WorldWideScience

Sample records for varying barrier function

  1. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  2. Performance of Traffic Noise Barriers with Varying Cross-Section

    Directory of Open Access Journals (Sweden)

    Sanja Grubeša

    2011-05-01

    Full Text Available The efficiency of noise barriers largely depends on their geometry. In this paper, the performance of noise barriers was simulated using the numerical Boundary Element Method (BEM. Traffic noise was particularly considered with its standardized noise spectrum adapted to human hearing. The cross-section of the barriers was varied with the goal of finding the optimum shape in comparison to classical rectangular barriers. The barrier performance was calculated at different receiver points for a fixed barrier height and source position. The magnitude of the insertion loss parameter was used to evaluate the performance change, both in one-third octave bands and as the broadband mean insertion loss value. The proposed barriers of varying cross-section were also compared with a typical T-shape barrier of the same height.

  3. Compilation of Instantaneous Source Functions for Varying ...

    African Journals Online (AJOL)

    Compilation of Instantaneous Source Functions for Varying Architecture of a Layered Reservoir with Mixed Boundaries and Horizontal Well Completion Part III: B-Shaped Architecture with Vertical Well in the Upper Layer.

  4. Compilation of Instantaneous Source Functions for Varying ...

    African Journals Online (AJOL)

    Compilation of Instantaneous Source Functions for Varying Architecture of a Layered Reservoir with Mixed Boundaries and Horizontal Well Completion Part IV: Normal and Inverted Letter 'h' and 'H' Architecture.

  5. Skin Barrier Function and Allergens

    DEFF Research Database (Denmark)

    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan

    2016-01-01

    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...

  6. Tracking time-varying coefficient-functions

    DEFF Research Database (Denmark)

    Nielsen, Henrik Aalborg; Nielsen, Torben Skov; Joensen, Alfred K.

    2000-01-01

    is a combination of recursive least squares with exponential forgetting and local polynomial regression. It is argued, that it is appropriate to let the forgetting factor vary with the value of the external signal which is the argument of the coefficient functions. Some of the key properties of the modified method...... are studied by simulation...

  7. Functional barriers: Properties and evaluation

    NARCIS (Netherlands)

    Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.

    2005-01-01

    Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of

  8. Partially linear varying coefficient models stratified by a functional covariate

    KAUST Repository

    Maity, Arnab; Huang, Jianhua Z.

    2012-01-01

    We consider the problem of estimation in semiparametric varying coefficient models where the covariate modifying the varying coefficients is functional and is modeled nonparametrically. We develop a kernel-based estimator of the nonparametric

  9. Uniting Control Lyapunov and Control Barrier Functions

    NARCIS (Netherlands)

    Romdlony, Zakiyullah; Jayawardhana, Bayu

    2014-01-01

    In this paper, we propose a nonlinear control design for solving the problem of stabilization with guaranteed safety. The design is based on the merging of a Control Lyapunov Function and a Control Barrier Function. The proposed control method allows us to combine the design of a stabilizer based on

  10. Perturbation methods and the Melnikov functions for slowly varying oscillators

    International Nuclear Information System (INIS)

    Lakrad, Faouzi; Charafi, Moulay Mustapha

    2005-01-01

    A new approach to obtaining the Melnikov function for homoclinic orbits in slowly varying oscillators is proposed. The present method applies the Lindstedt-Poincare method to determine an approximation of homoclinic solutions. It is shown that the resultant Melnikov condition is the same as that obtained in the usual way involving distance functions in three dimensions by Wiggins and Holmes [Homoclinic orbits in slowly varying oscillators. SIAM J Math Anal 1987;18(3):612

  11. Permanent isolation surface barrier: Functional performance

    International Nuclear Information System (INIS)

    Wing, N.R.

    1993-10-01

    This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release

  12. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  13. Partially linear varying coefficient models stratified by a functional covariate

    KAUST Repository

    Maity, Arnab

    2012-10-01

    We consider the problem of estimation in semiparametric varying coefficient models where the covariate modifying the varying coefficients is functional and is modeled nonparametrically. We develop a kernel-based estimator of the nonparametric component and a profiling estimator of the parametric component of the model and derive their asymptotic properties. Specifically, we show the consistency of the nonparametric functional estimates and derive the asymptotic expansion of the estimates of the parametric component. We illustrate the performance of our methodology using a simulation study and a real data application.

  14. Performance Testing of Suspension Plasma Sprayed Thermal Barrier Coatings Produced with Varied Suspension Parameters

    Directory of Open Access Journals (Sweden)

    Nicholas Curry

    2015-07-01

    Full Text Available Suspension plasma spraying has become an emerging technology for the production of thermal barrier coatings for the gas turbine industry. Presently, though commercial systems for coating production are available, coatings remain in the development stage. Suitable suspension parameters for coating production remain an outstanding question and the influence of suspension properties on the final coatings is not well known. For this study, a number of suspensions were produced with varied solid loadings, powder size distributions and solvents. Suspensions were sprayed onto superalloy substrates coated with high velocity air fuel (HVAF -sprayed bond coats. Plasma spray parameters were selected to generate columnar structures based on previous experiments and were maintained at constant to discover the influence of the suspension behavior on coating microstructures. Testing of the produced thermal barrier coating (TBC systems has included thermal cyclic fatigue testing and thermal conductivity analysis. Pore size distribution has been characterized by mercury infiltration porosimetry. Results show a strong influence of suspension viscosity and surface tension on the microstructure of the produced coatings.

  15. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

  16. A reciprocal Wald theorem for varying gravitational function

    International Nuclear Information System (INIS)

    Fay, Stephane

    2004-01-01

    We study when a cosmological constant is a natural issue if it is mimicked by the potential of a massive Hyperextended Scalar Tensor theory with a perfect fluid for Bianchi type I and V models. We then deduce a reciprocal Wald theorem giving the conditions such that the potential tends to a non vanishing constant when the gravitational function varies. We also get the conditions allowing the potential to vanish or diverge. (orig.)

  17. Model Complexities of Shallow Networks Representing Highly Varying Functions

    Czech Academy of Sciences Publication Activity Database

    Kůrková, Věra; Sanguineti, M.

    2016-01-01

    Roč. 171, 1 January (2016), s. 598-604 ISSN 0925-2312 R&D Projects: GA MŠk(CZ) LD13002 Grant - others:grant for Visiting Professors(IT) GNAMPA-INdAM Institutional support: RVO:67985807 Keywords : shallow networks * model complexity * highly varying functions * Chernoff bound * perceptrons * Gaussian kernel units Subject RIV: IN - Informatics, Computer Science Impact factor: 3.317, year: 2016

  18. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

  19. Monopoly models with time-varying demand function

    Science.gov (United States)

    Cavalli, Fausto; Naimzada, Ahmad

    2018-05-01

    We study a family of monopoly models for markets characterized by time-varying demand functions, in which a boundedly rational agent chooses output levels on the basis of a gradient adjustment mechanism. After presenting the model for a generic framework, we analytically study the case of cyclically alternating demand functions. We show that both the perturbation size and the agent's reactivity to profitability variation signals can have counterintuitive roles on the resulting period-2 cycles and on their stability. In particular, increasing the perturbation size can have both a destabilizing and a stabilizing effect on the resulting dynamics. Moreover, in contrast with the case of time-constant demand functions, the agent's reactivity is not just destabilizing, but can improve stability, too. This means that a less cautious behavior can provide better performance, both with respect to stability and to achieved profits. We show that, even if the decision mechanism is very simple and is not able to always provide the optimal production decisions, achieved profits are very close to those optimal. Finally, we show that in agreement with the existing empirical literature, the price series obtained simulating the proposed model exhibit a significant deviation from normality and large volatility, in particular when underlying deterministic dynamics become unstable and complex.

  20. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  1. A nuclide transfer model for barriers of the seabed repository using response function

    International Nuclear Information System (INIS)

    Lee, Youn Myoung; Kang, Chul Hyung; Hahn, Pil Soo

    1996-01-01

    A nuclide transfer by utilizing mass transfer coefficient and barrier response function defined for each barrier is proposed, by which the final nuclide transfer rate into the sea water can be evaluated. When simple and immediate quantification of the nuclide release is necessary in the conservative aspect, using this kind of approach may be advantageous since each layered barrier can be treated separately from other media in series in the repository system, making it possible to apply separate solutions in succession to other various media. Although one disadvantage is that while flux continuity can be maintained at the interface by using the exit nuclide flux from the first medium as the source flux for the next one, there may be no guarantee for concentration continuity, this problem could be eliminated assuming that there is no boundary resistance to mass transfer across the interface. Mass transfer coefficient can be determined by the assumption that the nuclide concentration gradient at the interface between adjacent barriers remains constant and barrier response function is obtained from an analytical expression for nuclide flow rate out of each barrier in response to a unit impulse into the barrier multiplied by mass transfer coefficient. Total time-dependent nuclide transfer rate from the barrier can then be obtained by convoluting the response function for the barrier with a previously calculated set of time-varying input of nuclide flow rate for the previous barrier. 18 refs., 5 figs. (author)

  2. Crossing safety barriers: influence of children's morphological and functional variables.

    Science.gov (United States)

    Cordovil, Rita; Vieira, Filomena; Barreiros, João

    2012-05-01

    Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  3. Standards for the Protection of Skin Barrier Function.

    Science.gov (United States)

    Giménez-Arnau, Ana

    2016-01-01

    The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.

  4. Predictions of barrier island berm evolution in a time-varying storm climatology

    Science.gov (United States)

    Plant, Nathaniel G.; Flocks, James; Stockdon, Hilary F.; Long, Joseph W.; Guy, Kristy K.; Thompson, David M.; Cormier, Jamie M.; Smith, Christopher G.; Miselis, Jennifer L.; Dalyander, P. Soupy

    2014-01-01

    Low-lying barrier islands are ubiquitous features of the world's coastlines, and the processes responsible for their formation, maintenance, and destruction are related to the evolution of smaller, superimposed features including sand dunes, beach berms, and sandbars. The barrier island and its superimposed features interact with oceanographic forces (e.g., overwash) and exchange sediment with each other and other parts of the barrier island system. These interactions are modulated by changes in storminess. An opportunity to study these interactions resulted from the placement and subsequent evolution of a 2 m high sand berm constructed along the northern Chandeleur Islands, LA. We show that observed berm length evolution is well predicted by a model that was fit to the observations by estimating two parameters describing the rate of berm length change. The model evaluates the probability and duration of berm overwash to predict episodic berm erosion. A constant berm length change rate is also predicted that persists even when there is no overwash. The analysis is extended to a 16 year time series that includes both intraannual and interannual variability of overwash events. This analysis predicts that as many as 10 or as few as 1 day of overwash conditions would be expected each year. And an increase in berm elevation from 2 m to 3.5 m above mean sea level would reduce the expected frequency of overwash events from 4 to just 0.5 event-days per year. This approach can be applied to understanding barrier island and berm evolution at other locations using past and future storm climatologies.

  5. The intestinal barrier function and its involvement in digestive disease

    Directory of Open Access Journals (Sweden)

    Eloísa Salvo-Romero

    2015-11-01

    Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.

  6. Adaptive Importance Sampling with a Rapidly Varying Importance Function

    International Nuclear Information System (INIS)

    Booth, Thomas E.

    2000-01-01

    It is known well that zero-variance Monte Carlo solutions are possible if an exact importance function is available to bias the random walks. Monte Carlo can be used to estimate the importance function. This estimated importance function then can be used to bias a subsequent Monte Carlo calculation that estimates an even better importance function; this iterative process is called adaptive importance sampling.To obtain the importance function, one can expand the importance function in a basis such as the Legendre polynomials and make Monte Carlo estimates of the expansion coefficients. For simple problems, Legendre expansions of order 10 to 15 are able to represent the importance function well enough to reduce the error geometrically by ten orders of magnitude or more. The more complicated problems are addressed in which the importance function cannot be represented well by Legendre expansions of order 10 to 15. In particular, a problem with a cross-section notch and a problem with a discontinuous cross section are considered

  7. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  8. Limiting reiteration for real interpolation with slowly varying functions

    Czech Academy of Sciences Publication Activity Database

    Gogatishvili, Amiran; Opic, Bohumír; Trebels, W.

    2005-01-01

    Roč. 278, 1-2 (2005), s. 86-107 ISSN 0025-584X R&D Projects: GA ČR(CZ) GA201/01/0333 Institutional research plan: CEZ:AV0Z10190503 Keywords : real interpolation * K-functional * limiting reiteration Subject RIV: BA - General Mathematics Impact factor: 0.465, year: 2005

  9. Stabilization with guaranteed safety using Control Lyapunov–Barrier Function

    NARCIS (Netherlands)

    Romdlony, Muhammad Zakiyullah; Jayawardhana, Bayu

    2016-01-01

    We propose a novel nonlinear control method for solving the problem of stabilization with guaranteed safety for nonlinear systems. The design is based on the merging of the well-known Control Lyapunov Function (CLF) and the recent concept of Control Barrier Function (CBF). The proposed control

  10. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  11. Barrier functions for Pucci-Heisenberg operators and applications

    OpenAIRE

    Cutri , Alessandra; Tchou , Nicoletta

    2007-01-01

    International audience; The aim of this article is the explicit construction of some barrier functions ("fundamental solutions") for the Pucci-Heisenberg operators. Using these functions we obtain the continuity property, up to the boundary, for the viscosity solution of fully non-linear Dirichlet problems on the Heisenberg group, if the boundary of the domain satisfies some regularity geometrical assumptions (e.g. an exterior Heisenberg-ball condition at the characteristic points). We point ...

  12. Barrier and system performances within a safety case: their functioning and evolution with time

    International Nuclear Information System (INIS)

    Hedin, A.; Voinis, S.; Fillion, E.; Keller, S.; Lalieux, Ph.; Nachmilner, L.; Nys, V.; Rodriguez, J.; Sevougian, D.; Wollrath, J.

    2002-01-01

    The following six questions were used as the basis for the discussions in a Working Group: - What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? - Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? - What is the requested or required performance versus the expected realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? - What is the issue associated with the geosphere stability for different geological systems? - How are barriers and system performances, as a function of time, evaluated (presented and communicated) in a safety case? - What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)

  13. Safety barriers and safety functions a comparison of different applications

    International Nuclear Information System (INIS)

    Harms-Ringdahl, L.

    1998-01-01

    A study is being made with the focus on different theories and applications concerning 'safety barriers' and 'safety functions'. One aim is to compare the characteristics of different kinds of safely functions, which can be purpose, efficiency, reliability, weak points etc. A further aim is to summarize how the combination of different barriers are described and evaluated. Of special interest are applications from nuclear and chemical process safety. The study is based on a literature review, interviews and discussions. Some preliminary conclusions are made. For example, it appears to exist a need for better tools to support the design and evaluation of procedures. There are a great number of theoretical models describing safety functions. However, it still appears to be an interest in further development of models, which might give the basis for improved practical tools. (author)

  14. Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

    Directory of Open Access Journals (Sweden)

    David eBueno

    2014-10-01

    Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

  15. The Effects of Anthrax Lethal Toxin on Host Barrier Function

    Directory of Open Access Journals (Sweden)

    David M. Frucht

    2011-06-01

    Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.

  16. Crossing the entropy barrier of dynamical zeta functions

    International Nuclear Information System (INIS)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F.

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.)

  17. Crossing the entropy barrier of dynamical zeta functions

    Energy Technology Data Exchange (ETDEWEB)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).

  18. Barriers to Medical Compassion as a Function of Experience and Specialization: Psychiatry, Pediatrics, Internal Medicine, Surgery, and General Practice.

    Science.gov (United States)

    Fernando, Antonio T; Consedine, Nathan S

    2017-06-01

    Compassion is an expectation of patients, regulatory bodies, and physicians themselves. Most research has, however, studied compassion fatigue rather than compassion itself and has concentrated on the role of the physician. The Transactional Model of Physician Compassion suggests that physician, patient, external environment, and clinical factors are all relevant. Because these factors vary both across different specialities and among physicians with differing degrees of experience, barriers to compassion are also likely to vary. We describe barriers to physician compassion as a function of specialization (psychiatry, general practice, surgery, internal medicine, and pediatrics) and physician experience. We used a cross-sectional study using demographic data, specialization, practice parameters, and the Barriers to Physician Compassion Questionnaire. Nonrandom convenience sampling was used to recruit 580 doctors, of whom 444 belonged to the targeted speciality groups. The sample was characterized before conducting a factorial Multivariate Analysis of Covariance and further post hoc analyses. A 5 (speciality grouping) × 2 (more vs. less physician experience) Multivariate Analysis of Covariance showed that the barriers varied as a function of both speciality and experience. In general, psychiatrists reported lower barriers, whereas general practitioners and internal medicine specialists generally reported greater barriers. Barriers were generally greater among less experienced doctors. Documenting and investigating barriers to compassion in different speciality groups have the potential to broaden current foci beyond the physician and inform interventions aimed at enhancing medical compassion. In addition, certain aspects of the training or practice of psychiatry that enhance compassion may mitigate barriers to compassion in other specialities. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  19. Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

    Directory of Open Access Journals (Sweden)

    Pasricha J

    1991-01-01

    Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

  20. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  1. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  2. Lipids and skin barrier function - a clinical perspective

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

    2008-01-01

    The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...

