Epidermal Growth Factor and Intestinal Barrier Function

Directory of Open Access Journals (Sweden)

Xiaopeng Tang

2016-01-01

Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

Compilation of Instantaneous Source Functions for Varying ...

African Journals Online (AJOL)

Compilation of Instantaneous Source Functions for Varying Architecture of a Layered Reservoir with Mixed Boundaries and Horizontal Well Completion Part III: B-Shaped Architecture with Vertical Well in the Upper Layer.

Performance Testing of Suspension Plasma Sprayed Thermal Barrier Coatings Produced with Varied Suspension Parameters

Directory of Open Access Journals (Sweden)

Nicholas Curry

2015-07-01

Full Text Available Suspension plasma spraying has become an emerging technology for the production of thermal barrier coatings for the gas turbine industry. Presently, though commercial systems for coating production are available, coatings remain in the development stage. Suitable suspension parameters for coating production remain an outstanding question and the influence of suspension properties on the final coatings is not well known. For this study, a number of suspensions were produced with varied solid loadings, powder size distributions and solvents. Suspensions were sprayed onto superalloy substrates coated with high velocity air fuel (HVAF -sprayed bond coats. Plasma spray parameters were selected to generate columnar structures based on previous experiments and were maintained at constant to discover the influence of the suspension behavior on coating microstructures. Testing of the produced thermal barrier coating (TBC systems has included thermal cyclic fatigue testing and thermal conductivity analysis. Pore size distribution has been characterized by mercury infiltration porosimetry. Results show a strong influence of suspension viscosity and surface tension on the microstructure of the produced coatings.

Improving Dispersion and Barrier Properties of Polyketone/Graphene Nanoplatelet Composites via Noncovalent Functionalization Using Aminopyrene.

Science.gov (United States)

Cho, Jaehyun; Jeon, Ikseong; Kim, Seong Yun; Lim, Soonho; Jho, Jae Young

2017-08-23

A series of polyketone (PK) nanocomposite films with varying content of noncovalently functionalized graphene nanoplatelet with 1-aminopyrene (GNP/APy) is prepared by solution blending with a solvent of hexafluoro-2-propanol. GNP/APy, prepared by a facile method, can effectively induce specific interaction such as hydrogen bonding between the amine functional group of GNP/APy and the carbonyl functional group of the PK matrix. With comparison of GNP and GNP/Py as reference materials, intensive investigation on filler-matrix interaction is achieved. In addition, the dispersion state of the functionalized GNP (f-GNPs; GNP/Py and GNP/APy) in the PK matrix is analyzed by three-dimensional nondestructive X-ray microcomputed tomography, and the increased dispersion state of those fillers results in significant improvement in the water vapor transmission rate (WVTR). The enhancement in WVTR of the PK/GNP/APy nanocomposite film at 1 wt % loading of filler leads to a barrier performance approximately 2 times larger compared to that of PK/GNP nanocomposite film and an approximately 92% reduction in WVTR compared to the case of pristine PK film. We expect that this facile method of graphene functionalization to enhance graphene dispersibility as well as interfacial interaction with the polymer matrix will be widely utilized to expand the potential of graphene materials to barrier film applications.

Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

Directory of Open Access Journals (Sweden)

Harmit S. Ranhotra

2016-07-01

Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

2011-01-01

therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...

The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

2011-01-01

therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

Crossing safety barriers: influence of children's morphological and functional variables.

Science.gov (United States)

Cordovil, Rita; Vieira, Filomena; Barreiros, João

2012-05-01

Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

The important role of stratum corneum lipids for the cutaneous barrier function.

Science.gov (United States)

van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

2014-03-01

The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

Partially linear varying coefficient models stratified by a functional covariate

KAUST Repository

Maity, Arnab; Huang, Jianhua Z.

2012-01-01

We consider the problem of estimation in semiparametric varying coefficient models where the covariate modifying the varying coefficients is functional and is modeled nonparametrically. We develop a kernel-based estimator of the nonparametric

Lyapunov Functions to Caputo Fractional Neural Networks with Time-Varying Delays

Directory of Open Access Journals (Sweden)

Ravi Agarwal

2018-05-01

Full Text Available One of the main properties of solutions of nonlinear Caputo fractional neural networks is stability and often the direct Lyapunov method is used to study stability properties (usually these Lyapunov functions do not depend on the time variable. In connection with the Lyapunov fractional method we present a brief overview of the most popular fractional order derivatives of Lyapunov functions among Caputo fractional delay differential equations. These derivatives are applied to various types of neural networks with variable coefficients and time-varying delays. We show that quadratic Lyapunov functions and their Caputo fractional derivatives are not applicable in some cases when one studies stability properties. Some sufficient conditions for stability of equilibrium of nonlinear Caputo fractional neural networks with time dependent transmission delays, time varying self-regulating parameters of all units and time varying functions of the connection between two neurons in the network are obtained. The cases of time varying Lipschitz coefficients as well as nonLipschitz activation functions are studied. We illustrate our theory on particular nonlinear Caputo fractional neural networks.

A search for parameters of universal sub-barrier fusion excitation function

Energy Technology Data Exchange (ETDEWEB)

Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)

2016-11-15

Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)

The Drosophila blood-brain barrier: Development and function of a glial endothelium

Directory of Open Access Journals (Sweden)

Stefanie eLimmer

2014-11-01

Full Text Available The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

The Drosophila blood-brain barrier: development and function of a glial endothelium.

Science.gov (United States)

Limmer, Stefanie; Weiler, Astrid; Volkenhoff, Anne; Babatz, Felix; Klämbt, Christian

2014-01-01

The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial (SPG) cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

Perturbation methods and the Melnikov functions for slowly varying oscillators

International Nuclear Information System (INIS)

Lakrad, Faouzi; Charafi, Moulay Mustapha

2005-01-01

A new approach to obtaining the Melnikov function for homoclinic orbits in slowly varying oscillators is proposed. The present method applies the Lindstedt-Poincare method to determine an approximation of homoclinic solutions. It is shown that the resultant Melnikov condition is the same as that obtained in the usual way involving distance functions in three dimensions by Wiggins and Holmes [Homoclinic orbits in slowly varying oscillators. SIAM J Math Anal 1987;18(3):612

Stabilization with guaranteed safety using Control Lyapunov–Barrier Function

NARCIS (Netherlands)

Romdlony, Muhammad Zakiyullah; Jayawardhana, Bayu

2016-01-01

We propose a novel nonlinear control method for solving the problem of stabilization with guaranteed safety for nonlinear systems. The design is based on the merging of the well-known Control Lyapunov Function (CLF) and the recent concept of Control Barrier Function (CBF). The proposed control

Treatment of barrier evolution: the SKB perspective

International Nuclear Information System (INIS)

Hedin, A.

2002-01-01

This paper serves as a point of departure for the discussions to be held within the Working Group of Technical Topic entitled 'Barriers and System Performances within a safety case: Their functioning and Evolution with Time'. The paper gives the SKB perspective of the issues to be discussed within the Working Group for this Topic. The following issues to be discussed by the Working Group are: What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? What is the requested or required performance versus the expected or realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? What is the issue associated with the geosphere stability for different geological systems? How is barriers and system performances as a function of time evaluated (and presented and communicated) in a safety case? What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)

Crossing the entropy barrier of dynamical zeta functions

International Nuclear Information System (INIS)

Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F.

1992-01-01

Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.)

Crossing the entropy barrier of dynamical zeta functions

Energy Technology Data Exchange (ETDEWEB)

Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)

1992-01-01

Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).

Fatty acids are required for epidermal permeability barrier function.

Science.gov (United States)

Mao-Qiang, M; Elias, P M; Feingold, K R

1993-08-01

The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

Science.gov (United States)

Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei

2016-01-01

Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P zonulin release (P zonulin (P zonulin protein release and improvement of intestinal TJ integrity.

Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

Directory of Open Access Journals (Sweden)

Pasricha J

1991-01-01

Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

Partially linear varying coefficient models stratified by a functional covariate

KAUST Repository

Maity, Arnab

2012-10-01

We consider the problem of estimation in semiparametric varying coefficient models where the covariate modifying the varying coefficients is functional and is modeled nonparametrically. We develop a kernel-based estimator of the nonparametric component and a profiling estimator of the parametric component of the model and derive their asymptotic properties. Specifically, we show the consistency of the nonparametric functional estimates and derive the asymptotic expansion of the estimates of the parametric component. We illustrate the performance of our methodology using a simulation study and a real data application.

Barrier functions for Pucci-Heisenberg operators and applications

OpenAIRE

Cutri , Alessandra; Tchou , Nicoletta

2007-01-01

International audience; The aim of this article is the explicit construction of some barrier functions ("fundamental solutions") for the Pucci-Heisenberg operators. Using these functions we obtain the continuity property, up to the boundary, for the viscosity solution of fully non-linear Dirichlet problems on the Heisenberg group, if the boundary of the domain satisfies some regularity geometrical assumptions (e.g. an exterior Heisenberg-ball condition at the characteristic points). We point ...

Lactobacillus frumenti Facilitates Intestinal Epithelial Barrier Function Maintenance in Early-Weaned Piglets

Science.gov (United States)

Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua

2018-01-01

Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance

Barrier properties of cultured retinal pigment epithelium.

Science.gov (United States)

Rizzolo, Lawrence J

2014-09-01

The principal function of an epithelium is to form a dynamic barrier that regulates movement between body compartments. Each epithelium is specialized with barrier functions that are specific for the tissues it serves. The apical surface commonly faces a lumen, but the retinal pigment epithelium (RPE) appears to be unique by a facing solid tissue, the sensory retina. Nonetheless, there exists a thin (subretinal) space that can become fluid filled during pathology. RPE separates the subretinal space from the blood supply of the outer retina, thereby forming the outer blood-retinal barrier. The intricate interaction between the RPE and sensory retina presents challenges for learning how accurately culture models reflect native behavior. The challenge is heightened by findings that detail the variation of RPE barrier proteins both among species and at different stages of the life cycle. Among the striking differences is the expression of claudin family members. Claudins are the tight junction proteins that regulate ion diffusion across the spaces that lie between the cells of a monolayer. Claudin expression by RPE varies with species and life-stage, which implies functional differences among commonly used animal models. Investigators have turned to transcriptomics to supplement functional studies when comparing native and cultured tissue. The most detailed studies of the outer blood-retinal barrier have focused on human RPE with transcriptome and functional studies reported for human fetal, adult, and stem-cell derived RPE. Copyright © 2014 Elsevier Ltd. All rights reserved.

Hydrogen sulfide metabolism regulates endothelial solute barrier function

Directory of Open Access Journals (Sweden)

Shuai Yuan

2016-10-01

Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

Safety barriers and safety functions a comparison of different applications

International Nuclear Information System (INIS)

Harms-Ringdahl, L.

1998-01-01

A study is being made with the focus on different theories and applications concerning 'safety barriers' and 'safety functions'. One aim is to compare the characteristics of different kinds of safely functions, which can be purpose, efficiency, reliability, weak points etc. A further aim is to summarize how the combination of different barriers are described and evaluated. Of special interest are applications from nuclear and chemical process safety. The study is based on a literature review, interviews and discussions. Some preliminary conclusions are made. For example, it appears to exist a need for better tools to support the design and evaluation of procedures. There are a great number of theoretical models describing safety functions. However, it still appears to be an interest in further development of models, which might give the basis for improved practical tools. (author)

Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

Science.gov (United States)

Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

2015-01-01

Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018

Arctigenin from Fructus Arctii (Seed of Burdock Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

Directory of Open Access Journals (Sweden)

Hee Soon Shin

2015-01-01

Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

Tests of potential functional barriers for laminated multilayer food packages. Part I: Low molecular weight permeants.

Science.gov (United States)

Simal-Gándara, J; Sarria-Vidal, M; Koorevaar, A; Rijk, R

2000-08-01

The advent of the functional barrier concept in food packaging has brought with it a requirement for fast tests of permeation through potential barrier materials. In such tests it would be convenient for both foodstuffs and materials below the functional barrier (sub-barrier materials) to be represented by standard simulants. By means of inverse gas chromatography, liquid paraffin spiked with appropriate permeants was considered as a potential simulant of sub-barrier materials based on polypropylene (PP) or similar polyolefins. Experiments were performed to characterize the kinetics of the permeation of low molecular weight model permeants (octene, toluene and isopropanol) from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick oriented PP) into the food stimulants olive oil and 3% (w/v) acetic acid. These permeation results were interpreted in terms of three permeation kinetic models regarding the solubility of a particular model permeant in the post-barrier medium (i.e. the food simulant). The results obtained justify the development and evaluation of liquid sub-barrier simulants that would allow flexible yet rigorous testing of new laminated multilayer packaging materials.

Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

Directory of Open Access Journals (Sweden)

David eBueno

2014-10-01

Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

Immune responses at brain barriers and implications for brain development and neurological function in later life

Directory of Open Access Journals (Sweden)

Helen B. Stolp

2013-08-01

Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

Executive Functioning, Barriers to Adherence, and Nonadherence in Adolescent and Young Adult Transplant Recipients.

Science.gov (United States)

Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L

2016-08-01

OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence.  METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures.  RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence.  CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A theoretical study of resonant tunneling characteristics in triangular double-barrier diodes

International Nuclear Information System (INIS)

Wang Hongmei; Xu Huaizhe; Zhang Yafei

2006-01-01

Resonant tunneling characteristics of triangular double-barrier diodes have been investigated systematically in this Letter, using Airy function approach to solve time-independent Schroedinger function in triangular double-barrier structures. Originally, the exact analytic expressions of quasi-bound levels and quasi-level lifetime in symmetrical triangular double-barrier structures have been derived within the effective-mass approximation as a function of structure parameters including well width, slope width and barrier height. Based on our derived analytic expressions, numerical results show that quasi-bound levels and quasi-level lifetime vary nearly linearly with the structure parameters except that the second quasi-level lifetime changes parabolically with slope width. Furthermore, according to our improved transmission coefficient of triangular double-barrier structures under external electric field, the current densities of triangular double-barrier diodes with different slope width at 0 K have been calculated numerically. The results show that the N-shaped negative differential resistance behaviors have been observed in current-voltage characteristics and current-voltage characteristics depend on the slope width

Damage and recovery of skin barrier function after glycolic acid chemical peeling and crystal microdermabrasion.

Science.gov (United States)

Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok

2004-03-01

Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.

Contacting co-culture of human retinal microvascular endothelial cells alters barrier function of human embryonic stem cell derived retinal pigment epithelial cells.

Science.gov (United States)

Skottman, H; Muranen, J; Lähdekorpi, H; Pajula, E; Mäkelä, K; Koivusalo, L; Koistinen, A; Uusitalo, H; Kaarniranta, K; Juuti-Uusitalo, K

2017-10-01

Here we evaluated the effects of human retinal microvascular endothelial cells (hREC) on mature human embryonic stem cell (hESC) derived retinal pigment epithelial (RPE) cells. The hESC-RPE cells (Regea08/017, Regea08/023 or Regea11/013) and hREC (ACBRI 181) were co-cultured on opposite sides of transparent membranes for up to six weeks. Thereafter barrier function, small molecule permeability, localization of RPE and endothelial cell marker proteins, cellular fine structure, and growth factor secretion of were evaluated. After co-culture, the RPE specific CRALBP and endothelial cell specific von Willebrand factor were appropriately localized. In addition, the general morphology, pigmentation, and fine structure of hESC-RPE cells were unaffected. Co-culture increased the barrier function of hESC-RPE cells, detected both with TEER measurements and cumulative permeability of FD4 - although the differences varied among the cell lines. Co-culturing significantly altered VEGF and PEDF secretion, but again the differences were cell line specific. The results of this study showed that co-culture with hREC affects hESC-RPE functionality. In addition, co-culture revealed drastic cell line specific differences, most notably in growth factor secretion. This model has the potential to be used as an in vitro outer blood-retinal barrier model for drug permeability testing. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

The Schottky energy barrier dependence of charge injection in organic light-emitting diodes

Science.gov (United States)

Campbell, I. H.; Davids, P. S.; Smith, D. L.; Barashkov, N. N.; Ferraris, J. P.

1998-04-01

We present device model calculations of the current-voltage (I-V) characteristics of organic diodes and compare them with measurements of structures fabricated using MEH-PPV. The structures are designed so that all of the current is injected from one contact. The I-V characteristics are considered as a function of the Schottky energy barrier to charge injection from the contact. Experimentally, the Schottky barrier is varied from essentially zero to more than 1 eV by using different metal contacts. A consistent description of the device I-V characteristics is obtained as the Schottky barrier is varied from small values, less than about 0.4 eV, where the current flow is space-charge limited to larger values where it is contact limited.

A reciprocal Wald theorem for varying gravitational function

International Nuclear Information System (INIS)

Fay, Stephane

2004-01-01

We study when a cosmological constant is a natural issue if it is mimicked by the potential of a massive Hyperextended Scalar Tensor theory with a perfect fluid for Bianchi type I and V models. We then deduce a reciprocal Wald theorem giving the conditions such that the potential tends to a non vanishing constant when the gravitational function varies. We also get the conditions allowing the potential to vanish or diverge. (orig.)

Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

Directory of Open Access Journals (Sweden)

Magdalena Boer

2016-02-01

Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

Ceramides and barrier function in healthy skin

DEFF Research Database (Denmark)

Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

2010-01-01

Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

Ballistic transport through graphene nanostructures of velocity and potential barriers

International Nuclear Information System (INIS)

Krstajic, P M; Vasilopoulos, P

2011-01-01

We investigate the electronic properties of graphene nanostructures when the Fermi velocity and the electrostatic potential vary in space. First, we consider the transmission T and conductance G through single and double barriers. We show that G for velocity barriers differs markedly from that for potential barriers for energies below the height of the latter and it exhibits periodic oscillations as a function of the energy for strong velocity modulation. Special attention is given to superlattices (SLs). It is shown that an applied bias can efficiently widen or shrink the allowed minibands of velocity-modulated SLs. The spectrum in the Kronig-Penney limit is periodic in the strength of the barriers. Collimation of an electron beam incident on an SL with velocity and potential barriers is present but it disappears when the potential barriers are absent. The number of additional Dirac points may change considerably if barriers and wells have sufficiently different Fermi velocities.

Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

Science.gov (United States)

Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

2012-01-01

Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

Science.gov (United States)

Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

2013-08-01

In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

The Schottky energy barrier dependence of charge injection in organic light-emitting diodes

Energy Technology Data Exchange (ETDEWEB)

Campbell, I.H.; Davids, P.S.; Smith, D.L. [Los Alamos National Laboratory, Los Alamos, New Mexico87545 (United States); Barashkov, N.N.; Ferraris, J.P. [The University of Texas at Dallas, Richardson, Texas75083 (United States)

1998-04-01

We present device model calculations of the current{endash}voltage (I{endash}V) characteristics of organic diodes and compare them with measurements of structures fabricated using MEH-PPV. The structures are designed so that all of the current is injected from one contact. The I{endash}V characteristics are considered as a function of the Schottky energy barrier to charge injection from the contact. Experimentally, the Schottky barrier is varied from essentially zero to more than 1 eV by using different metal contacts. A consistent description of the device I{endash}V characteristics is obtained as the Schottky barrier is varied from small values, less than about 0.4 eV, where the current flow is space-charge limited to larger values where it is contact limited. {copyright} {ital 1998 American Institute of Physics.}

Effect of saline iontophoresis on skin barrier function and cutaneous irritation in four ethnic groups.

Science.gov (United States)

Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I

2000-08-01

The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.

Barrier mechanisms in the Drosophila blood-brain barrier

Directory of Open Access Journals (Sweden)

Samantha Jane Hindle

2014-12-01

Full Text Available The invertebrate blood-brain barrier field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through GPCR signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate blood-brain barrier has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many blood-brain barrier mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the blood-brain barrier can govern whole animal physiologies. This includes novel functions of blood-brain barrier gap junctions in orchestrating synchronized neuroblast proliferation, and of blood-brain barrier secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate blood-brain barrier anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.

Model Complexities of Shallow Networks Representing Highly Varying Functions

Czech Academy of Sciences Publication Activity Database

Kůrková, Věra; Sanguineti, M.

2016-01-01

Roč. 171, 1 January (2016), s. 598-604 ISSN 0925-2312 R&D Projects: GA MŠk(CZ) LD13002 Grant - others:grant for Visiting Professors(IT) GNAMPA-INdAM Institutional support: RVO:67985807 Keywords : shallow networks * model complexity * highly varying functions * Chernoff bound * perceptrons * Gaussian kernel units Subject RIV: IN - Informatics, Computer Science Impact factor: 3.317, year: 2016

War experiences, general functioning and barriers to care among former child soldiers in Northern Uganda: the WAYS study.

Science.gov (United States)

Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio

2014-12-01

Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Monopoly models with time-varying demand function

Science.gov (United States)

Cavalli, Fausto; Naimzada, Ahmad

2018-05-01

We study a family of monopoly models for markets characterized by time-varying demand functions, in which a boundedly rational agent chooses output levels on the basis of a gradient adjustment mechanism. After presenting the model for a generic framework, we analytically study the case of cyclically alternating demand functions. We show that both the perturbation size and the agent's reactivity to profitability variation signals can have counterintuitive roles on the resulting period-2 cycles and on their stability. In particular, increasing the perturbation size can have both a destabilizing and a stabilizing effect on the resulting dynamics. Moreover, in contrast with the case of time-constant demand functions, the agent's reactivity is not just destabilizing, but can improve stability, too. This means that a less cautious behavior can provide better performance, both with respect to stability and to achieved profits. We show that, even if the decision mechanism is very simple and is not able to always provide the optimal production decisions, achieved profits are very close to those optimal. Finally, we show that in agreement with the existing empirical literature, the price series obtained simulating the proposed model exhibit a significant deviation from normality and large volatility, in particular when underlying deterministic dynamics become unstable and complex.

Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

Science.gov (United States)

Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

2016-02-01

A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.

Science.gov (United States)

Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B

2017-11-01

Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models ( Villin-CreER T2 ;Klf5 fl/fl designated as Klf5 ΔIND and Villin-Cre;Klf5 fl/fl as Klf5 ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND ). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2 , which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2 , a gene encoding a major component of desmosome structures. NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function

Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling

Directory of Open Access Journals (Sweden)

Kai Wang

2016-05-01

Full Text Available Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ loci occludin and zona occludens (ZO-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.

Predictions of barrier island berm evolution in a time-varying storm climatology

Science.gov (United States)

Plant, Nathaniel G.; Flocks, James; Stockdon, Hilary F.; Long, Joseph W.; Guy, Kristy K.; Thompson, David M.; Cormier, Jamie M.; Smith, Christopher G.; Miselis, Jennifer L.; Dalyander, P. Soupy

2014-01-01

Low-lying barrier islands are ubiquitous features of the world's coastlines, and the processes responsible for their formation, maintenance, and destruction are related to the evolution of smaller, superimposed features including sand dunes, beach berms, and sandbars. The barrier island and its superimposed features interact with oceanographic forces (e.g., overwash) and exchange sediment with each other and other parts of the barrier island system. These interactions are modulated by changes in storminess. An opportunity to study these interactions resulted from the placement and subsequent evolution of a 2 m high sand berm constructed along the northern Chandeleur Islands, LA. We show that observed berm length evolution is well predicted by a model that was fit to the observations by estimating two parameters describing the rate of berm length change. The model evaluates the probability and duration of berm overwash to predict episodic berm erosion. A constant berm length change rate is also predicted that persists even when there is no overwash. The analysis is extended to a 16 year time series that includes both intraannual and interannual variability of overwash events. This analysis predicts that as many as 10 or as few as 1 day of overwash conditions would be expected each year. And an increase in berm elevation from 2 m to 3.5 m above mean sea level would reduce the expected frequency of overwash events from 4 to just 0.5 event-days per year. This approach can be applied to understanding barrier island and berm evolution at other locations using past and future storm climatologies.

Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

Science.gov (United States)

Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

2016-01-01

To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

Effects of industrial detergents on the barrier function of human skin

DEFF Research Database (Denmark)

Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner

2000-01-01

Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...

Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

Directory of Open Access Journals (Sweden)

Xiang Ling

Full Text Available Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ. Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC. It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P < 0.01. Compared with the LPS group, bifidobacterium significantly decreased the production of IL-6 and TNF-α (P < 0.01 and suppressed zonulin release (P < 0.05. In addition, bifidobacterium pretreatment up-regulated occludin, claudin-3 and ZO-1 expression (P < 0.01 and also preserved these proteins localization at TJ compared with the LPS group. In the in vivo study, bifidobacterium decreased the incidence of NEC from 88 to 47% (P < 0.05 and reduced the severity in the NEC model. Increased levels of IL-6 and TNF-α in the ileum of NEC rats were normalized in bifidobacterium treated rats (P < 0.05. Moreover, administration of bifidobacterium attenuated the increase in intestinal permeability (P < 0.01, decreased the levels of serum zonulin (P < 0.05, normalized the expression and localization of TJ proteins in the ileum compared with animals with NEC. We concluded that bifidobacterium may

Inhibition of Murine Pulmonary Microvascular Endothelial Cell Apoptosis Promotes Recovery of Barrier Function under Septic Conditions

Directory of Open Access Journals (Sweden)

Lefeng Wang

2017-01-01

Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.

Endothelium-Derived 5-Methoxytryptophan Protects Endothelial Barrier Function by Blocking p38 MAPK Activation.

Directory of Open Access Journals (Sweden)

Ling-Yun Chu

Full Text Available The endothelial junction is tightly controlled to restrict the passage of blood cells and solutes. Disruption of endothelial barrier function by bacterial endotoxins, cytokines or growth factors results in inflammation and vascular damage leading to vascular diseases. We have identified 5-methoxytryptophan (5-MTP as an anti-inflammatory factor by metabolomic analysis of conditioned medium of human fibroblasts. Here we postulated that endothelial cells release 5-MTP to protect the barrier function. Conditioned medium of human umbilical vein endothelial cells (HUVECs prevented endothelial hyperpermeability and VE-cadherin downregulation induced by VEGF, LPS and cytokines. We analyzed the metabolomic profile of HUVEC conditioned medium and detected 5-MTP but not melatonin, serotonin or their catabolites, which was confirmed by enzyme-linked immunosorbent assay. Addition of synthetic pure 5-MTP preserved VE-cadherin and maintained barrier function despite challenge with pro-inflammatory mediators. Tryptophan hydroxylase-1, an enzyme required for 5-MTP biosynthesis, was downregulated in HUVECs by pro-inflammatory mediators and it was accompanied by reduction of 5-MTP. 5-MTP protected VE-cadherin and prevented endothelial hyperpermeability by blocking p38 MAPK activation. A chemical inhibitor of p38 MAPK, SB202190, exhibited a similar protective effect as 5-MTP. To determine whether 5-MTP prevents vascular hyperpermeability in vivo, we evaluated the effect of 5-MTP administration on LPS-induced murine microvascular permeability with Evans blue. 5-MTP significantly prevented Evans blue dye leakage. Our findings indicate that 5-MTP is a new class of endothelium-derived molecules which protects endothelial barrier function by blocking p38 MAPK.

Functions of an engineered barrier system for a nuclear waste repository in basalt

International Nuclear Information System (INIS)

Coons, W.E.; Moore, E.L.; Smith, M.J.; Kaser, J.D.

1980-01-01

Defined in this document are the functions of components selected for an engineered barrier system for a nuclear waste repository in basalt. The definitions provide a focal point for barrier material research and development by delineating the purpose and operative lifetime of each component of the engineered system. A five-component system (comprised of waste form, canister, buffer, overpack, and tailored backfill) is discussed in terms of effective operation throughout the course of repository history, recognizing that the emplacement environment changes with time. While components of the system are mutually supporting, redundancy is provided by subsystems of physical and chemical barriers which act in concert with the geology to provide a formidable barrier to transport of hazardous materials to the biosphere. The operating philosophy of the conceptual engineered barrier system is clarified by examples pertinent to storage in basalt, and a technical approach to barrier design and material selection is proposed. A method for system validation and qualification is also included which considers performance criteria proposed by external agencies in conjunction with site-specific models and risk assessment to define acceptable levels of system performance

Blood-aqueous Barrier Function in a Patient With Choroideremia

Directory of Open Access Journals (Sweden)

Muh-Shy Chen

2010-02-01

Full Text Available The purpose was to determine whether there was a breakdown of the blood-aqueous barrier in a patient with choroideremia. A 27-year-old man with typical choroideremia underwent standardized ophthalmo-logical evaluation, including quantitative measurement of aqueous flare intensity, by a laser flare-cell meter. The results showed areas of atrophy of the choriocapillaries and retinal pigment epithelium in the mid-periphery and posterior pole, although not in the macula. Fluorescein angiography showed areas of loss of the choriocapillaries and retinal pigment epithelium. The fovea was spared with a surrounding zone of hy-perfluorescence. Electroretinography showed a subnormal photopic amplitude and extinguished scotopic response. Electrooculography revealed that the light peak/dark trough ratio was reduced. Goldmann perimetry showed constricted peripheral fields. Laser photometry showed an increase in the aqueous flare intensity in both eyes, as compared with normal subjects. We conclude that the function of the blood-aqueous barrier might be affected in patients with choroideremia.

Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

Science.gov (United States)

Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

2017-07-01

Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

Internal resistor of multi-functional tunnel barrier for selectivity and switching uniformity in resistive random access memory.

Science.gov (United States)

Lee, Sangheon; Woo, Jiyong; Lee, Daeseok; Cha, Euijun; Hwang, Hyunsang

2014-01-01

In this research, we analyzed the multi-functional role of a tunnel barrier that can be integrated in devices. This tunnel barrier, acting as an internal resistor, changes its resistance with applied bias. Therefore, the current flow in the devices can be controlled by a tunneling mechanism that modifies the tunnel barrier thickness for non-linearity and switching uniformity of devices. When a device is in a low-resistance state, the tunnel barrier controls the current behavior of the device because most of the bias is applied to the tunnel barrier owing to its higher resistance. Furthermore, the tunnel barrier induces uniform filament formation during set operation with the tunnel barrier controlling the current flow.

Energy barriers in patterned media

NARCIS (Netherlands)

de Vries, Jeroen

2013-01-01

Due to the fact that thermal activation aids in overcoming the energy barrier, the required field for reversal varies from instance to instance for the same island. This thermally induced switching field distribution can be used to determine the difference in energy barrier of magneticallyweak and

Lipids and skin barrier function - a clinical perspective

DEFF Research Database (Denmark)

Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

2008-01-01

The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...

Chaotic correlations in barrier billiards with arbitrary barriers

International Nuclear Information System (INIS)

Osbaldestin, A H; Adamson, L N C

2013-01-01

We study autocorrelation functions in symmetric barrier billiards for golden mean trajectories with arbitrary barriers. Renormalization analysis reveals the presence of a chaotic invariant set and thus that, for a typical barrier, there are chaotic correlations. The chaotic renormalization set is the analogue of the so-called orchid that arises in a generalized Harper equation. (paper)

Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

Science.gov (United States)

Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

2016-06-01

Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

Estimation of Time-Varying Coherence and Its Application in Understanding Brain Functional Connectivity

Directory of Open Access Journals (Sweden)

Cheng Liu

2010-01-01

Full Text Available Time-varying coherence is a powerful tool for revealing functional dynamics between different regions in the brain. In this paper, we address ways of estimating evolutionary spectrum and coherence using the general Cohen's class distributions. We show that the intimate connection between the Cohen's class-based spectra and the evolutionary spectra defined on the locally stationary time series can be linked by the kernel functions of the Cohen's class distributions. The time-varying spectra and coherence are further generalized with the Stockwell transform, a multiscale time-frequency representation. The Stockwell measures can be studied in the framework of the Cohen's class distributions with a generalized frequency-dependent kernel function. A magnetoencephalography study using the Stockwell coherence reveals an interesting temporal interaction between contralateral and ipsilateral motor cortices under the multisource interference task.

Optimum Design of Multi-Function Robot Arm Gripper for Varying Shape Green Product

Directory of Open Access Journals (Sweden)

Razali Zol Bahri

2016-01-01

Full Text Available The project focuses on thorough experimentally studies of the optimum design of Multi-function Robot Arm Gripper for varying shape green product. The purpose of this project is to design a few of robot arm gripper for multi-functionally grip a green product with varying shape. The main character of the gripper is that it can automated adjust its finger to suit with the shape of the product. An optimum design of multi-function robot arm gripper is verified through experimental study. The expected result is a series of analytical results on the proposal of gripper design and material that will be selected for the gripper. The analysis of the gripper design proposal by using ANSYS and CATIA software is described in detail in this paper.

Proton nuclear magnetic resonance study on the barrier function of pig corneal epithelium and endothelium

International Nuclear Information System (INIS)

Yokoi, Norihiko; Kinoshita, Shigeru; Morimoto, Taketoshi; Yoshizaki, Kazuo.

1995-01-01

Using gadolinium diethylenetriaminepentaacetic acid (Gd-DTPA) as a tracer, the barrier function of the corneal epithelium and endothelium was evaluated by proton nuclear magnetic resonance. Whole pig eyes and cornea excised with scleral rim, which had been incubated in dextran-added Gd-DTPA solution, were subjected to T 1 relaxation measurement and magnetic resonance imaging (MRI). After incubation, the T 1 relaxation rate (1/T 1 ) of the excised cornea increased to a steady value, whereas that of the cornea from the whole eye increased only slightly. These results indicated that the increase in the T 1 relaxation rate of the excised cornea was attributable to Gd-DTPA penetration from the corneal endothelium and that the corneal epithelium exhibited a strong barrier function against Gd-DTPA entry. The MRI study also confirmed the strong barrier, enhanced signals being detected within the aqueous fluid in the T 1 -weighted image only when the corneal epithelium was abraded. Since Gd-DTPA scarcely penetrates the intact corneal epithelium, Gd-DTPA-enhanced MRI shows potential as a quantitative tracer in evaluating epithelial barrier disruption. (author)

Glucose Transporters at the Blood-Brain Barrier: Function, Regulation and Gateways for Drug Delivery.

Science.gov (United States)

Patching, Simon G

2017-03-01

Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.

Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.

Science.gov (United States)

Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard

2016-01-01

Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.

Gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice

Science.gov (United States)

Fang, Yu; Chen, Hao; Hu, Yuhui; Djukic, Zorka; Tevebaugh, Whitney; Shaheen, Nicholas J.; Orlando, Roy C.; Hu, Jianguo

2013-01-01

The barrier function of the esophageal epithelium is a major defense against gastroesophageal reflux disease. Previous studies have shown that reflux damage is reflected in a decrease in transepithelial electrical resistance associated with tight junction alterations in the esophageal epithelium. To develop novel therapies, it is critical to understand the molecular mechanisms whereby contact with a refluxate impairs esophageal barrier function. In this study, surgical models of duodenal and mixed reflux were developed in mice. Mouse esophageal epithelium was analyzed by gene microarray. Gene set enrichment analysis showed upregulation of inflammation-related gene sets and the NF-κB pathway due to reflux. Significance analysis of microarrays revealed upregulation of NF-κB target genes. Overexpression of NF-κB subunits (p50 and p65) and NF-κB target genes (matrix metalloproteinases-3 and -9, IL-1β, IL-6, and IL-8) confirmed activation of the NF-κB pathway in the esophageal epithelium. In addition, real-time PCR, Western blotting, and immunohistochemical staining also showed downregulation and mislocalization of claudins-1 and -4. In a second animal experiment, treatment with an NF-κB inhibitor, BAY 11-7085 (20 mg·kg−1·day−1 ip for 10 days), counteracted the effects of duodenal and mixed reflux on epithelial resistance and NF-κB-regulated cytokines. We conclude that gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice and that targeting the NF-κB pathway may strengthen esophageal barrier function against reflux. PMID:23639809

Suitability of polystyrene as a functional barrier layer in coloured food contact materials.

Science.gov (United States)

Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy

2015-01-01

Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.

A framework for understanding semi-permeable barrier effects on migratory ungulates

Science.gov (United States)

Sawyer, Hall; Kauffman, Matthew J.; Middleton, Arthur D.; Morrison, Thomas A.; Nielson, Ryan M.; Wyckoff, Teal B.

2013-01-01

1. Impermeable barriers to migration can greatly constrain the set of possible routes and ranges used by migrating animals. For ungulates, however, many forms of development are semi-permeable, and making informed management decisions about their potential impacts to the persistence of migration routes is difficult because our knowledge of how semi-permeable barriers affect migratory behaviour and function is limited. 2. Here, we propose a general framework to advance the understanding of barrier effects on ungulate migration by emphasizing the need to (i) quantify potential barriers in terms that allow behavioural thresholds to be considered, (ii) identify and measure behavioural responses to semi-permeable barriers and (iii) consider the functional attributes of the migratory landscape (e.g. stopovers) and how the benefits of migration might be reduced by behavioural changes. 3. We used global position system (GPS) data collected from two subpopulations of mule deer Odocoileus hemionus to evaluate how different levels of gas development influenced migratory behaviour, including movement rates and stopover use at the individual level, and intensity of use and width of migration route at the population level. We then characterized the functional landscape of migration routes as either stopover habitat or movement corridors and examined how the observed behavioural changes affected the functionality of the migration route in terms of stopover use. 4. We found migratory behaviour to vary with development intensity. Our results suggest that mule deer can migrate through moderate levels of development without any noticeable effects on migratory behaviour. However, in areas with more intensive development, animals often detoured from established routes, increased their rate of movement and reduced stopover use, while the overall use and width of migration routes decreased. 5. Synthesis and applications. In contrast to impermeable barriers that impede animal movement

Defects in small intestinal epithelial barrier function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine.

Science.gov (United States)

Moeser, Adam J; Borst, Luke B; Overman, Beth L; Pittman, Jeremy S

2012-10-01

The objective of this study was to investigate intestinal function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine. Jejunum and distal ileum from control and pigs exhibiting PFTS was harvested at weaning, 4 and 11 days post-weaning (PW) for intestinal barrier function studies and histological analyses (n=6 pigs per group). Marked disturbances in intestinal barrier function was observed in PFTS pigs, compared with controls, indicated by lower (p<0.05) TER and increased (p<0.01) permeability to FITC dextran (4 kDa). Intestines from weaned pigs, subjected to a 4-day fast, exhibited minor disturbances in intestinal barrier function. Villus atrophy and crypt hyperplasia were observed in the PFTS intestine compared with control and fasted pigs. These data demonstrate that PFTS is associated with profound disturbances in intestinal epithelial barrier function and alterations in mucosal and epithelial morphology in which anorexia is not the sole factor. Copyright © 2012 Elsevier Ltd. All rights reserved.

Modelling of migration from multi-layers and functional barriers: Estimation of parameters

NARCIS (Netherlands)

Dole, P.; Voulzatis, Y.; Vitrac, O.; Reynier, A.; Hankemeier, T.; Aucejo, S.; Feigenbaum, A.

2006-01-01

Functional barriers form parts of multi-layer packaging materials, which are deemed to protect the food from migration of a broad range of contaminants, e.g. those associated with reused packaging. Often, neither the presence nor the identity of the contaminants is known, so that safety assessment

A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

Science.gov (United States)

Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

2016-10-01

Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

Glycoprotein A33 deficiency: a new mouse model of impaired intestinal epithelial barrier function and inflammatory disease

Directory of Open Access Journals (Sweden)

Benjamin B. Williams

2015-08-01

Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms

Ceramides and barrier function in healthy skin

DEFF Research Database (Denmark)

Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

2010-01-01

Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

The blood-brain barrier and oncology : new insights into function and modulation

NARCIS (Netherlands)

Bart, J; Groen, HJM; Hendrikse, NH; van der Graaf, WTA; Vaalburg, W; de Vries, EGE

2000-01-01

The efficacy of chemotherapy for malignant primary or metastatic brain tumours is still poor. This is at least partly due to the presence of the blood-brain barrier (BBB). The functionality of the BBB can be explained by physicochemical features and efflux pump mechanisms. An overview of the

Barriers to Physical Activity in Individuals with Spinal Cord Injury

DEFF Research Database (Denmark)

Roberton, Terri; Bucks, Romola S.; Skinner, Timothy C.

2011-01-01

This study examined barriers to physical activity reported individuals with spinal cord injury (SCI) and the degree to which these barriers differed across varying degrees of independence. Participants were 65 individuals recruited from the Western Australian Spinal Cord Injury database. Data...... on physical activity participation and perceived barriers to physical activity participation were collected using a cross-sectional survey and analysed using independent samples t-tests. We found that, regardless of level of ambulation or ability to transfer, few participants reported being physically active....... While there were no significant differences in the amount of barriers reported by individuals with different levels of independence, the type of barriers reported varied across groups....

Modulation of ocular surface glycocalyx barrier function by a galectin-3 N-terminal deletion mutant and membrane-anchored synthetic glycopolymers.

Directory of Open Access Journals (Sweden)

Jerome Mauris

Full Text Available BACKGROUND: Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. CONCLUSIONS/SIGNIFICANCE: These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery.

Functions and requirements for subsurface barriers used in support of single-shell tank waste retrieval

International Nuclear Information System (INIS)

Lowe, S.S.

1993-01-01

The mission of the Tank Waste Remediation System (TWRS) Program is to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The scope of the TWRS Program includes project and program activities for receiving, storing, maintaining, treating, and disposing onsite, or packaging for offsite disposal, all Hanford tank waste. Hanford tank waste includes the contents of 149 single-shell tanks (SSTs) and 28 double-shell tanks (DSTs), plus any new waste added to these facilities, and all encapsulated cesium and strontium stored onsite and returned from offsite users. A key element of the TWRS Program is retrieval of the waste in the SSTs. The waste stored in these underground tanks must be removed in order to minimize environmental, safety, and health risks associated with continuing waste storage. Subsurface barriers are being considered as a means to mitigate the effects of tank leaks including those occurring during SST waste retrieval. The functions to be performed by subsurface barriers based on their role in retrieving waste from the SSTs are described, and the requirements which constrain their application are identified. These functions and requirements together define the functional baseline for subsurface barriers

Fulfillment of the long-term safety functions by the different barriers during the main time frames after repository closure

International Nuclear Information System (INIS)

Preter, P. de; Lalieux, Ph.

