effect of variation in microbiota composition on animals in natural populations is very limited. The core purpose of this study on the fruit fly Drosophila melanogaster was to identify the impact of natural variation in the taxonomic composition of gut bacterial communities on host traits, with the gut transcriptome as a molecular index of microbiota-responsive host traits. Use of the gut transcriptome was validated by demonstrating significant transcriptional differences between the guts of laboratory flies colonized with bacteria and maintained under axenic conditions. Wild Drosophila from six field collections made over two years had gut bacterial communities of diverse composition, dominated to varying extents by Acetobacteraceae and Enterobacteriaceae. The gut transcriptomes also varied among collections and differed markedly from those of laboratory flies. However, no overall relationship between variation in the wild fly transcriptome and taxonomic composition of the gut microbiota was evident at all taxonomic scales of bacteria tested for both individual fly genes and functional categories in Gene Ontology. We conclude that the interaction between microbiota composition and host functional traits may be confounded by uncontrolled variation in both ecological circumstance and host traits (e.g., genotype, age physiological condition) under natural conditions, and that microbiota effects on host traits identified in the laboratory should, therefore, be extrapolated to field population with great caution. © 2017 John Wiley & Sons Ltd.

  10. The impact of urban particulate pollution on skin barrier function and the subsequent drug absorption.

    Science.gov (United States)

    Pan, Tai-Long; Wang, Pei-Wen; Aljuffali, Ibrahim A; Huang, Chi-Ting; Lee, Chiang-Wen; Fang, Jia-You

    2015-04-01

    Ambient particulate matters (PMs) are known as inducers that adversely affect a variety of human organs. In this study, we aimed to evaluate the influence of PMs on the permeation of drugs and sunscreens via the skin. The role of skin-barrier properties such as the stratum corneum (SC) and tight junctions (TJs) during the delivery process was explored. This work was conducted using both in vitro and in vivo experiments in pigs to check the responses of the skin to PMs. PMs primarily containing heavy metals (1648a) and polycyclic aromatic hydrocarbons (PAHs, 1649b) were employed to treat the skin. According to the transepidermal water loss (TEWL), 1649b but not 1648a significantly disrupted the SC integrity by 2-fold compared to the PBS control. The immunohistochemistry (IHC) of cytokeratin, filaggrin, and E-cadherin exhibited that 1649b mildly damaged TJs. The cytotoxicity of keratinocytes and skin fibroblasts caused by 1649b was stronger than that caused by 1648a. The 1649b elicited apoptosis via caspase-3 activation. The proteomic profiles showed that PMs upregulated Annexin A2 by >5-fold, which can be a biomarker of PM-induced barrier disruption. We found that the skin uptake of ascorbic acid, an extremely hydrophilic drug, was increased from 74 to 112 μg/g by 1649b treatment. The extremely lipophilic drug tretinoin also showed a 2.6-fold increase of skin accumulation. Oxybenzone and dextran absorption was not affected by PMs. The in vivo dye distribution visualized by fluorescence microscopy had indicated that 1649b intervention promoted permeant partitioning into SC. Caution should be taken in exposing the skin to airborne dust due to its ability to reduce barrier function and increase the risk of drug overabsorption, although this effect was not very marked. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  11. Influence of sportive activity on skin barrier function: a quantitative evaluation of 60 athletes.

    Science.gov (United States)

    Luebberding, Stefanie; Kolbe, Lea; Kerscher, Martina

    2013-06-01

    While sports-related diseases are well documented in the literature, no study regarding the physiology of athlete's skin has been published yet. However, some evidence is given for impairment of the skin barrier due to sportive activity accompanied by an increase in sweating. In this explorative study, we investigated the effect of sportive activity on skin physiology, namely stratum corneum hydration, skin surface pH, and sebum content. A total of 60 healthy Caucasian volunteers (35 females, 25 males; mean 27.35 ± 4.09) were enrolled in this study. Measurements were done before and after 45 minutes of endurance cardio training at forehead, chest, forearm, and armpits. Hydration level, sebum secretion, and pH value of hydrolipid acid film were measured with worldwide-acknowledged biophysical measuring methods. Stratum corneum hydration significantly increased after sportive activity. The increase was about 51.9% at the forearm and 31.9% at the chest. Sebum content at the forehead significantly decreased during exercising, from 87.36 μg/cm2 to 62.41 μg/cm2. At all investigated body sites, measured values for skin surface pH increased after sportive activity. Highest pH value was measured in armpits (pH 5.64-5.98) and lowest at forearm (pH 4.75-4.93). Sportive activity is accompanied by significant changes of skin physiology that could stress the barrier function of the skin. Higher skin surface pH and hyperhydration of the stratum corneum as well as increased lipid content on the skin surface are probably caused by an increased sweat production. The impaired skin barrier may also be the reason for some reported sports-related dermatoses. © 2013 The International Society of Dermatology.

  12. Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions

    Directory of Open Access Journals (Sweden)

    Milos Mihajlovic

    2017-11-01

    Full Text Available As current kidney replacement therapies are not efficient enough for end-stage renal disease (ESRD treatment, a bioartificial kidney (BAK device, based on conditionally immortalized human proximal tubule epithelial cells (ciPTEC, could represent an attractive solution. The active transport activity of such a system was recently demonstrated. In addition, endocrine functions of the cells, such as vitamin D activation, are relevant. The organic anion transporter 1 (OAT-1 overexpressing ciPTEC line presented 1α-hydroxylase (CYP27B1, 24-hydroxylase (CYP24A1 and vitamin D receptor (VDR, responsible for vitamin D activation, degradation and function, respectively. The ability to produce and secrete 1α,25-dihydroxy-vitamin D3, was shown after incubation with the precursor, 25-hydroxy-vitamin D3. The beneficial effect of vitamin D on cell function and behavior in uremic conditions was studied in the presence of an anionic uremic toxins mixture. Vitamin D could restore cell viability, and inflammatory and oxidative status, as shown by cell metabolic activity, interleukin-6 (IL-6 levels and reactive oxygen species (ROS production, respectively. Finally, vitamin D restored transepithelial barrier function, as evidenced by decreased inulin-FITC leakage in biofunctionalized hollow fiber membranes (HFM carrying ciPTEC-OAT1. In conclusion, the protective effects of vitamin D in uremic conditions and proven ciPTEC-OAT1 endocrine function encourage the use of these cells for BAK application.

  13. Allocation to male vs female floral function varies by currency and responds differentially to density and moisture stress.

    Science.gov (United States)

    Brock, M T; Winkelman, R L; Rubin, M J; Edwards, C E; Ewers, B E; Weinig, C

    2017-11-01

    Allocation of finite resources to separate reproductive functions is predicted to vary across environments and affect fitness. Biomass is the most commonly measured allocation currency; however, in comparison with nutrients it may be less limited and express different environmental and evolutionary responses. Here, we measured carbon, nitrogen, phosphorus, and biomass allocation among floral whorls in recombinant inbred lines of Brassica rapa in multiple environments to characterize the genetic architecture of floral allocation, including its sensitivity to environmental heterogeneity and to choice of currency. Mass, carbon, and nitrogen allocation to female whorls (pistils and sepals) decreased under high density, whereas nitrogen allocation to male organs (stamens) decreased under drought. Phosphorus allocation decreased by half in pistils under drought, while stamen phosphorus was unaffected by environment. While the contents of each currency were positively correlated among whorls, selection to improve fitness through female (or male) function typically favored increased allocation to pistils (or stamens) but decreased allocation to other whorls. Finally, genomic regions underlying correlations among allocation metrics were mapped, and loci related to nitrogen uptake and floral organ development were located within mapped quantitative trait loci. Our candidate gene identification suggests that nutrient uptake may be a limiting step in maintaining male allocation. Taken together, allocation to male vs female function is sensitive to distinct environmental stresses, and the choice of currency affects the interpretation of floral allocation responses to the environment. Further, genetic correlations may counter the evolution of allocation patterns that optimize fitness through female or male function.

  14. Intestinal barrier function in response to abundant or depleted mucosal glutathione in Salmonella-infected rats

    Directory of Open Access Journals (Sweden)

    Vink Carolien

    2009-04-01

    Full Text Available Abstract Background Glutathione, the main antioxidant of intestinal epithelial cells, is suggested to play an important role in gut barrier function and prevention of inflammation-related oxidative damage as induced by acute bacterial infection. Most studies on intestinal glutathione focus on oxidative stress reduction without considering functional disease outcome. Our aim was to determine whether depletion or maintenance of intestinal glutathione changes susceptibility of rats to Salmonella infection and associated inflammation. Rats were fed a control diet or the same diet supplemented with buthionine sulfoximine (BSO; glutathione depletion or cystine (glutathione maintenance. Inert chromium ethylenediamine-tetraacetic acid (CrEDTA was added to the diets to quantify intestinal permeability. At day 4 after oral gavage with Salmonella enteritidis (or saline for non-infected controls, Salmonella translocation was determined by culturing extra-intestinal organs. Liver and ileal mucosa were collected for analyses of glutathione, inflammation markers and oxidative damage. Faeces was collected to quantify diarrhoea. Results Glutathione depletion aggravated ileal inflammation after infection as indicated by increased levels of mucosal myeloperoxidase and interleukin-1β. Remarkably, intestinal permeability and Salmonella translocation were not increased. Cystine supplementation maintained glutathione in the intestinal mucosa but inflammation and oxidative damage were not diminished. Nevertheless, cystine reduced intestinal permeability and Salmonella translocation. Conclusion Despite increased infection-induced mucosal inflammation upon glutathione depletion, this tripeptide does not play a role in intestinal permeability, bacterial translocation and diarrhoea. On the other hand, cystine enhances gut barrier function by a mechanism unlikely to be related to glutathione.

  15. N-acetyl glucosamine improves intestinal mucosal barrier function in rat

    Directory of Open Access Journals (Sweden)

    Yanxia Liu

    2012-12-01

    Full Text Available Our study investigated the effect of N-acetylglucosamine (GlcNAc on the intestinal mucosal barrier function in rats. Rats were randomly assigned into normal control group, diarrhea-predominant irritable bowel syndrome (IBS-D group and GlcNAc group. IBS-D was introduced into the IBS-D group without any treatment. The GlcNAc group were treated with GlcNAc. Microvilli and tight junctions of intestinal epithelial cells were detected. The D-lactic acid level and diamine oxidase (DAO activity in the serum were determined. Compared with normal rats, microvilli were sparsely distributed on the intestinal epithelial cells, the tight junction gap also widened, and D-lactic acid level and DAO activity were significantly higher in the IBS-D group. After GlcNAc treatment, the microscopic structure of the intestinal mucosa became largely normal, and the level of D-lactic acid and the DAO activity were lowered. In conclusion, GlcNAc can effectively improve the intestinal mucosal barrier dysfunction, perhaps through enhancing the cellular metabolism.

  16. Alteration of intestinal barrier function during activity-based anorexia in mice.

    Science.gov (United States)

    Jésus, Pierre; Ouelaa, Wassila; François, Marie; Riachy, Lina; Guérin, Charlène; Aziz, Moutaz; Do Rego, Jean-Claude; Déchelotte, Pierre; Fetissov, Sergueï O; Coëffier, Moïse

    2014-12-01

    Anorexia nervosa is a severe eating disorder often leading to malnutrition and cachexia, but its pathophysiology is still poorly defined. Chronic food restriction during anorexia nervosa may induce gut barrier dysfunction, which may contribute to disease development and its complications. Here we have characterized intestinal barrier function in mice with activity-based anorexia (ABA), an animal model of anorexia nervosa. Male C57Bl/6 ABA or limited food access (LFA) mice were placed respectively in cages with or without activity wheel. After 5 days of acclimatization, both ABA and LFA mice had progressively limited access to food from 6 h/d at day 6 to 3 h/d at day 9 and until the end of experiment at day 17. A group of pair-fed mice (PF) was also compared to ABA. On day 17, food intake was lower in ABA than LFA mice (2.0 ± 0.18 g vs. 3.0 ± 0.14 g, p anorexia nervosa. The role of these alterations in the pathophysiology of anorexia nervosa should be further evaluated. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  17. A mixed-effects, spatially varying coefficients model with application to multi-resolution functional magnetic resonance imaging data.

    Science.gov (United States)

    Liu, Zhuqing; Bartsch, Andreas J; Berrocal, Veronica J; Johnson, Timothy D

    2018-01-01

    Spatial resolution plays an important role in functional magnetic resonance imaging studies as the signal-to-noise ratio increases linearly with voxel volume. In scientific studies, where functional magnetic resonance imaging is widely used, the standard spatial resolution typically used is relatively low which ensures a relatively high signal-to-noise ratio. However, for pre-surgical functional magnetic resonance imaging analysis, where spatial accuracy is paramount, high-resolution functional magnetic resonance imaging may play an important role with its greater spatial resolution. High spatial resolution comes at the cost of a smaller signal-to-noise ratio. This begs the question as to whether we can leverage the higher signal-to-noise ratio of a standard functional magnetic resonance imaging study with the greater spatial accuracy of a high-resolution functional magnetic resonance imaging study in a pre-operative patient. To answer this question, we propose to regress the statistic image from a high resolution scan onto the statistic image obtained from a standard resolution scan using a mixed-effects model with spatially varying coefficients. We evaluate our model via simulation studies and we compare its performance with a recently proposed model that operates at a single spatial resolution. We apply and compare the two models on data from a patient awaiting tumor resection. Both simulation study results and the real data analysis demonstrate that our newly proposed model indeed leverages the larger signal-to-noise ratio of the standard spatial resolution scan while maintaining the advantages of the high spatial resolution scan.

  18. Composite of microgels and lipids as biofilm to restore skin barrier function

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.|info:eu-repo/dai/nl/304834939

    2008-01-01

    The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

  19. Effect of carbon nanoparticles on renal epithelial cell structure, barrier function, and protein expression.

    Science.gov (United States)

    Blazer-Yost, Bonnie L; Banga, Amiraj; Amos, Adam; Chernoff, Ellen; Lai, Xianyin; Li, Cheng; Mitra, Somenath; Witzmann, Frank A

    2011-09-01

    To assess effects of carbon nanoparticle (CNP) exposure on renal epithelial cells, fullerenes (C(60)), single-walled carbon nanotubes (SWNT), and multi-walled carbon nanotubes (MWNT) were incubated with a confluent renal epithelial line for 48 h. At low concentrations, CNP-treated cells exhibited significant decreases in transepithelial electrical resistance (TEER) but no changes in hormone-stimulated ion transport or CNP-induced toxicity or stress responses as measured by lactate dehydrogenase or cytokine release. The changes in TEER, manifested as an inverse relationship with CNP concentration, were mirrored by an inverse correlation between dose and changes in protein expression. Lower, more physiologically relevant, concentrations of CNP have the most profound effects on barrier cell function and protein expression. These results indicate an impact of CNPs on renal epithelial cells at concentrations lower than have been previously studied and suggest caution with regard to increasing CNP levels entering the food chain due to increasing environmental pollution.

  20. Endothelial calcium dynamics, connexin channels and blood-brain barrier function.

    Science.gov (United States)

    De Bock, Marijke; Wang, Nan; Decrock, Elke; Bol, Mélissa; Gadicherla, Ashish K; Culot, Maxime; Cecchelli, Romeo; Bultynck, Geert; Leybaert, Luc

    2013-09-01

    Situated between the circulation and the brain, the blood-brain barrier (BBB) protects the brain from circulating toxins while securing a specialized environment for neuro-glial signaling. BBB capillary endothelial cells exhibit low transcytotic activity and a tight, junctional network that, aided by the cytoskeleton, restricts paracellular permeability. The latter is subject of extensive research as it relates to neuropathology, edema and inflammation. A key determinant in regulating paracellular permeability is the endothelial cytoplasmic Ca(2+) concentration ([Ca(2+)]i) that affects junctional and cytoskeletal proteins. Ca(2+) signals are not one-time events restricted to a single cell but often appear as oscillatory [Ca(2+)]i changes that may propagate between cells as intercellular Ca(2+) waves. The effect of Ca(2+) oscillations/waves on BBB function is largely unknown and we here review current evidence on how [Ca(2+)]i dynamics influence BBB permeability. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Varying the item format improved the range of measurement in patient-reported outcome measures assessing physical function

    DEFF Research Database (Denmark)

    Liegl, Gregor; Gandek, Barbara; Fischer, H. Felix

    2017-01-01

    Background: Physical function (PF) is a core patient-reported outcome domain in clinical trials in rheumatic diseases. Frequently used PF measures have ceiling effects, leading to large sample size requirements and low sensitivity to change. In most of these instruments, the response category...... easy, increases the range of precise measurement of self-reported PF. Methods: Three five-item PF short forms were constructed from the Patient-Reported Outcomes Measurement Information System (PROMIS®) wave 1 data. All forms included the same physical activities but varied in item stem and response...... precision between the short forms using different item formats. Results: Sufficient unidimensionality of all short-form items and the original PF item bank was supported. Compared to formats A and B, format C increased the range of reliable measurement by about 0.5 standard deviations on the positive side...

  2. Optimization of the functional expression of Coprinus cinereus peroxidase in Pichia pastoris by varying the host and promoter.

    Science.gov (United States)

    Kim, Su-Jin; Lee, Jeong-Ah; Kim, Yong-Hwan; Song, Bong-Keun

    2009-09-01

    Peroxidase from Coprinus cinereus (CiP) has attracted attention for its high specific activity and broad substrate spectrum compared with other peroxidases. In this study, the functional expression of this peroxidase was successfully achieved in the methylotrophic yeast Pichia pastoris. The expression level of CiP was increased by varying the microbial hosts and the expression promoters. Since a signal sequence, such as the alpha mating factor of Saccharomyces cerevisiae, was placed preceding the cDNA of the CiP coding gene, expressed recombinant CiP (rCiP) was secreted into the culture broth. The Mut+ Pichia pastoris host showed a 3-fold higher peroxidase activity, as well as 2-fold higher growth rate, compared with the Muts Pichia pastoris host. Furthermore, the AOX1 promoter facilitated a 5-fold higher expression of rCiP than did the GAP promoter.

  3. Microbial community diversity and composition varies with habitat characteristics and biofilm function in macrophyte-rich streams

    DEFF Research Database (Denmark)

    Levi, Peter S.; Starnawski, Piotr; Poulsen, Britta

    2017-01-01

    in these biofilms by creating microhabitats. Here we describe the prokaryotic and eukaryotic microbial diversity of biofilms in sand and macrophyte habitats (i.e. epipsammon and epiphyton, respectively) in five macrophyte-rich streams in Jutland, Denmark. The macrophyte species varied in growth morphology, C...... as determined by measuring the similarity among communities (i.e. Sørensen similarity index). Furthermore, we found significant correlations between microbial diversity (i.e. Chao1 rarefied richness and Pielou’s evenness) and biofilm structure and function (i.e. C:N ratio and ammonium uptake efficiency...... dominated by Stramenopiles (i.e. diatoms). For both the prokaryotes and eukaryotes, the epipsammon were consistently the most diverse communities and the epiphytic communities were generally similar among the four macrophyte species. However, the communities on the least complex macrophyte, Sparganium...

  4. Brain-derived neurotrophic factor preserves intestinal mucosal barrier function and alters gut microbiota in mice

    Directory of Open Access Journals (Sweden)

    Chen Li

    2018-03-01

    Full Text Available The intestinal mucosal barrier (IMB enables the intestine to provide adequate containment of luminal microorganisms and molecules while preserving the ability to absorb nutrients. In this study, we explored the effect of brain-derived neurotrophic factor (BDNF on IMB function and gut microbiota in mice. BDNF gene knock-out mice (the BDNF+/− group and wild-type mice (the BDNF+/+ group were selected. The gut microbiota of these mice was analyzed by denaturing gradient gel electrophoresis (DGGE assay. The ultrastructure of the ileum and the colonic epithelium obtained from decapitated mice were observed by transmission electron microscopy. The protein expression of epithelial tight junction proteins, zonula occludens-1 (ZO-1 and occludin was detected by immunohistochemistry staining. The protein expression of claudin-1 and claudin-2 was determined by Western blotting. The DGGE band patterns of gut microbiota in the BDNF+/− group were significantly different from that in the BDNF+/+ group, which indicated that the BDNF expression alters the gut microbiota in mice. Compared with the BDNF+/+ group, the BDNF+/− group presented no significant difference in the ultrastructure of ileal epithelium; however, a significant difference was observed in the colonic epithelial barrier, manifested by decreased microvilli, widening intercellular space and bacterial invasion. Compared with the BDNF+/+ group, the expression of ZO-1 and occludin in the BDNF+/− group was significantly decreased. The expression of claudin-1 in the BDNF+/− group was significantly reduced, while the expression of claudin-2 was elevated. These findings indicate that BDNF preserves IMB function and modulates gut microbiota in mice.

  5. Investigating the Potential Barrier Function of Nanostructured Materials Formed in Engineered Barrier Systems (EBS) Designed for Nuclear Waste Isolation.

    Science.gov (United States)

    Cuevas, Jaime; Ruiz, Ana Isabel; Fernández, Raúl

    2018-02-21

    Clay and cement are known nano-colloids originating from natural processes or traditional materials technology. Currently, they are used together as part of the engineered barrier system (EBS) to isolate high-level nuclear waste (HLW) metallic containers in deep geological repositories (DGR). The EBS should prevent radionuclide (RN) migration into the biosphere until the canisters fail, which is not expected for approximately 10 3  years. The interactions of cementitious materials with bentonite swelling clay have been the scope of our research team at the Autonomous University of Madrid (UAM) with participation in several European Union (EU) projects from 1998 up to now. Here, we describe the mineral and chemical nature and microstructure of the alteration rim generated by the contact between concrete and bentonite. Its ability to buffer the surrounding chemical environment may have potential for further protection against RN migration. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Partial volume correction of PET-imaged tumor heterogeneity using expectation maximization with a spatially varying point spread function

    Science.gov (United States)

    Barbee, David L; Flynn, Ryan T; Holden, James E; Nickles, Robert J; Jeraj, Robert

    2010-01-01

    Tumor heterogeneities observed in positron emission tomography (PET) imaging are frequently compromised of partial volume effects which may affect treatment prognosis, assessment, or future implementations such as biologically optimized treatment planning (dose painting). This paper presents a method for partial volume correction of PET-imaged heterogeneous tumors. A point source was scanned on a GE Discover LS at positions of increasing radii from the scanner’s center to obtain the spatially varying point spread function (PSF). PSF images were fit in three dimensions to Gaussian distributions using least squares optimization. Continuous expressions were devised for each Gaussian width as a function of radial distance, allowing for generation of the system PSF at any position in space. A spatially varying partial volume correction (SV-PVC) technique was developed using expectation maximization (EM) and a stopping criterion based on the method’s correction matrix generated for each iteration. The SV-PVC was validated using a standard tumor phantom and a tumor heterogeneity phantom, and was applied to a heterogeneous patient tumor. SV-PVC results were compared to results obtained from spatially invariant partial volume correction (SINV-PVC), which used directionally uniform three dimensional kernels. SV-PVC of the standard tumor phantom increased the maximum observed sphere activity by 55 and 40% for 10 and 13 mm diameter spheres, respectively. Tumor heterogeneity phantom results demonstrated that as net changes in the EM correction matrix decreased below 35%, further iterations improved overall quantitative accuracy by less than 1%. SV-PVC of clinically observed tumors frequently exhibited changes of ±30% in regions of heterogeneity. The SV-PVC method implemented spatially varying kernel widths and automatically determined the number of iterations for optimal restoration, parameters which are arbitrarily chosen in SINV-PVC. Comparing SV-PVC to SINV

  7. Astilbin from Engelhardtia chrysolepis enhances intestinal barrier functions in Caco-2 cell monolayers.

    Science.gov (United States)

    Nakahara, Tatsuo; Nishitani, Yosuke; Nishiumi, Shin; Yoshida, Masaru; Azuma, Takeshi

    2017-06-05

    Astilbin, which is one of polyphenolic compounds isolated from the leaves of Engelhardtia chrysolepis HANCE (Chinese name, huang-qui), is available as the effective component in food and cosmetics because of its anti-oxidant and anti-inflammatory effects. The tight junction (TJ) proteins, which protect the body from foreign substances, are related to adhesion between a cell and a cell. Previously, the enhancement of TJ's functions induced by aglycones of flavonoids has been demonstrated, but the effects of the glycosides such as astilbin have not been observed yet. In this study, we investigated the effects of astilbin on the TJ's functions, and human colon carcinoma Caco-2 cell monolayers were used to evaluate the effects of astilbin on transepithelial electrical resistance (TER) value and the mRNA and proteins expressions of TJ-related molecules. Astilbin increased the TER value, mRNA expression levels of claudin-1 and ZO-2, and protein expression levels of occludin and ZO-2 in Caco-2 cells. Astilbin also increased the TER value in Caco-2 cells co-stimulated with TNF-α plus IFN-γ, and moreover upregulated the protein expression of TJ-related molecules in Caco-2 cells co-treated with TNF-α plus IFN-γ. These results suggest that astilbin can enhance the expressions of TJ-related molecules, leading to upregulation of the barrier functions in the intestinal cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Anatomical coupling among distributed cortical regions in youth varies as a function of individual differences in vocabulary abilities.

    Science.gov (United States)

    Lee, Nancy Raitano; Raznahan, Armin; Wallace, Gregory L; Alexander-Bloch, Aaron; Clasen, Liv S; Lerch, Jason P; Giedd, Jay N

    2014-05-01

    Patient lesion and functional magnetic resonance imaging (fMRI) studies have provided convincing evidence that a distributed brain network subserves word knowledge. However, little is known about the structural correlates of this network within the context of typical development and whether anatomical coupling in linguistically relevant regions of cortex varies as a function of vocabulary skill. Here we investigate the association between vocabulary and anatomical coupling in 235 typically developing youth (ages 6-19 years) using structural MRI. The study's primary aim was to evaluate whether higher vocabulary performance was associated with greater vertex-level cortical thickness covariation in distributed regions of cortex known to be associated with word knowledge. Results indicate that better vocabulary skills are associated with greater anatomical coupling in several linguistically relevant regions of cortex, including the left inferior parietal (temporal-parietal junction), inferior temporal, middle frontal, and superior frontal gyri and the right inferior frontal and precentral gyri. Furthermore, in high vocabulary scorers, stronger coupling is found among these regions. Thus, complementing patient and fMRI studies, this is the first investigation to highlight the relevance of anatomical covariance within the cortex to vocabulary skills in typically developing youth, further elucidating the distributed nature of neural systems subserving word knowledge. Copyright © 2013 Wiley Periodicals, Inc.

  9. Abl family kinases regulate endothelial barrier function in vitro and in mice.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Chislock

    Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

  10. Novel Functionally Graded Thermal Barrier Coatings in Coal-Fired Power Plant Turbines

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jing [Indiana Univ., Indianapolis, IN (United States)

    2016-11-01

    This project presents a detailed investigation of a novel functionally graded coating material, pyrochlore oxide, for thermal barrier coating (TBC) in gas turbines used in coal-fired power plants. Thermal barrier coatings are refractory materials deposited on gas turbine components, which provide thermal protection for metallic components at operating conditions. The ultimate goal of this research is to develop a manufacturing process to produce the novel low thermal conductivity and high thermal stability pyrochlore oxide based coatings with improved high-temperature durability. The current standard TBC, yttria stabilized zirconia (YSZ), has service temperatures limited to <1200°C, due to sintering and phase transition at higher temperatures. In contrast, pyrochlore oxide, e.g., lanthanum zirconate (La2Zr2O7, LZ), has demonstrated lower thermal conductivity and better thermal stability, which are crucial to high temperature applications, such as gas turbines used in coal-fired power plants. Indiana University – Purdue University Indianapolis (IUPUI) has collaborated with Praxair Surface Technologies (PST), and Changwon National University in South Korea to perform the proposed research. The research findings are critical to the extension of current TBCs to a broader range of high-temperature materials and applications. Several tasks were originally proposed and accomplished, with additional new opportunities identified during the course of the project. In this report, a description of the project tasks, the main findings and conclusions are given. A list of publications and presentations resulted from this research is listed in the Appendix at the end of the report.

  11. The effects of female sexual steroids on gastric function and barrier resistance of gastrointestinal tract following traumatic brain injury

    Directory of Open Access Journals (Sweden)

    Zakieh Keshavarzi

    2015-01-01

    Full Text Available Aim: The aim was to assess the alteration of gastric function and barrier function of gastrointestinal (GI tract following diffuse brain injury in varying ovarian hormone status. Materials and Methods: Diffuse traumatic brain injury (TBI was induced by Marmarou method. Rats were randomly assigned into 10 groups: Intact, sham + ovariectomized female (OVX, TBI, TBI + OVX, vehicle, estradiol (E2, progesterone (P, E2 + P, estrogen receptor alpha agonist and estrogen receptor beta agonist (DPN. Endotoxin levels were measured using enzyme-linked immunosorbent assay method. All the parameters were measured 5 days after TBI. Results: Intragastric pressure was significantly decreased in TBI as compared to the intact group (P < 0.001 and this was lower in TBI group versus TBI + OVX group (P < 0.05. Pretreatment with steroid hormones and their agonists did not have any effect on the gastric pressure compared to TBI + OVX or vehicle groups. Inflammation, congestion, ulcer and erosion were seen in the TBI rats. All treatment groups worsen the tissue condition so that the presence of thrombosis also was seen. The trauma induction did not have any effect on the serum and intestinal endotoxin levels. DPN had caused a significant reduction in serum levels of endotoxin compared with OVX + TBI group (P < 0.05. Conclusion: Pretreatment with sexual steroids is not useful in the treatment of GI dysfunction induced by TBI. The treatment with all sexual female hormones worsens the gastric tissue condition. Furthermore, the applied weight was not enough for releasing of endotoxin. It seems that estrogen reduced the endotoxin levels by estrogen beta receptor.

  12. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Directory of Open Access Journals (Sweden)

    Siming Yang

    2017-08-01

    Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.

  13. Oxygen functionalization of MWCNTs in RF-dielectric barrier discharge Ar/O2 plasma

    Science.gov (United States)

    Abdel-Fattah, E.; Ogawa, D.; Nakamura, K.

    2017-07-01

    The oxygenation of multi-wall carbon nanotubes (MWCNTs) was performed via a radio frequency dielectric barrier discharge (RF-DBD) in an Ar/{{\\text{H}}2}\\text{O} plasma mixture. The relative intensity of the Ar/{{\\text{O}}2} plasma species was characterized by optical emission spectroscopy (OES). The effects of treatment time, RF power and oxygen gas percentage on the chemical composition and surface morphology of MWCNTs were investigated by means of x-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy and field emission scanning electron microscopy (FE-SEM). The results of FTIR and XPS revealed the presence of oxygen-containing functional groups on the MWCNTs treated in an Ar/{{\\text{O}}2} plasma at an RF power of 50 W and pressure of 400 Pa. The amount of oxygen functional groups (C=O, C-O, and O-COO) also increased by increasing treatment time up to 6 min, but slightly decreased when treatment time was increased by 10 min. The increase of oxygen gas percentage in the plasma mixture does not affect the oxygen content in the treated MWCNTs. Meanwhile, MWCNTs treated at high power (80 W) showed a reduction in oxygen functional groups in comparison with low RF power conditions. The Raman analysis was consistent with the XPS and FTIR results. The integrity of the nanotube patterns also remained damaged as observed by FE-SEM images. The MWCNTs treated in RF-DBD using the Ar/{{\\text{O}}2} plasma mixture showed improved dispersibility in deionized water. A correlation between the OES data and the observed surface characterization for an improved understanding of the functionalization of MWCNTs in Ar/{{\\text{O}}2} plasma was presented.

  14. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Science.gov (United States)

    Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong

    2017-01-01

    Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542

  15. Fatty Acid Synthase Modulates Intestinal Barrier Function through Palmitoylation of Mucin 2

    OpenAIRE

    Wei, Xiaochao; Yang, Zhen; Rey, Federico E.; Ridaura, Vanessa K.; Davidson, Nicholas O.; Gordon, Jeffrey I.; Semenkovich, Clay F.

    2012-01-01

    The intestinal mucus barrier prevents pathogen invasion and maintains host-microbiota homeostasis. We show that fatty acid synthase (FAS), an insulin-responsive enzyme essential for de novo lipogenesis, helps maintain the mucus barrier by regulating Mucin 2, the dominant mucin in the colon and a central component of mucus. Inducible Cre recombinase-directed inactivation of the FAS gene in the colonic epithelium of mice is associated with disruptions in the intestinal mucus barrier as well as ...

  16. Composite of microgels and lipids as biofilm to restore skin barrier function

    OpenAIRE

    Oudshoorn, M.H.M.

    2008-01-01

    The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential process for survival. In patients, the natural recovery is sometimes rather slow, in particular in the cases of large defects. To support skin regeneration, a large variety of skin creams is prese...

  17. Association between acute gastrointestinal injury and biomarkers of intestinal barrier function in critically ill patients.

    Science.gov (United States)

    Li, Hongxiang; Chen, Ying; Huo, Feifei; Wang, Yushan; Zhang, Dong

    2017-03-29

    To assess the associations of biomarkers of intestinal barrier function and other clinical variables with acute gastrointestinal injury (AGI) grade, and of these clinical variables with mortality in critically ill patients. This was a single-center, observational, prospective study. Patients were included if they were diagnosed with AGI and underwent tests for the measurement of plasma levels of intestinal fatty acid-binding protein (i-FABP), D-lactate (D-la), and lipopolysaccharide. General characteristics, AGI grades, Acute Physiology and Chronic Health Evaluation (APACHE) II scores, Sepsis-related Organ Failure Assessment (SOFA) scores, intra-abdominal pressure (IAP), and 28-day mortality were recorded and compared among patients with different AGI grades. Among the 90 included patients, the APACHE II score, IAP, and LPS and D-la levels significantly differed between the four AGI grades. Multinomial logistic regression analysis with grade I as the reference for grades II, III, and IV revealed that high APACHE II scores increased the odds of AGI grade III (odds ratio [OR], 1.754; 95% confidence interval [CI], 1.225-2.511) and grade IV (OR, 1.493; 95% CI, 1.079-2.066). Similarly, IAP increased the odds of AGI grade III (OR, 1.622; 95% CI, 1.111-2.369) and grade IV (OR, 1.518; 95% CI, 1.066-2.162). Elevated D-la increased the odds of AGI grades II (OR, 1.059; 95% CI, 1.005-1.117), III (OR, 1.155; 95% CI, 1.052-2.268), and IV (OR, 1.088; 95% CI, 1.013-1.168). In contrast, i-FABP and LPS did not increase the odds of any AGI grade. SOFA scores could independently predict the odds of death in AGI patients (OR, 1.223; 95% CI, 1.007-1.485). AGI patients exhibit loss of gastrointestinal barrier function, and D-la could serve as a better marker of AGI grade than i-FABP or lipopolysaccharide.

  18. Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.

    Science.gov (United States)

    Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B

    2017-11-01

    Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models (Villin-CreERT2;Klf5fl/fl designated as Klf5ΔIND and Villin-Cre;Klf5fl/fl as Klf5ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2, which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2, a gene encoding a major component of desmosome structures.NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function, which is

  19. Detecting subtle facial emotion recognition deficits in high-functioning Autism using dynamic stimuli of varying intensities.

    Science.gov (United States)

    Law Smith, Miriam J; Montagne, Barbara; Perrett, David I; Gill, Michael; Gallagher, Louise

    2010-07-01

    Autism Spectrum Disorders (ASD) are characterised by social and communication impairment, yet evidence for deficits in the ability to recognise facial expressions of basic emotions is conflicting. Many studies reporting no deficits have used stimuli that may be too simple (with associated ceiling effects), for example, 100% 'full-blown' expressions. In order to investigate subtle deficits in facial emotion recognition, 21 adolescent males with high-functioning Austism Spectrum Disorders (ASD) and 16 age and IQ matched typically developing control males completed a new sensitive test of facial emotion recognition which uses dynamic stimuli of varying intensities of expressions of the six basic emotions (Emotion Recognition Test; Montagne et al., 2007). Participants with ASD were found to be less accurate at processing the basic emotional expressions of disgust, anger and surprise; disgust recognition was most impaired--at 100% intensity and lower levels, whereas recognition of surprise and anger were intact at 100% but impaired at lower levels of intensity. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  20. Altered free radical metabolism in acute mountain sickness: implications for dynamic cerebral autoregulation and blood-brain barrier function

    DEFF Research Database (Denmark)

    Bailey, D M; Evans, K A; James, P E

    2008-01-01

    We tested the hypothesis that dynamic cerebral autoregulation (CA) and blood-brain barrier (BBB) function would be compromised in acute mountain sickness (AMS) subsequent to a hypoxia-mediated alteration in systemic free radical metabolism. Eighteen male lowlanders were examined in normoxia (21% O...

  1. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro

    NARCIS (Netherlands)

    Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de

    2005-01-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of

  2. MicroRNAs regulate tight junction proteins and modulate epithelial/endothelial barrier functions.

    Science.gov (United States)

    Cichon, Christoph; Sabharwal, Harshana; Rüter, Christian; Schmidt, M Alexander

    2014-01-01

    Tightly controlled epithelial and endothelial barriers are a prerequisite for life as these barriers separate multicellular organisms from their environment and serve as first lines of defense. Barriers between neighboring epithelial cells are formed by multiple intercellular junctions including the 'apical junctional complex-AJC' with tight junctions (TJ), adherens junctions (AJ), and desmosomes. TJ consist of tetraspan transmembrane proteins like occludin, various claudins that directly control paracellular permeability, and the 'Junctional Adhesion Molecules' (JAMs). For establishing tight barriers TJ are essential but at the same time have to allow also selective permeability. For this, TJ need to be tightly regulated and controlled. This is organized by a variety of adaptor molecules, i.e., protein kinases, phosphatases and GTPases, which in turn are regulated and fine-tuned involving microRNAs (miRNAs). In this review we summarize available data on the role and targeting of miRNAs in the maintenance of epithelial and/or endothelial barriers.

  3. Regulation of endothelial barrier function during flow-induced conversion to an arterial phenotype.

    Science.gov (United States)

    Seebach, Jochen; Donnert, Gerald; Kronstein, Romy; Werth, Sebastian; Wojciak-Stothard, Beata; Falzarano, Darryl; Mrowietz, Christof; Hell, Stefan W; Schnittler, Hans-J

    2007-08-01

    Flow-induced conversion of endothelial cells into an elongated arterial phenotype requires a coordinated regulation of cell junctions. Here we investigated the effect of acute and chronic flow on junction regulation. Using an extended experimental setup that allows analyses of endothelial barrier function under flow conditions, we found a flow-induced upregulation of the transendothelial electrical resistance within minutes. This was accompanied by an increase in actin filaments along the junctions and vascular endothelial (VE)-cadherin clustering, which was identified at nanoscale resolution by stimulated emission depletion microscopy. In addition, a transient tyrosine phosphorylation of VE-cadherin and catenins occurred within minutes following the onset of flow. VE-cadherin and actin distribution were maintained under chronic flow over 24 h and associated with the upregulation of VE-cadherin and alpha-catenin expression, thus compensating for the cell elongation-mediated increase in cell border length. Importantly, all observed effects were rac1 dependent as verified by the inhibitory effect of dominant negative N17rac1. These results show that flow-induced conversion of endothelial cells into an arterial phenotype occurs while intercellular junctions remain intact. The data place rac1 in a central multimodal regulatory position that might be important in the development of vascular diseases, such as arteriosclerosis.

  4. Exogenous lysozyme influences Clostridium perfringens colonization and intestinal barrier function in broiler chickens.

    Science.gov (United States)

    Liu, Dan; Guo, Yuming; Wang, Zhong; Yuan, Jianmin

    2010-02-01

    Necrotic enteritis is a worldwide poultry disease caused by the overgrowth of Clostridium perfringens in the small intestine. An experiment with a 2x2 factorial design (supplementation with or without 40 mg lysozyme/kg diet for chickens challenged with or without C. perfringens) was conducted to investigate the inhibitory efficacy of exogenous lysozyme against intestinal colonization by C. perfringens in chickens subject to oral inoculation of C. perfringens type A on days 17 to 20. The C. perfringens challenge resulted in significant increase of C. perfringens, Escherichia coli and Lactobacillus populations in the ileum, bacteria translocation to the spleen, the intestinal lesion scores , There was significantly lower intestinal lysozyme activity in the duodenum and jejunum and weight gain during days 14 to 28 of the experiment. The addition of exogenous lysozyme significantly reduced the concentration of C. perfringens in the ileum and the intestinal lesion scores, inhibited the overgrowth of E. coli and Lactobacillus in the ileum and intestinal bacteria translocation to the spleen, and improved intestinal lysozyme activity in the duodenum and the feed conversion ratio of chickens. These findings suggest that exogenous lysozyme could decrease C. perfringens colonization and improve intestinal barrier function and growth performance of chickens.

  5. The blood-brain barrier: structure, function and therapeutic approaches to cross it.

    Science.gov (United States)

    Tajes, Marta; Ramos-Fernández, Eva; Weng-Jiang, Xian; Bosch-Morató, Mònica; Guivernau, Biuse; Eraso-Pichot, Abel; Salvador, Bertrán; Fernàndez-Busquets, Xavier; Roquer, Jaume; Muñoz, Francisco J

    2014-08-01

    The blood-brain barrier (BBB) is constituted by a specialized vascular endothelium that interacts directly with astrocytes, neurons and pericytes. It protects the brain from the molecules of the systemic circulation but it has to be overcome for the proper treatment of brain cancer, psychiatric disorders or neurodegenerative diseases, which are dramatically increasing as the population ages. In the present work we have revised the current knowledge on the cellular structure of the BBB and the different procedures utilized currently and those proposed to cross it. Chemical modifications of the drugs, such as increasing their lipophilicity, turn them more prone to be internalized in the brain. Other mechanisms are the use of molecular tools to bind the drugs such as small immunoglobulins, liposomes or nanoparticles that will act as Trojan Horses favoring the drug delivery in brain. This fusion of the classical pharmacology with nanotechnology has opened a wide field to many different approaches with promising results to hypothesize that BBB will not be a major problem for the new generation of neuroactive drugs. The present review provides an overview of all state-of-the-art of the BBB structure and function, as well as of the classic strategies and these appeared in recent years to deliver drugs into the brain for the treatment of Central Nervous System (CNS) diseases.

  6. Macleaya cordata Extract Decreased Diarrhea Score and Enhanced Intestinal Barrier Function in Growing Piglets

    Directory of Open Access Journals (Sweden)

    Gang Liu

    2016-01-01

    Full Text Available Macleaya cordata extract is of great scientific and practical interest to researchers, due to its antimicrobial and anti-inflammatory responses within experimental animals. This study was designed to determine the diarrhea score and innate immunity of growing piglets after they had received Macleaya cordata extract supplements. A total of 240 growing pigs were randomly assigned to one of three dietary treatments, with 8 replicates per treatment and 10 piglets per replicate. All pigs received a basal diet containing similar amounts of nutrients. The three treatments were a control (no additive, an antibiotic (200 mg/kg colistin, and the Macleaya cordata extract supplement group (40 mg/kg Macleaya cordata extract. The diarrhea score was calculated after D 28. The jejunal samples were obtained from five piglets selected randomly from each treatment on D 28. In comparison with the control group, the dietary Macleaya cordata extract and colistin group demonstrated a substantially decreased diarrhea score. The introduction of Macleaya cordata extract supplements to the diet significantly increased volumes of ZO-1 and claudin-1, particularly in comparison with the pigs in the control group (P<0.05. The findings indicate that Macleaya cordata extract does enhance intestinal barrier function in growing piglets and that it could be used as a viable substitute for antibiotics.

  7. Entamoeba histolytica contains an occludin-like protein that can alter colonic epithelial barrier function.

    Directory of Open Access Journals (Sweden)

    Michael Goplen

    Full Text Available The exact mechanism by which Entamoeba histolytica disrupts the human colonic epithelium and invades the mucosa has yet to be clearly elucidated. E. histolytica produces a diverse array of putative virulent factors such as glycosidase, cysteine proteinases and amebapore that can modulate and/or disrupt epithelial barrier functions. However, it is currently thought that E. histolytica produces numerous other molecules and strategies to disrupt colonic mucosal defenses. In this study, we document a putative mechanism whereby the parasite alters the integrity of human epithelium by expressing a cognate tight junction protein of the host. We detected this protein as "occludin-like" as revealed by immunoblotting and immunoprecipitation studies and visualization by confocal microscopy using antibodies highly specific for human occludin. We propose that E. histolytica occludin-like protein might displace mucosal epithelial occludin-occludin tight junction interactions resulting in epithelial disruption analogous to sub mucosal human dendritic cells sampling luminal contents. These results indicate that E. histolytica occludin is a putative virulent component that can play a role in the pathogenesis of intestinal amebiasis.