  3. Blood-aqueous Barrier Function in a Patient With Choroideremia

    Directory of Open Access Journals (Sweden)

    Muh-Shy Chen

    2010-02-01

    Full Text Available The purpose was to determine whether there was a breakdown of the blood-aqueous barrier in a patient with choroideremia. A 27-year-old man with typical choroideremia underwent standardized ophthalmo-logical evaluation, including quantitative measurement of aqueous flare intensity, by a laser flare-cell meter. The results showed areas of atrophy of the choriocapillaries and retinal pigment epithelium in the mid-periphery and posterior pole, although not in the macula. Fluorescein angiography showed areas of loss of the choriocapillaries and retinal pigment epithelium. The fovea was spared with a surrounding zone of hy-perfluorescence. Electroretinography showed a subnormal photopic amplitude and extinguished scotopic response. Electrooculography revealed that the light peak/dark trough ratio was reduced. Goldmann perimetry showed constricted peripheral fields. Laser photometry showed an increase in the aqueous flare intensity in both eyes, as compared with normal subjects. We conclude that the function of the blood-aqueous barrier might be affected in patients with choroideremia.

  4. Lyapunov Functions to Caputo Fractional Neural Networks with Time-Varying Delays

    Directory of Open Access Journals (Sweden)

    Ravi Agarwal

    2018-05-01

    Full Text Available One of the main properties of solutions of nonlinear Caputo fractional neural networks is stability and often the direct Lyapunov method is used to study stability properties (usually these Lyapunov functions do not depend on the time variable. In connection with the Lyapunov fractional method we present a brief overview of the most popular fractional order derivatives of Lyapunov functions among Caputo fractional delay differential equations. These derivatives are applied to various types of neural networks with variable coefficients and time-varying delays. We show that quadratic Lyapunov functions and their Caputo fractional derivatives are not applicable in some cases when one studies stability properties. Some sufficient conditions for stability of equilibrium of nonlinear Caputo fractional neural networks with time dependent transmission delays, time varying self-regulating parameters of all units and time varying functions of the connection between two neurons in the network are obtained. The cases of time varying Lipschitz coefficients as well as nonLipschitz activation functions are studied. We illustrate our theory on particular nonlinear Caputo fractional neural networks.

  5. Improving Dispersion and Barrier Properties of Polyketone/Graphene Nanoplatelet Composites via Noncovalent Functionalization Using Aminopyrene.

    Science.gov (United States)

    Cho, Jaehyun; Jeon, Ikseong; Kim, Seong Yun; Lim, Soonho; Jho, Jae Young

    2017-08-23

    A series of polyketone (PK) nanocomposite films with varying content of noncovalently functionalized graphene nanoplatelet with 1-aminopyrene (GNP/APy) is prepared by solution blending with a solvent of hexafluoro-2-propanol. GNP/APy, prepared by a facile method, can effectively induce specific interaction such as hydrogen bonding between the amine functional group of GNP/APy and the carbonyl functional group of the PK matrix. With comparison of GNP and GNP/Py as reference materials, intensive investigation on filler-matrix interaction is achieved. In addition, the dispersion state of the functionalized GNP (f-GNPs; GNP/Py and GNP/APy) in the PK matrix is analyzed by three-dimensional nondestructive X-ray microcomputed tomography, and the increased dispersion state of those fillers results in significant improvement in the water vapor transmission rate (WVTR). The enhancement in WVTR of the PK/GNP/APy nanocomposite film at 1 wt % loading of filler leads to a barrier performance approximately 2 times larger compared to that of PK/GNP nanocomposite film and an approximately 92% reduction in WVTR compared to the case of pristine PK film. We expect that this facile method of graphene functionalization to enhance graphene dispersibility as well as interfacial interaction with the polymer matrix will be widely utilized to expand the potential of graphene materials to barrier film applications.

  6. Functional Food Market Development in Serbia: Motivations and Barriers

    Directory of Open Access Journals (Sweden)

    Žaklina Stojanović

    2013-11-01

    Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.

  7. Applications of Skyrme energy-density functional to fusion reactions spanning the fusion barriers

    International Nuclear Information System (INIS)

    Liu Min; Wang, Ning; Li Zhuxia; Wu Xizhen; Zhao Enguang

    2006-01-01

    The Skyrme energy density functional has been applied to the study of heavy-ion fusion reactions. The barriers for fusion reactions are calculated by the Skyrme energy density functional with proton and neutron density distributions determined by using restricted density variational (RDV) method within the same energy density functional together with semi-classical approach known as the extended semi-classical Thomas-Fermi method. Based on the fusion barrier obtained, we propose a parametrization of the empirical barrier distribution to take into account the multi-dimensional character of real barrier and then apply it to calculate the fusion excitation functions in terms of barrier penetration concept. A large number of measured fusion excitation functions spanning the fusion barriers can be reproduced well. The competition between suppression and enhancement effects on sub-barrier fusion caused by neutron-shell-closure and excess neutron effects is studied

  8. Gender Differences in Barriers to Physical Activity among College Students Reporting Varying Levels of Regular Physical Activity

    Science.gov (United States)

    Munford, Shawn N.

    2011-01-01

    Researchers have studied the primary determinants of physical activity in an effort to enhance health promotion initiatives nationwide. These physical activity determinants have been observed to differ among various segments of the population, suggesting a further examination of physical activity barriers among differing populations. Little…

  9. Estimation of Time-Varying Coherence and Its Application in Understanding Brain Functional Connectivity

    Directory of Open Access Journals (Sweden)

    Cheng Liu

    2010-01-01

    Full Text Available Time-varying coherence is a powerful tool for revealing functional dynamics between different regions in the brain. In this paper, we address ways of estimating evolutionary spectrum and coherence using the general Cohen's class distributions. We show that the intimate connection between the Cohen's class-based spectra and the evolutionary spectra defined on the locally stationary time series can be linked by the kernel functions of the Cohen's class distributions. The time-varying spectra and coherence are further generalized with the Stockwell transform, a multiscale time-frequency representation. The Stockwell measures can be studied in the framework of the Cohen's class distributions with a generalized frequency-dependent kernel function. A magnetoencephalography study using the Stockwell coherence reveals an interesting temporal interaction between contralateral and ipsilateral motor cortices under the multisource interference task.

  10. Optimum Design of Multi-Function Robot Arm Gripper for Varying Shape Green Product

    Directory of Open Access Journals (Sweden)

    Razali Zol Bahri

    2016-01-01

    Full Text Available The project focuses on thorough experimentally studies of the optimum design of Multi-function Robot Arm Gripper for varying shape green product. The purpose of this project is to design a few of robot arm gripper for multi-functionally grip a green product with varying shape. The main character of the gripper is that it can automated adjust its finger to suit with the shape of the product. An optimum design of multi-function robot arm gripper is verified through experimental study. The expected result is a series of analytical results on the proposal of gripper design and material that will be selected for the gripper. The analysis of the gripper design proposal by using ANSYS and CATIA software is described in detail in this paper.

  11. Food Derived Bioactive Peptides and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Olga Martínez-Augustin

    2014-12-01

    Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  12. Sleep Restriction Impairs Blood–Brain Barrier Function

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J.; Wang, Yuping

    2014-01-01

    The blood–brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. PMID:25355222

  13. Sleep restriction impairs blood-brain barrier function.

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong

    2014-10-29

    The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.

  14. Functional Anatomy and Oncologic Barriers of the Larynx.

    Science.gov (United States)

    Mor, Niv; Blitzer, Andrew

    2015-08-01

    Laryngeal barriers to tumor spread are a product of laryngeal development, anatomic barriers, and enzymatic activity. Supraglottic and glottic/subglottic development is distinct and partially explains the metastatic behavior of laryngeal carcinoma. Dense connective tissues and elastic fibers provide anatomic barriers within the larynx. Laryngeal cartilage contains dense cartilage, enzyme inhibitors, and an intact perichondrium making it relatively resistant to tumor invasion; however, focal areas of vulnerability are created by ossified cartilage and natural interruptions in the perichondrium. Local inflammation and the enzymatic interplay between tumor and host are important factors in the spread of laryngeal tumor. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Emotional functioning, barriers, and medication adherence in pediatric transplant recipients.

    Science.gov (United States)

    McCormick King, Megan L; Mee, Laura L; Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Blount, Ronald L

    2014-04-01

    This study assessed relationships among internalizing symptoms, barriers to medication adherence, and medication adherence in adolescents with solid organ transplants. The sample included 72 adolescents who had received solid organ transplants. Multiple mediator models were tested via bootstrapping methods. Bivariate correlations revealed significant relationships between barriers and internalizing symptoms of depression, anxiety, and posttraumatic stress, as well as between internalizing symptoms and medication adherence. Barriers indicative of adaptation to the medication regimen (e.g., forgetting, lack of organization) were related to medication adherence and mediated the relationship between internalizing symptoms and medication adherence. These findings indicate that barriers may serve as a more specific factor in the relationship between more general, pervasive internalizing symptoms and medication adherence. Results may help guide areas for clinical assessment, and the focus of interventions for adolescent transplant recipients who are experiencing internalizing symptoms and/or who are nonadherent to their medication regimen.

  16. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  17. Study of the Wigner function at the device boundaries in one-dimensional single- and double-barrier structures

    International Nuclear Information System (INIS)

    Savio, Andrea; Poncet, Alain

    2011-01-01

    In this work, we compute the Wigner distribution function on one-dimensional devices from wave functions generated by solving the Schroedinger equation. Our goal is to investigate certain issues that we encountered in implementing Wigner transport equation solvers, such as the large discrepancies observed between the boundary conditions and the solution in the neighborhood of the boundaries. By evaluating the Wigner function without solving the Wigner transport equation, we intend to ensure that the actual boundary conditions are consistent with those commonly applied in literature. We study both single- and double-barrier unbiased structures. We use simple potential profiles, so that we can compute the wave functions analytically for better accuracy. We vary a number of structure geometry, material, meshing, and numerical parameters, among which are the contact length, the barrier height, the number of incident wave functions, and the numerical precision used for the computations, and we observe how the Wigner function at the device boundaries is affected. For the double-barrier structures, we look at the density matrix function and we study a model for the device transmission spectrum which helps explain the lobelike artifacts that we observe on the Wigner function.

  18. Methamphetamine Effects on Blood-Brain Barrier Structure and Function

    Directory of Open Access Journals (Sweden)

    Nicole Alia Northrop

    2015-03-01

    Full Text Available Methamphetamine (Meth is a widely abuse psychostimulant. Traditionally, studies have focused on the neurotoxic effects of Meth on monoaminergic neurotransmitter terminals. Recently, both in vitro and in vivo studies have investigated the effects of Meth on the BBB and found that Meth produces a decrease in BBB structural proteins and an increase in BBB permeability to various molecules. Moreover, preclinical studies are validated by clinical studies in which human Meth users have increased concentrations of toxins in the brain. Therefore, this review will focus on the structural and functional disruption of the BBB caused by Meth and the mechanisms that contribute to Meth-induced BBB disruption. The review will reveal that the mechanisms by which Meth damages dopamine and serotonin terminals are similar to the mechanisms by which the blood-brain barrier (BBB is damaged. Furthermore, this review will cover the factors that are known to potentiate the effects of Meth on the BBB, such as stress and HIV, both of which are co-morbid conditions associated with Meth abuse. Overall, the goal of this review is to demonstrate that the scope of damage produced by Meth goes beyond damage to monoaminergic neurotransmitter systems to include BBB disruption as well as provide a rationale for investigating therapeutics to treat Meth-induced BBB disruption. Since a breach of the BBB can have a multitude of consequences, therapies directed towards the treatment of BBB disruption may help to ameliorate the long-term neurodegeneration and cognitive deficits produced by Meth and possibly even Meth addiction.

  19. Tracking the Reorganization of Module Structure in Time-Varying Weighted Brain Functional Connectivity Networks.

    Science.gov (United States)

    Schmidt, Christoph; Piper, Diana; Pester, Britta; Mierau, Andreas; Witte, Herbert

    2018-05-01

    Identification of module structure in brain functional networks is a promising way to obtain novel insights into neural information processing, as modules correspond to delineated brain regions in which interactions are strongly increased. Tracking of network modules in time-varying brain functional networks is not yet commonly considered in neuroscience despite its potential for gaining an understanding of the time evolution of functional interaction patterns and associated changing degrees of functional segregation and integration. We introduce a general computational framework for extracting consensus partitions from defined time windows in sequences of weighted directed edge-complete networks and show how the temporal reorganization of the module structure can be tracked and visualized. Part of the framework is a new approach for computing edge weight thresholds for individual networks based on multiobjective optimization of module structure quality criteria as well as an approach for matching modules across time steps. By testing our framework using synthetic network sequences and applying it to brain functional networks computed from electroencephalographic recordings of healthy subjects that were exposed to a major balance perturbation, we demonstrate the framework's potential for gaining meaningful insights into dynamic brain function in the form of evolving network modules. The precise chronology of the neural processing inferred with our framework and its interpretation helps to improve the currently incomplete understanding of the cortical contribution for the compensation of such balance perturbations.

  20. Barriers to Eating Traditional Foods Vary by Age Group in Ecuador With Biodiversity Loss as a Key Issue.

    Science.gov (United States)

    Penafiel, Daniela; Termote, Celine; Lachat, Carl; Espinel, Ramon; Kolsteren, Patrick; Van Damme, Patrick

    2016-04-01

    To document the perceptions of indigenous peoples for the sustainable management of natural resources against malnutrition. Initially 4 and then 12 interviews were conducted with 4 different age groups. Eight rural villages in Guasaganda, central Ecuador, were studied in 2011-2012. A total of 75 people (22 children, 18 adolescents, 20 adults, and 15 elders). Benefits, severity, susceptibility, barriers, cues to action, and self-efficacy of eating traditional foods. Qualitative content analysis was completed using NVivo software. Initial analysis was inductive, followed by a content analysis directed by the Health Belief Model. Coding was completed independently by 2 researchers and kappa statistics (κ ≥ 0.65) were used to evaluate agreement. Healthy perceptions toward traditional foods existed and differed by age. Local young people ate traditional foods for their health benefits and good taste; adults cultivated traditional foods that had an economic benefit. Traditional knowledge used for consumption and cultivation of traditional foods was present but needs to be disseminated. Nutrition education in schools is needed that supports traditional knowledge in younger groups and prevents dietary changes toward unhealthy eating. Increased production of traditional food is needed to address current economic realities. Copyright © 2016 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  1. Emotion regulation ability varies in relation to intrinsic functional brain architecture.

    Science.gov (United States)

    Uchida, Mai; Biederman, Joseph; Gabrieli, John D E; Micco, Jamie; de Los Angeles, Carlo; Brown, Ariel; Kenworthy, Tara; Kagan, Elana; Whitfield-Gabrieli, Susan

    2015-12-01

    This study investigated the neural basis of individual variation in emotion regulation, specifically the ability to reappraise negative stimuli so as to down-regulate negative affect. Brain functions in young adults were measured with functional Magnetic Resonance Imaging during three conditions: (i) attending to neutral pictures; (ii) attending to negative pictures and (iii) reappraising negative pictures. Resting-state functional connectivity was measured with amygdala and dorsolateral prefrontal cortical (DLPFC) seed regions frequently associated with emotion regulation. Participants reported more negative affect after attending to negative than neutral pictures, and less negative affect following reappraisal. Both attending to negative vs neutral pictures and reappraising vs attending to negative pictures yielded widespread activations that were significantly right-lateralized for attending to negative pictures and left-lateralized for reappraising negative pictures. Across participants, more successful reappraisal correlated with less trait anxiety and more positive daily emotion, greater activation in medial and lateral prefrontal regions, and lesser resting-state functional connectivity between (a) right amygdala and both medial prefrontal and posterior cingulate cortices, and (b) bilateral DLPFC and posterior visual cortices. The ability to regulate emotion, a source of resilience or of risk for distress, appears to vary in relation to differences in intrinsic functional brain architecture. © The Author (2015). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  2. The performance of the backpropagation algorithm with varying slope of the activation function

    International Nuclear Information System (INIS)

    Bai Yanping; Zhang Haixia; Hao Yilong

    2009-01-01

    Some adaptations are proposed to the basic BP algorithm in order to provide an efficient method to non-linear data learning and prediction. In this paper, an adopted BP algorithm with varying slope of activation function and different learning rates is put forward. The results of experiment indicated that this algorithm can get very good performance of training. We also test the prediction performance of our adopted BP algorithm on 16 instances. We compared the test results to the ones of the BP algorithm with gradient descent momentum and an adaptive learning rate. The results indicate this adopted BP algorithm gives best performance (100%) for test example, which conclude this adopted BP algorithm produces a smoothed reconstruction that learns better to new prediction function values than the BP algorithm improved with momentum.

  3. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.