2002-01-01

In general terms the basis long-term safety functions of a disposal system (i.e. the engineered barrier system, including the waste forms and the host rock) are the functions that the system as a whole or its constituents must fulfill in order to assure an adequate level of long-term radiological safety. The long-term safety functions of a disposal system constitute a generic and methodological tool that can be used in a double sense. In the first place these functions provide an a priori instrument for designing the system: the implementer must ensure that these safety functions are fulfilled by a series of robust system barriers and components. These functions can also be used as an a posteriori means to describe and assess in general terms the functioning of the system. In this way they are an important qualitative element to help to support the safety case and to identify further R and D priorities. By providing a general description of system functioning they are also a communication tool to stakeholders who are less familiar with the details of a safety case. Instead of limiting the description to a multi-barrier system, the safety functions enable to better explain how the different barriers contribute to one or more safety functions and by which processes this is performed. By doing so the system description moves from multi-barrier to multi-function. The aim of this paper is to provide such a general description of the system functioning for the Belgian case of deep disposal of high-level waste (mainly spent fuel or vitrified waste from fuel reprocessing) in the Boom Clay, o poorly-indurated argillaceous formation. From the detailed safety and performance evaluations the main time frames after repository closure are identified. Each time frame relates to a period during which the successive safety functions play a key role. Also, in each time frame the radiological impact on the environment is distinctly different. (authors)

Biosensor Technology Reveals the Disruption of the Endothelial Barrier Function and the Subsequent Death of Blood Brain Barrier Endothelial Cells to Sodium Azide and Its Gaseous Products.

Science.gov (United States)

Kho, Dan T; Johnson, Rebecca H; O'Carroll, Simon J; Angel, Catherine E; Graham, E Scott

2017-09-21

Herein we demonstrate the sensitive nature of human blood-brain barrier (BBB) endothelial cells to sodium azide and its gaseous product. Sodium azide is known to be acutely cytotoxic at low millimolar concentrations, hence its use as a biological preservative (e.g., in antibodies). Loss of barrier integrity was noticed in experiments using Electric Cell-substrate Impedance Sensing (ECIS) biosensor technology, to measure endothelial barrier integrity continuously in real-time. Initially the effect of sodium azide was observed as an artefact where it was present in antibodies being employed in neutralisation experiments. This was confirmed where antibody clones that were azide-free did not mediate loss of barrier function. A delayed loss of barrier function in neighbouring wells implied the influence of a liberated gaseous product. ECIS technology demonstrated that the BBB endothelial cells had a lower level of direct sensitivity to sodium azide of ~3 µM. Evidence of gaseous toxicity was consistently observed at 30 µM and above, with disrupted barrier function and cell death in neighbouring wells. We highlight the ability of this cellular biosensor technology to reveal both the direct and gaseous toxicity mediated by sodium azide. The sensitivity and temporal dimension of ECIS technology was instrumental in these observations. These findings have substantial implications for the wide use of sodium azide in biological reagents, raising issues of their application in live-cell assays and with regard to the protection of the user. This research also has wider relevance highlighting the sensitivity of brain endothelial cells to a known mitochondrial disruptor. It is logical to hypothesise that BBB endothelial dysfunction due to mitochondrial dys-regulation could have an important but underappreciated role in a range of neurological diseases.

Sleep Restriction Impairs Blood–Brain Barrier Function

Science.gov (United States)

He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J.; Wang, Yuping

2014-01-01

The blood–brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. PMID:25355222

The Effects of Anthrax Lethal Toxin on Host Barrier Function

Directory of Open Access Journals (Sweden)

David M. Frucht

2011-06-01

Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.

A comparison of freeway median crash frequency, severity, and barrier strike outcomes by median barrier type.

Science.gov (United States)

Russo, Brendan J; Savolainen, Peter T

2018-08-01

Median-crossover crashes are among the most hazardous events that can occur on freeways, often resulting in severe or fatal injuries. The primary countermeasure to reduce the occurrence of such crashes is the installation of a median barrier. When installation of a median barrier is warranted, transportation agencies are faced with the decision among various alternatives including concrete barriers, beam guardrail, or high-tension cable barriers. Each barrier type differs in terms of its deflection characteristics upon impact, the required installation and maintenance costs, and the roadway characteristics (e.g., median width) where installation would be feasible. This study involved an investigation of barrier performance through an in-depth analysis of crash frequency and severity data from freeway segments where high-tension cable, thrie-beam, and concrete median barriers were installed. A comprehensive manual review of crash reports was conducted to identify crashes in which a vehicle left the roadway and encroached into the median. This review also involved an examination of crash outcomes when a barrier strike occurred, which included vehicle containment, penetration, or re-direction onto the travel lanes. The manual review of crash reports provided critical supplementary information through narratives and diagrams not normally available through standard fields on police crash report forms. Statistical models were estimated to identify factors that affect the frequency, severity, and outcomes of median-related crashes, with particular emphases on differences between segments with varying median barrier types. Several roadway-, traffic-, and environmental-related characteristics were found to affect these metrics, with results varying across the different barrier types. The results of this study provide transportation agencies with important guidance as to the in-service performance of various types of median barrier. Copyright © 2018 Elsevier Ltd. All rights

Hydration effects on the barrier function of stratum corneum lipids: Raman analysis of ceramides 2, III and 5.

Science.gov (United States)

Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette

2013-11-07

The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.

MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

Directory of Open Access Journals (Sweden)

Victor Chatterjee

Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

Acyl-CoA binding protein and epidermal barrier function

DEFF Research Database (Denmark)

Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

2014-01-01

The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

Science.gov (United States)

Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I

2015-10-01

Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular

Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

Directory of Open Access Journals (Sweden)

Shimon Bershtein

2015-10-01

Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the

Adaptive Neural Network Control for Nonlinear Hydraulic Servo-System with Time-Varying State Constraints

Directory of Open Access Journals (Sweden)

Shu-Min Lu

2017-01-01

Full Text Available An adaptive neural network control problem is addressed for a class of nonlinear hydraulic servo-systems with time-varying state constraints. In view of the low precision problem of the traditional hydraulic servo-system which is caused by the tracking errors surpassing appropriate bound, the previous works have shown that the constraint for the system is a good way to solve the low precision problem. Meanwhile, compared with constant constraints, the time-varying state constraints are more general in the actual systems. Therefore, when the states of the system are forced to obey bounded time-varying constraint conditions, the high precision tracking performance of the system can be easily realized. In order to achieve this goal, the time-varying barrier Lyapunov function (TVBLF is used to prevent the states from violating time-varying constraints. By the backstepping design, the adaptive controller will be obtained. A radial basis function neural network (RBFNN is used to estimate the uncertainties. Based on analyzing the stability of the hydraulic servo-system, we show that the error signals are bounded in the compacts sets; the time-varying state constrains are never violated and all singles of the hydraulic servo-system are bounded. The simulation and experimental results show that the tracking accuracy of system is improved and the controller has fast tracking ability and strong robustness.

Barrier Function-Based Neural Adaptive Control With Locally Weighted Learning and Finite Neuron Self-Growing Strategy.

Science.gov (United States)

Jia, Zi-Jun; Song, Yong-Duan

2017-06-01

This paper presents a new approach to construct neural adaptive control for uncertain nonaffine systems. By integrating locally weighted learning with barrier Lyapunov function (BLF), a novel control design method is presented to systematically address the two critical issues in neural network (NN) control field: one is how to fulfill the compact set precondition for NN approximation, and the other is how to use varying rather than a fixed NN structure to improve the functionality of NN control. A BLF is exploited to ensure the NN inputs to remain bounded during the entire system operation. To account for system nonlinearities, a neuron self-growing strategy is proposed to guide the process for adding new neurons to the system, resulting in a self-adjustable NN structure for better learning capabilities. It is shown that the number of neurons needed to accomplish the control task is finite, and better performance can be obtained with less number of neurons as compared with traditional methods. The salient feature of the proposed method also lies in the continuity of the control action everywhere. Furthermore, the resulting control action is smooth almost everywhere except for a few time instants at which new neurons are added. Numerical example illustrates the effectiveness of the proposed approach.

Penetration through the Skin Barrier

DEFF Research Database (Denmark)

Nielsen, Jesper Bo; Benfeldt, Eva; Holmgaard, Rikke

2016-01-01

The skin is a strong and flexible organ with barrier properties essential for maintaining homeostasis and thereby human life. Characterizing this barrier is the ability to prevent some chemicals from crossing the barrier while allowing others, including medicinal products, to pass at varying rates......-through diffusion cells) as well as in vivo methods (microdialysis and microperfusion). Then follows a discussion with examples of how different characteristics of the skin (age, site and integrity) and of the penetrants (size, solubility, ionization, logPow and vehicles) affect the kinetics of percutaneous...

Adaptive fuzzy dynamic surface control of nonlinear systems with input saturation and time-varying output constraints

Science.gov (United States)

Edalati, L.; Khaki Sedigh, A.; Aliyari Shooredeli, M.; Moarefianpour, A.

2018-02-01

This paper deals with the design of adaptive fuzzy dynamic surface control for uncertain strict-feedback nonlinear systems with asymmetric time-varying output constraints in the presence of input saturation. To approximate the unknown nonlinear functions and overcome the problem of explosion of complexity, a Fuzzy logic system is combined with the dynamic surface control in the backstepping design technique. To ensure the output constraints satisfaction, an asymmetric time-varying Barrier Lyapunov Function (BLF) is used. Moreover, by applying the minimal learning parameter technique, the number of the online parameters update for each subsystem is reduced to 2. Hence, the semi-globally uniformly ultimately boundedness (SGUUB) of all the closed-loop signals with appropriate tracking error convergence is guaranteed. The effectiveness of the proposed control is demonstrated by two simulation examples.

Food Derived Bioactive Peptides and Intestinal Barrier Function

Directory of Open Access Journals (Sweden)

Olga Martínez-Augustin

2014-12-01

Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

Influence of sunflower seed oil or baby lotion on the skin barrier function of newborns: A pilot study.

Science.gov (United States)

Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie

2017-12-01

Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.

Sleep restriction impairs blood-brain barrier function.

Science.gov (United States)

He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong

2014-10-29

The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.

Prolonged phonation impairs the integrity and barrier function of porcine vocal fold epithelium: a preliminary study.

Science.gov (United States)

Zhang, Chi; Paddock, Kieran; Chou, Adriana; Scholp, Austin; Gong, Ting; Jiang, Jack J

2018-04-18

Voice abuse is known to be a common risk factor of voice disorders and prolonged; high-intensity phonation has been shown to damage the vocal fold epithelium. We aim to evaluate the effects of phonation on the integrity and barrier function of vocal fold epithelium using a porcine laryngeal model. Ex vivo porcine larynges were phonated at low intensity or high intensity for 15, 30, or 60 min within 4 h after harvest. Vocal fold epithelium was visualized using transmission electron microscopy (TEM). The barrier function of vocal fold epithelium was evaluated by measuring the permeability to model molecules, fluorescein (376 Da), and fluorescein isothiocyanate (FITC)-dextrans of 4000 and 10,000 Da (FD4, FD10), in a Franz diffusing cell. Cell death and dilated intercellular space after phonation were observed using TEM. Thickness of vocal fold epithelium was significantly reduced after low-intensity phonation for 30 and 60 min and high-intensity phonation for 15, 30, and 60 min. Epithelial permeability to fluorescein was significantly increased after low-intensity phonation for 30 and 60 min, and high-intensity phonation. Permeability to FD4 was significantly increased after high-intensity phonation for 30 and 60 min. Phonation did not alter the permeability to FD10 significantly. Long-duration phonation destroys the integrity and barrier function of vocal fold epithelium. These effects likely make vocal folds more vulnerable to other environmental irritants, such as tobacco smoke, reflux components, allergens, and inhaled pollutants. Destroyed barrier function may be an important factor in the pathogenesis of voice lesions related to voice abuse.

Effects of Lactobacillus plantarum on gut barrier function in experimental obstructive jaundice

Science.gov (United States)

Zhou, Yu-Kun; Qin, Huan-Long; Zhang, Ming; Shen, Tong-Yi; Chen, Hong-Qi; Ma, Yan-Lei; Chu, Zhao-Xin; Zhang, Peng; Liu, Zhi-Hua

2012-01-01

AIM: To investigate the mechanisms of Lactobacillus plantarum (L. plantarum) action on gut barrier in preoperative and postoperative experimental obstructive jaundice in rats. METHODS: Forty rats were randomly divided into groups of sham-operation, bile duct ligation (BDL), BDL + L. plantarum, BDL + internal biliary drainage (IBD), and BDL + IBD + L. plantarum. Ten days after L. plantarum administration, blood and ileal samples were collected from the rats for morphological examination, and intestinal barrier function, liver function, intestinal oxidative stress and protein kinase C (PKC) activity measurement. The distribution and expression of the PKC and tight junction (TJ) proteins, such as occludin, zonula occludens-1, claudin-1, claudin-4, junction adhesion molecule-A and F-actin, were examined by confocal laser scanning microscopy, immunohistochemistry, Western blotting, real-time fluorescent quantitative polymerase chain reaction assay. RESULTS: L. plantarum administration substantially restored gut barrier, decreased enterocyte apoptosis, improved intestinal oxidative stress, promoted the activity and expression of protein kinase (BDL vs BDL + L. plantarum, 0.295 ± 0.007 vs 0.349 ± 0.003, P plantarum, 0.407 ± 0.046 vs 0.465 ± 0.135, P plantarum, 0.266 ± 0.118 vs 0.326 ± 0.009, P plantarum was more prominent after internal biliary drainage ( BDL + IBD vs BDL + IBD + L. plantarum, 0.415 ± 0.105 vs 0.494 ± 0.145, P plantarum can decrease intestinal epithelial cell apoptosis, reduce oxidative stress, and prevent TJ disruption in biliary obstruction by activating the PKC pathway. PMID:22912548

Stereodynamic tetrahydrobiisoindole “NU-BIPHEP(O”s: functionalization, rotational barriers and non-covalent interactions

Directory of Open Access Journals (Sweden)

Golo Storch

2016-07-01

Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.

Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer.

Science.gov (United States)

Fasano, Alessio

2011-01-01

The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.

Barrier mechanisms in the Drosophila blood-brain barrier.

Science.gov (United States)

Hindle, Samantha J; Bainton, Roland J

2014-01-01

The invertebrate blood-brain barrier (BBB) field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through G-protein coupled receptor signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate BBB has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many BBB mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the BBB can govern whole animal physiologies. This includes novel functions of BBB gap junctions in orchestrating synchronized neuroblast proliferation, and of BBB secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate BBB anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.

Functional Anatomy and Oncologic Barriers of the Larynx.

Science.gov (United States)

Mor, Niv; Blitzer, Andrew

2015-08-01

Laryngeal barriers to tumor spread are a product of laryngeal development, anatomic barriers, and enzymatic activity. Supraglottic and glottic/subglottic development is distinct and partially explains the metastatic behavior of laryngeal carcinoma. Dense connective tissues and elastic fibers provide anatomic barriers within the larynx. Laryngeal cartilage contains dense cartilage, enzyme inhibitors, and an intact perichondrium making it relatively resistant to tumor invasion; however, focal areas of vulnerability are created by ossified cartilage and natural interruptions in the perichondrium. Local inflammation and the enzymatic interplay between tumor and host are important factors in the spread of laryngeal tumor. Copyright © 2015 Elsevier Inc. All rights reserved.

Concerted regulation of retinal pigment epithelium basement membrane and barrier function by angiocrine factors.

Science.gov (United States)

Benedicto, Ignacio; Lehmann, Guillermo L; Ginsberg, Michael; Nolan, Daniel J; Bareja, Rohan; Elemento, Olivier; Salfati, Zelda; Alam, Nazia M; Prusky, Glen T; Llanos, Pierre; Rabbany, Sina Y; Maminishkis, Arvydas; Miller, Sheldon S; Rafii, Shahin; Rodriguez-Boulan, Enrique

2017-05-19

The outer blood-retina barrier is established through the coordinated terminal maturation of the retinal pigment epithelium (RPE), fenestrated choroid endothelial cells (ECs) and Bruch's membrane, a highly organized basement membrane that lies between both cell types. Here we study the contribution of choroid ECs to this process by comparing their gene expression profile before (P5) and after (P30) the critical postnatal period when mice acquire mature visual function. Transcriptome analyses show that expression of extracellular matrix-related genes changes dramatically over this period. Co-culture experiments support the existence of a novel regulatory pathway: ECs secrete factors that remodel RPE basement membrane, and integrin receptors sense these changes triggering Rho GTPase signals that modulate RPE tight junctions and enhance RPE barrier function. We anticipate our results will spawn a search for additional roles of choroid ECs in RPE physiology and disease.

The effects of temperature on Schottky diode barrier height and evidence of multiple barrier

International Nuclear Information System (INIS)

Rabah, K.V.O.

1994-07-01

Experimental study of Capacitance-Voltage-Temperature (C-V-T) plots, Current-Voltage-Temperature (I-V-T) characteristics have been undertaken in order to determine the height of the Schottky barrier. The results of the barrier height obtained by the above two methods were found to differ as well as vary with temperature change. In view of this discrepancy in barrier height values, two further experiments were performed: one on activation energy (I-T) plots and the other on pulsed (I-V-T) characteristics, and the results were found to show a similar trend. The Schottky diode studied was a 30CP040. (author). 23 refs, 9 figs, 3 tabs

Excreted/secreted Trichuris suis products reduce barrier function and suppress inflammatory cytokine production of intestinal epithelial cells

DEFF Research Database (Denmark)

Hiemstra, I. H.; Klaver, E. J.; Vrijland, K.

2014-01-01

The administration of helminths is considered a promising strategy for the treatment of autoimmune diseases due to their immunomodulatory properties. Currently, the application of the helminth Trichuris suis as a treatment for Crohn's disease is being studied in large multi-center clinical trials....... The intestinal epithelium forms an efficient barrier between the intestinal lumen containing the microbial flora and helminths, and dendritic cells (DCs) present in the lamina propria that determine the TH response. Here, we investigated how excreted/secreted (E/S) products of T. suis affect the barrier function...... of intestinal epithelial cells (IECs) in order to reach the DCs and modulate the immune response. We show that T. suis E/S products reduce the barrier function and the expression of the tight junction proteins EMP-1 and claudin-4 in IEC CMT93/69 monolayers in a glycan-dependent manner. This resulted...

Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

Science.gov (United States)

Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.

2016-01-01

Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

The blood-tendon barrier: identification and characterisation of a novel tissue barrier in tendon blood vessels

Directory of Open Access Journals (Sweden)

C Lehner

2016-05-01

Full Text Available Tissue barriers function as “gate keepers” between different compartments (usually blood and tissue and are formed by specialised membrane-associated proteins, localising to the apicolateral plasma membrane domain of epithelial and endothelial cells. By sealing the paracellular space, the free diffusion of solutes and molecules across epithelia and endothelia is impeded. Thereby, tissue barriers contribute to the establishment and maintenance of a distinct internal and external environment, which is crucial during organ development and allows maintenance of an organ-specific homeostatic milieu. So far, various epithelial and endothelial tissue barriers have been described, including the blood-brain barrier, the blood-retina barrier, the blood-testis barrier, the blood-placenta barrier, and the cerebrospinal fluid (CSF-brain barrier, which are vital for physiological function and any disturbance of these barriers can result in severe organ damage or even death. Here, we describe the identification of a novel barrier, located in the vascular bed of tendons, which we term the blood-tendon barrier (BTB. By using immunohistochemistry, transmission electron microscopy, and tracer studies we demonstrate the presence of a functional endothelial barrier within tendons restricting the passage of large blood-borne molecules into the surrounding tendon tissue. We further provide in vitro evidence that the BTB potentially contributes to the creation of a distinct internal tissue environment impacting upon the proliferation and differentiation of tendon-resident cells, effects which might be fundamental for the onset of tendon pathologies.

Thiolated silicone oils as adhesive skin protectants for improved barrier function.

Science.gov (United States)

Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A

2016-06-01

The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Potential barrier classification by short-time measurement

International Nuclear Information System (INIS)

Granot, Er'el; Marchewka, Avi

2006-01-01

We investigate the short-time dynamics of a delta-function potential barrier on an initially confined wave packet. There are mainly two conclusions: (A) At short times the probability density of the first particles that passed through the barrier is unaffected by it. (B) When the barrier is absorptive (i.e., its potential is imaginary) it affects the transmitted wave function at shorter times than a real potential barrier. Therefore, it is possible to distinguish between an imaginary and a real potential barrier by measuring its effect at short times only on the transmitting wave function

Potential barrier classification by short-time measurement

Science.gov (United States)

Granot, Er'El; Marchewka, Avi

2006-03-01

We investigate the short-time dynamics of a delta-function potential barrier on an initially confined wave packet. There are mainly two conclusions: (A) At short times the probability density of the first particles that passed through the barrier is unaffected by it. (B) When the barrier is absorptive (i.e., its potential is imaginary) it affects the transmitted wave function at shorter times than a real potential barrier. Therefore, it is possible to distinguish between an imaginary and a real potential barrier by measuring its effect at short times only on the transmitting wave function.

Performance of Density Functional Theory Procedures for the Calculation of Proton-Exchange Barriers: Unusual Behavior of M06-Type Functionals.

Science.gov (United States)

Chan, Bun; Gilbert, Andrew T B; Gill, Peter M W; Radom, Leo

2014-09-09

We have examined the performance of a variety of density functional theory procedures for the calculation of complexation energies and proton-exchange barriers, with a focus on the Minnesota-class of functionals that are generally highly robust and generally show good accuracy. A curious observation is that M05-type and M06-type methods show an atypical decrease in calculated barriers with increasing proportion of Hartree-Fock exchange. To obtain a clearer picture of the performance of the underlying components of M05-type and M06-type functionals, we have investigated the combination of MPW-type and PBE-type exchange and B95-type and PBE-type correlation procedures. We find that, for the extensive E3 test set, the general performance of the various hybrid-DFT procedures improves in the following order: PBE1-B95 → PBE1-PBE → MPW1-PBE → PW6-B95. As M05-type and M06-type procedures are related to PBE1-B95, it would be of interest to formulate and examine the general performance of an alternative Minnesota DFT method related to PW6-B95.

Probabilistic migration modelling focused on functional barrier efficiency and low migration concepts in support of risk assessment.

Science.gov (United States)

Brandsch, Rainer

2017-10-01

Migration modelling provides reliable migration estimates from food-contact materials (FCM) to food or food simulants based on mass-transfer parameters like diffusion and partition coefficients related to individual materials. In most cases, mass-transfer parameters are not readily available from the literature and for this reason are estimated with a given uncertainty. Historically, uncertainty was accounted for by introducing upper limit concepts first, turning out to be of limited applicability due to highly overestimated migration results. Probabilistic migration modelling gives the possibility to consider uncertainty of the mass-transfer parameters as well as other model inputs. With respect to a functional barrier, the most important parameters among others are the diffusion properties of the functional barrier and its thickness. A software tool that accepts distribution as inputs and is capable of applying Monte Carlo methods, i.e., random sampling from the input distributions of the relevant parameters (i.e., diffusion coefficient and layer thickness), predicts migration results with related uncertainty and confidence intervals. The capabilities of probabilistic migration modelling are presented in the view of three case studies (1) sensitivity analysis, (2) functional barrier efficiency and (3) validation by experimental testing. Based on the predicted migration by probabilistic migration modelling and related exposure estimates, safety evaluation of new materials in the context of existing or new packaging concepts is possible. Identifying associated migration risk and potential safety concerns in the early stage of packaging development is possible. Furthermore, dedicated material selection exhibiting required functional barrier efficiency under application conditions becomes feasible. Validation of the migration risk assessment by probabilistic migration modelling through a minimum of dedicated experimental testing is strongly recommended.

Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning.

NARCIS (Netherlands)

Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W.A.

2001-01-01

Compromising alterations in gastrointestinal architecture are common during the weaning transition of pigs. The relation between villous atrophy and epithelial barrier function at weaning is not well understood. This study evaluated in vitro transepithelial transport by Ussing metabolic chambers,

Mendelian randomization analysis of a time-varying exposure for binary disease outcomes using functional data analysis methods.

Science.gov (United States)

Cao, Ying; Rajan, Suja S; Wei, Peng

2016-12-01

A Mendelian randomization (MR) analysis is performed to analyze the causal effect of an exposure variable on a disease outcome in observational studies, by using genetic variants that affect the disease outcome only through the exposure variable. This method has recently gained popularity among epidemiologists given the success of genetic association studies. Many exposure variables of interest in epidemiological studies are time varying, for example, body mass index (BMI). Although longitudinal data have been collected in many cohort studies, current MR studies only use one measurement of a time-varying exposure variable, which cannot adequately capture the long-term time-varying information. We propose using the functional principal component analysis method to recover the underlying individual trajectory of the time-varying exposure from the sparsely and irregularly observed longitudinal data, and then conduct MR analysis using the recovered curves. We further propose two MR analysis methods. The first assumes a cumulative effect of the time-varying exposure variable on the disease risk, while the second assumes a time-varying genetic effect and employs functional regression models. We focus on statistical testing for a causal effect. Our simulation studies mimicking the real data show that the proposed functional data analysis based methods incorporating longitudinal data have substantial power gains compared to standard MR analysis using only one measurement. We used the Framingham Heart Study data to demonstrate the promising performance of the new methods as well as inconsistent results produced by the standard MR analysis that relies on a single measurement of the exposure at some arbitrary time point. © 2016 WILEY PERIODICALS, INC.

Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function

DEFF Research Database (Denmark)

Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis

2013-01-01

antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...

Simulations of skin barrier function: free energies of hydrophobic and hydrophilic transmembrane pores in ceramide bilayers.

Science.gov (United States)

Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K

2008-11-15

Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.

Functional Food Market Development in Serbia: Motivations and Barriers

Directory of Open Access Journals (Sweden)

Žaklina Stojanović

2013-11-01

Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.

Vehicle barrier systems

International Nuclear Information System (INIS)

Sena, P.A.

1986-01-01

The ground vehicle is one of the most effective tools available to an adversary force. Vehicles can be used to penetrate many types of perimeter barriers, transport equipment and personnel rapidly over long distances, and deliver large amounts of explosives directly to facilities in suicide missions. The function of a vehicle barrier system is to detain or disable a defined threat vehicle at a selected distance from a protected facility. Numerous facilities are installing, or planning to install, vehicle barrier systems and many of these facilities are requesting guidance to do so adequately. Therefore, vehicle barriers are being evaluated to determine their stopping capabilities so that systems can be designed that are both balanced and capable of providing a desired degree of protection. Equally important, many of the considerations that should be taken into account when establishing a vehicle barrier system have been identified. These considerations which pertain to site preparation, barrier selection, system integration and operation, and vehicle/barrier interaction, are discussed in this paper

Experimental fusion excitation functions and derived barrier distributions for heavy ion systems involving prolate and oblate target nuclei

International Nuclear Information System (INIS)

Bierman, J.D.; Chan, P.; Liang, J.F.; Kelly, M.P.; Sonzogni, A.A.; Vandenbosch, R.

1996-01-01

Fusion excitation functions spanning the entire barrier region in 1 MeV energy steps for the two systems 40 Ca + 192 Os, 194 Pt are presented. The results of fission fragment angular distribution measurements for fusion-fission of 40 Ca + 197 Au at several projectile energies within the barrier region are also presented. The fusion data is of high enough precision to allow for extraction of the distribution of fusion barriers from the second differential of the product of E and σ. Basic coupled channels calculations which are in quite good agreement with the data are shown and discussed

How hormones influence composition and physiological function of the brain-blood barrier.

Science.gov (United States)

Hampl, R; Bičíková, M; Sosvorová, L

2015-01-01

Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.

A Lactobacillus mutant capable of accumulating long-chain polyphosphates that enhance intestinal barrier function.

Science.gov (United States)

Saiki, Asako; Ishida, Yasuaki; Segawa, Shuichi; Hirota, Ryuichi; Nakamura, Takeshi; Kuroda, Akio

2016-05-01

Inorganic polyphosphate (polyP) was previously identified as a probiotic-derived substance that enhances intestinal barrier function. PolyP-accumulating bacteria are expected to have beneficial effects on the human gastrointestinal tract. In this study, we selected Lactobacillus paracasei JCM 1163 as a strain with the potential to accumulate polyP, because among the probiotic bacteria stored in our laboratory, it had the largest amount of polyP. The chain length of polyP accumulated in L. paracasei JCM 1163 was approximately 700 phosphate (Pi) residues. L. paracasei JCM 1163 accumulated polyP when Pi was added to Pi-starved cells. We further improved the ability of L. paracasei JCM 1163 to accumulate polyP by nitrosoguanidine mutagenesis. The mutant accumulated polyP at a level of 1500 nmol/mg protein-approximately 190 times that of the wild-type strain. PolyP extracted from the L. paracasei JCM 1163 significantly suppressed the oxidant-induced intestinal permeability in mouse small intestine. In conclusion, we have succeeded in breeding the polyP-accumulating Lactobacillus mutant that is expected to enhance intestinal barrier function.

Emotion regulation ability varies in relation to intrinsic functional brain architecture.

Science.gov (United States)

Uchida, Mai; Biederman, Joseph; Gabrieli, John D E; Micco, Jamie; de Los Angeles, Carlo; Brown, Ariel; Kenworthy, Tara; Kagan, Elana; Whitfield-Gabrieli, Susan

2015-12-01

This study investigated the neural basis of individual variation in emotion regulation, specifically the ability to reappraise negative stimuli so as to down-regulate negative affect. Brain functions in young adults were measured with functional Magnetic Resonance Imaging during three conditions: (i) attending to neutral pictures; (ii) attending to negative pictures and (iii) reappraising negative pictures. Resting-state functional connectivity was measured with amygdala and dorsolateral prefrontal cortical (DLPFC) seed regions frequently associated with emotion regulation. Participants reported more negative affect after attending to negative than neutral pictures, and less negative affect following reappraisal. Both attending to negative vs neutral pictures and reappraising vs attending to negative pictures yielded widespread activations that were significantly right-lateralized for attending to negative pictures and left-lateralized for reappraising negative pictures. Across participants, more successful reappraisal correlated with less trait anxiety and more positive daily emotion, greater activation in medial and lateral prefrontal regions, and lesser resting-state functional connectivity between (a) right amygdala and both medial prefrontal and posterior cingulate cortices, and (b) bilateral DLPFC and posterior visual cortices. The ability to regulate emotion, a source of resilience or of risk for distress, appears to vary in relation to differences in intrinsic functional brain architecture. © The Author (2015). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Chronic liver injury in mice promotes impairment of skin barrier function via tumor necrosis factor-alpha.

Science.gov (United States)

Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya

2016-09-01

Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.

Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

Science.gov (United States)

Chaudhuri, R K; Bojanowski, K

2017-10-01

The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Intestinal infection with Giardia spp. reduces epithelial barrier function in a myosin light chain kinase-dependent fashion.

Science.gov (United States)

Scott, Kevin G-E; Meddings, Jonathon B; Kirk, David R; Lees-Miller, Susan P; Buret, André G

2002-10-01

Giardiasis causes malabsorptive diarrhea, and symptoms can be present in the absence of any significant morphologic injury to the intestinal mucosa. The effects of giardiasis on epithelial permeability in vivo remain unknown, and the role of T cells and myosin light chain kinase (MLCK) in altered intestinal barrier function is unclear. This study was conducted to determine whether Giardia spp. alters intestinal permeability in vivo, to assess whether these abnormalities are dependent on T cells, and to assess the role of MLCK in altered epithelial barrier function. Immunocompetent and isogenic athymic mice were inoculated with axenic Giardia muris trophozoites or sterile vehicle (control), then assessed for trophozoite colonization and gastrointestinal permeability. Mechanistic studies using nontransformed human duodenal epithelial monolayers (SCBN) determined the effects of Giardia on myosin light chain (MLC) phosphorylation, transepithelial fluorescein isothiocyanate-dextran fluxes, cytoskeletal F-actin, tight junctional zonula occludens-1 (ZO-1), and MLCK. Giardia infection caused a significant increase in small intestinal, but not gastric or colonic, permeability that correlated with trophozoite colonization in both immunocompetent and athymic mice. In vitro, Giardia increased permeability and phosphorylation of MLC and reorganized F-actin and ZO-1. These alterations were abolished with an MLCK inhibitor. Disruption of small intestinal barrier function is T cell independent, disappears on parasite clearance, and correlates with reorganization of cytoskeletal F-actin and tight junctional ZO-1 in an MLCK-dependent fashion.

Beta dosimetry with surface barrier detectors

International Nuclear Information System (INIS)

Heinzelmann, M.F.M.; Schuren, H.; Dreesen, K.

1980-01-01

A small dosimeter to measure the dose rate due to β-radiation in an energy independent fashion is described in detail. A surface barrier semi-conductor detector is used whose thickness of sensitive layer is changed by varying the detector voltage. The integral count rate can then be determined as a function of applied voltage and discrimination thresholds. The integral count rate can be related to β dose rate in an energy independent fashion only for a time constant of 0.25 μs. However, the use of a single channel analyzer permits an energy-independent determination of the β-dose rate with 0.25 or 0.5 μs time constants. The sensitivity of the device as a function of dose rate is investigation up to 600 rad/hr. Furthermore, the sensitivity of the device at a constant dose rate was shown to be uniform up to a dose of 50,000 rads. (UK)

Therapeutic benefits of enhancing permeability barrier for atopic eczema

Directory of Open Access Journals (Sweden)

George Man

2015-06-01

Full Text Available The regulatory role of epidermal permeability barrier function in cutaneous inflammation has been well appreciated. While barrier disruption induces cutaneous inflammation, improvement of permeability barrier function alleviates inflammation. Studies have demonstrated that improvement of epidermal permeability barrier function not only prevents the development of atopic eczema, but also delays the relapse of these diseases. Moreover, enhancing the epidermal permeability barrier also alleviates atopic eczema. Furthermore, co-applications of barrier enhancing products with glucocorticoids can increase the therapeutic efficacy and reduce the adverse effects of glucocorticoids in the treatment of atopic eczema. Therefore, utilization of permeability barrier enhancing products alone or in combination with glucocorticoids could be a valuable approach in the treatment of atopic eczema. In this review, we discuss the benefits of improving the epidermal permeability barrier in the management of atopic eczema.

Zonulin, a regulator of epithelial and endothelial barrier functions, and its involvement in chronic inflammatory diseases.

Science.gov (United States)

Sturgeon, Craig; Fasano, Alessio

2016-01-01

Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.

Use of element model to evaluate transmissibility reduction due to barriers

Energy Technology Data Exchange (ETDEWEB)

Svanes, T.; South, D.; Dronen, O.M. [Statoil, Bergen (Norway)

1997-08-01

Water breakthrough has been observed a year earlier than expected in the productive Oseberg Formation in the Veslefrikk Field. Production data revealed extensive water override, whereas the opposite situation was expected based on a homogeneous and coarse flow simulation model. A new model was developed to include geological heterogeneities using a simple upscaling method. The Oseberg Fm. consists of an upper homogeneous unit (zone 2) and a lower unit containing thin barriers of shale and calcite cemented sandstone (zone 1). The barrier content varies laterally. When barriers are distributed in a complex 3D pattern, they reduce the upscaled horizontal transmissibility more than what is obtained by multiplying the sand permeability by the net-to-gross ratio (N/G). However, the transmissibility reduction strongly depends on the spatial distribution of barriers and their geometry. Therefore, a fine scale element model was used to derive the average transmissibility reduction as a function of N/G for alternative geological descriptions of the barriers. A geo-statistical method called General Marked Point Process was used to generate the fine scale descriptions. This work has resulted in a simple upscaling routine for horizontal transmissibility, which represents an effective bridge between geological evaluation of uncertainties and fluid flow simulation. The method combines geo-statistical and deterministic modelling in an elegant manner, recognising that most often these methods complement one another.

Caspase-14 Expression Impairs Retinal Pigment Epithelium Barrier Function: Potential Role in Diabetic Macular Edema

Directory of Open Access Journals (Sweden)

Selina Beasley

2014-01-01

Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.

Measuring solvent barrier properties of paper

International Nuclear Information System (INIS)

Bollström, Roger; Saarinen, Jarkko J; Toivakka, Martti; Räty, Jukka

2012-01-01

New methods for measuring barrier properties against solvents, acids and bases on dispersion coated paper were developed and investigated. Usability, reliability and repeatability were compared both between the new methods and with the standardized method for measuring barrier properties against water vapor. Barrier properties could be measured with all methods and the results obtained by the different methods were in correlation with each other. A qualitative method based on a trace color provided an indicative result, whereas further developed methods also took into account the durability. The effective barrier lifetime could be measured by measuring the conductivity through the substrate as a function of time, or by utilizing a glass prism where the change in refractive index caused by penetrated liquid was monitored, also as a function of time. Barrier properties against water and humidity were also measured and were found not to be predictors for barrier properties against either solvents, or acids or bases, which supports the need to develop new methods

Curcumin-mediated regulation of intestinal barrier function: The mechanism underlying its beneficial effects.

Science.gov (United States)

Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha

2018-01-02

Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.

Fission excitation function for 19F + 194,196,198Pt at near and above barrier energies

Directory of Open Access Journals (Sweden)

Singh Varinderjit

2015-01-01

Full Text Available Fission excitation functions for 19F + 194,196,198Pt reactions populating 213,215,217Fr compound nuclei are reported. Out of these three compound nuclei, 213Fr is a shell closed (N=126 compound nucleus and the other two are away from the shell closure. From a comparison of the experimental fission cross-sections with the statistical model predictions, it is observed that the fission cross-sections are underestimated by the statistical model predictions using shell corrected finite range rotating liquid drop model (FRLDM fission barriers. Further the FRLDM fission barriers are reduced to fit the fission cross-sections over the entire measured energy range.

Emotional functioning, barriers, and medication adherence in pediatric transplant recipients.

Science.gov (United States)

McCormick King, Megan L; Mee, Laura L; Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Blount, Ronald L

2014-04-01

This study assessed relationships among internalizing symptoms, barriers to medication adherence, and medication adherence in adolescents with solid organ transplants. The sample included 72 adolescents who had received solid organ transplants. Multiple mediator models were tested via bootstrapping methods. Bivariate correlations revealed significant relationships between barriers and internalizing symptoms of depression, anxiety, and posttraumatic stress, as well as between internalizing symptoms and medication adherence. Barriers indicative of adaptation to the medication regimen (e.g., forgetting, lack of organization) were related to medication adherence and mediated the relationship between internalizing symptoms and medication adherence. These findings indicate that barriers may serve as a more specific factor in the relationship between more general, pervasive internalizing symptoms and medication adherence. Results may help guide areas for clinical assessment, and the focus of interventions for adolescent transplant recipients who are experiencing internalizing symptoms and/or who are nonadherent to their medication regimen.

Alteration of intestinal barrier function during activity-based anorexia in mice.

Science.gov (United States)

Jésus, Pierre; Ouelaa, Wassila; François, Marie; Riachy, Lina; Guérin, Charlène; Aziz, Moutaz; Do Rego, Jean-Claude; Déchelotte, Pierre; Fetissov, Sergueï O; Coëffier, Moïse

2014-12-01

Anorexia nervosa is a severe eating disorder often leading to malnutrition and cachexia, but its pathophysiology is still poorly defined. Chronic food restriction during anorexia nervosa may induce gut barrier dysfunction, which may contribute to disease development and its complications. Here we have characterized intestinal barrier function in mice with activity-based anorexia (ABA), an animal model of anorexia nervosa. Male C57Bl/6 ABA or limited food access (LFA) mice were placed respectively in cages with or without activity wheel. After 5 days of acclimatization, both ABA and LFA mice had progressively limited access to food from 6 h/d at day 6 to 3 h/d at day 9 and until the end of experiment at day 17. A group of pair-fed mice (PF) was also compared to ABA. On day 17, food intake was lower in ABA than LFA mice (2.0 ± 0.18 g vs. 3.0 ± 0.14 g, p anorexia nervosa. The role of these alterations in the pathophysiology of anorexia nervosa should be further evaluated. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Brain barriers and functional interfaces with sequential appearance of ABC efflux transporters during human development

DEFF Research Database (Denmark)

Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.

2017-01-01

Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....

Mitigation of Traffic-Induced Ground Vibration by Inclined Wave Barriers

DEFF Research Database (Denmark)

Andersen, Lars; Augustesen, Anders Hust

2009-01-01

Double sheet pile walls can be used as wave barriers in order to mitigate ground vibrations from railways. The present analysis concerns the efficiency of such barriers, especially with regard to the influence of the barrier inclination and the backfill between the walls. Thus, the screening capa...... of reference following the load. This allows a computation of the steady state response to a harmonically varying point source moving at different speeds typical for a train....

The blood-brain barrier in migraine treatment

DEFF Research Database (Denmark)

Edvinsson, L; Tfelt-Hansen, P

2008-01-01

Salient aspects of the anatomy and function of the blood-barrier barrier (BBB) are reviewed in relation to migraine pathophysiology and treatment. The main function of the BBB is to limit the access of circulating substances to the neuropile. Smaller lipophilic substances have some access...

Fabrication of High Gas Barrier Epoxy Nanocomposites: An Approach Based on Layered Silicate Functionalized by a Compatible and Reactive Modifier of Epoxy-Diamine Adduct

Directory of Open Access Journals (Sweden)

Ran Wei

2018-05-01

Full Text Available To solve the drawbacks of poor dispersion and weak interface in gas barrier nanocomposites, a novel epoxy-diamine adduct (DDA was synthesized by reacting epoxy monomer DGEBA with curing agent D400 to functionalize montmorillonite (MMT, which could provide complete compatibility and reactivity with a DGEBA/D400 epoxy matrix. Thereafter, sodium type montmorillonite (Na-MMT and organic-MMTs functionalized by DDA and polyether amines were incorporated with epoxy to manufacture nanocomposites. The effects of MMT functionalization on the morphology and gas barrier property of nanocomposites were evaluated. The results showed that DDA was successfully synthesized, terminating with epoxy and amine groups. By simulating the small-angle neutron scattering data with a sandwich structure model, the optimal dispersion/exfoliation of MMT was observed in a DDA-MMT/DGEBA nanocomposite with a mean radius of 751 Å, a layer thickness of 30.8 Å, and only two layers in each tactoid. Moreover, the DDA-MMT/DGEBA nanocomposite exhibited the best N2 barrier properties, which were about five times those of neat epoxy. Based on a modified Nielsen model, it was clarified that this excellent gas barrier property was due to the homogeneously dispersed lamellas with almost exfoliated structures. The improved morphology and barrier property confirmed the superiority of the adduct, which provides a general method for developing gas barrier nanocomposites.