  8. Excitotoxicity triggered by neonatal monosodium glutamate treatment and blood-brain barrier function.

    Science.gov (United States)

    Gudiño-Cabrera, Graciela; Ureña-Guerrero, Monica E; Rivera-Cervantes, Martha C; Feria-Velasco, Alfredo I; Beas-Zárate, Carlos

    2014-11-01

    It is likely that monosodium glutamate (MSG) is the excitotoxin that has been most commonly employed to characterize the process of excitotoxicity and to improve understanding of the ways that this process is related to several pathological conditions of the central nervous system. Excitotoxicity triggered by neonatal MSG treatment produces a significant pathophysiological impact on adulthood, which could be due to modifications in the blood-brain barrier (BBB) permeability and vice versa. This mini-review analyzes this topic through brief descriptions about excitotoxicity, BBB structure and function, role of the BBB in the regulation of Glu extracellular levels, conditions that promote breakdown of the BBB, and modifications induced by neonatal MSG treatment that could alter the behavior of the BBB. In conclusion, additional studies to better characterize the effects of neonatal MSG treatment on excitatory amino acids transporters, ionic exchangers, and efflux transporters, as well as the role of the signaling pathways mediated by erythropoietin and vascular endothelial growth factor in the cellular elements of the BBB, should be performed to identify the mechanisms underlying the increase in neurovascular permeability associated with excitotoxicity observed in several diseases and studied using neonatal MSG treatment. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

  9. Macroporous silicon chips for laterally resolved, multi-parametric analysis of epithelial barrier function.

    Science.gov (United States)

    Michaelis, Stefanie; Rommel, Christina E; Endell, Jan; Göring, Petra; Wehrspohn, Ralf; Steinem, Claudia; Janshoff, Andreas; Galla, Hans-Joachim; Wegener, Joachim

    2012-07-07

    This study describes a novel assay to visualize the macromolecular permeability of epithelial and endothelial cell layers with subcellular lateral resolution. Defects within the cell layer and details about the permeation route of the migrating solute are revealed. The assay is based on silicon chips with densely packed, highly ordered, dead-ended pores of μm-diameters on one side. The cells under study are grown on the porous side of the chip such that the pores in the growth surface serve as an array of femtolitre-sized cuvettes in which the permeating probe accumulates at the site of permeation. The pattern of pore filling reveals the permeability characteristics of the cell layer with a lateral resolution in the μm range. Coating of the chip surface with a thin layer of gold allows for impedance analysis of the adherent cells in order to measure their tightness for inorganic ions at the same time. The new assay provides an unprecedented look on epithelial and endothelial barrier function.

  10. I. Fission Probabilities, Fission Barriers, and Shell Effects. II. Particle Structure Functions

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Kexing [Univ. of California, Berkeley, CA (United States)

    1999-05-01

    In Part I, fission excitation functions of osmium isotopes 185,186, 187, 189 Os produced in 3He +182,183, 184, 186W reactions, and of polonium isotopes 209,210, 211, 212Po produced in 3He/4He + 206, 207, 208Pb reactions, were measured with high precision. These excitation functions have been analyzed in detail based upon the transition state formalism. The fission barriers, and shell effects for the corresponding nuclei are extracted from the detailed analyses. A novel approach has been developed to determine upper limits of the transient time of the fission process. The upper limits are constrained by the fission probabilities of neighboring isotopes. The upper limits for the transient time set with this new method are 15x 10–21 sec and 25x 10–21 sec for 0s and Po compound nuclei, respectively. In Part II, we report on a search for evidence of the optical modulations in the energy spectra of alpha particles emitted from hot compound nuclei. The optical modulations are expected to arise from the ~-particle interaction with the rest of the nucleus as the particle prepares to exit. Some evidence for the modulations has been observed in the alpha spectra measured in the 3He-induced reactions, 3He + natAg in particular. The identification of the modulations involves a technique that subtracts the bulk statistical background from the measured alpha spectra, in order for the modulations to become visible in the residuals. Due to insufficient knowledge of the background spectra, however, the presented evidence should only be regarded as preliminary and tentative.

  11. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2017-07-21

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA+ cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  12. Double-stranded RNA attenuates the barrier function of human pulmonary artery endothelial cells.

    Directory of Open Access Journals (Sweden)

    Zoltán Bálint

    Full Text Available Circulating RNA may result from excessive cell damage or acute viral infection and can interact with vascular endothelial cells. Despite the obvious clinical implications associated with the presence of circulating RNA, its pathological effects on endothelial cells and the governing molecular mechanisms are still not fully elucidated. We analyzed the effects of double stranded RNA on primary human pulmonary artery endothelial cells (hPAECs. The effect of natural and synthetic double-stranded RNA (dsRNA on hPAECs was investigated using trans-endothelial electric resistance, molecule trafficking, calcium (Ca(2+ homeostasis, gene expression and proliferation studies. Furthermore, the morphology and mechanical changes of the cells caused by synthetic dsRNA was followed by in-situ atomic force microscopy, by vascular-endothelial cadherin and F-actin staining. Our results indicated that exposure of hPAECs to synthetic dsRNA led to functional deficits. This was reflected by morphological and mechanical changes and an increase in the permeability of the endothelial monolayer. hPAECs treated with synthetic dsRNA accumulated in the G1 phase of the cell cycle. Additionally, the proliferation rate of the cells in the presence of synthetic dsRNA was significantly decreased. Furthermore, we found that natural and synthetic dsRNA modulated Ca(2+ signaling in hPAECs by inhibiting the sarco-endoplasmic Ca(2+-ATPase (SERCA which is involved in the regulation of the intracellular Ca(2+ homeostasis and thus cell growth. Even upon synthetic dsRNA stimulation silencing of SERCA3 preserved the endothelial monolayer integrity. Our data identify novel mechanisms by which dsRNA can disrupt endothelial barrier function and these may be relevant in inflammatory processes.

  13. The PTEN phosphatase controls intestinal epithelial cell polarity and barrier function: role in colorectal cancer progression.

    Directory of Open Access Journals (Sweden)

    Marie-Josée Langlois

    2010-12-01

    Full Text Available The PTEN phosphatase acts on phosphatidylinositol 3,4,5-triphosphates resulting from phosphatidylinositol 3-kinase (PI3K activation. PTEN expression has been shown to be decreased in colorectal cancer. Little is known however as to the specific cellular role of PTEN in human intestinal epithelial cells. The aim of this study was to investigate the role of PTEN in human colorectal cancer cells.Caco-2/15, HCT116 and CT26 cells were infected with recombinant lentiviruses expressing a shRNA specifically designed to knock-down PTEN. The impact of PTEN downregulation was analyzed on cell polarization and differentiation, intercellular junction integrity (expression of cell-cell adhesion proteins, barrier function, migration (wound assay, invasion (matrigel-coated transwells and on tumor and metastasis formation in mice. Electron microscopy analysis showed that lentiviral infection of PTEN shRNA significantly inhibited Caco-2/15 cell polarization, functional differentiation and brush border development. A strong reduction in claudin 1, 3, 4 and 8 was also observed as well as a decrease in transepithelial resistance. Loss of PTEN expression increased the spreading, migration and invasion capacities of colorectal cancer cells in vitro. PTEN downregulation also increased tumor size following subcutaneous injection of colorectal cancer cells in nude mice. Finally, loss of PTEN expression in HCT116 and CT26, but not in Caco-2/15, led to an increase in their metastatic potential following tail-vein injections in mice.Altogether, these results indicate that PTEN controls cellular polarity, establishment of cell-cell junctions, paracellular permeability, migration and tumorigenic/metastatic potential of human colorectal cancer cells.

  14. Aggressive Antioxidant Reductive Stress Impairs Brain Endothelial Cell Angiogenesis and Blood Brain Barrier Function.

    Science.gov (United States)

    Mentor, Shireen; Fisher, David

    2017-01-01

    Oxidative stress in the brain microvasculature is a common characteristic in models of cerebrovascular disease. Considering the effects of reactive oxygen species activity in vascular-derived insults, it is naturally prudent to hypothesize those interventions inhibiting reactive oxygen species activity, such as antioxidant supplementation, may be beneficial for cerebrovascular disease. Hyper doses of antioxidant supplements, and foods with high antioxidant concentrations, are commonly used as an ongoing remedial and 'over-the-counter' treatments for most seasonal ailments. For the first time, this study reports the adverse effects of excess antioxidants on angiogenic properties of the blood-brain barrier (BBB) which have clinical implications. A medicinal tea, known as Rooibos, commonly used in South Africa and marketed globally, for its prominent antioxidant profile, demonstrated its effects on brain endothelial cellular proliferation, toxicology, mitochondrial activity and permeability. Mouse brain endothelial cells were seeded at cell densities ranging from 103-106 cells/ml and were incubated at pre-determined time intervals of 24 to120 hours. Daily exposure of a selected concentration range of fermented Rooibos tea caused dose-related decreases in cellular proliferation, and unequivocally decreased permeability across our in vitro BBB model. Despite the negative effects on cellular proliferation, no toxicity was observed for all selected fermented Rooibos concentrations. Our data conclusively shows that the use of excess antioxidants perturbs BBB functionality and angiogenic properties, adversely implicating the homeostatic regulation of the brain microenvironment, while suppression in cellular proliferation impacts both the maintenance and repair function of brain capillaries. Our study indicates that excess antioxidants will lead to an impaired response to mechanical-induced injury and pathogenic infection of the BBB, compromising patient recovery. Copyright

  15. Enhancement of tight junctional barrier function by micronutrients: compound-specific effects on permeability and claudin composition.

    Directory of Open Access Journals (Sweden)

    Joanna Mercado

    Full Text Available Amid an increasing number of reports in the literature concerning epithelial barrier enhancement by various nutrient compounds, there has never been a study performing side-by-side comparisons of these agents in a single epithelial model. We compare five nutrient compounds (previously reported in various epithelial models to enhance barrier function regarding their ability to increase transepithelial electrical resistance (R(t and decrease transepithelial mannitol permeability (J(m across LLC-PK₁ renal epithelial cell layers. The effects of these nutrients on the abundance of various tight junctional proteins are also compared. In the overall group of nutrients tested--zinc, indole, quercetin, butyrate and nicotine--only nicotine failed to improve barrier function by either parameter. Nicotine also was without effect on tight junctional proteins. Quercetin simultaneously increased R(t and decreased J(m. Zinc, butyrate and indole only exhibited statistically significant enhancement of R(t. Each of these four effective nutrient compounds had unique patterns of effects on the panel of tight junctional proteins studied. No two compounds produced the same pattern of effects. This unique pattern of effects on tight junctional complex composition by each compound establishes the chance for additive or even synergistic improvement of barrier function by combinations of compounds. A synergistic effect of the combination of quercetin and zinc on R(t is shown.

  16. Addressing barriers to eco-innovation: Exploring the finance mobilisation functions of institutional innovation intermediaries

    NARCIS (Netherlands)

    Polzin, Friedemann; Flotow, von Paschen; Klerkx, L.W.A.

    2016-01-01

    This research article explores the role of institutional innovation intermediaries in accelerating the commercialisation of (clean) technologies. Drawing on the finance and innovation intermediaries literatures, we show that financial barriers to eco-innovation can be partly overcome by particular

  17. Stress plays provoking role in hypertension-related stroke: injuries of blood-brain barrier function

    Science.gov (United States)

    Semyachkina-Glushkovskaya, O.; Shirokov, A.; Gekalyuk, A.; Abakumov, M.; Navolokin, N.; Abdurashitov, A.; Pavlov, A.; Ulanova, M.; Fedorova, V.; Razubaeva, V.; Saranceva, E.; Li, P.; Huang, Q.; Zhu, D.; Luo, Q.; Tuchin, V.; Kurths, J.

    2017-02-01

    Chronic hypertension itself does not cause stroke but significantly decreases the resistant to stroke induced by stress due to exhausting of adaptive capacity of cerebral endothelium and decrease resistance of blood-brain barrier to stress.

  18. Pilot study of lithium to restore intestinal barrier function in severe graft-versus-host disease

    NARCIS (Netherlands)

    Steinbach, G.; Hockenbery, D.M.; Huls, G.A.; Furlong, T.; Myerson, D.; Loeb, K.R.; Fann, J.R.; Castilla-Llorente, C.; McDonald, G.B.; Martin, P.J.

    2017-01-01

    Severe intestinal graft-vs-host disease (GVHD) after allogeneic hematopoietic cell transplantation (HCT) causes mucosal ulceration and induces innate and adaptive immune responses that amplify and perpetuate GVHD and the associated barrier dysfunction. Pharmacological agents to target mucosal

  19. Ambipolar MoS2 Transistors by Nanoscale Tailoring of Schottky Barrier Using Oxygen Plasma Functionalization.

    Science.gov (United States)

    Giannazzo, Filippo; Fisichella, Gabriele; Greco, Giuseppe; Di Franco, Salvatore; Deretzis, Ioannis; La Magna, Antonino; Bongiorno, Corrado; Nicotra, Giuseppe; Spinella, Corrado; Scopelliti, Michelangelo; Pignataro, Bruno; Agnello, Simonpietro; Roccaforte, Fabrizio

    2017-07-12

    One of the main challenges to exploit molybdenum disulfide (MoS2) potentialities for the next-generation complementary metal oxide semiconductor (CMOS) technology is the realization of p-type or ambipolar field-effect transistors (FETs). Hole transport in MoS2 FETs is typically hampered by the high Schottky barrier height (SBH) for holes at source/drain contacts, due to the Fermi level pinning close to the conduction band. In this work, we show that the SBH of multilayer MoS2 surface can be tailored at nanoscale using soft O2 plasma treatments. The morphological, chemical, and electrical modifications of MoS2 surface under different plasma conditions were investigated by several microscopic and spectroscopic characterization techniques, including X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), conductive AFM (CAFM), aberration-corrected scanning transmission electron microscopy (STEM), and electron energy loss spectroscopy (EELS). Nanoscale current-voltage mapping by CAFM showed that the SBH maps can be conveniently tuned starting from a narrow SBH distribution (from 0.2 to 0.3 eV) in the case of pristine MoS2 to a broader distribution (from 0.2 to 0.8 eV) after 600 s O2 plasma treatment, which allows both electron and hole injection. This lateral inhomogeneity in the electrical properties was associated with variations of the incorporated oxygen concentration in the MoS2 multilayer surface, as shown by STEM/EELS analyses and confirmed by ab initio density functional theory (DFT) calculations. Back-gated multilayer MoS2 FETs, fabricated by self-aligned deposition of source/drain contacts in the O2 plasma functionalized areas, exhibit ambipolar current transport with on/off current ratio Ion/Ioff ≈ 10(3) and field-effect mobilities of 11.5 and 7.2 cm(2) V(-1) s(-1) for electrons and holes, respectively. The electrical behavior of these novel ambipolar devices is discussed in terms of the peculiar current injection mechanisms in the O2 plasma

  20. The relative balance of GM-CSF and TGF-β1 regulates lung epithelial barrier function.

    Science.gov (United States)

    Overgaard, Christian E; Schlingmann, Barbara; Dorsainvil White, StevenClaude; Ward, Christina; Fan, Xian; Swarnakar, Snehasikta; Brown, Lou Ann S; Guidot, David M; Koval, Michael

    2015-06-15

    Lung barrier dysfunction is a cardinal feature of the acute respiratory distress syndrome (ARDS). Alcohol abuse, which increases the risk of ARDS two- to fourfold, induces transforming growth factor (TGF)-β1, which increases epithelial permeability and impairs granulocyte/macrophage colony-stimulating factor (GM-CSF)-dependent barrier integrity in experimental models. We hypothesized that the relative balance of GM-CSF and TGF-β1 signaling regulates lung epithelial barrier function. GM-CSF and TGF-β1 were tested separately and simultaneously for their effects on lung epithelial cell barrier function in vitro. TGF-β1 alone caused an ∼ 25% decrease in transepithelial resistance (TER), increased paracellular flux, and was associated with projections perpendicular to tight junctions ("spikes") containing claudin-18 that colocalized with F-actin. In contrast, GM-CSF treatment induced an ∼ 20% increase in TER, decreased paracellular flux, and showed decreased colocalization of spike-associated claudin-18 with F-actin. When simultaneously administered to lung epithelial cells, GM-CSF antagonized the effects of TGF-β1 on epithelial barrier function in cultured cells. Given this, GM-CSF and TGF-β1 levels were measured in bronchoalveolar lavage (BAL) fluid from patients with ventilator-associated pneumonia and correlated with markers for pulmonary edema and patient outcome. In patient BAL fluid, protein markers of lung barrier dysfunction, serum α2-macroglobulin, and IgM levels were increased at lower ratios of GM-CSF/TGF-β1. Critically, patients who survived had significantly higher GM-CSF/TGF-β1 ratios than nonsurviving patients. This study provides experimental and clinical evidence that the relative balance between GM-CSF and TGF-β1 signaling is a key regulator of lung epithelial barrier function. The GM-CSF/TGF-β1 ratio in BAL fluid may provide a concentration-independent biomarker that can predict patient outcomes in ARDS. Copyright © 2015 the American

  1. The Cullin-3-Rbx1-KCTD10 complex controls endothelial barrier function via K63 ubiquitination of RhoB.

    Science.gov (United States)

    Kovačević, Igor; Sakaue, Tomohisa; Majoleé, Jisca; Pronk, Manon C; Maekawa, Masashi; Geerts, Dirk; Fernandez-Borja, Mar; Higashiyama, Shigeki; Hordijk, Peter L

    2018-01-22

    RhoGTPases control endothelial cell (EC) migration, adhesion, and barrier formation. Whereas the relevance of RhoA for endothelial barrier function is widely accepted, the role of the RhoA homologue RhoB is poorly defined. RhoB and RhoA are 85% identical, but RhoB's subcellular localization and half-life are uniquely different. Here, we studied the role of ubiquitination for the function and stability of RhoB in primary human ECs. We show that the K63 polyubiquitination at lysine 162 and 181 of RhoB targets the protein to lysosomes. Moreover, we identified the RING E3 ligase complex Cullin-3-Rbx1-KCTD10 as key modulator of endothelial barrier integrity via its regulation of the ubiquitination, localization, and activity of RhoB. In conclusion, our data show that ubiquitination controls the subcellular localization and lysosomal degradation of RhoB and thereby regulates the stability of the endothelial barrier through control of RhoB-mediated EC contraction. © 2018 Kovačević et al.

  2. Barrier creams: facts and controversies.

    Science.gov (United States)

    Corazza, Monica; Minghetti, Sara; Bianchi, Anna; Virgili, Annarosa; Borghi, Alessandro

    2014-01-01

    Barrier creams (BCs) represent devices aiming to protect the skin from contact with exogenous hazardous substances, especially under working conditions. By preventing penetration and absorption of contaminants, BCs are designed to reduce the risk of developing both irritant and allergic contact dermatitis. In fact, BCs should improve stratum corneum hydration as well as provide emolliency to maintain skin integrity and to restore and repair the epidermis barrier function. The formulation and ingredients of the available BCs vary widely, and thus the choice of a BC should depend on the kind of contaminants, occupational conditions, and skin dysfunction. Although BCs are commonly recommended to prevent occupational contact dermatitis, their real benefit remains controversial. The aims of this review are to help the choice of appropriate BCs and to analyze the actual effectiveness in maintaining an intact skin barrier, preventing contact dermatitis, and speeding up the healing of barrier-impaired skin.

  3. Glycoprotein A33 deficiency: a new mouse model of impaired intestinal epithelial barrier function and inflammatory disease

    Directory of Open Access Journals (Sweden)

    Benjamin B. Williams

    2015-08-01

    Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms

  4. The functions of grainy head-like proteins in animals and fungi and the evolution of apical extracellular barriers.

    Directory of Open Access Journals (Sweden)

    Adam Paré

    Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.

  5. Functionally gradient materials for thermal barrier coatings in advanced gas turbine systems

    Energy Technology Data Exchange (ETDEWEB)

    Banovic, S.W.; Barmak, K.; Chan, H.M. [Lehigh Univ., Bethlehem, PA (United States)] [and others

    1995-10-01

    New designs for advanced gas turbine engines for power production are required to have higher operating temperatures in order to increase efficiency. However, elevated temperatures will increase the magnitude and severity of environmental degradation of critical turbine components (e.g. combustor parts, turbine blades, etc{hor_ellipsis}). To offset this problem, the usage of thermal barrier coatings (TBCs) has become popular by allowing an increase in maximum inlet temperatures for an operating engine. Although thermal barrier technology is over thirty years old, the principle failure mechanism is the spallation of the ceramic coating at or near the ceramic/bond coat interface. Therefore, it is desirable to develop a coating that combines the thermal barrier qualities of the ceramic layer and the corrosion protection by the metallic bond coat without the detrimental effects associated with the localization of the ceramic/metal interface to a single plane.

  6. Probabilistic migration modelling focused on functional barrier efficiency and low migration concepts in support of risk assessment.

    Science.gov (United States)

    Brandsch, Rainer

    2017-10-01

    Migration modelling provides reliable migration estimates from food-contact materials (FCM) to food or food simulants based on mass-transfer parameters like diffusion and partition coefficients related to individual materials. In most cases, mass-transfer parameters are not readily available from the literature and for this reason are estimated with a given uncertainty. Historically, uncertainty was accounted for by introducing upper limit concepts first, turning out to be of limited applicability due to highly overestimated migration results. Probabilistic migration modelling gives the possibility to consider uncertainty of the mass-transfer parameters as well as other model inputs. With respect to a functional barrier, the most important parameters among others are the diffusion properties of the functional barrier and its thickness. A software tool that accepts distribution as inputs and is capable of applying Monte Carlo methods, i.e., random sampling from the input distributions of the relevant parameters (i.e., diffusion coefficient and layer thickness), predicts migration results with related uncertainty and confidence intervals. The capabilities of probabilistic migration modelling are presented in the view of three case studies (1) sensitivity analysis, (2) functional barrier efficiency and (3) validation by experimental testing. Based on the predicted migration by probabilistic migration modelling and related exposure estimates, safety evaluation of new materials in the context of existing or new packaging concepts is possible. Identifying associated migration risk and potential safety concerns in the early stage of packaging development is possible. Furthermore, dedicated material selection exhibiting required functional barrier efficiency under application conditions becomes feasible. Validation of the migration risk assessment by probabilistic migration modelling through a minimum of dedicated experimental testing is strongly recommended.

  7. Soil moisture and ecosystem function responses of desert grassland varying in vegetative cover to a saturating precipitation pulse

    Science.gov (United States)

    A critical linkage between hydrological and ecological processes is plant cover, yet the ecosystem-level responses of aridland systems of varying plant cover to extreme precipitation events, predicted to increase in number and severity in the future, has not been well studied. We tracked average ro...

  8. Acne Vulgaris and the Epidermal Barrier: Is Acne Vulgaris Associated with Inherent Epidermal Abnormalities that Cause Impairment of Barrier Functions? Do Any Topical Acne Therapies Alter the Structural and/or Functional Integrity of the Epidermal Barrier?

    OpenAIRE

    Thiboutot, Diane; Del Rosso, James Q.

    2013-01-01

    Acne vulgaris is a common dermatological disorder that predominantly affects teenagers, but can also affect preadolescents and post-teen individuals. Despite the fact that acne vulgaris is the most common skin disorder encountered in ambulatory dermatology practice in the United States, there has been limited research on the epidermal permeability barrier in untreated skin of people with acne vulgaris and also after use of acne therapies. This article reviews the research results and discusse...

  9. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    DEFF Research Database (Denmark)

    Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

    2010-01-01

    Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now,...

  10. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

    Science.gov (United States)

    van Smeden, Jeroen; Bouwstra, Joke A

    2016-01-01

    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  11. Studying the varied shapes of gold clusters by an elegant optimization algorithm that hybridizes the density functional tight-binding theory and the density functional theory

    Science.gov (United States)

    Yen, Tsung-Wen; Lim, Thong-Leng; Yoon, Tiem-Leong; Lai, S. K.

    2017-11-01

    We combined a new parametrized density functional tight-binding (DFTB) theory (Fihey et al. 2015) with an unbiased modified basin hopping (MBH) optimization algorithm (Yen and Lai 2015) and applied it to calculate the lowest energy structures of Au clusters. From the calculated topologies and their conformational changes, we find that this DFTB/MBH method is a necessary procedure for a systematic study of the structural development of Au clusters but is somewhat insufficient for a quantitative study. As a result, we propose an extended hybridized algorithm. This improved algorithm proceeds in two steps. In the first step, the DFTB theory is employed to calculate the total energy of the cluster and this step (through running DFTB/MBH optimization for given Monte-Carlo steps) is meant to efficiently bring the Au cluster near to the region of the lowest energy minimum since the cluster as a whole has explicitly considered the interactions of valence electrons with ions, albeit semi-quantitatively. Then, in the second succeeding step, the energy-minimum searching process will continue with a skilledly replacement of the energy function calculated by the DFTB theory in the first step by one calculated in the full density functional theory (DFT). In these subsequent calculations, we couple the DFT energy also with the MBH strategy and proceed with the DFT/MBH optimization until the lowest energy value is found. We checked that this extended hybridized algorithm successfully predicts the twisted pyramidal structure for the Au40 cluster and correctly confirms also the linear shape of C8 which our previous DFTB/MBH method failed to do so. Perhaps more remarkable is the topological growth of Aun: it changes from a planar (n =3-11) → an oblate-like cage (n =12-15) → a hollow-shape cage (n =16-18) and finally a pyramidal-like cage (n =19, 20). These varied forms of the cluster's shapes are consistent with those reported in the literature.

  12. Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

    2008-09-29

    Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

  13. Functional Brain Organization of Working Memory in Adolescents Varies in Relation to Family Income and Academic Achievement

    Science.gov (United States)

    Finn, Amy S.; Minas, Jennifer E.; Leonard, Julia A.; Mackey, Allyson P.; Salvatore, John; Goetz, Calvin; West, Martin R.; Gabrieli, Christopher F. O.; Gabrieli, John D. E.

    2017-01-01

    Working memory (WM) capacity reflects executive functions associated with performance on a wide range of cognitive tasks and education outcomes, including mathematics achievement, and is associated with dorsolateral prefrontal and parietal cortices. Here we asked if family income is associated with variation in the functional brain organization of…

  14. Integrating Robot Support Functions into Varied Activities at Returning Hospital Visits: Supporting Child’s Self-Management of Diabetes

    NARCIS (Netherlands)

    Looije, L.; Neerincx, M.A.; Peters, J.K.; Blanson Henkemans, O.

    2016-01-01

    Persistent progress in the self-management of their disease is important and challenging for children with diabetes. The European ALIZ-e project developed and tested a set of core functions for a social robot that may help to establish such progress. These functions were studied in different set-ups

  15. Role of functionally dominant species in varying environmental regimes: evidence for the performance-enhancing effect of biodiversity

    Directory of Open Access Journals (Sweden)

    Langenheder Silke

    2012-07-01

    Full Text Available Abstract Background Theory suggests that biodiversity can act as a buffer against disturbances and environmental variability via two major mechanisms: Firstly, a stabilising effect by decreasing the temporal variance in ecosystem functioning due to compensatory processes; and secondly, a performance enhancing effect by raising the level of community response through the selection of better performing species. Empirical evidence for the stabilizing effect of biodiversity is readily available, whereas experimental confirmation of the performance-enhancing effect of biodiversity is sparse. Results Here, we test the effect of different environmental regimes (constant versus fluctuating temperature on bacterial biodiversity-ecosystem functioning relations. We show that positive effects of species richness on ecosystem functioning are enhanced by stronger temperature fluctuations due to the increased performance of individual species. Conclusions Our results provide evidence for the performance enhancing effect and suggest that selection towards functionally dominant species is likely to benefit the maintenance of ecosystem functioning under more variable conditions.

  16. Role of functionally dominant species in varying environmental regimes: evidence for the performance-enhancing effect of biodiversity.

    Science.gov (United States)

    Langenheder, Silke; Bulling, Mark T; Prosser, James I; Solan, Martin

    2012-07-30

    Theory suggests that biodiversity can act as a buffer against disturbances and environmental variability via two major mechanisms: Firstly, a stabilising effect by decreasing the temporal variance in ecosystem functioning due to compensatory processes; and secondly, a performance enhancing effect by raising the level of community response through the selection of better performing species. Empirical evidence for the stabilizing effect of biodiversity is readily available, whereas experimental confirmation of the performance-enhancing effect of biodiversity is sparse. Here, we test the effect of different environmental regimes (constant versus fluctuating temperature) on bacterial biodiversity-ecosystem functioning relations. We show that positive effects of species richness on ecosystem functioning are enhanced by stronger temperature fluctuations due to the increased performance of individual species. Our results provide evidence for the performance enhancing effect and suggest that selection towards functionally dominant species is likely to benefit the maintenance of ecosystem functioning under more variable conditions.

  17. A dosing algorithm for metformin based on the relationships between exposure and renal clearance of metformin in patients with varying degrees of kidney function

    NARCIS (Netherlands)

    Duong, Janna K.; Kroonen, M. Y. A. M.; Kumar, S. S.; Heerspink, H. L.; Kirkpatrick, C. M.; Graham, G. G.; Williams, K. M.; Day, R. O.

    The aims of this study were to investigate the relationship between metformin exposure, renal clearance (CLR), and apparent non-renal clearance of metformin (CLNR/F) in patients with varying degrees of kidney function and to develop dosing recommendations. Plasma and urine samples were collected

  18. Functional nanoparticles exploit the bile acid pathway to overcome multiple barriers of the intestinal epithelium for oral insulin delivery

    DEFF Research Database (Denmark)

    Fan, Weiwei; Xia, Dengning; Zhu, Quanlei

    2018-01-01

    Oral absorption of protein/peptide-loaded nanoparticles is often limited by multiple barriers of the intestinal epithelium. In addition to mucus translocation and apical endocytosis, highly efficient transepithelial absorption of nanoparticles requires successful intracellular trafficking......, especially to avoid lysosomal degradation, and basolateral release. Here, the functional material, deoxycholic acid-conjugated chitosan, is synthesized and loaded with the model protein drug insulin into deoxycholic acid-modified nanoparticles (DNPs). The DNPs designed in this study are demonstrated...... to overcome multiple barriers of the intestinal epithelium by exploiting the bile acid pathway. In Caco-2 cell monolayers, DNPs are internalized via apical sodium-dependent bile acid transporter (ASBT)-mediated endocytosis. Interestingly, insulin degradation in the epithelium is significantly prevented due...

  19. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model

    OpenAIRE

    Gschwandtner, M; Mildner, M.; Mlitz, V; Gruber, F; Eckhart, L; Werfel, T.; Gutzmer, R.; Elias, P M; Tschachler, E.

    2012-01-01

    Background Defects in keratinocyte differentiation and skin barrier are important features of inflammatory skin diseases like atopic dermatitis. Mast cells and their main mediator histamine are abundant in inflamed skin and thus may contribute to disease pathogenesis. Methods Human primary keratinocytes were cultured under differentiation-promoting conditions in the presence and absence of histamine, histamine receptor agonists and antagonists. The expression of differentiation-associated gen...

  20. Biophysical and ion channel functional characterization of the Torpedo californica nicotinic acetylcholine receptor in varying detergent-lipid environments.

    Science.gov (United States)

    Asmar-Rovira, Guillermo A; Asseo-García, Aloysha M; Quesada, Orestes; Hanson, Michael A; Cheng, Anchi; Nogueras, Carlos; Lasalde-Dominicci, José A; Stevens, Raymond C

    2008-05-01

    The nicotinic acetylcholine receptor (nAChR) of Torpedo electric rays has been extensively characterized over the last three decades. However, high-resolution structural studies have been hampered by the lack of mechanistic molecular models that describe how detergents influence membrane protein stability and function. Furthermore, elucidation of the dynamic detergent-lipid-protein interactions of solubilized membrane proteins is a largely unexplored research field. This study examines the effects of nine detergents on: (1) nAChR-lipid composition (gas chromatography with flame ionization; GC-FID and/or mass selective detectors; GC-MSD), (2) stability and aggregation state (analytical size exclusion chromatography; A-SEC and electron microscopy; EM) and (3) ion channel function (planar lipid bilayers). Detergent solubilization of nAChR-enriched membranes did not result in significant native lipid depletion or destabilization. Upon purification, native lipid depletion occurred in all detergents, with lipid-analogue detergents CHAPS {(3-[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate}, FC-12 (n-dodecylphosphocholine) and sodium cholate (3alpha,7alpha,12alpha-trihydroxy-5beta-cholan-24-oic acid) maintaining stability and supporting ion channel function, and non-lipid-analogue detergents Cymal-6 (6-cyclohexyl-1-hexyl-beta-D-maltoside), DDM (n-dodecyl-beta-D-maltopyranoside), LDAO (lauryldimethylamine-N-oxide) and OG (n-octyl-beta-d-glucopyranoside) decreasing stability and significantly reducing or completely suppressing ion channel function. Anapoe-C(12)E(9 )(polyoxyethylene-[9]-dodecyl ether) and BigCHAP (N,N'-bis-[3-d-gluconamidopropyl] cholamide) retained residual amounts of native lipid, maintaining moderate stability and ion channel function compared to lipid-analogue detergents. Therefore, the nAChR can be stable and functional in lipid-analogue detergents or in detergents that retain moderate amounts of residual native lipids, but not in non

  1. Influence of puerarin, paeoniflorin, and menthol on structure and barrier function of tight junctions in MDCK and MDCK-MDR1 Cells

    Directory of Open Access Journals (Sweden)

    Lin Zhang

    2015-04-01

    Conclusion: Menthol but not puerarin and paeoniflorin may enhance paracellular transport and improve drug penetration of the BBB by disrupting the structure and, thereby, weakening the barrier function of TJs.

  2. Functional, interactive and critical health literacy: Varying relationships with control over care and number of GP visits

    NARCIS (Netherlands)

    van der Heide, I.; Heijmans, M.; Schuit, A.J.; Uiters, E.; Rademakers, J.

    2015-01-01

    Objective: The aim of this study is to examine the extent to which functional, interactive and critical health literacy are associated with patients' perceived control over care and frequency of GP visits. Methods: Data from the Dutch 'National Panel of People with Chronic Illness or Disability' was

  3. Amygdala-prefrontal cortex resting-state functional connectivity varies with first depressive or manic episode in bipolar disorder.

    Science.gov (United States)

    Wei, Shengnan; Geng, Haiyang; Jiang, Xiaowei; Zhou, Qian; Chang, Miao; Zhou, Yifang; Xu, Ke; Tang, Yanqing; Wang, Fei

    2017-02-22

    Bipolar disorder (BD) is one of the most complex mental illnesses, characterized by interactive depressive and manic states that are 2 contrary symptoms of disease states. The bilateral amygdala and prefrontal cortex (PFC) appear to play critical roles in BD; however, abnormalities seem to manifest differently in the 2 states and may provide further insight into underlying mechanisms. Sixteen participants with first-episode depressive and 13 participants with first-episode manic states of bipolar disorder as well as 30 healthy control (HC) participants underwent resting-state functional magnetic resonance imaging (fMRI). Resting-state functional connectivity (rsFC) between the bilateral amygdala and PFC was compared among the 3 groups. Compared with depressive state participants of the BD group, manic state participants of the BD group showed a significant decrease in rsFC between the amygdala and right orbital frontal cortex (pamygdala and left middle frontal cortex was significantly decreased in depressive and manic state participants of the BD group when compared with the HC group (pamygdala- left PFC functional connectivity might present the trait feature for BD, while deficits in amygdala- right PFC functional connectivity might be specific to manic episode, compared to depressive episode. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Pavlovian Extinction of the Discriminative Stimulus Effects of Nicotine and Ethanol in Rats Varies as a Function of Context

    Science.gov (United States)

    Troisi, Joseph R., II

    2011-01-01

    Operant extinction contingencies can undermine the discriminative stimulus effects of drugs. Here, nicotine (0.4 mg/kg) and ethanol (0.8 g/kg) first functioned as either an S[superscript D] or S[superscript Delta], in a counterbalanced one-lever go/no-go (across sessions) operant drug discrimination procedure. Pavlovian extinction in the training…

  5. Knee Muscle Strength at Varying Angular Velocities and Associations with Gross Motor Function in Ambulatory Children with Cerebral Palsy

    Science.gov (United States)

    Hong, Wei-Hsien; Chen, Hseih-Ching; Shen, I-Hsuan; Chen, Chung-Yao; Chen, Chia-Ling; Chung, Chia-Ying

    2012-01-01

    The aim of this study was to evaluate the relationships of muscle strength at different angular velocities and gross motor functions in ambulatory children with cerebral palsy (CP). This study included 33 ambulatory children with spastic CP aged 6-15 years and 15 children with normal development. Children with CP were categorized into level I (n =…

  6. Altered intestinal microbial flora and impaired epithelial barrier structure and function in CKD: the nature, mechanisms, consequences and potential treatment.

    Science.gov (United States)

    Vaziri, Nosratola D; Zhao, Ying-Yong; Pahl, Madeleine V

    2016-05-01

    Chronic kidney disease (CKD) results in systemic inflammation and oxidative stress which play a central role in CKD progression and its adverse consequences. Although many of the causes and consequences of oxidative stress and inflammation in CKD have been extensively explored, little attention had been paid to the intestine and its microbial flora as a potential source of these problems. Our recent studies have revealed significant disruption of the colonic, ileal, jejunal and gastric epithelial tight junction in different models of CKD in rats. Moreover, the disruption of the epithelial barrier structure and function found in uremic animals was replicated in cultured human colonocytes exposed to uremic human plasma in vitro We have further found significant changes in the composition and function of colonic bacterial flora in humans and animals with advanced CKD. Together, uremia-induced impairment of the intestinal epithelial barrier structure and function and changes in composition of the gut microbiome contribute to the systemic inflammation and uremic toxicity by accommodating the translocation of endotoxin, microbial fragments and other noxious luminal products in the circulation. In addition, colonic bacteria are the main source of several well-known pro-inflammatory uremic toxins such as indoxyl sulfate, p-cresol sulfate, trimethylamine-N-oxide and many as-yet unidentified retained compounds in end-stage renal disease patients. This review is intended to provide an overview of the effects of CKD on the gut microbiome and intestinal epithelial barrier structure and their role in the pathogenesis of systemic inflammation and uremic toxicity. In addition, potential interventions aimed at mitigating these abnormalities are briefly discussed. © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  7. X-linked recessive ichthyosis: an impaired barrier function evokes limited gene responses before and after moisturizing treatments.

    Science.gov (United States)

    Hoppe, T; Winge, M C G; Bradley, M; Nordenskjöld, M; Vahlquist, A; Berne, B; Törmä, H

    2012-09-01

    X-linked recessive ichthyosis (XLRI) is due to deletions or inactivating mutations in the steroid sulfatase (STS) gene. This results in an accumulation of cholesterol sulphate affecting the packing of intercorneocyte lipids. XLRI is characterized by dry, scaly skin and increased skin barrier permeability; patients are often dependent on daily use of moisturizers. To examine the biophysical and molecular changes in the skin of patients with XLRI compared with healthy volunteers, and to analyse the effects of moisturizers on the patients' barrier function. Patients with XLRI (n=14) and healthy controls (n=14) were included in the study. Skin dryness score, transepidermal water loss (TEWL) and skin surface pH were monitored at baseline, and punch biopsies were obtained for mRNA expression profiles determined by oligonucleotide arrays. Measurements were repeated in the patients with XLRI after a 4-week treatment with three different moisturizers on the volar forearms. Patients with XLRI showed, compared with healthy controls, increased dryness and TEWL, equal skin pH and altered expression of 27 genes. There were no signs of activation of inflammation or repair pathways. Five selected genes were significantly altered also on quantitative polymerase chain reaction analysis. Treatment with the moisturizers showed similar effects: they improved skin dryness but had no effect on TEWL, pH or expression of selected genes. Despite a dysfunctional skin barrier, the limited number of genes altered in XLRI skin suggests that no inflammatory or repair mechanisms are triggered. Treatment with moisturizers does not have any major impact on the skin barrier properties of patients with XLRI. © 2012 The Authors. BJD © 2012 British Association of Dermatologists.

  8. Ginger Extract Suppresses Inflammatory Response and Maintains Barrier Function in Human Colonic Epithelial Caco-2 Cells Exposed to Inflammatory Mediators.

    Science.gov (United States)

    Kim, Yunyoung; Kim, Dong-Min; Kim, Ji Yeon

    2017-05-01

    The beneficial effects of ginger in the management of gastrointestinal disturbances have been reported. In this study, the anti-inflammatory potential of ginger extract was assessed in a cellular model of gut inflammation. In addition, the effects of ginger extract and its major active compounds on intestinal barrier function were evaluated. The response of Caco-2 cells following exposure to a mixture of inflammatory mediators [interleukin [IL]-1β, 25 ng/mL; lipopolysaccharides [LPS], 10 ng/mL; tumor necrosis factor [TNF]-α, 50 ng/mL; and interferon [INF]-γ, 50 ng/mL] were assessed by measuring the levels of secreted IL-6 and IL-8. In addition, the mRNA levels of cyclooxygenase-2 and inducible nitric oxide synthase were measured. Moreover, the degree of nuclear factor (NF)-κB inhibition was examined, and the intestinal barrier function was determined by measuring the transepithelial electrical resistance (TEER) and fluorescein isothiocyanate (FITC)-dextran transfer. It was observed that ginger extract and its constituents improved inflammatory responses by decreasing the levels of nitrite, PGE2, IL-6, and IL-8 via NF-κB inhibition. The ginger extract also increased the TEER and decreased the transfer of FITC-dextran from the apical side of the epithelium to the basolateral side. Taken together, these results show that ginger extract may be developed as a functional food for the maintenance of gastrointestinal health. © 2017 Institute of Food Technologists®.

  9. Chimeric proteins between cry1 and cry2 Arabidopsis blue light photoreceptors indicate overlapping functions and varying protein stability.

    Science.gov (United States)

    Ahmad, M; Jarillo, J A; Cashmore, A R

    1998-02-01

    A blue light (cryptochrome) photoreceptor from Arabidopsis, cry1, has been identified recently and shown to mediate a number of blue light-dependent phenotypes. Similar to phytochrome, the cryptochrome photoreceptors are encoded by a gene family of homologous members with considerable amino acid sequence similarity within the N-terminal chromophore binding domain. The two members of the Arabidopsis cryptochrome gene family (CRY1 and CRY2) overlap in function, but their proteins differ in stability: cry2 is rapidly degraded under light fluences (green, blue, and UV) that activate the photoreceptor, but cry1 is not. Here, we demonstrate by overexpression in transgenic plants of cry1 and cry2 fusion constructs that their domains are functionally interchangeable. Hybrid receptor proteins mediate functions similar to cry1 and include inhibition of hypocotyl elongation and blue light-dependent anthocyanin accumulation; differences in activity appear to be correlated with differing protein stability. Because cry2 accumulates to high levels under low-light intensities, it may have greater significance in wild-type plants under conditions when light is limited.

  10. [Retinal function under conditions of artificial illumination with varying spectral makeup in patients with sclerotic macular dystrophy].

    Science.gov (United States)

    Soldatova, A M

    1990-01-01

    In conditions of a laboratory experiment using illumination of various light sources (by incandescent, luminescent, arc-mercury, natrium lamps), determination of visual acuity, visual field, color perception, restoration time of visual acuity after macular flash lighting (photostress test), Heidinger's phenomenon as well as visocontrastometry after V. V. Volkov, Weston's correction test were conducted in 46 patients (92 eyes) with macular dystrophy and 50 healthy persons in the dynamics of a working day. It was found that the spectral composition of the visible light has a remarkable influence on the function of color perception, contrast sensitivity, reaction of visual analyser on light load, visual ability to work. In patients with macular dystrophy, the dependence on the light medium was expressed much greater than in healthy persons. The highest functional state of the retina and visual ability to work in patients with macular dystrophy were provided by natrium lamps having a maximum radiation in the yellow part of the spectrum. The short-wave visible light of arc-mercury and luminescent lamps somewhat suppressed the functional state of the retina and reduced visual ability to work. The results obtained are important for selection of optimal conditions of work for patients with macular dystrophy.

  11. Does calcium channel blockade and beta-adrenergic blockade affect platelet function and fibrinolysis to a varying degree?

    DEFF Research Database (Denmark)

    Fornitz, Gitte Gleerup; Mehlsen, J; Winther, K

    1995-01-01

    The effects of isradipine and atenolol on platelet function and fibrinolytic activity were studied in 10 male patients with mild untreated hypertension. After a 2-week placebo run-in period, the volunteers were randomized to either isradipine 2.5 mg twice daily or atenolol 100 mg daily for a 6...... as the fast-acting inhibitor against tissue plasminogen activator usually termed PAI-1. During atenolol and isradipine therapy, blood pressure (BP) was equally reduced (p Heart rate (HR) decreased during atenolol treatment but was not changed by isradipine. Platelet activity in vivo estimated as B...

  12. Food for thought: the importance of glucose and other energy substrates for sustaining brain function under varying levels of activity.

    Science.gov (United States)

    Pellerin, L

    2010-10-01

    The brain requires a constant and substantial energy supply to maintain its main functions. For decades, it was assumed that glucose was the major if not the only significant source of energy for neurons. This view was supported by the expression of specific facilitative glucose transporters on cerebral blood vessels, as well as neurons. Despite the fact that glucose remains a key energetic substrate for the brain, growing evidence suggests a different scenario. Thus astrocytes, a major type of glial cells that express their own glucose transporter, play a critical role in coupling synaptic activity with glucose utilization. It was shown that glutamatergic activity triggers an enhancement of aerobic glycolysis in this cell type. As a result, lactate is provided to neurons as an additional energy substrate. Indeed, lactate has proven to be a preferential energy substrate for neurons under various conditions. A family of proton-linked carriers known as monocarboxylate transporters has been described and specific members have been found to be expressed by endothelial cells, astrocytes and neurons. Moreover, these transporters are subject to fine regulation of their expression levels and localization, notably in neurons, which suggests that lactate supply could be adjusted as a function of their level of activity. Considering the importance of energetics in the aetiology of several neurodegenerative diseases, a better understanding of its cellular and molecular underpinnings might have important implications for the future development of neuroprotective strategies. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  13. Hybrid functional and quasiparticle calculations of the Schottky barrier height at TiN/HfO2 interface

    Science.gov (United States)

    Oh, Young Jun; Lee, Alex Taekyung; Noh, Hyeon-Kyun; Chang, K. J.