  4. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    International Nuclear Information System (INIS)

    Svenson, Ola

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses

  5. Bayesian switching factor analysis for estimating time-varying functional connectivity in fMRI.

    Science.gov (United States)

    Taghia, Jalil; Ryali, Srikanth; Chen, Tianwen; Supekar, Kaustubh; Cai, Weidong; Menon, Vinod

    2017-07-15

    There is growing interest in understanding the dynamical properties of functional interactions between distributed brain regions. However, robust estimation of temporal dynamics from functional magnetic resonance imaging (fMRI) data remains challenging due to limitations in extant multivariate methods for modeling time-varying functional interactions between multiple brain areas. Here, we develop a Bayesian generative model for fMRI time-series within the framework of hidden Markov models (HMMs). The model is a dynamic variant of the static factor analysis model (Ghahramani and Beal, 2000). We refer to this model as Bayesian switching factor analysis (BSFA) as it integrates factor analysis into a generative HMM in a unified Bayesian framework. In BSFA, brain dynamic functional networks are represented by latent states which are learnt from the data. Crucially, BSFA is a generative model which estimates the temporal evolution of brain states and transition probabilities between states as a function of time. An attractive feature of BSFA is the automatic determination of the number of latent states via Bayesian model selection arising from penalization of excessively complex models. Key features of BSFA are validated using extensive simulations on carefully designed synthetic data. We further validate BSFA using fingerprint analysis of multisession resting-state fMRI data from the Human Connectome Project (HCP). Our results show that modeling temporal dependencies in the generative model of BSFA results in improved fingerprinting of individual participants. Finally, we apply BSFA to elucidate the dynamic functional organization of the salience, central-executive, and default mode networks-three core neurocognitive systems with central role in cognitive and affective information processing (Menon, 2011). Across two HCP sessions, we demonstrate a high level of dynamic interactions between these networks and determine that the salience network has the highest temporal

  6. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...

  7. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

  8. Memory for faces and voices varies as a function of sex and expressed emotion.

    Science.gov (United States)

    S Cortes, Diana; Laukka, Petri; Lindahl, Christina; Fischer, Håkan

    2017-01-01

    We investigated how memory for faces and voices (presented separately and in combination) varies as a function of sex and emotional expression (anger, disgust, fear, happiness, sadness, and neutral). At encoding, participants judged the expressed emotion of items in forced-choice tasks, followed by incidental Remember/Know recognition tasks. Results from 600 participants showed that accuracy (hits minus false alarms) was consistently higher for neutral compared to emotional items, whereas accuracy for specific emotions varied across the presentation modalities (i.e., faces, voices, and face-voice combinations). For the subjective sense of recollection ("remember" hits), neutral items received the highest hit rates only for faces, whereas for voices and face-voice combinations anger and fear expressions instead received the highest recollection rates. We also observed better accuracy for items by female expressers, and own-sex bias where female participants displayed memory advantage for female faces and face-voice combinations. Results further suggest that own-sex bias can be explained by recollection, rather than familiarity, rates. Overall, results show that memory for faces and voices may be influenced by the expressions that they carry, as well as by the sex of both items and participants. Emotion expressions may also enhance the subjective sense of recollection without enhancing memory accuracy.

  9. Memory for faces and voices varies as a function of sex and expressed emotion.

    Directory of Open Access Journals (Sweden)

    Diana S Cortes

    Full Text Available We investigated how memory for faces and voices (presented separately and in combination varies as a function of sex and emotional expression (anger, disgust, fear, happiness, sadness, and neutral. At encoding, participants judged the expressed emotion of items in forced-choice tasks, followed by incidental Remember/Know recognition tasks. Results from 600 participants showed that accuracy (hits minus false alarms was consistently higher for neutral compared to emotional items, whereas accuracy for specific emotions varied across the presentation modalities (i.e., faces, voices, and face-voice combinations. For the subjective sense of recollection ("remember" hits, neutral items received the highest hit rates only for faces, whereas for voices and face-voice combinations anger and fear expressions instead received the highest recollection rates. We also observed better accuracy for items by female expressers, and own-sex bias where female participants displayed memory advantage for female faces and face-voice combinations. Results further suggest that own-sex bias can be explained by recollection, rather than familiarity, rates. Overall, results show that memory for faces and voices may be influenced by the expressions that they carry, as well as by the sex of both items and participants. Emotion expressions may also enhance the subjective sense of recollection without enhancing memory accuracy.

  10. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  11. ROS-activated calcium signaling mechanisms regulating endothelial barrier function.

    Science.gov (United States)

    Di, Anke; Mehta, Dolly; Malik, Asrar B

    2016-09-01

    Increased vascular permeability is a common pathogenic feature in many inflammatory diseases. For example in acute lung injury (ALI) and its most severe form, the acute respiratory distress syndrome (ARDS), lung microvessel endothelia lose their junctional integrity resulting in leakiness of the endothelial barrier and accumulation of protein rich edema. Increased reactive oxygen species (ROS) generated by neutrophils (PMNs) and other inflammatory cells play an important role in increasing endothelial permeability. In essence, multiple inflammatory syndromes are caused by dysfunction and compromise of the barrier properties of the endothelium as a consequence of unregulated acute inflammatory response. This review focuses on the role of ROS signaling in controlling endothelial permeability with particular focus on ALI. We summarize below recent progress in defining signaling events leading to increased endothelial permeability and ALI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Positive Selection or Free to Vary? Assessing the Functional Significance of Sequence Change Using Molecular Dynamics.

    Directory of Open Access Journals (Sweden)

    Jane R Allison

    Full Text Available Evolutionary arms races between pathogens and their hosts may be manifested as selection for rapid evolutionary change of key genes, and are sometimes detectable through sequence-level analyses. In the case of protein-coding genes, such analyses frequently predict that specific codons are under positive selection. However, detecting positive selection can be non-trivial, and false positive predictions are a common concern in such analyses. It is therefore helpful to place such predictions within a structural and functional context. Here, we focus on the p19 protein from tombusviruses. P19 is a homodimer that sequesters siRNAs, thereby preventing the host RNAi machinery from shutting down viral infection. Sequence analysis of the p19 gene is complicated by the fact that it is constrained at the sequence level by overprinting of a viral movement protein gene. Using homology modeling, in silico mutation and molecular dynamics simulations, we assess how non-synonymous changes to two residues involved in forming the dimer interface-one invariant, and one predicted to be under positive selection-impact molecular function. Interestingly, we find that both observed variation and potential variation (where a non-synonymous change to p19 would be synonymous for the overprinted movement protein does not significantly impact protein structure or RNA binding. Consequently, while several methods identify residues at the dimer interface as being under positive selection, MD results suggest they are functionally indistinguishable from a site that is free to vary. Our analyses serve as a caveat to using sequence-level analyses in isolation to detect and assess positive selection, and emphasize the importance of also accounting for how non-synonymous changes impact structure and function.

  13. Tests of potential functional barriers for laminated multilayer food packages. Part I: Low molecular weight permeants.

    Science.gov (United States)

    Simal-Gándara, J; Sarria-Vidal, M; Koorevaar, A; Rijk, R

    2000-08-01

    The advent of the functional barrier concept in food packaging has brought with it a requirement for fast tests of permeation through potential barrier materials. In such tests it would be convenient for both foodstuffs and materials below the functional barrier (sub-barrier materials) to be represented by standard simulants. By means of inverse gas chromatography, liquid paraffin spiked with appropriate permeants was considered as a potential simulant of sub-barrier materials based on polypropylene (PP) or similar polyolefins. Experiments were performed to characterize the kinetics of the permeation of low molecular weight model permeants (octene, toluene and isopropanol) from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick oriented PP) into the food stimulants olive oil and 3% (w/v) acetic acid. These permeation results were interpreted in terms of three permeation kinetic models regarding the solubility of a particular model permeant in the post-barrier medium (i.e. the food simulant). The results obtained justify the development and evaluation of liquid sub-barrier simulants that would allow flexible yet rigorous testing of new laminated multilayer packaging materials.

  14. Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning.

    NARCIS (Netherlands)

    Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W.A.

    2001-01-01

    Compromising alterations in gastrointestinal architecture are common during the weaning transition of pigs. The relation between villous atrophy and epithelial barrier function at weaning is not well understood. This study evaluated in vitro transepithelial transport by Ussing metabolic chambers,

  15. Inhibition of Murine Pulmonary Microvascular Endothelial Cell Apoptosis Promotes Recovery of Barrier Function under Septic Conditions

    Directory of Open Access Journals (Sweden)

    Lefeng Wang

    2017-01-01

    Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.

  16. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  17. Functional neuroanatomy of gesture-speech integration in children varies with individual differences in gesture processing.

    Science.gov (United States)

    Demir-Lira, Özlem Ece; Asaridou, Salomi S; Raja Beharelle, Anjali; Holt, Anna E; Goldin-Meadow, Susan; Small, Steven L

    2018-03-08

    Gesture is an integral part of children's communicative repertoire. However, little is known about the neurobiology of speech and gesture integration in the developing brain. We investigated how 8- to 10-year-old children processed gesture that was essential to understanding a set of narratives. We asked whether the functional neuroanatomy of gesture-speech integration varies as a function of (1) the content of speech, and/or (2) individual differences in how gesture is processed. When gestures provided missing information not present in the speech (i.e., disambiguating gesture; e.g., "pet" + flapping palms = bird), the presence of gesture led to increased activity in inferior frontal gyri, the right middle temporal gyrus, and the left superior temporal gyrus, compared to when gesture provided redundant information (i.e., reinforcing gesture; e.g., "bird" + flapping palms = bird). This pattern of activation was found only in children who were able to successfully integrate gesture and speech behaviorally, as indicated by their performance on post-test story comprehension questions. Children who did not glean meaning from gesture did not show differential activation across the two conditions. Our results suggest that the brain activation pattern for gesture-speech integration in children overlaps with-but is broader than-the pattern in adults performing the same task. Overall, our results provide a possible neurobiological mechanism that could underlie children's increasing ability to integrate gesture and speech over childhood, and account for individual differences in that integration. © 2018 John Wiley & Sons Ltd.

  18. Neurocognitive functioning in parents of schizophrenia patients: Attentional and executive performance vary with genetic loading.

    Science.gov (United States)

    Schulze-Rauschenbach, Svenja; Lennertz, Leonhard; Ruhrmann, Stephan; Petrovsky, Nadine; Ettinger, Ulrich; Pukrop, Ralf; Dreher, Jan; Klosterkötter, Joachim; Maier, Wolfgang; Wagner, Michael

    2015-12-30

    Neuropsychological deficits are candidate endophenotypes of schizophrenia which can assist to explain the neurocognitive impact of genetic risk variants. The identification of endophenotypes is often based on the familiality of these phenotypes. Several studies demonstrate neuropsychological deficits in unaffected biological relatives of schizophrenia patients without differentiating between genetic and non-genetic factors underlying these deficits. We assessed N=129 unaffected biological parents of schizophrenia patients, N=28 schizophrenia patients (paranoid subtype), and N=143 controls without a family history of schizophrenia with an extensive neuropsychological test battery. Direct comparison of N=22 parents with an ancestral history of schizophrenia (more likely carriers, MLC) and N=17 of their spouses without such a history (less likely carriers, LLC) allowed the separation of genetic and non-genetic aspects in cognition. Overall, parents showed significant deficits in neuropsychological tasks from all cognitive domains with medium effect sizes. Direct comparisons of MLC- and LLC-parents showed that attentional and executive tasks were most strongly affected by genetic loading. To conclude, unaffected parents of schizophrenia patients showed modest yet significant impairments in attention, memory, and executive functioning. In particular, attentional and executive impairments varied most strongly with genetic loading for schizophrenia, prioritising these dysfunctions for genotype-endophenotype analyses. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Redox stability of neptunium(V) in the presence of humic substances of varying functionality

    Energy Technology Data Exchange (ETDEWEB)

    Schmeide, K.; Geipel, G.; Bernhard, G. [Forschungszentrum Rossendorf e.V., Institute of Radiochemistry, P.O. Box 510 119, D-01314 Dresden (Germany)

    2005-07-01

    Full text of publication follows: Naturally occurring aquatic humic substances (humic and fulvic acids) are known to effect the speciation and thus, the migration behavior of actinide contaminants in environmental systems due to their complexing and redox properties and their ability to form colloids. Therefore, to understand and predict the mobility of actinides in natural aquifer systems, amongst others, information on their redox stability in the presence of humic substances is necessary. In the present work, the time dependence of the reduction of Np(V) to Np(IV) by humic substances of varying functionality has been studied under anaerobic conditions between pH 3.5 and pH 9. Synthetic humic acids with pronounced redox functionality (type Cat-Gly and Hyd-Glu) [1] were studied in comparison to natural humic substances (Aldrich humic acid, Kranichsee fulvic acid). For Np speciation in solution liquid-liquid extraction, laser-induced photoacoustic spectroscopy (LIPAS), NIR absorption spectroscopy, and ultrafiltration were applied. In comparison to the natural humic substances, the synthetic humic acids lead to a much stronger reduction of Np(V) to Np(IV) [2]. The Np(IV) formed in the course of the experiments is stabilized as Np(IV) humate. The tetravalent oxidation state of Np remained constant for several months. The redox capacities of the synthetic humic acids, which are significantly higher than those of the natural humic substances, can be attributed to their higher phenolic/acidic OH group contents compared to natural humic substances. The dominating role of phenolic/acidic OH groups for the reduction of Np(V) by humic substances could be verified applying a synthetic humic acid with blocked phenolic/acidic OH groups (type Hyd-Glu-PB). Furthermore, the influence of NO{sub 3}{sup -} on the Np(V) reduction by humic substances was studied. The results have shown that by application of the synthetic humic acids with distinct redox functionalities actinides can

  20. Executive Functioning, Barriers to Adherence, and Nonadherence in Adolescent and Young Adult Transplant Recipients.

    Science.gov (United States)

    Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L

    2016-08-01

    OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence.  METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures.  RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence.  CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. The Drosophila blood-brain barrier: Development and function of a glial endothelium

    Directory of Open Access Journals (Sweden)

    Stefanie eLimmer

    2014-11-01

    Full Text Available The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

  3. The Drosophila blood-brain barrier: development and function of a glial endothelium.

    Science.gov (United States)

    Limmer, Stefanie; Weiler, Astrid; Volkenhoff, Anne; Babatz, Felix; Klämbt, Christian

    2014-01-01

    The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial (SPG) cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

  4. Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Science.gov (United States)

    Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

    2015-01-01

    Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018

  5. Arctigenin from Fructus Arctii (Seed of Burdock Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Directory of Open Access Journals (Sweden)

    Hee Soon Shin

    2015-01-01

    Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

  6. The important role of stratum corneum lipids for the cutaneous barrier function.

    Science.gov (United States)

    van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

    2014-03-01

    The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

    Science.gov (United States)

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

  8. A search for parameters of universal sub-barrier fusion excitation function

    Energy Technology Data Exchange (ETDEWEB)

    Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)

    2016-11-15

    Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)

  9. Damage and recovery of skin barrier function after glycolic acid chemical peeling and crystal microdermabrasion.

    Science.gov (United States)

    Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok

    2004-03-01

    Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.

  10. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  11. Solute-solvent cavity and bridge functions. I. Varying size of the solute

    International Nuclear Information System (INIS)

    Vyalov, I.; Chuev, G.; Georgi, N.

    2014-01-01

    In this work we present the results of the extensive molecular simulations of solute-solvent cavity and bridge functions. The mixtures of Lennard-Jones solvent with Lennard-Jones solute at infinite dilution are considered for different solute-solvent size ratios—up to 4:1. The Percus-Yevick and hypernetted chain closures deviate substantially from simulation results in the investigated temperature and density ranges. We also find that the behavior of the indirect and cavity correlation functions is non-monotonous within the hard-core region, but the latter can be successfully approximated by mean-field theory if the solute-solvent interaction energy is divided into repulsive and attractive contribution, according to Weeks-Chandler-Andersen theory. Furthermore, in spite of the non-monotonous behavior of logarithm of the cavity function and the indirect correlation function, their difference, i.e., the bridge function remains constant within the hard-core region. Such behavior of the bridge and indirect correlation functions at small distances and for small values of indirect correlation function is well known from the Duh-Haymet plots, where the non-unique relationship results in loops of the bridge function vs. indirect correlation function graphs. We show that the same pathological behavior appears also when distance is small and indirect correlation function is large. We further show that the unique functional behavior of the bridge function can be established when bridge is represented as a function of the renormalized, repulsive indirect correlation function

  12. Functions of an engineered barrier system for a nuclear waste repository in basalt

    International Nuclear Information System (INIS)

    Coons, W.E.; Moore, E.L.; Smith, M.J.; Kaser, J.D.

    1980-01-01

    Defined in this document are the functions of components selected for an engineered barrier system for a nuclear waste repository in basalt. The definitions provide a focal point for barrier material research and development by delineating the purpose and operative lifetime of each component of the engineered system. A five-component system (comprised of waste form, canister, buffer, overpack, and tailored backfill) is discussed in terms of effective operation throughout the course of repository history, recognizing that the emplacement environment changes with time. While components of the system are mutually supporting, redundancy is provided by subsystems of physical and chemical barriers which act in concert with the geology to provide a formidable barrier to transport of hazardous materials to the biosphere. The operating philosophy of the conceptual engineered barrier system is clarified by examples pertinent to storage in basalt, and a technical approach to barrier design and material selection is proposed. A method for system validation and qualification is also included which considers performance criteria proposed by external agencies in conjunction with site-specific models and risk assessment to define acceptable levels of system performance

  13. Lactobacillus frumenti Facilitates Intestinal Epithelial Barrier Function Maintenance in Early-Weaned Piglets

    Science.gov (United States)

    Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua

    2018-01-01

    Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance

  14. Effects of industrial detergents on the barrier function of human skin

    DEFF Research Database (Denmark)

    Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner

    2000-01-01

    Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...

  15. The blood-brain barrier and oncology : new insights into function and modulation

    NARCIS (Netherlands)

    Bart, J; Groen, HJM; Hendrikse, NH; van der Graaf, WTA; Vaalburg, W; de Vries, EGE

    2000-01-01

    The efficacy of chemotherapy for malignant primary or metastatic brain tumours is still poor. This is at least partly due to the presence of the blood-brain barrier (BBB). The functionality of the BBB can be explained by physicochemical features and efflux pump mechanisms. An overview of the

  16. Effect of saline iontophoresis on skin barrier function and cutaneous irritation in four ethnic groups.

    Science.gov (United States)

    Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I

    2000-08-01

    The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.