Multistability of neural networks with discontinuous non-monotonic piecewise linear activation functions and time-varying delays.

Science.gov (United States)

Nie, Xiaobing; Zheng, Wei Xing

2015-05-01

This paper is concerned with the problem of coexistence and dynamical behaviors of multiple equilibrium points for neural networks with discontinuous non-monotonic piecewise linear activation functions and time-varying delays. The fixed point theorem and other analytical tools are used to develop certain sufficient conditions that ensure that the n-dimensional discontinuous neural networks with time-varying delays can have at least 5(n) equilibrium points, 3(n) of which are locally stable and the others are unstable. The importance of the derived results is that it reveals that the discontinuous neural networks can have greater storage capacity than the continuous ones. Moreover, different from the existing results on multistability of neural networks with discontinuous activation functions, the 3(n) locally stable equilibrium points obtained in this paper are located in not only saturated regions, but also unsaturated regions, due to the non-monotonic structure of discontinuous activation functions. A numerical simulation study is conducted to illustrate and support the derived theoretical results. Copyright © 2015 Elsevier Ltd. All rights reserved.

Socio-demographic and behavioral variation in barriers to leisure-time physical activity.

Science.gov (United States)

Borodulin, Katja; Sipilä, Noora; Rahkonen, Ossi; Leino-Arjas, Päivi; Kestilä, Laura; Jousilahti, Pekka; Prättälä, Ritva

2016-02-01

We examined the socio-demographic and behavioral determinants of perceived barriers to leisure-time physical activity (LTPA) in a population-based sample of working-aged adults. Data comprised the National FINRISK 2002 Study, a population-based health examination study. Analyses were restricted to those aged 25-64 years and who perceived that their amount of LTPA did not reach sufficient levels. They reported barriers to LTPA, defined as a lack of time, motivation and lack of companionship to be active with, as well as high expenses. Age, education, household income, employment status, family type, physical activity, smoking and body mass index (BMI) were included as explanatory variables. Lack of time was the most frequent barrier. Each barrier was explained by a different set of factors that also varied between genders. The strongest and most systematic associations with the barriers were found for age, employment status and family type. Lack of time was less often reported as a barrier among the unemployed, singles without children and older people. Lacking motivation as a barrier was most common among singles without children. High expenses as a barrier was more often reported by the unemployed, and less often reported in the highest income group. When considering actions to promote LTPA, there is not one single solution, because the perceived barriers vary by population subgroups. © 2015 the Nordic Societies of Public Health.

Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

Science.gov (United States)

Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

2017-08-01

Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

Time evolution of the Clay Barrier Chemistry in a HLW deep geological disposal in granite

International Nuclear Information System (INIS)

Font, I.; Miguel, M. J.; Juncosa, R.

2000-01-01

The main goal of a high level waste geological disposal is to guarantee the waste isolation from the biosphere, locking them away into very deep geological formations. The best way to assure the isolation is by means of a multiple barrier system. These barriers, in a serial disposition, should assure the confinement function of the disposal system. Two kinds of barriers are considered: natural barriers (geological formations) and engineered barriers (waste form, container and backfilling and sealing materials). Bentonite is selected as backfilling and sealing materials for HLW disposal into granite formations, due to its very low permeability and its ability to fill the remaining spaces. bentonite has also other interesting properties, such as, the radionuclide retention capacity by sorption processes. Once the clay barrier has been placed, the saturation process starts. The granite groundwater fills up the voids of the bentonite and because of the chemical interactions, the groundwater chemical composition varies. Near field processes, such as canister corrosion, waste leaching and radionuclide release, strongly depends on the water chemical composition. Bentonite pore water composition is such a very important feature of the disposal system and its determination and its evolution have great relevance in the HLW deep geological disposal performance assessment. The process used for the determination of the clay barrier pore water chemistry temporal evolution, and its influence on the performance assessment, are presented in this paper. (Author)

Effects of Lactobacillus johnsonii and Lactobacillus reuteri on gut barrier function and heat shock proteins in intestinal porcine epithelial cells.

Science.gov (United States)

Liu, Hao-Yu; Roos, Stefan; Jonsson, Hans; Ahl, David; Dicksved, Johan; Lindberg, Jan Erik; Lundh, Torbjörn

2015-04-01

Heat shock proteins (HSPs) are a set of highly conserved proteins that can serve as intestinal gate keepers in gut homeostasis. Here, effects of a probiotic, Lactobacillus rhamnosus GG (LGG), and two novel porcine isolates, Lactobacillus johnsonii strain P47-HY and Lactobacillus reuteri strain P43-HUV, on cytoprotective HSP expression and gut barrier function, were investigated in a porcine IPEC-J2 intestinal epithelial cell line model. The IPEC-J2 cells polarized on a permeable filter exhibited villus-like cell phenotype with development of apical microvilli. Western blot analysis detected HSP expression in IPEC-J2 and revealed that L. johnsonii and L. reuteri strains were able to significantly induce HSP27, despite high basal expression in IPEC-J2, whereas LGG did not. For HSP72, only the supernatant of L. reuteri induced the expression, which was comparable to the heat shock treatment, which indicated that HSP72 expression was more stimulus specific. The protective effect of lactobacilli was further studied in IPEC-J2 under an enterotoxigenic Escherichia coli (ETEC) challenge. ETEC caused intestinal barrier destruction, as reflected by loss of cell-cell contact, reduced IPEC-J2 cell viability and transepithelial electrical resistance, and disruption of tight junction protein zonula occludens-1. In contrast, the L. reuteri treatment substantially counteracted these detrimental effects and preserved the barrier function. L. johnsonii and LGG also achieved barrier protection, partly by directly inhibiting ETEC attachment. Together, the results indicate that specific strains of Lactobacillus can enhance gut barrier function through cytoprotective HSP induction and fortify the cell protection against ETEC challenge through tight junction protein modulation and direct interaction with pathogens. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Collaborative learning to unlock investments for functional ecological infrastructure: Bridging barriers in social-ecological systems in South Africa

CSIR Research Space (South Africa)

Angelstam, P

2017-05-01

Full Text Available . Based on expert knowledge at three scales, we analysed South Africa's opportunity to active adaptive management and to unlock investments that enhance functional ecological infrastructure. Barriers included lack of trust among actors, limited...

Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

Science.gov (United States)

van Smeden, Jeroen; Bouwstra, Joke A

2016-01-01

Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

Composite of microgels and lipids as biofilm to restore skin barrier function

NARCIS (Netherlands)

Oudshoorn, M.H.M.

2008-01-01

The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

Devices for overcoming biological barriers: the use of physical forces to disrupt the barriers.

Science.gov (United States)

Mitragotri, Samir

2013-01-01

Overcoming biological barriers including skin, mucosal membranes, blood brain barrier as well as cell and nuclear membrane constitutes a key hurdle in the field of drug delivery. While these barriers serve the natural protective function in the body, they limit delivery of drugs into the body. A variety of methods have been developed to overcome these barriers including formulations, targeting peptides and device-based technologies. This review focuses on the use of physical methods including acoustic devices, electric devices, high-pressure devices, microneedles and optical devices for disrupting various barriers in the body including skin and other membranes. A summary of the working principles of these devices and their ability to enhance drug delivery is presented. Copyright © 2012. Published by Elsevier B.V.

Impedance analysis of GPCR-mediated changes in endothelial barrier function: overview and fundamental considerations for stable and reproducible measurements.

Science.gov (United States)

Stolwijk, Judith A; Matrougui, Khalid; Renken, Christian W; Trebak, Mohamed

2015-10-01

The past 20 years has seen significant growth in using impedance-based assays to understand the molecular underpinning of endothelial and epithelial barrier function in response to physiological agonists and pharmacological and toxicological compounds. Most studies on barrier function use G protein-coupled receptor (GPCR) agonists which couple to fast and transient changes in barrier properties. The power of impedance-based techniques such as electric cell-substrate impedance sensing (ECIS) resides in its ability to detect minute changes in cell layer integrity label-free and in real-time ranging from seconds to days. We provide a comprehensive overview of the biophysical principles, applications, and recent developments in impedance-based methodologies. Despite extensive application of impedance analysis in endothelial barrier research, little attention has been paid to data analysis and critical experimental variables, which are both essential for signal stability and reproducibility. We describe the rationale behind common ECIS data presentation and interpretation and illustrate practical guidelines to improve signal intensity by adapting technical parameters such as electrode layout, monitoring frequency, or parameter (resistance versus impedance magnitude). Moreover, we discuss the impact of experimental parameters, including cell source, liquid handling, and agonist preparation on signal intensity and kinetics. Our discussions are supported by experimental data obtained from human microvascular endothelial cells challenged with three GPCR agonists, thrombin, histamine, and sphingosine-1-phosphate.

Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.

Science.gov (United States)

Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T

2012-01-01

Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.

Information barriers

International Nuclear Information System (INIS)

Fuller, J.L.; Wolford, J.

2001-01-01

Full text: An information barrier (IB) consists of procedures and technology that prevent the release of sensitive information during a joint inspection of a sensitive nuclear item, and provides confidence that the measurement system into which it has been integrated functions exactly as designed and constructed. Work in the U.S. on radiation detection system information barriers dates back at least to 1990, even though the terminology is more recent. In January 1999 the Joint DoD-DOE Information Barrier Working Group was formed in the United States to help coordinate technical efforts related to information barrier R and D. This paper presents an overview of the efforts of this group, by its Chairs, as well as recommendations for further information barrier R and D. Progress on the demonstration of monitoring systems containing IBs is also provided. From the U.S. perspective, the basic, top-level functional requirements for the information barrier portion of an integrated radiation signature-information barrier inspection system are twofold: The host must be assured that his classified information is protected from disclosure to the inspecting party; and The inspecting party must be confident that the integrated inspection system measures, processes, and presents the radiation-signature-based measurement conclusion in an accurate and reproducible manner. It is the position of the United States that in the absence of any agreement to share classified nuclear weapons design information in the conduct of an inspection regime, the requirement to protect host country classified warhead design information is paramount and admits no tradeoff versus the confidence provided to the inspecting party in the accuracy and reproducibility of the measurements. The U.S. has reached an internal consensus on several critical design elements that define a general standard for radiation signature information barrier design. These criteria have stood the test of time under intense

Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

Science.gov (United States)

Liu, Xinxin; Zheng, Wei; Sivasankar, M Preeti

2016-01-01

Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3) expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001). Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (pacrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (pacrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

Barrier Systems

NARCIS (Netherlands)

Heteren, S. van

2015-01-01

Barrier-system dynamics are a function of antecedent topography and substrate lithology, Relative sea-level (RSL) changes, sediment availability and type, climate, vegetation type and cover, and various aero- and hydrodynamic processes during fair-weather conditions and extreme events. Global change

Elucidation of the Synthetic Mechanism of Acylceramide, an Essential Lipid for Skin Barrier Function.

Science.gov (United States)

Ohno, Yusuke

2017-01-01

The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.

The performance of the backpropagation algorithm with varying slope of the activation function

International Nuclear Information System (INIS)

Bai Yanping; Zhang Haixia; Hao Yilong

2009-01-01

Some adaptations are proposed to the basic BP algorithm in order to provide an efficient method to non-linear data learning and prediction. In this paper, an adopted BP algorithm with varying slope of activation function and different learning rates is put forward. The results of experiment indicated that this algorithm can get very good performance of training. We also test the prediction performance of our adopted BP algorithm on 16 instances. We compared the test results to the ones of the BP algorithm with gradient descent momentum and an adaptive learning rate. The results indicate this adopted BP algorithm gives best performance (100%) for test example, which conclude this adopted BP algorithm produces a smoothed reconstruction that learns better to new prediction function values than the BP algorithm improved with momentum.

Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis.

Science.gov (United States)

Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

2017-08-01

Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Functional and structural alterations of epithelial barrier properties of rat ileum following X-irradiation

International Nuclear Information System (INIS)

Dublineau, I.; Lebrun, F.; Grison, S.; Griffiths, N.M.

2004-01-01

Irradiation of the digestive system leads to alterations of the small intestine. We have characterized the disruption of the barrier integrity in rat ileum from 1 to 14 days following irradiation ranging from 6 to 12 Gy. The intestinal permeability to 14 C-mannitol and 3 H-dextran 70,000 was measured in vitro in Ussing chambers. In parallel to these functional studies, immunohistochemical analyses of junctional proteins (ZO-1 and β-catenin) of ileal epithelium were performed by confocal microscopy. Irradiation with 10 Gy induced a marked decrease in epithelial tissue resistance at three days and a fivefold increase in mannitol permeability, without modifications of dextran permeability. A disorganization of the localization for ZO-1 and β-catenin was also observed. At 7 days after irradiation, we observed a recovery of the organization of junctional proteins in parallel to a return of intestinal permeability to control value. In addition to these time-dependent effects, a gradual effect on epithelial integrity of the radiation doses was observed 3 days after irradiation. This study shows a disruption of the integrity of the intestinal barrier in rat ileum following abdominal X-irradiation, depending on the time postirradiation and on the delivered dose. The loss of barrier integrity was characterized by a disorganization of proteins of tight and adherent junctions, leading to increased intestinal permeability to mannitol. (author)

Fusion barrier distributions from capture and quasi-elastic excitation functions measured in reaction 36S, 48Ca, 64Ni+238U

International Nuclear Information System (INIS)

Kozulin, E. M.

2009-01-01

The subbarrier fusion enhancement in reactions with heavy ions were explained by taking into account coupling between relative motion and intrinsic degrees of freedom of interacting nuclei. The coupling of reaction channels manifests itself in the potential barrier between interacting nuclei giving rise to a distribution of fusion barrier instead of single barrier.Capture and quasi-elastic scattering excitation functions at backward angles were measured for 3 6S , 4 8C a, 6 4N i+2 38U reactions systems at energies close and below the Coulomb barrier (i.e. when the influence of the shell effects on the fusion and characteristics of the decay of the composite system is considerable). Representations of the barrier distributions were extracted from both capture and quasi-elastic data. The experimental representations of barrier distributions were compared with coupled-channel calculations using CCFULL code. The major part of these experiments has been performed at the U-400 accelerator of the Flerov Laboratory of Nuclear Reactions (JINR, Dubna); at the TANDEM-ALPI accelerator of the LNL (INFN, Legnaro, Italy) and at the Accelerator Laboratory of University of Jyvaeskylae (JYFL, Finland) using a time-of-flight spectrometer of fission fragments CORSET (CORrelation SET-up.) The extraction of the masses and Total Kinetic Energy (TKE) of the binary reaction products is based upon the analysis of the two-body velocity In the case of the fusion-fission and quasi-fission processes, the observed peculiarities of mass and energy distributions of the fragments, the ratio between the fusion-fission and quasi-fission cross sections are determined deformations of interaction nuclei and angular momentum carried in the di-nuclear system and the shell structure of the formed fragments. In this work, the high-precision capture and quasi-elastic scattering excitation function data are presented.The influence of projectile and target excitations and nucleon transfer on fusion barrier

Employment status, employment functioning, and barriers to employment among VA primary care patients.

Science.gov (United States)

Zivin, Kara; Yosef, Matheos; Levine, Debra S; Abraham, Kristen M; Miller, Erin M; Henry, Jennifer; Nelson, C Beau; Pfeiffer, Paul N; Sripada, Rebecca K; Harrod, Molly; Valenstein, Marcia

2016-03-15

Prior research found lower employment rates among working-aged patients who use the VA than among non-Veterans or Veterans who do not use the VA, with the lowest reported employment rates among VA patients with mental disorders. This study assessed employment status, employment functioning, and barriers to employment among VA patients treated in primary care settings, and examined how depression and anxiety were associated with these outcomes. The sample included 287 VA patients treated in primary care in a large Midwestern VA Medical Center. Bivariate and multivariable analyses were conducted examining associations between socio-demographic and clinical predictors of six employment domains, including: employment status, job search self-efficacy, work performance, concerns about job loss among employed Veterans, and employment barriers and likelihood of job seeking among not employed Veterans. 54% of respondents were employed, 36% were not employed, and 10% were economically inactive. In adjusted analyses, participants with depression or anxiety (43%) were less likely to be employed, had lower job search self-efficacy, had lower levels of work performance, and reported more employment barriers. Depression and anxiety were not associated with perceived likelihood of job loss among employed or likelihood of job seeking among not employed. Single VA primary care clinic; cross-sectional study. Employment rates are low among working-aged VA primary care patients, particularly those with mental health conditions. Offering primary care interventions to patients that address mental health issues, job search self-efficacy, and work performance may be important in improving health, work, and economic outcomes. Published by Elsevier B.V.

Sex Differences in Financial Barriers and the Relationship to Recovery After Acute Myocardial Infarction

OpenAIRE

Beckman, Adam L.; Bucholz, Emily M.; Zhang, Weiwei; Xu, Xiao; Dreyer, Rachel P.; Strait, Kelly M.; Spertus, John A.; Krumholz, Harlan M.; Spatz, Erica S.

2016-01-01

Background Financial barriers to health care are associated with worse outcomes following acute myocardial infarction (AMI). Yet, it is unknown whether the prevalence of financial barriers and their relationship with post?AMI outcomes vary by sex among young adults. Methods and Results We assessed sex differences in patient?reported financial barriers among adults aged

Protective barrier development: Overview

International Nuclear Information System (INIS)

Wing, N.R.; Gee, G.W.

1990-01-01

Protective barrier and warning marker systems are being developed to isolate wastes disposed of near the earth's surface at the Hanford Site. The barrier is designed to function in an arid to semiarid climate, to limit infiltration and percolation of water through the waste zone to near-zero, to be maintenance free, and to last up to 10,000 yr. Natural materials (e.g., fine soil, sand, gravel, riprap, clay, asphalt) have been selected to optimize barrier performance and longevity and to create an integrated structure with redundant features. These materials isolate wastes by limiting water drainage; reducing the likelihood of plant, animal, and human intrusion; controlling emission of noxious gases; and minimizing erosion. Westinghouse Hanford Company and Pacific Northwest Laboratory efforts to assess the performance of various barrier and marker designs will be discussed

Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

DEFF Research Database (Denmark)

Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

2006-01-01

most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...

On the (DE-) stabilization of quantum mechanical binding by potential barriers

International Nuclear Information System (INIS)

Hogreve, H.

1994-04-01

Stabilization and destabilization effects caused by adding or rising a potential barrier are studied for a simple one-dimensional quantum system. Calculating the motion of the corresponding S-matrix poles for varying barrier width and height, this reveals the scenario for the transition between bound, virtual and resonance states. Our results show that the presence of a barrier leads to nonanalyticity of the ground state with respect to the involved coupling constants. Furthermore, for increasing barrier width the size of the virtual regime shrinks drastically, so that it might be hardly detectable in many practical situations. (author). 15 refs, 5 figs

Barriers and Facilitators to Implementing Functional Family Therapy in a Community Setting: Client and Practitioner Perspectives.

Science.gov (United States)

McPherson, Kerri E; Kerr, Susan; Casey, Beth; Marshall, John

2017-10-01

While Functional Family Therapy (FFT) is known to be effective in addressing adolescent behavioral problems, there has been little exploration of issues relevant to its transport from the tightly controlled setting of clinical trials into routine service delivery. This study sought the views of key stakeholders, clients, and practitioners, on barriers and facilitators to the successful implementation of FFT. Undertaken in a community setting in Scotland, interviews were carried out with 12 adolescents, 14 parents/caregivers, and 6 practitioners. Results focus on: Referral process and pre-intervention contact; Engagement of families; Structure and delivery; Organizational factors. Although barriers to engagement were identified, FFT was viewed as an acceptable, appropriate and feasible intervention with the potential to improve adolescent wellbeing in 'real-world' settings. © 2017 American Association for Marriage and Family Therapy.

An oncological view on the blood-testis barrier

NARCIS (Netherlands)

Bart, J; Groen, HJM; van der Graaf, WTA; Hollema, H; Hendrikse, NH; Vaalburg, W; Sleijfer, DT; de Vries, EGE

The function of the blood-testis barrier is to protect germ cells from harmful influences; thus, it also impedes the delivery of chemotherapeutic drugs to the testis. The barrier has three components: first, a physicochemical barrier consisting of continuous capillaries, Sertoli cells in the tubular

The functions of grainy head-like proteins in animals and fungi and the evolution of apical extracellular barriers.

Directory of Open Access Journals (Sweden)

Adam Paré

Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.

Mechanism of protection of transepithelial barrier function by Lactobacillus salivarius: strain dependence and attenuation by bacteriocin production.

Science.gov (United States)

Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W

2012-11-01

Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.

Tunnelling through a Gaussian random barrier

International Nuclear Information System (INIS)

Bezak, Viktor

2008-01-01

A thorough analysis of the tunnelling of electrons through a laterally inhomogeneous rectangular barrier is presented. The barrier height is defined as a statistically homogeneous Gaussian random function. In order to simplify calculations, we assume that the electron energy is low enough in comparison with the mean value of the barrier height. The randomness of the barrier height is defined vertically by a constant variance and horizontally by a finite correlation length. We present detailed calculations of the angular probability density for the tunnelled electrons (i.e. for the scattering forwards). The tunnelling manifests a remarkably diffusive character if the wavelength of the electrons is comparable with the correlation length of the barrier

Time-varying BRDFs.

Science.gov (United States)

Sun, Bo; Sunkavalli, Kalyan; Ramamoorthi, Ravi; Belhumeur, Peter N; Nayar, Shree K

2007-01-01

The properties of virtually all real-world materials change with time, causing their bidirectional reflectance distribution functions (BRDFs) to be time varying. However, none of the existing BRDF models and databases take time variation into consideration; they represent the appearance of a material at a single time instance. In this paper, we address the acquisition, analysis, modeling, and rendering of a wide range of time-varying BRDFs (TVBRDFs). We have developed an acquisition system that is capable of sampling a material's BRDF at multiple time instances, with each time sample acquired within 36 sec. We have used this acquisition system to measure the BRDFs of a wide range of time-varying phenomena, which include the drying of various types of paints (watercolor, spray, and oil), the drying of wet rough surfaces (cement, plaster, and fabrics), the accumulation of dusts (household and joint compound) on surfaces, and the melting of materials (chocolate). Analytic BRDF functions are fit to these measurements and the model parameters' variations with time are analyzed. Each category exhibits interesting and sometimes nonintuitive parameter trends. These parameter trends are then used to develop analytic TVBRDF models. The analytic TVBRDF models enable us to apply effects such as paint drying and dust accumulation to arbitrary surfaces and novel materials.

Music therapists' research activity and utilization barriers: a survey of the membership.

Science.gov (United States)

Waldon, Eric G

2015-01-01

Music therapists have access to a rapidly expanding body of research supporting the use of music-based interventions. What is not known is the extent to which music therapists access these resources and what factors may prevent them from incorporating research findings into clinical work. After constructing the Music Therapists' Research Activity and Utilization Barrier (MTRAUB) database, the purposes of this study involved: assessing the extent to which American Music Therapy Association (AMTA) members engage in certain research-related activities; and identifying respondents' perceived barriers to integrating research into clinical practice. This study employed a quantitative, non-experimental approach using an online survey. Respondents included professional, associate, student/graduate student, retired, inactive, and honorary life members of AMTA. Instrumentation involved a researcher-designed Background Questionnaire as well as the Barriers to Research Utilization Scale (BARRIERS; Funk, Champagne, Wiese, & Tornquist, 1991), a tool designed to assess perceived barriers to incorporating research into practice. Of the 3,194 survey invitations distributed, 974 AMTA members replied (a response rate of 30%). Regarding research-related activities, descriptive findings indicate that journal reading is the most frequently reported research-related activity while conducting research is the least frequently reported activity. Results from the BARRIERS Scale indicated that Organizational and Communication factors are perceived as interfering most prominently with the ability to utilize research in clinical practice. Findings suggest that research-related activity and perceived barriers vary as a function of educational attainment, work setting, and occupational role. The author discusses these differential findings in detail, suggests supportive mechanisms to encourage increased research activity and utilization, and offers recommendations for further analysis of the

Atomistic modeling of the structural components of the blood-brain barrier

Science.gov (United States)

Glukhova, O. E.; Grishina, O. A.; Slepchenkov, M. M.

2015-03-01

Blood-brain barrier, which is a barrage system between the brain and blood vessels, plays a key role in the "isolation" of the brain of unnecessary information, and reduce the "noise" in the interneuron communication. It is known that the barrier function of the BBB strictly depends on the initial state of the organism and changes significantly with age and, especially in developing the "vascular accidents". Disclosure mechanisms of regulation of the barrier function will develop new ways to deliver neurotrophic drugs to the brain in the newborn. The aim of this work is the construction of atomistic models of structural components of the blood-brain barrier to reveal the mechanisms of regulation of the barrier function.

The pH-sensing receptor OGR1 improves barrier function of epithelial cells and inhibits migration in an acidic environment.

Science.gov (United States)

de Vallière, Cheryl; Vidal, Solange; Clay, Ieuan; Jurisic, Giorgia; Tcymbarevich, Irina; Lang, Silvia; Ludwig, Marie-Gabrielle; Okoniewski, Michal; Eloranta, Jyrki J; Kullak-Ublick, Gerd A; Wagner, Carsten A; Rogler, Gerhard; Seuwen, Klaus

2015-09-15

The pH-sensing receptor ovarian cancer G protein-coupled receptor 1 (OGR1; GPR68) is expressed in the gut. Inflammatory bowel disease is typically associated with a decrease in local pH, which may lead to altered epithelial barrier function and subsequent gastrointestinal repair involving epithelial cell adhesion and migration. As the mechanisms underlying the response to pH changes are not well understood, we have investigated OGR1-mediated, pH-dependent signaling pathways in intestinal epithelial cells. Caco-2 cells stably overexpressing OGR1 were created and validated as tools to study OGR1 signaling. Barrier function, migration, and proliferation were measured using electric cell-substrate impedance-sensing technology. Localization of the tight junction proteins zonula occludens protein 1 and occludin and the rearrangement of cytoskeletal actin were examined by confocal microscopy. Paracellular permeability and protein and gene expression analysis using DNA microarrays were performed on filter-grown Caco-2 monolayers. We report that an acidic pH shift from pH 7.8 to 6.6 improved barrier function and stimulated reorganization of filamentous actin with prominent basal stress fiber formation. Cell migration and proliferation during in vitro wound healing were inhibited. Gene expression analysis revealed significant upregulation of genes related to cytoskeleton remodeling, cell adhesion, and growth factor signaling. We conclude that acidic extracellular pH can have a signaling function and impact the physiology of intestinal epithelial cells. The deconstruction of OGR1-dependent signaling may aid our understanding of mucosal inflammation mechanisms. Copyright © 2015 the American Physiological Society.

Alterations in blood-brain barrier function following acute hypertension: comparison of the blood-to-brain transfer of horseradish peroxidase with that of alpha-aminisobutyric acid

International Nuclear Information System (INIS)

Ellison, M.D.B.

1985-01-01

The blood-brain barrier (BBB) selectively restricts the blood-to-brain passage of many solutes owing to unique properties of cerebrovascular endothelial cell membranes. To date, experimental study of the BBB has been accomplished primarily through the use of two different methodological approaches. Morphological studies have mostly employed large molecular weight (MW) tracers to detect morphological alterations underlying increased permeability. Physiological studies, employing smaller, more physiologic tracers have successfully described, quantitatively, certain functional aspects of blood-to-brain transfer. The current work attempts to merge these two approaches and to consider barrier function/dysfunction from both a morphological and a functional perspective. Specifically, the study compares in rats, following acute hypertension, the cerebrovascular passage of 14 C-alpha-aminoisobutyric acid (AIB) and that of horseradish peroxidase (HRP). The blood-to-brain passage of AIB and HRP were compared following acute hypertension, with regard to both the distributions of the tracer extravasation patterns and the magnitude of tracer extravasation. The results of this study suggest that traditional morphological barrier studies alone do not reveal all aspects of altered barrier status and that multiple mechanisms underlying increased BBB permeability may operate simultaneously during BBB dysfunction

Deposition and characterization of plasma sprayed Ni-5A1/ magnesia stabilized zirconia based functionally graded thermal barrier coating

International Nuclear Information System (INIS)

Baig, M N; Khalid, F A

2014-01-01

Thermal barrier coatings (TBCs) are employed to protect hot section components in industrial and aerospace gas turbine engines. Conventional TBCs frequently fail due to high residual stresses and difference between coefficient of thermal expansion (CTE) of the substrate and coatings. Functionally graded thermal barrier coatings (FG-TBCs) with gradual variation in composition have been proposed to minimize the problem. In this work, a five layered functionally graded thermal barrier coating system was deposited by atmospheric plasma spray (APS) technique on Nimonic 90 substrates using Ni-5Al as bond coat (BC) and magnesia stabilized zirconia as top coat (TC). The coatings were characterized by SEM, EDS, XRD and optical profilometer. Microhardness and coefficient of thermal expansion of the five layers deposited as individual coatings were also measured. The deposited coating system was oxidized at 800°C. SEM analysis showed that five layers were successfully deposited by APS to produce a FG-TBC. The results also showed that roughness (Ra) of the individual layers decreased with an increase in TC content in the coatings. It was found that microhardness and CTE values gradually changed from bond coat to cermet layers to top coat. The oxidized coated sample revealed parabolic behavior and changes in the surface morphology and composition of coating

Safety barriers on oil and gas platforms. Means to prevent hydrocarbon releases

Energy Technology Data Exchange (ETDEWEB)

Sklet, Snorre

2005-12-15

The main objective of the PhD project has been to develop concepts and methods that can be used to define, illustrate, analyse, and improve safety barriers in the operational phase of offshore oil and gas production platforms. The main contributions of this thesis are; Clarification of the term safety barrier with respect to definitions, classification, and relevant attributes for analysis of barrier performance Development and discussion of a representative set of hydrocarbon release scenarios Development and testing of a new method, BORA-Release, for qualitative and quantitative risk analysis of hydrocarbon releases Safety barriers are defined as physical and/or non-physical means planned to prevent, control, or mitigate undesired events or accidents. The means may range from a single technical unit or human actions, to a complex socio-technical system. It is useful to distinguish between barrier functions and barrier systems. Barrier functions describe the purpose of safety barriers or what the safety barriers shall do in order to prevent, control, or mitigate undesired events or accidents. Barrier systems describe how a barrier function is realized or executed. If the barrier system is functioning, the barrier function is performed. If a barrier function is performed successfully, it should have a direct and significant effect on the occurrence and/or consequences of an undesired event or accident. It is recommended to address the following attributes to characterize the performance of safety barriers; a) functionality/effectiveness, b) reliability/ availability, c) response time, d) robustness, and e) triggering event or condition. For some types of barriers, not all the attributes are relevant or necessary in order to describe the barrier performance. The presented hydrocarbon release scenarios include initiating events, barrier functions introduced to prevent hydrocarbon releases, and barrier systems realizing the barrier functions. Both technical and human

Protective barrier systems for final disposal of Hanford Waste Sites

International Nuclear Information System (INIS)

Phillips, S.J.; Hartley, J.N.

1986-01-01

A protecting barrier system is being developed for potential application in the final disposal of defense wastes at the Hanford Site. The functional requirements for the protective barrier are control of water infiltration, wind erosion, and plant and animal intrusion into the waste zone. The barrier must also be able to function without maintenance for the required time period (up to 10,000 yr). This paper summarizes the progress made and future plans in this effort to design and test protective barriers at the Hanford Site

Electron transmission through a periodically driven graphene magnetic barrier

Energy Technology Data Exchange (ETDEWEB)

Biswas, R., E-mail: rbiswas.pkc@gmail.com [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Maiti, S. [Ajodhya Hills G.S.A.T High School, Ajodhya, Purulia, West Bengal – 723152 (India); Mukhopadhyay, S. [Purulia Zilla School, Dulmi Nadiha, Purulia, West Bengal – 723102 (India); Sinha, C. [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Department of Theoretical Physics, Indian Association for the Cultivation of Science, Jadavpur – 700032 (India)

2017-05-10

Electronic transport through graphene magnetic barriers is studied theoretically in presence of an external time harmonic scalar potential in the framework of non-perturbative Landau–Floquet Formalism. The oscillating field mostly suppresses the transmission for rectangular magnetic barrier structure and exhibits the Fano resonance for multiphoton processes due to the presence of bound state inside the barrier. While, for a pair of delta function barriers of larger separation, the oscillating potential suppresses the usual Fabry–Perot oscillations in the transmission and a new type of asymmetric Fano resonance is noted for smaller separation, occurring due to extended states between the barriers. - Highlights: • Tunnelling of the Dirac Fermions through oscillating pure magnetic barriers is reported for the first time. • The high energy transmission through a graphene magnetic barrier is suppressed by the application of time periodic modulation. • Suppression of the Fabry Perot transmission is noted due to the application of an external time harmonic potential. • Two kinds of the Fano resonances are noted in transmission through a pair of modulated δ-function magnetic barriers.

Universal potential-barrier penetration by initially confined wave packets

International Nuclear Information System (INIS)

Granot, Er'el; Marchewka, Avi

2007-01-01

The dynamics of an initially sharp-boundary wave packet in the presence of an arbitrary potential barrier is investigated. It is shown that the penetration through the barrier is universal in the sense that it depends only on the values of the wave function and its derivatives at the boundary. The dependence on the derivatives vanishes at long distances from the barrier, where the dynamics is governed solely by the initial value of the wave function at the boundary

Universal potential-barrier penetration by initially confined wave packets

Science.gov (United States)

Granot, Er'El; Marchewka, Avi

2007-07-01

The dynamics of an initially sharp-boundary wave packet in the presence of an arbitrary potential barrier is investigated. It is shown that the penetration through the barrier is universal in the sense that it depends only on the values of the wave function and its derivatives at the boundary. The dependence on the derivatives vanishes at long distances from the barrier, where the dynamics is governed solely by the initial value of the wave function at the boundary.

The role of plants on isolation barrier systems

International Nuclear Information System (INIS)

Link, S.O.; Downs, J.L.; Waugh, W.J.

1994-11-01

Surface barriers are used to isolate buried wastes from the environment. Most have been built for short-term isolation. The need to isolate radioactive wastes from the environment requires that the functional integrity of a barrier be maintained for thousands of years. Barrier function strongly depends on vegetation. Plants reduce wind and water erosion and minimize drainage, but may transport contaminants if roots extend into buried wastes. Our review of the function of plants on surface barriers focuses on the role of plants across mesic to arid environments and gives special consideration to studies done at Hanford. The Hanford Barrier Development Program was created to design and test an earthen cover system to inhibit water infiltration, plant and animal intrusion, and wind and water erosion, while isolating buried wastes for at least 1000 years. Studies at the Hanford have shown that plants will significantly interact with the barrier. Plants transpire soil water back into the atmosphere. Deep-rooted perennials best recycle water; soil water may drain through the root zone of shallow-rooted annuals. Lysimeter studies indicate that a surface layer of fine soil with deep-rooted plants precludes drainage even with three times normal precipitation. The presence of vegetation greatly reduces water and wind erosion, but deep-rooted plants pose a threat of biointrusion and contaminant transport. The Hanford barrier includes a buried rock layer and asphalt layer to prevent biointrusion

Intestinal epithelial barrier function and tight junction proteins with heat and exercise

DEFF Research Database (Denmark)

Dokladny, Karol; Zuhl, Micah N; Moseley, Pope L

2016-01-01

A single layer of enterocytes and tight junctions (intercellular multiprotein complexes) form the intestinal epithelial barrier that controls transport of molecules through transcellular and paracellular pathways. A dysfunctional or "leaky" intestinal tight junction barrier allows augmented perme...

Tracking the Reorganization of Module Structure in Time-Varying Weighted Brain Functional Connectivity Networks.

Science.gov (United States)

Schmidt, Christoph; Piper, Diana; Pester, Britta; Mierau, Andreas; Witte, Herbert

2018-05-01

Identification of module structure in brain functional networks is a promising way to obtain novel insights into neural information processing, as modules correspond to delineated brain regions in which interactions are strongly increased. Tracking of network modules in time-varying brain functional networks is not yet commonly considered in neuroscience despite its potential for gaining an understanding of the time evolution of functional interaction patterns and associated changing degrees of functional segregation and integration. We introduce a general computational framework for extracting consensus partitions from defined time windows in sequences of weighted directed edge-complete networks and show how the temporal reorganization of the module structure can be tracked and visualized. Part of the framework is a new approach for computing edge weight thresholds for individual networks based on multiobjective optimization of module structure quality criteria as well as an approach for matching modules across time steps. By testing our framework using synthetic network sequences and applying it to brain functional networks computed from electroencephalographic recordings of healthy subjects that were exposed to a major balance perturbation, we demonstrate the framework's potential for gaining meaningful insights into dynamic brain function in the form of evolving network modules. The precise chronology of the neural processing inferred with our framework and its interpretation helps to improve the currently incomplete understanding of the cortical contribution for the compensation of such balance perturbations.

Dynamic energy landscapes of riboswitches help interpret conformational rearrangements and function.

Directory of Open Access Journals (Sweden)

Giulio Quarta

Full Text Available Riboswitches are RNAs that modulate gene expression by ligand-induced conformational changes. However, the way in which sequence dictates alternative folding pathways of gene regulation remains unclear. In this study, we compute energy landscapes, which describe the accessible secondary structures for a range of sequence lengths, to analyze the transcriptional process as a given sequence elongates to full length. In line with experimental evidence, we find that most riboswitch landscapes can be characterized by three broad classes as a function of sequence length in terms of the distribution and barrier type of the conformational clusters: low-barrier landscape with an ensemble of different conformations in equilibrium before encountering a substrate; barrier-free landscape in which a direct, dominant "downhill" pathway to the minimum free energy structure is apparent; and a barrier-dominated landscape with two isolated conformational states, each associated with a different biological function. Sharing concepts with the "new view" of protein folding energy landscapes, we term the three sequence ranges above as the sensing, downhill folding, and functional windows, respectively. We find that these energy landscape patterns are conserved in various riboswitch classes, though the order of the windows may vary. In fact, the order of the three windows suggests either kinetic or thermodynamic control of ligand binding. These findings help understand riboswitch structure/function relationships and open new avenues to riboswitch design.

Delivery of siRNA silencing P-gp in peptide-functionalized nanoparticles causes efflux modulation at the blood-brain barrier

DEFF Research Database (Denmark)

Gomes, Maria João; Kennedy, Patrick J; Martins, Susana

2017-01-01

AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...

Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat

NARCIS (Netherlands)

Visser, J. T. J.; Lammers, K.; Hoogendijk, A.; Boer, M. W.; Brugman, S.; Beijer-Liefers, S.; Zandvoort, A.; Harmsen, H.; Welling, G.; Stellaard, F.; Bos, N. A.; Fasano, A.; Rozing, J.

2010-01-01

Aims/hypothesis Impaired intestinal barrier function is observed in type I diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading

Comparison of Edge and Internal Transport Barriers in Drift Wave Predictive Simulations

DEFF Research Database (Denmark)

Weiland, J.; Crombe, K.; Mantica, P.

2011-01-01

We have simulated the formation of an internal transport barrier on JET including a self-consistent treatment of ion and electron temperatures and poloidal and toroidal momentum. Similar simulations of edge transport barriers, including the L-H transition have also been made. However, here only p...... for the internal barrier. For the edge barrier the edge density was varied and it turned out that a lower edge density gave a stronger barrier. Electromagnetic and nonlocal effects were important for both types of barriers. [ABSTRACT FROM AUTHOR]......We have simulated the formation of an internal transport barrier on JET including a self-consistent treatment of ion and electron temperatures and poloidal and toroidal momentum. Similar simulations of edge transport barriers, including the L-H transition have also been made. However, here only...... polodal momentum and the temperatures were simulated. The internal barrier included an anomalous spinup of poloidal momentum similar to that in the experiment. Also the edge barrier was accompanied by a spinup of poloidal momentum. The experimental density (with no barrier) was used and kept fixed...

RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

Science.gov (United States)

Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

2014-01-01

ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

Investigation of the functional lifetime of TRISOPLASTr in relation to chemical compositions of pore water solutions in barriers

NARCIS (Netherlands)

Boels, D.; Beest, te H.; Zweers, H.; Groeneveld, P.

2003-01-01

Trisoplastr is a mixture of sand, bentonite and a polymer, used amongst others as landfill cover as well as barriers. Its permeability is generally lower than 1-2 x 10-11 m/s. Trisoplast keeps its functionality even in contact with different kinds of liquids, is not susceptible to cyclic drying and

Gated current integrator for the beam in the RR barrier buckets

Energy Technology Data Exchange (ETDEWEB)

A. Cadorn; C. Bhat; J. Crisp

2003-06-10

At the Fermilab Recycler Ring (RR), the antiproton (pbar) beam will be stored azimuthally in different segments created by barrier buckets. The beam in each segment may have widely varying intensities. They have developed a gated integrator system to measure the beam intensity in each of the barrier bucket. Here they discuss the design of the system and the results of beam measurements using the integrator.

Feasibility study of tank leakage mitigation using subsurface barriers

International Nuclear Information System (INIS)

Treat, R.L.; Peters, B.B.; Cameron, R.J.; McCormak, W.D.; Trenkler, T.; Walters, M.F.; Rouse, J.K.; McLaughlin, T.J.; Cruse, J.M.