    2014-03-01

    In high-k/metal gate transistors, it is important to control the metal work function such that it should be close to the valence and conduction band edges of Si in p- and n-channel devices, respectively. The Schottky barrier height (SBH) is affected by composition of metal gate, impurity, and deposition process. In theoretical studies, using the local density functional approximation, the SBH is severely underestimated because of the underestimation of the dielectric band gap. In this work, we perform both hybrid functional and quasiparticle calculations to improve the band gap and effective work function in TiN/HfO2 interface. We consider two types of TiN/HfO2 interface structures, which consist of either Ti-O or N-Hf interface bonds. Depending on the type of interface bonds, the SBH differs by 0.36 eV. In the many-body perturbation theory, the GW0 approach, which employs the self-consistent Green's function and the full frequency-dependent dielectric function, greatly improves the agreement of the SBH with experiments. We discuss the effects of the self-consistency and the plasmon-pole approximation on the SBH. On the other hand, with the hybrid functional, the SBH is overestimated due to the larger downward shift of the valence band edge of HfO2.

  14. Evaluating the solvation properties of functionalized ionic liquids with varied cation/anion composition using the solvation parameter model.

    Science.gov (United States)

    Twu, Pamela; Zhao, Qichao; Pitner, William R; Acree, William E; Baker, Gary A; Anderson, Jared L

    2011-08-05

    Ionic liquids (ILs) are promising gas chromatography (GC) stationary phases due to their high thermal stability, negligible vapor pressure, and ability to solvate a broad range of analytes. The tunability of ILs allows for structure modification in pursuit of enhanced separation selectivity and control of analyte elution order. In this study, the solvation parameter model is used to characterize the solvation interactions of fifteen ILs containing various cationic functional groups (i.e., dimethylamino, hydroxyl, and ether) and cation types paired with various counter anions, namely, tris(pentafluoroethyl)trifluorophosphate (FAP(-)), bis[(trifluoromethyl)sulfonyl]imide (NTf(2)(-)), thiocyanate (SCN(-)), tricyanomethide (C(CN)(3)(-)), tetracyanoborate (B(CN)(4)(-)), and bis[oxalate(2-)]borate (BOB(-)). The presence of functional groups affected the hydrogen bond basicity, hydrogen bond acidity, as well as dispersion interactions of the resulting ILs, while the change of cation type yielded modest influence on the dipolarity. The switch of counter anions in unfunctionalized ILs produced compounds with higher dipolarity and hydrogen bond basicity. The dipolarity and hydrogen bond basicity of ILs possessing cyano-containing anions appeared to be inversely proportional to the cyano content of the anion. The modification of IL structure resulted in a significant effect on the retention behavior as well as separation selectivity for many solutes, including reversed elution orders of some analytes. This study provides one of the most comprehensive examinations up-to-date on the relation between IL structure and the resulting solvation characteristics and gives tremendous insight into choosing suitable ILs as GC stationary phases for solute specific separations. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Pilot study of lithium to restore intestinal barrier function in severe graft-versus-host disease.

    Directory of Open Access Journals (Sweden)

    Gideon Steinbach

    Full Text Available Severe intestinal graft-vs-host disease (GVHD after allogeneic hematopoietic cell transplantation (HCT causes mucosal ulceration and induces innate and adaptive immune responses that amplify and perpetuate GVHD and the associated barrier dysfunction. Pharmacological agents to target mucosal barrier dysfunction in GVHD are needed. We hypothesized that induction of Wnt signaling by lithium, an inhibitor of glycogen synthase kinase (GSK3, would potentiate intestinal crypt proliferation and mucosal repair and that inhibition of GSK3 in inflammatory cells would attenuate the deregulated inflammatory response to mucosal injury. We conducted an observational pilot study to provide data for the potential design of a randomized study of lithium. Twenty patients with steroid refractory intestinal GVHD meeting enrollment criteria were given oral lithium carbonate. GVHD was otherwise treated per current practice, including 2 mg/kg per day of prednisone equivalent. Seventeen patients had extensive mucosal denudation (extreme endoscopic grade 3 in the duodenum or colon. We observed that 8 of 12 patients (67% had a complete remission (CR of GVHD and survived more than 1 year (median 5 years when lithium administration was started promptly within 3 days of endoscopic diagnosis of denuded mucosa. When lithium was started promptly and less than 7 days from salvage therapy for refractory GVHD, 8 of 10 patients (80% had a CR and survived more than 1 year. In perspective, a review of 1447 consecutive adult HCT patients in the preceding 6 years at our cancer center showed 0% one-year survival in 27 patients with stage 3-4 intestinal GVHD and grade 3 endoscopic appearance in the duodenum or colon. Toxicities included fatigue, somnolence, confusion or blunted affect in 50% of the patients. The favorable outcomes in patients who received prompt lithium therapy appear to support the future conduct of a randomized study of lithium for management of severe GVHD with

  16. Functional consequences of neuromyelitis optica-IgG astrocyte interactions on blood-brain barrier permeability and granulocyte recruitment.

    Science.gov (United States)

    Vincent, Thierry; Saikali, Philippe; Cayrol, Romain; Roth, Alejandro D; Bar-Or, Amit; Prat, Alexandre; Antel, Jack P

    2008-10-15

    Autoantibody neuromyelitis optica-IgG (NMO-IgG) recognizing aquaporin-4 (AQP4) is implicated as playing a central role in the physiopathology of NMO. The aim of this in vitro-based study was to characterize functional consequences of interaction between NMO-IgG and cells of the neurovascular unit (astrocytes and brain endothelium) that would provide insight into recognized features of NMO, namely altered blood-brain barrier (BBB) permeability and granulocyte recruitment. We used sera from NMO and longitudinally extensive transverse myelitis cases shown to bind in a characteristic perivascular pattern to primate cerebellar slices. Using flow cytometry, we found that sera from NMO-IgG-positive patients reacted with CNS-derived human fetal astrocytes, whereas sera from multiple sclerosis patients did not. We demonstrated that NMO-IgG binding to astrocytes alters aquaporin-4 polarized expression and increases permeability of a human BBB endothelium/astrocyte barrier. We further demonstrated that NMO-IgG binding to human fetal astrocytes can result in NK cell degranulation, astrocyte killing by Ab-dependent cellular cytotoxicity and complement-dependent granulocyte attraction through the BBB model. Our study highlights important functional roles for NMO-IgG that could account for pathological lesions and BBB dysfunction observed in NMO.

  17. Quantum state-resolved CH4 dissociation on Pt(111): coverage dependent barrier heights from experiment and density functional theory.

    Science.gov (United States)

    Ueta, Hirokazu; Chen, Li; Beck, Rainer D; Colón-Dìaz, Inara; Jackson, Bret

    2013-12-21

    The dissociative chemisorption of CH4 on Pt(111) was studied using quantum state-resolved methods at a surface temperature (T(s)) of 150 K where the nascent reaction products CH3(ads) and H(ads) are stable and accumulate on the surface. Most previous experimental studies of methane chemisorption on transition metal surfaces report only the initial sticking coefficients S0 on a clean surface. Reflection absorption infrared spectroscopy (RAIRS), used here for state resolved reactivity measurements, enables us to monitor the CH3(ads) uptake during molecular beam deposition as a function of incident translational energy (E(t)) and vibrational state (ν3 anti-symmetric C-H stretch of CH4) to obtain the initial sticking probability S0, the coverage dependence of the sticking probability S(θ) and the CH3(ads) saturation coverage θ(sat). We observe that both S0 and θ(sat) increase with increasing E(t) as well as upon ν3 excitation of the incident CH4 which indicates a coverage dependent dissociation barrier height for the dissociation of CH4 on Pt(111) at low surface temperature. This interpretation is supported by density functional calculations of barrier heights for dissociation, using large supercells containing one or more H and/or methyl adsorbates. We find a significant increase in the activation energies with coverage. These energies are used to construct simple models that reasonably reproduce the uptake data and the observed saturation coverages.

  18. Reflectance near-infrared measurements for determining changes in skin barrier function and scattering in relation to moisturizer application

    Science.gov (United States)

    Qassem, Meha; Kyriacou, Panayiotis A.

    2015-09-01

    Skin moisture relates to the state of multiple skin constituents and aspects, but unfortunately, a device which could provide comprehensive and in vivo analysis is not available. Nevertheless, several reports have demonstrated accurate estimations of dermal water content using near-infrared spectroscopy (NIRS), and the potential of employing this technique in skin analysis. We aim to investigate whether NIRS could detect changes in skin barrier function through evaluation of skin water uptake in relation to moisturizer application. NIR and capacitance data were collected from 20 volunteers at both forearms, prior to and after seven days of regular moisturizer use. Results indicated lower peak intensities at the 1940-nm minima and higher intensities at the 1450-nm equivalent minima with moisturizer abstinence, while the opposite was true with regular moisturizer application. As the light beam would have traveled deeper into the skin at 1450 nm, it has been concluded that long-term, frequent moisturizer use had limited the penetration of extrinsic water. Partial least squares analysis showed that separation of sample's scores increased with abstinence of moisturizer use. Thus, NIRS can provide valuable information not only on dermal water contents but also on additional parameters such as skin barrier function.

  19. Novel effects of the prototype translocating Escherichia coli, strain C25 on intestinal epithelial structure and barrier function.

    Science.gov (United States)

    Zareie, Mehri; Riff, Jason; Donato, Kevin; McKay, Derek M; Perdue, Mary H; Soderholm, Johan D; Karmali, Mohamed; Cohen, Mitchell B; Hawkins, Jennifer; Sherman, Philip M

    2005-12-01

    Intestinal bacteria play an etiologic role in triggering and perpetuating chronic inflammatory bowel disorders. However, the precise mechanisms whereby the gut microflora influences intestinal cell function remain undefined. Therefore, the effects of the non-pathogenic prototype translocating Escherichia coli, strain C25 on the barrier properties of human T84 and Madine-Darby canine kidney type 1 epithelial cells were examined. T-84 cells were also infected with commensal E. coil, strains F18 and HB101, and enterohaemorrhagic E. coli, serotype O157:H7. Strains F18 and HB101 had no effect on transepithelial electrical resistance (TER) of T84 monolayers. By contrast, epithelial cells infected with strain C25 displayed a time-dependent decrease in TER, preceded by an altered distribution of the cytoskeletal protein alpha-actinin, comparable to infection with E. coli O157:H7. E. coli C25 infection also led to activation of nuclear factor kappaB (NF-kappaB), interleukin-8 secretion and alterations in localization of claudin-1, but not zona occludens-1 or claudin-4, in T84 cells. There were adherent C25 bacteria on the intact apical surface of infected T84 cells, while mitochondria appeared swollen and vacuolated. These novel findings demonstrate the ability of a translocating commensal bacterium to adhere to and modulate intestinal epithelial barrier function and to induce morphological changes in a manner distinct from the known enteric pathogen, E. coli O157:H7.

  20. Effects of rhinovirus infection on hydrogen peroxide- induced alterations of barrier function in the cultured human tracheal epithelium.

    Science.gov (United States)

    Ohrui, T; Yamaya, M; Sekizawa, K; Yamada, N; Suzuki, T; Terajima, M; Okinaga, S; Sasaki, H

    1998-07-01

    To investigate whether rhinovirus infection impairs epithelial barrier functions, human rhinovirus 14 (HRV-14) was infected to primary cultures of human tracheal epithelial cells and experiments were performed on Day 2 after HRV-14 infection. Hydrogen peroxide (H2O2; 3 x 10(-)4 M) increased electrical conductance (G) across the epithelial cell sheet measured with Ussing's chamber methods. Exposure of the epithelial cells to HRV-14 had no effect on H2O2-induced increases in G and [3H]mannitol flux through the cultured epithelium in the control condition, but it markedly potentiated H2O2- induced increases in both parameters in IL-1beta (100 U/ml) pretreated condition. However, pretreatment with TNF-alpha (100 U/ml) was without effect. IL-1beta enhanced the intercellular adhesion molecule-1 (ICAM-1) expression assessed by immunohistochemical analysis and susceptibility of epithelial cells to HRV-14 infection. An antibody to ICAM-1 inhibited HRV-14 infection of epithelial cells and abolished H2O2-induced increases in G and [3H]mannitol flux in IL-1beta-pretreated epithelial cells with HRV-14 infection. These results suggest that rhinovirus infection may reduce barrier functions in the airway epithelium in association with upregulation of ICAM-1 expression.

  1. P-glycoprotein function at the blood-brain barrier imaged using 11C-N-desmethyl-loperamide in monkeys.

    Science.gov (United States)

    Liow, Jeih-San; Kreisl, William; Zoghbi, Sami S; Lazarova, Neva; Seneca, Nicholas; Gladding, Robert L; Taku, Andrew; Herscovitch, Peter; Pike, Victor W; Innis, Robert B

    2009-01-01

    11C-Loperamide is an avid substrate for P-glycoprotein (P-gp), but it is rapidly metabolized to 11C-N-desmethyl-loperamide (11C-dLop), which is also a substrate for P-gp and thereby contaminates the radioactive signal in the brain. Should further demethylation of 11C-dLop occur, radiometabolites with low entry into the brain are generated. Therefore, we evaluated the ability of 11C-dLop to quantify the function of P-gp at the blood-brain barrier in monkeys. Six monkeys underwent 12 PET scans of the brain, 5 at baseline and 7 after pharmacologic blockade of P-gp. A subset of monkeys also underwent PET scans with 15O-water to measure cerebral blood flow. To determine whether P-gp blockade affected peripheral distribution of 11C-dLop, we measured whole-body biodistribution in 4 monkeys at baseline and after P-gp blockade. The concentration of 11C-dLop in the brain was low under baseline conditions and increased 5-fold after P-gp blockade. This increase was primarily caused by an increased rate of entry into the brain rather than a decreased rate of removal from the brain. With P-gp blockade, uptake of radioactivity among brain regions correlated linearly with blood flow, suggesting a high single-pass extraction. After correction for cerebral blood flow, the uptake of 11C-dLop was fairly uniform among brain regions, suggesting that the function of P-gp is fairly uniformly distributed in the brain. On whole-body imaging, P-gp blockade significantly affected distribution of radioactivity only to the brain and not to other visually identified source organs. The effective dose estimated for humans was approximately 9 microSv/MBq. PET with 11C-dLop can quantify P-gp function at the blood-brain barrier in monkeys. The single-pass extraction of 11C-dLop is high and requires correction for blood flow to accurately measure the function of this efflux transporter. The low uptake at baseline and markedly increased uptake after P-gp blockade suggest that 11C-dLop will be useful to

  2. Subcortical BOLD responses during visual sexual stimulation vary as a function of implicit porn associations in women

    Science.gov (United States)

    de Jong, Peter J.; Georgiadis, Janniko R.

    2014-01-01

    Lifetime experiences shape people’s attitudes toward sexual stimuli. Visual sexual stimulation (VSS), for instance, may be perceived as pleasurable by some, but as disgusting or ambiguous by others. VSS depicting explicit penile–vaginal penetration (PEN) is relevant in this respect, because the act of penetration is a core sexual activity. In this study, 20 women without sexual complaints participated. We used functional magnetic resonance imaging and a single-target implicit association task to investigate how brain responses to PEN were modulated by the initial associations in memory (PEN-‘hot’ vs PEN-disgust) with such hardcore pornographic stimuli. Many brain areas responded to PEN in the same way they responded to disgust stimuli, and PEN-induced brain activity was prone to modulation by subjective disgust ratings toward PEN stimuli. The relative implicit PEN-disgust (relative to PEN-‘hot’) associations exclusively modulated PEN-induced brain responses: comparatively negative (PEN-disgust) implicit associations with pornography predicted the strongest PEN-related responses in the basal forebrain (including nucleus accumbens and bed nucleus of stria terminalis), midbrain and amygdala. Since these areas are often implicated in visual sexual processing, the present findings should be taken as a warning: apparently their involvement may also indicate a negative or ambivalent attitude toward sexual stimuli. PMID:23051899

  3. Subcortical BOLD responses during visual sexual stimulation vary as a function of implicit porn associations in women.

    Science.gov (United States)

    Borg, Charmaine; de Jong, Peter J; Georgiadis, Janniko R

    2014-02-01

    Lifetime experiences shape people's attitudes toward sexual stimuli. Visual sexual stimulation (VSS), for instance, may be perceived as pleasurable by some, but as disgusting or ambiguous by others. VSS depicting explicit penile-vaginal penetration (PEN) is relevant in this respect, because the act of penetration is a core sexual activity. In this study, 20 women without sexual complaints participated. We used functional magnetic resonance imaging and a single-target implicit association task to investigate how brain responses to PEN were modulated by the initial associations in memory (PEN-'hot' vs PEN-disgust) with such hardcore pornographic stimuli. Many brain areas responded to PEN in the same way they responded to disgust stimuli, and PEN-induced brain activity was prone to modulation by subjective disgust ratings toward PEN stimuli. The relative implicit PEN-disgust (relative to PEN-'hot') associations exclusively modulated PEN-induced brain responses: comparatively negative (PEN-disgust) implicit associations with pornography predicted the strongest PEN-related responses in the basal forebrain (including nucleus accumbens and bed nucleus of stria terminalis), midbrain and amygdala. Since these areas are often implicated in visual sexual processing, the present findings should be taken as a warning: apparently their involvement may also indicate a negative or ambivalent attitude toward sexual stimuli.

  4. Tuning the Electrical Memory Behavior from Nonvolatile to Volatile in Functional Copolyimides Bearing Varied Fluorene and Pyrene Moieties

    Science.gov (United States)

    Jia, Nanfang; Qi, Shengli; Tian, Guofeng; Wang, Xiaodong; Wu, Dezhen

    2017-04-01

    For producing polymer based electronics with good memory behavior, a series of functional copolyimides were designed and synthesized in this work by copolymerizing 3,3',4,4'-diphenylsulfonetetracarboxylic dianhydride (DSDA) with (9,9'-bis(4-aminophenyl)fluorene) (BAPF) and N, N-bis(4-aminophenyl) aminopyrene (DAPAP) diamines. The synthesized copolyimides DSDA/(DAPAP/BAPF) were denoted as coPI-DAPAP x ( x = 100, 50, 20, 10, 5, 1, 0), where x% represents the molar fraction of the DAPAP unit in the diamines. Characterization results indicate that the coPI-DAPAP x exhibits tunable electrical switching behaviors from write once read many times (WORM, nonvolatile, coPI-DAPAP100, coPI-DAPAP50, coPI-DAPAP20, coPI-DAPAP10) to the static random access memory (SRAM, volatile, coPI-DAPAP5, coPI-DAPAP1) with the variation of the DAPAP content. Optical and electrochemical characterization show gradually decreasing highest occupied molecular orbital levels and enlarged energy gap with the decrease of the DAPAP moiety, suggesting decreasing charge-transfer effect in the copolyimides, which can account for the observed WORM-SRAM memory conversion. Meanwhile, the charge transfer process was elucidated by quantum chemical calculation at B3LYP/6-31G(d) theory level. This work shows the effect of electron donor content on the memory behavior of polymer electronic materials.

  5. Effects of gluten-free breads, with varying functional supplements, on the biochemical parameters and antioxidant status of rat serum.

    Science.gov (United States)

    Świeca, Michał; Reguła, Julita; Suliburska, Joanna; Złotek, Urszula; Gawlik-Dziki, Urszula

    2015-09-01

    This paper examines the effects of gluten-free bread enriched with functional ingredients (milk powder, poppy, sunflower and pumpkin seeds, egg yolk, carum, hazel nuts and amaranth) on the morphological and biochemical parameters and antioxidant status of rats serum. Rats were provided test diets--gluten-free breads and water ad libitum. After 14 days, the animals were weighed and killed. A hazel nut-amaranth bread diet significantly increased the level of thrombocytes when compared to control bread. A mixed bread diet significantly decreased cholesterol levels in rats. All fortified breads decreased triglyceride levels and alanine transaminase activity and caused an increase in antiradical activity of the serum. In rats fed with poppy-milk bread, milk-seed bread and mixed bread, a marked decrease in superoxide dismutase activity was found. Enriched breads reduced the levels of triglyceride and improved the antiradical properties of serum, although the physiological relevance of this needs to be confirmed by human studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis

    DEFF Research Database (Denmark)

    List, Karin; Haudenschild, Christian C; Szabo, Roman

    2002-01-01

    , characterized by dysmorphic and pleomorphic corneocytes and the absence of vesicular bodies in transitional layer cells. This aberrant skin development seriously compromised both inward and outward epidermal barrier function, leading to the rapid and fatal dehydration of Matriptase/MT-SP1-deficient pups. Loss...... of Matriptase/MT-SP1 also seriously affected hair follicle development resulting in generalized follicular hypoplasia, absence of erupted vibrissae, lack of vibrissal hair canal formation, ingrown vibrissae, and wholesale abortion of vibrissal follicles. Furthermore, Matriptase/MT-SP1-deficiency resulted...... in dramatically increased thymocyte apoptosis, and depletion of thymocytes. This study demonstrates that Matriptase/MT-SP1 has pleiotropic functions in the development of the epidermis, hair follicles, and cellular immune system....

  7. The effect of wellsolve, a novel solubilizing agent, on the intestinal barrier function and intestinal absorption of griseofulvin in rats.

    Science.gov (United States)

    Hamid, Khuriah Abdul; Lin, Yulian; Gao, Yang; Katsumi, Hidemasa; Sakane, Toshiyasu; Yamamoto, Akira

    2009-11-01

    The effect of Wellsolve, a new solubilizing agent, on the function of intestinal membrane barrier and transporters including P-glycoprotein (P-gp) and peptide transporter (PEPT1) was examined by an in vitro diffusion chamber and an in situ closed loop method. The model drugs used in this study were 5(6)-carboxyfluorescein (CF), rhodamine123 (a P-glycoprotein substrate), cephalexin (a typical substrate for PEPT1) and griseofulvin (a BCS Class II drug). Intestinal absorption of CF was not affected by the addition of 1-10% (v/v) Wellsolve, while 20% (v/v) Wellsolve significantly enhanced its intestinal absorption by the in situ absorption study. Therefore, this finding suggested that high concentration of Wellsolve might alter the intestinal barrier function. The mucosal to serosal (absorptive) and serosal to mucosal (secretory) transport of rhodamine123 was significantly inhibited in the presence of 5.0-20% (v/v) of Wellsolve, suggesting that Wellsolve might not affect the function of P-gp in the intestine. The intestinal transport of cephalexin was not affected in the presence of Wellsolve, suggesting that this solubilizing agent might not change the function of PEPT1 in the intestine. In the toxicity studies, we found that 1-10% (v/v) Wellsolve did not change the release of lactate hydrogenase (LDH) and protein from the intestinal membranes. Furthermore, intestinal absorption of griseofulvin in the presence of 10% (v/v) Wellsolve significantly increased as compared with the control. In summary, Wellsolve at lower concentrations might be a potent and safe solubilizing agent for improving the solubility and absorption of poorly water-soluble drugs including griseofulvin.

  8. Deployment of attention to emotional pictures varies as a function of externally-oriented thinking: An eye tracking investigation.

    Science.gov (United States)

    Wiebe, Alex; Kersting, Anette; Suslow, Thomas

    2017-06-01

    Alexithymia is a multidimensional personality construct including the components difficulties identifying feelings (DIF), difficulties describing feelings (DDF), and externally oriented thinking (EOT). Different features of alexithymia are thought to reflect specific deficits in the cognitive processing and regulation of emotions. The aim of the present study was to examine for the first time patterns of deployment of attention as a function of alexithymia components in healthy persons by using eye-tracking technology. It was assumed that EOT is linked to avoidance of negative images. 99 healthy adults viewed freely pictures consisting of anxiety-related, depression-related, positive, and neutral images while gaze behavior was registered. Alexithymia was assessed by the 20-Item Toronto Alexithymia Scale. Measures of anxiety, depression, and (visual-perceptual) intelligence were also administered. A main effect of emotion condition on dwell times was observed. Viewing time was lowest for neutral images, longer for depression-related and happy images, and longest for anxiety-related images. Gender and EOT had significant effects on dwell times. EOT correlated negatively with dwell time on depression-related (but not anxiety-related) images. There were no correlations of dwell times with depression, trait anxiety, intelligence, DIF, or DDF. Alexithymia was assessed exclusively by self-report. Our results show that EOT but not DIF or DDF influences attention deployment to simultaneously presented emotional pictures. EOT may reduce attention allocation to dysphoric information. This attentional characteristic of EOT individuals might have mood protecting effects but also detrimental impacts on social relationships and coping competencies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Grid cell firing properties vary as a function of theta phase locking preferences in the rat medial entorhinal cortex

    Directory of Open Access Journals (Sweden)

    Ehren Lee Newman

    2014-10-01

    Full Text Available Theta rhythmic fluctuations in the hippocampal-entorhinal circuit are believed to reflect rapid transitions between modes of mnemonic processing. Specifically, activity at the trough and peak of CA1 pyramidal layer theta is thought to correspond to retrieval and encoding related processing, respectively. Spatially tuned ‘grid cells’ in layers II and III of the medial entorhinal cortex preferentially spike during the trough and peak phases of theta, respectively. Such differences suggest differential involvement of these layers to the processes of retrieval and encoding. It remains unknown, however, if the properties of grid cells that spike preferentially at the trough versus the peak of theta differ systematically. Such putative differences would offer insights into the differential processing that occurs during these two phases. The goal of the present work was to contrast these types of grid cells. We found that significant functional dissociations do exist: trough locked grid cells carried more spatial information, had a higher degree of head direction tuning, and were more likely to phase precess. Thus, grid cells that activate during the putative retrieval phase of theta (trough have a greater degree of location, orientation and temporal tuning specificity relative to grid cells that activate during the putative encoding phase (peak, potentially reflecting the influence of the retrieved content. Additionally, trough locked grid cells had a lower average firing rate, were more likely to burst, and were less phase locked to high-gamma (~80 Hz. Further analyses revealed they had different waveforms profiles and that systemic blockade of muscarinic acetylcholine receptors reduced the spatial tuning of both types, although these differences were only significant for the peak locked grid cells. These differences suggest that trough and peak locked grid cells are distinct populations of neurons.

  10. Hybrid functional versus quasiparticle calculations for the Schottky barrier and effective work function at TiN/HfO2 interface

    Science.gov (United States)

    Oh, Young Jun; Lee, Alex Taekyung; Noh, Hyeon-Kyun; Chang, K. J.

    2013-02-01

    We investigate the Schottky barrier and effective work function (EWF) at TiN/HfO2 interface through density functional calculations. For different interfaces that consist of either Ti-O or N-Hf interface bonds, the intrinsic metal-induced gap states are nearly independent of the interface structure, with similar decay lengths into the oxide. Due to the weak Fermi-level pinning, the EWF is more sensitive to the extrinsic effect of interface bonding. As N-rich interface bonds are replaced by O-rich bonds, the EWF decreases by up to 0.36 eV, which is attributed to the formation of opposing interface dipoles. To improve the band gap and EWF, we perform both hybrid functional and quasiparticle (QP) calculations. In the GW0 approximation, in which the Green's function is self-consistently calculated by updating only QP energies and the full frequency-dependent dielectric function is used, the agreement of the EWF with experiment is greatly improved, while QP calculations at the G0W0 level or using the plasmon-pole dielectric function tend to overestimate the EWF. In the self-consistent GW approach, in which both QP energies and wave functions are updated in iterations, the band gap is overestimated, resulting in the lower EWF. On the other hand, the EWF is severely underestimated with the hybrid functional because of the larger shift of the valence band edge level of HfO2.

  11. Endothelial Angiogenesis and Barrier Function in Response to Thrombin Require Ca2+ Influx through the Na+/Ca2+ Exchanger*

    Science.gov (United States)

    Andrikopoulos, Petros; Kieswich, Julius; Harwood, Steven M.; Baba, Akemichi; Matsuda, Toshio; Barbeau, Olivier; Jones, Keith; Eccles, Suzanne A.; Yaqoob, Muhammad M.

    2015-01-01

    Thrombin acts on the endothelium by activating protease-activated receptors (PARs). The endothelial thrombin-PAR system becomes deregulated during pathological conditions resulting in loss of barrier function and a pro-inflammatory and pro-angiogenic endothelial phenotype. We reported recently that the ion transporter Na+/Ca2+ exchanger (NCX) operating in the Ca2+-influx (reverse) mode promoted ERK1/2 activation and angiogenesis in vascular endothelial growth factor-stimulated primary human vascular endothelial cells. Here, we investigated whether Ca2+ influx through NCX was involved in ERK1/2 activation, angiogenesis, and endothelial barrier dysfunction in response to thrombin. Reverse-mode NCX inhibitors and RNAi-mediated NCX1 knockdown attenuated ERK1/2 phosphorylation in response to thrombin or an agonist of PAR-1, the main endothelial thrombin receptor. Conversely, promoting reverse-mode NCX by suppressing Na+-K+-ATPase activity enhanced ERK1/2 activation. Reverse-mode NCX inhibitors and NCX1 siRNA suppressed thrombin-induced primary human vascular endothelial cell angiogenesis, quantified as proliferation and tubular differentiation. Reverse-mode NCX inhibitors or NCX1 knockdown preserved barrier integrity upon thrombin stimulation in vitro. Moreover, the reverse-mode NCX inhibitor SEA0400 suppressed Evans' blue albumin extravasation to the lung and kidneys and attenuated edema formation and ERK1/2 activation in the lungs of mice challenged with a peptide activator of PAR-1. Mechanistically, thrombin-induced ERK1/2 activation required NADPH oxidase 2-mediated reactive oxygen species (ROS) production, and reverse-mode NCX inhibitors and NCX1 siRNA suppressed thrombin-induced ROS production. We propose that reverse-mode NCX is a novel mechanism contributing to thrombin-induced angiogenesis and hyperpermeability by mediating ERK1/2 activation in a ROS-dependent manner. Targeting reverse-mode NCX could be beneficial in pathological conditions involving

  12. Characterisation and functional properties of antimicrobial bio-barriers formed by natural fibres.

    Science.gov (United States)

    Tomšič, Brigita; Ilec, Eva; Žerjav, Metka; Hladnik, Aleš; Simončič, Andrej; Simončič, Barbara

    2014-10-01

    Antimicrobial bio-barriers formed on cotton (CO), silk (SE), and woollen (WO) fabrics were prepared by the application of 3-(trimethoxysilyl)-propyldimethyloctadecyl ammonium chloride (Si-QAC) at 11 concentrations ranging from 0.5% to 20% using an exhaustion method. The presence of the Si-QAC coating on the treated fabric samples was detected by X-ray photoelectron spectroscopy. The bromophenol blue reagent was used to determine the concentration of quaternary ammonium groups in the coating. The antimicrobial activity of the coated fibres against Gram-negative and Gram-positive bacteria (Escherichia coli and Staphylococcus aureus), fungi (Aspergillus niger and Chaetomium globosum), and soil microflora was assessed using standard microbiological methods. The antimicrobial protection of the fibres increased with increases in the applied concentration of Si-QAC. The fibre type strongly influenced the antimicrobial activity of Si-QAC. Si-QAC was most effective for CO fibres, less effective for WO fibres, and least effective for SE fibres, suggesting that Si-QAC is less accessible for interactions with microorganisms when applied to protein fibres than to cellulose. Although Si-QAC reduced the microbial growth, it did not significantly hinder the biodegradability or sustainability of the coated fibres when exposed to soil microflora. The extent of rotting was more influenced by the morphological and chemical properties of the fibres than by the presence of Si-QAC. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Blood-brain barrier: a definition of normal and altered function.

    Science.gov (United States)

    Pollay, M; Roberts, P A

    1980-06-01

    The anatomical component of the blood-brain barrier (BBB) has been shown to be the cerebral capillary. These capillary endothelial cells are connected by continuous tight intercellular junctions and under normal conditions do not demonstrate transendothelial channels or pinocytotic vesicles. The rate that substances penetrate the BBB is related to molecular size, lipid solubility, and the presence of a specific carrier-mediated transport system. This latter mechanism for transendothelial passage is utilized for the movement of a wide variety of biologically important compounds such as sugars, amino acids, and organic acids. In certain pathological conditions, the permeability of the BBB is altered so that normally excluded plasma proteins and fluid enter the brain extracellular space, with the subsequent development of cerebral edema. In other abnormal conditions, alterations in the specialized transport systems operating across the cerebral capillary result in adverse changes in cerebral and neurotransmitter metabolism. An understanding of the unique properties of the BBB and of the changes that occur in pathological conditions has allowed the development of rational therapeutic strategies for a wide variety of diseases of the central nervous system.

  14. Restoring Mucosal Barrier Function and Modifying Macrophage Phenotype with an Extracellular Matrix Hydrogel: Potential Therapy for Ulcerative Colitis.

    Science.gov (United States)

    Keane, Timothy J; Dziki, Jenna; Sobieski, Eric; Smoulder, Adam; Castleton, Arthur; Turner, Neill; White, Lisa J; Badylak, Stephen F

    2017-03-01

    Despite advances in therapeutic options, more than half of all patients with ulcerative colitis [UC] do not achieve long-term remission, many require colectomy, and the disease still has a marked negative impact on quality of life. Extracellular matrix [ECM] bioscaffolds facilitate the functional repair of many soft tissues by mechanisms that include mitigation of pro-inflammatory macrophage phenotype and mobilization of endogenous stem/progenitor cells. The aim of the present study was to determine if an ECM hydrogel therapy could influence outcomes in an inducible rodent model of UC. The dextran sodium sulphate [DSS]-colitis model was used in male Sprague Dawley rats. Animals were treated via enema with an ECM hydrogel and the severity of colitis was determined by clinical and histological criteria. Lamina propria cells were isolated and the production of inflammatory mediators was quantified. Mucosal permeability was assessed in vivo by administering TRITC-dextran and in vitro using transepithelial electrical resistance [TEER]. ECM hydrogel therapy accelerated healing and improved outcome. The hydrogel was adhesive to colonic tissue, which allowed for targeted delivery of the therapy, and resulted in a reduction in clinical and histological signs of disease. ECM hydrogel facilitated functional improvement of colonic epithelial barrier function and the resolution of the pro-inflammatory state of tissue macrophages. The present study shows that a non-surgical and non-pharmacological ECM-based therapy can abate DSS-colitis not by immunosuppression but by promoting phenotypic change in local macrophage phenotype and rapid replacement of the colonic mucosal barrier.

  15. A unified homographic law for fusion excitation functions above the barrier

    Directory of Open Access Journals (Sweden)

    Eudes P.

    2015-01-01

    Full Text Available We report on a systematics of fusion cross section data at energies above the reaction threshold to those of disappearance of fusion process. By an appropriate scaling of both cross sections and energy, a fusion excitation function common to all the data points is established. A universal description of the fusion excitation function relying on basic nuclear concepts is proposed and its dependence on the reaction cross section used for the cross section normalization is discussed.

  16. Hydrogel-forming microneedles increase in volume during swelling in skin, but skin barrier function recovery is unaffected.

    Science.gov (United States)

    Donnelly, Ryan F; Mooney, Karen; McCrudden, Maelíosa T C; Vicente-Pérez, Eva M; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C; Woolfson, A David

    2014-05-01

    We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle (MN) arrays and skin barrier recovery in human volunteers. Such MN arrays, prepared from aqueous blends of hydrolyzed poly(methylvinylether/maleic anhydride) (15%, w/w) and the cross-linker poly(ethyleneglycol) 10,000 Da (7.5%, w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN arrays swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 h in skin. Importantly, however, skin barrier function recovered within 24 h after MN removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required because transepidermal water loss measurements suggested micropore closure, whereas optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 h after MN had been removed. There were no complaints of skin reactions, adverse events, or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 h, and no adverse events were present on follow-up. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

  17. Effect of bile pigments on the compromised gut barrier function in a rat model of bile duct ligation.

    Directory of Open Access Journals (Sweden)

    Kangkang Zhou

    Full Text Available BACKGROUND: Studies have shown that the absence of bile in the gut lumen, either by bile duct ligation or bile diversion, induces mucosal injury. However, the mechanism remains elusive. In this study, the role of bile pigments in gut barrier function was investigated in a rat model of bile duct ligation. METHODS: Male Sprague Dawley (SD rats were used in this study. After ligation of bile duct, the animals were administrated with free bilirubin, bilirubin ditaurate, or biliverdin by intragastric gavage. 1, 2, or 3 days later, the animals were sacrificed and the damage of mucosa was assessed by histological staining as well as biochemical parameters such as changes of diamine oxidase (DAO and D-lactate (D-Lac in the blood. Trypsin and chymotrypsin of the gut were also measured to determine how these digestive proteases may relate to the observed effects of bile pigments. RESULTS: Bile duct ligation (BDL caused significant increases in gut trypsin and chymotrypsin along with damage of the mucosa as demonstrated by the histological findings under microscope, the reduced expression of tight junction molecules like occludin, and significant changes in DAO and D-lac in the blood. Free bilirubin but not bilirubin ditaurate or biliverdin showed significant inhibitions on trypsin and chymotrypsin as well as alleviated changes of histological and biochemical parameters related to gut barrier disruption. CONCLUSION: Bile may protect the gut from damage through inhibiting digestive proteases like trypsin and chymotrypsin by free bilirubin.

  18. Potential of Lactobacillus plantarum CCFM639 in Protecting against Aluminum Toxicity Mediated by Intestinal Barrier Function and Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Leilei Yu

    2016-12-01

    Full Text Available Aluminum (Al is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury.

  19. Does the impact of osteoarthritis vary by age, gender and social deprivation? A community study using the International Classification of Functioning, Disability and Health.

    Science.gov (United States)

    Pollard, Beth; Dixon, Diane; Johnston, Marie

    2014-01-01

    Abstract Purpose: The aim of the study was to explore if the impact of osteoarthritis varies with respect to age, gender and social deprivation. Impact was defined as impairment, activity limitations and participation restriction (International Classification of Functioning, Disability and Health (ICF)). Investigating the functioning of the ICF model for subgroups is important both practically and theoretically. The sample comprised a community sample of 763 people diagnosed with osteoarthritis. Uncontaminated measures of the ICF constructs were developed using discriminant content validity from a pool of 134 items, including the WOMAC and SF-36. Multigroup Structural Equation Modelling was used to explore if the same pathways exist for subgroups of gender, age and social deprivation. Different significant paths were found for gender and social deprivation: impairment did not predict participation restriction for women and those most deprived, whereas these paths were significant for men and those less deprived. No difference in the paths was found for age. The impact of osteoarthritis appears to vary with respect to gender and social deprivation but not age. This suggests both that osteoarthritis per se does not adequately explain the health outcomes observed and that different clinical approaches may be appropriate for people of different gender and levels of deprivation. Implications of Rehabilitation The ICF model appears to vary with respect to gender and social deprivation for people with osteoarthritis. The ICF model did not appear to vary with respect to age for people with osteoarthritis. Different treatments and interventions for osteoarthritis may need to be targeted for specific gender and social deprivation groups.

  20. Heat stress-induced disruption of endothelial barrier function is via PAR1 signaling and suppressed by Xuebijing injection.

    Directory of Open Access Journals (Sweden)

    Qiulin Xu

    Full Text Available Increased vascular permeability leading to acute lung injury (ALI and acute respiratory distress syndrome (ARDS is central to the pathogenesis of heatstroke. Protease-activated receptor 1 (PAR1, the receptor for thrombin, plays a key role in disruption of endothelial barrier function in response to extracellular stimuli. However, the role of PAR1 in heat stress-induced endothelial hyper-permeability is unknown. In this study, we measured PAR1 protein expression in heat-stressed human umbilical venous endothelial cells (HUVECs, investigated the influences of PAR1 on endothelial permeability, F-actin rearrangement, and moesin phosphorylation by inhibiting PAR1 with its siRNA, neutralizing antibody (anti-PAR1, specific inhibitor(RWJ56110, and Xuebijing injection (XBJ, a traditional Chinese medicine used for sepsis treatment, and evaluated the role of PAR1 in heatstroke-related ALI/ARDS in mice by suppressing PAR1 with RWJ56110, anti-PAR1and XBJ. We found that heat stress induced PAR1 protein expression 2h after heat stress in endothelial cells, caused the release of endothelial matrix metalloprotease 1, an activator of PAR1, after 60 or 120 min of heat stimulation, as well as promoted endothelial hyper-permeability and F-actin rearrangement, which were inhibited by suppressing PAR1 with RWJ56110, anti-PAR1 and siRNA. PAR1 mediated moesin phosphorylation, which caused F-actin rearrangement and disruption of endothelial barrier function. To corroborate findings from in vitro experiments, we found that RWJ56110 and the anti-PAR1 significantly decreased lung edema, pulmonary microvascular permeability, protein exudation, and leukocytes infiltrations in heatstroke mice. Additionally, XBJ was found to suppress PAR1-moesin signal pathway and confer protective effects on maintaining endothelial barrier function both in vitro and in vivo heat-stressed model, similar to those observed above with the inhibition of PAR1. These results suggest that PAR1 is a

  1. Optimal dietary protein level improved growth, disease resistance, intestinal immune and physical barrier function of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Xu, Jing; Wu, Pei; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2016-08-01

    This study investigated the effects of dietary proteins on the growth, disease resistance, intestinal immune and physical barrier functions of young grass carp (Ctenopharyngodon idella). A total of 540 young grass carp (264.11 ± 0.76 g) were fed six diets containing graded levels of protein (143.1, 176.7, 217.2, 257.5, 292.2 and 322.8 g digestible protein kg(-1) diet) for 8 weeks. After the growth trial, fish were challenged with Aeromonas hydrophila and mortalities were recorded for 14 days. The results indicated that optimal dietary protein levels: increased the production of antibacterial components, up-regulated anti-inflammatory cytokines, inhibitor of κBα, target of rapamycin and ribosomal protein S6 kinases 1 mRNA levels, whereas down-regulated pro-inflammatory cytokines, nuclear factor kappa B (NF-κB) P65, NF-κB P52, c-Rel, IκB kinase β, IκB kinase γ and eIF4E-binding proteins 2 mRNA levels in three intestinal segments of young grass carp (P dietary protein level could enhance fish intestinal immune barrier function; up-regulated the mRNA levels of tight junction complexes, B-cell lymphoma protein-2, inhibitor of apoptosis proteins, myeloid cell leukemia-1 and NF-E2-related factor 2, and increased the activities and mRNA levels of antioxidant enzymes, whereas down-regulated myosin light chain kinase, cysteinyl aspartic acid-protease 2, 3, 7, 8, 9, fatty acid synthetase ligand, apoptotic protease activating factor-1, Bcl-2 associated X protein, p38 mitogen-activated protein kinase, c-Jun N-terminal protein kinase and Kelch-like-ECH-associated protein 1b mRNA levels, and decreased reactive oxygen species, malondialdehyde and protein carbonyl contents in three intestinal segments of young grass carp (P dietary protein level could improve fish intestinal physical barrier function. Finally, the optimal dietary protein levels for the growth performance (PWG) and against enteritis morbidity of young grass carp were estimated to be 286.82 g kg(-1

  2. UPEC biomimickry at the urothelial barrier: lectin-functionalized PLGA microparticles for improved intravesical chemotherapy.

    Science.gov (United States)

    Neutsch, Lukas; Wambacher, Michael; Wirth, Eva-Maria; Spijker, Sylvia; Kählig, Hanspeter; Wirth, Michael; Gabor, Franz

    2013-06-25

    The urgent demand for more potent treatment schedules in bladder cancer (BCa) therapy calls for a refinement of the intravesical administration modalities. However, progress on drug delivery systems tailored to the penetration-hostile urothelial barrier lags behind the advancements in comparable fields. This study reports on a multimodal, carrier-based delivery concept that combines biorecognitive targeting with modified release strategies for improved intravesical chemotherapy. The plant lectin wheat germ agglutinin (WGA) was immobilized on poly(lactide-co-glycolide) (PLGA) microparticles (MP) to induce stable cytoadhesion via cellular carbohydrate chains, similar to the specific attachment mechanism utilized by uropathogenic bacteria. A panel of DNA-selective chemotherapeutics with established track record in uro-oncology was screened for physicochemical compatibility with the polymeric carrier formulation. Critical limitations in encapsulation efficiency were found for mitomycin C (MMC), doxorubicin (DOX), and gemcitabine hydrochloride (GEM), despite multiparametric optimization of the preparation conditions. In contrast, the amphiphilic 4-(N)-stearoyl prodrug of gemcitabine (GEM-C18) exhibited excellent processability with PLGA. In vitro bioassays on 5637 human BCa cells showed that the enhanced cytoadhesion of WGA-GEM-C18-PGLA-MP traces back to the specific lectin/carbohydrate interaction, and is not easily disrupted by adverse environmental factors. Owing to several synergistic effects, the combined prodrug/targeting approach resulted in strong cytostatic response even when adjusting the exposure scheme to the confined temporal conditions of instillative treatment. Our results highlight the importance of fine-tuning both pharmacokinetic and pharmacologic parameters to gain adequate impact on urothelial cancer cells, and assign promising potential to glycan-targeted delivery concepts for the intravesical route. Copyright © 2013 Elsevier B.V. All rights

  3. GPHR-dependent functions of the Golgi apparatus are essential for the formation of lamellar granules and the skin barrier.