  17. Modelling of migration from multi-layers and functional barriers: Estimation of parameters

    NARCIS (Netherlands)

    Dole, P.; Voulzatis, Y.; Vitrac, O.; Reynier, A.; Hankemeier, T.; Aucejo, S.; Feigenbaum, A.

    2006-01-01

    Functional barriers form parts of multi-layer packaging materials, which are deemed to protect the food from migration of a broad range of contaminants, e.g. those associated with reused packaging. Often, neither the presence nor the identity of the contaminants is known, so that safety assessment

  18. Bivariate functional data clustering: grouping streams based on a varying coefficient model of the stream water and air temperature relationship

    Science.gov (United States)

    H. Li; X. Deng; Andy Dolloff; E. P. Smith

    2015-01-01

    A novel clustering method for bivariate functional data is proposed to group streams based on their water–air temperature relationship. A distance measure is developed for bivariate curves by using a time-varying coefficient model and a weighting scheme. This distance is also adjusted by spatial correlation of streams via the variogram. Therefore, the proposed...

  19. Augmented brain function by coordinated reset stimulation with slowly varying sequences

    Directory of Open Access Journals (Sweden)

    Magteld eZeitler

    2015-03-01

    Full Text Available Several brain disorders are characterized by abnormally strong neuronal synchrony. Coordinated Reset (CR stimulation was developed to selectively counteract abnormal neuronal synchrony by desynchronization. For this, phase resetting stimuli are delivered to different subpopulations in a timely coordinated way. In neural networks with spike timing-dependent plasticity CR stimulation may eventually lead to an anti-kindling, i.e. an unlearning of abnormal synaptic connectivity and abnormal synchrony. The spatiotemporal sequence by which all stimulation sites are stimulated exactly once is called the stimulation site sequence, or briefly sequence. So far, in simulations, pre-clinical and clinical applications CR was applied either with fixed sequences or rapidly varying sequences (RVS. In this computational study we show that appropriate repetition of the sequence with occasional random switching to the next sequence may significantly improve the anti-kindling effect of CR. To this end, a sequence is applied many times before randomly switching to the next sequence. This new method is called SVS CR stimulation, i.e. CR with slowly varying sequences. In a neuronal network with strong short-range excitatory and weak long-range inhibitory dynamic couplings SVS CR stimulation turns out to be superior to CR stimulation with fixed sequences or RVS.

  20. Augmented brain function by coordinated reset stimulation with slowly varying sequences.

    Science.gov (United States)

    Zeitler, Magteld; Tass, Peter A

    2015-01-01

    Several brain disorders are characterized by abnormally strong neuronal synchrony. Coordinated Reset (CR) stimulation was developed to selectively counteract abnormal neuronal synchrony by desynchronization. For this, phase resetting stimuli are delivered to different subpopulations in a timely coordinated way. In neural networks with spike timing-dependent plasticity CR stimulation may eventually lead to an anti-kindling, i.e., an unlearning of abnormal synaptic connectivity and abnormal synchrony. The spatiotemporal sequence by which all stimulation sites are stimulated exactly once is called the stimulation site sequence, or briefly sequence. So far, in simulations, pre-clinical and clinical applications CR was applied either with fixed sequences or rapidly varying sequences (RVS). In this computational study we show that appropriate repetition of the sequence with occasional random switching to the next sequence may significantly improve the anti-kindling effect of CR. To this end, a sequence is applied many times before randomly switching to the next sequence. This new method is called SVS CR stimulation, i.e., CR with slowly varying sequences. In a neuronal network with strong short-range excitatory and weak long-range inhibitory dynamic couplings SVS CR stimulation turns out to be superior to CR stimulation with fixed sequences or RVS.

  1. Relaxation of the vibrational distribution function in N2 time varying discharges

    International Nuclear Information System (INIS)

    Capitelli, M.; Gorse, C.; Ricard, A.

    1981-01-01

    Relaxation of the electron and vibrational distribution functions have been calculated in function of residence time in nitrogen electrical discharges and post-discharges. In the discharge the vibrational temperature get bigger with the residence time for t -2 s. In the post-discharge the vibrational distribution is evolving in such a manner that the high levels are overpopulated as the low vibrational level population is dropping

  2. Modified Displacement Transfer Functions for Deformed Shape Predictions of Slender Curved Structures with Varying Curvatives

    Science.gov (United States)

    Ko, William L.; Fleischer, Van Tran

    2014-01-01

    To eliminate the need to use finite-element modeling for structure shape predictions, a new method was invented. This method is to use the Displacement Transfer Functions to transform the measured surface strains into deflections for mapping out overall structural deformed shapes. The Displacement Transfer Functions are expressed in terms of rectilinearly distributed surface strains, and contain no material properties. This report is to apply the patented method to the shape predictions of non-symmetrically loaded slender curved structures with different curvatures up to a full circle. Because the measured surface strains are not available, finite-element analysis had to be used to analytically generate the surface strains. Previously formulated straight-beam Displacement Transfer Functions were modified by introducing the curvature-effect correction terms. Through single-point or dual-point collocations with finite-elementgenerated deflection curves, functional forms of the curvature-effect correction terms were empirically established. The resulting modified Displacement Transfer Functions can then provide quite accurate shape predictions. Also, the uniform straight-beam Displacement Transfer Function was applied to the shape predictions of a section-cut of a generic capsule (GC) outer curved sandwich wall. The resulting GC shape predictions are quite accurate in partial regions where the radius of curvature does not change sharply.

  3. Mendelian randomization analysis of a time-varying exposure for binary disease outcomes using functional data analysis methods.

    Science.gov (United States)

    Cao, Ying; Rajan, Suja S; Wei, Peng

    2016-12-01

    A Mendelian randomization (MR) analysis is performed to analyze the causal effect of an exposure variable on a disease outcome in observational studies, by using genetic variants that affect the disease outcome only through the exposure variable. This method has recently gained popularity among epidemiologists given the success of genetic association studies. Many exposure variables of interest in epidemiological studies are time varying, for example, body mass index (BMI). Although longitudinal data have been collected in many cohort studies, current MR studies only use one measurement of a time-varying exposure variable, which cannot adequately capture the long-term time-varying information. We propose using the functional principal component analysis method to recover the underlying individual trajectory of the time-varying exposure from the sparsely and irregularly observed longitudinal data, and then conduct MR analysis using the recovered curves. We further propose two MR analysis methods. The first assumes a cumulative effect of the time-varying exposure variable on the disease risk, while the second assumes a time-varying genetic effect and employs functional regression models. We focus on statistical testing for a causal effect. Our simulation studies mimicking the real data show that the proposed functional data analysis based methods incorporating longitudinal data have substantial power gains compared to standard MR analysis using only one measurement. We used the Framingham Heart Study data to demonstrate the promising performance of the new methods as well as inconsistent results produced by the standard MR analysis that relies on a single measurement of the exposure at some arbitrary time point. © 2016 WILEY PERIODICALS, INC.

  4. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function

    DEFF Research Database (Denmark)

    Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis

    2013-01-01

    antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...

  5. An MLS coherence function and its performance in measurements on time-varying systems

    DEFF Research Database (Denmark)

    Liu, Jiyuan; Jacobsen, Finn

    1999-01-01

    A new MLS coherence function has been developed and tested in various room acoustic measurements. The new measure, which takes values between zero and unity just as the ordinary coherence, can be used only if averaging over several periods of the MLS signal is carried out. It indicates possible...... contamination by extraneous noise in the same manner as the the ordinary coherence function does in measurements with FFT analysers. It is also very sensitive to disturbances such as reflections caused by moving surfaces during the measurement. Very weak time-variance effects caused by a small change...

  6. Glucose Transporters at the Blood-Brain Barrier: Function, Regulation and Gateways for Drug Delivery.

    Science.gov (United States)

    Patching, Simon G

    2017-03-01

    Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.

  7. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  8. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Science.gov (United States)

    Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei

    2016-01-01

    Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P zonulin release (P zonulin (P zonulin protein release and improvement of intestinal TJ integrity.

  9. Memory-related functional connectivity in visual processing regions varies by prior emotional context.

    Science.gov (United States)

    Bowen, Holly J; Kensinger, Elizabeth A

    2017-09-06

    Memory retrieval involves the reactivation of processes that were engaged at encoding. Using a Generalized Linear Model to test for effects of valence, our prior study suggests that memory for information previously encoded in a negative context reengages sensory processing regions at retrieval to a greater extent than positive. Here, we used partial least squares analyses of the same dataset to determine whether this valence-specific processing was one of the dominant patterns in the retrieval data. Trials previously paired with a face revealed a strong pattern of emotion that did not vary by valence, but for trials previously paired with a scene, an extensive network of regions was active during recollection of trials paired with negative content. These same regions were negatively correlated with recollection of trials paired with positive content. These results confirm that, despite no emotional content present during the time of retrieval, strong patterns of emotional study context are present in the data. Moreover, at least for trials paired with scenes at encoding, valence-specific networks are linked to episodic memory recollection, providing further support for recapitulation of sensory processing during recollection of negative emotional information.

  10. The RNAi Universe in Fungi: A Varied Landscape of Small RNAs and Biological Functions.

    Science.gov (United States)

    Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M

    2017-09-08

    RNA interference (RNAi) is a conserved eukaryotic mechanism that uses small RNA molecules to suppress gene expression through sequence-specific messenger RNA degradation, translational repression, or transcriptional inhibition. In filamentous fungi, the protective function of RNAi in the maintenance of genome integrity is well known. However, knowledge of the regulatory role of RNAi in fungi has had to wait until the recent identification of different endogenous small RNA classes, which are generated by distinct RNAi pathways. In addition, RNAi research on new fungal models has uncovered the role of small RNAs and RNAi pathways in the regulation of diverse biological functions. In this review, we give an up-to-date overview of the different classes of small RNAs and RNAi pathways in fungi and their roles in the defense of genome integrity and regulation of fungal physiology and development, as well as in the interaction of fungi with biotic and abiotic environments.

  11. The varied functions of aluminium-activated malate transporters–much more than aluminium resistance

    Science.gov (United States)

    Palmer, Antony J.; Baker, Alison; Muench, Stephen P.

    2016-01-01

    The ALMT (aluminium-activated malate transporter) family comprises a functionally diverse but structurally similar group of ion channels. They are found ubiquitously in plant species, expressed throughout different tissues, and located in either the plasma membrane or tonoplast. The first family member identified was TaALMT1, discovered in wheat root tips, which was found to be involved in aluminium resistance by means of malate exudation into the soil. However, since this discovery other family members have been shown to have many other functions such as roles in stomatal opening, general anionic homoeostasis, and in economically valuable traits such as fruit flavour. Recent evidence has also shown that ALMT proteins can act as key molecular actors in GABA (γ-aminobutyric acid) signalling, the first evidence that GABA can act as a signal transducer in plants. PMID:27284052

  12. The varied functions of aluminium-activated malate transporters-much more than aluminium resistance.

    Science.gov (United States)

    Palmer, Antony J; Baker, Alison; Muench, Stephen P

    2016-06-15

    The ALMT (aluminium-activated malate transporter) family comprises a functionally diverse but structurally similar group of ion channels. They are found ubiquitously in plant species, expressed throughout different tissues, and located in either the plasma membrane or tonoplast. The first family member identified was TaALMT1, discovered in wheat root tips, which was found to be involved in aluminium resistance by means of malate exudation into the soil. However, since this discovery other family members have been shown to have many other functions such as roles in stomatal opening, general anionic homoeostasis, and in economically valuable traits such as fruit flavour. Recent evidence has also shown that ALMT proteins can act as key molecular actors in GABA (γ-aminobutyric acid) signalling, the first evidence that GABA can act as a signal transducer in plants. © 2016 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  13. The role of executive function in children's source monitoring with varying retrieval strategies

    Science.gov (United States)

    Earhart, Becky; Roberts, Kim P.

    2014-01-01

    Previous research on the relationship between executive function and source monitoring in young children has been inconclusive, with studies finding conflicting results about whether working memory and inhibitory control are related to source-monitoring ability. In this study, the role of working memory and inhibitory control in recognition memory and source monitoring with two different retrieval strategies were examined. Children (N = 263) aged 4–8 participated in science activities with two sources. They were later given a recognition and source-monitoring test, and completed measures of working memory and inhibitory control. During the source-monitoring test, half of the participants were asked about sources serially (one after the other) whereas the other half of the children were asked about sources in parallel (considering both sources simultaneously). Results demonstrated that working memory was a predictor of source-monitoring accuracy in both conditions, but inhibitory control was only related to source accuracy in the parallel condition. When age was controlled these relationships were no longer significant, suggesting that a more general cognitive development factor is a stronger predictor of source monitoring than executive function alone. Interestingly, the children aged 4–6 years made more accurate source decisions in the parallel condition than in the serial condition. The older children (aged 7–8) were overall more accurate than the younger children, and their accuracy did not differ as a function of interview condition. Suggestions are provided to guide further research in this area that will clarify the diverse results of previous studies examining whether executive function is a cognitive prerequisite for effective source monitoring. PMID:24847302

  14. Hybrid online sensor error detection and functional redundancy for systems with time-varying parameters.

    Science.gov (United States)

    Feng, Jianyuan; Turksoy, Kamuran; Samadi, Sediqeh; Hajizadeh, Iman; Littlejohn, Elizabeth; Cinar, Ali

    2017-12-01

    Supervision and control systems rely on signals from sensors to receive information to monitor the operation of a system and adjust manipulated variables to achieve the control objective. However, sensor performance is often limited by their working conditions and sensors may also be subjected to interference by other devices. Many different types of sensor errors such as outliers, missing values, drifts and corruption with noise may occur during process operation. A hybrid online sensor error detection and functional redundancy system is developed to detect errors in online signals, and replace erroneous or missing values detected with model-based estimates. The proposed hybrid system relies on two techniques, an outlier-robust Kalman filter (ORKF) and a locally-weighted partial least squares (LW-PLS) regression model, which leverage the advantages of automatic measurement error elimination with ORKF and data-driven prediction with LW-PLS. The system includes a nominal angle analysis (NAA) method to distinguish between signal faults and large changes in sensor values caused by real dynamic changes in process operation. The performance of the system is illustrated with clinical data continuous glucose monitoring (CGM) sensors from people with type 1 diabetes. More than 50,000 CGM sensor errors were added to original CGM signals from 25 clinical experiments, then the performance of error detection and functional redundancy algorithms were analyzed. The results indicate that the proposed system can successfully detect most of the erroneous signals and substitute them with reasonable estimated values computed by functional redundancy system.

  15. Proton nuclear magnetic resonance study on the barrier function of pig corneal epithelium and endothelium

    International Nuclear Information System (INIS)

    Yokoi, Norihiko; Kinoshita, Shigeru; Morimoto, Taketoshi; Yoshizaki, Kazuo.

    1995-01-01

    Using gadolinium diethylenetriaminepentaacetic acid (Gd-DTPA) as a tracer, the barrier function of the corneal epithelium and endothelium was evaluated by proton nuclear magnetic resonance. Whole pig eyes and cornea excised with scleral rim, which had been incubated in dextran-added Gd-DTPA solution, were subjected to T 1 relaxation measurement and magnetic resonance imaging (MRI). After incubation, the T 1 relaxation rate (1/T 1 ) of the excised cornea increased to a steady value, whereas that of the cornea from the whole eye increased only slightly. These results indicated that the increase in the T 1 relaxation rate of the excised cornea was attributable to Gd-DTPA penetration from the corneal endothelium and that the corneal epithelium exhibited a strong barrier function against Gd-DTPA entry. The MRI study also confirmed the strong barrier, enhanced signals being detected within the aqueous fluid in the T 1 -weighted image only when the corneal epithelium was abraded. Since Gd-DTPA scarcely penetrates the intact corneal epithelium, Gd-DTPA-enhanced MRI shows potential as a quantitative tracer in evaluating epithelial barrier disruption. (author)

  16. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Functional electrical stimulation of intrinsic laryngeal muscles under varying loads in exercising horses.

    Directory of Open Access Journals (Sweden)

    Jon Cheetham

    Full Text Available Bilateral vocal fold paralysis (BVCP is a life threatening condition and appears to be a good candidate for therapy using functional electrical stimulation (FES. Developing a working FES system has been technically difficult due to the inaccessible location and small size of the sole arytenoid abductor, the posterior cricoarytenoid (PCA muscle. A naturally-occurring disease in horses shares many functional and etiological features with BVCP. In this study, the feasibility of FES for equine vocal fold paralysis was explored by testing arytenoid abduction evoked by electrical stimulation of the PCA muscle. Rheobase and chronaxie were determined for innervated PCA muscle. We then tested the hypothesis that direct muscle stimulation can maintain airway patency during strenuous exercise in horses with induced transient conduction block of the laryngeal motor nerve. Six adult horses were instrumented with a single bipolar intra-muscular electrode in the left PCA muscle. Rheobase and chronaxie were within the normal range for innervated muscle at 0.55±0.38 v and 0.38±0.19 ms respectively. Intramuscular stimulation of the PCA muscle significantly improved arytenoid abduction at all levels of exercise intensity and there was no significant difference between the level of abduction achieved with stimulation and control values under moderate loads. The equine larynx may provide a useful model for the study of bilateral fold paralysis.