1994-01-01

The US Department of Energy (DOE) has established the Tank Waste Remediation System (TWRS) to satisfy manage and dispose of the waste currently stored in the underground storage tanks. The retrieval element of TWRS includes a work scope to develop subsurface impermeable barriers beneath SSTs. The barriers could serve as a means to contain leakage that may result from waste retrieval operations and could also support site closure activities by facilitating cleanup. Three types of subsurface barrier systems have emerged for further consideration: (1) chemical grout, (2) freeze walls, and (3) desiccant, represented in this feasibility study as a circulating air barrier. This report contains analyses of the costs and relative risks associated with combinations retrieval technologies and barrier technologies that from 14 alternatives. Eight of the alternatives include the use of subsurface barriers; the remaining six nonbarrier alternative are included in order to compare the costs, relative risks and other values of retrieval with subsurface barriers. Each alternative includes various combinations of technologies that can impact the risks associated with future contamination of the groundwater beneath the Hanford Site to varying degrees. Other potential risks associated with these alternatives, such as those related to accidents and airborne contamination resulting from retrieval and barrier emplacement operations, are not quantitatively evaluated in this report

Structure information from fusion barriers

Indian Academy of Sciences (India)

Pb, using the coupled reaction channel (CRC) method and correct structure information, have been analysed. The barrier distributions derived from these excitation functions including many of the significant channels are featureless, although these channels have considerable effects on the fusion excitation function.

Fingolimod promotes blood-nerve barrier properties in vitro.

Science.gov (United States)

Nishihara, Hideaki; Maeda, Toshihiko; Sano, Yasuteru; Ueno, Maho; Okamoto, Nana; Takeshita, Yukio; Shimizu, Fumitaka; Koga, Michiaki; Kanda, Takashi

2018-04-01

The main effect of fingolimod is thought to be functional antagonism of lymphocytic S1P1 receptors and the prevention of lymphocyte egress from lymphoid tissues, thereby reducing lymphocyte infiltration into the nervous system. However, a growing number of reports suggest that fingolimod also has a direct effect on several cell types in the nervous system. Although we previously reported that fingolimod enhances blood-brain barrier (BBB) functions, there have been no investigations regarding the blood-nerve barrier (BNB). In this study, we examine how fingolimod affects the BNB. An immortalized human peripheral nerve microvascular endothelial cell line (HPnMEC) was used to evaluate BNB barrier properties. We examined tight junction proteins and barrier functions of HPnMECs in conditioned medium with or without fingolimod-phosphate and blood sera from patients with typical chronic inflammatory demyelinating polyneuropathy (CIDP). Incubation with fingolimod-phosphate increased levels of claudin-5 mRNA and protein as well as TEER values in HPnMECs. Conversely, typical CIDP sera decreased claudin-5 mRNA/protein levels and TEER values in HPnMECs; however, pretreatment with fingolimod-phosphate inhibited the effects of the typical CIDP sera. Fingolimod-phosphate directly modifies the BNB and enhances barrier properties. This mechanism may be a viable therapeutic target for CIDP, and fingolimod may be useful in patients with typical CIDP who have severe barrier disruption.

HIV-1 impairs human retinal pigment epithelial barrier function: possible association with the pathogenesis of HIV-associated retinopathy.

Science.gov (United States)

Tan, Suiyi; Duan, Heng; Xun, Tianrong; Ci, Wei; Qiu, Jiayin; Yu, Fei; Zhao, Xuyan; Wu, Linxuan; Li, Lin; Lu, Lu; Jiang, Shibo; Liu, Shuwen

2014-07-01

The breakdown of human retinal pigment epithelial (HRPE) barrier is considered as the etiology of retinopathy, which affects the quality of life of HIV/AIDS patients. Here we demonstrate that HIV-1 could directly impair HRPE barrier function, which leads to the translocation of HIV-1 and bacteria. HRPE cells (D407) were grown to form polarized, confluent monolayers and treated with different HIV-1 infectious clones. A significant increase of monolayer permeability, as measured by trans-epithelial electrical resistance (TEER) and apical-basolateral movements of sodium fluorescein, was observed. Disrupted tightness of HRPE barrier was associated with the downregulation of several tight junction proteins in D407 cells, including ZO-1, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4, and Claudin-5, after exposure to HIV-1, without affecting the viability of cells. HIV-1 gp120 was shown to participate in the alteration of barrier properties, as evidenced by decreased TEER and weakened expression of tight junction proteins in D407 monolayers after exposure to pseudotyped HIV-1, UV-inactivated HIV-1, and free gp120, but not to an envelope (Env)-defective mutant of HIV. Furthermore, exposure to HIV-1 particles could induce the release of pro-inflammatory cytokines in D407, including IL-6 and MCP-1, both of which downregulated the expression of ZO-1 in the HRPE barrier. Disrupted HRPE monolayer allowed translocation of HIV-1 and bacteria across the epithelium. Overall, these findings suggest that HIV-1 may exploit its Env glycoprotein to induce an inflammatory state in HRPE cells, which could result in impairment of HRPE monolayer integrity, allowing virus and bacteria existing in ocular fluids to cross the epithelium and penetrate the HRPE barrier. Our study highlights the role of HIV-1 in the pathogenesis of HIV/AIDS-related retinopathy and suggests potential therapeutic targets for this ocular complication.

Sub 20 meV Schottky barriers in metal/MoTe2 junctions

Science.gov (United States)

Townsend, Nicola J.; Amit, Iddo; Craciun, Monica F.; Russo, Saverio

2018-04-01

The newly emerging class of atomically-thin materials has shown a high potential for the realisation of novel electronic and optoelectronic components. Amongst this family, semiconducting transition metal dichalcogenides (TMDCs) are of particular interest. While their band gaps are compatible with those of conventional solid state devices, they present a wide range of exciting new properties that is bound to become a crucial ingredient in the future of electronics. To utilise these properties for the prospect of electronics in general, and long-wavelength-based photodetectors in particular, the Schottky barriers formed upon contact with a metal and the contact resistance that arises at these interfaces have to be measured and controlled. We present experimental evidence for the formation of Schottky barriers as low as 10 meV between MoTe2 and metal electrodes. By varying the electrode work functions, we demonstrate that Fermi level pinning due to metal induced gap states at the interfaces occurs at 0.14 eV above the valence band maximum. In this configuration, thermionic emission is observed for the first time at temperatures between 40 K and 75 K. Finally, we discuss the ability to tune the barrier height using a gate electrode.

The Blood-Brain Barrier: An Engineering Perspective

Directory of Open Access Journals (Sweden)

Andrew eWong

2013-08-01

Full Text Available It has been more than 100 years since Paul Ehrlich reported that various water-soluble dyes injected into the circulation did not enter the brain. Since Ehrlich’s first experiments, only a small number of molecules, such as alcohol and caffeine have been found to cross the blood-brain barrier, and it remains the major roadblock to treatment of many central nervous system diseases. At the same time, many central nervous system diseases are associated with disruption of the blood-brain barrier that can lead to changes in permeability, modulation of immune cell transport, and trafficking of pathogens into the brain. Therefore advances in our understanding of the structure and function of the blood-brain barrier are key to advances in treatment of a wide range of central nervous system diseases. Over the past 10 years it has become recognized that the blood-brain barrier is a complex dynamic system that involves biomechanical and biochemical signaling between the vascular system and the brain. Here we reconstruct the structure, function, and transport properties of the blood-brain barrier from an engineering perspective. New insight into the physics of the blood-brain barrier could ultimately lead to clinical advances in the treatment of central nervous system diseases.

Safety barriers to prevent release of hydrocarbons during production of oil and gas

OpenAIRE

Sklet, Snorre; Hauge, Stein

2004-01-01

This report documents a set of scenarios related to release of hydrocarbons during production on oil and gas platforms. For each release scenario, initiating events, barrier functions aimed to prevent loss of containment, and barrier systems that realize these barrier functions are identified and described. Safety barriers to prevent release of hydrocarbons during production of oil and gas

Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro

NARCIS (Netherlands)

Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de

2005-01-01

The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of

The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier

Energy Technology Data Exchange (ETDEWEB)

Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.

2009-09-01

A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected

Tight junction proteins contribute to barrier properties in human pleura.

Science.gov (United States)

Markov, Alexander G; Voronkova, Maria A; Volgin, George N; Yablonsky, Piotr K; Fromm, Michael; Amasheh, Salah

2011-03-15

The permeability of pleural mesothelium helps to control the volume and composition of the liquid lubricating pleural surfaces. Information on pleural barrier function in health and disease, however, is scarce. Tissue specimens of human pleura were mounted in Ussing chambers for measurement of transmesothelial resistance. Expression of tight junction (TJ) proteins was studied by Western blots and immune fluorescence confocal microscopy. Both visceral and parietal pleura showed barrier properties represented by transmesothelial resistance. Occludin, claudin-1, -3, -5, and -7, were detected in visceral pleura. In parietal pleura, the same TJ proteins were detected, except claudin-7. In tissues from patients with pleural inflammation these tightening claudins were decreased and in visceral pleura claudin-2, a paracellular channel former, became apparent. We report that barrier function in human pleura coincides with expression of claudins known to be key determinants of epithelial barrier properties. In inflamed tissue, claudin expression indicates a reduced barrier function. Copyright © 2010 Elsevier B.V. All rights reserved.

Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

Directory of Open Access Journals (Sweden)

Xinxin Liu

Full Text Available Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3 expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001. Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (p<0.05 and a reduction in transepithelial electrical resistance (TEER by 180.0% (p<0.001. While the expression of tight junctional protein did not change in acrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (p<0.05. Taken together, these data provide evidence that acute acrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

ROS-activated calcium signaling mechanisms regulating endothelial barrier function.

Science.gov (United States)

Di, Anke; Mehta, Dolly; Malik, Asrar B

2016-09-01

Increased vascular permeability is a common pathogenic feature in many inflammatory diseases. For example in acute lung injury (ALI) and its most severe form, the acute respiratory distress syndrome (ARDS), lung microvessel endothelia lose their junctional integrity resulting in leakiness of the endothelial barrier and accumulation of protein rich edema. Increased reactive oxygen species (ROS) generated by neutrophils (PMNs) and other inflammatory cells play an important role in increasing endothelial permeability. In essence, multiple inflammatory syndromes are caused by dysfunction and compromise of the barrier properties of the endothelium as a consequence of unregulated acute inflammatory response. This review focuses on the role of ROS signaling in controlling endothelial permeability with particular focus on ALI. We summarize below recent progress in defining signaling events leading to increased endothelial permeability and ALI. Copyright © 2016 Elsevier Ltd. All rights reserved.

Intestinal barrier integrity and inflammatory bowel disease

DEFF Research Database (Denmark)

Holmberg, Fredrik Eric Olof; Pedersen, Jannie; Jørgensen, Peter

2018-01-01

Disruption of normal barrier function is a fundamental factor in the pathogenesis of inflammatory bowel disease, which includes increased epithelial cell death, modified mucus configuration, altered expression and distribution of tight junction-proteins, along with a decreased expression of antim......Disruption of normal barrier function is a fundamental factor in the pathogenesis of inflammatory bowel disease, which includes increased epithelial cell death, modified mucus configuration, altered expression and distribution of tight junction-proteins, along with a decreased expression...... of antimicrobial peptides. Inflammatory bowel disease is associated with life-long morbidity for affected patients, and both the incidence and prevalence is increasing globally, resulting in substantial economic strain for society. Mucosal healing and re-establishment of barrier integrity is associated......, novel treatment strategies to accomplish mucosal healing and to re-establish normal barrier integrity in inflammatory bowel disease are warranted, and luminal stem cell-based approaches might have an intriguing potential. Transplantation of in vitro expanded intestinal epithelial stem cells derived...

Gender Differences in Barriers to Physical Activity among College Students Reporting Varying Levels of Regular Physical Activity

Science.gov (United States)

Munford, Shawn N.

2011-01-01

Researchers have studied the primary determinants of physical activity in an effort to enhance health promotion initiatives nationwide. These physical activity determinants have been observed to differ among various segments of the population, suggesting a further examination of physical activity barriers among differing populations. Little…

Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs

Directory of Open Access Journals (Sweden)

Adam J. Moeser

2017-12-01

Full Text Available The gastrointestinal (GI barrier serves a critical role in survival and overall health of animals and humans. Several layers of barrier defense mechanisms are provided by the epithelial, immune and enteric nervous systems. Together they act in concert to control normal gut functions (e.g., digestion, absorption, secretion, immunity, etc. whereas at the same time provide a barrier from the hostile conditions in the luminal environment. Breakdown of these critical GI functions is a central pathophysiological mechanism in the most serious GI disorders in pigs. This review will focus on the development and functional properties of the GI barrier in pigs and how common early life production stressors, such as weaning, can alter immediate and long-term barrier function and disease susceptibility. Specific stress-related pathophysiological mechanisms responsible for driving GI barrier dysfunction induced by weaning and the implications to animal health and performance will be discussed.

Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

OpenAIRE

Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.

2008-01-01

Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...

Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

Science.gov (United States)

Han, Seung Hoon; Park, Ji Woong

2017-11-01

The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

Permeability Barrier Generation in the Martian Lithosphere

Science.gov (United States)

Schools, Joe; Montési, Laurent

2015-11-01

Permeability barriers develop when a magma produced in the interior of a planet rises into the cooler lithosphere and crystallizes more rapidly than the lithosphere can deform (Sparks and Parmentier, 1991). Crystallization products may then clog the porous network in which melt is propagating, reducing the permeability to almost zero, i.e., forming a permeability barrier. Subsequent melts cannot cross the barrier. Permeability barriers have been useful to explain variations in crustal thickness at mid-ocean ridges on Earth (Magde et al., 1997; Hebert and Montési, 2011; Montési et al., 2011). We explore here under what conditions permeability barriers may form on Mars.We use the MELTS thermodynamic calculator (Ghiorso and Sack, 1995; Ghiorso et al., 2002; Asimow et al., 2004) in conjunction with estimated Martian mantle compositions (Morgan and Anders, 1979; Wänke and Dreibus, 1994; Lodders and Fegley, 1997; Sanloup et al., 1999; Taylor 2013) to model the formation of permeability barriers in the lithosphere of Mars. In order to represent potential past and present conditions of Mars, we vary the lithospheric thickness, mantle potential temperature (heat flux), oxygen fugacity, and water content.Our results show that permeability layers can develop in the thermal boundary layer of the simulated Martian lithosphere if the mantle potential temperature is higher than ~1500°C. The various Martian mantle compositions yield barriers in the same locations, under matching variable conditions. There is no significant difference in barrier location over the range of accepted Martian oxygen fugacity values. Water content is the most significant influence on barrier development as it reduces the temperature of crystallization, allowing melt to rise further into the lithosphere. Our lower temperature and thicker lithosphere model runs, which are likely the most similar to modern Mars, show no permeability barrier generation. Losing the possibility of having a permeability

Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions

Directory of Open Access Journals (Sweden)

Milos Mihajlovic

2017-11-01

Full Text Available As current kidney replacement therapies are not efficient enough for end-stage renal disease (ESRD treatment, a bioartificial kidney (BAK device, based on conditionally immortalized human proximal tubule epithelial cells (ciPTEC, could represent an attractive solution. The active transport activity of such a system was recently demonstrated. In addition, endocrine functions of the cells, such as vitamin D activation, are relevant. The organic anion transporter 1 (OAT-1 overexpressing ciPTEC line presented 1α-hydroxylase (CYP27B1, 24-hydroxylase (CYP24A1 and vitamin D receptor (VDR, responsible for vitamin D activation, degradation and function, respectively. The ability to produce and secrete 1α,25-dihydroxy-vitamin D3, was shown after incubation with the precursor, 25-hydroxy-vitamin D3. The beneficial effect of vitamin D on cell function and behavior in uremic conditions was studied in the presence of an anionic uremic toxins mixture. Vitamin D could restore cell viability, and inflammatory and oxidative status, as shown by cell metabolic activity, interleukin-6 (IL-6 levels and reactive oxygen species (ROS production, respectively. Finally, vitamin D restored transepithelial barrier function, as evidenced by decreased inulin-FITC leakage in biofunctionalized hollow fiber membranes (HFM carrying ciPTEC-OAT1. In conclusion, the protective effects of vitamin D in uremic conditions and proven ciPTEC-OAT1 endocrine function encourage the use of these cells for BAK application.

Modeling Safety Barriers and Defense in Depth with Mulitlevel Flow Modeling

DEFF Research Database (Denmark)

Lind, Morten

2012-01-01

in MFM is a barrier function. It is shown that other barrier types can be represented andthat their combination into barrier chains may be used to analyze and design levels of safety in automated processes.Suggestion for further research on barrier modeling with MFM are included....

Reflectionlessness, kurtosis and top curvature of potential barriers

International Nuclear Information System (INIS)

Ahmed, Zafar

2006-01-01

Apart from the rectangular barrier, other barriers having a single maximum generally display reflectivity, R(E), as a smoothly decreasing function of energy. We conjecture that symmetric potential barriers with a single maximum entail zeros or sharp minima in R(E) provided they have either their coefficient of kurtosis lying in the range (1.8, 3.0), or their top curvature as zero, or both

Symmetry analysis of a model for the exercise of a barrier option

Science.gov (United States)

O'Hara, J. G.; Sophocleous, C.; Leach, P. G. L.

2013-09-01

A barrier option takes into account the possibility of an unacceptable change in the price of the underlying stock. Such a change could carry considerable financial loss. We examine one model based upon the Black-Scholes-Merton Equation and determine the functional forms of the barrier function and rebate function which are consistent with a solution of the underlying evolution partial differential equation using the Lie Theory of Extended Groups. The solution is consistent with the possibility of no rebate and the barrier function is very similar to one adopted on an heuristic basis.

Modelling the endothelial blood-CNS barriers: a method for the production of robust in vitro models of the rat blood-brain barrier and blood-spinal cord barrier.

Science.gov (United States)

Watson, P Marc D; Paterson, Judy C; Thom, George; Ginman, Ulrika; Lundquist, Stefan; Webster, Carl I

2013-06-18

Modelling the blood-CNS barriers of the brain and spinal cord in vitro continues to provide a considerable challenge for research studying the passage of large and small molecules in and out of the central nervous system, both within the context of basic biology and for pharmaceutical drug discovery. Although there has been considerable success over the previous two decades in establishing useful in vitro primary endothelial cell cultures from the blood-CNS barriers, no model fully mimics the high electrical resistance, low paracellular permeability and selective influx/efflux characteristics of the in vivo situation. Furthermore, such primary-derived cultures are typically labour-intensive and generate low yields of cells, limiting scope for experimental work. We thus aimed to establish protocols for the high yield isolation and culture of endothelial cells from both rat brain and spinal cord. Our aim was to optimise in vitro conditions for inducing phenotypic characteristics in these cells that were reminiscent of the in vivo situation, such that they developed into tight endothelial barriers suitable for performing investigative biology and permeability studies. Brain and spinal cord tissue was taken from the same rats and used to specifically isolate endothelial cells to reconstitute as in vitro blood-CNS barrier models. Isolated endothelial cells were cultured to expand the cellular yield and then passaged onto cell culture inserts for further investigation. Cell culture conditions were optimised using commercially available reagents and the resulting barrier-forming endothelial monolayers were characterised by functional permeability experiments and in vitro phenotyping by immunocytochemistry and western blotting. Using a combination of modified handling techniques and cell culture conditions, we have established and optimised a protocol for the in vitro culture of brain and, for the first time in rat, spinal cord endothelial cells. High yields of both CNS

Barriers to activity and participation for stroke survivors in rural China.

Science.gov (United States)

Zhang, Lifang; Yan, Tiebin; You, Liming; Li, Kun

2015-07-01

To investigate environmental barriers reported by stroke survivors in the rural areas of China and to determine the impact of environmental barriers on activity and participation relative to demographic characteristics and body functioning. Cross-sectional survey. Structured interviews in the participants' homes. Community-dwelling stroke survivors in the rural areas of China (N=639). Not applicable. Activity and participation (Chinese version of the World Health Organization Disability Assessment Schedule 2.0), environmental barriers (Craig Hospital Inventory of Environmental Factors), neurological function (Canadian Neurological Scale), cognitive function (Abbreviated Mental Test), and depression (6-item Hamilton Rating Scale for Depression). Physical/structural barriers are the major impediment to activity and participation for these participants (odds ratio, 1.86 and 1.99 for activity and participation, respectively; Penvironmental barriers to be decreased and eliminated first. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Flexible barrier film, method of forming same, and organic electronic device including same

Science.gov (United States)

Blizzard, John; Tonge, James Steven; Weidner, William Kenneth

2013-03-26

A flexible barrier film has a thickness of from greater than zero to less than 5,000 nanometers and a water vapor transmission rate of no more than 1.times.10.sup.-2 g/m.sup.2/day at 22.degree. C. and 47% relative humidity. The flexible barrier film is formed from a composition, which comprises a multi-functional acrylate. The composition further comprises the reaction product of an alkoxy-functional organometallic compound and an alkoxy-functional organosilicon compound. A method of forming the flexible barrier film includes the steps of disposing the composition on a substrate and curing the composition to form the flexible barrier film. The flexible barrier film may be utilized in organic electronic devices.

Finite-time barriers to reaction front propagation

Science.gov (United States)

Locke, Rory; Mahoney, John; Mitchell, Kevin

2015-11-01

Front propagation in advection-reaction-diffusion systems gives rise to rich geometric patterns. It has been shown for time-independent and time-periodic fluid flows that invariant manifolds, termed burning invariant manifolds (BIMs), serve as one-sided dynamical barriers to the propagation of reaction front. More recently, theoretical work has suggested that one-sided barriers, termed burning Lagrangian Coherent structures (bLCSs), exist for fluid velocity data prescribed over a finite time interval, with no assumption on the time-dependence of the flow. In this presentation, we use a time-varying fluid ``wind'' in a double-vortex channel flow to demonstrate that bLCSs form the (locally) most attracting or repelling fronts.

COMPARATIVE STUDY OF THE EFFECTS OF DETONATION NANODIAMONDS WITH VARIED PROPERTIES ON FUNCTIONAL STATE OF BRAIN NERVE TERMINALS

Directory of Open Access Journals (Sweden)

M. A. Galkin

2016-12-01

Full Text Available The aim of the study was to compare the effects of detonation nanodiamond preparations from different batches cleaned from impurities by diverse methods of chemical treatment on the membrane potential and glutamate transport characteristics of rat brain nerve terminals. The size of nanodiamond particles vary from 10–20 nm to 10 μm. There are carbonyl, hydroxyl and carboxyl functional groups on the surface of the particles. Physical-chemical properties such as a magnetic susceptibility and the amount of incombustible residue in samples of detonation nanodia-mond vary depending on the synthesis regime and the method of chemical cleaning of the product and therefore, the neuroactive properties of nanodiamonds from different batches can be different. It was shown by dynamic light scattering analysis that nanodiamond preparations from different batches treated by diverse technologies of chemical treatment had varied average size of particles and distribution of particles by size. Nanodiamond preparations from different batches changed the plasma membrane potential and caused membrane depolarization of nerve terminals. Analysis of the effects of nanodiamonds on transporter-mediated L-[14C]glutamate uptake by nerve terminals also revealed that all studied nanodiamond preparations decreased abovementioned parameter. Therefore, detonation nanodiamonds from different batches have similar principal effects on functional state of nerve terminals, however variability in their physical and chemical properties is associated with diverse strength of these effects.

Novel Functionally Graded Thermal Barrier Coatings in Coal-Fired Power Plant Turbines

Energy Technology Data Exchange (ETDEWEB)

Zhang, Jing [Indiana Univ., Indianapolis, IN (United States)

2016-11-01

This project presents a detailed investigation of a novel functionally graded coating material, pyrochlore oxide, for thermal barrier coating (TBC) in gas turbines used in coal-fired power plants. Thermal barrier coatings are refractory materials deposited on gas turbine components, which provide thermal protection for metallic components at operating conditions. The ultimate goal of this research is to develop a manufacturing process to produce the novel low thermal conductivity and high thermal stability pyrochlore oxide based coatings with improved high-temperature durability. The current standard TBC, yttria stabilized zirconia (YSZ), has service temperatures limited to <1200°C, due to sintering and phase transition at higher temperatures. In contrast, pyrochlore oxide, e.g., lanthanum zirconate (La₂Zr₂O₇, LZ), has demonstrated lower thermal conductivity and better thermal stability, which are crucial to high temperature applications, such as gas turbines used in coal-fired power plants. Indiana University – Purdue University Indianapolis (IUPUI) has collaborated with Praxair Surface Technologies (PST), and Changwon National University in South Korea to perform the proposed research. The research findings are critical to the extension of current TBCs to a broader range of high-temperature materials and applications. Several tasks were originally proposed and accomplished, with additional new opportunities identified during the course of the project. In this report, a description of the project tasks, the main findings and conclusions are given. A list of publications and presentations resulted from this research is listed in the Appendix at the end of the report.

Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat.

Science.gov (United States)

Visser, J T J; Lammers, K; Hoogendijk, A; Boer, M W; Brugman, S; Beijer-Liefers, S; Zandvoort, A; Harmsen, H; Welling, G; Stellaard, F; Bos, N A; Fasano, A; Rozing, J

2010-12-01

Impaired intestinal barrier function is observed in type 1 diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading to type 1 diabetes. Since a hydrolysed casein (HC) diet prevents autoimmune diabetes onset in diabetes-prone (DP)-BioBreeding (BB) rats, we studied the role of the HC diet on intestinal barrier function and, therefore, prevention of autoimmune diabetes onset in this animal model. DP-BB rats were fed the HC diet from weaning onwards and monitored for autoimmune diabetes development. Intestinal permeability was assessed in vivo by lactulose-mannitol test and ex vivo by measuring transepithelial electrical resistance (TEER). Levels of serum zonulin, a physiological tight junction modulator, were measured by ELISA. Ileal mRNA expression of Myo9b, Cldn1, Cldn2 and Ocln (which encode the tight junction-related proteins myosin IXb, claudin-1, claudin-2 and occludin) and Il-10, Tgf-ß (also known as Il10 and Tgfb, respectively, which encode regulatory cytokines) was analysed by quantitative PCR. The HC diet reduced autoimmune diabetes by 50% in DP-BB rats. In DP-BB rats, prediabetic gut permeability negatively correlated with the moment of autoimmune diabetes onset. The improved intestinal barrier function that was induced by HC diet in DP-BB rats was visualised by decreasing lactulose:mannitol ratio, decreasing serum zonulin levels and increasing ileal TEER. The HC diet modified ileal mRNA expression of Myo9b, and Cldn1 and Cldn2, but left Ocln expression unaltered. Improved intestinal barrier function might be an important intermediate in the prevention of autoimmune diabetes by the HC diet in DP-BB rats. Effects on tight junctions, ileal cytokines and zonulin production might be important mechanisms for this effect.

Wave trapping by dual porous barriers near a wall in the presence of bottom undulation

Science.gov (United States)

Kaligatla, R. B.; Manisha; Sahoo, T.

2017-09-01

Trapping of oblique surface gravity waves by dual porous barriers near a wall is studied in the presence of step type varying bottom bed that is connected on both sides by water of uniform depths. The porous barriers are assumed to be fixed at a certain distance in front of a vertical rigid wall. Using linear water wave theory and Darcy's law for flow past porous structure, the physical problem is converted into a boundary value problem. Using eigenfunction expansion in the uniform bottom bed region and modified mild-slope equation in the varying bottom bed region, the mathematical problem is handled for solution. Moreover, certain jump conditions are used to account for mass conservation at slope discontinuities in the bottom bed profile. To understand the effect of dual porous barriers in creating tranquility zone and minimum load on the sea wall, reflection coefficient, wave forces acting on the barrier and the wall, and surface wave elevation are computed and analyzed for different values of depth ratio, porous-effect parameter, incident wave angle, gap between the barriers and wall and slope length of undulated bottom. The study reveals that with moderate porosity and suitable gap between barriers and sea wall, using dual barriers an effective wave trapping system can be developed which will exert less wave force on the barriers and the rigid wall. The proposed wave trapping system is likely to be of immense help for protecting various facilities/ infrastructures in coastal environment.

Wave Trapping by Dual Porous Barriers Near a Wall in the Presence of Bottom Undulation

Institute of Scientific and Technical Information of China (English)

R.B. Kaligatla; Manisha; T. Sahoo

2017-01-01

Trapping of oblique surface gravity waves by dual porous barriers near a wall is studied in the presence of step type varying bottom bed that is connected on both sides by water of uniform depths. The porous barriers are assumed to be fixed at a certain distance in front of a vertical rigid wall. Using linear water wave theory and Darcy's law for flow past porous structure, the physical problem is converted into a boundary value problem. Using eigenfunction expansion in the uniform bottom bed region and modified mild-slope equation in the varying bottom bed region, the mathematical problem is handled for solution. Moreover, certain jump conditions are used to account for mass conservation at slope discontinuities in the bottom bed profile. To understand the effect of dual porous barriers in creating tranquility zone and minimum load on the sea wall, reflection coefficient, wave forces acting on the barrier and the wall, and surface wave elevation are computed and analyzed for different values of depth ratio, porous-effect parameter, incident wave angle, gap between the barriers and wall and slope length of undulated bottom. The study reveals that with moderate porosity and suitable gap between barriers and sea wall, using dual barriers an effective wave trapping system can be developed which will exert less wave force on the barriers and the rigid wall. The proposed wave trapping system is likely to be of immense help for protecting various facilities/ infrastructures in coastal environment.

Quantum finance Hamiltonian for coupon bond European and barrier options.

Science.gov (United States)

Baaquie, Belal E

2008-03-01

Coupon bond European and barrier options are financial derivatives that can be analyzed in the Hamiltonian formulation of quantum finance. Forward interest rates are modeled as a two-dimensional quantum field theory and its Hamiltonian and state space is defined. European and barrier options are realized as transition amplitudes of the time integrated Hamiltonian operator. The double barrier option for a financial instrument is "knocked out" (terminated with zero value) if the price of the underlying instrument exceeds or falls below preset limits; the barrier option is realized by imposing boundary conditions on the eigenfunctions of the forward interest rates' Hamiltonian. The price of the European coupon bond option and the zero coupon bond barrier option are calculated. It is shown that, is general, the constraint function for a coupon bond barrier option can -- to a good approximation -- be linearized. A calculation using an overcomplete set of eigenfunctions yields an approximate price for the coupon bond barrier option, which is given in the form of an integral of a factor that results from the barrier condition times another factor that arises from the payoff function.

Barriers to health care for undocumented immigrants: a literature review

Science.gov (United States)

Hacker, Karen; Anies, Maria; Folb, Barbara L; Zallman, Leah

2015-01-01

With the unprecedented international migration seen in recent years, policies that limit health care access have become prevalent. Barriers to health care for undocumented immigrants go beyond policy and range from financial limitations, to discrimination and fear of deportation. This paper is aimed at reviewing the literature on barriers to health care for undocumented immigrants and identifying strategies that have or could be used to address these barriers. To address study questions, we conducted a literature review of published articles from the last 10 years in PubMed using three main concepts: immigrants, undocumented, and access to health care. The search yielded 341 articles of which 66 met study criteria. With regard to barriers, we identified barriers in the policy arena focused on issues related to law and policy including limitations to access and type of health care. These varied widely across countries but ultimately impacted the type and amount of health care any undocumented immigrant could receive. Within the health system, barriers included bureaucratic obstacles including paperwork and registration systems. The alternative care available (safety net) was generally limited and overwhelmed. Finally, there was evidence of widespread discriminatory practices within the health care system itself. The individual level focused on the immigrant’s fear of deportation, stigma, and lack of capital (both social and financial) to obtain services. Recommendations identified in the papers reviewed included advocating for policy change to increase access to health care for undocumented immigrants, providing novel insurance options, expanding safety net services, training providers to better care for immigrant populations, and educating undocumented immigrants on navigating the system. There are numerous barriers to health care for undocumented immigrants. These vary by country and frequently change. Despite concerns that access to health care attracts

Dynamic responses of connections in road safety barriers

International Nuclear Information System (INIS)

Bayton, D.A.F.; Long, R.; Fourlaris, G.

2009-01-01

Bolted road safety barrier connections utilise slotted holes that are perpendicular to the direction of the safety barrier beam. Due to the clearance between the slotted holes and the bolts, a varying amount of slippage is seen before contact with the edge of the slot is made. The stiffness characteristics of bolted road safety barrier connections have been examined with a representative test coupon that incorporates a full size safety barrier connection slot to industry standard dimensions. Previous research work has successfully determined the stiffness characteristics of the bolted connections at quasi-static strain rates. Representative non-linear finite element models of the bolted test coupons have been constructed. When compared to the laboratory results the initial stiffness, maximum force and displacement of the bolted connections are similar to the finite element model predictions. Current investigations have moved onto strain rates comparable to those observed in actual vehicle crash tests. Explicit dynamic finite element (FE) models have been constructed and validated, using experimental data produced using a series of high strain rate laboratory tests for a number of bolt configurations

Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

Science.gov (United States)

Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

2010-01-01

Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

Science.gov (United States)

Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

2015-01-13

Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

Fusion barrier distributions and fission anisotropies

International Nuclear Information System (INIS)

Hinde, D.J.; Morton, C.R.; Dasgupta, M.; Leigh, J.R.; Lestone, J.P.; Lemmon, R.C.; Mein, J.C.; Newton, J.O.; Timmers, H.; Rowley, N.; Kruppa, A.T.

1995-01-01

Fusion excitation functions for 16,17 O+ 144 Sm have been measured to high precision. The extracted fusion barrier distributions show a double-peaked structure interpreted in terms of coupling to inelastic collective excitations of the target. The effect of the positive Q-value neutron stripping channel is evident in the reaction with 17 O. Fission and evaporation residue cross-sections and excitation functions have been measured for the reaction of 16 O+ 208 Pb and the fusion barrier distribution and fission anisotropies determined. It is found that the moments of the fusion l-distribution determined from the fusion and fission measurements are in good agreement. ((orig.))

Functional Two-Dimensional Coordination Polymeric Layer as a Charge Barrier in Li–S Batteries

KAUST Repository

Huang, Jing-Kai

2018-01-04

Ultrathin two-dimensional (2D) polymeric layers are capable of separating gases and molecules based on the reported size exclusion mechanism. What is equally important but missing today is an exploration of the 2D layers with charge functionality, which enables applications using the charge exclusion principle. This work demonstrates a simple and scalable method of synthesizing a free-standing 2D coordination polymer Zn2(benzimidazolate)2(OH)2 at the air–water interface. The hydroxyl (−OH) groups are stoichiometrically coordinated and implement electrostatic charges in the 2D structures, providing powerful functionality as a charge barrier. Electrochemical performance of the Li–S battery shows that the Zn2(benzimidazolate)2(OH)2 coordination polymer layers efficiently mitigate the polysulfide shuttling effects and largely enhance the battery capacity and cycle performance. The synthesis of the proposed coordination polymeric layers is simple, scalable, cost saving, and promising for practical use in batteries.

Theoretical investigation of gas separation in functionalized nanoporous graphene membranes

Science.gov (United States)

Wang, Yong; Yang, Qingyuan; Zhong, Chongli; Li, Jinping

2017-06-01

Graphene has enormous potential as a membrane-separation material with ultrahigh permeability and selectivity. The understanding of mass-transport mechanism in graphene membranes is crucial for applications in gas separation field. We computationally investigated the capability and mechanisms of functionalized nanoporous graphene membranes for gas separation. The functionalized graphene membranes with appropriate pore size and geometry possess excellent high selectivity for separating CO2/N2, CO2/CH4 and N2/CH4 gas mixtures with a gas permeance of ∼103-105 GPU, compared with ∼100 GPU for typical polymeric membranes. More important, we found that, for ultrathin graphene membranes, the gas separation performance has a great dependence not only with the energy barrier for gas getting into the pore of the graphene membranes, but also with the energy barrier for gas escaping from the pore to the other side of the membranes. The gas separation performance can be tuned by changing the two energy barriers, which can be realized by varying the chemical functional groups on the pore rim of the graphene. The novel mass-transport mechanism obtained in current study may provide a theoretical foundation for guiding the future design of graphene membranes with outstanding separation performance.

Permeability measurement of some barrier materials as a function of temperature and pressure

International Nuclear Information System (INIS)

Maqsood, M.; Faisal, S.; Ali, J.; Usman, A.; Alamgir, K.; Farooq, K.

2011-01-01

Barrier materials possess the ability to restrict the passage of gases, vapors, and organic liquids through their boundaries. These barrier materials have large number of applications in industry and scientific research. To measure the permeability of barrier materials, a specific gas flow system has been developed, pure helium gas is used to measure the back ground reading through SS-316. The permeability and break-through time has been measured through Inconel X-750, NBR and Viton below and above the atmospheric pressure and at different temperatures 20 deg. C, 40 deg. C and 70 deg. C. (author)

Electron tunneling across a tunable potential barrier

International Nuclear Information System (INIS)

Mangin, A; Anthore, A; Rocca, M L Della; Boulat, E; Lafarge, P

2009-01-01

We present an experiment where the elementary quantum electron tunneling process should be affected by an independent gate voltage parameter. We have realized nanotransistors where the source and drain electrodes are created by electromigration inducing a nanometer sized gap acting as a tunnel barrier. The barrier potential shape is in first approximation considered trapezoidal. The application of a voltage to the gate electrode close to the barrier region can in principle affect the barrier shape. Simulations of the source drain tunnel current as a function of the gate voltage predict modulations as large as one hundred percent. The difficulty of observing the predicted behaviour in our samples might be due to the peculiar geometry of the realized tunnel junction.

Bayesian switching factor analysis for estimating time-varying functional connectivity in fMRI.

Science.gov (United States)

Taghia, Jalil; Ryali, Srikanth; Chen, Tianwen; Supekar, Kaustubh; Cai, Weidong; Menon, Vinod

2017-07-15

There is growing interest in understanding the dynamical properties of functional interactions between distributed brain regions. However, robust estimation of temporal dynamics from functional magnetic resonance imaging (fMRI) data remains challenging due to limitations in extant multivariate methods for modeling time-varying functional interactions between multiple brain areas. Here, we develop a Bayesian generative model for fMRI time-series within the framework of hidden Markov models (HMMs). The model is a dynamic variant of the static factor analysis model (Ghahramani and Beal, 2000). We refer to this model as Bayesian switching factor analysis (BSFA) as it integrates factor analysis into a generative HMM in a unified Bayesian framework. In BSFA, brain dynamic functional networks are represented by latent states which are learnt from the data. Crucially, BSFA is a generative model which estimates the temporal evolution of brain states and transition probabilities between states as a function of time. An attractive feature of BSFA is the automatic determination of the number of latent states via Bayesian model selection arising from penalization of excessively complex models. Key features of BSFA are validated using extensive simulations on carefully designed synthetic data. We further validate BSFA using fingerprint analysis of multisession resting-state fMRI data from the Human Connectome Project (HCP). Our results show that modeling temporal dependencies in the generative model of BSFA results in improved fingerprinting of individual participants. Finally, we apply BSFA to elucidate the dynamic functional organization of the salience, central-executive, and default mode networks-three core neurocognitive systems with central role in cognitive and affective information processing (Menon, 2011). Across two HCP sessions, we demonstrate a high level of dynamic interactions between these networks and determine that the salience network has the highest temporal

The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; A randomized double-blind placebo controlled trial

NARCIS (Netherlands)

Mujagic, Zlatan; Vos, De Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm J.H.M.; Wit, De Nicole J.W.; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.

2017-01-01

The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein

The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; a randomized double-blind placebo controlled trial

NARCIS (Netherlands)

Mujagic, Zlatan; Vos, de Paul; Boekschoten, Mark; Govers, Coen; Pieters, Harm J.H.M.; Wit, de Nicole; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.

2017-01-01

The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein rearrangement,

The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; a randomized double-blind placebo controlled trial

NARCIS (Netherlands)

Mujagic, Zlatan; de Vos, Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm-Jan H M; de Wit, Nicole J. W.; Bron, Peter A.; Masclee, Ad A M; Troost, Freddy J

2017-01-01

The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein

Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

Science.gov (United States)

Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong

2017-01-01

Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542

Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

Directory of Open Access Journals (Sweden)

Siming Yang

2017-08-01

Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.

The intestinal complement system in inflammatory bowel disease: Shaping intestinal barrier function.

Science.gov (United States)

Sina, Christian; Kemper, Claudia; Derer, Stefanie

2018-06-01

The complement system is part of innate sensor and effector systems such as the Toll-like receptors (TLRs). It recognizes and quickly systemically and/or locally respond to microbial-associated molecular patterns (MAMPs) with a tailored defense reaction. MAMP recognition by intestinal epithelial cells (IECs) and appropriate immune responses are of major importance for the maintenance of intestinal barrier function. Enterocytes highly express various complement components that are suggested to be pivotal for proper IEC function. Appropriate activation of the intestinal complement system seems to play an important role in the resolution of chronic intestinal inflammation, while over-activation and/or dysregulation may worsen intestinal inflammation. Mice deficient for single complement components suffer from enhanced intestinal inflammation mimicking the phenotype of patients with chronic inflammatory bowel disease (IBD) such as Crohn's disease (CD) or ulcerative colitis (UC). However, the mechanisms leading to complement expression in IECs seem to differ markedly between UC and CD patients. Hence, how IECs, intestinal bacteria and epithelial cell expressed complement components interact in the course of IBD still remains to be mostly elucidated to define potential unique patterns contributing to the distinct subtypes of intestinal inflammation observed in CD and UC. Copyright © 2018 Elsevier Ltd. All rights reserved.

Sun-induced changes of stratum corneum hydration vary with age and gender in a normal Chinese population.

Science.gov (United States)

Liu, Zhili; Song, Shunpeng; Luo, Wenhai; Elias, Peter M; Man, Mao-Qiang

2012-02-01

Previous studies have demonstrated that sun-induced alteration of epidermal permeability barrier function varies with gender and age. In the present study, we assess the stratum corneum (SC) hydration in sun-exposed males and females. A total of 168 subjects (84 males and 84 females) aged 19-75 years were enrolled. A multifunctional skin physiology monitor was used to measure SC hydration. In comparison with non-sun exposure, sun exposure does not cause a significant change in SC hydration in either young males or young females, whereas in aged females, a significant reduction of SC hydration is seen on the forehead and the dorsal hand of sun-exposed subjects. SC hydration on the canthus of both aged males and aged females is significantly lower than that of young subjects. Additionally, SC hydration on the dorsal hand of aged females is also significantly lower as compared with young females. Sun-induced reduction of SC hydration is more evident on the dorsal hand of aged females than that of males (Phydration property vary with age and gender. © 2011 John Wiley & Sons A/S.