    Science.gov (United States)

    Tarutani, Masahito; Nakajima, Kimiko; Uchida, Yoshikazu; Takaishi, Mikiro; Goto-Inoue, Naoko; Ikawa, Masahito; Setou, Mitsutoshi; Kinoshita, Taroh; Elias, Peter M; Sano, Shigetoshi; Maeda, Yusuke

    2012-08-01

    The lumen of the Golgi apparatus is regulated to be weakly acidic, which is critical for its functions. The Golgi pH regulator (GPHR) is an anion channel essential for normal acidification of the Golgi apparatus, and is therefore required for its functions. The Golgi apparatus has been thought to be the origin of lamellar granules in the skin. To study the functional role(s) of GPHR in the skin, we established keratinocyte-specific GPHR-knockout mice using the Cre-loxP system. These mutant mice exhibited hypopigmented skin, hair loss, and scaliness. Histological examination of GPHR-knockout mice showed ballooning of the basal cells and follicular dysplasia. In addition, inflammatory cells were seen in the dermis. The expression of trans-Golgi network 46, a marker for lamellar bodies, and kallikrein 7, a protein within lamellar bodies, is diminished in GPHR-knockout mouse skin. Examination by electron microscopy revealed that keratinocytes produced aberrant lamellar bodies. The transepidermal water loss of these knockout mice was increased compared with wild-type mice. Moreover, expression of cathelicidin-related antimicrobial peptide (CRAMP) in the skin was diminished. These results suggest that GPHR is essential for the homeostasis of the epidermis including the formation of lamellar bodies and for the barrier function.

  4. Revised M06-L functional for improved accuracy on chemical reaction barrier heights, noncovalent interactions, and solid-state physics

    Science.gov (United States)

    Wang, Ying; Jin, Xinsheng; Yu, Haoyu S.; Truhlar, Donald G.; He, Xiao

    2017-08-01

    We present the revM06-L functional, which we designed by optimizing against a larger database than had been used for Minnesota 2006 local functional (M06-L) and by using smoothness restraints. The optimization strategy reduced the number of parameters from 34 to 31 because we removed some large terms that increased the required size of the quadrature grid and the number of self-consistent-field iterations. The mean unsigned error (MUE) of revM06-L on 422 chemical energies is 3.07 kcal/mol, which is improved from 3.57 kcal/mol calculated by M06-L. The MUE of revM06-L for the chemical reaction barrier height database (BH76) is 1.98 kcal/mol, which is improved by more than a factor of 2 with respect to the M06-L functional. The revM06-L functional gives the best result among local functionals tested for the noncovalent interaction database (NC51), with an MUE of only 0.36 kcal/mol, and the MUE of revM06-L for the solid-state lattice constant database (LC17) is half that for M06-L. The revM06-L functional also yields smoother potential curves, and it predicts more-accurate results than M06-L for seven out of eight diversified test sets not used for parameterization. We conclude that the revM06-L functional is well suited for a broad range of applications in chemistry and condensed-matter physics.

  5. Host Epithelial Interactions with Helicobacter Pylori: A Role for Disrupted Gastric Barrier Function in the Clinical Outcome of Infection?

    Directory of Open Access Journals (Sweden)

    Andre G Buret

    2005-01-01

    Full Text Available Infection of the human stomach with Helicobacter pylori may develop into gastritis, ulceration, adenocarcinoma and mucosal lymphomas. The pathogenic mechanisms that determine the clinical outcome from this microbial-epithelial interaction remain poorly understood. An increasing number of reports suggests that disruptions of epithelial barrier function may contribute to pathology and postinfectious complications in a variety of gastrointestinal infections. The aim of this review is to critically discuss the implications of H pylori persistence on gastric disease, with emphasis on the role of myosin light chain kinase, claudins and matrix metalloproteinases in gastric permeability defects, and their contribution to the development of cancer. These mechanisms and the associated signalling events may represent novel therapeutic targets to control disease processes induced by H pylori, a microbial pathogen that colonizes the stomach of over 50% of the human population.

  6. Permeating disciplines: Overcoming barriers between molecular simulations and classical structure-function approaches in biological ion transport.

    Science.gov (United States)

    Howard, Rebecca J; Carnevale, Vincenzo; Delemotte, Lucie; Hellmich, Ute A; Rothberg, Brad S

    2018-04-01

    Ion translocation across biological barriers is a fundamental requirement for life. In many cases, controlling this process-for example with neuroactive drugs-demands an understanding of rapid and reversible structural changes in membrane-embedded proteins, including ion channels and transporters. Classical approaches to electrophysiology and structural biology have provided valuable insights into several such proteins over macroscopic, often discontinuous scales of space and time. Integrating these observations into meaningful mechanistic models now relies increasingly on computational methods, particularly molecular dynamics simulations, while surfacing important challenges in data management and conceptual alignment. Here, we seek to provide contemporary context, concrete examples, and a look to the future for bridging disciplinary gaps in biological ion transport. This article is part of a Special Issue entitled: Beyond the Structure-Function Horizon of Membrane Proteins edited by Ute Hellmich, Rupak Doshi and Benjamin McIlwain. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Effects of Locally Applied Glycerol and Xylitol on the Hydration, Barrier Function and Morphological Parameters of the Skin.

    Science.gov (United States)

    Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor

    2017-02-08

    Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.

  8. Evolution of cement based materials in a repository for radioactive waste and their chemical barrier function

    Energy Technology Data Exchange (ETDEWEB)

    Kienzler, Bernhard; Metz, Volker; Schlieker, Martina; Bohnert, Elke [Karlsruhe Institute of Technology (KIT), Eggenstein-Leopoldshafen (Germany). Inst. fuer Nukleare Entsorgung (INE)

    2015-07-01

    The use of cementitious materials in nuclear waste management is quite widespread. It covers the solidification of low/intermediate-level liquid as well as solid wastes (e.g. laboratory wastes) and serves as shielding. For both high-level and intermediate-low level activity repositories, cement/concrete likewise plays an important role. It is used as construction material for underground and surface disposals, but more importantly it serves as barrier or sealing material. For the requirements of waste conditioning, special cement mixtures have been developed. These include special mixtures for the solidification of evaporator concentrates, borate binding additives and for spilling solid wastes. In recent years, low-pH cements were strongly discussed especially for repository applications, e.g. (Celine CAU DIT COUMES 2008; Garcia-Sineriz, et al. 2008). Examples for relevant systems are Calcium Silicate Cements (ordinary Portland cement (OPC) based) or Calcium Aluminates Cements (CAC). Low-pH pore solutions are achieved by reduction of the portlandite content by partial substitution of OPC by mineral admixtures with high silica content. The blends follow the pozzolanic reaction consuming Ca(OH){sub 2}. Potential admixtures are silica fume (SF) and fly ashes (FA). In these mixtures, super plasticizers are required, consisting of polycarboxilate or naphthalene formaldehyde as well as various accelerating admixtures (Garcia-Sineriz, et al. 2008). The pH regime of concrete/cement materials may stabilize radionuclides in solution. Newly formed alteration products retain or release radionuclides. An important degradation product of celluloses in cement is iso-saccharin acid. According to Glaus 2004 (Glaus and van Loon 2004), it reacts with radionuclides forming dissolved complexes. Apart from potentially impacting radionuclide solubility limitations, concrete additives, radionuclides or other strong complexants compete for surface sites for sorbing onto cement phases. In

  9. Prohibitin-2 Depletion Unravels Extra-Mitochondrial Functions at the Kidney Filtration Barrier.

    Science.gov (United States)

    Ising, Christina; Bharill, Puneet; Brinkkoetter, Sibylle; Brähler, Sebastian; Schroeter, Christina; Koehler, Sybille; Hagmann, Henning; Merkwirth, Carsten; Höhne, Martin; Müller, Roman U; Fabretti, Francesca; Schermer, Bernhard; Bloch, Wilhelm; Kerjaschki, Dontscho; Kurschat, Christine E; Benzing, Thomas; Brinkkoetter, Paul T

    2016-05-01

    Mitochondrial fusion is essential for maintenance of mitochondrial function and requires the prohibitin ring complex subunit prohibitin-2 (PHB2) at the mitochondrial inner membrane. Loss of the stomatin/PHB/flotillin/HflK/C (SPFH) domain containing protein PHB2 causes mitochondrial dysfunction and defective mitochondria-mediated signaling, which is implicated in a variety of human diseases, including progressive renal disease. Here, we provide evidence of additional, extra-mitochondrial functions of this membrane-anchored protein. Immunofluorescence and immunogold labeling detected PHB2 at mitochondrial membranes and at the slit diaphragm, a specialized cell junction at the filtration slit of glomerular podocytes. PHB2 coprecipitated with podocin, another SPFH domain-containing protein, essential for the assembly of the slit diaphragm protein-lipid supercomplex. Consistent with an evolutionarily conserved extra-mitochondrial function, the ortholog of PHB2 in Caenorhabditis elegans was also not restricted to mitochondria but colocalized with the mechanosensory complex that requires the podocin ortholog MEC2 for assembly. Knockdown of phb-2 partially phenocopied loss of mec-2 in touch neurons of the nematode, resulting in impaired gentle touch sensitivity. Collectively, these data indicate that, besides its established role in mitochondria, PHB2 may have an additional function in conserved protein-lipid complexes at the plasma membrane. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  10. Advanced age is not a barrier to creating a functional arteriovenous fistula: a retrospective study.

    Science.gov (United States)

    Beaulieu, Monica C; Dumaine, Chance S; Romann, Alexandra; Kiaii, Mercedeh

    2017-07-14

    Arteriovenous fistulas (AVFs) are the recommended form of vascular access for hemodialysis. However, controversy exists regarding whether AVFs are suitable for elderly patients. Single-center retrospective review to investigate the impact of age on AVF outcomes. Five hundred and twenty-five patients with AVF creation were stratified based on age 75 years. AVF outcomes including primary failure, AVF patency (primary, secondary, and functional), and AVF complications were studied for 3 years following AVF creation. The cohort was 63% male, 44% Caucasian, and 55% had diabetes or cardiovascular disease. 39% were aged 75 years. No differences in rates of primary failure, loss of primary patency, complications, or need for intervention were observed between age groups. There was a significant association of age with secondary patency and functional patency, with age >75 being an independent risk factor for shortened lifespan of the fistula. For patients aged >75 years, secondary patency at 3 years was 64% compared to 75%-78% for younger patients. Functional patency at 2 years was 69% for those aged >75 years compared to 78%-81% for younger patients. We found no difference in AVF maturation, primary patency, complications, or interventions in those over the age of 75 compared to younger counterparts. While secondary and functional patency rates were significantly lower in those aged >75 years, the magnitude of difference is likely not clinically relevant. Therefore, we recommend that advanced age alone should not preclude patients from AVF creation.

  11. On the contribution of mucosal mast cells to the regulation of mouse intestinal barrier function

    NARCIS (Netherlands)

    Rychter, J.

    2010-01-01

    The primary functions of the small intestine are the digestion and transport of luminal content and the absorption of nutrients. During these processes the intestinal mucosa is exposed to various ingested and resident pathogens. The ability of the intestinal wall to prevent transmucosal passage of

  12. Development of a vernix caseosa substitute : a novel strategy to improve skin barrier function and repair

    NARCIS (Netherlands)

    Rißmann, Robert

    2009-01-01

    Vernix caseosa (VC) is the cheesy, white cream that covers the skin of the human fetus and the newborn. VC is a protective cream, which consists of water containing dead cells that are embedded in lipids. This natural cream is suggested to feature multiple biological functions such as facilitating

  13. Keratin 76 is required for tight junction function and maintenance of the skin barrier.

    Directory of Open Access Journals (Sweden)

    Tia DiTommaso

    2014-10-01

    Full Text Available Keratins are cytoskeletal intermediate filament proteins that are increasingly being recognised for their diverse cellular functions. Here we report the consequences of germ line inactivation of Keratin 76 (Krt76 in mice. Homozygous disruption of this epidermally expressed gene causes neonatal skin flaking, hyperpigmentation, inflammation, impaired wound healing, and death prior to 12 weeks of age. We show that this phenotype is associated with functionally defective tight junctions that are characterised by mislocalization of the integral protein CLDN1. We further demonstrate that KRT76 interacts with CLDN1 and propose that this interaction is necessary to correctly position CLDN1 in tight junctions. The mislocalization of CLDN1 has been associated in various dermopathies, including the inflammatory disease, psoriasis. These observations establish a previously unknown connection between the intermediate filament cytoskeleton network and tight junctions and showcase Krt76 null mice as a possible model to study aberrant tight junction driven skin diseases.

  14. Keratin 76 is required for tight junction function and maintenance of the skin barrier.

    Science.gov (United States)

    DiTommaso, Tia; Cottle, Denny L; Pearson, Helen B; Schlüter, Holger; Kaur, Pritinder; Humbert, Patrick O; Smyth, Ian M

    2014-10-01

    Keratins are cytoskeletal intermediate filament proteins that are increasingly being recognised for their diverse cellular functions. Here we report the consequences of germ line inactivation of Keratin 76 (Krt76) in mice. Homozygous disruption of this epidermally expressed gene causes neonatal skin flaking, hyperpigmentation, inflammation, impaired wound healing, and death prior to 12 weeks of age. We show that this phenotype is associated with functionally defective tight junctions that are characterised by mislocalization of the integral protein CLDN1. We further demonstrate that KRT76 interacts with CLDN1 and propose that this interaction is necessary to correctly position CLDN1 in tight junctions. The mislocalization of CLDN1 has been associated in various dermopathies, including the inflammatory disease, psoriasis. These observations establish a previously unknown connection between the intermediate filament cytoskeleton network and tight junctions and showcase Krt76 null mice as a possible model to study aberrant tight junction driven skin diseases.

  15. Analysis and identification of time-invariant systems, time-varying systems, and multi-delay systems using orthogonal hybrid functions theory and algorithms with Matlab

    CERN Document Server

    Deb, Anish; Sarkar, Gautam

    2016-01-01

    This book introduces a new set of orthogonal hybrid functions (HF) which approximates time functions in a piecewise linear manner which is very suitable for practical applications. The book presents an analysis of different systems namely, time-invariant system, time-varying system, multi-delay systems---both homogeneous and non-homogeneous type- and the solutions are obtained in the form of discrete samples. The book also investigates system identification problems for many of the above systems. The book is spread over 15 chapters and contains 180 black and white figures, 18 colour figures, 85 tables and 56 illustrative examples. MATLAB codes for many such examples are included at the end of the book.

  16. Modulation of ocular surface glycocalyx barrier function by a galectin-3 N-terminal deletion mutant and membrane-anchored synthetic glycopolymers.

    Directory of Open Access Journals (Sweden)

    Jerome Mauris

    Full Text Available BACKGROUND: Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. CONCLUSIONS/SIGNIFICANCE: These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery.

  17. Modulation of Ocular Surface Glycocalyx Barrier Function by a Galectin-3 N-terminal Deletion Mutant and Membrane-Anchored Synthetic Glycopolymers

    Science.gov (United States)

    Mauris, Jerome; Mantelli, Flavio; Woodward, Ashley M.; Cao, Ziyhi; Bertozzi, Carolyn R.; Panjwani, Noorjahan; Godula, Kamil; Argüeso, Pablo

    2013-01-01

    Background Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. Methodology/Principal Findings Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. Conclusions/Significance These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery. PMID:23977277

  18. Microbial Community and Functional Structure Significantly Varied among Distinct Types of Paddy Soils But Responded Differently along Gradients of Soil Depth Layers.

    Science.gov (United States)

    Bai, Ren; Wang, Jun-Tao; Deng, Ye; He, Ji-Zheng; Feng, Kai; Zhang, Li-Mei

    2017-01-01

    Paddy rice fields occupy broad agricultural area in China and cover diverse soil types. Microbial community in paddy soils is of great interest since many microorganisms are involved in soil functional processes. In the present study, Illumina Mi-Seq sequencing and functional gene array (GeoChip 4.2) techniques were combined to investigate soil microbial communities and functional gene patterns across the three soil types including an Inceptisol (Binhai), an Oxisol (Leizhou), and an Ultisol (Taoyuan) along four profile depths (up to 70 cm in depth) in mesocosm incubation columns. Detrended correspondence analysis revealed that distinctly differentiation in microbial community existed among soil types and profile depths, while the manifest variance in functional structure was only observed among soil types and two rice growth stages, but not across profile depths. Along the profile depth within each soil type, Acidobacteria, Chloroflexi, and Firmicutes increased whereas Cyanobacteria, β-proteobacteria, and Verrucomicrobia declined, suggesting their specific ecophysiological properties. Compared to bacterial community, the archaeal community showed a more contrasting pattern with the predominant groups within phyla Euryarchaeota, Thaumarchaeota, and Crenarchaeota largely varying among soil types and depths. Phylogenetic molecular ecological network (pMEN) analysis further indicated that the pattern of bacterial and archaeal communities interactions changed with soil depth and the highest modularity of microbial community occurred in top soils, implying a relatively higher system resistance to environmental change compared to communities in deeper soil layers. Meanwhile, microbial communities had higher connectivity in deeper soils in comparison with upper soils, suggesting less microbial interaction in surface soils. Structure equation models were developed and the models indicated that pH was the most representative characteristics of soil type and identified as

  19. Microbial Community and Functional Structure Significantly Varied among Distinct Types of Paddy Soils But Responded Differently along Gradients of Soil Depth Layers

    Directory of Open Access Journals (Sweden)

    Ren Bai

    2017-05-01

    Full Text Available Paddy rice fields occupy broad agricultural area in China and cover diverse soil types. Microbial community in paddy soils is of great interest since many microorganisms are involved in soil functional processes. In the present study, Illumina Mi-Seq sequencing and functional gene array (GeoChip 4.2 techniques were combined to investigate soil microbial communities and functional gene patterns across the three soil types including an Inceptisol (Binhai, an Oxisol (Leizhou, and an Ultisol (Taoyuan along four profile depths (up to 70 cm in depth in mesocosm incubation columns. Detrended correspondence analysis revealed that distinctly differentiation in microbial community existed among soil types and profile depths, while the manifest variance in functional structure was only observed among soil types and two rice growth stages, but not across profile depths. Along the profile depth within each soil type, Acidobacteria, Chloroflexi, and Firmicutes increased whereas Cyanobacteria, β-proteobacteria, and Verrucomicrobia declined, suggesting their specific ecophysiological properties. Compared to bacterial community, the archaeal community showed a more contrasting pattern with the predominant groups within phyla Euryarchaeota, Thaumarchaeota, and Crenarchaeota largely varying among soil types and depths. Phylogenetic molecular ecological network (pMEN analysis further indicated that the pattern of bacterial and archaeal communities interactions changed with soil depth and the highest modularity of microbial community occurred in top soils, implying a relatively higher system resistance to environmental change compared to communities in deeper soil layers. Meanwhile, microbial communities had higher connectivity in deeper soils in comparison with upper soils, suggesting less microbial interaction in surface soils. Structure equation models were developed and the models indicated that pH was the most representative characteristics of soil type and

  20. Effects of ambient air particulate exposure on blood-gas barrier permeability and lung function

    DEFF Research Database (Denmark)

    Bräuner, Elvira Vaclavik; Mortensen, Jann; Møller, Peter

    2009-01-01

    Particulate air pollution is associated with increased risk of pulmonary diseases and detrimental outcomes related to the cardiovascular system, including altered vessel functions. This study's objective was too evaluate the effects of ambient particle exposure on the blood-gas permeability, lung...... function and Clara cell 16 (CC16) protein release in healthy young subjects. Twenty-nine nonsmokers participated in a randomized, two-factor crossover study with or without biking exercise for 180 min and with 24-h exposure to particle-rich (6169-15,362 particles/cm(3); 7.0-11.6 microg/m(3) PM(2.5); 7.......5-15.8 microg/m(3) PM(10-2.5)) or filtered (91-542 particles/cm(3)) air collected above a busy street. The clearance rate of aerosolized (99m)Tc-labeled diethylenetriamine pentaacetic acid ((99m)Tc-DTPA) was measured as an index for the alveolar epithelial membrane integrity and permeability of the lung blood-gas...

  1. Multistability of memristive Cohen-Grossberg neural networks with non-monotonic piecewise linear activation functions and time-varying delays.

    Science.gov (United States)

    Nie, Xiaobing; Zheng, Wei Xing; Cao, Jinde

    2015-11-01

    The problem of coexistence and dynamical behaviors of multiple equilibrium points is addressed for a class of memristive Cohen-Grossberg neural networks with non-monotonic piecewise linear activation functions and time-varying delays. By virtue of the fixed point theorem, nonsmooth analysis theory and other analytical tools, some sufficient conditions are established to guarantee that such n-dimensional memristive Cohen-Grossberg neural networks can have 5(n) equilibrium points, among which 3(n) equilibrium points are locally exponentially stable. It is shown that greater storage capacity can be achieved by neural networks with the non-monotonic activation functions introduced herein than the ones with Mexican-hat-type activation function. In addition, unlike most existing multistability results of neural networks with monotonic activation functions, those obtained 3(n) locally stable equilibrium points are located both in saturated regions and unsaturated regions. The theoretical findings are verified by an illustrative example with computer simulations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Impaired barrier function by dietary fructo-oligosaccharides (FOS in rats is accompanied by increased colonic mitochondrial gene expression

    Directory of Open Access Journals (Sweden)

    Kramer Evelien

    2008-03-01

    well as three other peptide hormone genes; peptide YY, pancreatic polypeptide and cholecystokinin. Conclusion We conclude that altered energy metabolism may underly colonic barrier function disruption due to FOS feeding in rats.

  3. Acute Effects of Viral Exposure on P-Glycoprotein Function in the Mouse Fetal Blood-Brain Barrier

    Directory of Open Access Journals (Sweden)

    Enrrico Bloise

    2017-02-01

    Full Text Available Background/Aims: Viral infection during pregnancy is known to affect the fetal brain. The toll-like receptor (TLR-3 is a pattern recognition receptor activated by viruses known to elicit adverse fetal neurological outcomes. The P-glycoprotein (P-gp efflux transporter protects the developing fetus by limiting the transfer of substrates across both the placenta and the fetal blood-brain barrier (BBB. As such, inhibition of P-gp at these blood-barrier sites may result in increased exposure of the developing fetus to environmental toxins and xenobiotics present in the maternal circulation. We hypothesized that viral exposure during pregnancy would impair P-gp function in the placenta and in the developing BBB. Here we investigated whether the TLR-3 ligand, polyinosinic:polycytidylic acid (PolyI:C, increased accumulation of one P-gp substrate in the fetus and in the developing fetal brain. Methods: Pregnant C57BL/6 mice (GD15.5 were injected (i.p. with PolyI:C (5 mg/kg or 10 mg/kg or vehicle (saline. [3H]digoxin (P-gp substrate was injected (i.v. 3 or 23h post-treatment and animals were euthanized 1h later. Maternal plasma, ‘fetal-units’ (fetal membranes, amniotic fluid and whole fetus, and fetal brains were collected. Results: PolyI:C exposure (4h significantly elevated maternal plasma IL-6 (P<0.001 and increased [3H]digoxin accumulation in the fetal brain (P<0.05. In contrast, 24h after PolyI:C exposure, no effect on IL-6 or fetal brain accumulation of P-gp substrate was observed. Conclusion: Viral infection modeled by PolyI:C causes acute increases in fetal brain accumulation of P-gp substrates and by doing so, may increase fetal brain exposure to xenobiotics and environmental toxins present in the maternal circulation.

  4. Varying coefficient function models to explore interactions between maternal nutritional status and prenatal methylmercury toxicity in the Seychelles Child Development Nutrition Study

    Energy Technology Data Exchange (ETDEWEB)

    Lynch, Miranda L., E-mail: Miranda_Lynch@urmc.rochester.edu [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States); Huang, Li-Shan [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States); Cox, Christopher [Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Strain, J.J. [University of Ulster, Coleraine, Northern Ireland (United Kingdom); Myers, Gary J. [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States); Bonham, Maxine P. [University of Ulster, Coleraine, Northern Ireland (United Kingdom); Shamlaye, Conrad F. [Ministry of Health, Republic of Seychelles (Seychelles); Stokes-Riner, Abbie [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States); Wallace, Julie M.W.; Duffy, Emeir M. [University of Ulster, Coleraine, Northern Ireland (United Kingdom); Clarkson, Thomas W.; Davidson, Philip W. [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States)

    2011-01-15

    Maternal consumption of fish during the gestational period exposes the fetus to both nutrients, especially the long-chain polyunsaturated fatty acids (LCPUFAs), believed to be beneficial for fetal brain development, as well as to the neurotoxicant methylmercury (MeHg). We recently reported that nutrients present in fish may modify MeHg neurotoxicity. Understanding the apparent interaction of MeHg exposure and nutrients present in fish is complicated by the limitations of modeling methods. In this study we fit varying coefficient function models to data from the Seychelles Child Development Nutrition Study (SCDNS) cohort to assess the association of dietary nutrients and children's development. This cohort of mother-child pairs in the Republic of Seychelles had fish consumption averaging 9 meals per week. Maternal nutritional status was assessed for five different nutritional components known to be present in fish (n-3 LCPUFA, n-6 LCPUFA, iron status, iodine status, and choline) and associated with children's neurological development. We also included prenatal MeHg exposure (measured in maternal hair). We examined two child neurodevelopmental outcomes (Bayley Scales Infant Development-II (BSID-II) Mental Developmental Index (MDI) and Psychomotor Developmental Index (PDI)), each administered at 9 and at 30 months. The varying coefficient models allow the possible interactions between each nutritional component and MeHg to be modeled as a smoothly varying function of MeHg as an effect modifier. Iron, iodine, choline, and n-6 LCPUFA had little or no observable modulation at different MeHg exposures. In contrast the n-3 LCPUFA docosahexaenoic acid (DHA) had beneficial effects on the BSID-II PDI that were reduced or absent at higher MeHg exposures. This study presents a useful modeling method that can be brought to bear on questions involving interactions between covariates, and illustrates the continuing importance of viewing fish consumption during pregnancy

  5. Functionalization of Hydrogen-free Diamond-like Carbon Films using Open-air Dielectric Barrier Discharge Atmospheric Plasma Treatments

    Energy Technology Data Exchange (ETDEWEB)

    Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA; Instituto de Materiales de Madrid, C.S.I.C., Cantoblanco, 28049 Madrid, Spain; Instituto de Quimica-Fisica" Rocasolano" C.S.I.C., 28006 Madrid, Spain; Mahasarakham University, Mahasarakham 44150, Thailand; CASTI, CNR-INFM Regional Laboratory, L' Aquila 67100, Italy; SUNY Upstate Medical University, Syracuse, NY 13210, USA; Endrino, Jose; Endrino, J. L.; Marco, J. F.; Poolcharuansin, P.; Phani, A.R.; Allen, M.; Albella, J. M.; Anders, A.

    2007-12-28

    A dielectric barrier discharge (DBD) technique has been employed to produce uniform atmospheric plasmas of He and N2 gas mixtures in open air in order to functionalize the surface of filtered-arc deposited hydrogen-free diamond-like carbon (DLC) films. XPS measurements were carried out on both untreated and He/N2 DBD plasma treated DLC surfaces. Chemical states of the C 1s and N 1s peaks were collected and used to characterize the surface bonds. Contact angle measurements were also used to record the short- and long-term variations in wettability of treated and untreated DLC. In addition, cell viability tests were performed to determine the influence of various He/N2 atmospheric plasma treatments on the attachment of osteoblast MC3T3 cells. Current evidence shows the feasibility of atmospheric plasmas in producing long-lasting variations in the surface bonding and surface energy of hydrogen-free DLC and consequently the potential for this technique in the functionalization of DLC coated devices.

  6. Asymmetric Barrier Lyapunov Function-Based Wheel Slip Control for Antilock Braking System

    Directory of Open Access Journals (Sweden)

    Xiaolei Chen

    2015-01-01

    Full Text Available As an important device of the aircraft landing system, the antilock braking system (ABS has a function to avoid aircraft wheels self-locking. To deal with the strong nonlinear characteristics, complex nonlinear control schemes are applied in ABS. However, none of existing control schemes focus on the braking operating status, which directly reflects wheels self-locking degree. In this paper, the braking operating status region is divided into three regions: the healthy region, the light slip region, and the deep slip region. An ABLF-based wheel slip controller is proposed for ABS to constrain the braking system operating status in the healthy region and the light slip region. Therefore the ABS will be prevented from operating in the deep slip region. Under the proposed control scheme, self-locking is avoided completely and zero steady state error tracking of the wheel optimal slip ratio is implemented. The Hardware-In-Loop (HIL experiments have validated the effectiveness of the proposed controller.

  7. Formation and barrier function of tight junctions in human ovarian surface epithelium.

    Science.gov (United States)

    Zhu, Yihong; Maric, Julia; Nilsson, Mikael; Brännström, Mats; Janson, P-O; Sundfeldt, Karin

    2004-07-01

    The normal ovarian surface epithelium (OSE) is a primitive epithelium made up by a single layer of mesothelial-type epithelial cells. When these cells get trapped in the ovarian stroma, expression of epithelial specific markers, such as E-cadherin, are induced. Most epithelial cells are also characterized by the ability to form tight junctions (TJ). Incomplete TJ have earlier been demonstrated in the OSE by electron microscopy studies. We have investigated expression and localization of the TJ proteins ZO-1, occludin, and claudin-1 in tissue biopsies from normal human ovaries and OSE in culture. The dynamics of TJ formation were studied in human OSE cultured on porous filters in culture inserts by measuring trans epithelial resistance (TER) including Ca(2+) switch experiments. Confluent OSE cells were also analyzed by electron microscopy. The results show that normal human OSE has expression of all three TJ proteins investigated. These proteins, ZO-1, occludin, and claudin-1, were localized to OSE cell borders both in ovarian biopsies and in cultured OSE. There was no difference in this regard between fertile and postmenopausal women. Cells in culture were polarized and presented junctional complexes seen by electron microscopy. In the Ca(2+) switch experiments, removing free Ca(2+) transiently, TER decreased significantly (P < 0.05) in the Ca(2+)-free group compared with nontreated OSE. TER was fully restored after 24 h. N-cadherin but not E-cadherin was expressed in the OSE and localized to the cell borders. We conclude that normal human OSE express and form functional TJ both in vivo and vitro. This report also describes a method to study the influence of ovarian-derived mediators on TJ in cultured OSE.

  8. Starting a new conversation: Engaging Veterans with spinal cord injury in discussions of what function means to them, the barriers/facilitators they encounter, and the adaptations they use to optimize function.

    Science.gov (United States)

    Hill, Jennifer N; Balbale, Salva; Lones, Keshonna; LaVela, Sherri L

    2017-01-01

    Assessments of function in persons with spinal cord injury (SCI) often utilize pre-defined constructs and measures without consideration of patient context, including how patients define function and what matters to them. We utilized photovoice to understand how individuals define function, facilitators and barriers to function, and adaptations to support functioning. Veterans with SCI were provided with cameras and guidelines to take photographs of things that: (1) help with functioning, (2) are barriers to function, and (3) represent adaptations used to support functioning. Interviews to discuss photographs followed and were audio-recorded, transcribed, and analyzed using grounded-thematic coding. Nvivo 8 was used to store and organize data. Participants (n = 9) were male (89%), Caucasian (67%), had paraplegia (75%), averaged 64 years of age, and were injured, on average, for 22 years. Function was described in several ways: the concept of 'normalcy,' aspects of daily living, and ability to be independent. Facilitators included: helpful tools, physical therapy/therapists, transportation, and caregivers. Barriers included: wheelchair-related issues and interior/exterior barriers both in the community and in the hospital. Examples of adaptations included: traditional examples like ramps, and also creative examples like the use of rubber bands on a can to help with grip. Patient-perspectives elicited in-depth information that expanded the common definition of function by highlighting the concept of "normality," facilitators and barriers to function, and adaptations to optimize function. These insights emphasize function within a patient-context, emphasizing a holistic definition of function that can be used to develop personalized, patient-driven care plans. Published by Elsevier Inc.

  9. Influence of thermally oxidized vegetable oils and animal fats on intestinal barrier function and immune variables in young pigs.

    Science.gov (United States)

    Liu, P; Kerr, B J; Weber, T E; Chen, C; Johnston, L J; Shurson, G C

    2014-07-01

    To evaluate the effect of feeding thermally oxidized lipids on metabolic oxidative status, gut barrier function, and immune response of young pigs, 108 barrows (6.67 ± 0.03 kg BW) were assigned to 12 dietary treatments in a 4 × 3 factorial arrangement in addition to a corn-soybean meal control diet. Main effects were 4 lipid sources (corn oil [CN], canola oil [CA], poultry fat [PF], and tallow [TL]) and 3 oxidation levels (original lipids [OL], slow oxidation [SO] of lipids heated for 72 h at 95°C, or rapid oxidation [RO] of lipids heated for 7 h at 185°C). Pigs were provided ad libitum access to diets for 28 d followed by controlled feed intake for 10 d. After a 24-h fast on d 38, serum was collected and analyzed for α-tocopherol (α-T), thiobarbituric acid reactive substances (TBARS), endotoxin, haptoglobin, IgA, and IgG. On the same day following serum collection, lactulose and mannitol were fed and subsequently measured in the urine to evaluate gut permeability. There was a source × peroxidation interaction for serum α-T concentration where pigs fed SO or RO had decreased (P < 0.05) serum α-T concentration compared with pigs fed OL in CA and CN diets but not in pigs fed PF and TL diets. There was no source × peroxidation interaction for serum TBARS, but among all lipid sources, pigs fed SO or RO lipids had increased (P < 0.05) serum TBARS compared with pigs fed OL. In addition, pigs fed CN or CA had greater (P < 0.05) serum TBARS compared with pigs fed PF or TL diets. There were no lipid source × peroxidation level interaction or lipid source or peroxidation level effects on serum endotoxin, haptoglobin, IgA, or IgG. Pigs fed lipid supplemented diets tended to have increased serum endotoxin (P = 0.06), IgA (P = 0.10), and IgG (P = 0.09) compared with pigs fed the control diet. There were no lipid source × peroxidation level interaction or lipid source or peroxidation level effects on urinary TBARS and lactulose to mannitol ratio. Compared with pigs

  10. Dietary Lactobacillus rhamnosus GG Supplementation Improves the Mucosal Barrier Function in the Intestine of Weaned Piglets Challenged by Porcine Rotavirus.

    Directory of Open Access Journals (Sweden)

    Xiangbing Mao

    Full Text Available Lactobacillus rhamnosus GG (LGG has been regarded as a safe probiotic strain. The aim of this study was to investigate whether dietary LGG supplementation could alleviate diarrhea via improving jejunal mucosal barrier function in the weaned piglets challenged by RV, and further analyze the potential roles for apoptosis of jejunal mucosal cells and intestinal microbiota. A total of 24 crossbred barrows weaned at 21 d of age were assigned randomly to 1 of 2 diets: the basal diet and LGG supplementing diet. On day 11, all pigs were orally infused RV or the sterile essential medium. RV infusion increased the diarrhea rate, increased the RV-Ab, NSP4 and IL-2 concentrations and the Bax mRNA levels of jejunal mucosa (P<0.05, decreased the villus height, villus height: crypt depth, the sIgA, IL-4 and mucin 1 concentrations and the ZO-1, occludin and Bcl-2 mRNA levels of jejunal mucosa (P<0.05, and affected the microbiota of ileum and cecum (P<0.05 in the weaned pigs. Dietary LGG supplementation increased the villus height and villus height: crypt depth, the sIgA, IL-4, mucin 1 and mucin 2 concentrations, and the ZO-1, occludin and Bcl-2 mRNA levels of the jejunal mucosa (P<0.05 reduced the Bax mRNA levels of the jejunal mucosa (P<0.05 in weaned pigs. Furthermore, dietary LGG supplementation alleviated the increase of diarrhea rate in the weaned pigs challenged by RV (P<0.05, and relieve the effect of RV infection on the villus height, crypt depth and the villus height: crypt depth of the jejunal mucosa (P<0.05, the NSP4, sIgA, IL-2, IL-4, mucin 1 and mucin 2 concentrations of jejunal mucosa (P<0.05, the ZO-1, occludin, Bax and Bcl-2 mRNA levels of the jejunal mucosa (P<0.05, and the microbiota of ileum and cecum (P<0.05 in the weaned pigs challenged by RV. These results suggest that supplementing LGG in diets alleviated the diarrhea of weaned piglets challenged by RV via inhibiting the virus multiplication and improving the jejunal mucosal barrier

  11. Characterization and modelling of the spatially- and spectrally-varying point-spread function in hyperspectral imaging systems for computational correction of axial optical aberrations

    Science.gov (United States)

    Špiclin, Žiga; Bürmen, Miran; Pernuš, Franjo; Likar, Boštjan

    2012-03-01

    Spatial resolution of hyperspectral imaging systems can vary significantly due to axial optical aberrations that originate from wavelength-induced index-of-refraction variations of the imaging optics. For systems that have a broad spectral range, the spatial resolution will vary significantly both with respect to the acquisition wavelength and with respect to the spatial position within each spectral image. Variations of the spatial resolution can be effectively characterized as part of the calibration procedure by a local image-based estimation of the pointspread function (PSF) of the hyperspectral imaging system. The estimated PSF can then be used in the image deconvolution methods to improve the spatial resolution of the spectral images. We estimated the PSFs from the spectral images of a line grid geometric caliber. From individual line segments of the line grid, the PSF was obtained by a non-parametric estimation procedure that used an orthogonal series representation of the PSF. By using the non-parametric estimation procedure, the PSFs were estimated at different spatial positions and at different wavelengths. The variations of the spatial resolution were characterized by the radius and the fullwidth half-maximum of each PSF and by the modulation transfer function, computed from images of USAF1951 resolution target. The estimation and characterization of the PSFs and the image deconvolution based spatial resolution enhancement were tested on images obtained by a hyperspectral imaging system with an acousto-optic tunable filter in the visible spectral range. The results demonstrate that the spatial resolution of the acquired spectral images can be significantly improved using the estimated PSFs and image deconvolution methods.

  12. Fluoxetine and vitamin C synergistically inhibits blood-spinal cord barrier disruption and improves functional recovery after spinal cord injury.

    Science.gov (United States)

    Lee, Jee Y; Choi, Hae Y; Yune, Tae Y

    2016-10-01

    Recently we reported that fluoxetine (10 mg/kg) improves functional recovery by attenuating blood spinal cord barrier (BSCB) disruption after spinal cord injury (SCI). Here we investigated whether a low-dose of fluoxetine (1 mg/kg) and vitamin C (100 mg/kg), separately not possessing any protective effect, prevents BSCB disruption and improves functional recovery when combined. After a moderate contusion injury at T9 in rat, a low-dose of fluoxetine and vitamin C, or the combination of both was administered intraperitoneally immediately after SCI and further treated once a day for 14 d. Co-treatment with fluoxetine and vitamin C significantly attenuated BSCB permeability at 1 d after SCI. When only fluoxetine or vitamin C was treated after injury, however, there was no effect on BSCB disruption. Co-treatment with fluoxetine and vitamin C also significantly inhibited the expression and activation of MMP-9 at 8 h and 1 d after injury, respectively, and the infiltration of neutrophils (at 1 d) and macrophages (at 5 d) and the expression of inflammatory mediators (at 2 h, 6 h, 8 h or 24 h after injury) were significantly inhibited by co-treatment with fluoxetine and vitamin C. Furthermore, the combination of fluoxetine and vitamin C attenuated apoptotic cell death at 1 d and 5 d and improved locomotor function at 5 weeks after SCI. These results demonstrate the synergistic effect combination of low-dose fluoxetine and vitamin C on BSCB disruption after SCI and furthermore support the effectiveness of the combination treatment regimen for the management of acute SCI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Evaluation of (R)-[11C]verapamil as PET tracer of P-glycoprotein function in the blood-brain barrier : kinetics and metabolism in the rat

    NARCIS (Netherlands)

    Luurtsema, Gert; Molthoff, Carla F. M.; Schuit, Robert C.; Windhorst, Albert D.; Lammertsma, Adriaan A.; Franssen, Eric J F

    There is evidence that P-glycoprotein (P-gp) in the blood-brain barrier (BBB) may be involved in the aetiology of neurological disorders. For quantification of P-gp function in vivo, (R)-[11C]verapamil can be used as a positron emission tomography (PET) tracer, provided that a mathematical model

  14. Stimulation of G protein-coupled bile acid receptor enhances vascular endothelial barrier function via activation of protein kinase A and Rac1.

    Science.gov (United States)

    Kida, Taiki; Omori, Keisuke; Hori, Masatoshi; Ozaki, Hiroshi; Murata, Takahisa

    2014-01-01

    Bile acids are end products of cholesterol metabolism, and they constantly exist at high concentrations in the blood. Since vascular endothelial cells express G protein-coupled bile acid receptor (GPBAR), bile acids potentially modulate endothelial function. Here, we investigated whether and how GPBAR agonism affects endothelial barrier function. In bovine aortic endothelial cells (BAECs), treatment with a GPBAR agonist, taurolithocholic acid (TLCA) increased the transendothelial electrical resistance. In addition, TLCA suppressed the thrombin-induced dextran infiltration through the endothelial monolayer. Knockdown of GPBAR abolished the inhibitory effect of TLCA on hyperpermeability. These results indicate that stimulation of GPBAR enhances endothelial barrier function. TLCA increased intracellular cAMP production in BAECs. Inhibition of protein kinase A (PKA) or Rac1 significantly attenuated the TLCA-induced endothelial barrier protection. TLCA induced cortical actin polymerization, which was attenuated by a Rac1 inhibitor. In vivo, local administration of TLCA into the mouse ear significantly inhibited vascular leakage and edema formation induced by croton oil or vascular endothelial growth factor. These results indicate that stimulation of GPBAR enhances endothelial barrier function by cAMP/PKA/Rac1-dependent cytoskeletal rearrangement.

  15. A method for partial volume correction of PET-imaged tumor heterogeneity using expectation maximization with a spatially varying point spread function.

    Science.gov (United States)

    Barbee, David L; Flynn, Ryan T; Holden, James E; Nickles, Robert J; Jeraj, Robert

    2010-01-07

    Tumor heterogeneities observed in positron emission tomography (PET) imaging are frequently compromised by partial volume effects which may affect treatment prognosis, assessment or future implementations such as biologically optimized treatment planning (dose painting). This paper presents a method for partial volume correction of PET-imaged heterogeneous tumors. A point source was scanned on a GE Discovery LS at positions of increasing radii from the scanner's center to obtain the spatially varying point spread function (PSF). PSF images were fit in three dimensions to Gaussian distributions using least squares optimization. Continuous expressions were devised for each Gaussian width as a function of radial distance, allowing for generation of the system PSF at any position in space. A spatially varying partial volume correction (SV-PVC) technique was developed using expectation maximization (EM) and a stopping criterion based on the method's correction matrix generated for each iteration. The SV-PVC was validated using a standard tumor phantom and a tumor heterogeneity phantom and was applied to a heterogeneous patient tumor. SV-PVC results were compared to results obtained from spatially invariant partial volume correction (SINV-PVC), which used directionally uniform three-dimensional kernels. SV-PVC of the standard tumor phantom increased the maximum observed sphere activity by 55 and 40% for 10 and 13 mm diameter spheres, respectively. Tumor heterogeneity phantom results demonstrated that as net changes in the EM correction matrix decreased below 35%, further iterations improved overall quantitative accuracy by less than 1%. SV-PVC of clinically observed tumors frequently exhibited changes of +/-30% in regions of heterogeneity. The SV-PVC method implemented spatially varying kernel widths and automatically determined the number of iterations for optimal restoration, parameters which are arbitrarily chosen in SINV-PVC. Comparing SV-PVC to SINV-PVC demonstrated

  16. Varying coefficient function models to explore interactions between maternal nutritional status and prenatal methylmercury toxicity in the Seychelles Child Development Nutrition Study

    Science.gov (United States)

    Lynch, Miranda L.; Huang, Li-Shan; Cox, Christopher; Strain, J.J.; Myers, Gary J.; Bonham, Maxine P.; Shamlaye, Conrad F.; Stokes-Riner, Abbie; Wallace, Julie M.W.; Duffy, Emeir M.; Clarkson, Thomas W.; Davidson, Philip W.

    2010-01-01

    Maternal consumption of fish during the gestational period exposes the fetus to both nutrients, especially the long-chain polyunsaturated fatty acids (LCPUFAs), believed to be beneficial for fetal brain development, as well as to the neurotoxicant methylmercury (MeHg). We recently reported that nutrients present in fish may modify MeHg neurotoxicity. Understanding the apparent interaction of MeHg exposure and nutrients present in fish is complicated by the limitations of modeling methods. In this study we fit varying coefficient function models to data from the Seychelles Child Development Nutrition Study (SCDNS) cohort to assess the association of dietary nutrients and children’s development. This cohort of mother-child pairs in the Republic of Seychelles had fish consumption averaging 9 meals per week. Maternal nutritional status was assessed for five different nutritional components known to be present in fish (n-3 LCPUFA, n-6 LCPUFA, iron status, iodine status, and choline) and associated with children’s neurological development. We also included prenatal MeHg exposure (measured in maternal hair). We examined two child neurodevelopmental outcomes (Bayley Scales Infant Development-II (BSID-II) Mental Developmental Index (MDI) and Psychomotor Developmental Index (PDI)), each administered at 9 and at 30 months. The varying coefficient models allow the possible interactions between each nutritional component and MeHg to be modeled as a smoothly varying function of MeHg as an effect modifier. Iron, iodine, choline, and n-6 LCPUFA had little or no observable modulation at different MeHg exposures. In contrast the n-3 LCPUFA docosahexaenoic acid (DHA) had beneficial effects on the BSID-II PDI that were reduced or absent at higher MeHg exposures. This study presents a useful modeling method that can be brought to bear on questions involving interactions between covariates, and illustrates the continuing importance of viewing fish consumption during pregnancy as a

  17. The SETD8/PR-Set7 Methyltransferase Functions as a Barrier to Prevent Senescence-Associated Metabolic Remodeling

    Directory of Open Access Journals (Sweden)

    Hiroshi Tanaka

    2017-02-01

    Full Text Available Cellular senescence is an irreversible growth arrest that contributes to development, tumor suppression, and age-related conditions. Senescent cells show active metabolism compared with proliferating cells, but the underlying mechanisms remain unclear. Here we show that the SETD8/PR-Set7 methyltransferase, which catalyzes mono-methylation of histone H4 at lysine 20 (H4K20me1, suppresses nucleolar and mitochondrial activities to prevent cellular senescence. SETD8 protein was selectively downregulated in both oncogene-induced and replicative senescence. Inhibition of SETD8 alone was sufficient to trigger senescence. Under these states, the expression of genes encoding ribosomal proteins (RPs and ribosomal RNAs as well as the cyclin-dependent kinase (CDK inhibitor p16INK4A was increased, with a corresponding reduction of H4K20me1 at each locus. As a result, the loss of SETD8 concurrently stimulated nucleolar function and retinoblastoma protein-mediated mitochondrial metabolism. In conclusion, our data demonstrate that SETD8 acts as a barrier to prevent cellular senescence through chromatin-mediated regulation of senescence-associated metabolic remodeling.