  18. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2016-05-01

    Full Text Available Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ loci occludin and zona occludens (ZO-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.

  19. Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.

    Science.gov (United States)

    Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard

    2016-01-01

    Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.

  20. Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer.

    Science.gov (United States)

    Fasano, Alessio

    2011-01-01

    The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.

  1. Influence of parental care on offspring hippocampal volume in young adults varies as a function of overprotection

    OpenAIRE

    Wang, Yinan; Song, Yiying; Li, Xueting; Zhang, Lin; Liu, Jia

    2017-01-01

    Parental care results in increased hippocampal volumes through adaptive stress responses in developing animals. However, human studies have not yet provided consistent findings analogous to the animal literature, possibly because parental care in humans is likely intermingled with parental overprotection, as suggested by the optimal parenting theory. Here, we tested the hypothesis that the effect of parental care on offspring hippocampal volume varies as a function of parental overprotection ...

  2. Zonulin, a regulator of epithelial and endothelial barrier functions, and its involvement in chronic inflammatory diseases.

    Science.gov (United States)

    Sturgeon, Craig; Fasano, Alessio

    2016-01-01

    Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.

  3. Concerted regulation of retinal pigment epithelium basement membrane and barrier function by angiocrine factors.

    Science.gov (United States)

    Benedicto, Ignacio; Lehmann, Guillermo L; Ginsberg, Michael; Nolan, Daniel J; Bareja, Rohan; Elemento, Olivier; Salfati, Zelda; Alam, Nazia M; Prusky, Glen T; Llanos, Pierre; Rabbany, Sina Y; Maminishkis, Arvydas; Miller, Sheldon S; Rafii, Shahin; Rodriguez-Boulan, Enrique

    2017-05-19

    The outer blood-retina barrier is established through the coordinated terminal maturation of the retinal pigment epithelium (RPE), fenestrated choroid endothelial cells (ECs) and Bruch's membrane, a highly organized basement membrane that lies between both cell types. Here we study the contribution of choroid ECs to this process by comparing their gene expression profile before (P5) and after (P30) the critical postnatal period when mice acquire mature visual function. Transcriptome analyses show that expression of extracellular matrix-related genes changes dramatically over this period. Co-culture experiments support the existence of a novel regulatory pathway: ECs secrete factors that remodel RPE basement membrane, and integrin receptors sense these changes triggering Rho GTPase signals that modulate RPE tight junctions and enhance RPE barrier function. We anticipate our results will spawn a search for additional roles of choroid ECs in RPE physiology and disease.

  4. Internal resistor of multi-functional tunnel barrier for selectivity and switching uniformity in resistive random access memory.

    Science.gov (United States)

    Lee, Sangheon; Woo, Jiyong; Lee, Daeseok; Cha, Euijun; Hwang, Hyunsang

    2014-01-01

    In this research, we analyzed the multi-functional role of a tunnel barrier that can be integrated in devices. This tunnel barrier, acting as an internal resistor, changes its resistance with applied bias. Therefore, the current flow in the devices can be controlled by a tunneling mechanism that modifies the tunnel barrier thickness for non-linearity and switching uniformity of devices. When a device is in a low-resistance state, the tunnel barrier controls the current behavior of the device because most of the bias is applied to the tunnel barrier owing to its higher resistance. Furthermore, the tunnel barrier induces uniform filament formation during set operation with the tunnel barrier controlling the current flow.

  5. Gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice

    Science.gov (United States)

    Fang, Yu; Chen, Hao; Hu, Yuhui; Djukic, Zorka; Tevebaugh, Whitney; Shaheen, Nicholas J.; Orlando, Roy C.; Hu, Jianguo

    2013-01-01

    The barrier function of the esophageal epithelium is a major defense against gastroesophageal reflux disease. Previous studies have shown that reflux damage is reflected in a decrease in transepithelial electrical resistance associated with tight junction alterations in the esophageal epithelium. To develop novel therapies, it is critical to understand the molecular mechanisms whereby contact with a refluxate impairs esophageal barrier function. In this study, surgical models of duodenal and mixed reflux were developed in mice. Mouse esophageal epithelium was analyzed by gene microarray. Gene set enrichment analysis showed upregulation of inflammation-related gene sets and the NF-κB pathway due to reflux. Significance analysis of microarrays revealed upregulation of NF-κB target genes. Overexpression of NF-κB subunits (p50 and p65) and NF-κB target genes (matrix metalloproteinases-3 and -9, IL-1β, IL-6, and IL-8) confirmed activation of the NF-κB pathway in the esophageal epithelium. In addition, real-time PCR, Western blotting, and immunohistochemical staining also showed downregulation and mislocalization of claudins-1 and -4. In a second animal experiment, treatment with an NF-κB inhibitor, BAY 11-7085 (20 mg·kg−1·day−1 ip for 10 days), counteracted the effects of duodenal and mixed reflux on epithelial resistance and NF-κB-regulated cytokines. We conclude that gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice and that targeting the NF-κB pathway may strengthen esophageal barrier function against reflux. PMID:23639809

  6. Endothelium-Derived 5-Methoxytryptophan Protects Endothelial Barrier Function by Blocking p38 MAPK Activation.

    Directory of Open Access Journals (Sweden)

    Ling-Yun Chu

    Full Text Available The endothelial junction is tightly controlled to restrict the passage of blood cells and solutes. Disruption of endothelial barrier function by bacterial endotoxins, cytokines or growth factors results in inflammation and vascular damage leading to vascular diseases. We have identified 5-methoxytryptophan (5-MTP as an anti-inflammatory factor by metabolomic analysis of conditioned medium of human fibroblasts. Here we postulated that endothelial cells release 5-MTP to protect the barrier function. Conditioned medium of human umbilical vein endothelial cells (HUVECs prevented endothelial hyperpermeability and VE-cadherin downregulation induced by VEGF, LPS and cytokines. We analyzed the metabolomic profile of HUVEC conditioned medium and detected 5-MTP but not melatonin, serotonin or their catabolites, which was confirmed by enzyme-linked immunosorbent assay. Addition of synthetic pure 5-MTP preserved VE-cadherin and maintained barrier function despite challenge with pro-inflammatory mediators. Tryptophan hydroxylase-1, an enzyme required for 5-MTP biosynthesis, was downregulated in HUVECs by pro-inflammatory mediators and it was accompanied by reduction of 5-MTP. 5-MTP protected VE-cadherin and prevented endothelial hyperpermeability by blocking p38 MAPK activation. A chemical inhibitor of p38 MAPK, SB202190, exhibited a similar protective effect as 5-MTP. To determine whether 5-MTP prevents vascular hyperpermeability in vivo, we evaluated the effect of 5-MTP administration on LPS-induced murine microvascular permeability with Evans blue. 5-MTP significantly prevented Evans blue dye leakage. Our findings indicate that 5-MTP is a new class of endothelium-derived molecules which protects endothelial barrier function by blocking p38 MAPK.

  7. Prolonged phonation impairs the integrity and barrier function of porcine vocal fold epithelium: a preliminary study.

    Science.gov (United States)

    Zhang, Chi; Paddock, Kieran; Chou, Adriana; Scholp, Austin; Gong, Ting; Jiang, Jack J

    2018-04-18

    Voice abuse is known to be a common risk factor of voice disorders and prolonged; high-intensity phonation has been shown to damage the vocal fold epithelium. We aim to evaluate the effects of phonation on the integrity and barrier function of vocal fold epithelium using a porcine laryngeal model. Ex vivo porcine larynges were phonated at low intensity or high intensity for 15, 30, or 60 min within 4 h after harvest. Vocal fold epithelium was visualized using transmission electron microscopy (TEM). The barrier function of vocal fold epithelium was evaluated by measuring the permeability to model molecules, fluorescein (376 Da), and fluorescein isothiocyanate (FITC)-dextrans of 4000 and 10,000 Da (FD4, FD10), in a Franz diffusing cell. Cell death and dilated intercellular space after phonation were observed using TEM. Thickness of vocal fold epithelium was significantly reduced after low-intensity phonation for 30 and 60 min and high-intensity phonation for 15, 30, and 60 min. Epithelial permeability to fluorescein was significantly increased after low-intensity phonation for 30 and 60 min, and high-intensity phonation. Permeability to FD4 was significantly increased after high-intensity phonation for 30 and 60 min. Phonation did not alter the permeability to FD10 significantly. Long-duration phonation destroys the integrity and barrier function of vocal fold epithelium. These effects likely make vocal folds more vulnerable to other environmental irritants, such as tobacco smoke, reflux components, allergens, and inhaled pollutants. Destroyed barrier function may be an important factor in the pathogenesis of voice lesions related to voice abuse.

  8. Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

    OpenAIRE

    Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.

    2008-01-01

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...

  9. Prefrontal Structure Varies as a Function of Pain Symptoms in Chronic Fatigue Syndrome.

    Science.gov (United States)

    van der Schaaf, Marieke E; De Lange, Floris P; Schmits, Iris C; Geurts, Dirk E M; Roelofs, Karin; van der Meer, Jos W M; Toni, Ivan; Knoop, Hans

    2017-02-15

    Chronic fatigue syndrome (CFS) is characterized by severe fatigue persisting for ≥6 months and leading to considerable impairment in daily functioning. Neuroimaging studies of patients with CFS have revealed alterations in prefrontal brain morphology. However, it remains to be determined whether these alterations are specific for fatigue or whether they relate to other common CFS symptoms (e.g., chronic pain, lower psychomotor speed, and reduced physical activity). We used magnetic resonance imaging to quantify gray matter volume (GMV) and the N-acetylaspartate and N-acetylaspartylglutamate/creatine ratio (NAA/Cr) in a group of 89 women with CFS. Building on previous reports, we tested whether GMV and NAA/Cr in the dorsolateral prefrontal cortex are associated with fatigue severity, pain, psychomotor speed, and physical activity, while controlling for depressive symptoms. We also considered GMV and NAA/Cr differences between patients with CFS and 26 sex-, age-, and education-matched healthy controls. The presence of pain symptoms was the main predictor of both GMV and NAA/Cr in the left dorsolateral prefrontal cortex of patients with CFS. More pain was associated with reduced GMVs and NAA/Cr, over and above the effects of fatigue, depressive symptoms, physical activity, and psychomotor speed. In contrast to previous reports and despite a large representative sample, global GMV did not differ between the CFS and healthy control groups. CFS, as diagnosed by Centers for Disease Control and Prevention criteria, is not a clinical entity reliably associated with reduced GMV. Individual variation in the presence of pain, rather than fatigue, is associated with neuronal alterations in the dorsolateral prefrontal cortex of patients with CFS. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  10. Functions and requirements for subsurface barriers used in support of single-shell tank waste retrieval

    International Nuclear Information System (INIS)

    Lowe, S.S.

    1993-01-01

    The mission of the Tank Waste Remediation System (TWRS) Program is to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The scope of the TWRS Program includes project and program activities for receiving, storing, maintaining, treating, and disposing onsite, or packaging for offsite disposal, all Hanford tank waste. Hanford tank waste includes the contents of 149 single-shell tanks (SSTs) and 28 double-shell tanks (DSTs), plus any new waste added to these facilities, and all encapsulated cesium and strontium stored onsite and returned from offsite users. A key element of the TWRS Program is retrieval of the waste in the SSTs. The waste stored in these underground tanks must be removed in order to minimize environmental, safety, and health risks associated with continuing waste storage. Subsurface barriers are being considered as a means to mitigate the effects of tank leaks including those occurring during SST waste retrieval. The functions to be performed by subsurface barriers based on their role in retrieving waste from the SSTs are described, and the requirements which constrain their application are identified. These functions and requirements together define the functional baseline for subsurface barriers

  11. Simulations of skin barrier function: free energies of hydrophobic and hydrophilic transmembrane pores in ceramide bilayers.

    Science.gov (United States)

    Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K

    2008-11-15

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.

  12. Modelling altered revenue function based on varying power consumption distribution and electricity tariff charge using data analytics framework

    Science.gov (United States)

    Zainudin, W. N. R. A.; Ramli, N. A.

    2017-09-01

    In 2010, Energy Commission (EC) had introduced Incentive Based Regulation (IBR) to ensure sustainable Malaysian Electricity Supply Industry (MESI), promotes transparent and fair returns, encourage maximum efficiency and maintains policy driven end user tariff. To cater such revolutionary transformation, a sophisticated system to generate policy driven electricity tariff structure is in great need. Hence, this study presents a data analytics framework that generates altered revenue function based on varying power consumption distribution and tariff charge function. For the purpose of this study, the power consumption distribution is being proxy using proportion of household consumption and electricity consumed in KwH and the tariff charge function is being proxy using three-tiered increasing block tariff (IBT). The altered revenue function is useful to give an indication on whether any changes in the power consumption distribution and tariff charges will give positive or negative impact to the economy. The methodology used for this framework begins by defining the revenue to be a function of power consumption distribution and tariff charge function. Then, the proportion of household consumption and tariff charge function is derived within certain interval of electricity power. Any changes in those proportion are conjectured to contribute towards changes in revenue function. Thus, these changes can potentially give an indication on whether the changes in power consumption distribution and tariff charge function are giving positive or negative impact on TNB revenue. Based on the finding of this study, major changes on tariff charge function seems to affect altered revenue function more than power consumption distribution. However, the paper concludes that power consumption distribution and tariff charge function can influence TNB revenue to some great extent.

  13. Tracer Studies to Characterize the Effects of Roadside Noise Barriers on Near-Road Pollutant Dispersion under Varying Atmospheric Stability Conditions

    Science.gov (United States)

    A roadway toxics dispersion study was conducted by the Field Research Division (FRD) of NOAA at the Idaho National Laboratory (INL) near Idaho Falls, ID to document the effects on concentrations of roadway emissions behind a roadside sound barrier in various conditions of atmosph...

  14. Response function of an HPGe detector simulated through MCNP 4A varying the density and chemical composition of the matrix

    International Nuclear Information System (INIS)

    Leal A, B.; Mireles G, F.; Quirino T, L.; Pinedo, J.L.

    2005-01-01

    In the area of the Radiological Safety it is required of a calibrated detection system in energy and efficiency for the determination of the concentration in activity in samples that vary in chemical composition and by this in density. The area of Nuclear Engineering requires to find the grade of isotopic enrichment of the uranium of the Sub-critic Nuclear Chicago 9000 Mark. Given the experimental importance that has the determination from the curves of efficiency to the effects of establishing the quantitative results, is appealed to the simulation of the response function of the detector used in the Regional Center of Nuclear Studies inside the range of energy of 80 keV to 1400 keV varying the density of the matrix and the chemical composition by means of the application of the Monte Carlo code MCNP-4A. The obtained results in the simulation of the response function of the detector show a grade of acceptance in the range from 500 to 1400 keV energy, with a smaller percentage discrepancy to 10%, in the range of low energy that its go from 59 to 400 keV, the percentage discrepancy varies from 17% until 30%, which is manifested in the opposing isotopic relationship for 5 fuel rods of the Sub critic nuclear assemble. (Author)

  15. COMPARATIVE STUDY OF THE EFFECTS OF DETONATION NANODIAMONDS WITH VARIED PROPERTIES ON FUNCTIONAL STATE OF BRAIN NERVE TERMINALS

    Directory of Open Access Journals (Sweden)

    M. A. Galkin

    2016-12-01

    Full Text Available The aim of the study was to compare the effects of detonation nanodiamond preparations from different batches cleaned from impurities by diverse methods of chemical treatment on the membrane potential and glutamate transport characteristics of rat brain nerve terminals. The size of nanodiamond particles vary from 10–20 nm to 10 μm. There are carbonyl, hydroxyl and carboxyl functional groups on the surface of the particles. Physical-chemical properties such as a magnetic susceptibility and the amount of incombustible residue in samples of detonation nanodia-mond vary depending on the synthesis regime and the method of chemical cleaning of the product and therefore, the neuroactive properties of nanodiamonds from different batches can be different. It was shown by dynamic light scattering analysis that nanodiamond preparations from different batches treated by diverse technologies of chemical treatment had varied average size of particles and distribution of particles by size. Nanodiamond preparations from different batches changed the plasma membrane potential and caused membrane depolarization of nerve terminals. Analysis of the effects of nanodiamonds on transporter-mediated L-[14C]glutamate uptake by nerve terminals also revealed that all studied nanodiamond preparations decreased abovementioned parameter. Therefore, detonation nanodiamonds from different batches have similar principal effects on functional state of nerve terminals, however variability in their physical and chemical properties is associated with diverse strength of these effects.

  16. Suitability of polystyrene as a functional barrier layer in coloured food contact materials.

    Science.gov (United States)

    Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy

    2015-01-01

    Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.

  17. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Science.gov (United States)

    Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I

    2015-10-01

    Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular

  18. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Directory of Open Access Journals (Sweden)

    Shimon Bershtein

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the

  19. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2017-07-01

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Caspase-14 Expression Impairs Retinal Pigment Epithelium Barrier Function: Potential Role in Diabetic Macular Edema

    Directory of Open Access Journals (Sweden)

    Selina Beasley

    2014-01-01

    Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.

  1. Brain barriers and functional interfaces with sequential appearance of ABC efflux transporters during human development

    DEFF Research Database (Denmark)

    Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.

    2017-01-01

    Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....

  2. Barriers and Facilitators to Implementing Functional Family Therapy in a Community Setting: Client and Practitioner Perspectives.