Influence of parental care on offspring hippocampal volume in young adults varies as a function of overprotection

OpenAIRE

Wang, Yinan; Song, Yiying; Li, Xueting; Zhang, Lin; Liu, Jia

2017-01-01

Parental care results in increased hippocampal volumes through adaptive stress responses in developing animals. However, human studies have not yet provided consistent findings analogous to the animal literature, possibly because parental care in humans is likely intermingled with parental overprotection, as suggested by the optimal parenting theory. Here, we tested the hypothesis that the effect of parental care on offspring hippocampal volume varies as a function of parental overprotection ...

Markers for blood-brain barrier integrity

DEFF Research Database (Denmark)

Saunders, Norman R; Dziegielewska, Katarzyna M; Møllgård, Kjeld

2015-01-01

In recent years there has been a resurgence of interest in brain barriers and various roles their intrinsic mechanisms may play in neurological disorders. Such studies require suitable models and markers to demonstrate integrity and functional changes at the interfaces between blood, brain......, and cerebrospinal fluid. Studies of brain barrier mechanisms and measurements of plasma volume using dyes have a long-standing history, dating back to the late nineteenth-century. Their use in blood-brain barrier studies continues in spite of their known serious limitations in in vivo applications. These were well...... known when first introduced, but seem to have been forgotten since. Understanding these limitations is important because Evans blue is still the most commonly used marker of brain barrier integrity and those using it seem oblivious to problems arising from its in vivo application. The introduction...

Qualitative risk assessment of subsurface barriers in applications supporting retrieval of SST waste

International Nuclear Information System (INIS)

Treat, R.L.

1994-04-01

This report provides a brief, qualitative assessment of risks associated with the potential use of impermeable surface barriers installed around and beneath Hanford Site single-shell tanks (SSTs) to support the retrieval of wastes from those tanks. These risks are compared to qualitative assessment of costs and risks associated with a case in which barriers are not used. A quantitative assessment of costs and risks associated with these two cases will be prepared and documented in a companion report. The companion report will compare quantitatively the costs and risks of several retrieval options with varying parameters, such as effectiveness of retrieval, effectiveness of subsurface barriers, and the use of surface barriers. For ease of comparison of qualitative risks, a case in which impermeable subsurface barriers are used in conjunction with another technology to remove tank waste is referred, to in this report as the Barrier Case. A case in which waste removal technologies are used without employing a subsurface barrier is referred to as the No Barrier Case. The technologies associated with each case are described in the following sections

Analysis of complete fusion excitation functions for 7Li+152Sm, 197Au and 209Bi reactions at around barrier energies

International Nuclear Information System (INIS)

Kharab, Rajesh; Chahal, Rajiv; Kumar, Rajiv

2017-01-01

In the present work we have analyzed the fusion excitation function for CF process using the simple Wong’s formula in conjunction with the energy dependent Woods-Saxon potential (EDWSP) in near barrier energy region for 7 Li+ 152 Sm, 197 Au and 209 Bi reactions

Memory for faces and voices varies as a function of sex and expressed emotion.

Science.gov (United States)

S Cortes, Diana; Laukka, Petri; Lindahl, Christina; Fischer, Håkan

2017-01-01

We investigated how memory for faces and voices (presented separately and in combination) varies as a function of sex and emotional expression (anger, disgust, fear, happiness, sadness, and neutral). At encoding, participants judged the expressed emotion of items in forced-choice tasks, followed by incidental Remember/Know recognition tasks. Results from 600 participants showed that accuracy (hits minus false alarms) was consistently higher for neutral compared to emotional items, whereas accuracy for specific emotions varied across the presentation modalities (i.e., faces, voices, and face-voice combinations). For the subjective sense of recollection ("remember" hits), neutral items received the highest hit rates only for faces, whereas for voices and face-voice combinations anger and fear expressions instead received the highest recollection rates. We also observed better accuracy for items by female expressers, and own-sex bias where female participants displayed memory advantage for female faces and face-voice combinations. Results further suggest that own-sex bias can be explained by recollection, rather than familiarity, rates. Overall, results show that memory for faces and voices may be influenced by the expressions that they carry, as well as by the sex of both items and participants. Emotion expressions may also enhance the subjective sense of recollection without enhancing memory accuracy.

Memory for faces and voices varies as a function of sex and expressed emotion.

Directory of Open Access Journals (Sweden)

Diana S Cortes

Full Text Available We investigated how memory for faces and voices (presented separately and in combination varies as a function of sex and emotional expression (anger, disgust, fear, happiness, sadness, and neutral. At encoding, participants judged the expressed emotion of items in forced-choice tasks, followed by incidental Remember/Know recognition tasks. Results from 600 participants showed that accuracy (hits minus false alarms was consistently higher for neutral compared to emotional items, whereas accuracy for specific emotions varied across the presentation modalities (i.e., faces, voices, and face-voice combinations. For the subjective sense of recollection ("remember" hits, neutral items received the highest hit rates only for faces, whereas for voices and face-voice combinations anger and fear expressions instead received the highest recollection rates. We also observed better accuracy for items by female expressers, and own-sex bias where female participants displayed memory advantage for female faces and face-voice combinations. Results further suggest that own-sex bias can be explained by recollection, rather than familiarity, rates. Overall, results show that memory for faces and voices may be influenced by the expressions that they carry, as well as by the sex of both items and participants. Emotion expressions may also enhance the subjective sense of recollection without enhancing memory accuracy.

Myosin light chain kinase knockout improves gut barrier function and confers a survival advantage in polymicrobial sepsis.

Science.gov (United States)

Lorentz, C Adam; Liang, Zhe; Meng, Mei; Chen, Ching-Wen; Yoseph, Benyam P; Breed, Elise R; Mittal, Rohit; Klingensmith, Nathan J; Farris, Alton B; Burd, Eileen M; Koval, Michael; Ford, Mandy L; Coopersmith, Craig M

2017-06-07

Sepsis-induced intestinal hyperpermeability is mediated by disruption of the epithelial tight junction, which is closely associated with the peri-junctional actin-myosin ring. Myosin light chain kinase (MLCK) phosphorylates the myosin regulatory light chain, resulting in increased permeability. The purpose of this study was to determine whether genetic deletion of MLCK would alter gut barrier function and survival from sepsis. MLCK -/- and wild type (WT) mice were subjected to cecal ligation and puncture and assayed for both survival and mechanistic studies. Survival was significantly increased in MLCK -/- mice (95% vs. 24%, p<0.0001). Intestinal permeability increased in septic WT mice compared to unmanipulated mice. In contrast, permeability in septic MLCK -/- mice was similar to that seen in unmanipulated animals. Improved gut barrier function in MLCK -/- mice was associated with increases in the tight junction mediators ZO-1 and claudin 15 without alterations in claudin 1, 2, 3, 4, 5, 7, 8, 13, occludin or JAM-A. Other components of intestinal integrity (apoptosis, proliferation and villus length) were unaffected by MLCK deletion as were local peritoneal inflammation and distant lung injury. Systemic IL-10 was decreased greater than 10-fold in MLCK -/- mice; however, survival was similar between septic MLCK -/- mice given exogenous IL-10 or vehicle. These data demonstrate that deletion of MLCK improves survival following sepsis, associated with normalization of intestinal permeability and selected tight junction proteins.

Defect-driven inhomogeneities in Ni /4H-SiC Schottky barriers

Science.gov (United States)

Tumakha, S.; Ewing, D. J.; Porter, L. M.; Wahab, Q.; Ma, X.; Sudharshan, T. S.; Brillson, L. J.

2005-12-01

Nanoscale depth-resolved cathodoluminescence spectroscopy (DRCLS) of Ni diode arrays on 4H-SiC epitaxial wafers reveals a striking correspondence between deep level defects and electrical transport measurements on a diode-by-diode basis. Current-voltage measurements display both ideal and nonideal diode characteristics due to multiple barriers within individual contacts. Near-interface DRCLS demonstrates the presence of three discrete midgap defect levels with 2.2, 2.45, and 2.65eV emission energies whose concentrations vary on a submicron scale among and within individual diodes, correlating with barrier inhomogeneity. These results also suggest that SiC native defect levels can account for the maximum range of n-type barrier heights.

The biological significance of brain barrier mechanisms

DEFF Research Database (Denmark)

Saunders, Norman R; Habgood, Mark D; Møllgård, Kjeld

2016-01-01

, but more work is required to evaluate the method before it can be tried in patients. Overall, our view is that much more fundamental knowledge of barrier mechanisms and development of new experimental methods will be required before drug targeting to the brain is likely to be a successful endeavor......Barrier mechanisms in the brain are important for its normal functioning and development. Stability of the brain's internal environment, particularly with respect to its ionic composition, is a prerequisite for the fundamental basis of its function, namely transmission of nerve impulses....... In addition, the appropriate and controlled supply of a wide range of nutrients such as glucose, amino acids, monocarboxylates, and vitamins is also essential for normal development and function. These are all cellular functions across the interfaces that separate the brain from the rest of the internal...

Functionally gradient materials for thermal barrier coatings in advanced gas turbine systems

Energy Technology Data Exchange (ETDEWEB)

Banovic, S.W.; Barmak, K.; Chan, H.M. [Lehigh Univ., Bethlehem, PA (United States)] [and others

1995-10-01

New designs for advanced gas turbine engines for power production are required to have higher operating temperatures in order to increase efficiency. However, elevated temperatures will increase the magnitude and severity of environmental degradation of critical turbine components (e.g. combustor parts, turbine blades, etc{hor_ellipsis}). To offset this problem, the usage of thermal barrier coatings (TBCs) has become popular by allowing an increase in maximum inlet temperatures for an operating engine. Although thermal barrier technology is over thirty years old, the principle failure mechanism is the spallation of the ceramic coating at or near the ceramic/bond coat interface. Therefore, it is desirable to develop a coating that combines the thermal barrier qualities of the ceramic layer and the corrosion protection by the metallic bond coat without the detrimental effects associated with the localization of the ceramic/metal interface to a single plane.

Regional increase in P-glycoprotein function in the blood-brain barrier of patients with chronic schizophrenia : A PET study with [C-11]verapamil as a probe for P-glycoprotein function

NARCIS (Netherlands)

de Klerk, Onno L.; Willemsen, Antoon T. M.; Bosker, Fokko J.; Bartels, Anna L.; Hendrikse, N. Harry; den Boer, Johan A.; Dierckx, Rudy A.

2010-01-01

P-glycoprotein (P-gp), a major efflux pump in the blood-brain barrier (BBB) has a profound effect on entry of drugs, peptides and other substances into the central nervous system (CNS). The brain's permeability can be negatively influenced by modulation of the transport function of P-gp.

Metal-semiconductor Schottky barrier junctions and their applications

CERN Document Server

1984-01-01

The present-day semiconductor technology would be inconceivable without extensive use of Schottky barrier junctions. In spite of an excellent book by Professor E.H. Rhoderick (1978) dealing with the basic principles of metal­ semiconductor contacts and a few recent review articles, the need for a monograph on "Metal-Semiconductor Schottky Barrier Junctions and Their Applications" has long been felt by students, researchers, and technologists. It was in this context that the idea of publishing such a monograph by Mr. Ellis H. Rosenberg, Senior Editor, Plenum Publishing Corporation, was considered very timely. Due to the numerous and varied applications of Schottky barrier junctions, the task of bringing it out, however, looked difficult in the beginning. After discussions at various levels, it was deemed appropriate to include only those typical applications which were extremely rich in R&D and still posed many challenges so that it could be brought out in the stipulated time frame. Keeping in view the la...

Single blinded, randomized, placebo-controlled study on the effects of ciclosporin on cutaneous barrier function and immunological response in atopic beagles.

Science.gov (United States)

White, Amelia G; Santoro, Domenico; Ahrens, Kim; Marsella, Rosanna

2018-03-01

Ciclosporin (CsA) is a common treatment for canine atopic dermatitis (cAD). cAD is a very common skin disease with a multifactorial pathogenesis due to complex interactions between the host and the environment. The purpose of this study was to describe the physical and immunological effects of CsA in cAD using a canine model of AD. Fourteen beagles were enrolled; seven received CsA orally every 24 h for 28 days, and seven received placebo. All dogs were exposed to relevant allergens, house dust mite solution, one day prior to treatment and once weekly thereafter for 28 consecutive days. Canine atopic dermatitis extent and severity index-03 (CADESI-03) and skin biopsies were performed on day 0, 14, and 28. Quantitative RT-PCR was used to determine levels of cutaneous cytokines and barrier function markers. Indirect immunofluorescence was used to determine protein expression and distribution of nuclear messengers, barrier function and inflammatory [thymic stromal lymphopoietin (TSLP)] markers. The data were tested for normality and then the upaired two samples Student's t-test and the repeated measurements ANOVA, followed by the Dunnett's Multiple Comparison Test as post-hoc analysis, were performed. A P value of immunologic milieu or barrier markers despite evident improvement of physical signs in the treatment group. Although this study confirmed the usefulness of CsA for the treatment of cAD, a clear involvement of CsA on some of the currently known immunological alterations present in cAD was not determined. However, it is important to note that there was no measurable exacerbation of skin barrier dysfunction secondary to CsA administration in this model. Copyright © 2018 Elsevier B.V. All rights reserved.

Management-retrieval code system of fission barrier parameter sub-library

International Nuclear Information System (INIS)

Zhang Limin; Su Zongdi; Ge Zhigang

1995-01-01

The fission barrier parameter (FBP) library, which is a sub-library of Chinese Evaluated Nuclear Parameter library (CENPL), stores various popular used fission barrier parameters from different historical period, and could retrieve the required fission barrier parameters by using the management retrieval code system of the FBP sub-library. The function, feature and operation instruction of the code system are described briefly

Self-regulation of turbulence bursts and transport barriers

International Nuclear Information System (INIS)

Floriani, E; Ciraolo, G; Ghendrih, Ph; Sarazin, Y; Lima, R

2013-01-01

The interplay between turbulent bursts and transport barriers is analyzed with a simplified model of interchange turbulence in magnetically confined plasmas. The turbulent bursts spread into the transport barriers and, depending on the competing magnitude of the burst and stopping capability of the barrier, can burn through. Simulations of two models of transport barriers are presented: a hard barrier where interchange turbulence modes are stable in a prescribed region and a soft barrier with external plasma biasing. The response of the transport barriers to the non-linear perturbations of the turbulent bursts, addressed in a predator–prey approach, indicates that the barriers monitor an amplification factor of the turbulent bursts, with amplification smaller than one for most bursts and, in some cases, amplification factors that can significantly exceed unity. The weak barriers in corrugated profiles and magnetic structures, as well as the standard barriers, are characterized by these transmission properties, which then regulate the turbulent burst transport properties. The interplays of barriers and turbulent bursts are modeled as competing stochastic processes. For different classes of the probability density function (PDF) of these processes, one can predict the heavy tail properties of the bursts downstream from the barrier, either exponential for a leaky barrier, or with power laws for a tight barrier. The intrinsic probing of the transport barriers by the turbulent bursts thus gives access to the properties of the barriers. The main stochastic variables are the barrier width and the spreading distance of the turbulent bursts within the barrier, together with their level of correlation. One finds that in the case of a barrier with volumetric losses, such as radiation or particle losses as addressed in our present simulations, the stochastic model predicts a leaky behavior with an exponential PDF of escaping turbulent bursts in agreement with the simulation

Qualitative Comparison of Barriers to Antiretroviral Medication Adherence Among Perinatally and Behaviorally HIV-Infected Youth.

Science.gov (United States)

Fields, Errol L; Bogart, Laura M; Thurston, Idia B; Hu, Caroline H; Skeer, Margie R; Safren, Steven A; Mimiaga, Matthew J

2017-07-01

Medication adherence among youth living with HIV (28%-69%) is often insufficient for viral suppression. The psychosocial context of adherence barriers is complex. We sought to qualitatively understand adherence barriers among behaviorally infected and perinatally infected youth and develop an intervention specific to their needs. We conducted in-depth interviews with 30 youth living with HIV (aged 14-24 years) and analyzed transcripts using the constant comparative method. Barriers were influenced by clinical and psychosocial factors. Perinatally infected youth barriers included reactance, complicated regimens, HIV fatigue, and difficulty transitioning to autonomous care. Behaviorally infected youth barriers included HIV-related shame and difficulty initiating medication. Both groups reported low risk perception, medication as a reminder of HIV, and nondisclosure, but described different contexts to these common barriers. Common and unique barriers emerged for behaviorally infected and perinatally infected youth reflecting varying HIV experiences and psychosocial contexts. We developed a customizable intervention addressing identified barriers and their psychosocial antecedents.

Potential and barrier study. Energy efficiency in Norwegian vocational buildings; Potensial- og barrierestudie. Energieffektivisering i norske yrkesbygg

Energy Technology Data Exchange (ETDEWEB)

Boehn, Trond Ivar; Palm, Linn Therese; Bakken, Line; Nossum, Aase; Jordell, Hanne

2012-07-01

On behalf of Enova SF, Multiconsult AS and Analyse og Strategi AS conducted an analysis to identify potential and barriers related to commercial buildings energy performance. The aim of this study was to determine what is the potential for energy efficiency for Norwegian vocational buildings that distinguishes between theoretical, technical, financial and real potential. Technical potential is the percentage of the theoretical potential that is technically feasible. Economic potential is the proportion of technical potential that is economically profitable to implement. Economic potential varies with the energy price. Build a small part of the total potential in 2020. In the calculation of the real potential is taken into account induced potential in terms of that, each year, a percentage actually implementing energy conservation measures (energy efficiency ratio 2%), a percentage rehabilitating / upgrading existing buildings (rehab rate 1.5%), and that a proportion of new buildings built better than regulatory requirements (rate 10%). In real potential for energy efficiency is the proportion of the economic potential that is not natural triggered but which is limited by various barriers. In real potential also varies with energy price. Respondents in our study is particularly concerned with the economic barriers, and least concerned the technical barriers. Attitudes and knowledge barriers are also very important. Lack of knowledge the effects and benefits of energy efficiency means that negative attitudes persist and that myths about the lack of profitability continues to exist. Many believe this is due to lack the knowledge and can be the cause of other types of barriers such as economic barriers. It has been analyzed which part of the real potential bounded by the barriers, and which type of institutions in society that can reduce these barriers with various categories of instrument. Main barriers for existing buildings practical barriers, economic barriers and

Alloy Dependence of Electron-Phonon Interactions in Double Barrier Structures

National Research Council Canada - National Science Library

Wallis, Corinne

1996-01-01

...)As double barrier structures as a function of the alloy concentration in the barrier. We have measured current-voltage and conductance-voltage curves associated with phonon-assisted tunneling with magnetic fields from 0 to 6.8 Tesla...

Barriers related to physical activity practice in adolescents. A focus-group study

Directory of Open Access Journals (Sweden)

Ciro Romélio Rodriguez Añez

2010-04-01

Full Text Available The aim of study was to identify barriers to physical activity in adolescents. Focus group interviews were conducted with subjects aged 15 to 18 years (n=59, 50.8% girls and divided according to gender. Content analysis was used to classify the reports into specific dimensions. Descriptive statistics employing relative and absolute frequencies of similar reports was performed using the SPSS 11.0 software. The most frequent barriers among adolescents were those associated with “psychological, cognitive and emotional” and “cultural and social” dimensions. For boys, the most frequently reported barriers were “feeling lazy”, “lack of company” and “lack of time”. For girls, “feeling lazy”, “lack of com-pany” and “occupation” were the most common barriers. In conclusion, the perception of barriers by adolescents varies according to gender, a fact requiring specific actions for the promotion of physical activity in this group.

Abl family kinases regulate endothelial barrier function in vitro and in mice.

Directory of Open Access Journals (Sweden)

Elizabeth M Chislock

Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

A spectral blanking-out controller for demonstration of information barrier technology

International Nuclear Information System (INIS)

Liu Suping; Gong Jian; Hu Guangchun; Zhang Jianhua

2006-01-01

Information barrier technology has become more and more important in the R and D of radiation fingerprint verification associated with classified items such as nuclear warheads, nuclear components and military-used nuclear materials. The function of information barriers is two-fold: one is to prevent the classified information from leaking out; the other is to provide creditable verification. To fulfill these two functions, the information barriers for a viable verification system (including all its hardware and software) must be designed on the basic principles of protecting classified information and the ability to authenticate. The Spectral Blanking-out Controller (SBC) is developed to illustrate the two functions of the information barriers and to explore some practice measures to meet the required design fundamentals. This paper briefs the task assigned to the SBC, the specific design concerns and the practical information barrier measures. The R and D of the SBC embodies the concepts of information barrier technology and has to conform to the basic guidelines: If a verification system is expected to possess strict information barriers, the design of the system must be integrative with due considerations given to the factors such as the efficiency of the verification technique, the possible measures to protect the classified information from directly or indirectly leaking out, the complete openness in all aspects of the system for the inspectors to authenticate the system for the sake of achieving certain degree of confidence on the verification results. (authors)

The biofiltration permeable reactive barrier: Practical experience from Synthesia

Energy Technology Data Exchange (ETDEWEB)

Vesela, L.; Nemecek, J.; Siglova, M.; Kubal, M. [DEKONTA, Prague (Czech Republic)

2006-10-15

The paper refers to utilization of biological elements within permeable reactive barriers. The concept of a biofiltration permeable barrier has been tested in the laboratory and in pilot-scale. Oxyhumolite (oxidized young lignite) was examined as an absorption material and a biofilm carrier. Laboratory tests performed before the pilot verification confirmed that oxyhumolite adsorbs organic pollutants at a minimum value, but that it can be used for biofilm attachment. An experimental barrier was built on premises of a chemical factory contaminated mainly by various organic pollutants (benzene, toluene, ethylbenzene, and xylenes (BTEX), chlorobenzenes, naphthalene, nitro-derivatives, phenols, trichloroethylene (TCE), and total petroleum hydrocarbon (TPH)). Before the barrier was installed, a preliminary survey of the unsaturated zone, hydrogeological investigation, and a microbiological survey had been performed. The barrier was designed as a trench-and-gate system with an in situ bioreactor. During the year 2004, measurements of groundwater flux and retention time under current hydrological conditions, together with chemical and microbiological monitoring, were carried out on the site. The results showed high effectiveness of organic contamination removal. Average elimination varied from 57.3% (naphthalene) to 99.9% (nitro-derivatives, BTEX); microbial density in the bioreactor was approx. 10{sup 5} CFU mL{sup -1}.

Electron optics with magnetic vector potential barriers in graphene

International Nuclear Information System (INIS)

Ghosh, Sankalpa; Sharma, Manish

2009-01-01

An analysis of electron transport in graphene in the presence of various arrangements of delta-function like magnetic barriers is presented. The motion through one such barrier gives an unusual non-specular refraction leading to asymmetric transmission. The symmetry is restored by putting two such barriers in opposite directions side by side. Periodic arrangements of such barriers can be used as Bragg reflectors whose reflectivity has been calculated using a transfer matrix formalism. Such Bragg reflectors can be used to make resonant cavities. We also analyze the associated band structure for the case of infinite periodic structures. (fast track communication)

Systems pharmacology and blood-brain barrier functionality in Parkinson's disease

NARCIS (Netherlands)

Ravenstijn, Paulien Gerarda Maria

2009-01-01

Parkinson’s disease is a progressive neurodegenerative disease, which is composed of many components, each caused by interplay of a number of genetic and nongenetic causes. As the blood-brain barrier (BBB) is a key player in the relationship between plasma and brain pharmacokinetics, the influences

Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

International Nuclear Information System (INIS)

Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

2010-01-01

The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

Energy Technology Data Exchange (ETDEWEB)

Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

2010-07-02

The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

Sprache als Barriere (Language as a Barrier)

Science.gov (United States)

Mattheier, Klaus

1974-01-01

The concept of language barrier has its derivations in the fields of dialectology, sociology and psychology. In contemporary usage however, the concept has two meanings i.e. regional-cultural barrier and socio-cultural barrier. (Text is in German.) (DS)

South African Teachers' Attitudes toward Learners with Barriers to Learning: Attention-Deficit and Hyperactivity Disorder and Little or No Functional Speech

Science.gov (United States)

Bornman, Juan; Donohue, Dana K.

2013-01-01

This study examined teachers' attitudes toward learners with two types of barriers to learning: a learner with attention-deficit and hyperactivity disorder (ADHD), and a learner with little or no functional speech (LNFS). The results indicated that although teachers reported that the learner with ADHD would be more disruptive in class and have a…

Shakeoff Ionization near the Coulomb Barrier Energy

Science.gov (United States)

Sharma, Prashant; Nandi, T.

2017-11-01

We measure the projectile K x-ray spectra as a function of the beam energies around the Coulomb barrier in different collision systems. The energy is scanned in small steps around the barrier aiming to explore the nuclear effects on the elastically scattered projectile ions. The variation of the projectile x-ray energy with the ion-beam energies exhibits an unusual increase in between the interaction barrier and fusion barrier energies. This additional contribution to the projectile ionization can be attributed to the shakeoff of outer-shell electrons of the projectile ions due to the sudden nuclear recoil (˜10-21 sec ) caused by the attractive nuclear potential, which gets switched on near the interaction barrier energy. In the sudden approximation limit, the theoretical shakeoff probability calculation due to the nuclear recoil explains the observed data well. In addition to its fundamental interest, such processes can play a significant role in dark matter detection through the possible mechanism of x-ray emissions, where the weakly interacting massive particle-nucleus elastic scattering can lead to the nuclear-recoil-induced inner-shell vacancy creations. Furthermore, the present work may provide new prospects for atomic physics research at barrier energies as well as provide a novel technique to perform barrier distribution studies for two-body systems.

Acute exposure to ergot alkaloids from endophyte-infected tall fescue does not alter absorptive or barrier function of the isolated bovine ruminal epithelium.

Science.gov (United States)

Foote, A P; Penner, G B; Walpole, M E; Klotz, J L; Brown, K R; Bush, L P; Harmon, D L

2014-07-01

Ergot alkaloids in endophyte-infected (Neotyphodium coenophialum) tall fescue (Lolium arundinaceum) have been shown to cause a reduction in blood flow to the rumen epithelium as well as a decrease in volatile fatty acids (VFA) absorption from the washed rumen of steers. Previous data also indicates that incubating an extract of endophyte-infected tall fescue seed causes an increase in the amount of VFA absorbed per unit of blood flow, which could result from an alteration in the absorptive or barrier function of the rumen epithelium. An experiment was conducted to determine the acute effects of an endophyte-infected tall fescue seed extract (EXT) on total, passive or facilitated acetate and butyrate flux across the isolated bovine rumen as well as the barrier function measured by inulin flux and tissue conductance (G t ). Flux of ergovaline across the rumen epithelium was also evaluated. Rumen tissue from the caudal dorsal sac of Holstein steers (n=6), fed a common diet, was collected and isolated shortly after slaughter and mounted between two halves of Ussing chambers. In vitro treatments included vehicle control (80% methanol, 0.5% of total volume), Low EXT (50 ng ergovaline/ml) and High EXT (250 ng ergovaline/ml). Results indicate that there is no effect of acute exposure to ergot alkaloids on total, passive or facilitated flux of acetate or butyrate across the isolate bovine rumen epithelium (P>0.51). Inulin flux (P=0.16) and G t (P>0.17) were not affected by EXT treatment, indicating no alteration in barrier function due to acute ergot alkaloid exposure. Ergovaline was detected in the serosal buffer of the High EXT treatment indicating that the flux rate is ~0.25 to 0.44 ng/cm2 per hour. Data indicate that specific pathways for VFA absorption and barrier function of the rumen epithelium are not affected by acute exposure to ergot alkaloids from tall fescue at the concentrations tested. Ergovaline has the potential to be absorbed from the rumen of cattle that

Hydraulic performance of permeable barriers for in situ treatment of contaminated groundwater

International Nuclear Information System (INIS)

Smyth, D.J.A.; Shikaze, S.G.; Cherry, J.A.

1997-01-01

The passive interception and in situ treatment of dissolved contaminants in groundwater by permeable reactive barriers has recently gained favor at an increasing number of sites as an alternative to conventional approaches to groundwater remediation such as the pump-and-treat method. Permeable reactive barriers have two essential functions. The first is that the barriers must be installed in a position such that all of the plume passes through the reactive system. The second function is to achieve acceptable treatment of the contamination by physical, chemical or biological means within or downgradient of the barrier. In this paper, issues associated with the hydraulic performance of permeable reaction barriers are evaluated using a three-dimensional groundwater flow model. The efficiency of plume capture by permeable wall and funnel-and-gate systems is examined for some generic and for site-specific hydrogeologic systems. The results have important implications to decisions pertaining to the selection, design and installation of permeable reactive barrier systems

Multi-functional energy plantation; Multifunktionella bioenergiodlingar

Energy Technology Data Exchange (ETDEWEB)

Boerjesson, Paal [Lund Univ. (Sweden). Environmental and Energy Systems Studies; Berndes, Goeran; Fredriksson, Fredrik [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Physical Resource Theory; Kaaberger, Tomas [Ecotraffic, Goeteborg (Sweden)

2002-02-01

plantations established at specific locations, or on a certain type of soil. The concept of multi-functional energy plantations accentuate the need of synchronising agricultural, environmental and energy policies. Structural barriers, such as farm size, type of production etc., are relevant both for conventional and multi-functional energy production. It is here estimated that the risk of such barriers is lowest in regions with intensively managed farmland which normally holds a higher share of large farms producing food crops. These regions also have the highest need for the environmental services discussed here. The occurrence of technical/physical barriers in form of possible future limitations in the need of energy crops varies between different regions in Sweden. In some counties in forest regions there exist a surplus of biomass in form of forest fuels, also when the need of biomass increase significantly in the future. (abstract truncated)

Distinct Shifts in Microbiota Composition during Drosophila Aging Impair Intestinal Function and Drive Mortality

Directory of Open Access Journals (Sweden)

Rebecca I. Clark

2015-09-01

Full Text Available Alterations in the composition of the intestinal microbiota have been correlated with aging and measures of frailty in the elderly. However, the relationships between microbial dynamics, age-related changes in intestinal physiology, and organismal health remain poorly understood. Here, we show that dysbiosis of the intestinal microbiota, characterized by an expansion of the Gammaproteobacteria, is tightly linked to age-onset intestinal barrier dysfunction in Drosophila. Indeed, alterations in the microbiota precede and predict the onset of intestinal barrier dysfunction in aged flies. Changes in microbial composition occurring prior to intestinal barrier dysfunction contribute to changes in excretory function and immune gene activation in the aging intestine. In addition, we show that a distinct shift in microbiota composition follows intestinal barrier dysfunction, leading to systemic immune activation and organismal death. Our results indicate that alterations in microbiota dynamics could contribute to and also predict varying rates of health decline during aging in mammals.

Noninvasive evaluation of the barrier properties of the skin

Directory of Open Access Journals (Sweden)

Utz S.R.

2014-09-01

Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.

Barriers and opportunities: A review of selected successful energy-efficiency programs

International Nuclear Information System (INIS)

Worrell, Ernst; Price, Lynn

2001-01-01

In industry, barriers may exist at various points in the decision making process, and in the implementation and management of measures to improve energy efficiency. Barriers may take many forms, and are determined by the business environment and include decision-making processes, energy prices, lack of information, a lack of confidence in the information, or high transaction costs for obtaining reliable information, as well as limited capital availability. Other barriers are the ''invisibility'' of energy efficiency measures and the difficulty of quantifying the impacts, and slow diffusion of innovative technology into markets while firms typically under-invest in R and D, despite the high pay-backs. Various programs try to reduce the barriers to improve the uptake of innovative technologies. A wide array of policies has been used and tested in the industrial sector in industrialized countries, with varying success rates. We review some new approaches to industrial energy efficiency improvement in industrialized countries, focusing on voluntary agreements

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

A novel method of calculating the energy deposition curve of nanosecond pulsed surface dielectric barrier discharge

International Nuclear Information System (INIS)

He, Kun; Wang, Xinying; Lu, Jiayu; Cui, Quansheng; Pang, Lei; Di, Dongxu; Zhang, Qiaogen

2015-01-01

To obtain the energy deposition curve is very important in the fields to which nanosecond pulse dielectric barrier discharges (NPDBDs) are applied. It helps the understanding of the discharge physics and fast gas heating. In this paper, an equivalent circuit model, composed of three capacitances, is introduced and a method of calculating the energy deposition curve is proposed for a nanosecond pulse surface dielectric barrier discharge (NPSDBD) plasma actuator. The capacitance C d and the energy deposition curve E R are determined by mathematically proving that the mapping from C d to E R is bijective and numerically searching one C d that satisfies the requirement for E R to be a monotonically non-decreasing function. It is found that the value of capacitance C d varies with the amplitude of applied pulse voltage due to the change of discharge area and is dependent on the polarity of applied voltage. The bijectiveness of the mapping from C d to E R in nanosecond pulse volumetric dielectric barrier discharge (NPVDBD) is demonstrated and the feasibility of the application of the new method to NPVDBD is validated. This preliminarily shows a high possibility of developing a unified approach to calculate the energy deposition curve in NPDBD. (paper)

Plasma sprayed and electrospark deposited zirconium metal diffusion barrier coatings

International Nuclear Information System (INIS)

Hollis, Kendall J.; Pena, Maria I.

2010-01-01

Zirconium metal coatings applied by plasma spraying and electrospark deposition (ESD) have been investigated for use as diffusion barrier coatings on low enrichment uranium fuel for research nuclear reactors. The coatings have been applied to both stainless steel as a surrogate and to simulated nuclear fuel uranium-molybdenum alloy substrates. Deposition parameter development accompanied by coating characterization has been performed. The structure of the plasma sprayed coating was shown to vary with transferred arc current during deposition. The structure of ESD coatings was shown to vary with the capacitance of the deposition equipment.

Multistability of memristive Cohen-Grossberg neural networks with non-monotonic piecewise linear activation functions and time-varying delays.

Science.gov (United States)

Nie, Xiaobing; Zheng, Wei Xing; Cao, Jinde

2015-11-01

The problem of coexistence and dynamical behaviors of multiple equilibrium points is addressed for a class of memristive Cohen-Grossberg neural networks with non-monotonic piecewise linear activation functions and time-varying delays. By virtue of the fixed point theorem, nonsmooth analysis theory and other analytical tools, some sufficient conditions are established to guarantee that such n-dimensional memristive Cohen-Grossberg neural networks can have 5(n) equilibrium points, among which 3(n) equilibrium points are locally exponentially stable. It is shown that greater storage capacity can be achieved by neural networks with the non-monotonic activation functions introduced herein than the ones with Mexican-hat-type activation function. In addition, unlike most existing multistability results of neural networks with monotonic activation functions, those obtained 3(n) locally stable equilibrium points are located both in saturated regions and unsaturated regions. The theoretical findings are verified by an illustrative example with computer simulations. Copyright © 2015 Elsevier Ltd. All rights reserved.

Response function of an HPGe detector simulated through MCNP 4A varying the density and chemical composition of the matrix

International Nuclear Information System (INIS)

Leal A, B.; Mireles G, F.; Quirino T, L.; Pinedo, J.L.

2005-01-01

In the area of the Radiological Safety it is required of a calibrated detection system in energy and efficiency for the determination of the concentration in activity in samples that vary in chemical composition and by this in density. The area of Nuclear Engineering requires to find the grade of isotopic enrichment of the uranium of the Sub-critic Nuclear Chicago 9000 Mark. Given the experimental importance that has the determination from the curves of efficiency to the effects of establishing the quantitative results, is appealed to the simulation of the response function of the detector used in the Regional Center of Nuclear Studies inside the range of energy of 80 keV to 1400 keV varying the density of the matrix and the chemical composition by means of the application of the Monte Carlo code MCNP-4A. The obtained results in the simulation of the response function of the detector show a grade of acceptance in the range from 500 to 1400 keV energy, with a smaller percentage discrepancy to 10%, in the range of low energy that its go from 59 to 400 keV, the percentage discrepancy varies from 17% until 30%, which is manifested in the opposing isotopic relationship for 5 fuel rods of the Sub critic nuclear assemble. (Author)

Na+/K+-ATPase α1 identified as an abundant protein in the blood-labyrinth barrier that plays an essential role in the barrier integrity.

Directory of Open Access Journals (Sweden)

Yue Yang

2011-01-01

Full Text Available The endothelial-blood/tissue barrier is critical for maintaining tissue homeostasis. The ear harbors a unique endothelial-blood/tissue barrier which we term "blood-labyrinth-barrier". This barrier is critical for maintaining inner ear homeostasis. Disruption of the blood-labyrinth-barrier is closely associated with a number of hearing disorders. Many proteins of the blood-brain-barrier and blood-retinal-barrier have been identified, leading to significant advances in understanding their tissue specific functions. In contrast, capillaries in the ear are small in volume and anatomically complex. This presents a challenge for protein analysis studies, which has resulted in limited knowledge of the molecular and functional components of the blood-labyrinth-barrier. In this study, we developed a novel method for isolation of the stria vascularis capillary from CBA/CaJ mouse cochlea and provided the first database of protein components in the blood-labyrinth barrier as well as evidence that the interaction of Na(+/K(+-ATPase α1 (ATP1A1 with protein kinase C eta (PKCη and occludin is one of the mechanisms of loud sound-induced vascular permeability increase.Using a mass-spectrometry, shotgun-proteomics approach combined with a novel "sandwich-dissociation" method, more than 600 proteins from isolated stria vascularis capillaries were identified from adult CBA/CaJ mouse cochlea. The ion transporter ATP1A1 was the most abundant protein in the blood-labyrinth barrier. Pharmacological inhibition of ATP1A1 activity resulted in hyperphosphorylation of tight junction proteins such as occludin which increased the blood-labyrinth-barrier permeability. PKCη directly interacted with ATP1A1 and was an essential mediator of ATP1A1-initiated occludin phosphorylation. Moreover, this identified signaling pathway was involved in the breakdown of the blood-labyrinth-barrier resulting from loud sound trauma.The results presented here provide a novel method for

Compliance with barrier precautions during paediatric trauma resuscitations.

Science.gov (United States)

Kelleher, Deirdre C; Carter, Elizabeth A; Waterhouse, Lauren J; Burd, Randall S

2013-03-01

Barrier precautions protect patients and providers from blood-borne pathogens. Although barrier precaution compliance has been shown to be low among adult trauma teams, it has not been evaluated during paediatric resuscitations in which perceived risk of disease transmission may be low. The purpose of this study was to identify factors associated with compliance with barrier precautions during paediatric trauma resuscitations. Video recordings of resuscitations performed on injured children (compliance with an established policy requiring gowns and gloves. Depending on activation level, trauma team members included up to six physicians, four nurses, and a respiratory therapist. Multivariate logistic regression was used to determine the effect of team role, resuscitation factors, and injury mechanism on barrier precaution compliance. Over twelve weeks, 1138 trauma team members participated in 128 resuscitations (4.7% penetrating injuries, 9.4% highest level activations). Compliance with barrier precautions was 81.3%, with higher compliance seen among roles primarily at the bedside compared to positions not primarily at the bedside (90.7% vs. 65.1%, pcompliance, while surgical attendings (20.8%) had the lowest (prole, increased compliance was observed during resuscitations of patients with penetrating injuries (OR=3.97 [95% CI: 1.35-11.70], p=0.01), during resuscitations triaged to the highest activation level (OR=2.61 [95% CI: 1.34-5.10], p=0.005), and among team members present before patient arrival (OR=4.14 [95% CI: 2.29-7.39], pCompliance with barrier precautions varies by trauma team role. Team members have higher compliance when treating children with penetrating and high acuity injuries and when arriving before the patient. Interventions integrating barrier precautions into the workflow of team members are needed to reduce this variability and improve compliance with universal precautions during paediatric trauma resuscitations. Copyright © 2012 Elsevier

Desmoglein 2 regulates the intestinal epithelial barrier via p38 mitogen-activated protein kinase.

Science.gov (United States)

Ungewiß, Hanna; Vielmuth, Franziska; Suzuki, Shintaro T; Maiser, Andreas; Harz, Hartmann; Leonhardt, Heinrich; Kugelmann, Daniela; Schlegel, Nicolas; Waschke, Jens

2017-07-24

Intestinal epithelial barrier properties are maintained by a junctional complex consisting of tight junctions (TJ), adherens junctions (AJ) and desmosomes. Desmoglein 2 (Dsg2), an adhesion molecule of desmosomes and the only Dsg isoform expressed in enterocytes, is required for epithelial barrier properties and may contribute to barrier defects in Crohn's disease. Here, we identified extradesmosomal Dsg2 on the surface of polarized enterocytes by Triton extraction, confocal microscopy, SIM and STED. Atomic force microscopy (AFM) revealed Dsg2-specific binding events along the cell border on the surface of enterocytes with a mean unbinding force of around 30pN. Binding events were blocked by an inhibitory antibody targeting Dsg2 which under same conditions activated p38MAPK but did not reduce cell cohesion. In enterocytes deficient for Dsg2, p38MAPK activity was reduced and both barrier integrity and reformation were impaired. Dsc2 rescue did not restore p38MAPK activity indicating that Dsg2 is required. Accordingly, direct activation of p38MAPK in Dsg2-deficient cells enhanced barrier reformation demonstrating that Dsg2-mediated activation of p38MAPK is crucial for barrier function. Collectively, our data show that Dsg2, beside its adhesion function, regulates intestinal barrier function via p38MAPK signalling. This is in contrast to keratinocytes and points towards tissue-specific signalling functions of desmosomal cadherins.