  18. Morphine induces bacterial translocation in mice by compromising intestinal barrier function in a TLR-dependent manner.

    Directory of Open Access Journals (Sweden)

    Jingjing Meng

    Full Text Available Opiates are among the most prescribed drugs for pain management. However, morphine use or abuse results in significant gut bacterial translocation and predisposes patients to serious infections with gut origin. The mechanism underlying this defect is still unknown. In this report, we investigated the mechanisms underlying compromised gut immune function and bacterial translocation following morphine treatment. We demonstrate significant bacterial translocation to mesenteric lymph node (MLN and liver following morphine treatment in wild-type (WT animals that was dramatically and significantly attenuated in Toll-like receptor (TLR2 and 4 knockout mice. We further observed significant disruption of tight junction protein organization only in the ileum but not in the colon of morphine treated WT animals. Inhibition of myosin light chain kinase (MLCK blocked the effects of both morphine and TLR ligands, suggesting the role of MLCK in tight junction modulation by TLR. This study conclusively demonstrates that morphine induced gut epithelial barrier dysfunction and subsequent bacteria translocation are mediated by TLR signaling and thus TLRs can be exploited as potential therapeutic targets for alleviating infections and even sepsis in morphine-using or abusing populations.

  19. In vivo assessment of corneal barrier function through non-invasive impedance measurements using a flexible probe

    Science.gov (United States)

    Guimera, A.; Illa, X.; Traver, E.; Marchan, S.; Herrero, C.; Lagunas, C.; Maldonado, M. J.; Ivorra, A.; Villa, R.

    2013-04-01

    The cornea is a transparent structure composed of three layers: the epithelium, the stroma and the endothelium. To maintain its ransparency the stroma remains in a constant state of dehydration. Consequently, any ion flow disorder through the covering layers can compromise the barrier function and, therefore the corneal homeostasis. Since ionic permeability has a fundamental impact on the passive electrical properties of living tissues, in this work it is proposed and demonstrated a diagnosis method based on tetrapolar impedance measurements performed by electrodes placed on the corneal surface. The contribution of each cornea layer to the total measured impedance has been analysed over a frequency range. Following the obtained guidelines, a flexible probe with integrated electrodes has been developed and manufactured using SU-8 photoresin. The feasibility of the proposed method has been evaluated in vivo by monitoring corneal epithelium wound healing. Obtained impedance measurements have been compared with measurements of permeability to sodium fluorescein from different excised corneas. Successful results demonstrate the feasibility of this novel flexible sensor and its capability to quantify corneal permeability in vivo in a noninvasive way.

  20. Supplementation of tributyrin improves the growth and intestinal digestive and barrier functions in intrauterine growth-restricted piglets.

    Science.gov (United States)

    Dong, Li; Zhong, Xiang; He, Jintian; Zhang, Lili; Bai, Kaiwen; Xu, Wen; Wang, Tian; Huang, Xuexin

    2016-04-01

    Intrauterine growth restriction (IUGR) neonates suffer from growth restriction. Tributyrin (TB), a pro-drug of butyrate, can facilitate the growth of animals. This study was to investigate the effects of TB supplementation on the growth of IUGR neonatal piglets. Sixteen IUGR and 8 NBW (normal body weight) neonatal piglets were chosen, weaned at 7th day and fed basic milk diets (NBW and IUGR group) or the basic diets supplemented with 0.1% tributyrin (IT group, IUGR piglets fed with tributyrin) until day 21 (n = 8). The body weights of the piglets on days 0, 7, 10, 14, 17, and 20 were measured. The digestive enzyme activity, intestinal morphology, immunoglobulin levels and gene expression of IgG, FcRn and GPR41 in the small intestines were analyzed. The body weights of the piglets in the IUGR and IT group were similar, and both were lower than the NBW group on days 10 and 14. However, after day 17, the IT group exhibited improved (P piglets were sacrificed on day 21. Compared with the NBW piglets, IUGR impaired the development of immune organs and small intestines, impaired the intestinal villus morphology, decreased (P digestive enzyme activities, decreased (P Piglets in the IT group exhibited a better-developed (P digestive enzyme activities, and up-regulated (P digestive and barrier functions in IUGR piglets during the suckling period. Copyright © 2015. Published by Elsevier Ltd.

  1. Aging and endothelial barrier function in culture: effects of chronic exposure to fatty acid hydroperoxides and vitamin E.

    Science.gov (United States)

    Boissonneault, G A; Hennig, B; Wang, Y; Wood, C L

    1990-10-01

    As the endothelium ages it may become more susceptible to damage by atherogenic plasma components such as toxic lipid oxidation products. Vitamin E (vit E) might prove to be anti-atherogenic by reducing oxidative injury. This study investigated the effects of age and chronic exposure to fatty acid hydroperoxides (OFA) and/or vit E on endothelial barrier function (EBF) and cell growth characteristics. Chronic exposure to 5 microM OFA for 40 passages resulted in an age-related decrease in EBF, while supplementation of OFA-treated cultures with 25 microM vit E protected against the OFA-mediated decrease in EBF, independent of cell age. Vit E treatment alone had no significant effect on EBF relative to control cultures. No changes in growth characteristics, i.e., total DNA or protein per culture, were noted, regardless of treatment, although total DNA per culture decreased with increasing culture passage. These results suggest that chronic oxidative stress decreases EBF, predisposing the artery to infiltration by blood components and subsequent atherogenesis and that vit E delays cumulative changes in EBF related to chronic OFA exposure.

  2. The mucus layer is critical in protecting against ischemia-reperfusion-mediated gut injury and in the restitution of gut barrier function.

    Science.gov (United States)

    Qin, Xiaofa; Sheth, Sharvil U; Sharpe, Susan M; Dong, Wei; Lu, Qi; Xu, Dazhong; Deitch, Edwin A

    2011-03-01

    It is well documented that the gut injury plays a critical role in the development of systemic inflammation and distant organ injury in conditions associated with splanchnic ischemia. Consequently, understanding the mechanisms leading to gut injury is important. In this context, recent work suggests a protective role for the intestinal mucus layer and an injury-inducing role for luminal pancreatic proteases. Thus, we explored the role of the mucus layer in gut barrier function by observing how the removal of the mucus layer affects ischemia-reperfusion-mediated gut injury in rats as well as the potential role of luminal pancreatic proteases in the pathogenesis of gut injury. Ischemia was induced by the ligation of blood vessels to segments of the ileum for 45 min, followed by up to 3 h of reperfusion. The ileal segments were divided into five groups. These included a nonischemic control, ischemic segments exposed to saline, the mucolytic N-acetylcysteine (NAC), pancreatic proteases, or NAC + pancreatic proteases. Changes in gut barrier function were assessed by the permeation of fluorescein isothiocyanate dextran (molecular weight, 4,000 d) in ileal everted sacs. Gut injury was measured morphologically and by the luminal content of protein, DNA, and hemoglobin. The mucus layer was assessed functionally by measuring its hydrophobicity and morphologically. Gut barrier function was promptly and effectively reestablished during reperfusion, which was accompanied by the restoration of the mucus layer. In contrast, treatment of the gut with the mucolytic NAC for 10 min during ischemia resulted in a failure of mucus restitution and further increases in gut permeability and injury. The presence of digestive proteases by themselves did not exacerbate gut injury, but in combination with NAC, they caused an even greater increase in gut injury and permeability. These results suggest that the mucus layer not only serves as a barrier between the luminal contents and gut surface

  3. Time-varying Markov regression random-effect model with Bayesian estimation procedures: Application to dynamics of functional recovery in patients with stroke.

    Science.gov (United States)

    Pan, Shin-Liang; Chen, Hsiu-Hsi

    2010-09-01

    The rates of functional recovery after stroke tend to decrease with time. Time-varying Markov processes (TVMP) may be more biologically plausible than time-invariant Markov process for modeling such data. However, analysis of such stochastic processes, particularly tackling reversible transitions and the incorporation of random effects into models, can be analytically intractable. We make use of ordinary differential equations to solve continuous-time TVMP with reversible transitions. The proportional hazard form was used to assess the effects of an individual's covariates on multi-state transitions with the incorporation of random effects that capture the residual variation after being explained by measured covariates under the concept of generalized linear model. We further built up Bayesian directed acyclic graphic model to obtain full joint posterior distribution. Markov chain Monte Carlo (MCMC) with Gibbs sampling was applied to estimate parameters based on posterior marginal distributions with multiple integrands. The proposed method was illustrated with empirical data from a study on the functional recovery after stroke. Copyright 2010 Elsevier Inc. All rights reserved.

  4. "Missing pieces"--functional, social, and environmental barriers to recovery for vulnerable older adults transitioning from hospital to home.

    Science.gov (United States)

    Greysen, S Ryan; Hoi-Cheung, Doug; Garcia, Veronica; Kessell, Eric; Sarkar, Urmimala; Goldman, Lauren; Schneidermann, Michelle; Critchfield, Jeffrey; Pierluissi, Edgar; Kushel, Margot

    2014-08-01

    To describe barriers to recovery at home for vulnerable older adults after leaving the hospital. Standard qualitative research techniques, including purposeful sampling of participants according to age, sex, race, and English proficiency, were used to ensure a wide breadth of experiences. All participants were interviewed in their native language (English, Spanish, or Chinese). Two investigators independently coded interviews using the constant comparative method. The entire research team, with diverse backgrounds in primary care, hospital medicine, geriatrics, and nursing, performed thematic analysis. Urban public safety-net teaching hospital. Vulnerable older adults (low income and health literacy, limited English proficiency) enrolled in a larger discharge interventional study. Qualitative data (participant quotations) were organized into themes. Twenty-four individuals with a mean age of 63 (range 55-84), 66% male, 67% nonwhite, 16% Spanish speaking, 16% Chinese speaking were interviewed. An overarching theme of "missing pieces" was identified in the plan for postdischarge recovery at home, from which three specific subthemes emerged: functional limitations and difficulty with mobility and self-care tasks, social isolation and lack of support from family and friends, and challenges from poverty and the built environment at home. In contrast, participants described mostly supportive experiences with traditional focuses of transition, care such as following prescribed medication and diet regimens. Hospital-based discharge interventions that focus on traditional aspects of care may overlook social and functional gaps in postdischarge care at home for vulnerable older adults. Postdischarge interventions that address these challenges may be necessary to reduce readmissions in this population. © 2014, Copyright the Authors Journal compilation © 2014, The American Geriatrics Society.

  5. Commensal and probiotic bacteria influence intestinal barrier function and susceptibility to colitis in Nod1-/-; Nod2-/- mice.

    Science.gov (United States)

    Natividad, Jane M M; Petit, Valerie; Huang, Xianxi; de Palma, Giada; Jury, Jennifer; Sanz, Yolanda; Philpott, Dana; Garcia Rodenas, Clara L; McCoy, Kathy D; Verdu, Elena F

    2012-08-01

    The intestinal microbiota regulates key host functions. It is unknown whether modulation of the microbiota can affect a genetically determined host phenotype. Polymorphisms in the Nucleotide oligomerization domain (Nod)-like receptor family confer genetic risk for inflammatory bowel disease (IBD). We investigated whether the intestinal microbiota and the probiotic strain Bifidobacterium breve NCC2950 affect intestinal barrier function and responses to intestinal injury in Nod1(-/-); Nod2(-/-) mice. Specific pathogen-free (SPF) Nod1(-/-); Nod2(-/-) mice and mice gnotobiotically derived with altered Schaedler flora (ASF) biota were used. SPF Nod1(+/-); Nod2(+/-) littermates (generated by crossing SPF Nod1(-/-); Nod2(-/-) and germ-free C57BL/6 mice) and ASF Nod1(+/-); Nod2(+/-) mice were used as controls. SPF mice were gavaged daily with 10(9) -CFU B. breve for 14 days before colitis induction. Denaturing gradient gel electrophoresis (DGGE) and real-time polymerase chain reaction (PCR) were used to assess microbiota composition. Intestinal permeability was assessed by in vitro and in vivo techniques. Expressions of epithelial apical junction proteins, mucin, and antimicrobial proteins were assessed by quantitative reverse-transcription PCR (qRT-PCR) and immunofluorescence. Responses to intestinal injury were investigated using an acute experimental model of colitis. Under SPF conditions, Nod1(-/-); Nod2(-/-) mice had increased paracellular permeability, decreased E-cadherin, and lower colonic antimicrobial RegIII-γ expression compared to Nod1(+/-); Nod2(+/-) littermate controls. These changes were associated with increased susceptibility to colitis. ASF colonization or B. breve supplementation normalized RegIII-γ expression and decreased susceptibility to dextran sodium sulfate (DSS) colitis in Nod1(-/-); Nod2(-/-) mice. The intestinal microbiota influences colitis severity in Nod1(-/-); Nod2(-/-) mice. The results suggest that colonization strategies with defined

  6. Bilayer Poly(Lactic-co-glycolic acid/Nano-Hydroxyapatite Membrane with Barrier Function and Osteogenesis Promotion for Guided Bone Regeneration

    Directory of Open Access Journals (Sweden)

    Li Fu

    2017-03-01

    Full Text Available Guided bone regeneration (GBR is one such treatment that reconstructs neo-bone tissue by using a barrier membrane to prevent the invasion of soft tissue and to create a space for guiding new bone growth into the bone defect. Herein, we report a novel functionally graded bilayer membrane (FGBM for GBR application. To fabricate the novel membrane, the composites of poly(lactic-co-glycolic acid and nano-hydroxyapatite were prepared by phase inversion for the dense layer and by electrospinning for another porous layer, and their corresponding properties were evaluated including surface morphology, mechanics, degradability, cell barrier function, and in vitro osteogenic bioactivity. The results showed that PLGA with 5% nHA in dense layer could meet the requirement of mechanical strength and have excellent barrier function even on condition of post-degradation. Furthermore, PLGA with 30% nHA in porous layer could achieve the good physical and chemical properties. In addition, 30% nHA incorporation would enhance the in vitro mineralization, and have superior capabilities of cell adhesion, proliferation and differentiation compared to other groups. Therefore, the designed FGBM could potentially serve as a barrier for preferential tissue ingrowth and achieve a desirable therapeutic result for bone tissue regeneration.

  7. Bilayer Poly(Lactic-co-glycolic acid)/Nano-Hydroxyapatite Membrane with Barrier Function and Osteogenesis Promotion for Guided Bone Regeneration

    Science.gov (United States)

    Fu, Li; Wang, Zhanfeng; Dong, Shujun; Cai, Yan; Ni, Yuxin; Zhang, Tianshou; Wang, Lin; Zhou, Yanmin

    2017-01-01

    Guided bone regeneration (GBR) is one such treatment that reconstructs neo-bone tissue by using a barrier membrane to prevent the invasion of soft tissue and to create a space for guiding new bone growth into the bone defect. Herein, we report a novel functionally graded bilayer membrane (FGBM) for GBR application. To fabricate the novel membrane, the composites of poly(lactic-co-glycolic acid) and nano-hydroxyapatite were prepared by phase inversion for the dense layer and by electrospinning for another porous layer, and their corresponding properties were evaluated including surface morphology, mechanics, degradability, cell barrier function, and in vitro osteogenic bioactivity. The results showed that PLGA with 5% nHA in dense layer could meet the requirement of mechanical strength and have excellent barrier function even on condition of post-degradation. Furthermore, PLGA with 30% nHA in porous layer could achieve the good physical and chemical properties. In addition, 30% nHA incorporation would enhance the in vitro mineralization, and have superior capabilities of cell adhesion, proliferation and differentiation compared to other groups. Therefore, the designed FGBM could potentially serve as a barrier for preferential tissue ingrowth and achieve a desirable therapeutic result for bone tissue regeneration. PMID:28772618

  8. Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

    Science.gov (United States)

    Wu, Richard Y.; Abdullah, Majd; Määttänen, Pekka; Pilar, Ana Victoria C.; Scruten, Erin; Johnson-Henry, Kathene C.; Napper, Scott; O’Brien, Catherine; Jones, Nicola L.; Sherman, Philip M.

    2017-01-01

    Prebiotics are non-digestible oligosaccharides that promote the growth of beneficial gut microbes, but it is unclear whether they also have direct effects on the intestinal mucosal barrier. Here we demonstrate two commercial prebiotics, inulin and short-chain fructo-oligosaccharide (scFOS), when applied onto intestinal epithelia in the absence of microbes, directly promote barrier integrity to prevent pathogen-induced barrier disruptions. We further show that these effects involve the induction of select tight junction (TJ) proteins through a protein kinase C (PKC) δ-dependent mechanism. These results suggest that in the absence of microbiota, prebiotics can directly exert barrier protective effects by activating host cell signaling in the intestinal epithelium, which represents a novel alternative mechanism of action of prebiotics. PMID:28098206

  9. [The biochemical composition of the bile and the function of the protective mucosal barrier in peptic ulcer patients].

    Science.gov (United States)

    Oparin, A G; Khakimov, M T; Chonka, V Iu; Mendzherer, A; Pandeĭ, I

    1991-05-01

    The state of the protective mucosa barrier was studied in 87 patients with ulcer disease by means of determination of the level of PAS-positive substances and acid mucopolysaccharides in the gastric and duodenal mucosa. It was found that changes of the biochemical composition of the bile produced an essential influence on the reduction of protective properties of the gastroduodenal mucosa barrier, especially in the presence of gastroduodenal reflux.

  10. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D.; Wondrak, Georg T.

    2017-01-01

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as ‘annatto’) originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination. PMID:29258247

  11. Probiotic-derived polyphosphate enhances the epithelial barrier function and maintains intestinal homeostasis through integrin-p38 MAPK pathway.

    Directory of Open Access Journals (Sweden)

    Shuichi Segawa

    Full Text Available Probiotics exhibit beneficial effects on human health, particularly in the maintenance of intestinal homeostasis in a complex manner notwithstanding the diversity of an intestinal flora between individuals. Thus, it is highly probable that some common molecules secreted by probiotic and/or commensal bacteria contribute to the maintenance of intestinal homeostasis and protect the intestinal epithelium from injurious stimuli. To address this question, we aimed to isolate the cytoprotective compound from a lactobacillus strain, Lactobacillus brevis SBC8803 which possess the ability to induce cytoprotective heat shock proteins in mouse small intestine. L. brevis was incubated in MRS broth and the supernatant was passed through with a 0.2-µm filter. Caco2/bbe cells were treated with the culture supernatant, and HSP27 expression was evaluated by Western blotting. HSP27-inducible components were separated by ammonium sulfate precipitation, DEAE anion exchange chromatography, gel filtration, and HPLC. Finally, we identified that the HSP27-inducible fraction was polyphosphate (poly P, a simple repeated structure of phosphates, which is a common product of lactobacilli and other bacteria associated with intestinal microflora without any definitive physiological functions. Then, poly P was synthesized by poly P-synthesizing enzyme polyphosphate kinase. The synthesized poly P significantly induced HSP27 from Caco2/BBE cells. In addition, Poly P suppressed the oxidant-induced intestinal permeability in the mouse small intestine and pharmacological inhibitors of p38 MAPK and integrins counteract its protective effect. Daily intrarectal administration of poly P (10 µg improved the inflammation grade and survival rate in 4% sodium dextran sulfate-administered mice. This study, for the first time, demonstrated that poly P is the molecule responsible for maintaining intestinal barrier actions which are mediated through the intestinal integrin β1-p38 MAPK.

  12. The impact of lactoferrin with different levels of metal saturation on the intestinal epithelial barrier function and mucosal inflammation.

    Science.gov (United States)

    Majka, Grzegorz; Więcek, Grażyna; Śróttek, Małgorzata; Śpiewak, Klaudyna; Brindell, Małgorzata; Koziel, Joanna; Marcinkiewicz, Janusz; Strus, Magdalena

    2016-12-01

    Translocation of bacteria, primarily Gram-negative pathogenic flora, from the intestinal lumen into the circulatory system leads to sepsis. In newborns, and especially very low birth weight infants, sepsis is a major cause of morbidity and mortality. The results of recently conducted clinical trials suggest that lactoferrin, an iron-binding protein that is abundant in mammalian colostrum and milk, may be an effective agent in preventing sepsis in newborns. However, despite numerous basic studies on lactoferrin, very little is known about how metal saturation of this protein affects a host's health. Therefore, the main objective of this study was to elucidate how iron-depleted, iron-saturated, and manganese-saturated forms of lactoferrin regulate intestinal barrier function via interactions with epithelial cells and macrophages. For these studies, a human intestinal epithelial cell line, Caco-2, was used. In this model, none of the tested lactoferrin forms induced higher levels of apoptosis or necrosis. There was also no change in the production of tight junction proteins regardless of lactoferrin metal saturation status. None of the tested forms induced a pro-inflammatory response in Caco-2 cells or in macrophages either. However, the various lactoferrin forms did effectively inhibit the pro-inflammatory response in macrophages that were activated with lipopolysaccharide with the most potent effect observed for apolactoferrin. Lactoferrin that was not bound to its cognate receptor was able to bind and neutralize lipopolysaccharide. Lactoferrin was also able to neutralize microbial-derived antigens, thereby potentially reducing their pro-inflammatory effect. Therefore, we hypothesize that lactoferrin supplementation is a relevant strategy for preventing sepsis.

  13. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

    2017-12-18

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  14. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2017-12-01

    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  15. Cathelicidin-WA Improves Intestinal Epithelial Barrier Function and Enhances Host Defense against Enterohemorrhagic Escherichia coli O157:H7 Infection.

    Science.gov (United States)

    Yi, Hongbo; Hu, Wangyang; Chen, Shan; Lu, Zeqing; Wang, Yizhen

    2017-02-15

    Impaired epithelial barrier function disrupts immune homeostasis and increases inflammation in intestines, leading to many intestinal diseases. Cathelicidin peptides suppress intestinal inflammation and improve intestinal epithelial barrier function independently of their antimicrobial activity. In this study, we investigated the effects of Cathelicidin-WA (CWA) on intestinal epithelial barrier function, as well as the underlying mechanism, by using enterohemorrhagic Escherichia coli (EHEC)-infected mice and intestinal epithelial cells. The results showed that CWA attenuated EHEC-induced clinical symptoms and intestinal colitis, as did enrofloxacin (Enro). CWA decreased IL-6 production in the serum, jejunum, and colon of EHEC-infected mice. Additionally, CWA alleviated the EHEC-induced disruption of mucin-2 and goblet cells in the intestine. Interestingly, CWA increased the mucus layer thickness, which was associated with increasing expression of trefoil factor 3, in the jejunum of EHEC-infected mice. CWA increased the expression of tight junction proteins in the jejunum of EHEC-infected mice. Using intestinal epithelial cells and a Rac1 inhibitor in vitro, we demonstrated that the CWA-mediated increases in the tight junction proteins might depend on the Rac1 pathway. Furthermore, CWA improved the microbiota and short-chain fatty acid concentrations in the cecum of EHEC-infected mice. Although Enro and CWA had similar effects on intestinal inflammation, CWA was superior to Enro with regard to improving intestinal epithelial barrier and microbiota in the intestine. In conclusion, CWA attenuated EHEC-induced inflammation, intestinal epithelial barrier damage, and microbiota disruption in the intestine of mice, suggesting that CWA may be an effective therapy for many intestinal diseases. Copyright © 2017 by The American Association of Immunologists, Inc.

  16. Scaling up of continuous-flow, microwave-assisted, organic reactions by varying the size of Pd-functionalized catalytic monoliths

    Science.gov (United States)

    He, Ping; Fletcher, Paul D I; Kelly, Stephen M; Mansfield, Andrew

    2011-01-01

    Summary A product-scalable, catalytically mediated flow system has been developed to perform Suzuki–Miyaura reactions under a microwave heating regime, in which the volumetric throughput of a Pd-supported silica monolith can be used to increase the quantity of the product without changing the optimal operating conditions. Two silica monoliths (both 3 cm long), with comparable pore diameters and surface areas, were fabricated with diameters of 3.2 and 6.4 mm to give volumetric capacities of 0.205 and 0.790 mL, respectively. The two monoliths were functionalized with a loading of 4.5 wt % Pd and then sealed in heat-shrinkable Teflon® tubing to form a monolithic flow reactor. The Pd-supported silica monolith flow reactor was then placed into the microwave cavity and connected to an HPLC pump and a backpressure regulator to minimize the formation of gas bubbles. The flow rate and microwave power were varied to optimize the reactant contact time and temperature, respectively. Under optimal reaction conditions the quantity of product could be increased from 31 mg per hour to 340 mg per hour simply by changing the volumetric capacity of the monolith. PMID:21915220

  17. Similarities and Differences of the Soleus and Gastrocnemius H-reflexes during Varied Body Postures, Foot Positions, and Muscle Function: Multifactor Designs for Repeated Measures

    Directory of Open Access Journals (Sweden)

    Sabbahi Mohamed A

    2011-06-01

    Full Text Available Abstract Background Although the soleus (Sol, medial gastrocnemius (MG, and lateral gastrocnemius (LG muscles differ in function, composition, and innervations, it is a common practice is to investigate them as single H-reflex recording. The purpose of this study was to compare H-reflex recordings between these three sections of the triceps surae muscle group of healthy participants while lying and standing during three different ankle positions. Methods The Sol, MG and LG muscles' H-reflexes were recorded from ten participants during prone lying and standing with the ankle in neutral, maximum dorsiflexion, and maximum plantarflexion positions. Four traces were averaged for each combination of conditions. Three-way ANOVAs (posture X ankle position X muscle with planned comparisons were used for statistical comparisons. Results Although the H-reflex in the three muscle sections differed in latency and amplitude, its dependency on posture and ankle position was similar. The H-reflex amplitudes and maximum H-reflex to M-response (H/M ratios were significantly 1 lower during standing compared to lying with the ankle in neutral, 2 greater during standing with the ankle in plantarflexion compared to neutral, and 3 less with the ankle in dorsiflexion compared to neutral during lying and standing for all muscles (p ≤ .05. Conclusion Varying demands are required for muscles activated during distinctly different postures and ankle movement tasks.

  18. Variáveis ruminais avaliadas por meio de funções matemáticas contínuas Rumen variables evaluated through continuum mathematical functions

    Directory of Open Access Journals (Sweden)

    Edenio Detmann

    2007-11-01

    Full Text Available O objetivo deste trabalho foi avaliar as variáveis pH e concentração de nitrogênio amoniacal ruminal em bovinos por meio de funções matemáticas contínuas, utilizando-se o polinômio trigonométrico em série de Fourier. Foram utilizados quatro conjuntos de dados simulados referentes à alimentação de vacas em lactação em confinamento e bovinos suplementados em pastejo. Os ajustamentos dos modelos foram realizados por procedimentos iterativos. Os efeitos nutricionais nas diferentes situações de alimentação simuladas foram estimados por operações de cálculo integral. As séries de Fourier apresentam elevada capacidade de ajustamento para descrição do comportamento diário do pH e concentração de nitrogênio amoniacal ruminal. As variáveis geradas por integração das funções ajustadas apresentam elevada capacidade discriminatória, o que permite refinamentos sobre a interpretação dos efeitos nutricionais de diferentes dietas das características físico-químicas do ambiente ruminal.The objective of this work was to evaluate rumen pH and ammonia concentration in cattle through continuum mathematical functions by using the Fourier's trigonometric polynomial. Four simulated dataset, which represent feeding conditions of confined dairy cows and cattle supplemented at pasture were used. The models adjustments were performed by iterative procedures. The nutritional effects in the different simulated feeding situations were evaluated through integral calculus. The Fourier series has showed a good adjustment in describing the daily behavior of rumen pH and ammonia concentration. Variables obtained through numeric integration show a high discriminatory power, which leads to a fine tuning on the evaluation of diet effects on physical and chemical characteristics of rumen.

  19. Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

    Science.gov (United States)

    Han, Seung Hoon; Park, Ji Woong

    2017-11-01

    The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

  20. Seasonal discrimination of C3 and C4 grasses functional types: An evaluation of the prospects of varying spectral configurations of new generation sensors

    Science.gov (United States)

    Shoko, Cletah; Mutanga, Onisimo

    2017-10-01

    The present study assessed the potential of varying spectral configuration of Landsat 8 Operational Land Imager (OLI), Sentinel 2 MultiSpectal Instrument (MSI) and Worldview 2 sensors in the seasonal discrimination of Festuca costata (C3) and Themeda Triandra (C4) grass species in the Drakensberg, South Africa. This was achieved by resampling hyperspectral measurements to the spectral windows corresponding to the three sensors at two distinct seasonal periods (summer peak and end of winter), using the Discriminant Analysis (DA) classification ensemble. In summer, standard bands of the Worldview 2 produced the highest overall classification accuracy (98.61%), followed by Sentinel 2 (97.52%), whereas the Landsat 8 spectral configuration was the least performer, using vegetation indices (95.83%). In winter, Sentinel 2 spectral bands produced the highest accuracy (96.18%) for the two species, followed by Worldview 2 (94.44%) and Landsat 8 yielded the least (91.67%) accuracy. Results also showed that maximum separability between C3 and C4 grasses was in summer, while at the end of winter considerable overlaps were noted, especially when using the spectral settings of the Landsat 8 OLI and Sentinel 2 shortwave infrared bands. Test of significance in species reflectance further confirmed that in summer, there were significant differences (P 0.05) between the two species. In this regard, the peak summer period presents a promising opportunity for the spectral discrimination of C3 and C4 grass species functional types, than the end of winter, when using multispectral sensors. Results from this study highlight the influence of seasonality on discrimination and therefore provide the basis for the successful discrimination and mapping of C3 and C4 grass species.

  1. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in Shiga toxin independent manner

    Science.gov (United States)

    Roxas, Jennifer Lising; Koutsouris, Athanasia; Bellmeyer, Amy; Tesfay, Samuel; Royan, Sandhya; Falzari, Kanakeshwari; Harris, Antoneicka; Cheng, Hao; Rhee, Ki-Jong; Hecht, Gail

    2010-01-01

    Shiga toxin (Stx) is implicated in the development of hemorrhagic colitis and hemolytic-uremic syndrome, but early symptoms of enterohemorrhagic Escherichia coli (EHEC) infection such as non-bloody diarrhea may be Stx-independent. In this study, we defined the effects of EHEC, in the absence of Stx, on the intestinal epithelium using a murine model. EHEC colonization of intestines from two groups of antibiotic-free and streptomycin-treated C57Bl/6J mice were characterized and compared. EHEC colonized the cecum and colon more efficiently than the ileum in both groups; however, greater amounts of tissue-associated EHEC were detected in streptomycin-pretreated mice. Imaging of intestinal tissues of mice infected with bioluminescent EHEC further confirmed tight association of the bacteria to the cecum and colon. Greater numbers of EHEC were also cultured from stool of streptomycin-pretreated mice, as compared to those that received no antibiotic. Transmission electron microscopy demonstrated that EHEC infection leads to microvillous effacement of mouse colonocytes. Hematoxylin and eosin staining of colonic tissues of infected mice revealed a slight increase in the number of lamina propria polymorphonuclear leukocytes. Transmucosal electrical resistance, a measure of epithelial barrier function, was reduced in colonic tissues of infected animals. Increased mucosal permeability to 4KDa FITC-Dextran was also observed in colonic tissues of infected mice. Immunofluorescence microscopy revealed that EHEC infection resulted in redistribution of the tight junction proteins occludin and claudin-3 and increased expression of claudin-2 while ZO-1 localization remained unaltered. Quantitative real-time PCR revealed that EHEC altered mRNA transcription of Ocln, Cldn2 and Cldn3. Most notably, claudin-2 expression was significantly increased and correlated with increased intestinal permeability. Our data indicate that C57Bl/6J mice serve as an in vivo model to study the physiological

  2. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner.

    Science.gov (United States)

    Roxas, Jennifer L; Koutsouris, Athanasia; Bellmeyer, Amy; Tesfay, Samuel; Royan, Sandhya; Falzari, Kanakeshwari; Harris, Antoneicka; Cheng, Hao; Rhee, Ki Jong; Hecht, Gail

    2010-08-01

    Shiga toxin (Stx) is implicated in the development of hemorrhagic colitis and hemolytic-uremic syndrome, but early symptoms of enterohemorrhagic Escherichia coli (EHEC) infection such as nonbloody diarrhea may be Stx independent. In this study, we defined the effects of EHEC, in the absence of Stx, on the intestinal epithelium using a murine model. EHEC colonization of intestines from two groups of antibiotic-free and streptomycin-treated C57Bl/6J mice were characterized and compared. EHEC colonized the cecum and colon more efficiently than the ileum in both groups; however, greater amounts of tissue-associated EHEC were detected in streptomycin-pretreated mice. Imaging of intestinal tissues of mice infected with bioluminescent EHEC further confirmed tight association of the bacteria with the cecum and colon. Greater numbers of EHEC were also cultured from stool samples obtained from streptomycin-pretreated mice, as compared with those that received no antibiotics. Transmission electron microscopy shows that EHEC infection leads to microvillous effacement of mouse colonocytes. Hematoxylin and eosin staining of the colonic tissues of infected mice revealed a slight increase in the number of lamina propria polymorphonuclear leukocytes. Transmucosal electrical resistance, a measure of epithelial barrier function, was reduced in the colonic tissues of infected animals. Increased mucosal permeability to 4- kDa FITC-dextran was also observed in the colonic tissues of infected mice. Immunofluorescence microscopy showed that EHEC infection resulted in redistribution of the tight junction (TJ) proteins occludin and claudin-3 and increased the expression of claudin-2, whereas ZO-1 localization remained unaltered. Quantitative real-time PCR showed that EHEC altered mRNA transcription of OCLN, CLDN2, and CLDN3. Most notably, claudin-2 expression was significantly increased and correlated with increased intestinal permeability. Our data indicate that C57Bl/6J mice serve as an

  3. Creating Live Interactions to Mitigate Barriers (CLIMB): A Mobile Intervention to Improve Social Functioning in People With Chronic Psychotic Disorders.

    Science.gov (United States)

    Biagianti, Bruno; Schlosser, Danielle; Nahum, Mor; Woolley, Josh; Vinogradov, Sophia

    2016-12-13

    Numerous psychosocial interventions for individuals with chronic psychotic disorders (CPD) have shown positive effects on social cognitive and functional outcome measures. However, access to and engagement with these interventions remains limited. This is partly because these interventions require specially trained therapists, are not available in all clinical settings, and have a high scheduling burden for participants, usually requiring a commitment of several weeks. Delivering interventions remotely via mobile devices may facilitate access, improve scheduling flexibility, and decrease participant burden, thus improving adherence to intervention requirements. To address these needs, we designed the Creating Live Interactions to Mitigate Barriers (CLIMB) digital intervention, which aims to enhance social functioning in people with CPD. CLIMB consists of two treatment components: a computerized social cognition training (SCT) program and optimized remote group therapy (ORGT). ORGT is an innovative treatment that combines remote group therapy with group texting (short message service, SMS). The objectives of this single-arm study were to investigate the feasibility of delivering 6 weeks of CLIMB to people with CPD and explore the initial effects on outcomes. Participants were recruited, screened and enrolled via the Internet, and delivered assessments and interventions remotely using provided tablets (iPads). Participants were asked to complete 18 hours of SCT and to attend 6 remote group therapy sessions. To assess feasibility, adherence to study procedures, attrition rates, engagement metrics, and acceptability of the intervention were evaluated. Changes on measures of social cognition, quality of life, and symptoms were also explored. In total, 27 participants were enrolled over 12 months. Remote assessments were completed successfully on 96% (26/27) of the enrolled participants. Retention in the 6-week trial was 78% (21/27). Of all the iPads used, 95% (22

  4. Monitoring functionality and durability of the New York State Highway 30 turtle barrier and adjacent nesting substrate.

    Science.gov (United States)

    2012-08-01

    In 2008, the NYS Department of Transportation installed a wildlife barrier along NYS Route 30 in Tupper Lake, Franklin County, NY. The major objectives of the study that is the subject of this report were to: evaluate the effectiveness of the Route 3...

  5. Enhanced cerebral uptake of receptor ligands by modulation of P-glycoprotein function in the blood-brain barrier

    NARCIS (Netherlands)

    Doze, P; Van Waarde, A; Elsinga, P H; Hendrikse, N H; Vaalburg, W

    Low cerebral uptake of some therapeutic drugs can be enhanced by modulation of P-glycoprotein (P-gp), an ATP-driven drug efflux pump at the blood-brain barrier (BBB). We investigated the possibility of increasing cerebral uptake of the beta-adrenergic ligands S-1'-[(18)F]-fluorocarazolol (FCAR) and

  6. Effects of cognate, non-cognate and synthetic CXCR4 and ACKR3 ligands on human lung endothelial cell barrier function.

    Directory of Open Access Journals (Sweden)

    You-Hong Cheng

    Full Text Available Recent evidence suggests that chemokine CXCL12, the cognate agonist of chemokine receptors CXCR4 and ACKR3, reduces thrombin-mediated impairment of endothelial barrier function. A detailed characterization of the effects of CXCL12 on thrombin-mediated human lung endothelial hyperpermeability is lacking and structure-function correlations are not available. Furthermore, effects of other CXCR4/ACKR3 ligands on lung endothelial barrier function are unknown. Thus, we tested the effects of a panel of CXCR4/ACKR3 ligands (CXCL12, CXCL11, ubiquitin, AMD3100, TC14012 and compared the CXCR4/ACKR3 activities of CXCL12 variants (CXCL12α/β, CXCL12(3-68, CXCL121, CXCL122, CXCL12-S-S4V, CXCL12-R47E, CXCL12-K27A/R41A/R47A with their effects on human lung endothelial barrier function in permeability assays. CXCL12α enhanced human primary pulmonary artery endothelial cell (hPPAEC barrier function, whereas CXCL11, ubiquitin, AMD3100 and TC14012 were ineffective. Pre-treatment of hPPAEC with CXCL12α and ubiquitin reduced thrombin-mediated hyperpermeability. CXCL12α-treatment of hPPAEC after thrombin exposure reduced barrier function impairment by 70% (EC50 0.05-0.5nM, which could be antagonized with AMD3100; ubiquitin (0.03-3μM was ineffective. In a human lung microvascular endothelial cell line (HULEC5a, CXCL12α and ubiquitin post-treatment attenuated thrombin-induced hyperpermeability to a similar degree. CXCL12(3-68 was inefficient to activate CXCR4 in Presto-Tango β-arrestin2 recruitment assays; CXCL12-S-S4V, CXCL12-R47E and CXCL12-K27A/R41A/R47A showed significantly reduced potencies to activate CXCR4. While the potencies of all proteins in ACKR3 Presto-Tango assays were comparable, the efficacy of CXCL12(3-68 to activate ACKR3 was significantly reduced. The potencies to attenuate thrombin-mediated hPPAEC barrier function impairment were: CXCL12α/β, CXCL121, CXCL12-K27A/R41A/R47A > CXCL12-S-S4V, CXCL12-R47E > CXCL122 > CXCL12(3-68. Our findings

  7. Apoplastic Diffusion Barriers in Arabidopsis

    Science.gov (United States)

    Schreiber, Lukas; Franke, Rochus Benni; Geldner, Niko; Reina-Pinto, José J.; Kunst, Ljerka

    2013-01-01

    During the development of Arabidopsis and other land plants, diffusion barriers are formed in the apoplast of specialized tissues within a variety of plant organs. While the cuticle of the epidermis is the primary diffusion barrier in the shoot, the Casparian strips and suberin lamellae of the endodermis and the periderm represent the diffusion barriers in the root. Different classes of molecules contribute to the formation of extracellular diffusion barriers in an organ- and tissue-specific manner. Cutin and wax are the major components of the cuticle, lignin forms the early Casparian strip, and suberin is deposited in the stage II endodermis and the periderm. The current status of our understanding of the relationships between the chemical structure, ultrastructure and physiological functions of plant diffusion barriers is discussed. Specific aspects of the synthesis of diffusion barrier components and protocols that can be used for the assessment of barrier function and important barrier properties are also presented. PMID:24465172

  8. Intestinal barrier function of Atlantic salmon (Salmo salar L. post smolts is reduced by common sea cage environments and suggested as a possible physiological welfare indicator

    Directory of Open Access Journals (Sweden)

    Ellis Tim

    2010-11-01

    Full Text Available Abstract Background Fish farmed under high intensity aquaculture conditions are subjected to unnatural environments that may cause stress. Therefore awareness of how to maintain good health and welfare of farmed fish is important. For Atlantic salmon held in sea cages, water flow, dissolved oxygen (DO levels and temperature will fluctuate over time and the fish can at times be exposed to detrimentally low DO levels and high temperatures. This experimental study investigates primary and secondary stress responses of Atlantic salmon post smolts to long-term exposure to reduced and fluctuating DO levels and high water temperatures, mimicking situations in the sea cages. Plasma cortisol levels and cortisol release to the water were assessed as indicators of the primary stress response and intestinal barrier integrity and physiological functions as indicators of secondary responses to changes in environmental conditions. Results Plasma cortisol levels were elevated in fish exposed to low (50% and 60% saturation DO levels and low temperature (9°C, at days 9, 29 and 48. The intestinal barrier function, measured as electrical resistance (TER and permeability of mannitol at the end of the experiment, were reduced at 50% DO, in both proximal and distal intestine. When low DO levels were combined with high temperature (16°C, plasma cortisol levels were elevated in the cyclic 1:5 h at 85%:50% DO group and fixed 50% DO group compared to the control (85% DO group at day 10 but not at later time points. The intestinal barrier function was clearly disturbed in the 50% DO group; TER was reduced in both intestinal regions concomitant with increased paracellular permeability in the distal region. Conclusions This study reveals that adverse environmental conditions (low water flow, low DO levels at low and high temperature, that can occur in sea cages, elicits primary and secondary stress responses in Atlantic salmon post smolts. The intestinal barrier function

  9. The mucus layer is critical in protecting against ischemia/reperfusion-mediated gut injury and in the restitution of gut barrier function

    Science.gov (United States)

    Qin, Xiaofa; Sheth, Sharvil U.; Sharpe, Susan M.; Dong, Wei; Lu, Qi; Xu, Dazhong; Deitch, Edwin A.

    2011-01-01

    It is well documented that the gut injury plays a critical role in the development of systemic inflammation and distant organ injury in conditions associated with splanchnic ischemia. Consequently understanding the mechanisms leading to gut injury is important. In this context, recent work suggests a protective role for the intestinal mucus layer and an injury-inducing role for luminal pancreatic proteases. Thus, we explored the role of the mucus layer in gut barrier function by observing how the removal of the mucus layer affects ischemia/reperfusion-mediated gut injury in rats as well as the potential role of luminal pancreatic proteases in the pathogenesis of gut injury. Ischemia was induced by the ligation of blood vessels to segments of the ileum for 45 min, followed by up to three hours of reperfusion. The ileal segments were divided into 5 groups. These included a non-ischemic control, ischemic segments exposed to saline, the mucolytic N-acetylcholine (NAC), pancreatic proteases or NAC plus pancreatic proteases. Changes in gut barrier function were assessed by the permeation of fluorescein isothiocyanate dextran (MW 4000 Da; FD4) in ileal everted sacs. Gut injury was measured morphologically and by the luminal content of protein, DNA and hemoglobin. The mucus layer was assessed functionally by measuring its hydrophobicity and morphologically. Gut barrier function was promptly and effectively re-established during reperfusion, which was accompanied by the restoration of the mucus layer. In contrast, treatment of the gut with the mucolytic NAC for 10 min during ischemia resulted in a failure of mucus restitution and further increases in gut permeability and injury. The presence of digestive proteases by themselves did not exacerbate gut injury but in combination with NAC, they caused an even greater increase in gut injury and permeability. These results suggest that the mucus layer not only serves as a barrier between the luminal contents and gut surface

  10. Delivery of siRNA silencing P-gp in peptide-functionalized nanoparticles causes efflux modulation at the blood-brain barrier

    DEFF Research Database (Denmark)

    Gomes, Maria João; Kennedy, Patrick J; Martins, Susana

    2017-01-01

    AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...... was evaluated in vitro; rhodamine 123 permeability was assessed after cell monolayer treatment with siRNA NPs. RESULTS: Beyond their ability to improve siRNA permeability through the BBB by twofold, 96-h post-transfection, functionalized polymeric NPs successfully reduced P-gp mRNA expression up to 52...

  11. Effects of dietary protein levels on the disease resistance, immune function and physical barrier function in the gill of grass carp (Ctenopharyngodon idella) after challenged with Flavobacterium columnare.