    Science.gov (United States)

    McPherson, Kerri E; Kerr, Susan; Casey, Beth; Marshall, John

    2017-10-01

    While Functional Family Therapy (FFT) is known to be effective in addressing adolescent behavioral problems, there has been little exploration of issues relevant to its transport from the tightly controlled setting of clinical trials into routine service delivery. This study sought the views of key stakeholders, clients, and practitioners, on barriers and facilitators to the successful implementation of FFT. Undertaken in a community setting in Scotland, interviews were carried out with 12 adolescents, 14 parents/caregivers, and 6 practitioners. Results focus on: Referral process and pre-intervention contact; Engagement of families; Structure and delivery; Organizational factors. Although barriers to engagement were identified, FFT was viewed as an acceptable, appropriate and feasible intervention with the potential to improve adolescent wellbeing in 'real-world' settings. © 2017 American Association for Marriage and Family Therapy.

  3. Curcumin-mediated regulation of intestinal barrier function: The mechanism underlying its beneficial effects.

    Science.gov (United States)

    Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha

    2018-01-02

    Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.

  4. Rooting depth varies differentially in trees and grasses as a function of mean annual rainfall in an African savanna.

    Science.gov (United States)

    Holdo, Ricardo M; Nippert, Jesse B; Mack, Michelle C

    2018-01-01

    A significant fraction of the terrestrial biosphere comprises biomes containing tree-grass mixtures. Forecasting vegetation dynamics in these environments requires a thorough understanding of how trees and grasses use and compete for key belowground resources. There is disagreement about the extent to which tree-grass vertical root separation occurs in these ecosystems, how this overlap varies across large-scale environmental gradients, and what these rooting differences imply for water resource availability and tree-grass competition and coexistence. To assess the extent of tree-grass rooting overlap and how tree and grass rooting patterns vary across resource gradients, we examined landscape-level patterns of tree and grass functional rooting depth along a mean annual precipitation (MAP) gradient extending from ~ 450 to ~ 750 mm year -1 in Kruger National Park, South Africa. We used stable isotopes from soil and stem water to make inferences about relative differences in rooting depth between these two functional groups. We found clear differences in rooting depth between grasses and trees across the MAP gradient, with grasses generally exhibiting shallower rooting profiles than trees. We also found that trees tended to become more shallow-rooted as a function of MAP, to the point that trees and grasses largely overlapped in terms of rooting depth at the wettest sites. Our results reconcile previously conflicting evidence for rooting overlap in this system, and have important implications for understanding tree-grass dynamics under altered precipitation scenarios.

  5. Multistability of neural networks with discontinuous non-monotonic piecewise linear activation functions and time-varying delays.

    Science.gov (United States)

    Nie, Xiaobing; Zheng, Wei Xing

    2015-05-01

    This paper is concerned with the problem of coexistence and dynamical behaviors of multiple equilibrium points for neural networks with discontinuous non-monotonic piecewise linear activation functions and time-varying delays. The fixed point theorem and other analytical tools are used to develop certain sufficient conditions that ensure that the n-dimensional discontinuous neural networks with time-varying delays can have at least 5(n) equilibrium points, 3(n) of which are locally stable and the others are unstable. The importance of the derived results is that it reveals that the discontinuous neural networks can have greater storage capacity than the continuous ones. Moreover, different from the existing results on multistability of neural networks with discontinuous activation functions, the 3(n) locally stable equilibrium points obtained in this paper are located in not only saturated regions, but also unsaturated regions, due to the non-monotonic structure of discontinuous activation functions. A numerical simulation study is conducted to illustrate and support the derived theoretical results. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Novel assay of metformin levels in patients with type 2 diabetes and varying levels of renal function: clinical recommendations.

    Science.gov (United States)

    Frid, Anders; Sterner, Gunnar N; Löndahl, Magnus; Wiklander, Clara; Cato, Anne; Vinge, Ellen; Andersson, Anders

    2010-06-01

    To study trough levels of metformin in serum and its intra-individual variation in patients using a newly developed assay. Trough serum levels of metformin were measured once using liquid chromatography-tandem mass spectrometry (LCMSMS) in 137 type 2 diabetic patients with varying renal function (99 men) and followed repeatedly during 2 months in 20 patients (16 men) with estimated glomerular filtration rate (eGFR) 60, 30-60, and 20 micromol/l. Metformin measurement is less suitable for dose titration.

  7. Novel Assay of Metformin Levels in Patients With Type 2 Diabetes and Varying Levels of Renal Function

    Science.gov (United States)

    Frid, Anders; Sterner, Gunnar N.; Löndahl, Magnus; Wiklander, Clara; Cato, Anne; Vinge, Ellen; Andersson, Anders

    2010-01-01

    OBJECTIVE To study trough levels of metformin in serum and its intra-individual variation in patients using a newly developed assay. RESEARCH DESIGN AND METHODS Trough serum levels of metformin were measured once using liquid chromatography–tandem mass spectrometry (LCMSMS) in 137 type 2 diabetic patients with varying renal function (99 men) and followed repeatedly during 2 months in 20 patients (16 men) with estimated glomerular filtration rate (eGFR) 60, 30–60, and 20 μmol/l. Metformin measurement is less suitable for dose titration. PMID:20215446

  8. Biosensor Technology Reveals the Disruption of the Endothelial Barrier Function and the Subsequent Death of Blood Brain Barrier Endothelial Cells to Sodium Azide and Its Gaseous Products.

    Science.gov (United States)

    Kho, Dan T; Johnson, Rebecca H; O'Carroll, Simon J; Angel, Catherine E; Graham, E Scott

    2017-09-21

    Herein we demonstrate the sensitive nature of human blood-brain barrier (BBB) endothelial cells to sodium azide and its gaseous product. Sodium azide is known to be acutely cytotoxic at low millimolar concentrations, hence its use as a biological preservative (e.g., in antibodies). Loss of barrier integrity was noticed in experiments using Electric Cell-substrate Impedance Sensing (ECIS) biosensor technology, to measure endothelial barrier integrity continuously in real-time. Initially the effect of sodium azide was observed as an artefact where it was present in antibodies being employed in neutralisation experiments. This was confirmed where antibody clones that were azide-free did not mediate loss of barrier function. A delayed loss of barrier function in neighbouring wells implied the influence of a liberated gaseous product. ECIS technology demonstrated that the BBB endothelial cells had a lower level of direct sensitivity to sodium azide of ~3 µM. Evidence of gaseous toxicity was consistently observed at 30 µM and above, with disrupted barrier function and cell death in neighbouring wells. We highlight the ability of this cellular biosensor technology to reveal both the direct and gaseous toxicity mediated by sodium azide. The sensitivity and temporal dimension of ECIS technology was instrumental in these observations. These findings have substantial implications for the wide use of sodium azide in biological reagents, raising issues of their application in live-cell assays and with regard to the protection of the user. This research also has wider relevance highlighting the sensitivity of brain endothelial cells to a known mitochondrial disruptor. It is logical to hypothesise that BBB endothelial dysfunction due to mitochondrial dys-regulation could have an important but underappreciated role in a range of neurological diseases.

  9. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  10. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  11. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  12. Functional, interactive and critical health literacy: Varying relationships with control over care and number of GP visits.

    Science.gov (United States)

    van der Heide, Iris; Heijmans, Monique; Schuit, A Jantine; Uiters, Ellen; Rademakers, Jany

    2015-08-01

    The aim of this study is to examine the extent to which functional, interactive and critical health literacy are associated with patients' perceived control over care and frequency of GP visits. Data from the Dutch 'National Panel of People with Chronic Illness or Disability' was used (N=2508). Health literacy was assessed by the Functional, Communicative and Critical Health Literacy measure. Perceived control over care was indicated by perceived ability to organize care, interact with providers and to perform self-care. By multivariate linear and logistic regression analyses, associations between health literacy and perceived control over care and subsequently frequency of GP visits were studied. Mainly interactive health literacy was associated with patients' perceived ability to organize care, interact with healthcare providers and perform self-care, whereas only functional health literacy was associated with number of GP visits. The results imply that some patients' may be less able to exert control over their care because of lower health literacy. Functional, interactive and critical health literacy vary in their relevance for patients' ability to exert control. Initiatives for strengthening patients' role in healthcare may be improved by paying attention to patients' health literacy, specifically functional and interactive health literacy. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Functional and structural alterations of epithelial barrier properties of rat ileum following X-irradiation

    International Nuclear Information System (INIS)

    Dublineau, I.; Lebrun, F.; Grison, S.; Griffiths, N.M.

    2004-01-01

    Irradiation of the digestive system leads to alterations of the small intestine. We have characterized the disruption of the barrier integrity in rat ileum from 1 to 14 days following irradiation ranging from 6 to 12 Gy. The intestinal permeability to 14 C-mannitol and 3 H-dextran 70,000 was measured in vitro in Ussing chambers. In parallel to these functional studies, immunohistochemical analyses of junctional proteins (ZO-1 and β-catenin) of ileal epithelium were performed by confocal microscopy. Irradiation with 10 Gy induced a marked decrease in epithelial tissue resistance at three days and a fivefold increase in mannitol permeability, without modifications of dextran permeability. A disorganization of the localization for ZO-1 and β-catenin was also observed. At 7 days after irradiation, we observed a recovery of the organization of junctional proteins in parallel to a return of intestinal permeability to control value. In addition to these time-dependent effects, a gradual effect on epithelial integrity of the radiation doses was observed 3 days after irradiation. This study shows a disruption of the integrity of the intestinal barrier in rat ileum following abdominal X-irradiation, depending on the time postirradiation and on the delivered dose. The loss of barrier integrity was characterized by a disorganization of proteins of tight and adherent junctions, leading to increased intestinal permeability to mannitol. (author)

  14. Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

    Science.gov (United States)

    Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

    2017-08-01

    Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. How gut transcriptional function of Drosophila melanogaster varies with the presence and composition of the gut microbiota.

    Science.gov (United States)

    Bost, Alyssa; Franzenburg, Soeren; Adair, Karen L; Martinson, Vincent G; Loeb, Greg; Douglas, Angela E

    2018-04-01

    Despite evidence from laboratory experiments that perturbation of the gut microbiota affects many traits of the animal host, our understanding of the effect of variation in microbiota composition on animals in natural populations is very limited. The core purpose of this study on the fruit fly Drosophila melanogaster was to identify the impact of natural variation in the taxonomic composition of gut bacterial communities on host traits, with the gut transcriptome as a molecular index of microbiota-responsive host traits. Use of the gut transcriptome was validated by demonstrating significant transcriptional differences between the guts of laboratory flies colonized with bacteria and maintained under axenic conditions. Wild Drosophila from six field collections made over two years had gut bacterial communities of diverse composition, dominated to varying extents by Acetobacteraceae and Enterobacteriaceae. The gut transcriptomes also varied among collections and differed markedly from those of laboratory flies. However, no overall relationship between variation in the wild fly transcriptome and taxonomic composition of the gut microbiota was evident at all taxonomic scales of bacteria tested for both individual fly genes and functional categories in Gene Ontology. We conclude that the interaction between microbiota composition and host functional traits may be confounded by uncontrolled variation in both ecological circumstance and host traits (e.g., genotype, age physiological condition) under natural conditions, and that microbiota effects on host traits identified in the laboratory should, therefore, be extrapolated to field population with great caution. © 2017 John Wiley & Sons Ltd.

  16. Collaborative learning to unlock investments for functional ecological infrastructure: Bridging barriers in social-ecological systems in South Africa

    CSIR Research Space (South Africa)

    Angelstam, P

    2017-05-01

    Full Text Available . Based on expert knowledge at three scales, we analysed South Africa's opportunity to active adaptive management and to unlock investments that enhance functional ecological infrastructure. Barriers included lack of trust among actors, limited...

  17. Elucidation of the Synthetic Mechanism of Acylceramide, an Essential Lipid for Skin Barrier Function.

    Science.gov (United States)

    Ohno, Yusuke

    2017-01-01

    The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.

  18. Stereodynamic tetrahydrobiisoindole “NU-BIPHEP(O”s: functionalization, rotational barriers and non-covalent interactions

    Directory of Open Access Journals (Sweden)

    Golo Storch

    2016-07-01

    Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.

  19. War experiences, general functioning and barriers to care among former child soldiers in Northern Uganda: the WAYS study.

    Science.gov (United States)

    Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio

    2014-12-01

    Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

    Science.gov (United States)

    Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

    2015-01-13

    Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

  1. Barrier Function-Based Neural Adaptive Control With Locally Weighted Learning and Finite Neuron Self-Growing Strategy.

    Science.gov (United States)

    Jia, Zi-Jun; Song, Yong-Duan

    2017-06-01

    This paper presents a new approach to construct neural adaptive control for uncertain nonaffine systems. By integrating locally weighted learning with barrier Lyapunov function (BLF), a novel control design method is presented to systematically address the two critical issues in neural network (NN) control field: one is how to fulfill the compact set precondition for NN approximation, and the other is how to use varying rather than a fixed NN structure to improve the functionality of NN control. A BLF is exploited to ensure the NN inputs to remain bounded during the entire system operation. To account for system nonlinearities, a neuron self-growing strategy is proposed to guide the process for adding new neurons to the system, resulting in a self-adjustable NN structure for better learning capabilities. It is shown that the number of neurons needed to accomplish the control task is finite, and better performance can be obtained with less number of neurons as compared with traditional methods. The salient feature of the proposed method also lies in the continuity of the control action everywhere. Furthermore, the resulting control action is smooth almost everywhere except for a few time instants at which new neurons are added. Numerical example illustrates the effectiveness of the proposed approach.

  2. Effects of Lactobacillus plantarum on gut barrier function in experimental obstructive jaundice

    Science.gov (United States)

    Zhou, Yu-Kun; Qin, Huan-Long; Zhang, Ming; Shen, Tong-Yi; Chen, Hong-Qi; Ma, Yan-Lei; Chu, Zhao-Xin; Zhang, Peng; Liu, Zhi-Hua

    2012-01-01

    AIM: To investigate the mechanisms of Lactobacillus plantarum (L. plantarum) action on gut barrier in preoperative and postoperative experimental obstructive jaundice in rats. METHODS: Forty rats were randomly divided into groups of sham-operation, bile duct ligation (BDL), BDL + L. plantarum, BDL + internal biliary drainage (IBD), and BDL + IBD + L. plantarum. Ten days after L. plantarum administration, blood and ileal samples were collected from the rats for morphological examination, and intestinal barrier function, liver function, intestinal oxidative stress and protein kinase C (PKC) activity measurement. The distribution and expression of the PKC and tight junction (TJ) proteins, such as occludin, zonula occludens-1, claudin-1, claudin-4, junction adhesion molecule-A and F-actin, were examined by confocal laser scanning microscopy, immunohistochemistry, Western blotting, real-time fluorescent quantitative polymerase chain reaction assay. RESULTS: L. plantarum administration substantially restored gut barrier, decreased enterocyte apoptosis, improved intestinal oxidative stress, promoted the activity and expression of protein kinase (BDL vs BDL + L. plantarum, 0.295 ± 0.007 vs 0.349 ± 0.003, P plantarum, 0.407 ± 0.046 vs 0.465 ± 0.135, P plantarum, 0.266 ± 0.118 vs 0.326 ± 0.009, P plantarum was more prominent after internal biliary drainage ( BDL + IBD vs BDL + IBD + L. plantarum, 0.415 ± 0.105 vs 0.494 ± 0.145, P plantarum can decrease intestinal epithelial cell apoptosis, reduce oxidative stress, and prevent TJ disruption in biliary obstruction by activating the PKC pathway. PMID:22912548

  3. Thiolated silicone oils as adhesive skin protectants for improved barrier function.

    Science.gov (United States)

    Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A

    2016-06-01

    The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  4. A Lactobacillus mutant capable of accumulating long-chain polyphosphates that enhance intestinal barrier function.

    Science.gov (United States)

    Saiki, Asako; Ishida, Yasuaki; Segawa, Shuichi; Hirota, Ryuichi; Nakamura, Takeshi; Kuroda, Akio

    2016-05-01

    Inorganic polyphosphate (polyP) was previously identified as a probiotic-derived substance that enhances intestinal barrier function. PolyP-accumulating bacteria are expected to have beneficial effects on the human gastrointestinal tract. In this study, we selected Lactobacillus paracasei JCM 1163 as a strain with the potential to accumulate polyP, because among the probiotic bacteria stored in our laboratory, it had the largest amount of polyP. The chain length of polyP accumulated in L. paracasei JCM 1163 was approximately 700 phosphate (Pi) residues. L. paracasei JCM 1163 accumulated polyP when Pi was added to Pi-starved cells. We further improved the ability of L. paracasei JCM 1163 to accumulate polyP by nitrosoguanidine mutagenesis. The mutant accumulated polyP at a level of 1500 nmol/mg protein-approximately 190 times that of the wild-type strain. PolyP extracted from the L. paracasei JCM 1163 significantly suppressed the oxidant-induced intestinal permeability in mouse small intestine. In conclusion, we have succeeded in breeding the polyP-accumulating Lactobacillus mutant that is expected to enhance intestinal barrier function.

  5. Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.

    Science.gov (United States)

    Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T

    2012-01-01

    Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.

  6. Hybridization between two cryptic filamentous brown seaweeds along the shore: analysing pre- and postzygotic barriers in populations of individuals with varying ploidy levels.