Barrier pillar between production panels in coal mine

Energy Technology Data Exchange (ETDEWEB)

Zingano, Andre Cezar; Koppe, Jair Carlos; Costa, Joao Felipe C.L. [Universidade Federal do Rio Grande do Sul, Porto Alegre (Brazil)

2007-07-01

The function of the barrier pillar is to protect the mining panel in activity from the abutment load of adjacent mining panels that were mined. In the case of underground mines in Santa Catarina State, the barrier pillar has functioned to protect the main entries of the mine against pillar failure from old mining panels. The objective of this paper is to verify the application of the empirical method to design barrier pillars as proposed by Peng (1986), using numerical simulation following the mining geometry of the coal mines in Santa Catarina State. Two-dimensional numerical models were built taking into account the geometry of the main entries and mining panels for different overburden thickness, and considering the geomechanical properties for the rock mass that forms the roof-pillar-floor system for the Bonito coal vein. The results of the simulations showed that the empirical method to determine the barrier pillar width is valid for the studied coal vein and considered mine geometry. Neither did the pillar at the main entry become overstressed due to adjacent mine panels, nor did the roof present any failure due to stress redistribution. 9 refs., 6 figs., 5 tabs.

On the performance of capillary barriers as landfill cover

Science.gov (United States)

Kämpf, M.; Montenegro, H.

Landfills and waste heaps require an engineered surface cover upon closure. The capping system can vary from a simple soil cover to multiple layers of earth and geosynthetic materials. Conventional design features a compacted soil layer, which suffers from drying out and cracking, as well as root and animal intrusion. Capillary barriers consisting of inclined fine-over-coarse soil layers are investigated as an alternative cover system. Under unsaturated conditions, the textural contrast delays vertical drainage by capillary forces. The moisture that builds up above the contact will flow downdip along the interface of the layers. Theoretical studies of capillary barriers have identified the hydraulic properties of the layers, the inclination angle, the length of the field and the infiltration rate as the fundamental characteristics of the system. However, it is unclear how these findings can lead to design criteria for capillary barriers. To assess the uncertainty involved in such approaches, experiments have been carried out in a 8 m long flume and on large scale test sites (40 m x 15 m). In addition, the ability of a numerical model to represent the relevant flow processes in capillary barriers has been examined.

On the performance of capillary barriers as landfill cover

Directory of Open Access Journals (Sweden)

M. Kämpf

1997-01-01

Full Text Available Landfills and waste heaps require an engineered surface cover upon closure. The capping system can vary from a simple soil cover to multiple layers of earth and geosynthetic materials. Conventional design features a compacted soil layer, which suffers from drying out and cracking, as well as root and animal intrusion. Capillary barriers consisting of inclined fine-over-coarse soil layers are investigated as an alternative cover system. Under unsaturated conditions, the textural contrast delays vertical drainage by capillary forces. The moisture that builds up above the contact will flow downdip along the interface of the layers. Theoretical studies of capillary barriers have identified the hydraulic properties of the layers, the inclination angle, the length of the field and the infiltration rate as the fundamental characteristics of the system. However, it is unclear how these findings can lead to design criteria for capillary barriers. To assess the uncertainty involved in such approaches, experiments have been carried out in a 8 m long flume and on large scale test sites (40 m x 15 m. In addition, the ability of a numerical model to represent the relevant flow processes in capillary barriers has been examined.

Return-to-work barriers for workers with contact dermatitis.

Science.gov (United States)

Holness, D Linn

2003-12-01

There is little information available regarding barriers to return-to-work (RTW) in workers with contact dermatitis. The purpose of this study was to survey occupational health and safety personnel to determine their perceptions regarding RTW barriers for workers with contact dermatitis. The study was conducted during an occupational health and safety research conference attended by stakeholders from labour, management, injured workers, government, safety associations, occupational health and safety practitioners and researchers. The attendees were presented with 3 pictures of varying degrees of work-related hand contact dermatitis and were asked to list the 3 key barriers or challenges in RTW for individuals with contact dermatitis. 21 individuals completed the survey. Issues identified in descending order of frequency were concern of ongoing dermatitis, ability to do the job safely, appearance, ability to accommodate, personal protective equipment, fear that the rash was contagious, workplace attitudes and pain. While some of these issues are potentially common to RTW situations in general, others are more specific to health problems which have a visible manifestation. Increased awareness of and attention to these possible barriers to RTW may lead to better RTW outcomes.

Methamphetamine Effects on Blood-Brain Barrier Structure and Function

Directory of Open Access Journals (Sweden)

Nicole Alia Northrop

2015-03-01

Full Text Available Methamphetamine (Meth is a widely abuse psychostimulant. Traditionally, studies have focused on the neurotoxic effects of Meth on monoaminergic neurotransmitter terminals. Recently, both in vitro and in vivo studies have investigated the effects of Meth on the BBB and found that Meth produces a decrease in BBB structural proteins and an increase in BBB permeability to various molecules. Moreover, preclinical studies are validated by clinical studies in which human Meth users have increased concentrations of toxins in the brain. Therefore, this review will focus on the structural and functional disruption of the BBB caused by Meth and the mechanisms that contribute to Meth-induced BBB disruption. The review will reveal that the mechanisms by which Meth damages dopamine and serotonin terminals are similar to the mechanisms by which the blood-brain barrier (BBB is damaged. Furthermore, this review will cover the factors that are known to potentiate the effects of Meth on the BBB, such as stress and HIV, both of which are co-morbid conditions associated with Meth abuse. Overall, the goal of this review is to demonstrate that the scope of damage produced by Meth goes beyond damage to monoaminergic neurotransmitter systems to include BBB disruption as well as provide a rationale for investigating therapeutics to treat Meth-induced BBB disruption. Since a breach of the BBB can have a multitude of consequences, therapies directed towards the treatment of BBB disruption may help to ameliorate the long-term neurodegeneration and cognitive deficits produced by Meth and possibly even Meth addiction.

Quantum coherence in the reflection of above barrier wavepackets

Science.gov (United States)

Petersen, Jakob; Pollak, Eli

2018-02-01

The quantum phenomenon of above barrier reflection is investigated from a time-dependent perspective using Gaussian wavepackets. The transition path time distribution, which in principle is experimentally measurable, is used to study the mean flight times ⟨t⟩R and ⟨t⟩T associated with the reflection and the transmission over the barrier paying special attention to their dependence on the width of the barrier. Both flight times, and their difference Δt, exhibit two distinct regimes depending on the ratio of the spatial width of the incident wavepacket and the length of the barrier. When the ratio is larger than unity, the reflection and transmission dynamics are coherent and dominated by the resonances above the barrier. The flight times ⟨t⟩R/T and the flight time difference Δt oscillate as a function of the barrier width (almost in phase with the transmission probability). These oscillations reflect a momentum filtering effect related to the coherent superposition of the reflected and transmitted waves. For a ratio less than unity, the barrier reflection and transmission dynamics are incoherent and the oscillations are absent. The barrier width which separates the coherent and incoherent regimes is identified analytically. The oscillatory structure of the time difference Δt as a function of the barrier width in the coherent regime is absent when considered in terms of the Wigner phase time delays for reflection and transmission. We conclude that the Wigner phase time does not correctly describe the temporal properties of above barrier reflection. We also find that the structure of the reflected and transmitted wavepackets depends on the coherence of the process. In the coherent regime, the wavepackets can have an overlapping peak structure, but the peaks are not fully resolved. In the incoherent regime, the wavepackets split in time into distinct separated Gaussian like waves, each one reflecting the number of times the wavepacket crosses the barrier

Analysing how plants in coastal wetlands respond to varying tidal regimes throughout their life cycles.

Science.gov (United States)

Xie, Tian; Cui, Baoshan; Li, Shanze

2017-10-15

Important to conserve plant species in coastal wetlands throughout their life cycle. All life stages in these habitats are exposed to varying tidal cycles. It is necessary to investigate all life stages as to how they respond to varying tidal regimes. We examine three wetlands containing populations of an endangered halophyte species, each subjected to different tidal regimes: (1). wetlands completely closed to tidal cycles; (2). wetlands directly exposed to tidal cycles (3). wetlands exposed to a partially closed tidal regime. Our results showed that the most threatened stage varied between wetlands subjected to these varying tidal regimes. We hypothesis that populations of this species have adapted to these different tidal regimes. Such information is useful in developing management options for coastal wetlands and modifying future barriers restricting tidal flushing. Copyright © 2017 Elsevier Ltd. All rights reserved.

Lysosomal storage diseases and the blood-brain barrier.

Science.gov (United States)

Begley, David J; Pontikis, Charles C; Scarpa, Maurizio

2008-01-01

The blood-brain barrier becomes a crucial issue in neuronopathic lysosomal storage diseases for three reasons. Firstly, the function of the blood-brain barrier may be compromised in many of the lysosomal storage diseases and this barrier dysfunction may contribute to the neuropathology seen in the diseases and accelerate cell death. Secondly, the substrate reduction therapies, which successfully reduce peripheral lysosomal storage, because of the blood-brain barrier may not have as free an access to brain cells as they do to peripheral cells. And thirdly, enzyme replacement therapy appears to have little access to the central nervous system as the mannose and mannose-6-phosphate receptors involved in their cellular uptake and transport to the lysosome do not appear to be expressed at the adult blood-brain barrier. This review will discuss in detail these issues and their context in the development of new therapeutic strategies.

Adaptive Importance Sampling with a Rapidly Varying Importance Function

International Nuclear Information System (INIS)

Booth, Thomas E.

2000-01-01

It is known well that zero-variance Monte Carlo solutions are possible if an exact importance function is available to bias the random walks. Monte Carlo can be used to estimate the importance function. This estimated importance function then can be used to bias a subsequent Monte Carlo calculation that estimates an even better importance function; this iterative process is called adaptive importance sampling.To obtain the importance function, one can expand the importance function in a basis such as the Legendre polynomials and make Monte Carlo estimates of the expansion coefficients. For simple problems, Legendre expansions of order 10 to 15 are able to represent the importance function well enough to reduce the error geometrically by ten orders of magnitude or more. The more complicated problems are addressed in which the importance function cannot be represented well by Legendre expansions of order 10 to 15. In particular, a problem with a cross-section notch and a problem with a discontinuous cross section are considered

Molecular Characterization of Barrier Properties in Follicle-Associated Epithelium of Porcine Peyer's Patches Reveals Major Sealing Function of Claudin-4

Directory of Open Access Journals (Sweden)

Judith Radloff

2017-08-01

Full Text Available The pig represents a preferred model for the analysis of intestinal immunology. However, the barrier of the follicle-associated epithelium (FAE covering porcine Peyer's patches (PP has not yet been characterized in detail. This study aimed to perform this characterization in order to pave the way toward an understanding of the functional contribution of epithelial barrier properties in gut immunology. Porcine tissue specimens were taken from the distal small intestine in order to obtain electrophysiological data of PP FAE and neighboring villous epithelium (VE, employing the Ussing chamber technique. Transepithelial resistance (TER and paracellular fluorescein flux were measured, and tissues were morphometrically compared. In selfsame tissues, expression and localization of major tight junction (TJ proteins (claudin-1, -2, -3, -4, -5, and -8 were analyzed. PP FAE specimens showed a higher TER and a lower apparent permeability for sodium fluorescein than VE. Immunoblotting revealed an expression of all claudins within both epithelia, with markedly stronger expression of the sealing TJ protein claudin-4 in PP FAE compared with the neighboring VE. Immunohistochemistry confirmed the expression and localization of all claudins in both PP FAE and VE, with stronger claudin-4 abundance in PP FAE. The results are in accordance with the physiological function of the FAE, which strongly regulates and limits antigen uptake determining a mandatory transcellular route for antigen presentation, highlighting the importance of this structure for the first steps of the intestinal immune response. Thus, this study provides detailed insights into the specific barrier properties of the porcine FAE covering intestinal PP, at the interface of intestinal immunology and barriology.

Airway Epithelial Barrier Dysfunction in Chronic Obstructive Pulmonary Disease: Role of Cigarette Smoke Exposure.

Science.gov (United States)

Aghapour, Mahyar; Raee, Pourya; Moghaddam, Seyed Javad; Hiemstra, Pieter S; Heijink, Irene H

2018-02-01

The epithelial lining of the airway forms the first barrier against environmental insults, such as inhaled cigarette smoke, which is the primary risk factor for the development of chronic obstructive pulmonary disease (COPD). The barrier is formed by airway epithelial junctions, which are interconnected structures that restrict permeability to inhaled pathogens and environmental stressors. Destruction of the epithelial barrier not only exposes subepithelial layers to hazardous agents in the inspired air, but also alters the normal function of epithelial cells, which may eventually contribute to the development of COPD. Of note, disruption of epithelial junctions may lead to modulation of signaling pathways involved in differentiation, repair, and proinflammatory responses. Epithelial barrier dysfunction may be particularly relevant in COPD, where repeated injury by cigarette smoke exposure, pathogens, inflammatory mediators, and impaired epithelial regeneration may compromise the barrier function. In the current review, we discuss recent advances in understanding the mechanisms of barrier dysfunction in COPD, as well as the molecular mechanisms that underlie the impaired repair response of the injured epithelium in COPD and its inability to redifferentiate into a functionally intact epithelium.

Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation

DEFF Research Database (Denmark)

Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina

2007-01-01

12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...

Trends and barriers to lateral gene transfer in prokaryotes.

Science.gov (United States)

Popa, Ovidiu; Dagan, Tal

2011-10-01

Gene acquisition by lateral gene transfer (LGT) is an important mechanism for natural variation among prokaryotes. Laboratory experiments show that protein-coding genes can be laterally transferred extremely fast among microbial cells, inherited to most of their descendants, and adapt to a new regulatory regime within a short time. Recent advance in the phylogenetic analysis of microbial genomes using networks approach reveals a substantial impact of LGT during microbial genome evolution. Phylogenomic networks of LGT among prokaryotes reconstructed from completely sequenced genomes uncover barriers to LGT in multiple levels. Here we discuss the kinds of barriers to gene acquisition in nature including physical barriers for gene transfer between cells, genomic barriers for the integration of acquired DNA, and functional barriers for the acquisition of new genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Barriers to Liposomal Gene Delivery: from Application Site to the Target.

Science.gov (United States)

Saffari, Mostafa; Moghimi, Hamid Reza; Dass, Crispin R

2016-01-01

Gene therapy is a therapeutic approach to deliver genetic material into cells to alter their function in entire organism. One promising form of gene delivery system (DDS) is liposomes. The success of liposome-mediated gene delivery is a multifactorial issue and well-designed liposomal systems might lead to optimized gene transfection particularly in vivo. Liposomal gene delivery systems face different barriers from their site of application to their target, which is inside the cells. These barriers include presystemic obstacles (epithelial barriers), systemic barriers in blood circulation and cellular barriers. Epithelial barriers differ depending on the route of administration. Systemic barriers include enzymatic degradation, binding and opsonisation. Both of these barriers can act as limiting hurdles that genetic material and their vector should overcome before reaching the cells. Finally liposomes should overcome cellular barriers that include cell entrance, endosomal escape and nuclear uptake. These barriers and their impact on liposomal gene delivery will be discussed in this review.

Functional, interactive and critical health literacy: Varying relationships with control over care and number of GP visits.

Science.gov (United States)

van der Heide, Iris; Heijmans, Monique; Schuit, A Jantine; Uiters, Ellen; Rademakers, Jany

2015-08-01

The aim of this study is to examine the extent to which functional, interactive and critical health literacy are associated with patients' perceived control over care and frequency of GP visits. Data from the Dutch 'National Panel of People with Chronic Illness or Disability' was used (N=2508). Health literacy was assessed by the Functional, Communicative and Critical Health Literacy measure. Perceived control over care was indicated by perceived ability to organize care, interact with providers and to perform self-care. By multivariate linear and logistic regression analyses, associations between health literacy and perceived control over care and subsequently frequency of GP visits were studied. Mainly interactive health literacy was associated with patients' perceived ability to organize care, interact with healthcare providers and perform self-care, whereas only functional health literacy was associated with number of GP visits. The results imply that some patients' may be less able to exert control over their care because of lower health literacy. Functional, interactive and critical health literacy vary in their relevance for patients' ability to exert control. Initiatives for strengthening patients' role in healthcare may be improved by paying attention to patients' health literacy, specifically functional and interactive health literacy. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Barriers to health care for undocumented immigrants: a literature review

Directory of Open Access Journals (Sweden)

Hacker K

2015-10-01

Full Text Available Karen Hacker,1,2 Maria Anies,2 Barbara L Folb,2,3 Leah Zallman4–6 1Allegheny County Health Department, Pittsburgh, PA, USA; 2Graduate School of Public Health, 3Health Sciences Library System, University of Pittsburgh, Pittsburgh, PA, USA; 4Institute for Community Health, Cambridge, MA, USA; 5Cambridge Health Alliance, Cambridge, MA, USA; 6Harvard School of Medicine, Boston, MA, USA Abstract: With the unprecedented international migration seen in recent years, policies that limit health care access have become prevalent. Barriers to health care for undocumented immigrants go beyond policy and range from financial limitations, to discrimination and fear of deportation. This paper is aimed at reviewing the literature on barriers to health care for undocumented immigrants and identifying strategies that have or could be used to address these barriers. To address study questions, we conducted a literature review of published articles from the last 10 years in PubMed using three main concepts: immigrants, undocumented, and access to health care. The search yielded 341 articles of which 66 met study criteria. With regard to barriers, we identified barriers in the policy arena focused on issues related to law and policy including limitations to access and type of health care. These varied widely across countries but ultimately impacted the type and amount of health care any undocumented immigrant could receive. Within the health system, barriers included bureaucratic obstacles including paperwork and registration systems. The alternative care available (safety net was generally limited and overwhelmed. Finally, there was evidence of widespread discriminatory practices within the health care system itself. The individual level focused on the immigrant’s fear of deportation, stigma, and lack of capital (both social and financial to obtain services. Recommendations identified in the papers reviewed included advocating for policy change to increase

Myosin Light Chain Kinase Mediates Intestinal Barrier Disruption following Burn Injury

Science.gov (United States)

Chen, Chuanli; Wang, Pei; Su, Qin; Wang, Shiliang; Wang, Fengjun

2012-01-01

Background Severe burn injury results in the loss of intestinal barrier function, however, the underlying mechanism remains unclear. Myosin light chain (MLC) phosphorylation mediated by MLC kinase (MLCK) is critical to the pathophysiological regulation of intestinal barrier function. We hypothesized that the MLCK-dependent MLC phosphorylation mediates the regulation of intestinal barrier function following burn injury, and that MLCK inhibition attenuates the burn-induced intestinal barrier disfunction. Methodology/Principal Findings Male balb/c mice were assigned randomly to either sham burn (control) or 30% total body surface area (TBSA) full thickness burn without or with intraperitoneal injection of ML-9 (2 mg/kg), an MLCK inhibitor. In vivo intestinal permeability to fluorescein isothiocyanate (FITC)-dextran was measured. Intestinal mucosa injury was assessed histologically. Tight junction proteins ZO-1, occludin and claudin-1 was analyzed by immunofluorescent assay. Expression of MLCK and phosphorylated MLC in ileal mucosa was assessed by Western blot. Intestinal permeability was increased significantly after burn injury, which was accompanied by mucosa injury, tight junction protein alterations, and increase of both MLCK and MLC phosphorylation. Treatment with ML-9 attenuated the burn-caused increase of intestinal permeability, mucosa injury, tight junction protein alterations, and decreased MLC phosphorylation, but not MLCK expression. Conclusions/Significance The MLCK-dependent MLC phosphorylation mediates intestinal epithelial barrier dysfunction after severe burn injury. It is suggested that MLCK-dependent MLC phosphorylation may be a critical target for the therapeutic treatment of intestinal epithelial barrier disruption after severe burn injury. PMID:22529961

Altered free radical metabolism in acute mountain sickness: implications for dynamic cerebral autoregulation and blood-brain barrier function

DEFF Research Database (Denmark)

Bailey, D M; Evans, K A; James, P E

2008-01-01

We tested the hypothesis that dynamic cerebral autoregulation (CA) and blood-brain barrier (BBB) function would be compromised in acute mountain sickness (AMS) subsequent to a hypoxia-mediated alteration in systemic free radical metabolism. Eighteen male lowlanders were examined in normoxia (21% O...... developed clinical AMS (AMS+) and were more hypoxaemic relative to subjects without AMS (AMS-). A more marked increase in the venous concentration of the ascorbate radical (A(*-)), lipid hydroperoxides (LOOH) and increased susceptibility of low-density lipoprotein (LDL) to oxidation was observed during...

How gut transcriptional function of Drosophila melanogaster varies with the presence and composition of the gut microbiota.

Science.gov (United States)

Bost, Alyssa; Franzenburg, Soeren; Adair, Karen L; Martinson, Vincent G; Loeb, Greg; Douglas, Angela E

2018-04-01

Despite evidence from laboratory experiments that perturbation of the gut microbiota affects many traits of the animal host, our understanding of the effect of variation in microbiota composition on animals in natural populations is very limited. The core purpose of this study on the fruit fly Drosophila melanogaster was to identify the impact of natural variation in the taxonomic composition of gut bacterial communities on host traits, with the gut transcriptome as a molecular index of microbiota-responsive host traits. Use of the gut transcriptome was validated by demonstrating significant transcriptional differences between the guts of laboratory flies colonized with bacteria and maintained under axenic conditions. Wild Drosophila from six field collections made over two years had gut bacterial communities of diverse composition, dominated to varying extents by Acetobacteraceae and Enterobacteriaceae. The gut transcriptomes also varied among collections and differed markedly from those of laboratory flies. However, no overall relationship between variation in the wild fly transcriptome and taxonomic composition of the gut microbiota was evident at all taxonomic scales of bacteria tested for both individual fly genes and functional categories in Gene Ontology. We conclude that the interaction between microbiota composition and host functional traits may be confounded by uncontrolled variation in both ecological circumstance and host traits (e.g., genotype, age physiological condition) under natural conditions, and that microbiota effects on host traits identified in the laboratory should, therefore, be extrapolated to field population with great caution. © 2017 John Wiley & Sons Ltd.

Thickness-, Composition-, and Magnetic-Field-Dependent Complex Impedance Spectroscopy of Granular-Type-Barrier Co/Co-Al2O3/Co MTJs

Science.gov (United States)

Tuan, Nguyen Anh; Anh, Nguyen Tuan; Nga, Nguyen Tuyet; Tue, Nguyen Anh; Van Cuong, Giap

2016-06-01

The alternating-current (ac) electrical properties of granular-type-barrier magnetic tunnel junctions (GBMTJs) based on Co/Co x (Al2O3)1- x ( t)/Co trilayer structures have been studied using complex impedance spectroscopy (CIS). Their CIS characteristics were investigated in external magnetic fields varying from 0 kOe to 3 kOe as a function of Co composition x at 10 at.%, 25 at.%, and 35 at.%, with barrier layer thickness t of 20 nm to 90 nm. The influence of these factors on the behaviors of the ac impedance response of the GBMTJs was deeply investigated and attributed to the dielectric or conducting nature of the Co-Al2O3 barrier layer. The most remarkable typical phenomena observed in these behaviors, even appearing paradoxical, include lower impedance for thicker t for each given x, a declining trend of Z with increasing x, a clear decrease of Z with H, and especially a partition of Z into zones according to the H value. All these effects are analyzed and discussed to demonstrate that diffusion-type and mass-transfer-type phenomena can be inferred from processes such as spin tunneling and Coulomb or spin blockade in the Co-Al2O3 barrier layer.

Ginger Extract Suppresses Inflammatory Response and Maintains Barrier Function in Human Colonic Epithelial Caco-2 Cells Exposed to Inflammatory Mediators.

Science.gov (United States)

Kim, Yunyoung; Kim, Dong-Min; Kim, Ji Yeon

2017-05-01

The beneficial effects of ginger in the management of gastrointestinal disturbances have been reported. In this study, the anti-inflammatory potential of ginger extract was assessed in a cellular model of gut inflammation. In addition, the effects of ginger extract and its major active compounds on intestinal barrier function were evaluated. The response of Caco-2 cells following exposure to a mixture of inflammatory mediators [interleukin [IL]-1β, 25 ng/mL; lipopolysaccharides [LPS], 10 ng/mL; tumor necrosis factor [TNF]-α, 50 ng/mL; and interferon [INF]-γ, 50 ng/mL] were assessed by measuring the levels of secreted IL-6 and IL-8. In addition, the mRNA levels of cyclooxygenase-2 and inducible nitric oxide synthase were measured. Moreover, the degree of nuclear factor (NF)-κB inhibition was examined, and the intestinal barrier function was determined by measuring the transepithelial electrical resistance (TEER) and fluorescein isothiocyanate (FITC)-dextran transfer. It was observed that ginger extract and its constituents improved inflammatory responses by decreasing the levels of nitrite, PGE2, IL-6, and IL-8 via NF-κB inhibition. The ginger extract also increased the TEER and decreased the transfer of FITC-dextran from the apical side of the epithelium to the basolateral side. Taken together, these results show that ginger extract may be developed as a functional food for the maintenance of gastrointestinal health. © 2017 Institute of Food Technologists®.

Oxygen functionalization of MWCNTs in RF-dielectric barrier discharge Ar/O2 plasma

Science.gov (United States)

Abdel-Fattah, E.; Ogawa, D.; Nakamura, K.

2017-07-01

The oxygenation of multi-wall carbon nanotubes (MWCNTs) was performed via a radio frequency dielectric barrier discharge (RF-DBD) in an Ar/{{\\text{H}}2}\\text{O} plasma mixture. The relative intensity of the Ar/{{\\text{O}}2} plasma species was characterized by optical emission spectroscopy (OES). The effects of treatment time, RF power and oxygen gas percentage on the chemical composition and surface morphology of MWCNTs were investigated by means of x-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy and field emission scanning electron microscopy (FE-SEM). The results of FTIR and XPS revealed the presence of oxygen-containing functional groups on the MWCNTs treated in an Ar/{{\\text{O}}2} plasma at an RF power of 50 W and pressure of 400 Pa. The amount of oxygen functional groups (C=O, C-O, and O-COO) also increased by increasing treatment time up to 6 min, but slightly decreased when treatment time was increased by 10 min. The increase of oxygen gas percentage in the plasma mixture does not affect the oxygen content in the treated MWCNTs. Meanwhile, MWCNTs treated at high power (80 W) showed a reduction in oxygen functional groups in comparison with low RF power conditions. The Raman analysis was consistent with the XPS and FTIR results. The integrity of the nanotube patterns also remained damaged as observed by FE-SEM images. The MWCNTs treated in RF-DBD using the Ar/{{\\text{O}}2} plasma mixture showed improved dispersibility in deionized water. A correlation between the OES data and the observed surface characterization for an improved understanding of the functionalization of MWCNTs in Ar/{{\\text{O}}2} plasma was presented.

Novel Assay of Metformin Levels in Patients With Type 2 Diabetes and Varying Levels of Renal Function

Science.gov (United States)

Frid, Anders; Sterner, Gunnar N.; Löndahl, Magnus; Wiklander, Clara; Cato, Anne; Vinge, Ellen; Andersson, Anders

2010-01-01

OBJECTIVE To study trough levels of metformin in serum and its intra-individual variation in patients using a newly developed assay. RESEARCH DESIGN AND METHODS Trough serum levels of metformin were measured once using liquid chromatography–tandem mass spectrometry (LCMSMS) in 137 type 2 diabetic patients with varying renal function (99 men) and followed repeatedly during 2 months in 20 patients (16 men) with estimated glomerular filtration rate (eGFR) 60, 30–60, and 20 μmol/l. Metformin measurement is less suitable for dose titration. PMID:20215446

High density internal transport barriers for burning plasma operation

International Nuclear Information System (INIS)

Pericoli Ridolfini, V.

2005-01-01

One of the proposed ITER scenarios foresees the creation and sustainment of an internal transport barrier (ITB) in order to improve the confinement properties of the hot core plasma. The more stringent requests are: the ITB must be sustained with electron heating only with no or very small external momentum source, the strong collisional coupling at the envisaged density (line average >1.0 1020 m-3) must not prevent the barrier existence, the bootstrap current created by the large induced gradients must have a radial profile consistent with that requested by the barrier creation and sustainment. To all these items the studies carried out in FTU in the same density range (ne0 ?1.5 1020 m-3) provide encouraging prospects. With pure electron heating and current drive (LH+ECH) steady electron barrier are generated and maintained with central e- temperature >5.0 keV. Almost full CD conditions are established with a bootstrap current close to 25% of the total and well aligned with that driven by the LH waves and responsible for the barrier building. The clear change in the density fluctuations close to the ITB radius, observed by reflectometry, indicates stabilization of turbulence that is consistent with the drop of the thermal electron diffusivity inside the ITB to very low values, ?e<0.5 m2/s estimated by the transport analysis. The 10 fold neutron rate increase testifies a significant collisional ion heating, even though usually ?Ti0/Ti0 does not exceed 40%, because the e--i + equipartition time, always 4-5 times longer than the energy confinement time, does not allow thermal equilibrium with electrons to be attained. The ion thermal diffusivity inside the barrier must be lowered to the neoclassical level to account for the observed Ti(r) profiles, clearly indicating at least a non-degraded ion transport. The global confinement in turn improves by 1.6 times above the FTU L-scaling. The ITB radius can be controlled by varying the LH power deposition profile that is

Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.

Science.gov (United States)

Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars

2018-04-24

In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.

Long-Term Drainage from the Riprap Side Slope of a Surface Barrier

Energy Technology Data Exchange (ETDEWEB)

Zhang, Zhuanfang

2017-07-01

Surface barriers designed to isolate underground nuclear waste in place are expected to function for at least 1000 years. To achieve this long design life, such barriers need to be protected with side slopes against wind- and water-induced erosion and damage by natural or human activities. However, the side slopes are usually constructed with materials coarser than the barrier. Their hydrological characteristics must be understood so that any drainage from them is considered in the barrier design and will not compromise the barrier function. The Prototype Hanford Barrier, an evapotranspiration-capillary (ETC) barrier, was constructed in 1994 at the Hanford Site in southeastern Washington state, with a gravel side slope and a riprap side slope. The soil water content in the gravel side slope and drainage from both side slopes have been monitored since the completion of construction. The monitoring results show that under natural precipitation the annual drainage rates from the two types of side slopes were very similar and about 5 times the typical recharge from local soil with natural vegetation and 40 times the barrier design criterion. The higher recharge from the side slopes results in some of the drainage migrating laterally to the region beneath the ETC barrier. This edge effect of the enhanced drainage was evaluated for a period of 1000 years by numerical simulation. The edge effect was quantified by the amount of water across the barrier edges and the affecting distance of the barrier edges. These results indicate that design features can be adjusted to reduce the edge effect when necessary.

Barriers and Motivators to Physical Activity among African American Women

Science.gov (United States)

James, Delores C. S.; Efunbumi, Orisatalabi; Harville, Cedric; Sears, Cynthia

2014-01-01

The goals of the study were to identify the barriers and motivators for physical activity (PA) and to assess whether these factors vary by weight status. A self-administered survey was completed by 413 African American women. Each woman provided verbal informed consent and was weighed and measured by a research team member. The participants' mean…

Rooting depth varies differentially in trees and grasses as a function of mean annual rainfall in an African savanna.

Science.gov (United States)

Holdo, Ricardo M; Nippert, Jesse B; Mack, Michelle C

2018-01-01

A significant fraction of the terrestrial biosphere comprises biomes containing tree-grass mixtures. Forecasting vegetation dynamics in these environments requires a thorough understanding of how trees and grasses use and compete for key belowground resources. There is disagreement about the extent to which tree-grass vertical root separation occurs in these ecosystems, how this overlap varies across large-scale environmental gradients, and what these rooting differences imply for water resource availability and tree-grass competition and coexistence. To assess the extent of tree-grass rooting overlap and how tree and grass rooting patterns vary across resource gradients, we examined landscape-level patterns of tree and grass functional rooting depth along a mean annual precipitation (MAP) gradient extending from ~ 450 to ~ 750 mm year -1 in Kruger National Park, South Africa. We used stable isotopes from soil and stem water to make inferences about relative differences in rooting depth between these two functional groups. We found clear differences in rooting depth between grasses and trees across the MAP gradient, with grasses generally exhibiting shallower rooting profiles than trees. We also found that trees tended to become more shallow-rooted as a function of MAP, to the point that trees and grasses largely overlapped in terms of rooting depth at the wettest sites. Our results reconcile previously conflicting evidence for rooting overlap in this system, and have important implications for understanding tree-grass dynamics under altered precipitation scenarios.

Modeling Interactions between Backbarrier Marshes, Tidal Inlets, Ebb-deltas, and Adjacent Barriers Exposed to Rising Sea Levels

Science.gov (United States)

Hanegan, K.; Georgiou, I. Y.; FitzGerald, D.

2016-02-01

Along barrier island chains, tidal exchange between the backbarrier and the coastal ocean supports unique saltwater and brackish ecosystems and is responsible for exporting sediment and nutrients to the surrounding coast. Tidal prism, basement controls, and wave and tidal energy dictate the size and number of tidal inlets and the volume of sand sequestered in ebb-tidal deltas. The inlet tidal prism is a function of bay area, tidal range, and secondary controls, including flow inertia, basinal hypsometry, and frictional factors. Sea- level rise (SLR) is threatening coastal environments, causing mainland flooding, changes in sediment supply, and conversion of wetlands and tidal flats to open water. These factors are impacting basinal hypsometry and increasing open water area, resulting in enlarging tidal prisms, increased dimensions of tidal inlets and ebb-tidal deltas, and erosion along adjacent barrier shorelines. Although the effects of SLR on coastal morphology are difficult to study by field observations alone, physics-based numerical models provide a sophisticated means of analyzing coastal processes over decadal time-scales and linking process causation to long term development. Here, we use a numerical model that includes relevant features in the barrier/tidal basin system, linking back-barrier marsh degradation, inlet expansion, and ebb-delta growth to barrier erosion through long-term hydrodynamic and morphology simulations. Sediment exchange and process interactions are investigated using an idealized domain resembling backbarrier basins of mixed energy coasts so that the sensitivity to varying SLR rates, interior marsh loss, sediment supply, and hydrodynamic controls can be more easily analyzed. Model runs explore these processes over geologic time scales, demonstrating the vulnerability of backbarrier systems to projected SLR and marsh loss. Results demonstrate the links between changing basin morphology and shoreface sedimentation patterns that initiate

Lead poisoning and the blood-brain barrier

International Nuclear Information System (INIS)

Hertz, M.H.; Bolwig, T.G.; Grandjean, P.; Westergaard, E.

1981-01-01

Lead exposure may produce varying degrees of neuropsychiatric manifestations from discrete phenomena, quite often seen in children and as an occupational disease, to the rare fulminant lead encephalopathy. It was determined whether or not damage of the blood-brain barrier permeability in adult rats, as has been demonstr rated in neonatal animals exposed to lead, could also play a role. Massive lead exposure did not induce any change in the transfer (facilitated diffusion) of phenylalanine and tyrosine measured by means of the indicator dilution technique. Ultrastructural examination, after application of horseradish peroxidase, did not reveal any pahtological changes in the permeability to the tracer. It is concluded that in adult rats, in contrast to neonatal anmials, the observed pathological signs clearly seen in the chronically exposed animals must be ascribed to a noxious influence of lead on the extravascular side of the blood-brain barrier. (author)

Bivariate functional data clustering: grouping streams based on a varying coefficient model of the stream water and air temperature relationship

Science.gov (United States)

H. Li; X. Deng; Andy Dolloff; E. P. Smith

2015-01-01

A novel clustering method for bivariate functional data is proposed to group streams based on their water–air temperature relationship. A distance measure is developed for bivariate curves by using a time-varying coefficient model and a weighting scheme. This distance is also adjusted by spatial correlation of streams via the variogram. Therefore, the proposed...

An Investigation of Groundwater Flow on a Coastal Barrier using Multi Electrode Profiling

DEFF Research Database (Denmark)

Poulsen, Søren Erbs; Christensen, Steen; Rasmussen, Keld Rømer

2008-01-01

Preliminary geophysical and hydrogeological investigations indicate that multi-electrode profiling (MEP) can be used to monitor groundwater salinity on a coastal barrier where a shallow thin aquifer discharges to the North Sea. A monitoring system including five groups of piezometers and five MEP...... groundwater modeling we hope to be able to quantify how time varying recharge, tides, and storms hitting the barrier affect groundwater flow and discharge to the sea. At the conference we will present monitoring results from the winter and spring 2008....

Role of intestinal mucosal barrier in the development and progression of nonalcoholic fatty liver disease

Directory of Open Access Journals (Sweden)

ZHANG Yuanyuan

2016-12-01

Full Text Available The incidence of non-alcoholic fatty liver disease (NAFLD has been increasing year by year in China. Intestinal mucosa is the largest organ for bacterial storage, and intestinal mucosal barrier includes biological barrier, mechanical barrier, immunological barrier, and chemical barrier. This article investigates the important role of intestinal mucosal barrier function in the pathogenesis of NAFLD. As for the intestinal biological barrier, abnormalities in gut microbiota occur earlier than obesity and other metabolic disorders; small intestinal bacterial overgrowth may affect energy metabolism, promote insulin resistance, and get involved in the pathogenesis of NAFLD; regulation of gut microbiota has a certain clinical effect in the treatment of NAFLD. Intestinal mechanical barrier impairment increases the mucosal permeability and is associated with intestinal dysbacteriosis. The changes in intestinal immunological barrier may be associated with obesity, metabolic disorders, and liver inflammation. The changes in intestinal chemical barrier can inhibit the synthesis and secretion of very low-density lipoprotein and low-density lipoprotein in hepatocytes and may result in triglyceride deposition in the liver. It is pointed out that the research on intestinal mucosal barrier function provides promising prospects for the prevention and treatment of NAFLD.

Efficacy and flexibility impact perceived adherence barriers in pediatric kidney post-transplantation.

Science.gov (United States)

Guilfoyle, Shanna M; Goebel, Jens W; Pai, Ahna L H

2011-03-01

The alarming rates of medication nonadherence and its detrimental effect on long-term graft survival in pediatric kidney transplantation has called attention to identifying modifiable factors that promote better adherence and subsequent transplant outcomes. In a sample of 45 adolescent kidney transplant recipients (14.7 ± 3.3 years, 77.8% Caucasian, 39.5% female) and their primary caregivers, study aims included: 1) identifying sociodemographic and medical correlates of both caregiver- and patient-reported general family functioning (i.e., efficacy, flexibility, and communication) and 2) determining the unique contributions of these family functioning indices to perceived posttransplant adherence barriers. During a routine clinic visit, caregivers completed a sociodemographic form and questionnaire on general family functioning. Both caregivers and the adolescents completed a measure on perceived medication adherence barriers. Data identified household income and family structure as persistent correlates of family functioning. Familial efficacy and flexibility contributed significant variance to perceived adherence barriers. Family-based interventions enhancing modifiable family factors, such as flexibility and efficacy, in overcoming medication adherence barriers would likely promote more optimal health outcomes in the pediatric kidney transplant population. (c) 2011 APA, all rights reserved

The use of internal transport barriers in tokamak plasmas

Energy Technology Data Exchange (ETDEWEB)

Challis, C D [Euratom/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxon, OX14 3DB (United Kingdom)

2004-12-01

Internal transport barriers (ITBs) can provide high tokamak confinement at modest plasma current. This is desirable for operation with most of the current driven non-inductively by the bootstrap mechanism, as currently envisaged for steady-state power plants. Maintaining such plasmas in steady conditions with high plasma purity is challenging, however, due to MHD instabilities and impurity transport effects. Significant progress has been made in the control of ITB plasmas: the pressure profile has been varied using the barrier location; q-profile modification has been achieved with non-inductive current drive, and means have been found to affect density peaking and impurity accumulation. All these features are, to some extent, interdependent and must be integrated self-consistently to demonstrate a sound basis for extrapolation to future devices.

Non-Saccharomyces yeasts protect against epithelial cell barrier disruption induced by Salmonella enterica subsp. enterica serovar Typhimurium.

Science.gov (United States)

Smith, I M; Baker, A; Arneborg, N; Jespersen, L

2015-11-01

The human gastrointestinal epithelium makes up the largest barrier separating the body from the external environment. Whereas invasive pathogens cause epithelial barrier disruption, probiotic micro-organisms modulate tight junction regulation and improve epithelial barrier function. In addition, probiotic strains may be able to reduce epithelial barrier disruption caused by pathogenic species. The aim of this study was to explore non-Saccharomyces yeast modulation of epithelial cell barrier function in vitro. Benchmarking against established probiotic strains, we evaluated the ability of four nonpathogenic yeast species to modulate transepithelial electrical resistance (TER) across a monolayer of differentiated human colonocytes (Caco-2 cells). Further, we assessed yeast modulation of a Salmonella Typhimurium-induced epithelial cell barrier function insult. Our findings demonstrate distinct patterns of non-Saccharomyces yeast modulation of epithelial cell barrier function. While the established probiotic yeast Saccharomyces boulardii increased TER across a Caco-2 monolayer by 30%, Kluyveromyces marxianus exhibited significantly stronger properties of TER enhancement (50% TER increase). In addition, our data demonstrate significant yeast-mediated modulation of Salmonella-induced epithelial cell barrier disruption and identify K. marxianus and Metschnikowia gruessii as two non-Saccharomyces yeasts capable of protecting human epithelial cells from pathogen invasion. This study demonstrates distinct patterns of non-Saccharomyces yeast modulation of epithelial cell barrier function in vitro. Further, our data demonstrate significant yeast-mediated modulation of Salmonella Typhimurium-induced epithelial cell barrier disruption and identify Kluyveromyces marxianus and Metschnikowia gruessii as two non-Saccharomyces yeasts capable of protecting human epithelial cells from pathogen invasion. This study is the first to demonstrate significant non-Saccharomyces yeast

The effect of fucoidan on intestinal flora and intestinal barrier function in rats with breast cancer.