    Science.gov (United States)

    Xu, Jing; Feng, Lin; Jiang, Wei-Dan; Wu, Pei; Liu, Yang; Jiang, Jun; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

    2016-10-01

    The effects of dietary protein levels on the disease resistance, gill immune function and physical barrier function of grass carp (Ctenopharyngodon idella) were investigated in this study. A total of 540 grass carp (264.11 ± 0.76 g) were fed six diets containing graded levels of protein (143.1, 176.7, 217.2, 257.5, 292.2 and 322.8 g digestible protein kg(-1) diet) for 8 weeks. After the growth trial, fish were challenged with Flavobacterium columnare for 3 days. The results indicated that optimal levels of dietary protein had the following effects: (1) the production of antibacterial components increased, and anti-inflammatory cytokines, inhibitor of κBα, target of rapamycin and ribosomal protein S6 kinases 1 mRNA levels were up-regulated, whereas mRNA levels of pro-inflammatory cytokines, nuclear factor kappa B (NF-κB) P65, NF-κB P52, IκB kinase (IKK) α, IKKβ, IKKγ, eIF4E-binding proteins (4E-BP) 1 and 4E-BP2 were down-regulated in the gills of grass carp (P dietary protein; (2) the activities and mRNA levels of antioxidant enzymes and glutathione content increased, the contents of reactive oxygen species, malondialdehyde and protein carbonyl (PC) decreased, and NF-E2-related factor 2, B-cell lymphoma protein-2, inhibitor of apoptosis proteins, myeloid cell leukemia-1 and tight junction complexes mRNA levels were up-regulated, whereas Kelch-like-ECH-associated protein (Keap) 1a, Keap1b, cysteinyl aspartic acid-protease 3, 8, 9, fatty acid synthetase ligand, apoptotic protease activating factor-1, Bcl-2 associated X protein, c-Jun N-terminal protein kinase, myosin light chain kinase and p38 mitogen-activated protein kinase mRNA levels were down-regulated in the gills of grass carp (P dietary protein. Finally, based on the gill rot morbidity, ACP activity and PC content, the optimal levels of dietary protein for grass carp were estimated to be 286.65 g kg(-1) diet (253.73 g digestible protein kg(-1) diet), 290.46 g kg(-1) diet (257.76

  12. Neutral detergent-soluble fiber improves gut barrier function in twenty-five-day-old weaned rabbits.

    Science.gov (United States)

    Gómez-Conde, M S; García, J; Chamorro, S; Eiras, P; Rebollar, P G; Pérez de Rozas, A; Badiola, I; de Blas, C; Carabaño, R

    2007-12-01

    The effect of neutral detergent-soluble fiber level on gut barrier function and intestinal microbiota was examined in weaned rabbits. A control diet (AH) containing 103 g of neutral detergent-soluble fiber/ kg of DM included alfalfa hay as main source of fiber. Another diet (B-AP) was formulated by replacing half of the alfalfa hay with a mixture of beet and apple pulp resulting in 131 g of soluble fiber/kg of DM. A third diet (OH) was obtained by substituting half of the alfalfa hay with a mix of oat hulls and a soybean protein concentrate and contained 79 g of soluble fiber/kg of DM. Rabbits weaned at 25 d and slaughtered at 35 d were used to determine ileal digestibility, jejunal morphology, sucrase activity, lamina propria lymphocytes, and intestinal microbiota. Suckling 35-d-old rabbits were used to assess mucosa morphology. Mortality (from weaning to 63 d of age) was also determined. Villous height of the jejunal mucosa increased with soluble fiber (P = 0.001). Rabbits fed with the greatest level of soluble fiber (BA-P diet) showed the highest villous height/ crypt depth ratio (8.14; P = 0.001), sucrase specific activity (8,671 mumol of glucose/g of protein; P = 0.019), and the greatest ileal starch digestibility (96.8%; P = 0.002). The opposite effects were observed in rabbits fed decreased levels of soluble fiber (AH and OH diets; 4.70, 5,848 mumol of glucose/g of protein, as average, respectively). The lowest ileal starch digestibility was detected for animals fed OH diet (93.2%). Suckling rabbits of the same age showed a lower villous height/crypt depth ratio (6.70) compared with the B-AP diet group, but this ratio was higher than the AH or OH diet groups. Lower levels of soluble fiber tended (P = 0.074) to increase the cellular immune response (CD8+ lymphocytes). Diet affected IL-2 production (CD25+, P = 0.029; CD5+CD25+, P = 0.057), with no clear relationship between soluble fiber and IL-2. The intestinal microbiota biodiversity was not affected by

  13. Modeling immune functions of the mouse blood-cerebrospinal fluid barrier in vitro: primary rather than immortalized mouse choroid plexus epithelial cells are suited to study immune cell migration across this brain barrier.

    Science.gov (United States)

    Lazarevic, Ivana; Engelhardt, Britta

    2016-01-29

    The blood-cerebrospinal fluid barrier (BCSFB) established by the choroid plexus (CP) epithelium has been recognized as a potential entry site of immune cells into the central nervous system during immunosurveillance and neuroinflammation. The location of the choroid plexus impedes in vivo analysis of immune cell trafficking across the BCSFB. Thus, research on cellular and molecular mechanisms of immune cell migration across the BCSFB is largely limited to in vitro models. In addition to forming contact-inhibited epithelial monolayers that express adhesion molecules, the optimal in vitro model must establish a tight permeability barrier as this influences immune cell diapedesis. We compared cell line models of the mouse BCSFB derived from the Immortomouse(®) and the ECPC4 line to primary mouse choroid plexus epithelial cell (pmCPEC) cultures for their ability to establish differentiated and tight in vitro models of the BCSFB. We found that inducible cell line models established from the Immortomouse(®) or the ECPC4 tumor cell line did not express characteristic epithelial proteins such as cytokeratin and E-cadherin and failed to reproducibly establish contact-inhibited epithelial monolayers that formed a tight permeability barrier. In contrast, cultures of highly-purified pmCPECs expressed cytokeratin and displayed mature BCSFB characteristic junctional complexes as visualized by the junctional localization of E-cadherin, β-catenin and claudins-1, -2, -3 and -11. pmCPECs formed a tight barrier with low permeability and high electrical resistance. When grown in inverted filter cultures, pmCPECs were suitable to study T cell migration from the basolateral to the apical side of the BCSFB, thus correctly modelling in vivo migration of immune cells from the blood to the CSF. Our study excludes inducible and tumor cell line mouse models as suitable to study immune functions of the BCSFB in vitro. Rather, we introduce here an in vitro inverted filter model of the

  14. Chronic social stress in pigs impairs intestinal barrier and nutrient transporter function, and alters neuro-immune mediator and receptor expression

    Science.gov (United States)

    Li, Yihang; Song, Zehe; Kerr, Katelyn A.; Moeser, Adam J.

    2017-01-01

    Psychosocial stress is a major factor driving gastrointestinal (GI) pathophysiology and disease susceptibility in humans and animals. The mechanisms governing susceptibility to stress-induced GI disease remain poorly understood. In the present study, we investigated the influence of chronic social stress (CSS) in pigs, induced by 7 d of chronic mixing/crowding stress, on intestinal barrier and nutrient transport function, corticotropin releasing factor (CRF) signaling and immunological responses. Results from this study showed that CSS resulted in a significant impairment of ileal and colonic barrier function indicated by reduced transepithelial electrical resistance (TER) in the ileum and increased FD4 flux in the ileum (by 0.8 fold) and colon (by 0.7 fold). Ileal sodium glucose linked transporter 1 (SGLT-1) function, measured as glucose-induced changes in short-circuit current (Isc), was diminished (by 52%) in CSS pigs, associated with reduced body weight gain and feed efficiency. Although reductions in SGLT-1 function were observed in CSS pigs, mRNA expression for SGLT-1, villus heights were increased in CSS pigs. Corticotropin releasing factor (CRF) mRNA was upregulated (by 0.9 fold) in the ileum of CSS pigs but not in the colon. Urocortin 2 (Ucn2) mRNA was upregulated (by 1.5 fold) in the colon of CSS pigs, but not in the ileum. In CSS pigs, a downregulation of pro-inflammatory cytokines mRNA (IL1B, TNFA, IL8, and IL6) was observed in both ileum and colon, compared with controls. In contrast CSS induced a marked upregulation of mRNA for IL10 and mast cell chymase gene (CMA1) in the ileum and colon. Together, these data demonstrate that chronic stress in pigs results in significant alterations in intestinal barrier and nutrient transport function and neuro-immune mediator and receptor expression. PMID:28170426

  15. Alterations in Factors Involved in Differentiation and Barrier Function in the Epithelium in Oral and Genital Lichen Planus.

    Science.gov (United States)

    Danielsson, Karin; Ebrahimi, Majid; Nylander, Elisabet; Wahlin, Ylva Britt; Nylander, Karin

    2017-02-08

    Lichen planus is a chronic recurrent inflammatory disease affecting both skin and mucosa, mainly in oral and/or genital regions. Keratinocytes go through a well-regulated process of proliferation and differentiation, alterations in which may result in defects in the protective epithelial barrier. Long-term barrier impairment might lead to chronic inflammation. In order to broaden our understanding of the differentiation process in mucosal lichen planus, we mapped the expression of 4 factors known to be involved in differentiation. Biopsies were collected from oral and genital lichen planus lesions and normal controls. Altered expression of all 4 factors in epithelium from lichen planus lesions was found, clearly indicating disturbed epithelial differentiation in lichen planus lesions.

  16. In vivo and in vitro evaluation of topical formulations containing physiological lipid mixture for replacement of skin barrier function.

    Science.gov (United States)

    Barba, C; Parra, J L; Coderch, L; Semenzato, A

    2014-06-01

    The aim of the study was to describe a new in vivo and in vitro approach of the efficacy evaluation of cosmetic emollients to better understand the link between the formulation and the activity of cosmetic products. Two long term in vivo studies were carried out on nine healthy Caucasian volunteers mean age 40±12 years to evaluate the protecting and repairing effects of the two different barrier repair cosmetic formulations. The application of the formulations was repeated once a day during 7 days and biophysical parameters (TEWL and Skin Hydration) were measured before and after Sodium laureth sulphate exposure The in vitro study was carried out by freeze substitution transmission electron microscopy (FSTEM) on stratum corneum samples obtained by sections of fresh skin from young pigs, depleted with a solvent mixture and treated with the two products The in vivo results demonstrated that daily product application provided a reinforcement of the skin barrier with protecting and repairing effects from chemical injuries the extent of which was dependent on the formulation features (product A>product B) The role of the technical form on the lipid availability was confirmed by the in vitro evaluation tests. The results point out that a daily application of physiological lipid mixture containing emulsion can protect healthy skin and promote the reparing effect on unpaired barrier skin, reducing TEWL and maintaining hydration of the stratum corneum. The efficacy degree is higher when the cosmetic form promotes the availability of active ingredients increasing the product performance.

  17. Metformin induces up-regulation of blood-brain barrier functions by activating AMP-activated protein kinase in rat brain microvascular endothelial cells.

    Science.gov (United States)

    Takata, Fuyuko; Dohgu, Shinya; Matsumoto, Junichi; Machida, Takashi; Kaneshima, Shuji; Matsuo, Mai; Sakaguchi, Shinya; Takeshige, Yuki; Yamauchi, Atsushi; Kataoka, Yasufumi

    2013-04-19

    Blood-brain barrier (BBB) disruption occurs frequently in CNS diseases and injuries. Few drugs have been developed as therapeutic candidates for facilitating BBB functions. Here, we examined whether metformin up-regulates BBB functions using rat brain microvascular endothelial cells (RBECs). Metformin, concentration- and time-dependently increased transendothelial electrical resistance of RBEC monolayers, and decreased RBEC permeability to sodium fluorescein and Evans blue albumin. These effects of metformin were blocked by compound C, an inhibitor of AMP-activated protein kinase (AMPK). AMPK stimulation with an AMPK activator, AICAR, enhanced BBB functions. These findings indicate that metformin induces up-regulation of BBB functions via AMPK activation. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. The pH-sensing receptor OGR1 improves barrier function of epithelial cells and inhibits migration in an acidic environment.

    Science.gov (United States)

    de Vallière, Cheryl; Vidal, Solange; Clay, Ieuan; Jurisic, Giorgia; Tcymbarevich, Irina; Lang, Silvia; Ludwig, Marie-Gabrielle; Okoniewski, Michal; Eloranta, Jyrki J; Kullak-Ublick, Gerd A; Wagner, Carsten A; Rogler, Gerhard; Seuwen, Klaus

    2015-09-15

    The pH-sensing receptor ovarian cancer G protein-coupled receptor 1 (OGR1; GPR68) is expressed in the gut. Inflammatory bowel disease is typically associated with a decrease in local pH, which may lead to altered epithelial barrier function and subsequent gastrointestinal repair involving epithelial cell adhesion and migration. As the mechanisms underlying the response to pH changes are not well understood, we have investigated OGR1-mediated, pH-dependent signaling pathways in intestinal epithelial cells. Caco-2 cells stably overexpressing OGR1 were created and validated as tools to study OGR1 signaling. Barrier function, migration, and proliferation were measured using electric cell-substrate impedance-sensing technology. Localization of the tight junction proteins zonula occludens protein 1 and occludin and the rearrangement of cytoskeletal actin were examined by confocal microscopy. Paracellular permeability and protein and gene expression analysis using DNA microarrays were performed on filter-grown Caco-2 monolayers. We report that an acidic pH shift from pH 7.8 to 6.6 improved barrier function and stimulated reorganization of filamentous actin with prominent basal stress fiber formation. Cell migration and proliferation during in vitro wound healing were inhibited. Gene expression analysis revealed significant upregulation of genes related to cytoskeleton remodeling, cell adhesion, and growth factor signaling. We conclude that acidic extracellular pH can have a signaling function and impact the physiology of intestinal epithelial cells. The deconstruction of OGR1-dependent signaling may aid our understanding of mucosal inflammation mechanisms. Copyright © 2015 the American Physiological Society.

  19. Endogenous β-glucocerebrosidase activity in Abca12−/−epidermis elevates ceramide levels after topical lipid application but does not restore barrier function

    Science.gov (United States)

    Haller, Jorge F.; Cavallaro, Paul; Hernandez, Nicholas J.; Dolat, Lee; Soscia, Stephanie J.; Welti, Ruth; Grabowski, Gregory A.; Fitzgerald, Michael L.; Freeman, Mason W.

    2014-01-01

    ABCA12 mutations disrupt the skin barrier and cause harlequin ichthyosis. We previously showed Abca12−/− skin has increased glucosylceramide (GlcCer) and correspondingly lower amounts of ceramide (Cer). To examine why loss of ABCA12 leads to accumulation of GlcCer, de novo sphingolipid synthesis was assayed using [14C]serine labeling in ex vivo skin cultures. A defect was found in β-glucocerebrosidase (GCase) processing of newly synthesized GlcCer species. This was not due to a decline in GCase function. Abca12−/− epidermis had 5-fold more GCase protein (n = 4, P epidermis, immunostaining in null skin showed a typical interstitial distribution of the GCase protein in the Abca12−/− stratum corneum. Hence, we tested whether the block in GlcCer conversion could be circumvented by topically providing GlcCer. This approach restored up to 15% of the lost Cer products of GCase activity in the Abca12−/− epidermis. However, this level of barrier ceramide replacement did not significantly reduce trans-epidermal water loss function. Our results indicate loss of ABCA12 function results in a failure of precursor GlcCer substrate to productively interact with an intact GCase enzyme, and they support a model of ABCA12 function that is critical for transporting GlcCer into lamellar bodies. PMID:24293640

  20. Endogenous β-glucocerebrosidase activity in Abca12⁻/⁻epidermis elevates ceramide levels after topical lipid application but does not restore barrier function.

    Science.gov (United States)

    Haller, Jorge F; Cavallaro, Paul; Hernandez, Nicholas J; Dolat, Lee; Soscia, Stephanie J; Welti, Ruth; Grabowski, Gregory A; Fitzgerald, Michael L; Freeman, Mason W

    2014-03-01

    ABCA12 mutations disrupt the skin barrier and cause harlequin ichthyosis. We previously showed Abca12(-/-) skin has increased glucosylceramide (GlcCer) and correspondingly lower amounts of ceramide (Cer). To examine why loss of ABCA12 leads to accumulation of GlcCer, de novo sphingolipid synthesis was assayed using [(14)C]serine labeling in ex vivo skin cultures. A defect was found in β-glucocerebrosidase (GCase) processing of newly synthesized GlcCer species. This was not due to a decline in GCase function. Abca12(-/-) epidermis had 5-fold more GCase protein (n = 4, P epidermis, immunostaining in null skin showed a typical interstitial distribution of the GCase protein in the Abca12(-/-) stratum corneum. Hence, we tested whether the block in GlcCer conversion could be circumvented by topically providing GlcCer. This approach restored up to 15% of the lost Cer products of GCase activity in the Abca12(-/-) epidermis. However, this level of barrier ceramide replacement did not significantly reduce trans-epidermal water loss function. Our results indicate loss of ABCA12 function results in a failure of precursor GlcCer substrate to productively interact with an intact GCase enzyme, and they support a model of ABCA12 function that is critical for transporting GlcCer into lamellar bodies.

  1. Mycotoxins modify the barrier function of Caco-2 cells through differential gene expression of specific claudin isoforms: Protective effect of illite mineral clay.

    Science.gov (United States)

    Romero, Alejandro; Ares, Irma; Ramos, Eva; Castellano, Víctor; Martínez, Marta; Martínez-Larrañaga, María-Rosa; Anadón, Arturo; Martínez, María-Aránzazu

    2016-04-15

    Aflatoxin B1 (AFB1), fumonisin B1 (FB1), ochratoxin A (OTA) and T-2 toxin (T2) are mycotoxins that commonly contaminate the food chain and cause various toxicological effects. Their global occurrence is regarded as an important risk factor for human and animal health. In this study, the results demonstrate that, in human Caco-2 cells, AFB1, FB1, OTA and T2 origin cytotoxic effects, determining cell viability through MTT assay and LDH leakage, and decrease trans-epithelial electrical resistance (TEER). The decrease in barrier properties is concomitant with a reduction in the expression levels of the tight junction constituents claudin-3, claudin-4 and occludin. The protective effect of mineral clays (diosmectite, montmorillonite and illite) on alterations in cell viability and epithelial barrier function induced by the mycotoxins was also evaluated. Illite was the best clay to prevent the mycotoxin effects. Illite plus mycotoxin co-treatment completely abolished AFB1 and FB1-induced cytotoxicity. Also, the decreases in the gene expression of claudins and the reduction of TEER induced by mycotoxins were reversed by the illite plus mycotoxin co-treatment. In conclusion, these results demonstrated that mycotoxins AFB1, FB1, T2 and OTA disrupt the intestinal barrier permeability by a mechanism involving reduction of claudin isoform expressions, and illite counteracts this disruption. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Effects of glutamine alone or in combination with zinc and vitamin A on growth, intestinal barrier function, stress and satiety-related hormones in Brazilian shantytown children.

    Science.gov (United States)

    Lima, Aldo A M; Anstead, Gregory M; Zhang, Qiong; Figueiredo, Ítalo L; Soares, Alberto M; Mota, Rosa M S; Lima, Noélia L; Guerrant, Richard L; Oriá, Reinaldo B

    2014-01-01

    To determine the impact of supplemental zinc, vitamin A, and glutamine alone or in combination on growth, intestinal barrier function, stress and satiety-related hormones among Brazilian shantytown children with low median height-for-age z-scores. A randomized, double-blind, placebo-controlled trial was conducted in children aged two months to nine years from the urban shanty compound community of Fortaleza, Brazil. Demographic and anthropometric information was assessed. The random treatment groups available for testing (a total of 120 children) were as follows: (1) glutamine alone, n = 38; (2) glutamine plus vitamin A plus zinc, n = 37; and a placebo (zinc plus vitamin A vehicle) plus glycine (isonitrogenous to glutamine) control treatment, n = 38. Leptin, adiponectin, insulin-like growth factor (IGF-1), and plasma levels of cortisol were measured with immune-enzymatic assays; urinary lactulose/mannitol and serum amino acids were measured with high-performance liquid chromatography. ClinicalTrials.gov: NCT00133406. Glutamine treatment significantly improved weight-for-height z-scores compared to the placebo-glycine control treatment. Either glutamine alone or all nutrients combined prevented disruption of the intestinal barrier function, as measured by the percentage of lactulose urinary excretion and the lactulose:mannitol absorption ratio. Plasma leptin was negatively correlated with plasma glutamine (p = 0.002) and arginine (p = 0.001) levels at baseline. After glutamine treatment, leptin was correlated with weight-for-age (WAZ) and weight-for-height z-scores (WHZ) (p≤0.002) at a 4-month follow-up. In addition, glutamine and all combined nutrients (glutamine, vitamin A, and zinc) improved the intestinal barrier function in these children. Taken together, these findings reveal the benefits of glutamine alone or in combination with other gut-trophic nutrients in growing children via interactions with leptin.

  3. Lactobacillus rhamnosus GG supernatant promotes intestinal barrier function, balances Treg and TH17 cells and ameliorates hepatic injury in a mouse model of chronic-binge alcohol feeding.

    Science.gov (United States)

    Chen, Rui-Cong; Xu, Lan-Man; Du, Shan-Jie; Huang, Si-Si; Wu, He; Dong, Jia-Jia; Huang, Jian-Rong; Wang, Xiao-Dong; Feng, Wen-Ke; Chen, Yong-Ping

    2016-01-22

    Impaired intestinal barrier function plays a critical role in alcohol-induced hepatic injury, and the subsequent excessive absorbed endotoxin and bacterial translocation activate the immune response that aggravates the liver injury. Lactobacillus rhamnosus GG supernatant (LGG-s) has been suggested to improve intestinal barrier function and alleviate the liver injury induced by chronic and binge alcohol consumption, but the underlying mechanisms are still not clear. In this study, chronic-binge alcohol fed model was used to determine the effects of LGG-s on the prevention of alcoholic liver disease in C57BL/6 mice and investigate underlying mechanisms. Mice were fed Lieber-DeCarli diet containing 5% alcohol for 10 days, and one dose of alcohol was gavaged on Day 11. In one group, LGG-s was supplemented along with alcohol. Control mice were fed isocaloric diet. Nine hours later the mice were sacrificed for analysis. Chronic-binge alcohol exposure induced an elevation in liver enzymes, steatosis and morphology changes, while LGG-s supplementation attenuated these changes. Treatment with LGG-s significantly improved intestinal barrier function reflected by increased mRNA expression of tight junction (TJ) proteins and villus-crypt histology in ileum, and decreased Escherichia coli (E. coli) protein level in liver. Importantly, flow cytometry analysis showed that alcohol reduced Treg cell population while increased TH17 cell population as well as IL-17 secretion, which was reversed by LGG-s administration. In conclusion, our findings indicate that LGG-s is effective in preventing chronic-binge alcohol exposure-induced liver injury and shed a light on the importance of the balance of Treg and TH17 cells in the role of LGG-s application. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Effects of glutamine alone or in combination with zinc and vitamin A on growth, intestinal barrier function, stress and satiety-related hormones in Brazilian shantytown children

    Directory of Open Access Journals (Sweden)

    Aldo A.M. Lima

    2014-04-01

    Full Text Available OBJECTIVE: To determine the impact of supplemental zinc, vitamin A, and glutamine alone or in combination on growth, intestinal barrier function, stress and satiety-related hormones among Brazilian shantytown children with low median height-for-age z-scores. METHODS: A randomized, double-blind, placebo-controlled trial was conducted in children aged two months to nine years from the urban shanty compound community of Fortaleza, Brazil. Demographic and anthropometric information was assessed. The random treatment groups available for testing (a total of 120 children were as follows: (1 glutamine alone, n = 38; (2 glutamine plus vitamin A plus zinc, n = 37; and a placebo (zinc plus vitamin A vehicle plus glycine (isonitrogenous to glutamine control treatment, n = 38. Leptin, adiponectin, insulin-like growth factor (IGF-1, and plasma levels of cortisol were measured with immune-enzymatic assays; urinary lactulose/mannitol and serum amino acids were measured with high-performance liquid chromatography. ClinicalTrials.gov: NCT00133406. RESULTS: Glutamine treatment significantly improved weight-for-height z-scores compared to the placebo-glycine control treatment. Either glutamine alone or all nutrients combined prevented disruption of the intestinal barrier function, as measured by the percentage of lactulose urinary excretion and the lactulose:mannitol absorption ratio. Plasma leptin was negatively correlated with plasma glutamine (p = 0.002 and arginine (p = 0.001 levels at baseline. After glutamine treatment, leptin was correlated with weight-for-age (WAZ and weight-for-height z-scores (WHZ (p≤0.002 at a 4-month follow-up. In addition, glutamine and all combined nutrients (glutamine, vitamin A, and zinc improved the intestinal barrier function in these children. CONCLUSION: Taken together, these findings reveal the benefits of glutamine alone or in combination with other gut-trophic nutrients in growing children via

  5. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  6. Fecal microbiota transplantation and bacterial consortium transplantation have comparable effects on the re-establishment of mucosal barrier function in mice with intestinal dysbiosis

    Directory of Open Access Journals (Sweden)

    Ming eLi

    2015-07-01

    Full Text Available Fecal microbiota transplantation (FMT is a promising therapy, despite some reports of adverse side effects. Bacterial consortia transplantation (BCT for targeted restoration of the intestinal ecosystem is considered a relatively safe and simple procedure. However, no systematic research has assessed the effects of FMT and BCT on immune responses of intestinal mucosal barrier in patients. We conducted complementary studies in animal models on the effects of FMT and BCT, and provide recommendations for improving the clinical outcomes of these treatments. To establish the dysbiosis model, male BALB/c mice were treated with ceftriaxone intra-gastrically for 7 days. After that, FMT and BCT were performed on ceftriaxone-treated mice for 3 consecutive days to rebuild the intestinal ecosystem. Post-FMT and post-BCT changes of the intestinal microbial community and mucosal barrier functions were investigated and compared. Disruption of intestinal microbial homeostasis impacted the integrity of mucosal epithelial layer, resulting in increased intestinal permeability. These outcomes were accompanied by overexpression of Muc2, significant decrease of SIgA secretion, and overproduction of defensins and inflammatory cytokines. After FMT and BCT, the intestinal microbiota recovered quickly, this was associated with better reconstruction of mucosal barriers and re-establishment of immune networks compared with spontaneous recovery (SR. Although based on a short-term study, our results suggest that FMT and BCT promote the re-establishment of intestinal microbial communities in mice with antibiotic-induced dysbiosis, and contribute to the temporal and spatial interactions between microbiota and mucosal barriers. The effects of BCT are comparable to that of FMT, especially in normalizing the intestinal levels of Muc2, SIgA, and defensins.

  7. Evaluation of skin surface hydration state and barrier function of stratum corneum of dorsa of hands and heels treated with PROTECT X2 skin protective cream.

    Science.gov (United States)

    Kubota, Takahiro

    2012-06-01

    Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents

  8. Initial contact of glioblastoma cells with existing normal brain endothelial cells strengthen the barrier function via fibroblast growth factor 2 secretion: a new in vitro blood-brain barrier model.

    Science.gov (United States)

    Toyoda, Keisuke; Tanaka, Kunihiko; Nakagawa, Shinsuke; Thuy, Dinh Ha Duy; Ujifuku, Kenta; Kamada, Kensaku; Hayashi, Kentaro; Matsuo, Takayuki; Nagata, Izumi; Niwa, Masami

    2013-05-01

    Glioblastoma multiforme (GBM) cells invade along the existing normal capillaries in brain. Normal capillary endothelial cells function as the blood-brain barrier (BBB) that limits permeability of chemicals into the brain. To investigate whether GBM cells modulate the BBB function of normal endothelial cells, we developed a new in vitro BBB model with primary cultures of rat brain endothelial cells (RBECs), pericytes, and astrocytes. Cells were plated on a membrane with 8 μm pores, either as a monolayer or as a BBB model with triple layer culture. The BBB model consisted of RBEC on the luminal side as a bottom, and pericytes and astrocytes on the abluminal side as a top of the chamber. Human GBM cell line, LN-18 cells, or lung cancer cell line, NCI-H1299 cells, placed on either the RBEC monolayer or the BBB model increased the transendothelial electrical resistance (TEER) values against the model, which peaked within 72 h after the tumor cell application. The TEER value gradually returned to baseline with LN-18 cells, whereas the value quickly dropped to the baseline in 24 h with NCI-H1299 cells. NCI-H1299 cells invaded into the RBEC layer through the membrane, but LN-18 cells did not. Fibroblast growth factor 2 (FGF-2) strengthens the endothelial cell BBB function by increased occludin and ZO-1 expression. In our model, LN-18 and NCI-H1299 cells secreted FGF-2, and a neutralization antibody to FGF-2 inhibited LN-18 cells enhanced BBB function. These results suggest that FGF-2 would be a novel therapeutic target for GBM in the perivascular invasive front.

  9. Barrier mechanisms in the Drosophila blood-brain barrier

    Directory of Open Access Journals (Sweden)

    Samantha Jane Hindle

    2014-12-01

    Full Text Available The invertebrate blood-brain barrier field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through GPCR signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate blood-brain barrier has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many blood-brain barrier mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the blood-brain barrier can govern whole animal physiologies. This includes novel functions of blood-brain barrier gap junctions in orchestrating synchronized neuroblast proliferation, and of blood-brain barrier secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate blood-brain barrier anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.

  10. Correlation of NOX1 and NOX2 expression in ulcerative colitis tissue with intestinal mucosal oxidative stress response and barrier function injury

    Directory of Open Access Journals (Sweden)

    Tao Ma

    2017-10-01

    Full Text Available Objective: To study the correlation of NOX1 and NOX2 expression in ulcerative colitis tissue with intestinal mucosal oxidative stress response and barrier function injury. Methods: A total of 69 patients who were diagnosed with ulcerative colitis in Yan’an People’s Hospital between May 2015 and March 2017 were selected as the UC group of the research, and 78 patients who were diagnosed with colon polyps were selected as the polyps group of the research. The ulcerative colitis lesion and polyp lesion were collected to detect the expression of NOX1 and NOX2, the generation of oxygen free radicals as well as the contents of apoptosis molecules and mucosal barrier molecules. Results: The mRNA expression and protein expression of NOX1 and NOX2 in the intestinal mucosa of UC group were significantly higher than those of polyps group; LPO, MDA, AOPP, NO, PDCD5 and Bax levels in intestinal mucosa of UC group were significantly higher than those of polyps group and positively correlated with the mRNA expression and protein expression of NOX1 and NOX2 while Bcl-2, Cdx1, Cdx2, galectin-1, galectin-3, OCLN, cingulin and ZO-1 levels were significantly lower than those of polyps group and negatively correlated with the mRNA expression and protein expression of NOX1 and NOX2. Conclusion: The high expression of NOX1 and NOX2 in ulcerative colitis tissue can activate the intestinal mucosal oxidative stress response and result in the intestinal mucosal barrier function injury.

  11. Intestinal Barrier Function and the Gut Microbiome Are Differentially Affected in Mice Fed a Western-Style Diet or Drinking Water Supplemented with Fructose.

    Science.gov (United States)

    Volynets, Valentina; Louis, Sandrine; Pretz, Dominik; Lang, Lisa; Ostaff, Maureen J; Wehkamp, Jan; Bischoff, Stephan C

    2017-05-01

    Background: The consumption of a Western-style diet (WSD) and high fructose intake are risk factors for metabolic diseases. The underlying mechanisms are largely unclear. Objective: To unravel the mechanisms by which a WSD and fructose promote metabolic disease, we investigated their effects on the gut microbiome and barrier function. Methods: Adult female C57BL/6J mice were fed a sugar- and fat-rich WSD or control diet (CD) for 12 wk and given access to tap water or fructose-supplemented water. The microbiota was analyzed with the use of 16S rRNA gene sequencing. Barrier function was studied with the use of permeability tests, and endotoxin, mucus thickness, and gene expressions were measured. Results: The WSD increased body weight gain but not endotoxin translocation compared with the CD. In contrast, high fructose intake increased endotoxin translocation 2.6- and 3.8-fold in the groups fed the CD + fructose and WSD + fructose, respectively, compared with the CD group. The WSD + fructose treatment also induced a loss of mucus thickness in the colon (-46%) and reduced defensin expression in the ileum and colon. The lactulose:mannitol ratio in the WSD + fructose mice was 1.8-fold higher than in the CD mice. Microbiota analysis revealed that fructose, but not the WSD, increased the Firmicutes:Bacteroidetes ratio by 88% for CD + fructose and 63% for WSD + fructose compared with the CD group. Bifidobacterium abundance was greater in the WSD mice than in the CD mice (63-fold) and in the WSD + fructose mice than in the CD + fructose mice (330-fold). Conclusions: The consumption of a WSD or high fructose intake differentially affects gut permeability and the microbiome. Whether these differences are related to the distinct clinical outcomes, whereby the WSD primarily promotes weight gain and high fructose intake causes barrier dysfunction, needs to be investigated in future studies. © 2017 American Society for Nutrition.

  12. Effect of Wild-Type Shigella Species and Attenuated Shigella Vaccine Candidates on Small Intestinal Barrier Function, Antigen Trafficking, and Cytokine Release

    Science.gov (United States)

    Fiorentino, Maria; Levine, Myron M.

    2014-01-01

    Bacterial dysentery due to Shigella species is a major cause of morbidity and mortality worldwide. The pathogenesis of Shigella is based on the bacteria's ability to invade and replicate within the colonic epithelium, resulting in severe intestinal inflammatory response and epithelial destruction. Although the mechanisms of pathogenesis of Shigella in the colon have been extensively studied, little is known on the effect of wild-type Shigella on the small intestine and the role of the host response in the development of the disease. Moreover, to the best of our knowledge no studies have described the effects of apically administered Shigella flexneri 2a and S. dysenteriae 1 vaccine strains on human small intestinal enterocytes. The aim of this study was to assess the coordinated functional and immunological human epithelial responses evoked by strains of Shigella and candidate vaccines on small intestinal enterocytes. To model the interactions of Shigella with the intestinal mucosa, we apically exposed monolayers of human intestinal Caco2 cells to increasing bacterial inocula. We monitored changes in paracellular permeability, examined the organization of tight-junctions and the pro-inflammatory response of epithelial cells. Shigella infection of Caco2 monolayers caused severe mucosal damage, apparent as a drastic increase in paracellular permeability and disruption of tight junctions at the cell-cell boundary. Secretion of pro-inflammatory IL-8 was independent of epithelial barrier dysfunction. Shigella vaccine strains elicited a pro-inflammatory response without affecting the intestinal barrier integrity. Our data show that wild-type Shigella infection causes a severe alteration of the barrier function of a small intestinal cell monolayer (a proxy for mucosa) and might contribute (along with enterotoxins) to the induction of watery diarrhea. Diarrhea may be a mechanism by which the host attempts to eliminate harmful bacteria and transport them from the small to

  13. Interleukin-6 induces keratin expression in intestinal epithelial cells: potential role of keratin-8 in interleukin-6-induced barrier function alterations.

    Science.gov (United States)

    Wang, Lixin; Srinivasan, Shanthi; Theiss, Arianne L; Merlin, Didier; Sitaraman, Shanthi V

    2007-03-16

    Keratin 8 (K8) and keratin-18 (K18) are the major intermediate filament proteins in the intestinal epithelia. The regulation and function of keratin in the intestinal epithelia is largely unknown. In this study we addressed the role and regulation of K8 and K18 expression by interleukin 6 (IL-6). Caco2-BBE cell line and IL-6 null mice were used to study the effect of IL-6 on keratin expression. Keratin expression was studied by Northern blot, Western blot, and confocal microscopy. Paracellular permeability was assessed by apical-to-basal transport of a fluorescein isothiocyanate dextran probe (FD-4). K8 was silenced using the small interfering RNA approach. IL-6 significantly up-regulated mRNA and protein levels of K8 and K18. Confocal microscopy showed a reticular pattern of intracellular keratin localized to the subapical region after IL-6 treatment. IL-6 also induced serine phosphorylation of K8. IL-6 decreased paracellular flux of FD-4 compared with vehicle-treated monolayers. K8 silencing abolished the decrease in paracellular permeability induced by IL-6. Administration of dextran sodium sulfate (DSS) significantly increased intestinal permeability in IL-6-/- mice compared with wild type mice given DSS. Collectively, our data demonstrate that IL-6 regulates the colonic expression of K8 and K18, and K8/K18 mediates barrier protection by IL-6 under conditions where intestinal barrier is compromised. Thus, our data uncover a novel function of these abundant cytoskeletal proteins, which may have implications in intestinal disorders such as inflammatory bowel disease wherein barrier dysfunction underlies the inflammatory response.

  14. Effect of wild-type Shigella species and attenuated Shigella vaccine candidates on small intestinal barrier function, antigen trafficking, and cytokine release.

    Directory of Open Access Journals (Sweden)

    Maria Fiorentino

    Full Text Available Bacterial dysentery due to Shigella species is a major cause of morbidity and mortality worldwide. The pathogenesis of Shigella is based on the bacteria's ability to invade and replicate within the colonic epithelium, resulting in severe intestinal inflammatory response and epithelial destruction. Although the mechanisms of pathogenesis of Shigella in the colon have been extensively studied, little is known on the effect of wild-type Shigella on the small intestine and the role of the host response in the development of the disease. Moreover, to the best of our knowledge no studies have described the effects of apically administered Shigella flexneri 2a and S. dysenteriae 1 vaccine strains on human small intestinal enterocytes. The aim of this study was to assess the coordinated functional and immunological human epithelial responses evoked by strains of Shigella and candidate vaccines on small intestinal enterocytes. To model the interactions of Shigella with the intestinal mucosa, we apically exposed monolayers of human intestinal Caco2 cells to increasing bacterial inocula. We monitored changes in paracellular permeability, examined the organization of tight-junctions and the pro-inflammatory response of epithelial cells. Shigella infection of Caco2 monolayers caused severe mucosal damage, apparent as a drastic increase in paracellular permeability and disruption of tight junctions at the cell-cell boundary. Secretion of pro-inflammatory IL-8 was independent of epithelial barrier dysfunction. Shigella vaccine strains elicited a pro-inflammatory response without affecting the intestinal barrier integrity. Our data show that wild-type Shigella infection causes a severe alteration of the barrier function of a small intestinal cell monolayer (a proxy for mucosa and might contribute (along with enterotoxins to the induction of watery diarrhea. Diarrhea may be a mechanism by which the host attempts to eliminate harmful bacteria and transport them

  15. Peroxisomes induced in Candida boidinii by methanol, oleic acid and D-alanine vary in metabolic function but share common integral membrane proteins

    NARCIS (Netherlands)

    Goodman, Joel M.; Trapp, Steven B.; Hwang, Harold; Veenhuis, Marten

    Peroxisomes massively proliferate in the methylotrophic yeast Candida boidinii when cultured on methanol as the only carbon and energy source. These organelles contain enzymes that catalyze the initial reactions of methanol utilization. The membranes contain abundant proteins of unknown function;

  16. Dietary tryptophan modulates intestinal immune response, barrier function, antioxidant status and gene expression of TOR and Nrf2 in young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Wen, Hailang; Feng, Lin; Jiang, Weidan; Liu, Yang; Jiang, Jun; Li, Shuhong; Tang, Ling; Zhang, Yongan; Kuang, Shengyao; Zhou, Xiaoqiu

    2014-09-01

    The present research evaluated the effects of dietary tryptophan (Trp) on growth performance, intestinal mucosal immune, barrier function and antioxidant capacity and gene expression of young grass carp (Ctenopharyngodon idella). Fish were fed six different experimental diets containing graded levels of Trp at 0.7(control), 1.7, 3.1, 4.0, 5.2 and 6.1 g kg(-1) diet for 8 weeks. The results showed that Trp supplementation significantly enhanced the percent weight gain (PWG), feed intake and feed efficiency (P fish growth, intestinal immune response, barrier function and antioxidant status, and regulated the mRNA levels of related signal molecules of young grass carp. Based on the quadratic regression analysis of the PWG and PAC, the dietary Trp requirement of young grass carp (287-699 g) was estimated to be 3.81 g kg(-1) diet (12.7 g kg(-1) protein) and 3.89 g kg(-1) diet (13.0 g kg(-1) protein), respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Structural Optimization Using the Newton Modified Barrier Method

    Science.gov (United States)

    Khot, N. S.; Polyak, R. A.; Schneur, R.; Berke, L.

    1995-01-01

    The Newton Modified Barrier Method (NMBM) is applied to structural optimization problems with large a number of design variables and constraints. This nonlinear mathematical programming algorithm was based on the Modified Barrier Function (MBF) theory and the Newton method for unconstrained optimization. The distinctive feature of the NMBM method is the rate of convergence that is due to the fact that the design remains in the Newton area after each Lagrange multiplier update. This convergence characteristic is illustrated by application to structural problems with a varying number of design variables and constraints. The results are compared with those obtained by optimality criteria (OC) methods and by the ASTROS program.

  18. Lipid rafts regulate PCB153-induced disruption of occludin and brain endothelial barrier function through protein phosphatase 2A and matrix metalloproteinase-2

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Sung Yong, E-mail: seum@miami.edu; Jaraki, Dima; András, Ibolya E.; Toborek, Michal

    2015-09-15

    Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2′,4,4′,5,5′-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1 h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24 h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs. - Highlights: • PCB153 disturbed human brain endothelial barrier through disruption of occludin. • Lipid raft-associated PP

  19. Trail making test performance in youth varies as a function of anatomical coupling between the prefrontal cortex and distributed cortical regions

    Directory of Open Access Journals (Sweden)

    Nancy Raitano Lee

    2014-07-01

    Full Text Available While researchers have gained a richer understanding of the neural correlates of executive function in adulthood, much less is known about how these abilities are represented in the developing brain and what structural brain networks underlie them. Thus, the current study examined how individual differences in executive function, as measured by the Trail Making Test (TMT, relate to structural covariance in the pediatric brain. The sample included 146 unrelated, typically developing youth (80 females, ages 9-14 years, who completed a structural MRI scan of the brain and the Halstead-Reitan TMT (intermediate form. TMT scores used to index executive function included those that evaluated set-shifting ability: Trails B time (number-letter sequencing and the difference in time between Trails B and A (number sequencing only. Anatomical coupling was measured by examining correlations between mean cortical thickness (MCT across the entire cortical ribbon and individual vertex thickness measured at ~81,000 vertices. To examine how TMT scores related to anatomical coupling strength, linear regression was utilized and the interaction between age-normed TMT scores and both age and sex-normed MCT was used to predict vertex thickness. Results revealed that stronger Trails B scores were associated with greater anatomical coupling between a large swath of prefrontal cortex and the rest of cortex. For the difference between Trails B and A, a network of regions in the frontal, temporal and parietal lobes was found to be more tightly coupled with the rest of cortex in stronger performers. This study is the first to highlight the importance of structural covariance in the prediction of individual differences in executive function skills in youth. Thus, it adds to the growing literature on the neural correlates of childhood executive functions and identifies neuroanatomic coupling as a biological substrate that may contribute to executive function and dysfunction in

  20. The masticatory system under varying functional load. Part 2: effect of reduced masticatory load on the degree and distribution of mineralization in the rabbit mandible

    NARCIS (Netherlands)

    Grünheid, T.; Langenbach, G.E.J.; Brugman, P.; Everts, V.; Zentner, A.

    2011-01-01

    A reduction in mechanical loading of the mandible brought about by mastication of soft food is assumed to decrease the remodelling rate of bone, which, in turn, might increase the degree of bone mineralization. The effect of a reduction in masticatory functional load on the degree and distribution

  1. Alterations in Gut Microbiome Composition and Barrier Function Are Associated with Reproductive and Metabolic Defects in Women with Polycystic Ovary Syndrome (PCOS): A Pilot Study.

    Science.gov (United States)

    Lindheim, Lisa; Bashir, Mina; Münzker, Julia; Trummer, Christian; Zachhuber, Verena; Leber, Bettina; Horvath, Angela; Pieber, Thomas R; Gorkiewicz, Gregor; Stadlbauer, Vanessa; Obermayer-Pietsch, Barbara

    2017-01-01

    Polycystic ovary syndrome (PCOS) is a common female endocrinopathy of unclear origin characterized by hyperandrogenism, oligo-/anovulation, and ovarian cysts. Women with PCOS frequently display overweight, insulin resistance, and systemic low-grade inflammation. We hypothesized that endotoxemia resulting from a leaky gut is associated with inflammation, insulin resistance, fat accumulation, and hyperandrogenemia in PCOS. In this pilot study, we compared the stool microbiome, gut permeability, and inflammatory status of women with PCOS and healthy controls. 16S rRNA gene amplicon sequencing was performed on stool samples from 24 PCOS patients and 19 healthy controls. Data processing and microbiome analysis were conducted in mothur and QIIME using different relative abundance cut-offs. Gut barrier integrity, endotoxemia, and inflammatory status were evaluated using serum and stool markers and associations with reproductive, metabolic, and anthropometric parameters were investigated. The stool microbiome of PCOS patients showed a lower diversity and an altered phylogenetic composition compared to controls. We did not observe significant differences in any taxa with a relative abundance>1%. When looking at rare taxa, the relative abundance of bacteria from the phylum Tenericutes, the order ML615J-28 (phylum Tenericutes) and the family S24-7 (phylum Bacteroidetes) was significantly lower and associated with reproductive parameters in PCOS patients. Patients showed alterations in some, but not all markers of gut barrier function and endotoxemia. Patients with PCOS have a lower diversity and an altered phylogenetic profile in their stool microbiome, which is associated with clinical parameters. Gut barrier dysfunction and endotoxemia were not driving factors in this patient cohort, but may contribute to the clinical phenotype in certain PCOS patients.