    Science.gov (United States)

    Montecinos, Alejandro E; Guillemin, Marie-Laure; Couceiro, Lucia; Peters, Akira F; Stoeckel, Solenn; Valero, Myriam

    2017-07-01

    We aimed to study the importance of hybridization between two cryptic species of the genus Ectocarpus, a group of filamentous algae with haploid-diploid life cycles that include the principal genetic model organism for the brown algae. In haploid-diploid species, the genetic structure of the two phases of the life cycle can be analysed separately in natural populations. Such life cycles provide a unique opportunity to estimate the frequency of hybrid genotypes in diploid sporophytes and meiotic recombinant genotypes in haploid gametophytes allowing the effects of reproductive barriers preventing fertilization or preventing meiosis to be untangle. The level of hybridization between E. siliculosus and E. crouaniorum was quantified along the European coast. Clonal cultures (568 diploid, 336 haploid) isolated from field samples were genotyped using cytoplasmic and nuclear markers to estimate the frequency of hybrid genotypes in diploids and recombinant haploids. We identified admixed individuals using microsatellite loci, classical assignment methods and a newly developed Bayesian method (XPloidAssignment), which allows the analysis of populations that exhibit variations in ploidy level. Over all populations, the level of hybridization was estimated at 8.7%. Hybrids were exclusively observed in sympatric populations. More than 98% of hybrids were diploids (40% of which showed signs of aneuploidy) with a high frequency of rare alleles. The near absence of haploid recombinant hybrids demonstrates that the reproductive barriers are mostly postzygotic and suggests that abnormal chromosome segregation during meiosis following hybridization of species with different genome sizes could be a major cause of interspecific incompatibility in this system. © 2017 John Wiley & Sons Ltd.

  7. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Directory of Open Access Journals (Sweden)

    Xiang Ling

    Full Text Available Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ. Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC. It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P < 0.01. Compared with the LPS group, bifidobacterium significantly decreased the production of IL-6 and TNF-α (P < 0.01 and suppressed zonulin release (P < 0.05. In addition, bifidobacterium pretreatment up-regulated occludin, claudin-3 and ZO-1 expression (P < 0.01 and also preserved these proteins localization at TJ compared with the LPS group. In the in vivo study, bifidobacterium decreased the incidence of NEC from 88 to 47% (P < 0.05 and reduced the severity in the NEC model. Increased levels of IL-6 and TNF-α in the ileum of NEC rats were normalized in bifidobacterium treated rats (P < 0.05. Moreover, administration of bifidobacterium attenuated the increase in intestinal permeability (P < 0.01, decreased the levels of serum zonulin (P < 0.05, normalized the expression and localization of TJ proteins in the ileum compared with animals with NEC. We concluded that bifidobacterium may

  8. Microbial community diversity and composition varies with habitat characteristics and biofilm function in macrophyte-rich streams

    DEFF Research Database (Denmark)

    Levi, Peter S.; Starnawski, Piotr; Poulsen, Britta

    2017-01-01

    Biofilms in streams play an integral role in ecosystem processes and function yet few studies have investigated the broad diversity of these complex prokaryotic and eukaryotic microbial communities. Physical habitat characteristics can affect the composition and abundance of microorganisms...... in these biofilms by creating microhabitats. Here we describe the prokaryotic and eukaryotic microbial diversity of biofilms in sand and macrophyte habitats (i.e. epipsammon and epiphyton, respectively) in five macrophyte-rich streams in Jutland, Denmark. The macrophyte species varied in growth morphology, C......:N stoichiometry, and preferred stream habitat, providing a range in environmental conditions for the epiphyton. Among all habitats and streams, the prokaryotic communities were dominated by common phyla, including Alphaproteobacteria, Bacteriodetes, and Gammaproteobacteria, while the eukaryotic communities were...

  9. Contacting co-culture of human retinal microvascular endothelial cells alters barrier function of human embryonic stem cell derived retinal pigment epithelial cells.

    Science.gov (United States)

    Skottman, H; Muranen, J; Lähdekorpi, H; Pajula, E; Mäkelä, K; Koivusalo, L; Koistinen, A; Uusitalo, H; Kaarniranta, K; Juuti-Uusitalo, K

    2017-10-01

    Here we evaluated the effects of human retinal microvascular endothelial cells (hREC) on mature human embryonic stem cell (hESC) derived retinal pigment epithelial (RPE) cells. The hESC-RPE cells (Regea08/017, Regea08/023 or Regea11/013) and hREC (ACBRI 181) were co-cultured on opposite sides of transparent membranes for up to six weeks. Thereafter barrier function, small molecule permeability, localization of RPE and endothelial cell marker proteins, cellular fine structure, and growth factor secretion of were evaluated. After co-culture, the RPE specific CRALBP and endothelial cell specific von Willebrand factor were appropriately localized. In addition, the general morphology, pigmentation, and fine structure of hESC-RPE cells were unaffected. Co-culture increased the barrier function of hESC-RPE cells, detected both with TEER measurements and cumulative permeability of FD4 - although the differences varied among the cell lines. Co-culturing significantly altered VEGF and PEDF secretion, but again the differences were cell line specific. The results of this study showed that co-culture with hREC affects hESC-RPE functionality. In addition, co-culture revealed drastic cell line specific differences, most notably in growth factor secretion. This model has the potential to be used as an in vitro outer blood-retinal barrier model for drug permeability testing. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. How hormones influence composition and physiological function of the brain-blood barrier.

    Science.gov (United States)

    Hampl, R; Bičíková, M; Sosvorová, L

    2015-01-01

    Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.

  11. Functional Two-Dimensional Coordination Polymeric Layer as a Charge Barrier in Li–S Batteries

    KAUST Repository

    Huang, Jing-Kai

    2018-01-04

    Ultrathin two-dimensional (2D) polymeric layers are capable of separating gases and molecules based on the reported size exclusion mechanism. What is equally important but missing today is an exploration of the 2D layers with charge functionality, which enables applications using the charge exclusion principle. This work demonstrates a simple and scalable method of synthesizing a free-standing 2D coordination polymer Zn2(benzimidazolate)2(OH)2 at the air–water interface. The hydroxyl (−OH) groups are stoichiometrically coordinated and implement electrostatic charges in the 2D structures, providing powerful functionality as a charge barrier. Electrochemical performance of the Li–S battery shows that the Zn2(benzimidazolate)2(OH)2 coordination polymer layers efficiently mitigate the polysulfide shuttling effects and largely enhance the battery capacity and cycle performance. The synthesis of the proposed coordination polymeric layers is simple, scalable, cost saving, and promising for practical use in batteries.

  12. Descendant root volume varies as a function of root type: estimation of root biomass lost during uprooting in Pinus pinaster.

    Science.gov (United States)

    Danjon, Frédéric; Caplan, Joshua S; Fortin, Mathieu; Meredieu, Céline

    2013-01-01

    Root systems of woody plants generally display a strong relationship between the cross-sectional area or cross-sectional diameter (CSD) of a root and the dry weight of biomass (DWd) or root volume (Vd) that has grown (i.e., is descendent) from a point. Specification of this relationship allows one to quantify root architectural patterns and estimate the amount of material lost when root systems are extracted from the soil. However, specifications of this relationship generally do not account for the fact that root systems are comprised of multiple types of roots. We assessed whether the relationship between CSD and Vd varies as a function of root type. Additionally, we sought to identify a more accurate and time-efficient method for estimating missing root volume than is currently available. We used a database that described the 3D root architecture of Pinus pinaster root systems (5, 12, or 19 years) from a stand in southwest France. We determined the relationship between CSD and Vd for 10,000 root segments from intact root branches. Models were specified that did and did not account for root type. The relationships were then applied to the diameters of 11,000 broken root ends to estimate the volume of missing roots. CSD was nearly linearly related to the square root of Vd, but the slope of the curve varied greatly as a function of root type. Sinkers and deep roots tapered rapidly, as they were limited by available soil depth. Distal shallow roots tapered gradually, as they were less limited spatially. We estimated that younger trees lost an average of 17% of root volume when excavated, while older trees lost 4%. Missing volumes were smallest in the central parts of root systems and largest in distal shallow roots. The slopes of the curves for each root type are synthetic parameters that account for differentiation due to genetics, soil properties, or mechanical stimuli. Accounting for this differentiation is critical to estimating root loss accurately.

  13. RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

    Science.gov (United States)

    Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

    2014-01-01

    ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

  14. The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.

    2009-09-01

    A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected

  15. Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions

    Directory of Open Access Journals (Sweden)

    Milos Mihajlovic

    2017-11-01

    Full Text Available As current kidney replacement therapies are not efficient enough for end-stage renal disease (ESRD treatment, a bioartificial kidney (BAK device, based on conditionally immortalized human proximal tubule epithelial cells (ciPTEC, could represent an attractive solution. The active transport activity of such a system was recently demonstrated. In addition, endocrine functions of the cells, such as vitamin D activation, are relevant. The organic anion transporter 1 (OAT-1 overexpressing ciPTEC line presented 1α-hydroxylase (CYP27B1, 24-hydroxylase (CYP24A1 and vitamin D receptor (VDR, responsible for vitamin D activation, degradation and function, respectively. The ability to produce and secrete 1α,25-dihydroxy-vitamin D3, was shown after incubation with the precursor, 25-hydroxy-vitamin D3. The beneficial effect of vitamin D on cell function and behavior in uremic conditions was studied in the presence of an anionic uremic toxins mixture. Vitamin D could restore cell viability, and inflammatory and oxidative status, as shown by cell metabolic activity, interleukin-6 (IL-6 levels and reactive oxygen species (ROS production, respectively. Finally, vitamin D restored transepithelial barrier function, as evidenced by decreased inulin-FITC leakage in biofunctionalized hollow fiber membranes (HFM carrying ciPTEC-OAT1. In conclusion, the protective effects of vitamin D in uremic conditions and proven ciPTEC-OAT1 endocrine function encourage the use of these cells for BAK application.

  16. Employment status, employment functioning, and barriers to employment among VA primary care patients.

    Science.gov (United States)

    Zivin, Kara; Yosef, Matheos; Levine, Debra S; Abraham, Kristen M; Miller, Erin M; Henry, Jennifer; Nelson, C Beau; Pfeiffer, Paul N; Sripada, Rebecca K; Harrod, Molly; Valenstein, Marcia

    2016-03-15

    Prior research found lower employment rates among working-aged patients who use the VA than among non-Veterans or Veterans who do not use the VA, with the lowest reported employment rates among VA patients with mental disorders. This study assessed employment status, employment functioning, and barriers to employment among VA patients treated in primary care settings, and examined how depression and anxiety were associated with these outcomes. The sample included 287 VA patients treated in primary care in a large Midwestern VA Medical Center. Bivariate and multivariable analyses were conducted examining associations between socio-demographic and clinical predictors of six employment domains, including: employment status, job search self-efficacy, work performance, concerns about job loss among employed Veterans, and employment barriers and likelihood of job seeking among not employed Veterans. 54% of respondents were employed, 36% were not employed, and 10% were economically inactive. In adjusted analyses, participants with depression or anxiety (43%) were less likely to be employed, had lower job search self-efficacy, had lower levels of work performance, and reported more employment barriers. Depression and anxiety were not associated with perceived likelihood of job loss among employed or likelihood of job seeking among not employed. Single VA primary care clinic; cross-sectional study. Employment rates are low among working-aged VA primary care patients, particularly those with mental health conditions. Offering primary care interventions to patients that address mental health issues, job search self-efficacy, and work performance may be important in improving health, work, and economic outcomes. Published by Elsevier B.V.

  17. The cag PAI is intact and functional but HP0521 varies significantly in Helicobacter pylori isolates from Malaysia and Singapore.

    Science.gov (United States)

    Schmidt, H-M A; Andres, S; Nilsson, C; Kovach, Z; Kaakoush, N O; Engstrand, L; Goh, K-L; Fock, K M; Forman, D; Mitchell, H

    2010-04-01

    Helicobacter pylori-related disease is at least partially attributable to the genotype of the infecting strain, particularly the presence of specific virulence factors. We investigated the prevalence of a novel combination of H. pylori virulence factors, including the cag pathogenicity island (PAI), and their association with severe disease in isolates from the three major ethnicities in Malaysia and Singapore, and evaluated whether the cag PAI was intact and functional in vitro. Polymerase chain reaction (PCR) was used to detect dupA, cagA, cagE, cagT, cagL and babA, and to type vacA, the EPIYA motifs, HP0521 alleles and oipA ON status in 159 H. pylori clinical isolates. Twenty-two strains were investigated for IL-8 induction and CagA translocation in vitro. The prevalence of cagA, cagE, cagL, cagT, babA, oipA ON and vacA s1 and i1 was >85%, irrespective of the disease state or ethnicity. The prevalence of dupA and the predominant HP0521 allele and EPIYA motif varied significantly with ethnicity (p < 0.05). A high prevalence of an intact cag PAI was found in all ethnic groups; however, no association was observed between any virulence factor and disease state. The novel association between the HP0521 alleles, EPIYA motifs and host ethnicity indicates that further studies to determine the function of this gene are important.

  18. Experimental fusion excitation functions and derived barrier distributions for heavy ion systems involving prolate and oblate target nuclei

    International Nuclear Information System (INIS)

    Bierman, J.D.; Chan, P.; Liang, J.F.; Kelly, M.P.; Sonzogni, A.A.; Vandenbosch, R.

    1996-01-01

    Fusion excitation functions spanning the entire barrier region in 1 MeV energy steps for the two systems 40 Ca + 192 Os, 194 Pt are presented. The results of fission fragment angular distribution measurements for fusion-fission of 40 Ca + 197 Au at several projectile energies within the barrier region are also presented. The fusion data is of high enough precision to allow for extraction of the distribution of fusion barriers from the second differential of the product of E and σ. Basic coupled channels calculations which are in quite good agreement with the data are shown and discussed

  19. Fulfillment of the long-term safety functions by the different barriers during the main time frames after repository closure

    International Nuclear Information System (INIS)

    Preter, P. de; Lalieux, Ph.

    2002-01-01

    In general terms the basis long-term safety functions of a disposal system (i.e. the engineered barrier system, including the waste forms and the host rock) are the functions that the system as a whole or its constituents must fulfill in order to assure an adequate level of long-term radiological safety. The long-term safety functions of a disposal system constitute a generic and methodological tool that can be used in a double sense. In the first place these functions provide an a priori instrument for designing the system: the implementer must ensure that these safety functions are fulfilled by a series of robust system barriers and components. These functions can also be used as an a posteriori means to describe and assess in general terms the functioning of the system. In this way they are an important qualitative element to help to support the safety case and to identify further R and D priorities. By providing a general description of system functioning they are also a communication tool to stakeholders who are less familiar with the details of a safety case. Instead of limiting the description to a multi-barrier system, the safety functions enable to better explain how the different barriers contribute to one or more safety functions and by which processes this is performed. By doing so the system description moves from multi-barrier to multi-function. The aim of this paper is to provide such a general description of the system functioning for the Belgian case of deep disposal of high-level waste (mainly spent fuel or vitrified waste from fuel reprocessing) in the Boom Clay, o poorly-indurated argillaceous formation. From the detailed safety and performance evaluations the main time frames after repository closure are identified. Each time frame relates to a period during which the successive safety functions play a key role. Also, in each time frame the radiological impact on the environment is distinctly different. (authors)

  20. Alteration of intestinal barrier function during activity-based anorexia in mice.

    Science.gov (United States)

    Jésus, Pierre; Ouelaa, Wassila; François, Marie; Riachy, Lina; Guérin, Charlène; Aziz, Moutaz; Do Rego, Jean-Claude; Déchelotte, Pierre; Fetissov, Sergueï O; Coëffier, Moïse

    2014-12-01

    Anorexia nervosa is a severe eating disorder often leading to malnutrition and cachexia, but its pathophysiology is still poorly defined. Chronic food restriction during anorexia nervosa may induce gut barrier dysfunction, which may contribute to disease development and its complications. Here we have characterized intestinal barrier function in mice with activity-based anorexia (ABA), an animal model of anorexia nervosa. Male C57Bl/6 ABA or limited food access (LFA) mice were placed respectively in cages with or without activity wheel. After 5 days of acclimatization, both ABA and LFA mice had progressively limited access to food from 6 h/d at day 6 to 3 h/d at day 9 and until the end of experiment at day 17. A group of pair-fed mice (PF) was also compared to ABA. On day 17, food intake was lower in ABA than LFA mice (2.0 ± 0.18 g vs. 3.0 ± 0.14 g, p anorexia nervosa. The role of these alterations in the pathophysiology of anorexia nervosa should be further evaluated. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  1. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

    Science.gov (United States)

    Liu, Xinxin; Zheng, Wei; Sivasankar, M Preeti

    2016-01-01

    Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3) expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001). Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (pacrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (pacrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

  2. Intestinal epithelial barrier function and tight junction proteins with heat and exercise

    DEFF Research Database (Denmark)

    Dokladny, Karol; Zuhl, Micah N; Moseley, Pope L

    2016-01-01

    A single layer of enterocytes and tight junctions (intercellular multiprotein complexes) form the intestinal epithelial barrier that controls transport of molecules through transcellular and paracellular pathways. A dysfunctional or "leaky" intestinal tight junction barrier allows augmented perme...

  3. Composite of microgels and lipids as biofilm to restore skin barrier function

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.

    2008-01-01

    The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

  4. Tests of potential functional barriers for laminated multilayer food packages. Part II: Medium molecular weight permeants.