Science.gov (United States)

Xue, Meilan; Ji, Xinqiang; Liang, Hui; Liu, Ying; Wang, Bing; Sun, Lingling; Li, Weiwei

2018-02-21

Recent research studies have shown that the intestinal flora are related to the occurrence and progress of breast cancer. This study investigates the effect of fucoidan on intestinal flora and intestinal barrier function in rats with 7,12-dimethylbenz[a]anthracene (DMBA)-induced breast cancers. Sixty female Sprague-Dawley rats were randomly assigned to the control group, the model group, and the F1 and F2 groups, which were fed fucoidan at concentrations of 200 and 400 mg per kg bw (body weight), respectively. Intestinal histopathological analysis was performed and 16S rDNA high-throughput sequencing was used to provide an overview of the intestinal flora composition. The contents of d-lactic acid (d-LA), diamine oxidase (DAO) and endotoxin in plasma were detected by ELISA. Expression levels of the tight junction (TJ) proteins, phosphorylated p38 MAPK and ERK1/2 were measured using western blotting. Our results suggested that the intestinal wall of the model group was damaged. However, after fucoidan intervention, the villi were gradually restored. ELISA showed that the levels of plasma endotoxin, d-LA and DAO decreased in the F1 and F2 groups compared to those in the model group. Fucoidan treatment also increased the expressions of ZO-1, occludin, claudin-1 and claudin-8. Furthermore, the expression levels of phosphorylated p38 MAPK and ERK1/2 were upregulated in fucoidan treatment groups. The results of 16S rDNA high-throughput sequencing indicated that fucoidan increased the diversity of the intestinal microbiota and induced changes in microbial composition, with the increased Bacteroidetes/Firmicutes phylum ratio. In conclusion, the supplement of fucoidan could improve the fecal microbiota composition and repair the intestinal barrier function. The study suggested the use of fucoidan as an intestinal flora modulator for potential prevention of breast cancer.

Barrier performance researches for the safety evaluation

International Nuclear Information System (INIS)

Niibori, Yuichi

2004-01-01

So far, many researches were conducted to propose a scientific evidence (a safety case) for the realization of geological disposal in Japan. In order to regulate the geological disposal system of radioactive wastes, on the other hand, we need also a holistic approach to integrate various data related for the performance evaluations of the engineered barrier system and the natural barrier system. However, the scientific bases are not sufficient to establish the safety regulation for such a natural system. For example, we often apply the specific probability density function (PDF) to the uncertainty of barrier system due to the essential heterogeneity. However, the applicability is not clear in the regulation point of view. A viewpoint to understand such an applicability of PDFs has been presented. (author)

Influence of solid noise barriers on near-road and on-road air quality

Science.gov (United States)

Baldauf, Richard W.; Isakov, Vlad; Deshmukh, Parikshit; Venkatram, Akula; Yang, Bo; Zhang, K. Max

2016-03-01

Public health concerns regarding adverse health effects for populations spending significant amounts of time near high traffic roadways has increased substantially in recent years. Roadside features, including solid noise barriers, have been investigated as potential methods that can be implemented in a relatively short time period to reduce air pollution exposures from nearby traffic. A field study was conducted to determine the influence of noise barriers on both on-road and downwind pollutant concentrations near a large highway in Phoenix, Arizona, USA. Concentrations of nitrogen dioxide, carbon monoxide, ultrafine particles, and black carbon were measured using a mobile platform and fixed sites along two limited-access stretches of highway that contained a section of noise barrier and a section with no noise barrier at-grade with the surrounding terrain. Results of the study showed that pollutant concentrations behind the roadside barriers were significantly lower relative to those measured in the absence of barriers. The reductions ranged from 50% within 50 m from the barrier to about 30% as far as 300 m from the barrier. Reductions in pollutant concentrations generally began within the first 50 m of the barrier edge; however, concentrations were highly variable due to vehicle activity behind the barrier and along nearby urban arterial roadways. The concentrations on the highway, upwind of the barrier, varied depending on wind direction. Overall, the on-road concentrations in front of the noise barrier were similar to those measured in the absence of the barrier, contradicting previous modeling results that suggested roadside barriers increase pollutant levels on the road. Thus, this study suggests that noise barriers do reduce potential pollutant exposures for populations downwind of the road, and do not likely increase exposures to traffic-related pollutants for vehicle passengers on the highway.

The barrier within: endothelial transport of hormones.

Science.gov (United States)

Kolka, Cathryn M; Bergman, Richard N

2012-08-01

Hormones are involved in a plethora of processes including development and growth, metabolism, mood, and immune responses. These essential functions are dependent on the ability of the hormone to access its target tissue. In the case of endocrine hormones that are transported through the blood, this often means that the endothelium must be crossed. Many studies have shown that the concentrations of hormones and nutrients in blood can be very different from those surrounding the cells on the tissue side of the blood vessel endothelium, suggesting that transport across this barrier can be rate limiting for hormone action. This transport can be regulated by altering the surface area of the blood vessel available for diffusion through to the underlying tissue or by the permeability of the endothelium. Many hormones are known to directly or indirectly affect the endothelial barrier, thus affecting their own distribution to their target tissues. Dysfunction of the endothelial barrier is found in many diseases, particularly those associated with the metabolic syndrome. The interrelatedness of hormones may help to explain why the cluster of diseases in the metabolic syndrome occur together so frequently and suggests that treating the endothelium may ameliorate defects in more than one disease. Here, we review the structure and function of the endothelium, its contribution to the function of hormones, and its involvement in disease.

Identification of time-varying nonlinear systems using differential evolution algorithm

DEFF Research Database (Denmark)

Perisic, Nevena; Green, Peter L; Worden, Keith

2013-01-01

(DE) algorithm for the identification of time-varying systems. DE is an evolutionary optimisation method developed to perform direct search in a continuous space without requiring any derivative estimation. DE is modified so that the objective function changes with time to account for the continuing......, thus identification of time-varying systems with nonlinearities can be a very challenging task. In order to avoid conventional least squares and gradient identification methods which require uni-modal and double differentiable objective functions, this work proposes a modified differential evolution...... inclusion of new data within an error metric. This paper presents results of identification of a time-varying SDOF system with Coulomb friction using simulated noise-free and noisy data for the case of time-varying friction coefficient, stiffness and damping. The obtained results are promising and the focus...

Nuclear structure and fusion at the barrier

International Nuclear Information System (INIS)

Reisdorf, W.

1985-01-01

A comparative study of measured fusion excitation functions in the vicinity of the barrier reveals nuclear structure effects, due in particular to the coupling of the fusion process to direct-reaction channels. (orig.)

Myosin light chain kinase mediates intestinal barrier disruption following burn injury.

Directory of Open Access Journals (Sweden)

Chuanli Chen

Full Text Available BACKGROUND: Severe burn injury results in the loss of intestinal barrier function, however, the underlying mechanism remains unclear. Myosin light chain (MLC phosphorylation mediated by MLC kinase (MLCK is critical to the pathophysiological regulation of intestinal barrier function. We hypothesized that the MLCK-dependent MLC phosphorylation mediates the regulation of intestinal barrier function following burn injury, and that MLCK inhibition attenuates the burn-induced intestinal barrier disfunction. METHODOLOGY/PRINCIPAL FINDINGS: Male balb/c mice were assigned randomly to either sham burn (control or 30% total body surface area (TBSA full thickness burn without or with intraperitoneal injection of ML-9 (2 mg/kg, an MLCK inhibitor. In vivo intestinal permeability to fluorescein isothiocyanate (FITC-dextran was measured. Intestinal mucosa injury was assessed histologically. Tight junction proteins ZO-1, occludin and claudin-1 was analyzed by immunofluorescent assay. Expression of MLCK and phosphorylated MLC in ileal mucosa was assessed by Western blot. Intestinal permeability was increased significantly after burn injury, which was accompanied by mucosa injury, tight junction protein alterations, and increase of both MLCK and MLC phosphorylation. Treatment with ML-9 attenuated the burn-caused increase of intestinal permeability, mucosa injury, tight junction protein alterations, and decreased MLC phosphorylation, but not MLCK expression. CONCLUSIONS/SIGNIFICANCE: The MLCK-dependent MLC phosphorylation mediates intestinal epithelial barrier dysfunction after severe burn injury. It is suggested that MLCK-dependent MLC phosphorylation may be a critical target for the therapeutic treatment of intestinal epithelial barrier disruption after severe burn injury.

Sun-Induced Changes in Stratum Corneum Function Are Gender and Dose Dependent in a Chinese Population

Science.gov (United States)

Liu, Z.; Fluhr, J.W.; Song, S.P.; Sun, Z.; Wang, H.; Shi, Y.J.; Elias, P.M.; Man, M.-Q.

2010-01-01

Previous studies have demonstrated that UVB radiation changes the epidermal permeability barrier and stratum corneum (SC) hydration. It is well known that sun exposure causes erythema, sunburn and melanoma. However, whether daily sun exposure alters SC integrity and epidermal permeability barrier function is largely unknown, especially in Chinese subjects. In the present study, we assess the SC integrity, SC hydration and epidermal permeability barrier function following various doses of sun exposure. A total of 258 subjects (124 males and 134 females) aged 18–50 years were enrolled. A multifunctional skin physiology monitor (Courage & Khazaka MPA5) was used to measure SC hydration and transepidermal water loss (TEWL) on the forearms. In males, basal TEWL was higher with higher doses of sun exposure than with lower doses and control, whereas in females, basal TEWL was higher with lower doses of sun exposure than with higher doses and control. In the group with higher doses of sun exposure, TEWL in females was significantly lower than that in males. The barrier recovery was faster in females than in males in both control and lower-dose groups. In both males and females, barrier recovery was delayed with higher doses of sun exposure. In males, sun exposure did not alter SC hydration, while in females SC hydration was lower with lower doses of sun exposure as compared with control and higher doses of sun exposure. These results demonstrated that sun-induced changes in SC function and SC hydration vary with gender and the extent of sun exposure. PMID:20571289

Alpha-induced instabilities in tandem thermal barriers

Energy Technology Data Exchange (ETDEWEB)

Kammash, T.; Galbraith, D.L.

1987-01-01

A major premise in the operation of Tandem Mirror reactors is that the fusion reactions take place in the central cell only. The alpha particles generated by the Deuterium-Tritium (DT) fusions, along with other ions, will however pass from the central cell to the thermal barriers and return to the central cell as a result of reflection by the potential hills that exist by the plugs' side of these barriers. This streaming motion gives rise to electrostatic and electomagnetic instabilities which could detract from the barrier's function as a thermal insulator. The number density and streaming velocity of these passing particles are dictated by the electrostatic potential variation and the magnetic field structure in these regions. It is shown that, in the absence of alphas, barriers with deep potential depression are less susceptible to electrostatic instabilities while particularly vulnerable to unstable electromagnetic modes. In the presence of alphas, especially the fast alphas whose mean energy is significantly larger than the barrier potentials they see, (which is twice as high as that seen by the ions) both types of modes become unstable.

Glomerular endothelial surface layer acts as a barrier against albumin filtration

NARCIS (Netherlands)

Dane, M.J.; Berg, B.M. van den; Avramut, M.C.; Faas, F.G.; Vlag, J. van der; Rops, A.L.; Ravelli, R.B.; Koster, B.J.; Zonneveld, A.J. van; Vink, H.; Rabelink, T.J.

2013-01-01

Glomerular endothelium is highly fenestrated, and its contribution to glomerular barrier function is the subject of debate. In recent years, a polysaccharide-rich endothelial surface layer (ESL) has been postulated to act as a filtration barrier for large molecules, such as albumin. To test this

InGaAs-based planar barrier diode as microwave rectifier

Science.gov (United States)

Farhani Zakaria, Nor; Rizal Kasjoo, Shahrir; Zailan, Zarimawaty; Mohamad Isa, Muammar; Arshad, Mohd Khairuddin Md; Taking, Sanna

2018-06-01

In this report, we proposed and simulated a new planar nonlinear rectifying device fabricated using InGaAs substrate and referred to as a planar barrier diode (PBD). Using an asymmetrical inverse-arrowhead-shaped structure between the electrodes, a nonuniform depletion region is developed, which creates a triangular energy barrier in the conducting channel. This barrier is voltage dependent and can be controlled by the applied voltage across the PBD, thus resulting in nonlinear diode-like current–voltage characteristics; thus it can be used as a rectifying device. The PBD’s working principle is explained using thermionic emission theory. Furthermore, by varying the PBD’s geometric design, the asymmetry of the current–voltage characteristics can be optimized to realize superior rectification performance. By employing the optimized structural parameters, the obtained cut-off frequency of the device was approximately 270 GHz with a curvature coefficient peak of 14 V‑1 at a low DC bias voltage of 50 mV.

Efficacy of IPL device combined with intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with regards to the recovery of skin barrier function: A pilot study.

Science.gov (United States)

Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun

2015-10-01

Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.

Tracer Studies to Characterize the Effects of Roadside Noise Barriers on Near-Road Pollutant Dispersion under Varying Atmospheric Stability Conditions

Science.gov (United States)

A roadway toxics dispersion study was conducted by the Field Research Division (FRD) of NOAA at the Idaho National Laboratory (INL) near Idaho Falls, ID to document the effects on concentrations of roadway emissions behind a roadside sound barrier in various conditions of atmosph...

Homoepitaxial graphene tunnel barriers for spin transport (Presentation Recording)

Science.gov (United States)

Friedman, Adam L.

2015-09-01

Tunnel barriers are key elements for both charge-and spin-based electronics, offering devices with reduced power consumption and new paradigms for information processing. Such devices require mating dissimilar materials, raising issues of heteroepitaxy, interface stability, and electronic states that severely complicate fabrication and compromise performance. Graphene is the perfect tunnel barrier. It is an insulator out-of-plane, possesses a defect-free, linear habit, and is impervious to interdiffusion. Nonetheless, true tunneling between two stacked graphene layers is not possible in environmental conditions (magnetic field, temperature, etc.) usable for electronics applications. However, two stacked graphene layers can be decoupled using chemical functionalization. Here, we demonstrate homoepitaxial tunnel barrier devices in which graphene serves as both the tunnel barrier and the high mobility transport channel. Beginning with multilayer graphene, we fluorinate or hydrogenate the top layer to decouple it from the bottom layer, so that it serves as a single monolayer tunnel barrier for both charge and spin injection into the lower graphene transport channel. We demonstrate successful tunneling by measuring non-linear IV curves, and a weakly temperature dependent zero bias resistance. We perform lateral transport of spin currents in non-local spin-valve structures and determine spin lifetimes with the non-local Hanle effect to be commensurate with previous studies (~200 ps). However, we also demonstrate the highest spin polarization efficiencies (~45%) yet measured in graphene-based spin devices [1]. [1] A.L. Friedman, et al., Homoepitaxial tunnel barriers with functionalized graphene-on-graphene for charge and spin transport, Nat. Comm. 5, 3161 (2014).

Parkinson's disease in Jordan: Barriers and motivators to exercise.

Science.gov (United States)

Khalil, Hanan; Nazzal, Mohammad; Al-Sheyab, Nihaya

2016-10-01

Perceived barriers to engaging in exercise in people with Parkinson's disease (PD) are becoming more defined in countries such as the UK and the US. This, however, may vary by culture and environment. This study aimed to explore the perceptions of exercise and barriers that may affect participation in people with PD from Jordan. Two focus groups and seven individual interviews were conducted with people with PD. Additionally, individual interviews were conducted with two neurologists. Conversations were digitally recorded and transcribed. Transcripts were analyzed using thematic analysis and validated via researcher triangulation and peer checking. Most of the PD participants lacked previous participation in any disease-specific exercises. Several barriers were perceived by PD participants for such lack of participation. Barriers included difficulty of diagnosis, lack of informational support provided by neurologists, lack of referral to physiotherapy services, disease-specific issues, and setting-related issues. Neurologists indicated a number of barriers in counseling their PD patients on exercise including lack of time and lack of health system resources. Motivators to participate in future exercise included outcome expectations and family support. Findings of the study shed light into large areas of unmet needs of supporting exercise and physiotherapy for people with PD in developing countries as per Jordan. For better patient outcomes, findings of the study suggest that it is crucial to raise awareness among all PD-related stakeholders on the benefits of early referrals to physiotherapy and early engagement in exercise programs.

Fusion of 16O+46,50Ti near and below the Coulomb barrier

International Nuclear Information System (INIS)

Liguori Neto, R.; Acquadro, J.C.; Gomes, P.R.S.; Toledo, A.S. de; Crema, E.; Carlin Filho, N.; Coimbra, M.M.

1988-11-01

Fusion excitation functions for the systems 16 O+ 46 , 50 Ti at bombarding energies in the range 30 MeV ≤ E LAB ( 16 O) ≤ 65 MeV were measured by means of the γ-ray spectroscopy technique. The fusion excitation functions are analysed using a semi-classical one-dimensional barrier-penetration model with different nuclear potentials describing the heavy-ion interaction. From the analysis the fusion barrier parameters were obtained. The observed fusion cross sections at subbarrier energies are larger than predicted by this conventional one-dimensional barrier-penetration model. The fusion enhacement at sub-barrier energies for these systems can be explained by the simple approach of Wong's model, considering explicitly the quadrupole deformation parameter of the target-nucleus. (author) [pt

Influence of a BGaN back-barrier on DC and dynamic performances of an AlGaN/GaN HEMT: simulation study

Science.gov (United States)

Guenineche, Lotfi; Hamdoune, Abdelkader

2016-05-01

In this paper, we study the effect of a BGaN back-barrier on the DC and RF performances of an AlGaN/GaN high electron mobility transistor. Using TCAD Silvaco, we examine some variations of thickness and boron concentration in the BGaN back-barrier layer. First, we fix the thickness of the back-barrier layer at 5 nm and we vary the concentration of the boron in BGaN from 1% to 4%. Second, we fix the concentration of the boron in BGaN to only 2% and we vary the thickness of the back-barrier layer from 20 nm to 110 nm. The BGaN back-barrier layer creates an electrostatic barrier under the channel layer and improves the performances of the device by improving the electron confinement in the two-dimensional electron gas. The DC and AC characteristics are improved, respectively, by a greater concentration of boron and by a thicker BGaN layer. For 4% boron concentration and 5 nm thick back-barrier layer, we obtain a maximum drain current of 1.1 A, a maximum transconductance of 480 mS mm-1, a cut-off frequency of 119 GHz, and a maximum oscillation frequency of 311 GHz.

Open problems in sub-barrier fusion

International Nuclear Information System (INIS)

Vandenbosch, R.

1992-01-01

Two aspects of sub-barrier fusion are discussed. A challenge to the use of fission fragment angular distributions to probe the spin distribution in fusion is addressed. Evidence from excitation functions for the importance of neutron transfer and the neck degree of freedom is examined

Molecular Pathophysiology of Epithelial Barrier Dysfunction in Inflammatory Bowel Diseases

Directory of Open Access Journals (Sweden)

Jessica Y. Lee

2018-03-01

Full Text Available Over the years, the scientific community has explored myriads of theories in search of the etiology and a cure for inflammatory bowel disease (IBD. The cumulative evidence has pointed to the key role of the intestinal barrier and the breakdown of these mechanisms in IBD. More and more scientists and clinicians are embracing the concept of the impaired intestinal epithelial barrier and its role in the pathogenesis and natural history of IBD. However, we are missing a key tool that bridges these scientific insights to clinical practice. Our goal is to overcome the limitations in understanding the molecular physiology of intestinal barrier function and develop a clinical tool to assess and quantify it. This review article explores the proteins in the intestinal tissue that are pivotal in regulating intestinal permeability. Understanding the molecular pathophysiology of impaired intestinal barrier function in IBD may lead to the development of a biochemical method of assessing intestinal tissue integrity which will have a significant impact on the development of novel therapies targeting the intestinal mucosa.

Social barriers to the adoption of smart homes

International Nuclear Information System (INIS)

Balta-Ozkan, Nazmiye; Davidson, Rosemary; Bicket, Martha; Whitmarsh, Lorraine

2013-01-01

The aim of this paper is to explore social barriers to the adoption of smart homes through the analysis of expert views and public attitudes. Smart home services aim to improve the comfort, convenience and safety of householders, as well as allowing them to use energy more efficiently and cope with increasing costs. Despite the existence of smart homes and smart home technologies for some time, their prevalence is not widespread, and thus their potential largely untapped. Using a combination of in-depth deliberative public workshops, expert interviews and a review of the existing literature, this paper explores social barriers to smart home diffusion, including how these vary by expertise, life-stage and location. The research highlights the importance of barriers such as control, security, and cost, providing insights for policymakers as well as smart-home designers and developers as to how these might be addressed. - Highlights: • Smart homes and related technologies can provide a variety of benefits. • Technologies need to be reliable and fit into householders’ lifestyles. • Public concerns relate to cost, control and privacy. • Trust in energy companies and government is important

Modelling altered revenue function based on varying power consumption distribution and electricity tariff charge using data analytics framework

Science.gov (United States)

Zainudin, W. N. R. A.; Ramli, N. A.

2017-09-01

In 2010, Energy Commission (EC) had introduced Incentive Based Regulation (IBR) to ensure sustainable Malaysian Electricity Supply Industry (MESI), promotes transparent and fair returns, encourage maximum efficiency and maintains policy driven end user tariff. To cater such revolutionary transformation, a sophisticated system to generate policy driven electricity tariff structure is in great need. Hence, this study presents a data analytics framework that generates altered revenue function based on varying power consumption distribution and tariff charge function. For the purpose of this study, the power consumption distribution is being proxy using proportion of household consumption and electricity consumed in KwH and the tariff charge function is being proxy using three-tiered increasing block tariff (IBT). The altered revenue function is useful to give an indication on whether any changes in the power consumption distribution and tariff charges will give positive or negative impact to the economy. The methodology used for this framework begins by defining the revenue to be a function of power consumption distribution and tariff charge function. Then, the proportion of household consumption and tariff charge function is derived within certain interval of electricity power. Any changes in those proportion are conjectured to contribute towards changes in revenue function. Thus, these changes can potentially give an indication on whether the changes in power consumption distribution and tariff charge function are giving positive or negative impact on TNB revenue. Based on the finding of this study, major changes on tariff charge function seems to affect altered revenue function more than power consumption distribution. However, the paper concludes that power consumption distribution and tariff charge function can influence TNB revenue to some great extent.

Smart parking barrier

KAUST Repository

Alharbi, Abdulrazaq M.

2016-05-06

Various methods and systems are provided for smart parking barriers. In one example, among others, a smart parking barrier system includes a movable parking barrier located at one end of a parking space, a barrier drive configured to control positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking space and a second position that allows access to the parking space. The parking controller can initiate movement of the movable parking barrier in response to a positive identification of an individual allowed to use the parking space. The parking controller can identify the individual through, e.g., a RFID tag, a mobile device (e.g., a remote control, smartphone, tablet, etc.), an access card, biometric information, or other appropriate identifier.

Barriers to access to opioid medicines for patients with opioid dependence: a review of legislation and regulations in eleven central and eastern European countries.

Science.gov (United States)

Vranken, Marjolein J M; Mantel-Teeuwisse, Aukje K; Jünger, Saskia; Radbruch, Lukas; Scholten, Willem; Lisman, John A; Subataite, Marija; Schutjens, Marie-Hélène D B

2017-06-01

Barriers linked to drug control systems are considered to contribute to inequitable access to controlled medicines, leaving millions of people in pain and suffering. Most studies focus on access to opioids for the treatment of severe (cancer) pain. This study aims to identify specific access barriers for patients with opioid dependence in legislation and regulations of 11 central and eastern European countries. This study builds on a previous analysis of legislation and regulations as part of the EU 7th Framework Access To Opioid Medication in Europe (ATOME) project. An in-depth analysis was undertaken to determine specific barriers for patients with opioid dependence in need of opioid analgesics or opioid agonist therapy (OAT). For each country, the number and nature of specific potential barriers for these patients were assessed according to eight categories: prescribing; dispensing; manufacturing; usage; trade and distribution; affordability; penalties; and other. An additional keyword search was conducted to minimize the omission of barriers. Barriers in an additional category, language, were recorded qualitatively. Countries included Bulgaria, Cyprus, Estonia, Greece, Hungary, Latvia, Lithuania, Serbia, Slovakia, Slovenia and Turkey. Ten of the 11 countries (all except Estonia) showed specific potential barriers in their legislation and regulations. The total number of barriers varied from two (Slovenia) to 46 (Lithuania); the number of categories varied from one (Slovenia) to five (Lithuania). Most specific potential barriers were shown in the categories 'prescribing', 'usage' and 'other'. The total number in a single category varied from one to 18 (Lithuania, prescribing). Individual differences between countries in the same specific potential barrier were shown; for example, variation in minimum age criteria for admission to OAT ranging from 15 (Lithuania, in special cases) to 20 years (Greece). All countries had stigmatizing language in their legislation

Sphingosine 1-phosphate receptor 5 mediates the immune quiescence of the human brain endothelial barrier

Directory of Open Access Journals (Sweden)

van Doorn Ruben

2012-06-01

Full Text Available Abstract Background The sphingosine 1-phosphate (S1P receptor modulator FTY720P (Gilenya® potently reduces relapse rate and lesion activity in the neuroinflammatory disorder multiple sclerosis. Although most of its efficacy has been shown to be related to immunosuppression through the induction of lymphopenia, it has been suggested that a number of its beneficial effects are related to altered endothelial and blood–brain barrier (BBB functionality. However, to date it remains unknown whether brain endothelial S1P receptors are involved in the maintenance of the function of the BBB thereby mediating immune quiescence of the brain. Here we demonstrate that the brain endothelial receptor S1P5 largely contributes to the maintenance of brain endothelial barrier function. Methods We analyzed the expression of S1P5 in human post-mortem tissues using immunohistochemistry. The function of S1P5 at the BBB was assessed in cultured human brain endothelial cells (ECs using agonists and lentivirus-mediated knockdown of S1P5. Subsequent analyses of different aspects of the brain EC barrier included the formation of a tight barrier, the expression of BBB proteins and markers of inflammation and monocyte transmigration. Results We show that activation of S1P5 on cultured human brain ECs by a selective agonist elicits enhanced barrier integrity and reduced transendothelial migration of monocytes in vitro. These results were corroborated by genetically silencing S1P5 in brain ECs. Interestingly, functional studies with these cells revealed that S1P5 strongly contributes to brain EC barrier function and underlies the expression of specific BBB endothelial characteristics such as tight junctions and permeability. In addition, S1P5 maintains the immunoquiescent state of brain ECs with low expression levels of leukocyte adhesion molecules and inflammatory chemokines and cytokines through lowering the activation of the transcription factor NFκB. Conclusion Our

Magnetic barriers and their q95 dependence at DIII-D

Science.gov (United States)

Volpe, F. A.; Kessler, J.; Ali, H.; Evans, T. E.; Punjabi, A.

2012-05-01

It is well known that externally generated resonant magnetic perturbations (RMPs) can form islands in the plasma edge. In turn, large overlapping islands generate stochastic fields, which are believed to play a role in the avoidance and suppression of edge localized modes (ELMs) at DIII-D. However, large coalescing islands can also generate, in the middle of these stochastic regions, KAM surfaces effectively acting as ‘barriers’ against field-line dispersion and, indirectly, particle diffusion. It was predicted in Ali and Punjabi (2007 Plasma Phys. Control. Fusion 49 1565-82) that such magnetic barriers can form in piecewise analytic DIII-D plasma equilibria. In this work, the formation of magnetic barriers at DIII-D is corroborated by field-line tracing calculations using experimentally constrained EFIT (Lao et al 1985 Nucl. Fusion 25 1611) DIII-D equilibria perturbed to include the vacuum field from the internal coils utilized in the experiments. According to these calculations, the occurrence and location of magnetic barriers depend on the edge safety factor q95. It was thus suggested that magnetic barriers might contribute to narrowing the edge stochastic layer and play an indirect role in the RMPs failing to control ELMs for certain values of q95. The analysis of DIII-D discharges where q95 was varied, however, does not show anti-correlation between barrier formation and ELM suppression.

Magnetic barriers and their q95 dependence at DIII-D

International Nuclear Information System (INIS)

Volpe, F.A.; Kessler, J.; Ali, H.; Punjabi, A.; Evans, T.E.

2012-01-01

It is well known that externally generated resonant magnetic perturbations (RMPs) can form islands in the plasma edge. In turn, large overlapping islands generate stochastic fields, which are believed to play a role in the avoidance and suppression of edge localized modes (ELMs) at DIII-D. However, large coalescing islands can also generate, in the middle of these stochastic regions, KAM surfaces effectively acting as ‘barriers’ against field-line dispersion and, indirectly, particle diffusion. It was predicted in Ali and Punjabi (2007 Plasma Phys. Control. Fusion 49 1565–82) that such magnetic barriers can form in piecewise analytic DIII-D plasma equilibria. In this work, the formation of magnetic barriers at DIII-D is corroborated by field-line tracing calculations using experimentally constrained EFIT (Lao et al 1985 Nucl. Fusion 25 1611) DIII-D equilibria perturbed to include the vacuum field from the internal coils utilized in the experiments. According to these calculations, the occurrence and location of magnetic barriers depend on the edge safety factor q 95 . It was thus suggested that magnetic barriers might contribute to narrowing the edge stochastic layer and play an indirect role in the RMPs failing to control ELMs for certain values of q 95 . The analysis of DIII-D discharges where q 95 was varied, however, does not show anti-correlation between barrier formation and ELM suppression. (paper)

The two-pore domain K+ channel TASK-1 is closely associated with brain barriers and meninges.

Science.gov (United States)

Kanjhan, Refik; Pow, David V; Noakes, Peter G; Bellingham, Mark C

2010-12-01

Impairment of the blood-brain barrier (BBB), the blood-cerebrospinal fluid (CSF) barrier and brain-CSF barrier has been implicated in neuropathology of several brain disorders, such as amyotrophic lateral sclerosis, cerebral edema, multiple sclerosis, neural inflammation, ischemia and stroke. Two-pore domain weakly inward rectifying K+ channel (TWIK)-related acid-sensitive potassium (TASK)-1 channels (K2p3.1; KCNK3) are among the targets that contribute to the development of these pathologies. For example TASK-1 activity is inhibited by acidification, ischemia, hypoxia and several signaling molecules released under pathologic conditions. We have used immuno-histochemistry to examine the distribution of the TASK-1 protein in structures associated with the BBB, blood-CSF barrier, brain-CSF barrier, and in the meninges of adult rat. Dense TASK-1 immuno-reactivity (TASK-1-IR) was observed in ependymal cells lining the fourth ventricle at the brain-CSF interface, in glial cells that ensheath the walls of blood vessels at the glio-vascular interface, and in the meninges. In these structures, TASK-1-IR often co-localized with glial fibrillary associated protein (GFAP) or vimentin. This study provides anatomical evidence for localization of TASK-1 K+ channels in cells that segregate distinct fluid compartments within and surrounding the brain. We suggest that TASK-1 channels, in coordination with other ion channels (e.g., aquaporins and chloride channels) and transporters (e.g., Na+-K+-ATPase and Na+-K+-2Cl⁻ and by virtue of its heterogeneous distribution, may differentially contribute to the varying levels of K+ vital for cellular function in these compartments. Our findings are likely to be relevant to recently reported roles of TASK-1 in cerebral ischemia, stroke and inflammatory brain disorders.

Study of Quasielastic scattering for 7Li+159Tb at around- barrier energies

Directory of Open Access Journals (Sweden)

Mukherjee A.

2017-01-01

Full Text Available Quasielastic scattering cross sections for the reaction 7Li+159Tb have been measured at large backangles, at energies around the Coulomb barrier. The quasielastic barrier distribution has been extracted from the measured quasielastic scattering excitation function, including and excluding α particle contribution. The peak of the quasielastic barrier distribution including α particle contribution shows a shift towards higher energy compared to the peak of the distribution without α particles. The quasielastic barrier distribution when compared to the calculated fusion barrier distribution, appears to show reasonable agreement for the system.

Effects of breakup of weakly bound projectile and neutron transfer on fusion reactions around Coulomb barrier

International Nuclear Information System (INIS)

Lin, C.J.; Zhang, H.Q.; Yang, F.; Ruan, M.; Liu, Z.H.; Wu, Y.W.; Wu, X.K.; Zhou, P.; Zhang, C.L.; Zhang, G.L.; An, G.P.; Jia, H.M.; Xu, X.X.

2007-01-01

The excitation functions of quasielastic and elastic scattering at backward angles have been measured for the systems of 16 O+ 152 Sm, 6,7 Li+ 208 Pb and 32 S+ 90,96 Zr. The barrier distributions are extracted from these measured excitation functions and compared with the corresponding fusion barrier distributions. Except some details, the barrier distributions derived from the data of fusion and quasielastic/elastic scattering are almost the same for the tightly bound reaction systems. For the reaction systems with weakly bound projectile, the barrier distributions extracted from quasielastic scattering are obviously different from the fusion barrier distributions. However, the barrier distributions extracted from the excitation functions of the quasielastic scattering plus breakup are almost the same as the one extracted from the complete fusion data. This result means that barrier distribution not only bears the information of nuclear structures but also contains the knowledge of reaction mechanisms. Our results show that the complete fusion of the weakly bound projectile with heavy target is suppressed at the above barrier energies as compared with the model predictions. In addition, the measured barrier distribution of 32 S+ 96 Zr is broaden and extends to lower energy than in the case of 32 S+ 90 Zr due to the coupling of neutron transfer with positive Q-values, which result in a significant enhancement of fusion cross sections at the subbarrier energies

Conjugate heat transfer investigation on the cooling performance of air cooled turbine blade with thermal barrier coating

Science.gov (United States)

Ji, Yongbin; Ma, Chao; Ge, Bing; Zang, Shusheng

2016-08-01

A hot wind tunnel of annular cascade test rig is established for measuring temperature distribution on a real gas turbine blade surface with infrared camera. Besides, conjugate heat transfer numerical simulation is performed to obtain cooling efficiency distribution on both blade substrate surface and coating surface for comparison. The effect of thermal barrier coating on the overall cooling performance for blades is compared under varied mass flow rate of coolant, and spatial difference is also discussed. Results indicate that the cooling efficiency in the leading edge and trailing edge areas of the blade is the lowest. The cooling performance is not only influenced by the internal cooling structures layout inside the blade but also by the flow condition of the mainstream in the external cascade path. Thermal barrier effects of the coating vary at different regions of the blade surface, where higher internal cooling performance exists, more effective the thermal barrier will be, which means the thermal protection effect of coatings is remarkable in these regions. At the designed mass flow ratio condition, the cooling efficiency on the pressure side varies by 0.13 for the coating surface and substrate surface, while this value is 0.09 on the suction side.

Functionalized graphene/silicon chemi-diode H₂ sensor with tunable sensitivity.

Science.gov (United States)

Uddin, Md Ahsan; Singh, Amol Kumar; Sudarshan, Tangali S; Koley, Goutam

2014-03-28

A reverse bias tunable Pd- and Pt-functionalized graphene/Si heterostructure Schottky diode H2 sensor has been demonstrated. Compared to the graphene chemiresistor sensor, the chemi-diode sensor offers more than one order of magnitude higher sensitivity as the molecular adsorption induced Schottky barrier height change causes the heterojunction current to vary exponentially in reverse bias. The reverse bias operation also enables low power consumption, as well as modulation of the atomically thin graphene's Fermi level, leading to tunable sensitivity and detection of H₂ down to the sub-ppm range.

Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.

Science.gov (United States)

Kawano, Ken-Ichi; Umemura, Kazuo

2013-05-01

The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.

Healthcare Barriers and Utilization Among Adolescents and Young Adults Accessing Services for Homeless and Runaway Youth.

Science.gov (United States)

Chelvakumar, Gayathri; Ford, Nancy; Kapa, Hillary M; Lange, Hannah L H; McRee, Annie-Laurie; Bonny, Andrea E

2017-06-01

Homeless and runaway youth are at disproportionate risk for adverse health outcomes. Many barriers to accessing healthcare have been documented; however, the relative impact of discrete barriers on homeless youth healthcare utilization behavior is not firmly established. We administered a survey examining reported barriers and healthcare utilization among adolescents and young adults accessing services at three community centers for homeless and runaway youth. Of 180 respondents, 57 % were male, 80 % non-White, and 21 % identified as a sexual minority. Stepwise logistic regression models, controlling for age and study site, explored associations between barriers and 3 healthcare utilization outcomes (doctor visit in past 12 months; regular care provider; frequent emergency department (ED) visits). The most commonly reported barriers were "don't have a ride" (27.2 %), "no insurance" (23.3 %), and "costs too much" (22.8 %). All fear-based barriers (e.g., "I don't trust the doctors") were reported by runaway youth as the impact of discrete barriers varies depending on outcome of focus.

Hydrogel-forming microneedles increase in volume during swelling in skin, but skin barrier function recovery is unaffected

Science.gov (United States)

Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David

2014-01-01

We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895

Electronic transport for armchair graphene nanoribbons with a potential barrier

International Nuclear Information System (INIS)

Ben-Hu, Zhou; Ben-Liang, Zhou; Guang-Hui, Zhou; Zi-Gang, Duan

2010-01-01

This paper studies the electronic transport property through a square potential barrier in armchair-edge graphene nanoribbon (AGNR). Using the Dirac equation with the continuity condition for wave functions at the interfaces between regions with and without a barrier, we calculate the mode-dependent transmission probability for both semiconducting and metallic AGNRs, respectively. It is shown that, by some numerical examples, the transmission probability is generally an oscillating function of the height and range of the barrier for both types of AGNRs. The main difference between the two types of systems is that the magnitude of oscillation for the semiconducting AGNR is larger than that for the metallic one. This fact implies that the electronic transport property for AGNRs depends sensitively on their widths and edge details due to the Dirac nature of fermions in the system

Barriers, activities and participation: Incorporating ICF into service planning datasets.

LENUS (Irish Health Repository)

O'Donovan, MA

2009-05-21

Purpose. Guided by the World Health Organization\\'s International Classification of Functioning, Disability and Health (ICF), a measure of activity and participation (MAP) was developed and incorporated into the National Physical and Sensory Disability Database in Ireland. The aims of this article are to investigate and explore the relationship between the barriers, participation restriction and functioning levels experienced by people with disabilities. Method. Seven thousand five hundred and sixty-two personal interviews with people meeting specific eligibility criteria for registering onto the database were conducted across four health service executive regions in Ireland. Results. Overall, differences in barriers, participation restriction and activity limitations experienced by people with different types of disabilities were found to be significant. Furthermore, low functioning and experience of barriers were indicators of participation restriction. Conclusions. This article has shown that elements of the ICF have been successfully operationalised in a service planning tool through the development of the MAP. This provides a more holistic view of disability and will enable the impact of service interventions to be measured over time.

Smart parking barrier

KAUST Repository

Alharbi, Abdulrazaq M.

2016-01-01

positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking

Sustainable Supply Chain Management Implementation–Enablers and Barriers in the Textile Industry

Directory of Open Access Journals (Sweden)

Nelly Oelze

2017-08-01

Full Text Available The distinct definition of accordance in the perceived barriers and enablers for sustainable supply chain management (SSCM policy implementation has been the subject of various research studies, but a distinct focus on the textile sector has been the object of limited previous attention. However, it has been found that it affects the approach to developments in company approaches to sustainable supply chain management within that industry. This article presents the results of an in-depth comparative case study analysis, drawing on 23 interviews with managers of 10 companies from the textile industry. The analysis demonstrates that specific modes of collaboration can both enable an effective SSCM and diminish barriers for policy implementation. The width and depth varies between a collaborative management approach for an effective internal SSCM versus industry collaboration and buyer supplier collaboration to address external barriers and enablers.

Injectable barriers for waste isolation

International Nuclear Information System (INIS)

Persoff, P.; Finsterle, S.; Moridis, G.J.; Apps, J.; Pruess, K.; Muller, S.J.

1995-03-01

In this paper the authors report laboratory work and numerical simulation done in support of development and demonstration of injectable barriers formed from either of two fluids: colloidal silica or polysiloxane. Two principal problems addressed here are control of gel time and control of plume emplacement in the vadose zone. Gel time must be controlled so that the viscosity of the barrier fluid remains low long enough to inject the barrier, but increases soon enough to gel the barrier in place. During injection, the viscosity must be low enough to avoid high injection pressures which could uplift or fracture the formation. To test the grout gel time in the soil, the injection pressure was monitored as grouts were injected into sandpacks. When grout is injected into the vadose zone, it slumps under the influence of gravity, and redistributes due to capillary forces as it gels. The authors have developed a new module for the reservoir simulator TOUGH2 to model grout injection into the vadose zone, taking into account the increase of liquid viscosity as a function of gel concentration and time. They have also developed a model to calculate soil properties after complete solidification of the grout. The numerical model has been used to design and analyze laboratory experiments and field pilot tests. The authors present the results of computer simulations of grout injection, redistribution, and solidification

An empirical orthogonal function analysis of ocean shoreline location on the Virginia barrier islands

Science.gov (United States)

Haluska, J. D.

2017-12-01

Shoreline change along the Eastern Atlantic shore of Virginia has been studied for the individual barrier islands but not as an integrated system. This study combines the Atlantic shoreline locations for eleven barrier islands obtained from LANDSAT 5, 7, and 8 images. Approximately 250 shoreline locations over a 24-year period from Jan 1990 to Dec 2014 were extracted from the digitized shoreline data at 338 transects. The resulting 338 by 250 matrix was analyzed by the empirical orthogonal function (EOF) technique. The first four principal components (PC) explained 86 percent of the sample variance. Since the data was not detrended, the first PC was the overall trend of the data with a discontinuity in 2004-2005. The 2004-2005 interval included storm events and large shoreline changes. PCs 2 to 4 reflect the effects of El Nino events and tropical and non-tropical storms. Eigenvectors 1 to 4 all show the effects of the nine inlets in the island group. Eigenvector (EV) 1 explains 59 percent of the shoreline spatial variance and shows the largest changes at the northern and southern island ends. EVs 2 to 4 reflect the pattern of EV1 but at sequentially smaller percentages of the spatial variance. As a group, the eleven islands are losing ocean side shoreline. The lone exception is Hog Island. Sea level had the strongest correlation with the shoreline loss trend of PC1. The coefficient of determination was 0.41. The NAO and MEI also correlated with PC1 with correlations of determination of 0.05 and 0.12 respectively. These confidence level for the three factors was better than 99 percent. Sea level also correlated with PC3 and PC4. The PCs as a group show that the year intervals 2004-2005 and 2009-2010 had large effects on the shoreline change pattern for the island group. EVs 1 to 4 had the highest range of shoreline change at the island ends indicating the effect the changes of the inlets have on the adjacent islands. The smaller islands as a group had a higher level

AKAP12 mediates barrier functions of fibrotic scars during CNS repair.