  2. Functions of the CB1 and CB 2 receptors in neuroprotection at the level of the blood-brain barrier.

    Science.gov (United States)

    Vendel, Esmée; de Lange, Elizabeth C M

    2014-09-01

    The cannabinoid (CB) receptors are the main targets of the cannabinoids, which include plant cannabinoids, endocannabinoids and synthetic cannabinoids. Over the last few years, accumulated evidence has suggested a role of the CB receptors in neuroprotection. The blood-brain barrier (BBB) is an important brain structure that is essential for neuroprotection. A link between the CB receptors and the BBB is thus likely, but this possible connection has only recently gained attention. Cannabinoids and the BBB share the same mechanisms of neuroprotection and both protect against excitotoxicity (CB1), cell death (CB1), inflammation (CB2) and oxidative stress (possibly CB independent)-all processes that also damage the BBB. Several examples of CB-mediated protection of the BBB have been found, such as inhibition of leukocyte influx and induction of amyloid beta efflux across the BBB. Moreover, the CB receptors were shown to improve BBB integrity, particularly by restoring the tightness of the tight junctions. This review demonstrated that both CB receptors are able to restore the BBB and neuroprotection, but much uncertainty about the underlying signaling cascades still exists and further investigation is needed.

  3. Cutaneous Na+ storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense.

    Science.gov (United States)

    Jantsch, Jonathan; Schatz, Valentin; Friedrich, Diana; Schröder, Agnes; Kopp, Christoph; Siegert, Isabel; Maronna, Andreas; Wendelborn, David; Linz, Peter; Binger, Katrina J; Gebhardt, Matthias; Heinig, Matthias; Neubert, Patrick; Fischer, Fabian; Teufel, Stefan; David, Jean-Pierre; Neufert, Clemens; Cavallaro, Alexander; Rakova, Natalia; Küper, Christoph; Beck, Franz-Xaver; Neuhofer, Wolfgang; Muller, Dominik N; Schuler, Gerold; Uder, Michael; Bogdan, Christian; Luft, Friedrich C; Titze, Jens

    2015-03-03

    Immune cells regulate a hypertonic microenvironment in the skin; however, the biological advantage of increased skin Na(+) concentrations is unknown. We found that Na(+) accumulated at the site of bacterial skin infections in humans and in mice. We used the protozoan parasite Leishmania major as a model of skin-prone macrophage infection to test the hypothesis that skin-Na(+) storage facilitates antimicrobial host defense. Activation of macrophages in the presence of high NaCl concentrations modified epigenetic markers and enhanced p38 mitogen-activated protein kinase (p38/MAPK)-dependent nuclear factor of activated T cells 5 (NFAT5) activation. This high-salt response resulted in elevated type-2 nitric oxide synthase (Nos2)-dependent NO production and improved Leishmania major control. Finally, we found that increasing Na(+) content in the skin by a high-salt diet boosted activation of macrophages in a Nfat5-dependent manner and promoted cutaneous antimicrobial defense. We suggest that the hypertonic microenvironment could serve as a barrier to infection. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. A dual functional fluorescent probe for glioma imaging mediated by blood-brain barrier penetration and glioma cell targeting.

    Science.gov (United States)

    Ma, Hongwei; Gao, Zhiyong; Yu, Panfeng; Shen, Shun; Liu, Yongmei; Xu, Bainan

    2014-06-20

    Glioma is a huge threat for human being because it was hard to be completely removed owing to both the infiltrating growth of glioma cells and integrity of blood brain barrier. Thus effectively imaging the glioma cells may pave a way for surgical removing of glioma. In this study, a fluorescent probe, Cy3, was anchored onto the terminal of AS1411, a glioma cell targeting aptamer, and then TGN, a BBB targeting peptide, was conjugated with Cy3-AS1411 through a PEG linker. The production, named AsT, was characterized by gel electrophoresis, (1)H NMR and FTIR. In vitro cellular uptake and glioma spheroid uptake demonstrated the AsT could not only be uptaken by both glioma and endothelial cells, but also penetrate through endothelial cell monolayer and uptake by glioma spheroids. In vivo, AsT could effectively target to glioma with high intensity. In conclusion, AsT could be used as an effective glioma imaging probe. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Collaborative learning to unlock investments for functional ecological infrastructure: Bridging barriers in social-ecological systems in South Africa

    CSIR Research Space (South Africa)

    Angelstam, P

    2017-05-01

    Full Text Available Marsh A Polonsky S Richardson DM Rivers N Shackleton RT Stafford, William ABSTRACT: Maintenance of functional ecological (or green) infrastructure is threatened by habitat conversion, fragmentation and loss, water scarcity, invasive species...

  6. Hypothermia-induced loss of endothelial barrier function is restored after dopamine pretreatment : Role of p42/p44 activation

    NARCIS (Netherlands)

    Brinkkoetter, Paul-Thomas; Beck, Grietje C.; Gottmann, Uwe; Loesel, Ralf; Schnetzke, Ulf; Rudic, Boris; Hanusch, Christine; Rafat, Neysan; Liu, Zhenzi; Weiss, Christel; Leuvinik, Henri G. D.; Ploeg, Rutger; Braun, Claude; Schnuelle, Peter; van der Woude, Fokko J.; Yard, Benito A.

    2006-01-01

    Background. Donor dopamine usage is associated with improved immediate graft function after renal transplantation. Although prolonged cold preservation results in an increased vascular permeability, the present study was conducted to examine in vitro and in vivo if dopamine Pretreatment influences

  7. Synergism of MSC-secreted HGF and VEGF in stabilising endothelial barrier function upon lipopolysaccharide stimulation via the Rac1 pathway.

    Science.gov (United States)

    Yang, Yi; Chen, Qi-Hong; Liu, Ai-Ran; Xu, Xiu-Ping; Han, Ji-Bin; Qiu, Hai-Bo

    2015-12-16

    Mesenchymal stem cells (MSCs) stabilise endothelial barrier function in acute lung injury via paracrine hepatocyte growth factor (HGF). Vascular endothelial growth factor (VEGF), which is secreted by MSCs, is another key regulator of endothelial permeability; however, its role in adjusting permeability remains controversial. In addition, whether an interaction occurs between HGF and VEGF, which are secreted by MSCs, is not completely understood. We introduced a co-cultured model of human pulmonary microvascular endothelial cells (HPMECs) and MSC conditioned medium (CM) collected from MSCs after 24 h of hypoxic culture. The presence of VEGF and HGF in the MSC-CM was neutralised by anti-VEGF and anti-HGF antibodies, respectively. To determine the roles and mechanisms of MSC-secreted HGF and VEGF, we employed recombinant humanised HGF and recombinant humanised VEGF to co-culture with HPMECs. Additionally, we employed the RhoA inhibitor C3 transferase and the Rac1 inhibitor NSC23766 to inhibit the activities of RhoA and Rac1 in HPMECs treated with MSC-CM or VEGF/HGF with the same dosage as in the MSC-CM. Then, endothelial paracellular and transcellular permeability was detected. VE-cadherin, occludin and caveolin-1 protein expression in HPMECs was measured by western blot. Adherens junction proteins, including F-actin and VE-cadherin, were detected by immunofluorescence. MSC-CM treatment significantly decreased lipopolysaccharide-induced endothelial paracellular and transcellular permeability, which was significantly inhibited by pretreatment with HGF antibody or with both VEGF and HGF antibodies. Furthermore, MSC-CM treatment increased the expression of the endothelial intercellular adherence junction proteins VE-cadherin and occludin and decreased the expression of caveolin-1 protein. MSC-CM treatment also decreased endothelial apoptosis and induced endothelial cell proliferation; however, the effects of MSC-CM treatment were inhibited by pretreatment with HGF

  8. Fine-scale genetic mapping of a hybrid sterility factor between Drosophila simulans and D. mauritiana: the varied and elusive functions of "speciation genes"

    Directory of Open Access Journals (Sweden)

    Lemos Bernardo

    2010-12-01

    Full Text Available Abstract Background Hybrid male sterility (HMS is a usual outcome of hybridization between closely related animal species. It arises because interactions between alleles that are functional within one species may be disrupted in hybrids. The identification of genes leading to hybrid sterility is of great interest for understanding the evolutionary process of speciation. In the current work we used marked P-element insertions as dominant markers to efficiently locate one genetic factor causing a severe reduction in fertility in hybrid males of Drosophila simulans and D. mauritiana. Results Our mapping effort identified a region of 9 kb on chromosome 3, containing three complete and one partial coding sequences. Within this region, two annotated genes are suggested as candidates for the HMS factor, based on the comparative molecular characterization and public-source information. Gene Taf1 is partially contained in the region, but yet shows high polymorphism with four fixed non-synonymous substitutions between the two species. Its molecular functions involve sequence-specific DNA binding and transcription factor activity. Gene agt is a small, intronless gene, whose molecular function is annotated as methylated-DNA-protein-cysteine S-methyltransferase activity. High polymorphism and one fixed non-synonymous substitution suggest this is a fast evolving gene. The gene trees of both genes perfectly separate D. simulans and D. mauritiana into monophyletic groups. Analysis of gene expression using microarray revealed trends that were similar to those previously found in comparisons between whole-genome hybrids and parental species. Conclusions The identification following confirmation of the HMS candidate gene will add another case study leading to understanding the evolutionary process of hybrid incompatibility.

  9. Function of SSA subfamily of Hsp70 within and across species varies widely in complementing Saccharomyces cerevisiae cell growth and prion propagation.

    Directory of Open Access Journals (Sweden)

    Deepak Sharma

    2009-08-01

    Full Text Available The cytosol of most eukaryotic cells contains multiple highly conserved Hsp70 orthologs that differ mainly by their spatio-temporal expression patterns. Hsp70s play essential roles in protein folding, transport or degradation, and are major players of cellular quality control processes. However, while several reports suggest that specialized functions of Hsp70 orthologs were selected through evolution, few studies addressed systematically this issue.We compared the ability of Ssa1p-Ssa4p from Saccharomyces cerevisiae and Ssa5p-Ssa8p from the evolutionary distant yeast Yarrowia lipolytica to perform Hsp70-dependent tasks when expressed as the sole Hsp70 for S. cerevisiae in vivo. We show that Hsp70 isoforms (i supported yeast viability yet with markedly different growth rates, (ii influenced the propagation and stability of the [PSI(+] and [URE3] prions, but iii did not significantly affect the proteasomal degradation rate of CFTR. Additionally, we show that individual Hsp70 orthologs did not induce the formation of different prion strains, but rather influenced the aggregation properties of Sup35 in vivo. Finally, we show that [URE3] curing by the overexpression of Ydj1p is Hsp70-isoform dependent.Despite very high homology and overlapping functions, the different Hsp70 orthologs have evolved to possess distinct activities that are required to cope with different types of substrates or stress situations. Yeast prions provide a very sensitive model to uncover this functional specialization and to explore the intricate network of chaperone/co-chaperone/substrates interactions.

  10. Nature of "superluminal" barrier tunneling.

    Science.gov (United States)

    Winful, Herbert G

    2003-01-17

    We show that the distortionless tunneling of electromagnetic pulses through a barrier is a quasistatic process in which the slowly varying envelope of the incident pulse modulates the amplitude of a standing wave. For pulses longer than the barrier width, the barrier acts as a lumped element with respect to the pulse envelope. The envelopes of the transmitted and reflected fields can adiabatically follow the incident pulse with only a small delay that originates from energy storage. The theory presented here provides a physical explanation of the tunneling process and resolves the mystery of apparent superluminality.

  11. Organizational barriers

    Science.gov (United States)

    Kenneth S. Blonski

    1995-01-01

    One of the traditional roles that prescribed fire has played in the fire management arena is reduction of hazardous fuel buildups under controlled, well-defined environmental conditions. However, our ability to use this tool effectively is blocked by many barriers. The preceding panel discussion about the causes of limited success in implementing prescribed burning...

  12. Dietary acid load and renal function have varying effects on blood acid-base status and exercise performance across age and sex.

    Science.gov (United States)

    Hietavala, Enni-Maria; Stout, Jeffrey R; Frassetto, Lynda A; Puurtinen, Risto; Pitkänen, Hannu; Selänne, Harri; Suominen, Harri; Mero, Antti A

    2017-12-01

    Diet composition influences acid-base status of the body. This may become more relevant as renal functional capacity declines with aging. We examined the effects of low (LD) versus high dietary acid load (HD) on blood acid-base status and exercise performance. Participants included 22 adolescents, 33 young adults (YA), and 33 elderly (EL), who followed a 7-day LD and HD in a randomized order. At the end of both diet periods the subjects performed a cycle ergometer test (3 × 10 min at 35%, 55%, 75%, and (except EL) until exhaustion at 100% of maximal oxygen uptake). At the beginning of and after the diet periods, blood samples were collected at rest and after all workloads. Oxygen uptake, respiratory exchange ratio (RER), and heart rate (HR) were monitored during cycling. In YA and EL, bicarbonate (HCO 3 - ) and base excess (BE) decreased over the HD period, and HCO 3 - , BE, and pH were lower at rest after HD compared with LD. In YA and EL women, HCO 3 - and BE were lower at submaximal workloads after HD compared with LD. In YA women, the maximal workload was 19% shorter and maximal oxygen uptake, RER, and HR were lower after HD compared with LD. Our data uniquely suggests that better renal function is associated with higher availability of bases, which may diminish exercise-induced acidosis and improve maximal aerobic performance. Differences in glomerular filtration rate between the subject groups likely explains the larger effects of dietary acid load in the elderly compared with younger subjects and in women compared with men.

  13. Functional Behavior Assessments and Behavior Intervention Plans in Rural Schools: An Exploration of the Need, Barriers, and Recommendations

    Science.gov (United States)

    Oram, Lindsay; Owens, Sarah; Maras, Melissa

    2016-01-01

    A wealth of research highlights negative outcomes associated with mental and behavioral health problems in children and adolescents. Prevention-based frameworks have been developed to provide prevention and early intervention in the school setting. Tertiary behavioral supports often include the use of functional behavior assessments (FBAs) and…

  14. Excreted/secreted Trichuris suis products reduce barrier function and suppress inflammatory cytokine production of intestinal epithelial cells

    DEFF Research Database (Denmark)

    Hiemstra, I. H.; Klaver, E. J.; Vrijland, K.

    2014-01-01

    in an increased passage of soluble compounds to the basolateral side that affected DC function. In addition, T. suis E/S suppressed LPS-induced pro-inflammatory cytokine production by CMT93/69 cells, whereas the production of the TH2 response-inducing cytokine thymic stromal lymphopoietin (TSLP) was induced. Our...

  15. Changes in intestinal barrier function and gut microbiota in high-fat diet-fed rats are dynamic and region dependent.

    Science.gov (United States)

    Hamilton, M Kristina; Boudry, Gaëlle; Lemay, Danielle G; Raybould, Helen E

    2015-05-15

    A causal relationship between the pathophysiological changes in the gut epithelium and altered gut microbiota with the onset of obesity have been suggested but not defined. The aim of this study was to determine the temporal relationship between impaired intestinal barrier function and microbial dysbiosis in the small and large intestine in rodent high-fat (HF) diet-induced obesity. Rats were fed HF diet (45% fat) or normal chow (C, 10% fat) for 1, 3, or 6 wk; food intake, body weight, and adiposity were measured. Barrier function ex vivo using FITC-labeled dextran (4,000 Da, FD-4) and horseradish peroxidase (HRP) probes in Ussing chambers, gene expression, and gut microbial communities was assessed. After 1 wk, there was an immediate but reversible increase in paracellular permeability, decrease in IL-10 expression, and decrease in abundance of genera within the class Clostridia in the ileum. In the large intestine, HRP flux and abundance of genera within the order Bacteroidales increased with time on the HF diet and correlated with the onset of increased body weight and adiposity. The data show immediate insults in the ileum in response to ingestion of a HF diet, which were rapidly restored and preceded increased passage of large molecules across the large intestinal epithelium. This study provides an understanding of microbiota dysbiosis and gut pathophysiology in diet-induced obesity and has identified IL-10 and Oscillospira in the ileum and transcellular flux in the large intestine as potential early impairments in the gut that might lead to obesity and metabolic disorders. Copyright © 2015 the American Physiological Society.

  16. Are there any different effects of Bifidobacterium, Lactobacillus and Streptococcus on intestinal sensation, barrier function and intestinal immunity in PI-IBS mouse model?

    Directory of Open Access Journals (Sweden)

    Huan Wang

    Full Text Available BACKGROUND AND AIMS: Research has increasingly suggested that gut flora plays an important role in the development of post-infectious irritable bowel syndrome (PI-IBS. Studies of the curative effect of probiotics for IBS have usually been positive but not always. However, the differences of treatment effects and mechanisms among probiotic stains, or mixture of them, are not clear. In this study, we compared the effects of different probiotics (Befidobacterium, Lactobacillus, Streptococcus or mixture of the three on intestinal sensation, barrier function and intestinal immunity in PI-IBS mouse model. METHODS: PI-IBS model was induced by Trichinella spiralis infection in mice. Different probiotics were administered to mice after 8 weeks infection. Visceral sensitivity was measured by scores of abdominal withdrawal reflex (AWR and the threshold intensity of colorectal distention. Colonic smooth muscle contractile response was assessed by contraction of the longitudinal muscle strips. Plasma diamine oxidase (DAO and d-lactate were determined by an enzymatic spectrophotometry. Expression of tight junction proteins and cytokines in ileum were measured by Western blotting. RESULTS: Compared to control mice, PI-IBS mice treated either alone with Befidobacterium or Lactobacillus (but not Streptococcus, or the mixture of the three exhibited not only decreased AWR score and contractile response, but also reduced plasma DAO and D-lactate. These probiotic treatments also suppressed the expression of proinflammatory cytokine IL-6 and IL-17 and promoted the expression of major tight junction proteins claudin-1 and occludin. The mixture of the three probiotic strains performed better than the individual in up-regulating these tight junction proteins and suppressing IL-17 expression. CONCLUSIONS: Bifidobacterium and Lactobacillus, but not Streptococcus, alleviated visceral hypersensitivity and recovered intestinal barrier function as well as inflammation in PI

  17. Reversed Effects of Intermittent Theta Burst Stimulation following Motor Training That Vary as a Function of Training-Induced Changes in Corticospinal Excitability.

    Science.gov (United States)

    Stöckel, Tino; Summers, Jeffery J; Hinder, Mark R

    2015-01-01

    Intermittent theta burst stimulation (iTBS) has the potential to enhance corticospinal excitability (CSE) and subsequent motor learning. However, the effects of iTBS following motor learning are unknown. The purpose of the present study was to explore the effect of iTBS on CSE and performance following motor learning. Therefore twenty-four healthy participants practiced a ballistic motor task for a total of 150 movements. iTBS was subsequently applied to the trained motor cortex (STIM group) or the vertex (SHAM group). Performance and CSE were assessed before motor learning and before and after iTBS. Training significantly increased performance and CSE in both groups. In STIM group participants, subsequent iTBS significantly reduced motor performance with smaller reductions in CSE. CSE changes as a result of motor learning were negatively correlated with both the CSE changes and performance changes as a result of iTBS. No significant effects of iTBS were found for SHAM group participants. We conclude that iTBS has the potential to degrade prior motor learning as a function of training-induced CSE changes. That means the expected LTP-like effects of iTBS are reversed following motor learning.

  18. Reversed Effects of Intermittent Theta Burst Stimulation following Motor Training That Vary as a Function of Training-Induced Changes in Corticospinal Excitability

    Directory of Open Access Journals (Sweden)

    Tino Stöckel

    2015-01-01

    Full Text Available Intermittent theta burst stimulation (iTBS has the potential to enhance corticospinal excitability (CSE and subsequent motor learning. However, the effects of iTBS following motor learning are unknown. The purpose of the present study was to explore the effect of iTBS on CSE and performance following motor learning. Therefore twenty-four healthy participants practiced a ballistic motor task for a total of 150 movements. iTBS was subsequently applied to the trained motor cortex (STIM group or the vertex (SHAM group. Performance and CSE were assessed before motor learning and before and after iTBS. Training significantly increased performance and CSE in both groups. In STIM group participants, subsequent iTBS significantly reduced motor performance with smaller reductions in CSE. CSE changes as a result of motor learning were negatively correlated with both the CSE changes and performance changes as a result of iTBS. No significant effects of iTBS were found for SHAM group participants. We conclude that iTBS has the potential to degrade prior motor learning as a function of training-induced CSE changes. That means the expected LTP-like effects of iTBS are reversed following motor learning.

  19. Impaired intestinal barrier function and relapsing digestive disease: Lessons from a porcine model of early life stress.

    Science.gov (United States)

    Ziegler, A L; Blikslager, A T

    2017-11-01

    Within this issue of Neurogastroenterology and Motility, an article by Pohl et al highlights new insights from a powerful porcine model of the link between early life adversity and relapsing functional gastrointestinal disorders. Early weaning stress closely mimics the early life psychosocial stressors that have been linked to adult onset gastrointestinal dysfunction. This early weaning model provides reproducible and highly translatable outcomes in young stress-challenged pigs. Due to the convincingly comparable neurological and gastroenterological anatomy and physiology between pigs and human beings, gastrointestinal stress and injury studies utilizing swine models will provide invaluable insights to improve our understanding and treatment of gastrointestinal disease in human beings. Future studies to examine mechanisms underlying this link between early life adversity and functional gastrointestinal disorders will explore the roles of gender and hypomaturity in gastrointestinal responses to stress. © 2017 John Wiley & Sons Ltd.

  20. Genome-wide analysis of chitinase genes and their varied functions in larval moult, pupation and eclosion in the rice striped stem borer, Chilo suppressalis.

    Science.gov (United States)

    Su, C; Tu, G; Huang, S; Yang, Q; Shahzad, M F; Li, F

    2016-08-01

    Some insect chitinases are required to degrade chitin and ensure successful metamorphosis. Although chitinase genes have been well characterized in several model insects, no reports exist for the rice striped stem borer, Chilo suppressalis, a highly destructive pest that causes huge yield losses in rice production. Here, we conducted a genome-level analysis of chitinase genes in C. suppressalis. After amplification of full-length transcripts with rapid amplification of cDNA ends, we identified 12 chitinase genes in C. suppressalis. All these genes had the conserved domains and motifs of glycoside hydrolase family 18 and grouped phylogenetically into five subgroups. C. suppressalis chitinase 1 (CsCht1) was highly expressed in late pupae, whereas CsCht3 was abundant in early pupae. Both CsCht2 and CsCht4 were highly expressed in larvae. CsCht2 was abundant specifically in the third-instar larvae and CsCht4 showed periodic high expression in 2- to 5-day-old larvae in each instar. Tissue specific expression analysis indicated that CsCht1 and CsCht3 were highly expressed in epidermis whereas CsCht2 and CsCht4 were specifically abundant in the midgut. Knockdown of CsCht1 resulted in adults with curled wings, indicating that CsCht1 might have an important role in wing expansion. Silencing of CsCht2 or CsCht4 arrested moulting, suggesting essential roles in larval development. When the expression of CsCht3 was interfered, defects in pupation occurred. Overall, we provide here the first catalogue of chitinase genes in the rice striped stem borer and have elucidated the functions of four chitinases in metamorphosis. © 2016 The Royal Entomological Society.

  1. Skin barrier in rosacea*

    Science.gov (United States)

    Addor, Flavia Alvim Sant'Anna

    2016-01-01

    Recent studies about the cutaneous barrier demonstrated consistent evidence that the stratum corneum is a metabolically active structure and also has adaptive functions, may play a regulatory role in the inflammatory response with activation of keratinocytes, angiogenesis and fibroplasia, whose intensity depends primarily on the intensity the stimulus. There are few studies investigating the abnormalities of the skin barrier in rosacea, but the existing data already show that there are changes resulting from inflammation, which can generate a vicious circle caused a prolongation of flare-ups and worsening of symptoms. This article aims to gather the most relevant literature data about the characteristics and effects of the state of the skin barrier in rosacea. PMID:26982780

  2. Using the International Classification of Functioning, Disability and Health (ICF) to address facilitators and barriers to participation at work.

    Science.gov (United States)

    Martins, Anabela Correia

    2015-01-01

    The International Classification of Functioning, Disability and Health (ICF) was approved by the World Health Assembly in 2001. Ten years later, strong arguments have arisen regarding the added value of ICF to the policies on employment and the outcomes at the workplace. As a conceptual framework, ICF has universality because of its inclusive and comprehensive view of human functioning. At a practical level ICF can be used to quantify the impact of impairment on an individual's ability to act in his/her environment and to assess interventions to minimize the impact of disability and maximize functioning. To explore key indicators of social participation (life habits) of persons with disabilities, particularly related to work, among environmental and personal factors. Data were collected by self-administered questionnaires from a convenience sample of 149 working-age persons with disabilities. Social participation is a construct composed by multiple components and employment domain is the strongest indicator of participation. Correlations between social participation and personal factors, such as self-efficacy and attitudes towards disability were moderate. Those who are employed scored higher quality of life in terms of satisfaction with life, more positive attitudes toward disabilities and higher self-efficacy than the ones who are retired or unemployed. Persons using adapted wheelchair and those who were involved in wheelchair selection scored higher in social participation in general, performance at work, and quality of life. Age and disability duration were not associated with participants' employment status. These findings suggest that rehabilitation and vocational agents, like physiotherapists and other professionals, should have knowledge and understanding of the multiple factors that influence persons with disabilities' participation at work. Programs should provide appropriate wheelchairs, skills training, empowerment and problem-solving strategies in

  3. Response function of an HPGe detector simulated through MCNP 4A varying the density and chemical composition of the matrix; Funcion respuesta de un detector HPGe simulada mediante MCNP 4A variando la densidad y composicion quimica de la matriz

    Energy Technology Data Exchange (ETDEWEB)

    Leal A, B.; Mireles G, F.; Quirino T, L.; Pinedo, J.L. [Universidad Autonoma de Zacatecas, Zacatecas (Mexico)]. e-mail: bleal79@yahoo.com.mx

    2005-07-01

    In the area of the Radiological Safety it is required of a calibrated detection system in energy and efficiency for the determination of the concentration in activity in samples that vary in chemical composition and by this in density. The area of Nuclear Engineering requires to find the grade of isotopic enrichment of the uranium of the Sub-critic Nuclear Chicago 9000 Mark. Given the experimental importance that has the determination from the curves of efficiency to the effects of establishing the quantitative results, is appealed to the simulation of the response function of the detector used in the Regional Center of Nuclear Studies inside the range of energy of 80 keV to 1400 keV varying the density of the matrix and the chemical composition by means of the application of the Monte Carlo code MCNP-4A. The obtained results in the simulation of the response function of the detector show a grade of acceptance in the range from 500 to 1400 keV energy, with a smaller percentage discrepancy to 10%, in the range of low energy that its go from 59 to 400 keV, the percentage discrepancy varies from 17% until 30%, which is manifested in the opposing isotopic relationship for 5 fuel rods of the Sub critic nuclear assemble. (Author)

  4. Apical, but not basolateral, endotoxin preincubation protects alveolar epithelial cells against hydrogen peroxide-induced loss of barrier function: the role of nitric oxide synthesis.

    Science.gov (United States)

    Rose, Frank; Guthmann, Bernd; Tenenbaum, Tobias; Fink, Ludger; Ghofrani, Ardeschir; Weissmann, Norbert; König, Peter; Ermert, Leander; Dahlem, Gabriele; Haenze, Joerg; Kummer, Wolfgang; Seeger, Werner; Grimminger, Friedrich

    2002-08-01

    The influence of LPS preincubation on hydrogen peroxide (H(2)O(2))-induced loss of epithelial barrier function was investigated in rat alveolar epithelial type II cells (ATII). Both apical and basolateral H(2)O(2) administration caused a manyfold increase in transepithelial [(3)H]mannitol passage. Apical but not basolateral preincubation of ATII with LPS did not influence control barrier properties but fully abrogated the H(2)O(2)-induced leakage response. The effect of apical LPS was CD14 dependent and was accompanied by a strong up-regulation of NO synthase II mRNA and protein and NO release. Inhibition of NO by N(G)-monomethyl-L-arginine suppressed the LPS effect, whereas it was reproduced by exogenous application of gaseous NO or NO donor agents. Manipulation of the glutathione homeostasis (buthionine-(S,R)-sulfoximine) and the cGMP pathway (1H-(1,2,4)oxadiazolo[4,3-alpha]quinoxaline-1-one; zaprinast) did not interfere with the protective effect of LPS. Superoxide (O*(-)(2)) generation by ATII cells was reduced by exogenous NO and LPS preincubation. O*(-)(2) scavenging with exogenous superoxide dismutase, the intracellular superoxide dismutase analog Mn(III)tetrakis(4-benzoic acid) porphyrin, and the superoxide scavenger nitroblue tetrazolium and, in particular, hydroxyl radical scavenging with hydroxyl radical scavenger 1,3-dimethyl-thiourea inhibited the H(2)O(2)-induced epithelial leakage response. In conclusion, apical but not basolateral LPS preincubation of ATII cells provides strong protection against H(2)O(2)-induced transepithelial leakage, attributable to an up-regulation of epithelial NO synthesis. It is suggested that the LPS-induced NO formation is effective via interaction with reactive oxygen species, including superoxide and hydroxyl radicals. The polarized epithelial response to LPS may be part of the lung innate immune system, activated by inhaled endotoxin or under conditions of pneumonia.

  5. Multiple roles for keratin intermediate filaments in the regulation of epithelial barrier function and apico-basal polarity.

    Science.gov (United States)

    Salas, Pedro J; Forteza, Radia; Mashukova, Anastasia

    2016-01-01

    As multicellular organisms evolved a family of cytoskeletal proteins, the keratins (types I and II) expressed in epithelial cells diversified in more than 20 genes in vertebrates. There is no question that keratin filaments confer mechanical stiffness to cells. However, such a number of genes can hardly be explained by evolutionary advantages in mechanical features. The use of transgenic mouse models has revealed unexpected functional relationships between keratin intermediate filaments and intracellular signaling. Accordingly, loss of keratins or mutations in keratins that cause or predispose to human diseases, result in increased sensitivity to apoptosis, regulation of innate immunity, permeabilization of tight junctions, and mistargeting of apical proteins in different epithelia. Precise mechanistic explanations for these phenomena are still lacking. However, immobilization of membrane or cytoplasmic proteins, including chaperones, on intermediate filaments ("scaffolding") appear as common molecular mechanisms and may explain the need for so many different keratin genes in vertebrates.

  6. The Chick Chorioallantoic Membrane: A Model of Molecular, Structural, and Functional Adaptation to Transepithelial Ion Transport and Barrier Function during Embryonic Development

    Directory of Open Access Journals (Sweden)

    Maria Gabriella Gabrielli

    2010-01-01

    Full Text Available The chick chorioallantoic membrane is a very simple extraembryonic membrane which serves multiple functions during embryo development; it is the site of exchange of respiratory gases, calcium transport from the eggshell, acid-base homeostasis in the embryo, and ion and H2O reabsorption from the allantoic fluid. All these functions are accomplished by its epithelia, the chorionic and the allantoic epithelium, by differentiation of a wide range of structural and molecular peculiarities which make them highly specialized, ion transporting epithelia. Studying the different aspects of such a developmental strategy emphasizes the functional potential of the epithelium and offers an excellent model system to gain insights into questions partly still unresolved.

  7. Osteoconductive Potential of Barrier NanoSiO2 PLGA Membranes Functionalized by Plasma Enhanced Chemical Vapour Deposition

    Directory of Open Access Journals (Sweden)

    Antonia Terriza

    2014-01-01

    Full Text Available The possibility of tailoring membrane surfaces with osteoconductive potential, in particular in biodegradable devices, to create modified biomaterials that stimulate osteoblast response should make them more suitable for clinical use, hopefully enhancing bone regeneration. Bioactive inorganic materials, such as silica, have been suggested to improve the bioactivity of synthetic biopolymers. An in vitro study on HOB human osteoblasts was performed to assess biocompatibility and bioactivity of SiO2 functionalized poly(lactide-co-glycolide (PLGA membranes, prior to clinical use. A 15 nm SiO2 layer was deposited by plasma enhanced chemical vapour deposition (PECVD, onto a resorbable PLGA membrane. Samples were characterized by X-ray photoelectron spectroscopy, atomic force microscopy, scanning electron microscopy, and infrared spectroscopy (FT-IR. HOB cells were seeded on sterilized test surfaces where cell morphology, spreading, actin cytoskeletal organization, and focal adhesion expression were assessed. As proved by the FT-IR analysis of samples, the deposition by PECVD of the SiO2 onto the PLGA membrane did not alter the composition and other characteristics of the organic membrane. A temporal and spatial reorganization of cytoskeleton and focal adhesions and morphological changes in response to SiO2 nanolayer were identified in our model. The novedous SiO2 deposition method is compatible with the standard sterilization protocols and reveals as a valuable tool to increase bioactivity of resorbable PLGA membranes.

  8. Altered permeability barrier structure in cholesteatoma matrix

    DEFF Research Database (Denmark)

    Svane-Knudsen, Viggo; Halkier-Sørensen, Lars; Rasmussen, Gurli

    2002-01-01

    lipid structures filling the intercellular spaces mainly control the barrier function. The barrier in cholesteatoma epithelium is several times thicker than in unaffected skin but presents distinctive features of a defective barrier as seen in other scaling skin diseases. The intercellular spaces appear...... frequently occur. The corneocytes are shed in clusters, not as single cells. Further, lipid droplets and intracellular membranous material are occasionally seen. In spite of these clear signs of barrier dysfunction, it is unknown whether the thickness of the barrier compensates for the defect in barrier...

  9. Smoothly Varying Bright Blazars

    Science.gov (United States)

    Van Alfen, Nicholas; Hindman, Lauren; Moody, Joseph Ward; Biancardi, Rochelle; Whipple, Parkes; Gaunt, Caleb

    2018-01-01

    It is becoming increasingly apparent that blazar light can vary sinusoidally with periods of hundreds of days to tens of years. Such behavior is expected of, among other things, jets coming from binary black holes. To look for general variability in lesser-known blazars and AGN, in 2015-2016 we monitored 182 objects with Johnson V-band magnitudes reported as being < 16. In all, this campaign generated 22,000 frames from 2,000 unique pointings. We find that approximately one dozen of these objects show evidence of smooth variability consistent with sinusoidal periods. We report on the entire survey sample, highlighting those that show sinusoidal variations.

  10. The cortical acto-myosin network: from diffusion barrier to functional gateway in the transport of neurosecretory vesicles to the plasma membrane

    Directory of Open Access Journals (Sweden)

    Andreas ePapadopulos

    2013-10-01

    Full Text Available Dysregulation of regulated exocytosis is linked to an array of pathological conditions, including neurodegenerative disorders, asthma and diabetes. Understanding the molecular mechanisms underpinning neuroexocytosis including the processes that allow neurosecretory vesicles to access and fuse with the plasma membrane and to recycle post-fusion, is therefore critical to the design of future therapeutic drugs that will efficiently tackle these diseases. Despite considerable efforts to determine the principles of vesicular fusion, the mechanisms controlling the approach of vesicles to the plasma membrane in order to undergo tethering, docking, priming, and fusion remain poorly understood. All these steps involve the cortical actin network, a dense mesh of actin filaments localized beneath the plasma membrane. Recent work overturned the long-held belief that the cortical actin network only plays a passive constraining role in neuroexocytosis functioning as a physical barrier that partly breaks down upon entry of Ca2+ to allow secretory vesicles to reach the plasma membrane. A multitude of new roles for the cortical actin network in regulated exocytosis have now emerged and point to highly dynamic novel functions of key myosin molecular motors. Myosins are not only believed to help bring about dynamic changes in the actin cytoskeleton, tethering and guiding vesicles to their fusion sites, but they also regulate the size and duration of the fusion pore, thereby directly contributing to the release of neurotransmitters and hormones.Here we discuss the functions of the cortical actin network, myosins and their effectors in controlling the processes that lead to tethering, directed transport, docking, and fusion of exocytotic vesicles in regulated exocytosis.

  11. Intestinal cell barrier function in vitro is severely compromised by keratin 8 and 18 mutations identified in patients with inflammatory bowel disease.

    Science.gov (United States)

    Zupancic, Tina; Stojan, Jure; Lane, Ellen Birgitte; Komel, Radovan; Bedina-Zavec, Apolonija; Liovic, Mirjana

    2014-01-01

    Keratin 8 and 18 (K8/K18) mutations have been implicated in the aetiology of certain pathogenic processes of the liver and pancreas. While some K8 mutations (K8 G62C, K8 K464N) are also presumed susceptibility factors for inflammatory bowel disease (IBD), the only K18 mutation (K18 S230T) discovered so far in an IBD patient is thought to be a polymorphism. The aim of our study was to demonstrate that these mutations might also directly affect intestinal cell barrier function. Cell monolayers of genetically engineered human colonocytes expressing these mutations were tested for permeability, growth rate and resistance to heat-stress. We also calculated the change in dissociation constant (Kd, measure of affinity) each of these mutations introduces into the keratin protein, and present the first model of a keratin dimer L12 region with in silico clues to how the K18 S230T mutation may affect keratin function. Physiologically, these mutations cause up to 30% increase in paracellular permeability in vitro. Heat-stress induces little keratin clumping but instead cell monolayers peel off the surface suggesting a problem with cell junctions. K18 S230T has pronounced pathological effects in vitro marked by high Kd, low growth rate and increased permeability. The latter may be due to the altered distribution of tight junction components claudin-4 and ZO-1. This is the first time intestinal cells have been suggested also functionally impaired by K8/K18 mutations. Although an in vitro colonocyte model system does not completely mimic the epithelial lining of the intestine, nevertheless the data suggest that K8/K18 mutations may be also able to produce a phenotype in vivo.

  12. Intestinal cell barrier function in vitro is severely compromised by keratin 8 and 18 mutations identified in patients with inflammatory bowel disease.

    Directory of Open Access Journals (Sweden)

    Tina Zupancic

    Full Text Available Keratin 8 and 18 (K8/K18 mutations have been implicated in the aetiology of certain pathogenic processes of the liver and pancreas. While some K8 mutations (K8 G62C, K8 K464N are also presumed susceptibility factors for inflammatory bowel disease (IBD, the only K18 mutation (K18 S230T discovered so far in an IBD patient is thought to be a polymorphism. The aim of our study was to demonstrate that these mutations might also directly affect intestinal cell barrier function. Cell monolayers of genetically engineered human colonocytes expressing these mutations were tested for permeability, growth rate and resistance to heat-stress. We also calculated the change in dissociation constant (Kd, measure of affinity each of these mutations introduces into the keratin protein, and present the first model of a keratin dimer L12 region with in silico clues to how the K18 S230T mutation may affect keratin function. Physiologically, these mutations cause up to 30% increase in paracellular permeability in vitro. Heat-stress induces little keratin clumping but instead cell monolayers peel off the surface suggesting a problem with cell junctions. K18 S230T has pronounced pathological effects in vitro marked by high Kd, low growth rate and increased permeability. The latter may be due to the altered distribution of tight junction components claudin-4 and ZO-1. This is the first time intestinal cells have been suggested also functionally impaired by K8/K18 mutations. Although an in vitro colonocyte model system does not completely mimic the epithelial lining of the intestine, nevertheless the data suggest that K8/K18 mutations may be also able to produce a phenotype in vivo.

  13. Skin Barrier Function Is Not Impaired and Kallikrein 7 Gene Polymorphism Is Frequently Observed in Korean X-linked Ichthyosis Patients Diagnosed by Fluorescence in Situ Hybridization and Array Comparative Genomic Hybridization.

    Science.gov (United States)

    Lee, Noo Ri; Yoon, Na Young; Jung, Minyoung; Kim, Ji-Yun; Seo, Seong Jun; Wang, Hye-Young; Lee, Hyeyoung; Sohn, Young Bae; Choi, Eung Ho

    2016-08-01

    X-linked ichthyosis (XLI) is a recessively inherited ichthyosis. Skin barrier function of XLI patients reported in Western countries presented minimally abnormal or normal. Here, we evaluated the skin barrier properties and a skin barrier-related gene mutation in 16 Korean XLI patients who were diagnosed by fluorescence in situ hybridization and array comparative genomic hybridization analysis. Skin barrier properties were measured, cytokine expression levels in the stratum corneum (SC) were evaluated with the tape stripped specimen from skin surface, and a genetic test was done on blood. XLI patients showed significantly lower SC hydration, but normal basal trans-epidermal water loss and skin surface pH as compared to a healthy control group. Histopathology of ichthyosis epidermis showed no acanthosis, and levels of the pro-inflammatory cytokines in the corneal layer did not differ between control and lesional/non-lesional skin of XLI patients. Among the mutations in filaggrin (FLG), kallikrein 7 (KLK7), and SPINK5 genes, the prevalence of KLK7 gene mutations was significantly higher in XLI patients (50%) than in controls (0%), whereas FLG and SPINK5 prevalence was comparable. Korean XLI patients exhibited unimpaired skin barrier function and frequent association with the KLK7 gene polymorphism, which may differentiate them from Western XLI patients.

  14. Modulation of the intestinal environment, innate immune response, and barrier function by dietary threonine and purified fiber during a coccidiosis challenge in broiler chicks.

    Science.gov (United States)

    Wils-Plotz, E L; Jenkins, M C; Dilger, R N

    2013-03-01

    Coccidiosis is a major contributor to economic losses in the poultry industry due to its detrimental effects on growth performance and nutrient utilization. We hypothesized that the combined effects of supplemental dietary Thr and purified fiber may modulate the intestinal environment and positively affect intestinal immune responses and barrier function in broiler chicks infected with Eimeria maxima. A Thr-deficient basal diet (3.1 g of Thr/kg of diet) was supplemented with 70 g/kg of silica sand (control) or high-methoxy pectin and 1 of 2 concentrations of Thr (1.8 or 5.3 g/kg of diet; 4 diets total), and fed to chicks from hatch to d 16 posthatch. On d 10 posthatch, chicks received 0.5 mL of distilled water or an acute dose of Eimeria maxima (1.5 × 10(3) sporulated oocytes) with 6 replicate pens of 6 chicks per each of 8 treatment combinations (4 diets and 2 inoculation states). Body weight gain, feed intake, and G:F increased (P coccidiosis, Thr supplementation had the greatest effect on intestinal immune response and maintenance of near normal growth in young broiler chicks infected with E. maxima.

  15. Programme on the recyclability of food-packaging materials with respect to food safety considerations: polyethylene terephthalate (PET), paper and board, and plastics covered by functional barriers.

    Science.gov (United States)

    Franz, R

    2002-01-01

    Stimulated by new ecology-driven European and national regulations, news routes of recycling waste appear on the market. Since food packages represent a large percentage of the plastics consumption and since they have a short lifetime, an important approach consists in making new packages from post-consumer used packages. On the other hand, food-packaging regulations in Europe require that packaging materials must be safe. Therefore, potential mass transfer (migration) of harmful recycling-related substances to the food must be excluded and test methods to ensure the safety-in-use of recycled materials for food packaging are needled. As a consequence of this situation, a European research project FAIR-CT98-4318, with the acronym 'Recyclability', was initiated. The project consists of three sections each focusing on a different class of recycled materials: polyethylene terephthalate (PET), paper and board, and plastics covered by functional barriers. The project consortium consists of 28 project members from 11 EU countries. In addition, the project is during its lifetime in discussion with the US Food and Drug Administrations (FDA) to consider also US FDA regulatory viewpoints and to aim, as a consequence, to harmonizable conclusions and recommendations. The paper introduces the project and presents an overview of the project work progress.

  16. A synchrotron X-ray diffraction deconvolution method for the measurement of residual stress in thermal barrier coatings as a function of depth.

    Science.gov (United States)

    Li, C; Jacques, S D M; Chen, Y; Daisenberger, D; Xiao, P; Markocsan, N; Nylen, P; Cernik, R J

    2016-12-01

    The average residual stress distribution as a function of depth in an air plasma-sprayed yttria stabilized zirconia top coat used in thermal barrier coating (TBC) systems was measured using synchrotron radiation X-ray diffraction in reflection geometry on station I15 at Diamond Light Source, UK, employing a series of incidence angles. The stress values were calculated from data deconvoluted from diffraction patterns collected at increasing depths. The stress was found to be compressive through the thickness of the TBC and a fluctuation in the trend of the stress profile was indicated in some samples. Typically this fluctuation was observed to increase from the surface to the middle of the coating, decrease a little and then increase again towards the interface. The stress at the interface region was observed to be around 300 MPa, which agrees well with the reported values. The trend of the observed residual stress was found to be related to the crack distribution in the samples, in particular a large crack propagating from the middle of the coating. The method shows promise for the development of a nondestructive test for as-manufactured samples.

  17. Role of TLR4/NF-κB in damage to intestinal mucosa barrier function and bacterial translocation in rats exposed to hypoxia.

    Directory of Open Access Journals (Sweden)

    Han Luo

    Full Text Available The role of Toll-like receptor 4 (TLR4/nuclear factor-kappa-B (NF-κB in intestinal mucosal barrier damage and bacterial translocation under hypoxic exposure is unclear. Here, we investigated their role using an acute hypobaric hypoxia model. Adult Sprague-Dawley rats were divided into control (C, hypoxia (H, hypoxia+NF-κB inhibitor pyrrolidinedithiocarbamic acid (PDTC (100 mg. kg (HP, hypoxia+0.5 mg/kg lipopolysaccharide (HPL, and hypoxia+PDTC+LPS (HPL group. Except control group, other four groups were placed in a hypobaric chamber set at 7000 m. Samples were collected at 72 h after pressure reduction. Damage in ultrastructure of the intestinal tract was examined by transmission electron microscopy and bacterial translocation was detected by cultivation. Kinetic turbidimetric assay was used to measure the serum LPS.ELISA was performed to detect TNF-α and IL-6 serum concentrations. Fluorescent quantitative RT-PCR was used to measure TLR4 mRNA levels was measured using quantitative RT-PCR and protein of NF-κB p65 was measured by western blotting. Different degrees of intestinal mucosa damage were observed in groups H and HL. The damage was significantly alleviated after blockage of the TLR4/NF-κB signaling pathway. PDTC- treatment also reversed hyoxia- and LPS-induced bacterial translocation rate and increased serum levels of LPS, TNF-α, and IL-6. TLR4 mRNA levels and NF-κB p65 expression were consistent with the serum factor results. This study suggested that TLR4 and NF-κB expression increased in rat intestinal tissues after acute hypoxia exposure. PDTC-treatment reversed TLR4 and NF-κB upregulation and alleviated damage to the intestinal tract and bacterial translocation. Thus, the TLR4/NF-κB signaling pathway may be critical to the mechanism underlying hypoxia-induced damage to intestinal barrier function and bacterial translocation.