Directory of Open Access Journals (Sweden)

Jong-Ho Cha

Full Text Available The repair process after CNS injury shows a well-organized cascade of three distinct stages: inflammation, new tissue formation, and remodeling. In the new tissue formation stage, various cells migrate and form the fibrotic scar surrounding the lesion site. The fibrotic scar is known as an obstacle for axonal regeneration in the remodeling stage. However, the role of the fibrotic scar in the new tissue formation stage remains largely unknown. We found that the number of A-kinase anchoring protein 12 (AKAP12-positive cells in the fibrotic scar was increased over time, and the cells formed a structure which traps various immune cells. Furthermore, the AKAP12-positive cells strongly express junction proteins which enable the structure to function as a physical barrier. In in vivo validation, AKAP12 knock-out (KO mice showed leakage from a lesion, resulting from an impaired structure with the loss of the junction complex. Consistently, focal brain injury in the AKAP12 KO mice led to extended inflammation and more severe tissue damage compared to the wild type (WT mice. Accordingly, our results suggest that AKAP12-positive cells in the fibrotic scar may restrict excessive inflammation, demonstrating certain mechanisms that could underlie the beneficial actions of the fibrotic scar in the new tissue formation stage during the CNS repair process.

Permeability of EVOH Barrier Material Used in Automotive Applications: Metrology Development for Model Fuel Mixtures

Directory of Open Access Journals (Sweden)

Zhao Jing

2015-02-01

Full Text Available EVOH (Ethylene-Vinyl Alcohol materials are widely used in automotive applications in multi-layer fuel lines and tanks owing to their excellent barrier properties to aromatic and aliphatic hydrocarbons. These barrier materials are essential to limit environmental fuel emissions and comply with the challenging requirements of fast changing international regulations. Nevertheless, the measurement of EVOH permeability to model fuel mixtures or to their individual components is particularly difficult due to the complexity of these systems and their very low permeability, which can vary by several orders of magnitude depending on the permeating species and their relative concentrations. This paper describes the development of a new automated permeameter capable of taking up the challenge of measuring minute quantities as low as 1 mg/(m2.day for partial fluxes for model fuel mixtures containing ethanol, i-octane and toluene at 50°C. The permeability results are discussed as a function of the model fuel composition and the importance of EVOH preconditioning is emphasized for accurate permeability measurements. The last part focuses on the influence of EVOH conditioning on its mechanical properties and its microstructure, and further illustrates the specific behavior of EVOH in presence of ethanol oxygenated fuels. The new metrology developed in this work offers a new insight in the permeability properties of a leading barrier material and will help prevent the consequences of (bioethanol addition in fuels on environmental emissions through fuel lines and tanks.

Caution, Student Experience May Vary: Social Identities Impact a Student’s Experience in Peer Discussions

Science.gov (United States)

Eddy, Sarah L.; Brownell, Sara E.; Thummaphan, Phonraphee; Lan, Ming-Chih; Wenderoth, Mary Pat

2015-01-01

In response to calls for implementing active learning in college-level science, technology, engineering, and mathematics courses, classrooms across the country are being transformed from instructor centered to student centered. In these active-learning classrooms, the dynamics among students becomes increasingly important for understanding student experiences. In this study, we focus on the role a student prefers to assume during peer discussions, and how this preferred role may vary given a student’s social identities. In addition we explore whether three hypothesized barriers to participation may help explain participation difference in the classroom. These barriers are 1) students are excluded from the discussion by actions of their groupmates; 2) students are anxious about participating in peer discussion; and 3) students do not see value in peer discussions. Our results indicate that self-reported preferred roles in peer discussions can be predicted by student gender, race/ethnicity, and nationality. In addition, we found evidence for all three barriers, although some barriers were more salient for certain students than others. We encourage instructors to consider structuring their in-class activities in ways that promote equity, which may require more purposeful attention to alleviating the current differential student experiences with peer discussions. PMID:26628561

Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

International Nuclear Information System (INIS)

Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae; Park, Sang Chul

2010-01-01

One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin α, karyopherin β, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

Energy Technology Data Exchange (ETDEWEB)

Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Park, Sang Chul, E-mail: scpark@snu.ac.kr [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)

2010-01-01

One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin {alpha}, karyopherin {beta}, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

Does weight status influence perceptions of physical activity barriers among African-American women?

Science.gov (United States)

Genkinger, Jeanine M; Jehn, Megan L; Sapun, Marcella; Mabry, Iris; Young, Deborah Rohm

2006-01-01

Many African-American women fail to participate in regular physical activity. Weight status may influence physical activity barriers. This study examined the frequency and type of barriers. Participants in this study were enrolled in Project EXE-L (Exercising Ladies Excel), a six-month, church-based, randomized trial of moderate-intensity physical activity based in Baltimore city and county in Maryland. Participants were composed of African-American women who attended one of the participating churches, had friends who were church members, or who lived in neighborhoods surrounding one of the churches. Individuals who were between the ages of 25 and 70 years, were not regularly physically active (defined as not engaging in moderate-intensity activity more than three times per week), and were able to participate in moderate-intensity activity met eligibility criteria to participate in the trial. Barriers to physical activity were evaluated with the Steinhardt/Dishman Barriers for Habitual Physical Activity Scale at baseline. One hundred twenty women were classified as normal weight (body mass index [BMI]: or = 30 kg/m2). Obese participants were more likely to report "lack of motivation" as a barrier compared with normal-weight participants (63% vs 31%). Normal-weight and overweight participants were more likely to report no barriers compared with the obese (31%, 0%, 5%, respectively, P<.05). Barriers for African-American women may vary by BMI status. By defining these unique barriers, effective physical activity interventions can be developed.

Near-field geologic environment as an effective barrier against radionuclide transport

International Nuclear Information System (INIS)

Umeki, H.; Sakuma, H.; Ishiguro, K.; Hatanaka, K.; Naito, M.

1993-01-01

A generic performance assessment of the geologic disposal system of HLW in Japan has been carried out by the Power Reactor and Nuclear Fuel Development Corporation (PNC) in accordance with the overall HLW management program defined by the Japanese Atomic Energy Commission. A massive engineered barrier system, consisting of vitrified waste, carbon-steel overpack and thick bentonite buffer, is introduced to ensure a long-term performance of the disposal system considering a wide range of geologic environment. A major part of the total performance of the disposal system is borne by the engineered barrier system given a geologic environment that assures and complements the performance of such engineered barrier system. The performance of the natural barrier system coupled with the strong engineered barrier system was investigated by sensitivity analyses. Two types of conceptual model were considered for the analysis to describe radionuclide transport in geologic media and the range of relevant parameters was given by taking the variation of the geologic environment in Japan into account. The results show that the degree of retardation of radionuclide transport chosen in the geologic media varies significantly depending on the parameter values chosen. However, it is indicated that there are realistic combinations of those geologic parameter values which could provide a sufficient degree of retardation within a range of only a few tens of meters from the engineered barrier system. The relative importance of the near-field geologic environment is also discussed

Ethnic differences in cancer symptom awareness and barriers to seeking medical help in England.

Science.gov (United States)

Niksic, Maja; Rachet, Bernard; Warburton, Fiona G; Forbes, Lindsay J L

2016-06-28

Ethnic differences in cancer symptom awareness and barriers to seeking medical help in the English population are not fully understood. We aimed to quantify these differences, to help develop more effective health campaigns, tailored to the needs of different ethnic groups. Using a large national data set (n=38 492) of cross-sectional surveys that used the Cancer Research UK Cancer Awareness Measure, we examined how cancer symptom awareness and barriers varied by ethnicity, controlling for socio-economic position, age and gender. Data were analysed using multivariable logistic regression. Awareness of cancer symptoms was lower in minority ethnic groups than White participants, with the lowest awareness observed among Bangladeshis and Black Africans. Ethnic minorities were more likely than White British to report barriers to help-seeking. South Asians reported the highest emotional barriers, such as lack of confidence to talk to the doctor, and practical barriers, such as worry about many other things. The Irish were more likely than the White British to report practical barriers, such as being too busy to visit a doctor. White British participants were more likely than any other ethnic group to report that they would feel worried about wasting the doctor's time. Overall, Black Africans had the lowest barriers. All differences were statistically significant (Pcancer symptoms among ethnic minorities. Campaigns should tackle the specific barriers prevalent in each ethnic group.

Controlling the hydration of the skin though the application of occluding barrier creams.

Science.gov (United States)

Sparr, Emma; Millecamps, Danielle; Isoir, Muriel; Burnier, Véronique; Larsson, Åsa; Cabane, Bernard

2013-03-06

The skin is a barrier membrane that separates environments with profoundly different water contents. The barrier properties are assured by the outer layer of the skin, the stratum corneum (SC), which controls the transepidermal water loss. The SC acts as a responding membrane, since its hydration and permeability vary with the boundary condition, which is the activity of water at the outer surface of the skin. We show how this boundary condition can be changed by the application of a barrier cream that makes a film with a high resistance to the transport of water. We present a quantitative model that predicts hydration and water transport in SC that is covered by such a film. We also develop an experimental method for measuring the specific resistance to water transport of films made of occluding barrier creams. Finally, we combine the theoretical model with the measured properties of the barrier creams to predict how a film of cream changes the activity of water at the outer surface of the SC. Using the known variations of SC permeability and hydration with the water activity in its environment (i.e. the relative humidity), we can thus predict how a film of barrier cream changes SC hydration.

Microbial community diversity and composition varies with habitat characteristics and biofilm function in macrophyte-rich streams

DEFF Research Database (Denmark)

Levi, Peter S.; Starnawski, Piotr; Poulsen, Britta

2017-01-01

Biofilms in streams play an integral role in ecosystem processes and function yet few studies have investigated the broad diversity of these complex prokaryotic and eukaryotic microbial communities. Physical habitat characteristics can affect the composition and abundance of microorganisms...... in these biofilms by creating microhabitats. Here we describe the prokaryotic and eukaryotic microbial diversity of biofilms in sand and macrophyte habitats (i.e. epipsammon and epiphyton, respectively) in five macrophyte-rich streams in Jutland, Denmark. The macrophyte species varied in growth morphology, C......:N stoichiometry, and preferred stream habitat, providing a range in environmental conditions for the epiphyton. Among all habitats and streams, the prokaryotic communities were dominated by common phyla, including Alphaproteobacteria, Bacteriodetes, and Gammaproteobacteria, while the eukaryotic communities were...

The critical role of the barrier thickness in spin filter tunneling

International Nuclear Information System (INIS)

Miller, Casey W.

2009-01-01

Spin filter tunneling is considered in the low bias limit as functions of the temperature dependent barrier parameters. We demonstrate the generation of spin polarized tunneling currents in relation to the magnetic order parameter, and discuss how an interfacially suppressed order parameter leads to a temperature dependent tunneling current asymmetry. Analyzing the full parameter space reveals that the often overlooked barrier thickness plays a critical role in spin filter tunneling. With all else fixed, thicker barriers yield higher spin polarization, and allow a given polarization to be achieved at higher temperatures. This insight may open the door for new materials to serve as spin filter barriers.

Identifying barriers in the diffusion of renewable energy sources

International Nuclear Information System (INIS)

Eleftheriadis, Iordanis M.; Anagnostopoulou, Evgenia G.

2015-01-01

Rapid diffusion of renewable energy sources (RES) in the electricity power sector is crucial if the EU wants to fulfill its 2050 CO 2 reduction commitments. For this reason, identifying and alleviating all barriers that hinder the development of RES is necessary to the successful deployment of these technologies. This paper discusses the main barriers in the diffusion of wind and photovoltaic (PV) solar power in the Greek electricity sector by drawing on the literature of technological innovation systems and system functions. Furthermore, we provide an explanation of the different diffusion rates between the two technologies. Inadequate financial resources, low grid capacity, delays in the issuance of building permits, opposition from local communities to the construction of wind farms and the lack of a stable institutional framework are among the most important barriers that inhibit the diffusion of the wind and PV solar power. The nature of the barriers identified in this study calls for policy intervention. - Highlights: • Firms in the Greek wind and solar power sectors assess RES barriers. • Lack of financial resources is the most important RES barrier. • Lack of a stable institutional framework negatively affects RES deployment. • The support of the public sector is crucial to the diffusion of RES. •Wind power faces strong legitimization barriers

Performance characteristics of a self-sealing/self-healing barrier

International Nuclear Information System (INIS)

McGregor, R.G.; Stegemann, J.A.

1997-01-01

Environment Canada and the Netherlands Energy Research Foundation are co-developers of a patented Self-Sealing/Self-Healing (SS/SH) Barrier system for containment of wastes which is licensed to Water Technology International Corporation. The SS/SH Barrier is intended for use as either a liner or cover for landfills, contaminated sites, secondary containment areas, etc., in the industrial, chemical, mining and municipal sectors, and also as a barrier to hydraulic flow for the transportation and construction industry. The SS/SH Barrier's most significant feature is its capability for self-repair in the event of a breach. By contrast, conventional barrier systems, such as clay, geomembrane, or geosynthetic clay liners can not be repaired without laborious excavation and reconstruction. Laboratory investigations have shown that the SS/SH Barrier concept will function with a variety of reactive materials. Self-Sealing/Self-Healing Barriers are cost competitive and consistently exhibit hydraulic conductivities ranging from 10 -9 to 10 -13 m/s, which decrease with time. These measurements meet or exceed the recommended hydraulic conductivity required by EPA for clay liners ( -9 m/s) used in landfills and hazardous waste sites. Results of mineralogical examination of the seal, diffusion testing, hydraulic conductivity measurement, and durability testing, including wet/dry, freeze/thaw cycling and leachate compatibility are also presented

ECRH [electron-cyclotron resonance heating]-heated distributions in thermal-barrier tandem mirrors

International Nuclear Information System (INIS)

Cohen, R.H.; LoDestro, L.L.

1987-01-01

The distribution function is calculated for electrons subjected to strong electron-cyclotron resonance heating (ECRH) at the plug and barrier in a tandem-mirror thermal-barrier cell. When ECRH diffusion locally dominates over collisions and a boundary condition (associated with electrons passing to the center cell) imposes variations on the distribution function rapid compared to the variation of the ECRH and collisional diffusion coefficients, the kinetic equation can be reduced approximately to Laplace's equation. For the typical case where velocity space is divided into distinct regions in which plug and barrier ECRH dominate, the solution in each region can be expressed in terms of the plasma dispersion function or exponential integrals, according to whether the passing electrons are dominated by collisions or ECRH, respectively. The analytic results agree well with Fokker-Planck code results, in terms of both velocity-space structure and values of moments. 10 refs., 4 figs

Modulating the skin barrier function by DMSO: molecular dynamics simulations of hydrophilic and hydrophobic transmembrane pores

NARCIS (Netherlands)

den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.

2008-01-01

The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these

A composite vacuum barrier for the LHC short straight section

International Nuclear Information System (INIS)

Jenny, B.; Rohmig, P.; Uriarte, J.M.

1996-01-01

The lattice of the CERN Large Hadron Collider (LHC) will contain 384 Short Straight Section (SSS) units, one in every 53 m half-cell. The SSS is composed of a twin aperture high-field superconducting quadrupole and of two combined-function corrector magnets operating in pressurized helium at 1.9 K. The SSS cryostat contains also a barrier for sectorisation of the insulation vacuum. The vacuum barrier is mounted between the helium vessel and the vacuum enclosure. Its functions are to limit the extent of eventual helium leaks and to facilitate the leak detection and the pumping-down from atmospheric pressure. During installation of the LHC, the vacuum barrier permits independent testing of the half-cells, thus enabling higher installation rates. In parallel to a conventional barrier made out of austenitic stainless steel, a barrier of composite material was developed, taking advantage of the lower thermal conductivity of glass fibre reinforced epoxy resin, and with the aim of reducing costs for LHC. The thermo-mechanical design together with the conception and the moulding techniques used for the manufacture of the prototype are described. Bonding techniques for the leak tight stainless steel composite interfaces are presented and test results shown. Results on the mechanical performance and on the helium tests carried out on the prototype are given

Stability of barrier buckets with zero RF-barrier separations

Energy Technology Data Exchange (ETDEWEB)

Ng, K.Y.; /Fermilab

2005-03-01

A barrier bucket with very small separation between the rf barriers (relative to the barrier widths) or even zero separation has its synchrotron tune decreasing rather slowly from a large value towards the boundary of the bucket. As a result, large area at the bucket edges can become unstable under the modulation of rf voltage and/or rf phase. In addition, chaotic regions may form near the bucket center and extend outward under increasing modulation. Application is made to those barrier buckets used in the process of momentum mining at the Fermilab Recycler Ring.

Novel assay of metformin levels in patients with type 2 diabetes and varying levels of renal function: clinical recommendations.

Science.gov (United States)

Frid, Anders; Sterner, Gunnar N; Löndahl, Magnus; Wiklander, Clara; Cato, Anne; Vinge, Ellen; Andersson, Anders

2010-06-01

To study trough levels of metformin in serum and its intra-individual variation in patients using a newly developed assay. Trough serum levels of metformin were measured once using liquid chromatography-tandem mass spectrometry (LCMSMS) in 137 type 2 diabetic patients with varying renal function (99 men) and followed repeatedly during 2 months in 20 patients (16 men) with estimated glomerular filtration rate (eGFR) 60, 30-60, and 20 micromol/l. Metformin measurement is less suitable for dose titration.

Functionalized graphene/silicon chemi-diode H2 sensor with tunable sensitivity

International Nuclear Information System (INIS)

Uddin, Md Ahsan; Singh, Amol Kumar; Sudarshan, Tangali S; Koley, Goutam

2014-01-01

A reverse bias tunable Pd- and Pt-functionalized graphene/Si heterostructure Schottky diode H 2 sensor has been demonstrated. Compared to the graphene chemiresistor sensor, the chemi-diode sensor offers more than one order of magnitude higher sensitivity as the molecular adsorption induced Schottky barrier height change causes the heterojunction current to vary exponentially in reverse bias. The reverse bias operation also enables low power consumption, as well as modulation of the atomically thin graphene’s Fermi level, leading to tunable sensitivity and detection of H 2 down to the sub-ppm range. (paper)

In vitro models of the blood-brain barrier

DEFF Research Database (Denmark)

Helms, Hans Christian Cederberg; Abbott, N Joan; Burek, Malgorzata

2016-01-01

The endothelial cells lining the brain capillaries separate the blood from the brain parenchyma. The endothelial monolayer of the brain capillaries serves both as a crucial interface for exchange of nutrients, gases, and metabolites between blood and brain, and as a barrier for neurotoxic...... components of plasma and xenobiotics. This "blood-brain barrier" function is a major hindrance for drug uptake into the brain parenchyma. Cell culture models, based on either primary cells or immortalized brain endothelial cell lines, have been developed, in order to facilitate in vitro studies of drug...... transport to the brain and studies of endothelial cell biology and pathophysiology. In this review, we aim to give an overview of established in vitro blood-brain barrier models with a focus on their validation regarding a set of well-established blood-brain barrier characteristics. As an ideal cell culture...

Cold fission description with constant and varying mass asymmetries

International Nuclear Information System (INIS)

Duarte, S.B.; Rodriguez, O.; Tavares, O.A.P.; Goncalves, M.; Garcia, F.; Guzman, F.

1998-01-01

Different description for varying the mass asymmetry in the fragmentation process are used to calculate the cold fission barrier penetrability. The relevance of the appropriate choice for both the description of the pre-scission phase and inertia coefficient to unify alpha decay, cluster radioactivity, and spontaneous cold fission processes in the same theoretical framework is explicitly shown. We calculate the half-life of all possible partition modes of nuclei of A > 200 following the most recent Mass Table by Audi and Wapstra. It is shown that if one uses the description in which the mass asymmetry is maintained constant during the fragmentation process, the experimental half-life-values and mass yield of 234 U cold fission are satisfactorily reproduced. (author)

Safety-barrier diagrams as a tool for modelling safety of hydrogen applications

DEFF Research Database (Denmark)

Duijm, Nijs Jan; Markert, Frank

2009-01-01

Safety-barrier diagrams have proven to be a useful tool in documenting the safety measures taken to prevent incidents and accidents in process industry. Especially during the introduction of new hydrogen technologies or applications, as e.g. hydrogen refuelling stations, safety-barrier diagrams...... are considered a valuable supplement to other traditional risk analysis tools to support the communication with authorities and other stakeholders during the permitting process. Another advantage of safety-barrier diagrams is that they highlight the importance of functional and reliable safety barriers in any...... system and here is a direct focus on those barriers that need to be subject to safety management in terms of design and installation, operational use, inspection and monitoring, and maintenance. Safety-barrier diagrams support both quantitative and qualitative approaches. The paper will describe...

Effect of ruminal acidosis and short-term low feed intake on indicators of gastrointestinal barrier function in Holstein steers.

Science.gov (United States)

Pederzolli, Rae-Leigh A; Van Kessel, Andrew G; Campbell, John; Hendrick, Steve; Wood, Katie M; Penner, Gregory B

2018-02-15

The objective of this study was to determine effect of ruminal acidosis (RA) and low feed intake [LFI] on the regional barrier function of the gastrointestinal tract. Twenty-one Holstein steers were fed for ad libitum intake for 5 d (control [CON]), fed at 25% of ad libitum intake for 5 d (LFI), or provided 2 d of ad libitum intake followed by 1-d of feed restriction (25% of ad libitum intake), 1 d where 30% of ad libitum dry matter intake (DMI) was provided as pelleted barley followed by the full allocation (RA) and fed for ad libitum intake the following day. Tissues and digesta from the rumen, omasum, duodenum, jejunum, ileum, cecum, proximal, and distal colon were collected. Permeability was assessed using the mucosal-to-serosal flux of inulin (JMS-inulin) and mannitol (JMS-mannitol). Digesta pH was 0.81, 0.63, and 0.42 pH units less for RA than CON in the rumen, cecum, and proximal colon; while, LFI had pH that was 0.47 and 0.36 pH units greater in the rumen and proximal colon compared to CON. Total ruminal short-chain fatty acid (SCFA) concentration were less for LFI (92 mM; P = 0.010) and RA (87 mM; P = 0.007) than CON (172 mM) steers. In the proximal colon, the proportion of butyrate (P = 0.025 and P = 0.022) and isobutyrate (P = 0.019 and P = 0.019) were greater, and acetate (P = 0.028 and P = 0.028) was less for LFI and RA, respectively, when compared to CON steers. Ruminal papillae length, width, perimeter, and surface area were 1.21 mm, 0.78 mm, 3.84 mm, and 11.15 mm2 less for LFI than CON; while, RA decreased papillae width by 0.52 mm relative to CON. The JMS-mannitol was less for LFI steers than CON in the proximal colon (P = 0.041) and in the distal colon (P = 0.015). Increased gene expression for claudin 1, occludin, tight-cell junction protein 1 and 2, and toll-like receptor 4 were detected for LFI relative to CON in the rumen, jejunum, and proximal colon. For RA steers, expression of toll-like receptor 4 in the rumen, and occludin and tight

Lipid rafts regulate PCB153-induced disruption of occludin and brain endothelial barrier function through protein phosphatase 2A and matrix metalloproteinase-2

Energy Technology Data Exchange (ETDEWEB)

Eum, Sung Yong, E-mail: seum@miami.edu; Jaraki, Dima; András, Ibolya E.; Toborek, Michal

2015-09-15

Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2′,4,4′,5,5′-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1 h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24 h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs. - Highlights: • PCB153 disturbed human brain endothelial barrier through disruption of occludin. • Lipid raft-associated PP

Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

International Nuclear Information System (INIS)

Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

2008-01-01

Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

Energy Technology Data Exchange (ETDEWEB)

Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

2008-09-29

Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

Three-dimensional culture conditions differentially affect astrocyte modulation of brain endothelial barrier function in response to transforming growth factor β1.

Science.gov (United States)

Hawkins, Brian T; Grego, Sonia; Sellgren, Katelyn L

2015-05-22

Blood-brain barrier (BBB) function is regulated by dynamic interactions among cell types within the neurovascular unit, including astrocytes and endothelial cells. Co-culture models of the BBB typically involve astrocytes seeded on two-dimensional (2D) surfaces, which recent studies indicate cause astrocytes to express a phenotype similar to that of reactive astrocytes in situ. We hypothesized that the culture conditions of astrocytes would differentially affect their ability to modulate BBB function in vitro. Brain endothelial cells were grown alone or in co-culture with astrocytes. Astrocytes were grown either as conventional (2D) monolayers, or in a collagen-based gel which allows them to grow in a three-dimensional (3D) construct. Astrocytes were viable in 3D conditions, and displayed a marked reduction in their expression of glial fibrillary acidic protein (GFAP), suggesting reduced activation. Stimulation of astrocytes with transforming growth factor (TGF)β1 decreased transendothelial electrical resistance (TEER) and reduced expression of claudin-5 in co-cultures, whereas treatment of endothelial cells in the absence of astrocytes was without effect. The effect of TGFβ1 on TEER was significantly more pronounced in endothelial cells cultured with 3D astrocytes compared to 2D astrocytes. These results demonstrate that astrocyte culture conditions differentially affect their ability to modulate brain endothelial barrier function, and suggest a direct relationship between reactive gliosis and BBB permeability. Moreover, these studies demonstrate the potential importance of physiologically relevant culture conditions to in vitro modeling of disease processes that affect the neurovascular unit. Copyright © 2015 Elsevier B.V. All rights reserved.

Environmental barriers, person-environment fit and mortality among community-dwelling very old people.

Science.gov (United States)

Rantakokko, Merja; Törmäkangas, Timo; Rantanen, Taina; Haak, Maria; Iwarsson, Susanne

2013-08-28

Environmental barriers are associated with disability-related outcomes in older people but little is known of the effect of environmental barriers on mortality. The aim of this study was to examine whether objectively measured barriers in the outdoor, entrance and indoor environments are associated with mortality among community-dwelling 80- to 89-year-old single-living people. This longitudinal study is based on a sample of 397 people who were single-living in ordinary housing in Sweden. Participants were interviewed during 2002-2003, and 393 were followed up for mortality until May 15, 2012.Environmental barriers and functional limitations were assessed with the Housing Enabler instrument, which is intended for objective assessments of Person-Environment (P-E) fit problems in housing and the immediate outdoor environment. Mortality data were gathered from the public national register. Cox regression models were used for the analyses. A total of 264 (67%) participants died during follow-up. Functional limitations increased mortality risk. Among the specific environmental barriers that generate the most P-E fit problems, lack of handrails in stairs at entrances was associated with the highest mortality risk (adjusted RR 1.55, 95% CI 1.14-2.10), whereas the total number of environmental barriers at entrances and outdoors was not associated with mortality. A higher number of environmental barriers indoors showed a slight protective effect against mortality even after adjustment for functional limitations (RR 0.98, 95% CI 0.96-1.00). Specific environmental problems may increase mortality risk among very-old single-living people. However, the association may be confounded by individuals' health status which is difficult to fully control for. Further studies are called for.

Clusterin Seals the Ocular Surface Barrier in Mouse Dry Eye.

Science.gov (United States)

Bauskar, Aditi; Mack, Wendy J; Mauris, Jerome; Argüeso, Pablo; Heur, Martin; Nagel, Barbara A; Kolar, Grant R; Gleave, Martin E; Nakamura, Takahiro; Kinoshita, Shigeru; Moradian-Oldak, Janet; Panjwani, Noorjahan; Pflugfelder, Stephen C; Wilson, Mark R; Fini, M Elizabeth; Jeong, Shinwu

2015-01-01

Dry eye is a common disorder caused by inadequate hydration of the ocular surface that results in disruption of barrier function. The homeostatic protein clusterin (CLU) is prominent at fluid-tissue interfaces throughout the body. CLU levels are reduced at the ocular surface in human inflammatory disorders that manifest as severe dry eye, as well as in a preclinical mouse model for desiccating stress that mimics dry eye. Using this mouse model, we show here that CLU prevents and ameliorates ocular surface barrier disruption by a remarkable sealing mechanism dependent on attainment of a critical all-or-none concentration. When the CLU level drops below the critical all-or-none threshold, the barrier becomes vulnerable to desiccating stress. CLU binds selectively to the ocular surface subjected to desiccating stress in vivo, and in vitro to the galectin LGALS3, a key barrier component. Positioned in this way, CLU not only physically seals the ocular surface barrier, but it also protects the barrier cells and prevents further damage to barrier structure. These findings define a fundamentally new mechanism for ocular surface protection and suggest CLU as a biotherapeutic for dry eye.

Clusterin Seals the Ocular Surface Barrier in Mouse Dry Eye.

Directory of Open Access Journals (Sweden)

Aditi Bauskar

Full Text Available Dry eye is a common disorder caused by inadequate hydration of the ocular surface that results in disruption of barrier function. The homeostatic protein clusterin (CLU is prominent at fluid-tissue interfaces throughout the body. CLU levels are reduced at the ocular surface in human inflammatory disorders that manifest as severe dry eye, as well as in a preclinical mouse model for desiccating stress that mimics dry eye. Using this mouse model, we show here that CLU prevents and ameliorates ocular surface barrier disruption by a remarkable sealing mechanism dependent on attainment of a critical all-or-none concentration. When the CLU level drops below the critical all-or-none threshold, the barrier becomes vulnerable to desiccating stress. CLU binds selectively to the ocular surface subjected to desiccating stress in vivo, and in vitro to the galectin LGALS3, a key barrier component. Positioned in this way, CLU not only physically seals the ocular surface barrier, but it also protects the barrier cells and prevents further damage to barrier structure. These findings define a fundamentally new mechanism for ocular surface protection and suggest CLU as a biotherapeutic for dry eye.

Time-Varying Networks of Inter-Ictal Discharging Reveal Epileptogenic Zone.

Science.gov (United States)

Zhang, Luyan; Liang, Yi; Li, Fali; Sun, Hongbin; Peng, Wenjing; Du, Peishan; Si, Yajing; Song, Limeng; Yu, Liang; Xu, Peng

2017-01-01

The neuronal synchronous discharging may cause an epileptic seizure. Currently, most of the studies conducted to investigate the mechanism of epilepsy are based on EEGs or functional magnetic resonance imaging (fMRI) recorded during the ictal discharging or the resting-state, and few studies have probed into the dynamic patterns during the inter-ictal discharging that are much easier to record in clinical applications. Here, we propose a time-varying network analysis based on adaptive directed transfer function to uncover the dynamic brain network patterns during the inter-ictal discharging. In addition, an algorithm based on the time-varying outflow of information derived from the network analysis is developed to detect the epileptogenic zone. The analysis performed revealed the time-varying network patterns during different stages of inter-ictal discharging; the epileptogenic zone was activated prior to the discharge onset then worked as the source to propagate the activity to other brain regions. Consistence between the epileptogenic zones detected by our proposed approach and the actual epileptogenic zones proved that time-varying network analysis could not only reveal the underlying neural mechanism of epilepsy, but also function as a useful tool in detecting the epileptogenic zone based on the EEGs in the inter-ictal discharging.

Barriers to meditation by gender and age among cancer family caregivers.

Science.gov (United States)

Williams, Anna-Leila; Ness, Peter Van; Dixon, Jane; McCorkle, Ruth

2012-01-01

Despite solid basic science research supporting meditation's physiologic benefits, meditation remains a marginalized practice for many Westerners; observational and descriptive studies indicate a spectrum of barriers to meditation practice. The aim of this study was to determine differences in barriers to meditation by gender and age. A cross-sectional survey study of 150 family caregivers to adults with cancer visiting an outpatient chemotherapy center in Connecticut was conducted. The primary outcome was the Determinants of Meditation Practice Inventory. Explanatory variables included demographic characteristics, Center for Epidemiologic Studies-Depression Scale, Big Five Inventory, and Caregiver Reaction Assessment. Participants included 98 women and 52 men. Age range was 18-84 years (M = 52.3 years). The highest frequency of barriers for both genders related to misconceptions about meditation. The total number of barriers to meditation did not significantly vary by gender (p = .10) nor age (p = .27). After adjusting for personality trait, reactions to caregiving, and emotional distress, gender (adjusted β = 0.81, SE = 1.70, p = .63) and age (adjusted β = 0.02, SE = 0.05, p = .67) still did not predict the number of barriers to meditation. Backward elimination in model building showed that personality trait and reactions to caregiving account for 32% of the variability in barriers. The total number of barriers to meditation was examined, and a difference was not found by age or gender. It is possible that differences by age and gender exist at the item level of evaluation but were not evident when evaluating total scores. Further study is needed with samples large enough to have statistical power for item-level analysis.

Tests of potential functional barriers for laminated multilayer food packages. Part II: Medium molecular weight permeants.

Science.gov (United States)

Simal-Gándara, J; Sarria-Vidal, M; Rijk, R

2000-09-01

Experiments were performed to characterize the kinetics of the permeation of different medium molecular weight model permeants: bisphenol A, warfarin and anthracene, from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick orientated polypropylene--OPP) into the food simulants olive oil and 3% (w/v) acetic acid. The characterization of permeation kinetics generally observed the permeation models previously reported to explain the experimental permeation results obtained for a low molecular weight group of model permeants. In general, the model permeants exhibited behaviour consistent with their relative molecular weights with respect to (a) the time taken to attain steady-state permeation into the food simulant in which they were more soluble, (b) their subsequent steady-state permeation rates, and (c) their partition between liquid paraffin and the OPP membrane.

Toll-Like Receptor 2 Activation by beta 2 -> 1-Fructans Protects Barrier Function of T84 Human Intestinal Epithelial Cells in a Chain Length-Dependent Manner

NARCIS (Netherlands)

Vogt, Leonie M.; Meyer, Diederick; Pullens, Gerdie; Faas, Marijke M.; Venema, Koen; Ramasamy, Uttara; Schols, Henk A.; de Vos, Paul

Dietary fiber intake is associated with lower incidence and mortality from disease, but the underlying mechanisms of these protective effects are unclear. We hypothesized that beta 2 -> 1-fructan dietary fibers confer protection on intestinal epithelial cell barrier function via Toll-like receptor 2

Skin barrier disruption by acetone: observations in a hairless mouse skin model

NARCIS (Netherlands)

Rissmann, R.; Oudshoorn, M.H.M.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

2009-01-01

To disrupt the barrier function of the skin, different in vivo methods have been established, e.g., by acetone wiping or tape-stripping. In this study, the acetone-induced barrier disruption of hairless mice was investigated in order to establish a reliable model to study beneficial, long-term

Multifactorial skin barrier deficiency and atopic dermatitis: Essential topics to prevent the atopic march.

Science.gov (United States)

Egawa, Gyohei; Kabashima, Kenji

2016-08-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the industrialized world and has multiple causes. Over the past decade, data from both experimental models and patients have highlighted the primary pathogenic role of skin barrier deficiency in patients with AD. Increased access of environmental agents into the skin results in chronic inflammation and contributes to the systemic "atopic (allergic) march." In addition, persistent skin inflammation further attenuates skin barrier function, resulting in a positive feedback loop between the skin epithelium and the immune system that drives pathology. Understanding the mechanisms of skin barrier maintenance is essential for improving management of AD and limiting downstream atopic manifestations. In this article we review the latest developments in our understanding of the pathomechanisms of skin barrier deficiency, with a particular focus on the formation of the stratum corneum, the outermost layer of the skin, which contributes significantly to skin barrier function. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Safety- barrier diagrams

DEFF Research Database (Denmark)

Duijm, Nijs Jan

2008-01-01

Safety-barrier diagrams and the related so-called 'bow-tie' diagrams have become popular methods in risk analysis. This paper describes the syntax and principles for constructing consistent and valid safety-barrier diagrams. The relation of safety-barrier diagrams to other methods such as fault...... trees and Bayesian networks is discussed. A simple method for quantification of safety-barrier diagrams is proposed. It is concluded that safety-barrier diagrams provide a useful framework for an electronic data structure that integrates information from risk analysis with operational safety management....

Safety-barrier diagrams

DEFF Research Database (Denmark)

Duijm, Nijs Jan

2007-01-01

Safety-barrier diagrams and the related so-called "bow-tie" diagrams have become popular methods in risk analysis. This paper describes the syntax and principles for constructing consistent and valid safety-barrier diagrams. The relation with other methods such as fault trees and Bayesian networks...... are discussed. A simple method for quantification of safety-barrier diagrams is proposed, including situations where safety barriers depend on shared common elements. It is concluded that safety-barrier diagrams provide a useful framework for an electronic data structure that integrates information from risk...... analysis with operational safety management....

Investment barriers under a renewable-electricity support scheme: Differences across investor types

International Nuclear Information System (INIS)

Linnerud, Kristin; Holden, Erling

2015-01-01

In 2012, Norway and Sweden implemented a common market for tradable green certificates to achieve each country's renewable-energy target. This is the first example of a cooperation mechanism that the EU has suggested to improve the cost efficiency of its renewable-energy policies. We asked investors in 446 planned hydropower projects in Norway what type of barriers may prevent their project from being realized under this scheme, and how likely it is that their project will be realized. Based on a regression analysis we find that the responses to these questions vary systematically with investor, project and process characteristics. We find that investors are concerned with capacity barriers imposed on the market because of the short duration and abrupt termination of the subsidy scheme at the end of 2020. Consequently, the cost efficiency of this and similar schemes can be improved by choosing a better design. Moreover, experienced investors and local landowners without previous experience in the energy sector responded differently to these questions. Local landowners were more optimistic, less concerned with capacity barriers and more concerned with economic barriers than experienced investors were. These observations are interesting given the recent emergence of new investors in the renewable energy sector. - Highlights: • Norway and Sweden have implemented a common market for tradable green certificates. • We asked questions on barriers and potential to investors in 446 hydropower projects. • Capacity barriers imposed on the market by the support scheme design are important. • Local landowners are more optimistic than experienced investors are, all else equal. • They focus relatively more on economic barriers and risk and less on capacity barriers

Additive impairment of the barrier function and irritation by biogenic amines and sodium lauryl sulphate: a controlled in vivo tandem irritation study.

Science.gov (United States)

Fluhr, J W; Kelterer, D; Fuchs, S; Kaatz, M; Grieshaber, R; Kleesz, P; Elsner, P

2005-01-01

Biogenic amines are potential irritants e.g. in fish-, meat-, milk- and egg-processing professions like cooks, butchers and bakers. The aim of this study was to test the irritative and barrier-disrupting properties of the biogenic amines ammonium hydroxide (AM), dimethylamine (DMA) and trimethylamine (TMA). A repeated sequential irritation of 30 min twice per day was performed over a total of 4 days (tandem repeated irritation test) on the back of 20 healthy volunteers of both sexes with AM, DMA, TMA and sodium lauryl sulphate (SLS). The epidermal barrier function was assessed with a Tewameter TM 210, stratum corneum surface pH was measured with a Skin-pH-Meter 900, inflammation was assessed with a Chromameter CR-300 on the a* axis for redness and a visual score was recorded. All tested biogenic amines (AM, DMA and TMA) induced a barrier disruption and a pH increase paralleled with a 1-day-delayed onset of inflammatory signs. These effects were further enhanced and accelerated by a sequential application of SLS together with the biogenic amines, and inflammation occurred earlier than with the single compounds. Acetic acid (AA) in contrast did only show mild barrier disruption and no significant inflammatory signs. Our system allowed a ranking of the different compounds in their irritative potential in the tandem irritation with SLS: SLS > NaOH > TMA > AA > AM > DMA. The results are suggestive that in the food-processing industry the simultaneous contact with biogenic amines and harmful detergents like SLS should be minimized. Copyright 2005 S. Karger AG, Basel.

Mapping of the freshwater lens in a coastal aquifer on the Keta Barrier (Ghana) by transient electromagnetic soundings

DEFF Research Database (Denmark)

Nielsen, Lars; Jørgensen, Niels Oluf; Gelting, Peter

2007-01-01

We present a model of the freshwater lens and saltwater intrusion in a 1000 m wide and 2500 m long portion of the Keta Barrier, Ghana, based on 96 transient electromagnetic (TEM) measurements. Saltwater intrusions from the Gulf of Guinea to the south of the barrier and from the Keta Lagoon...... interpret the existence of a mixing zone with brackish water between the freshwater lens and the layers with saline pore water. This mixing zone varies in thickness from 0-5 m close to the coastlines to  10-20 m in the central part of the barrier....

Controlling the spin-torque efficiency with ferroelectric barriers

KAUST Repository

Useinov, A.; Chshiev, M.; Manchon, Aurelien

2015-01-01

Nonequilibrium spin-dependent transport in magnetic tunnel junctions comprising a ferroelectric barrier is theoretically investigated. The exact solutions of the free electron Schrödinger equation for electron tunneling in the presence of interfacial screening are obtained by combining Bessel and Airy functions. We demonstrate that the spin transfer torque efficiency, and more generally the bias dependence of tunneling magneto- and electroresistance, can be controlled by switching the ferroelectric polarization of the barrier. In particular, the critical voltage at which the in-plane torque changes sign can be strongly enhanced or reduced depending on the direction of the ferroelectric polarization of the barrier. This effect provides a supplementary way to electrically control the current-driven dynamic states of the magnetization and related magnetic noise in spin transfer devices.

Claudins, dietary milk proteins, and intestinal barrier regulation.

Science.gov (United States)

Kotler, Belinda M; Kerstetter, Jane E; Insogna, Karl L

2013-01-01

The family of claudin proteins plays an important role in regulating the intestinal barrier by modulating the permeability of tight junctions. The impact of dietary protein on claudin biology has not been studied extensively. Whey proteins have been reported to improve intestinal barrier function, but their mechanism of action is not clear. Recent studies, however, have demonstrated increased intestinal claudin expression in response to milk protein components. Reviewed here are new findings suggesting that whey-protein-derived transforming growth factor β transcriptionally upregulates claudin-4 expression via a Smad-4-dependent pathway. These and other data, including limited clinical studies, are summarized below and, in the aggregate, suggest a therapeutic role for whey protein in diseases of intestinal barrier dysfunction, perhaps, in part, by regulating claudin expression. © 2013 International Life Sciences Institute.

Controlling the spin-torque efficiency with ferroelectric barriers