  18. Dual function of novel pollen coat (surface proteins: IgE-binding capacity and proteolytic activity disrupting the airway epithelial barrier.

    Directory of Open Access Journals (Sweden)

    Mohamed Elfatih H Bashir

    Full Text Available BACKGROUND: The pollen coat is the first structure of the pollen to encounter the mucosal immune system upon inhalation. Prior characterizations of pollen allergens have focused on water-soluble, cytoplasmic proteins, but have overlooked much of the extracellular pollen coat. Due to washing with organic solvents when prepared, these pollen coat proteins are typically absent from commercial standardized allergenic extracts (i.e., "de-fatted", and, as a result, their involvement in allergy has not been explored. METHODOLOGY/PRINCIPAL FINDINGS: Using a unique approach to search for pollen allergenic proteins residing in the pollen coat, we employed transmission electron microscopy (TEM to assess the impact of organic solvents on the structural integrity of the pollen coat. TEM results indicated that de-fatting of Cynodon dactylon (Bermuda grass pollen (BGP by use of organic solvents altered the structural integrity of the pollen coat. The novel IgE-binding proteins of the BGP coat include a cysteine protease (CP and endoxylanase (EXY. The full-length cDNA that encodes the novel IgE-reactive CP was cloned from floral RNA. The EXY and CP were purified to homogeneity and tested for IgE reactivity. The CP from the BGP coat increased the permeability of human airway epithelial cells, caused a clear concentration-dependent detachment of cells, and damaged their barrier integrity. CONCLUSIONS/SIGNIFICANCE: Using an immunoproteomics approach, novel allergenic proteins of the BGP coat were identified. These proteins represent a class of novel dual-function proteins residing on the coat of the pollen grain that have IgE-binding capacity and proteolytic activity, which disrupts the integrity of the airway epithelial barrier. The identification of pollen coat allergens might explain the IgE-negative response to available skin-prick-testing proteins in patients who have positive symptoms. Further study of the role of these pollen coat proteins in allergic

  19. Expression of glucose transporter-1 and aquaporin-4 in the cerebral cortex of stroke-prone spontaneously hypertensive rats in relation to the blood-brain barrier function.

    Science.gov (United States)

    Ishida, Hiroyuki; Takemori, Kumiko; Dote, Kensaku; Ito, Hiroyuki

    2006-01-01

    Cerebral edema is an important initial event in cases of stroke among humans. Although hypertension is a major risk factor for endothelial injury, the precise mechanisms regulating brain microvascular changes are still unknown. To elucidate the pathogenesis of increases in vascular permeability in the cerebral cortex, we investigated the expression of glucose transporter-1 (GLUT-1) in endothelial cells and aquaporin-4 (AQP4) in astrocytes in relation to blood-brain barrier (BBB) function. Using male stroke-prone spontaneously hypertensive rats (SHRSP) and normotensive Wistar-Kyoto rats (WKY), the particular localization of both GLUT-1 and AQP4 was investigated by immunohistochemistry. Quantitative changes in these molecules were examined by Western blot analysis in these rats at 6 weeks and 20 weeks of age. Furthermore, to investigate the expression of these molecules at the mRNA level, reverse transcriptase-polymerase chain reaction (RT-PCR) analysis was carried out using 20-week-old SHRSP and age-matched WKY. We confirmed the localization of GLUT-1 in endothelial cells and that of AQP4 in the end feet of astrocytes around microvessels, as determined by electron immunohistochemistry. No significant differences were found in the expression of these molecules in rats at 6 weeks of age, whereas GLUT-1 expression was lower, but that of AQP4 was higher, in SHRSP after the establishment of hypertension. Furthermore, GLUT-1 mRNA expression was lower in SHRSP, and AQP4 mRNA expression was also lower in SHRSP than in WKY at 20 weeks of age. These results indicate that AQP4 may play a much more important role in BBB function than GLUT-1, and thereby also in water distribution in the cerebral cortex of SHRSP with severe hypertension.

  20. varying elastic parameters distributions

    KAUST Repository

    Moussawi, Ali

    2014-12-01

    The experimental identication of mechanical properties is crucial in mechanics for understanding material behavior and for the development of numerical models. Classical identi cation procedures employ standard shaped specimens, assume that the mechanical elds in the object are homogeneous, and recover global properties. Thus, multiple tests are required for full characterization of a heterogeneous object, leading to a time consuming and costly process. The development of non-contact, full- eld measurement techniques from which complex kinematic elds can be recorded has opened the door to a new way of thinking. From the identi cation point of view, suitable methods can be used to process these complex kinematic elds in order to recover multiple spatially varying parameters through one test or a few tests. The requirement is the development of identi cation techniques that can process these complex experimental data. This thesis introduces a novel identi cation technique called the constitutive compatibility method. The key idea is to de ne stresses as compatible with the observed kinematic eld through the chosen class of constitutive equation, making possible the uncoupling of the identi cation of stress from the identi cation of the material parameters. This uncoupling leads to parametrized solutions in cases where 5 the solution is non-unique (due to unknown traction boundary conditions) as demonstrated on 2D numerical examples. First the theory is outlined and the method is demonstrated in 2D applications. Second, the method is implemented within a domain decomposition framework in order to reduce the cost for processing very large problems. Finally, it is extended to 3D numerical examples. Promising results are shown for 2D and 3D problems.

  1. Superheavy nuclei and fission barriers

    Science.gov (United States)

    Lu, Bing-Nan; Zhao, Jie; Zhao, En-Guang; Zhou, Shan-Gui

    In this chapter, we will present relativistic mean field (RMF) description of heavy and superheavy nuclei (SHN). We will discuss the shell structure and magic numbers in the mass region of SHN, binding energies and α decay Q values, shapes of ground states and potential energy surfaces and fission barriers. We particularly focus on the multidimensionally-constrained covariant density functional theories (CDFT) and the applications of CDFT to the study of exotic nuclear shapes and fission barriers.

  2. Lipopolysaccharide impairs amyloid beta efflux from brain: altered vascular sequestration, cerebrospinal fluid reabsorption, peripheral clearance and transporter function at the blood–brain barrier

    Directory of Open Access Journals (Sweden)

    Erickson Michelle A

    2012-06-01

    Full Text Available Abstract Background Defects in the low density lipoprotein receptor-related protein-1 (LRP-1 and p-glycoprotein (Pgp clearance of amyloid beta (Aβ from brain are thought to contribute to Alzheimer’s disease (AD. We have recently shown that induction of systemic inflammation by lipopolysaccharide (LPS results in impaired efflux of Aβ from the brain. The same treatment also impairs Pgp function. Here, our aim is to determine which physiological routes of Aβ clearance are affected following systemic inflammation, including those relying on LRP-1 and Pgp function at the blood–brain barrier. Methods CD-1 mice aged between 6 and 8 weeks were treated with 3 intraperitoneal injections of 3 mg/kg LPS at 0, 6, and 24 hours and studied at 28 hours. 125I-Aβ1-42 or 125I-alpha-2-macroglobulin injected into the lateral ventricle of the brain (intracerebroventricular (ICV or into the jugular vein (intravenous (IV was used to quantify LRP-1-dependent partitioning between the brain vasculature and parenchyma and peripheral clearance, respectively. Disappearance of ICV-injected 14 C-inulin from brain was measured to quantify bulk flow of cerebrospinal fluid (CSF. Brain microvascular protein expression of LRP-1 and Pgp was measured by immunoblotting. Endothelial cell localization of LRP-1 was measured by immunofluorescence microscopy. Oxidative modifications to LRP-1 at the brain microvasculature were measured by immunoprecipitation of LRP-1 followed by immunoblotting for 4-hydroxynonenal and 3-nitrotyrosine. Results We found that LPS: caused an LRP-1-dependent redistribution of ICV-injected Aβ from brain parenchyma to brain vasculature and decreased entry into blood; impaired peripheral clearance of IV-injected Aβ; inhibited reabsorption of CSF; did not significantly alter brain microvascular protein levels of LRP-1 or Pgp, or oxidative modifications to LRP-1; and downregulated LRP-1 protein levels and caused LRP-1 mislocalization in cultured brain

  3. Lipopolysaccharide impairs amyloid β efflux from brain: altered vascular sequestration, cerebrospinal fluid reabsorption, peripheral clearance and transporter function at the blood-brain barrier.

    Science.gov (United States)

    Erickson, Michelle A; Hartvigson, Pehr E; Morofuji, Yoichi; Owen, Joshua B; Butterfield, D Allan; Banks, William A

    2012-06-29

    Defects in the low density lipoprotein receptor-related protein-1 (LRP-1) and p-glycoprotein (Pgp) clearance of amyloid beta (Aβ) from brain are thought to contribute to Alzheimer's disease (AD). We have recently shown that induction of systemic inflammation by lipopolysaccharide (LPS) results in impaired efflux of Aβ from the brain. The same treatment also impairs Pgp function. Here, our aim is to determine which physiological routes of Aβ clearance are affected following systemic inflammation, including those relying on LRP-1 and Pgp function at the blood-brain barrier. CD-1 mice aged between 6 and 8 weeks were treated with 3 intraperitoneal injections of 3 mg/kg LPS at 0, 6, and 24 hours and studied at 28 hours. 125I-Aβ1-42 or 125I-alpha-2-macroglobulin injected into the lateral ventricle of the brain (intracerebroventricular (ICV)) or into the jugular vein (intravenous (IV)) was used to quantify LRP-1-dependent partitioning between the brain vasculature and parenchyma and peripheral clearance, respectively. Disappearance of ICV-injected 14 C-inulin from brain was measured to quantify bulk flow of cerebrospinal fluid (CSF). Brain microvascular protein expression of LRP-1 and Pgp was measured by immunoblotting. Endothelial cell localization of LRP-1 was measured by immunofluorescence microscopy. Oxidative modifications to LRP-1 at the brain microvasculature were measured by immunoprecipitation of LRP-1 followed by immunoblotting for 4-hydroxynonenal and 3-nitrotyrosine. We found that LPS: caused an LRP-1-dependent redistribution of ICV-injected Aβ from brain parenchyma to brain vasculature and decreased entry into blood; impaired peripheral clearance of IV-injected Aβ; inhibited reabsorption of CSF; did not significantly alter brain microvascular protein levels of LRP-1 or Pgp, or oxidative modifications to LRP-1; and downregulated LRP-1 protein levels and caused LRP-1 mislocalization in cultured brain endothelial cells. These results suggest that LRP-1

  4. Lipid-colloid dressing shows improved reepithelialization, pain relief, and corneal barrier function in split-thickness skin-graft donor wound healing.

    Science.gov (United States)

    Tanaka, Katsuya; Akita, Sadanori; Yoshimoto, Hiroshi; Houbara, Seiji; Hirano, Akiyoshi

    2014-09-01

    Donor-site wound healing was tested with a nonadherent petrolatum- and hydrocolloid-impregnated polyester, a lipid-colloid dressing, and a nonadherent polyester dressing, supplemented with petrolatum manually by a physician onsite. Ten patients, 1 woman and 9 men (22 to 79 years old; average 58.4 ± 17.54 years), were enrolled in this prospective comparison study. The split-thickness skin graft was 14.5 ± 7.49 cm long × 8.2 ± 4.07 cm wide (5.5-27 cm long and 4.0-14.0 wide) and 14/1000 inches (0.356 mm) deep. The degree of reepithelialization in lipid-colloid dressing was significantly better than that in polyester mesh dressing, with 1.7 ± 1.00 and 2.8 ± 0.83 for the lipid-colloid dressing and polyester mesh dressing, respectively (P colloid dressing than that in polyester dressing, 1.7 ± 1.11 and 2.9 ± 1.12 for the lipid-colloid dressing and polyester mesh dressing, respectively (P colloid at wound healing was significantly smaller than those in polyester mesh (effective contact coefficient: 11.7 ± 1.87% and 15.6 ± 3.09% for lipid-colloid and polyester mesh, respectively, P colloid and polyester mesh, respectively, P colloid polyester dressing has superior wound healing and pain relief and demonstrates better corneal barrier function delineated by effective contact coefficient and corneal thickness at healing in split-thickness donors. © The Author(s) 2014.

  5. The noncommensal bacterium Methylococcus capsulatus (Bath) ameliorates dextran sulfate (Sodium Salt)-Induced Ulcerative Colitis by influencing mechanisms essential for maintenance of the colonic barrier function.

    Science.gov (United States)

    Kleiveland, Charlotte R; Hult, Lene T Olsen; Spetalen, Signe; Kaldhusdal, Magne; Christofferesen, Trine Eker; Bengtsson, Oskar; Romarheim, Odd Helge; Jacobsen, Morten; Lea, Tor

    2013-01-01

    Dietary inclusion of a bacterial meal has recently been shown to efficiently abolish soybean meal-induced enteritis in Atlantic salmon. The objective of this study was to investigate whether inclusion of this bacterial meal in the diet could abrogate disease development in a murine model of epithelial injury and colitis and thus possibly have therapeutic potential in human inflammatory bowel disease. C57BL/6N mice were fed ad libitum a control diet or an experimental diet containing 254 g/kg of body weight BioProtein, a bacterial meal consisting of Methylococcus capsulatus (Bath), together with the heterogenic bacteria Ralstonia sp., Brevibacillus agri, and Aneurinibacillus sp. At day 8, colitis was induced by 3.5% dextran sulfate sodium (DSS) ad libitum in the drinking water for 6 days. Symptoms of DSS treatment were less profound after prophylactic treatment with the diet containing the BioProtein. Colitis-associated parameters such as reduced body weight, colon shortening, and epithelial damage also showed significant improvement. Levels of acute-phase reactants, proteins whose plasma concentrations increase in response to inflammation, and neutrophil infiltration were reduced. On the other, increased epithelial cell proliferation and enhanced mucin 2 (Muc2) transcription indicated improved integrity of the colonic epithelial layer. BioProtein mainly consists of Methylococcus capsulatus (Bath) (88%). The results that we obtained when using a bacterial meal consisting of M. capsulatus (Bath) were similar to those obtained when using BioProtein in the DSS model. Our results show that a bacterial meal of the noncommensal bacterium M. capsulatus (Bath) has the potential to attenuate DSS-induced colitis in mice by enhancing colonic barrier function, as judged by increased epithelial proliferation and increased Muc2 transcription.

  6. Bifidobacterium longum CCM 7952 Promotes Epithelial Barrier Function and Prevents Acute DSS-Induced Colitis in Strictly Strain-Specific Manner

    Science.gov (United States)

    Srutkova, Dagmar; Schwarzer, Martin; Hudcovic, Tomas; Zakostelska, Zuzana; Drab, Vladimir; Spanova, Alena; Rittich, Bohuslav; Kozakova, Hana; Schabussova, Irma

    2015-01-01

    Background Reduced microbial diversity has been associated with inflammatory bowel disease (IBD) and probiotic bacteria have been proposed for its prevention and/or treatment. Nevertheless, comparative studies of strains of the same subspecies for specific health benefits are scarce. Here we compared two Bifidobacterium longum ssp. longum strains for their capacity to prevent experimental colitis. Methods Immunomodulatory properties of nine probiotic bifidobacteria were assessed by stimulation of murine splenocytes. The immune responses to B. longum ssp. longum CCM 7952 (Bl 7952) and CCDM 372 (Bl 372) were further characterized by stimulation of bone marrow-derived dendritic cell, HEK293/TLR2 or HEK293/NOD2 cells. A mouse model of dextran sulphate sodium (DSS)-induced colitis was used to compare their beneficial effects in vivo. Results The nine bifidobacteria exhibited strain-specific abilities to induce cytokine production. Bl 372 induced higher levels of both pro- and anti-inflammatory cytokines in spleen and dendritic cell cultures compared to Bl 7952. Both strains engaged TLR2 and contain ligands for NOD2. In a mouse model of DSS-induced colitis, Bl 7952, but not Bl 372, reduced clinical symptoms and preserved expression of tight junction proteins. Importantly, Bl 7952 improved intestinal barrier function as demonstrated by reduced FITC-dextran levels in serum. Conclusions We have shown that Bl 7952, but not Bl 372, protected mice from the development of experimental colitis. Our data suggest that although some immunomodulatory properties might be widespread among the genus Bifidobacterium, others may be rare and characteristic only for a specific strain. Therefore, careful selection might be crucial in providing beneficial outcome in clinical trials with probiotics in IBD. PMID:26218526

  7. Recovery of mucosal barrier function in ischemic porcine ileum and colon is stimulated by a novel agonist of the ClC-2 chloride channel, lubiprostone.

    Science.gov (United States)

    Moeser, Adam J; Nighot, Prashant K; Engelke, Kory J; Ueno, Ryuji; Blikslager, Anthony T

    2007-02-01

    Previous studies utilizing an ex vivo porcine model of intestinal ischemic injury demonstrated that prostaglandin (PG)E(2) stimulates repair of mucosal barrier function via a mechanism involving Cl(-) secretion and reductions in paracellular permeability. Further experiments revealed that the signaling mechanism for PGE(2)-induced mucosal recovery was mediated via type-2 Cl(-) channels (ClC-2). Therefore, the objective of the present study was to directly investigate the role of ClC-2 in mucosal repair by evaluating mucosal recovery in ischemia-injured intestinal mucosa treated with the selective ClC-2 agonist lubiprostone. Ischemia-injured porcine ileal mucosa was mounted in Ussing chambers, and short-circuit current (I(sc)) and transepithelial electrical resistance (TER) were measured in response to lubiprostone. Application of 0.01-1 microM lubiprostone to ischemia-injured mucosa induced concentration-dependent increases in TER, with 1 microM lubiprostone stimulating a twofold increase in TER (DeltaTER = 26 Omega.cm(2); P lubiprostone (1 microM) stimulated higher elevations in TER despite lower I(sc) responses compared with the nonselective secretory agonist PGE(2) (1 microM). Furthermore, lubiprostone significantly (P lubiprostone stimulated elevations in TER and reductions in mannitol flux in ischemia-injured intestine associated with structural changes in tight junctions. Prostones such as lubiprostone may provide a selective and novel pharmacological mechanism of accelerating recovery of acutely injured intestine compared with the nonselective action of prostaglandins such as PGE(2).

  8. Coral-macroalgal phase shifts or reef resilience: links with diversity and functional roles of herbivorous fishes on the Great Barrier Reef

    Science.gov (United States)

    Cheal, A. J.; MacNeil, M. Aaron; Cripps, E.; Emslie, M. J.; Jonker, M.; Schaffelke, B.; Sweatman, H.

    2010-12-01

    Changes from coral to macroalgal dominance following disturbances to corals symbolize the global degradation of coral reefs. The development of effective conservation measures depends on understanding the causes of such phase shifts. The prevailing view that coral-macroalgal phase shifts commonly occur due to insufficient grazing by fishes is based on correlation with overfishing and inferences from models and small-scale experiments rather than on long-term quantitative field studies of fish communities at affected and resilient sites. Consequently, the specific characteristics of herbivorous fish communities that most promote reef resilience under natural conditions are not known, though this information is critical for identifying vulnerable ecosystems. In this study, 11 years of field surveys recorded the development of the most persistent coral-macroalgal phase shift (>7 years) yet observed on Australia’s Great Barrier Reef (GBR). This shift followed extensive coral mortality caused by thermal stress (coral bleaching) and damaging storms. Comparisons with two similar reefs that suffered similar disturbances but recovered relatively rapidly demonstrated that the phase shift occurred despite high abundances of one herbivore functional group (scraping/excavating parrotfishes: Labridae). However, the shift was strongly associated with low fish herbivore diversity and low abundances of algal browsers (predominantly Siganidae) and grazers/detritivores (Acanthuridae), suggesting that one or more of these factors underpin reef resilience and so deserve particular protection. Herbivorous fishes are not harvested on the GBR, and the phase shift was not enhanced by unusually high nutrient levels. This shows that unexploited populations of herbivorous fishes cannot ensure reef resilience even under benign conditions and suggests that reefs could lose resilience under relatively low fishing pressure. Predictions of more severe and widespread coral mortality due to global

  9. Bifidobacterium longum CCM 7952 Promotes Epithelial Barrier Function and Prevents Acute DSS-Induced Colitis in Strictly Strain-Specific Manner.

    Directory of Open Access Journals (Sweden)

    Dagmar Srutkova

    Full Text Available Reduced microbial diversity has been associated with inflammatory bowel disease (IBD and probiotic bacteria have been proposed for its prevention and/or treatment. Nevertheless, comparative studies of strains of the same subspecies for specific health benefits are scarce. Here we compared two Bifidobacterium longum ssp. longum strains for their capacity to prevent experimental colitis.Immunomodulatory properties of nine probiotic bifidobacteria were assessed by stimulation of murine splenocytes. The immune responses to B. longum ssp. longum CCM 7952 (Bl 7952 and CCDM 372 (Bl 372 were further characterized by stimulation of bone marrow-derived dendritic cell, HEK293/TLR2 or HEK293/NOD2 cells. A mouse model of dextran sulphate sodium (DSS-induced colitis was used to compare their beneficial effects in vivo.The nine bifidobacteria exhibited strain-specific abilities to induce cytokine production. Bl 372 induced higher levels of both pro- and anti-inflammatory cytokines in spleen and dendritic cell cultures compared to Bl 7952. Both strains engaged TLR2 and contain ligands for NOD2. In a mouse model of DSS-induced colitis, Bl 7952, but not Bl 372, reduced clinical symptoms and preserved expression of tight junction proteins. Importantly, Bl 7952 improved intestinal barrier function as demonstrated by reduced FITC-dextran levels in serum.We have shown that Bl 7952, but not Bl 372, protected mice from the development of experimental colitis. Our data suggest that although some immunomodulatory properties might be widespread among the genus Bifidobacterium, others may be rare and characteristic only for a specific strain. Therefore, careful selection might be crucial in providing beneficial outcome in clinical trials with probiotics in IBD.

  10. Influence of varying Germanium content on the optical function dispersion of Fe{sub 2}MnSi{sub x}Ge{sub 1-x}: An ab initio study

    Energy Technology Data Exchange (ETDEWEB)

    Reshak, Ali H., E-mail: maalidph@yahoo.co.uk [School of Complex Systems, FFPW, CENAKVA, University of South Bohemia in CB, Nove Hrady 37333 (Czech Republic); School of Material Engineering, Malaysia University of Perlis, P.O. Box 77, d/a Pejabat Pos Besar, 01007 Kangar, Perlis (Malaysia); Charifi, Z., E-mail: charifizoulikha@gmail.com [Physics Department, Faculty of Science, University of M' sila, 28000 M' sila (Algeria); Baaziz, H. [Physics Department, Faculty of Science, University of M' sila, 28000 M' sila (Algeria)

    2013-01-15

    The optical dielectric functions of Fe{sub 2}MnSi{sub 1-x}Ge{sub x} alloys for selected concentrations (x=0.0, 0.25, 0.5, 0.75 and 1.0) were investigated. The ferromagnetic Fe{sub 2}MnSi{sub x}Ge{sub 1-x} is semiconducting with optical band gaps 0.507, 0.531, 0.539, 0.514 and 0.547 eV for the minority spin and is metallic for the majority spin. From the calculated results the half-metallic character and stability of ferromagnetic state for Fe{sub 2}MnSi{sub x}Ge{sub 1-x} is determined. The total magnetic moment is found to be 3.0{mu}{sub B} for all alloys with the most contribution from Mn local magnetic moments. Iron atoms however exhibit much smaller spin moments, about 10% of the bulk value, and the sp atoms have induced magnetic moments due to the proximity of Fe first nearest neighbors, which couple antiferromagnetically with Fe and Mn spin moments. We have employed full-potential linearized augmented plane wave method based on spin-polarized density functional theory. The generalized gradient approximation exchange-correlation potential was used. The edge of optical absorption for {epsilon}{sub 2}({omega}) of spin-down varies between 0.507 (Fe{sub 2}MnGe) and 0.547 eV (Fe{sub 2}MnSi). Since the spin-up shows metallic nature, the Drude term was included in the spin-up optical dielectric functions. This confirms our finding that these materials are half-metallic. Furthermore, the reflectivity, refractivity and the absorption coefficient were calculated. These results show that the materials possess half-metallic character. - Highlights: Black-Right-Pointing-Pointer The optical dielectric functions of Fe{sub 2}MnSi{sub 1-x}Ge{sub x} were investigated. Black-Right-Pointing-Pointer Fe{sub 2}MnSi{sub x}Ge{sub 1-x} is semiconducting for majority spin and is metallic for minority spin. Black-Right-Pointing-Pointer The total magnetic moment is found to be 3.0{mu}{sub B} for all alloys. Black-Right-Pointing-Pointer The edge of optical absorption for {epsilon}{sub 2

  11. Structure information from fusion barriers

    Indian Academy of Sciences (India)

    The fusion excitation functions for 16O+208Pb, using the coupled reaction channel (CRC) method and correct structure information, have been analysed. The barrier distributions derived from these excitation functions including many of the significant channels are featureless, although these channels have considerable ...

  12. Evaluation of blood-brain barrier function by quotient alpha2 macroglobulin and its relationship with interleukin-6 and complement component 3 levels in neuropsychiatric systemic lupus erythematosus.

    Science.gov (United States)

    Asano, Tomoyuki; Ito, Hiromi; Kariya, Yoshinobu; Hoshi, Kyoka; Yoshihara, Akioh; Ugawa, Yoshikazu; Sekine, Hideharu; Hirohata, Shunsei; Yamaguchi, Yoshiki; Sato, Shuzo; Kobayashi, Hiroko; Migita, Kiyoshi; Ohira, Hiromasa; Hashimoto, Yasuhiro; Watanabe, Hiroshi

    2017-01-01

    Although quotient of alpha2 macroglobulin (Qα2MG) was previously reported to be useful for the evaluation of blood-brain barrier (BBB) function, it is not commonly used. We therefore evaluated BBB function among the various subsets of neuropsychiatric systemic lupus erythematosus (NPSLE) using quotient Q α2MG. Furthermore, we determined the correlation between Q α2MG and cerebrospinal (CSF) interleukin (IL)-6 level and quotient complement component 3 (Q C3). To determine intrathecal production of C3, the C3 index (Q C3/Q α2MG) was also calculated. Fifty-six patients with SLE were included in this study. Of these, 48 were diagnosed with NPSLE, consisting of 30 diffuse NPSLE patients (acute confusional state (ACS): n = 14, non-ACS: n = 16) and 18 patients with focal NPSLE. CSF IL-6 concentration, and paired serum and CSF levels of α2MG and C3, were measured by enzyme-linked immuno solvent assay (ELISA). The Q α2MG, Q C3, and C3 index were then calculated. Q α2MG, Q C3, and IL-6 concentrations in the CSF were significantly elevated in NPSLE compared with non-NPSLE. Among the subsets of NPSLE, significant increases in Q α2MG, CSF IL-6, and Q C3 were observed in ACS compared with non-ACS or focal NPSLE. There was a positive correlation between CSF IL-6 level and Q α2MG, as well as between Q C3 and Q α2MG, in diffuse NPSLE. There were no significant differences in C3 index between NPSLE and non-NPSLE, as well as among the subgroups of NPSLE. Our study suggests that BBB disruption is present in ACS, and elevated levels of IL-6 and C3 in CSF in diffuse NPSLE, especially in ACS, might result from their entry to the CSF from the systemic circulation through the damaged BBB, as well as increased intrathecal production. Furthermore, Q α2MG might be useful for the evaluation of BBB integrity.

  13. Long-term reliable physically unclonable function based on oxide tunnel barrier breakdown on two-transistors two-magnetic-tunnel-junctions cell-based embedded spin transfer torque magnetoresistive random access memory

    Science.gov (United States)

    Takaya, Satoshi; Tanamoto, Tetsufumi; Noguchi, Hiroki; Ikegami, Kazutaka; Abe, Keiko; Fujita, Shinobu

    2017-04-01

    Among the diverse applications of spintronics, security for internet-of-things (IoT) devices is one of the most important. A physically unclonable function (PUF) with a spin device (spin transfer torque magnetoresistive random access memory, STT-MRAM) is presented. Oxide tunnel barrier breakdown is used to realize long-term stability for PUFs. A secure PUF has been confirmed by evaluating the Hamming distance of a 32-bit STT-MRAM-PUF fabricated using 65 nm CMOS technology.

  14. Upregulation of Intestinal Barrier Function in Mice with DSS-Induced Colitis by a Defined Bacterial Consortium Is Associated with Expansion of IL-17A Producing Gamma Delta T Cells

    Directory of Open Access Journals (Sweden)

    Ming Li

    2017-07-01

    Full Text Available Bacterial consortium transplantation (BCT is a promising alternative to fecal microbiota transplantation in treating inflammatory bowel disease (IBD. Here, we showed that a defined bacterial consortium derived from healthy mice was able to enhance the intestinal barrier function of mice with dextran sulfate sodium (DSS-induced colitis. Interestingly, we found that the bacterial consortium significantly promoted the expansion of IL-17A-producing γδT (γδT17 cells in colonic lamina propria, which was closely associated with changing of intestinal microbial composition. The increased IL-17A secretion upon treatment with microbial products derived from the bacterial consortium was accompanied with upregulation of TLR2 expression by γδT cells, and it might be responsible for the upregulation of mucosal barrier function through IL-17R-ACT1-mediated recovery of the disrupted occludin subcellular location. Changing of some specific microbial groups such as Bifidobacterium and Bacillus spp. was closely correlated with the promotion of TLR2+ γδT cells. Our results support that BCT can restore the alliance between commensal microbiota and intestinal γδT cells, which contributes to the improvement of intestinal barrier function. This study provides new insight into the development of bacteria transplantation therapy for the treatment of IBD.

  15. Efficacy of IPL device combined with intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with regards to the recovery of skin barrier function: A pilot study.

    Science.gov (United States)

    Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun

    2015-10-01

    Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.

  16. 155 Enhanced Stem Cell Delivery by Functional Blood-Brain Barrier Modulation Improves Neurological Recovery in a Rodent Stroke Model.

    Science.gov (United States)

    Lang, Michael J; Lin, Ruihe; Sharan, Ashwini Dayal; Rosenwasser, Robert H; Iacovitti, Lorraine

    2016-08-01

    The presence of the blood-brain barrier (BBB) in vertebrates is a major limitation to the delivery of therapeutic agents into brain tissue. Mesenchymal stem cell (MSC) infusion has been shown to reduce stroke volume and improve recovery, but the BBB limits cellular engraftment. Sphenopalatine ganglion (SPG) stimulation has been shown to transiently increase BBB permeability. A rodent model was designed to test the hypothesis that SPG stimulation enhances the effect of MSC infusion. Sprague-Dawley rats (n = 30) underwent middle cerebral artery occlusion by coated nylon filament. All animals underwent internal carotid artery cannulation on poststroke day 1. Control animals (n = 6) received saline infusion, positive controls (n = 12) received 1.0 × 10 MSC infusion, and experimental (n = 12) animals underwent 1.0 × 10 MSC infusion with concomitant SPG stimulation at 5 V, 10 Hz, 1 ms square-wave pulse in 90 seconds on/60 seconds off blocks for 20 minutes before infusion. Functional Outcomes: Modified Neurological Severity Score was measured for all animals (range = 0-18). For control animals, mean scores on poststroke days 1, 2, 4, 7, and 14 (±SD) were 13.6 ± 1.1, 11.2 ± 1.8, 11.0 ± 2.5, 10.2 ± 1.3, and 10.5 ± 0.7, respectively. For animals undergoing MSC injection without SPG stimulation, mean scores were 12.9 ± 1.3, 12.1 ± 1.6, 10.7 ± 1.9, 8.4 ± 2.4, and 6.5 ± 1.3, respectively. For animals undergoing MSC injection with SPG stimulation, mean modified neurological severity scores were 12.7 ± 2.2, 9.8 ± 4.2, 6.0 ± 3.7, 5.0 ± 3.4, and 3.0 ± 1.0, respectively. Significant difference was demonstrated at poststroke day 14 (P < .05). No animal exhibited worsened neurological status following stem cell injection. Initial experience with sphenopalatine ganglion stimulation-based BBB modulation demonstrates increased engraftment of mesenchymal stem cells administered by the transarterial route compared with animals that did not receive SPG stimulation at the

  17. PET studies on P-glycoprotein function in the blood-brain barrier : How it affects uptake and binding of drugs within the CNS

    NARCIS (Netherlands)

    Elsinga, PH; Hendrikse, Nelis; Bart, J; Vaalburg, W; van Waarde, A

    2004-01-01

    Permeability of the blood-brain barrier (BBB) is one of the factors determining the bioavailability of therapeutic drugs. The BBB only allows entry of lipophilic compounds with low molecular weights by passive diffusion. However, many lipophilic drugs show negligible brain uptake. They are

  18. The Mammalian Brain in the Electromagnetic Fields Designed by Man with Special Reference to Blood-Brain Barrier Function, Neuronal Damage and Possible Physical Mechanisms

    Science.gov (United States)

    Salford, L. G.; Nittby, H.; Brun, A.; Grafström, G.; Malmgren, L.; Sommarin, M.; Eberhardt, J.; Widegren, B.; Persson, B. R.

    Life on earth was formed during billions of years, exposed to,and shaped by the original physical forces such as gravitation, cosmic irradiation, atmospheric electric fields and the terrestrial magnetism. The Schumann resonances at 7.4 Hz are an example of oscillations possibly important for life. The existing organisms are created to function in harmony with these forces. However, in the late 19th century mankind introduced the use of electricity, in the early 20th century long-wave radio and in the 1940-ies short-wave radio. High frequency RF was introduced in the 50-ies as FM and television and during the very last decades, microwaves of the modern communication society spread around the world. Today, however, one third of the world's population is owner of the microwave-producing mobile phones and an even larger number is exposed to the cordless RF emitting systems. To what extent are all living organisms affected by these, almost everywhere present radio freque ncy fields? And what will be the effects of many years of continuing exposure? Since 1988 our group has studied the effects upon the mammalian blood-brain barrier (BBB) in rats by non-thermal radio frequency electromagnetic fields (RF-EMF). These have been shown to cause significantly increased leakage of the rats' own blood albumin through the BBB of exposed rats, at energy levels of 1W/kg and below, as compared to non-exposed animals in a total series of about two thousand animals.-6)} One remarkable observation is the fact that the lowest energy levels, with whole-body average power densities below 10mW/kg, give rise to the most pronounced albumin leakage. If mobile communication, even at extremely low energy levels, causes the users' own albumin to leak out through the BBB, also other unwanted and toxic molecules in the blood, may leak into the brain tissue and concentrate in and damage the neurons and glial cells of the brain. In later studies we have shown that a 2-h exposure to GSM 915 MHz, at

  19. Resuscitation of Hypotensive Traumatic Brain Injured Animals With Spray-Dried Plasma Does Not Adversely Alter Physiology and Improves Blood-Brain Barrier Function.

    Science.gov (United States)

    McDaniel, Steven; Golla, Stephanie; Moore, Anthony N; DaCorta, Joe; Bode, Arthur; Pati, Shibani; Dash, Pramod K; Zhao, Jing

    2017-07-01

    According to the Defense and Veterans Brain Injury Center and the Armed Forces Health Surveillance Center, the number of soldiers who have sustained a traumatic brain injury (TBI) has risen dramatically over the past decade. Studies have shown that brain damage can be exacerbated if blood loss occurs (often occurring in polytrauma). As blood supply is critical for brain function and survival, TBI patients must be properly resuscitated to maintain blood volume, blood pressure, and cerebral perfusion. Recent studies have suggested that blood loss can damage the vascular endothelium and enhance blood-brain barrier (BBB) permeability. Brain endothelial cells and the tight junctions between them are key structural components of the BBB. As the BBB is critical for isolating the brain from potential pathogens and for regulating the influx of molecules into the brain, evaluation of resuscitation fluids for their efficacy to improve BBB function has clinical relevance. Although whole blood and fresh frozen plasma (FFP) contain the essential coagulation factors, ions, and other factors, the transport and storage of these products in remote, austere environments can be challenging. The use of spray-dried plasma (SDP) has several advantages including storage at ambient temperature, can be readily reconstituted before use, and infectious materials can be inactivated during the drying process. In this study, we compared FFP and SDP for their effects on blood pressure, cerebral blood flow, BBB integrity, and markers of endothelial cells and tight junction proteins, in TBI animals with blood loss. All procedures were reviewed and approved by the UTHealth animal welfare committee. Sprague Dawley rats received controlled cortical impact brain injury followed by removal of 25% blood volume. Animals were resuscitated 40 minutes later with either FFP or concentrated SDP (Resusix) Heart rate and blood pressure were monitored continuously using catheters implanted into the femoral artery

  20. Excitation functions and mass asymmetric fission barriers for compound nuclei sup 7 sup 0 sup , sup 7 sup 6 Se 24.60.Dr; 25.85.Ge; 24.75.+i; Nuclear reactions 12C(58,64Ni,X); E=6-14A MeV; Measured sigma(Z) vs E; Deduced mass asymmetric fission barriers for 70,76Se; Transition state fission rates

    CERN Document Server

    Fan, T S; Phair, L; Tso, K; McMahan, M; Hanold, K A; Wozniak, G J; Moretto, L G

    2000-01-01

    Excitation functions were measured for complex fragments with atomic number Z=5-20 emitted from the compound nuclei sup 7 sup 0 sup , sup 7 sup 6 Se produced in the reactions sup 5 sup 8 sup , sup 6 sup 4 Ni+ sup 1 sup 2 C. Mass asymmetric fission barriers were extracted by fitting the excitation functions with a transition state formalism. The extracted barriers were compared with those calculated from macroscopic nuclear models. The measured barriers for symmetric fission seem to support the hypothesis of a shape-dependent congruence energy, which doubles for fission of strongly indented saddle-point shapes. All of the measured excitation functions can be scaled onto a single straight line according to the transition state prediction.

  1. Partial Enteral Nutrition Preserves Elements of Gut Barrier Function, Including Innate Immunity, Intestinal Alkaline Phosphatase (IAP) Level, and Intestinal Microbiota in Mice.

    Science.gov (United States)

    Wan, Xiao; Bi, Jingcheng; Gao, Xuejin; Tian, Feng; Wang, Xinying; Li, Ning; Li, Jieshou

    2015-08-03

    Lack of enteral nutrition (EN) during parenteral nutrition (PN) leads to higher incidence of infection because of gut barrier dysfunction. However, the effects of partial EN on intestina linnate immunity, intestinal alkaline phosphatase (IAP) and microbiota remain unclear. The mice were randomized into six groups to receive either standard chow or isocaloric and isonitrogenous nutritional support with variable partial EN to PN ratios. Five days later, the mice were sacrificed and tissue samples were collected. Bacterial translocation, the levels of lysozyme, mucin 2 (MUC2), and IAP were analyzed. The composition of intestinal microbiota was analyzed by 16S rRNA pyrosequencing. Compared with chow, total parenteral nutrition (TPN) resulted in a dysfunctional mucosal barrier, as evidenced by increased bacterial translocation (p microbiota (p intestinal microbiota.

  2. Towards a clinical practice guide in pharmacogenomics testing for functional polymorphisms of drug-metabolising enzymes. Gene/drug pairs and barriers perceived in Spain.

    Directory of Open Access Journals (Sweden)

    José A G Agúndez

    2012-11-01

    Full Text Available The development of clinical practice recommendations or guidelines for the clinical use of biomarkers is an issue of great importance with regard to adverse drug reactions. The potential of pharmacogenomic biomarkers has been extensively investigated in recent years. However, several barriers to implementing the use of pharmacogenomics testing exist. We conducted a survey among members of the Spanish Societies of Pharmacology and Clinical Pharmacology to obtain information about the perception of such barriers and to compare the perceptions of participants about the relative importance of major gene/drug pairs.Of 11 potential barriers, the highest importance was attributed to lack of institutional support for pharmacogenomics testing, and to the issues related to the lack of guidelines. Of the proposed gene/drug pairs the highest importance was assigned to HLA-B/abacavir, UGT1A1/irinotecan and CYP2D6/tamoxifen. In this perspective article we compare the relative importance of 29 gene/drug pairs in the Spanish study with that of the same pairs in the American Society for Clinical Pharmacology & Therapeutics study, and we provide suggestions and areas of focus to develop a guide for clinical practice in pharmacogenomics testing.

  3. Structure information from fusion barriers

    Indian Academy of Sciences (India)

    effects on the fusion excitation function. However, a simultaneous analysis of the fusion, elastic and quasi-elastic channels would fix the structure and the reaction unambiguously. Keywords. Heavy ion fusion; fusion barrier distributions; nuclear structure; coupled reaction chan- nel calculations. PACS Nos 25.70.Bc; 25.70.

  4. Smart parking barrier

    KAUST Repository

    Alharbi, Abdulrazaq M.

    2016-05-06

    Various methods and systems are provided for smart parking barriers. In one example, among others, a smart parking barrier system includes a movable parking barrier located at one end of a parking space, a barrier drive configured to control positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking space and a second position that allows access to the parking space. The parking controller can initiate movement of the movable parking barrier in response to a positive identification of an individual allowed to use the parking space. The parking controller can identify the individual through, e.g., a RFID tag, a mobile device (e.g., a remote control, smartphone, tablet, etc.), an access card, biometric information, or other appropriate identifier.

  5. Establishment, maintenance and functional integrity of the blood-testis barrier in organotypic cultures of fresh and frozen/thawed prepubertal mouse testes.

    Science.gov (United States)

    Rondanino, C; Maouche, A; Dumont, L; Oblette, A; Rives, N

    2017-05-01

    Can the spatio-temporal formation of an intact blood-testis barrier (BTB), which is essential for the progression of spermatogenesis, be reproduced in cultures of fresh or frozen/thawed prepubertal mouse testes? Organotypic cultures allow the establishment and maintenance of major BTB components and the formation of a functional BTB in mouse testicular tissues. In vitro maturation of prepubertal testicular tissues is a promising approach to restore fertility in adult survivors of childhood cancer. Although gametes can be successfully obtained from prepubertal mouse testes in organotypic cultures, the spermatogenic yield remains low compared to in vivo controls. Mouse testicular tissues were frozen using controlled slow freezing (CSF) or solid surface vitrification (SSV) procedures. A total of 158 testes (fresh n = 58, CSF n = 58 or SSV n = 42) from 6 to 7 days postpartum (dpp) mice were cultured at 34°C in basal medium (α-MEM, 10% KnockOut Serum Replacement, 5 μg/ml gentamicin) at a gas-liquid interphase (under 20% O2), with or without 10-6 M retinol, for 9, 16 and 30 days. In addition, 32 testes from 6-7, 15-16, 22-23 and 36-37 dpp mice were used as in vivo controls. The mRNA levels of BTB genes (Claudin 3, Claudin 11, Zonula occludens 1 and Connexin-43), germ cell-specific genes (Sal-like protein 4, Kit oncogene, Stimulated by retinoic acid gene 8, Synaptonemal complex protein 3, Transition protein 1 and Protamine 2), markers of Sertoli cell immaturity/maturity (anti-Mullerian hormone, androgen receptor, cyclin-dependent kinase inhibitor 1b) and the androgen-regulated gene Reproductive homeobox 5 (Rhox5) were measured by quantitative RT-PCR (RT-qPCR). The localization of BTB proteins in seminiferous tubules was studied by immunohistochemistry and spermatogenic progression was evaluated histologically. The integrity of the BTB was assessed using a biotin tracer. Modest differences in Claudin 11 (Cldn11), Zonula occludens 1 (Zo-1), Connexin-43 (Cx43

  6. Optimal spacing of soil conservation barriers : example of rock bunds in Burkina Faso

    NARCIS (Netherlands)

    Zougmore, R.; Kabore, D.; Lowenberg-DeBoer, J.

    2000-01-01

    Though construction methods vary widely, use of physical or biological barriers to conserve soil and water is common throughout the world. Rock or earthen bunds are common physical barriers. Strips of perennial grass, shrubs or trees serve as biological barriers. Often these barriers are arranged on

  7. Efficient Estimation in Heteroscedastic Varying Coefficient Models

    Directory of Open Access Journals (Sweden)

    Chuanhua Wei

    2015-07-01

    Full Text Available This paper considers statistical inference for the heteroscedastic varying coefficient model. We propose an efficient estimator for coefficient functions that is more efficient than the conventional local-linear estimator. We establish asymptotic normality for the proposed estimator and conduct some simulation to illustrate the performance of the proposed method.

  8. Blood-brain barrier permeability imaging using perfusion computed tomography

    Directory of Open Access Journals (Sweden)

    Avsenik Jernej

    2015-06-01

    Full Text Available Background. The blood-brain barrier represents the selective diffusion barrier at the level of the cerebral microvascular endothelium. Other functions of blood-brain barrier include transport, signaling and osmoregulation. Endothelial cells interact with surrounding astrocytes, pericytes and neurons. These interactions are crucial to the development, structural integrity and function of the