    Science.gov (United States)

    Simal-Gándara, J; Sarria-Vidal, M; Rijk, R

    2000-09-01

    Experiments were performed to characterize the kinetics of the permeation of different medium molecular weight model permeants: bisphenol A, warfarin and anthracene, from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick orientated polypropylene--OPP) into the food simulants olive oil and 3% (w/v) acetic acid. The characterization of permeation kinetics generally observed the permeation models previously reported to explain the experimental permeation results obtained for a low molecular weight group of model permeants. In general, the model permeants exhibited behaviour consistent with their relative molecular weights with respect to (a) the time taken to attain steady-state permeation into the food simulant in which they were more soluble, (b) their subsequent steady-state permeation rates, and (c) their partition between liquid paraffin and the OPP membrane.

  5. The effect of fucoidan on intestinal flora and intestinal barrier function in rats with breast cancer.

    Science.gov (United States)

    Xue, Meilan; Ji, Xinqiang; Liang, Hui; Liu, Ying; Wang, Bing; Sun, Lingling; Li, Weiwei

    2018-02-21

    Recent research studies have shown that the intestinal flora are related to the occurrence and progress of breast cancer. This study investigates the effect of fucoidan on intestinal flora and intestinal barrier function in rats with 7,12-dimethylbenz[a]anthracene (DMBA)-induced breast cancers. Sixty female Sprague-Dawley rats were randomly assigned to the control group, the model group, and the F1 and F2 groups, which were fed fucoidan at concentrations of 200 and 400 mg per kg bw (body weight), respectively. Intestinal histopathological analysis was performed and 16S rDNA high-throughput sequencing was used to provide an overview of the intestinal flora composition. The contents of d-lactic acid (d-LA), diamine oxidase (DAO) and endotoxin in plasma were detected by ELISA. Expression levels of the tight junction (TJ) proteins, phosphorylated p38 MAPK and ERK1/2 were measured using western blotting. Our results suggested that the intestinal wall of the model group was damaged. However, after fucoidan intervention, the villi were gradually restored. ELISA showed that the levels of plasma endotoxin, d-LA and DAO decreased in the F1 and F2 groups compared to those in the model group. Fucoidan treatment also increased the expressions of ZO-1, occludin, claudin-1 and claudin-8. Furthermore, the expression levels of phosphorylated p38 MAPK and ERK1/2 were upregulated in fucoidan treatment groups. The results of 16S rDNA high-throughput sequencing indicated that fucoidan increased the diversity of the intestinal microbiota and induced changes in microbial composition, with the increased Bacteroidetes/Firmicutes phylum ratio. In conclusion, the supplement of fucoidan could improve the fecal microbiota composition and repair the intestinal barrier function. The study suggested the use of fucoidan as an intestinal flora modulator for potential prevention of breast cancer.

  6. Investigating the Potential Barrier Function of Nanostructured Materials Formed in Engineered Barrier Systems (EBS) Designed for Nuclear Waste Isolation.

    Science.gov (United States)

    Cuevas, Jaime; Ruiz, Ana Isabel; Fernández, Raúl

    2018-02-21

    Clay and cement are known nano-colloids originating from natural processes or traditional materials technology. Currently, they are used together as part of the engineered barrier system (EBS) to isolate high-level nuclear waste (HLW) metallic containers in deep geological repositories (DGR). The EBS should prevent radionuclide (RN) migration into the biosphere until the canisters fail, which is not expected for approximately 10 3  years. The interactions of cementitious materials with bentonite swelling clay have been the scope of our research team at the Autonomous University of Madrid (UAM) with participation in several European Union (EU) projects from 1998 up to now. Here, we describe the mineral and chemical nature and microstructure of the alteration rim generated by the contact between concrete and bentonite. Its ability to buffer the surrounding chemical environment may have potential for further protection against RN migration. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Does the heritability of cognitive abilities vary as a function of parental education? Evidence from a German twin sample.

    Science.gov (United States)

    Spengler, Marion; Gottschling, Juliana; Hahn, Elisabeth; Tucker-Drob, Elliot M; Harzer, Claudia; Spinath, Frank M

    2018-01-01

    A well-known hypothesis in the behavioral genetic literature predicts that the heritability of cognitive abilities is higher in the presence of higher socioeconomic contexts. However, studies suggest that the effect of socioeconomic status (SES) on the heritability of cognitive ability may not be universal, as it has mostly been demonstrated in the United States, but not in other Western nations. In the present study we tested whether the importance of genetic and environmental effects on cognitive abilities varies as a function of parental education in a German twin sample. Cognitive ability scores (general, verbal, and nonverbal) were obtained on 531 German twin pairs (192 monozygotic, 339 dizygotic, ranging from 7 to 14 years of age; Mage = 10.25, SD = 1.83). Data on parental education were available from mothers and fathers. Results for general cognitive ability and nonverbal ability indicated no significant gene x parental education interaction effect. For verbal ability, a significant nonshared environment (E) x parental education interaction was found in the direction of greater nonshared environmental influences on verbal abilities among children raised by more educated parents.

  8. Influence of parental care on offspring hippocampal volume in young adults varies as a function of overprotection.

    Science.gov (United States)

    Wang, Yinan; Song, Yiying; Li, Xueting; Zhang, Lin; Liu, Jia

    2017-04-12

    Parental care results in increased hippocampal volumes through adaptive stress responses in developing animals. However, human studies have not yet provided consistent findings analogous to the animal literature, possibly because parental care in humans is likely intermingled with parental overprotection, as suggested by the optimal parenting theory. Here, we tested the hypothesis that the effect of parental care on offspring hippocampal volume varies as a function of parental overprotection with a large cohort of young adult participants (N = 257). Consistent with some previous human studies, we found that parental care in childhood alone had little association with the hippocampal volume in adulthood. However, when parental overprotection was low, parental care was positively correlated with offspring hippocampal volume, whereas there was no association between parental care and offspring hippocampal volume when parental overprotection was high. Thus, an interaction exists between parental care and overprotection in human's hippocampal development, which contributes to the elucidation of the complex relationship between brain structure and environmental factors.

  9. Varying the item format improved the range of measurement in patient-reported outcome measures assessing physical function.

    Science.gov (United States)

    Liegl, Gregor; Gandek, Barbara; Fischer, H Felix; Bjorner, Jakob B; Ware, John E; Rose, Matthias; Fries, James F; Nolte, Sandra

    2017-03-21

    Physical function (PF) is a core patient-reported outcome domain in clinical trials in rheumatic diseases. Frequently used PF measures have ceiling effects, leading to large sample size requirements and low sensitivity to change. In most of these instruments, the response category that indicates the highest PF level is the statement that one is able to perform a given physical activity without any limitations or difficulty. This study investigates whether using an item format with an extended response scale, allowing respondents to state that the performance of an activity is easy or very easy, increases the range of precise measurement of self-reported PF. Three five-item PF short forms were constructed from the Patient-Reported Outcomes Measurement Information System (PROMIS®) wave 1 data. All forms included the same physical activities but varied in item stem and response scale: format A ("Are you able to …"; "without any difficulty"/"unable to do"); format B ("Does your health now limit you …"; "not at all"/"cannot do"); format C ("How difficult is it for you to …"; "very easy"/"impossible"). Each short-form item was answered by 2217-2835 subjects. We evaluated unidimensionality and estimated a graded response model for the 15 short-form items and remaining 119 items of the PROMIS PF bank to compare item and test information for the short forms along the PF continuum. We then used simulated data for five groups with different PF levels to illustrate differences in scoring precision between the short forms using different item formats. Sufficient unidimensionality of all short-form items and the original PF item bank was supported. Compared to formats A and B, format C increased the range of reliable measurement by about 0.5 standard deviations on the positive side of the PF continuum of the sample, provided more item information, and was more useful in distinguishing known groups with above-average functioning. Using an item format with an extended

  10. Hydration effects on the barrier function of stratum corneum lipids: Raman analysis of ceramides 2, III and 5.

    Science.gov (United States)

    Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette

    2013-11-07

    The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.

  11. An empirical orthogonal function analysis of ocean shoreline location on the Virginia barrier islands

    Science.gov (United States)

    Haluska, J. D.

    2017-12-01

    Shoreline change along the Eastern Atlantic shore of Virginia has been studied for the individual barrier islands but not as an integrated system. This study combines the Atlantic shoreline locations for eleven barrier islands obtained from LANDSAT 5, 7, and 8 images. Approximately 250 shoreline locations over a 24-year period from Jan 1990 to Dec 2014 were extracted from the digitized shoreline data at 338 transects. The resulting 338 by 250 matrix was analyzed by the empirical orthogonal function (EOF) technique. The first four principal components (PC) explained 86 percent of the sample variance. Since the data was not detrended, the first PC was the overall trend of the data with a discontinuity in 2004-2005. The 2004-2005 interval included storm events and large shoreline changes. PCs 2 to 4 reflect the effects of El Nino events and tropical and non-tropical storms. Eigenvectors 1 to 4 all show the effects of the nine inlets in the island group. Eigenvector (EV) 1 explains 59 percent of the shoreline spatial variance and shows the largest changes at the northern and southern island ends. EVs 2 to 4 reflect the pattern of EV1 but at sequentially smaller percentages of the spatial variance. As a group, the eleven islands are losing ocean side shoreline. The lone exception is Hog Island. Sea level had the strongest correlation with the shoreline loss trend of PC1. The coefficient of determination was 0.41. The NAO and MEI also correlated with PC1 with correlations of determination of 0.05 and 0.12 respectively. These confidence level for the three factors was better than 99 percent. Sea level also correlated with PC3 and PC4. The PCs as a group show that the year intervals 2004-2005 and 2009-2010 had large effects on the shoreline change pattern for the island group. EVs 1 to 4 had the highest range of shoreline change at the island ends indicating the effect the changes of the inlets have on the adjacent islands. The smaller islands as a group had a higher level

  12. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

    Directory of Open Access Journals (Sweden)

    Xinxin Liu

    Full Text Available Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3 expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001. Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (p<0.05 and a reduction in transepithelial electrical resistance (TEER by 180.0% (p<0.001. While the expression of tight junctional protein did not change in acrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (p<0.05. Taken together, these data provide evidence that acute acrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

  13. Abl family kinases regulate endothelial barrier function in vitro and in mice.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Chislock

    Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

  14. Novel Functionally Graded Thermal Barrier Coatings in Coal-Fired Power Plant Turbines

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jing [Indiana Univ., Indianapolis, IN (United States)

    2016-11-01

    This project presents a detailed investigation of a novel functionally graded coating material, pyrochlore oxide, for thermal barrier coating (TBC) in gas turbines used in coal-fired power plants. Thermal barrier coatings are refractory materials deposited on gas turbine components, which provide thermal protection for metallic components at operating conditions. The ultimate goal of this research is to develop a manufacturing process to produce the novel low thermal conductivity and high thermal stability pyrochlore oxide based coatings with improved high-temperature durability. The current standard TBC, yttria stabilized zirconia (YSZ), has service temperatures limited to <1200°C, due to sintering and phase transition at higher temperatures. In contrast, pyrochlore oxide, e.g., lanthanum zirconate (La2Zr2O7, LZ), has demonstrated lower thermal conductivity and better thermal stability, which are crucial to high temperature applications, such as gas turbines used in coal-fired power plants. Indiana University – Purdue University Indianapolis (IUPUI) has collaborated with Praxair Surface Technologies (PST), and Changwon National University in South Korea to perform the proposed research. The research findings are critical to the extension of current TBCs to a broader range of high-temperature materials and applications. Several tasks were originally proposed and accomplished, with additional new opportunities identified during the course of the project. In this report, a description of the project tasks, the main findings and conclusions are given. A list of publications and presentations resulted from this research is listed in the Appendix at the end of the report.

  15. Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.

    Science.gov (United States)

    Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars

    2018-04-24

    In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.

  16. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Science.gov (United States)

    Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong

    2017-01-01

    Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542

  17. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Directory of Open Access Journals (Sweden)

    Siming Yang

    2017-08-01

    Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.

  18. Oxygen functionalization of MWCNTs in RF-dielectric barrier discharge Ar/O2 plasma

    Science.gov (United States)

    Abdel-Fattah, E.; Ogawa, D.; Nakamura, K.

    2017-07-01

    The oxygenation of multi-wall carbon nanotubes (MWCNTs) was performed via a radio frequency dielectric barrier discharge (RF-DBD) in an Ar/{{\\text{H}}2}\\text{O} plasma mixture. The relative intensity of the Ar/{{\\text{O}}2} plasma species was characterized by optical emission spectroscopy (OES). The effects of treatment time, RF power and oxygen gas percentage on the chemical composition and surface morphology of MWCNTs were investigated by means of x-ray photoelectron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy and field emission scanning electron microscopy (FE-SEM). The results of FTIR and XPS revealed the presence of oxygen-containing functional groups on the MWCNTs treated in an Ar/{{\\text{O}}2} plasma at an RF power of 50 W and pressure of 400 Pa. The amount of oxygen functional groups (C=O, C-O, and O-COO) also increased by increasing treatment time up to 6 min, but slightly decreased when treatment time was increased by 10 min. The increase of oxygen gas percentage in the plasma mixture does not affect the oxygen content in the treated MWCNTs. Meanwhile, MWCNTs treated at high power (80 W) showed a reduction in oxygen functional groups in comparison with low RF power conditions. The Raman analysis was consistent with the XPS and FTIR results. The integrity of the nanotube patterns also remained damaged as observed by FE-SEM images. The MWCNTs treated in RF-DBD using the Ar/{{\\text{O}}2} plasma mixture showed improved dispersibility in deionized water. A correlation between the OES data and the observed surface characterization for an improved understanding of the functionalization of MWCNTs in Ar/{{\\text{O}}2} plasma was presented.

  19. Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

    Science.gov (United States)

    Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

    2017-09-30

    Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. The intestinal complement system in inflammatory bowel disease: Shaping intestinal barrier function.

    Science.gov (United States)

    Sina, Christian; Kemper, Claudia; Derer, Stefanie

    2018-06-01

    The complement system is part of innate sensor and effector systems such as the Toll-like receptors (TLRs). It recognizes and quickly systemically and/or locally respond to microbial-associated molecular patterns (MAMPs) with a tailored defense reaction. MAMP recognition by intestinal epithelial cells (IECs) and appropriate immune responses are of major importance for the maintenance of intestinal barrier function. Enterocytes highly express various complement components that are suggested to be pivotal for proper IEC function. Appropriate activation of the intestinal complement system seems to play an important role in the resolution of chronic intestinal inflammation, while over-activation and/or dysregulation may worsen intestinal inflammation. Mice deficient for single complement components suffer from enhanced intestinal inflammation mimicking the phenotype of patients with chronic inflammatory bowel disease (IBD) such as Crohn's disease (CD) or ulcerative colitis (UC). However, the mechanisms leading to complement expression in IECs seem to differ markedly between UC and CD patients. Hence, how IECs, intestinal bacteria and epithelial cell expressed complement components interact in the course of IBD still remains to be mostly elucidated to define potential unique patterns contributing to the distinct subtypes of intestinal inflammation observed in CD and UC. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Time-varying acceleration coefficients IPSO for solving dynamic economic dispatch with non-smooth cost function

    International Nuclear Information System (INIS)

    Mohammadi-ivatloo, Behnam; Rabiee, Abbas; Ehsan, Mehdi

    2012-01-01

    Highlights: ► New approach to solve power systems dynamic economic dispatch. ► Considering Valve-point effect, prohibited operation zones. ► Proposing TVAC-IPSO algorithm. - Abstract: The objective of the dynamic economic dispatch (DED) problem is to schedule power generation for the online units for a given time horizon economically, satisfying various operational constraints. Due to the effect of valve-point effects and prohibited operating zones (POZs) in the generating units cost functions, DED problem is a highly non-linear and non-convex optimization problem. The DED problem even may be more complicated if transmission losses and ramp-rate constraints are taken into account. This paper presents a novel and heuristic algorithm to solve DED problem of generating units, by employing time varying acceleration coefficients iteration particle swarm optimization (TVAC-IPSO) method. The effectiveness of the proposed method is examined and validated by carrying out extensive tests on different test systems, i.e. 5-unit and 10-unit test systems. Valve-point effects, POZs and ramp-rate constraints along with transmission losses are considered. To examine the efficiency of the proposed TVAC-IPSO algorithm, comprehensive studies are carried out, which compare convergence properties of the proposed TVAC-IPSO approach with conventional PSO algorithm, in addition to the other recently reported approaches. Numerical results show that the TVAC-IPSO method has good convergence properties and the generation costs resulted from the proposed method are lower than other algorithms reported in recent literature.

  2. Interferon-gamma increased epithelial barrier function via upregulating claudin-7 expression in human submandibular gland duct epithelium.

    Science.gov (United States)

    Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo

    2016-06-01

    Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.

  3. Excreted/secreted Trichuris suis products reduce barrier function and suppress inflammatory cytokine production of intestinal epithelial cells

    DEFF Research Database (Denmark)

    Hiemstra, I. H.; Klaver, E. J.; Vrijland, K.

    2014-01-01

    The administration of helminths is considered a promising strategy for the treatment of autoimmune diseases due to their immunomodulatory properties. Currently, the application of the helminth Trichuris suis as a treatment for Crohn's disease is being studied in large multi-center clinical trials....... The intestinal epithelium forms an efficient barrier between the intestinal lumen containing the microbial flora and helminths, and dendritic cells (DCs) present in the lamina propria that determine the TH response. Here, we investigated how excreted/secreted (E/S) products of T. suis affect the barrier function...... of intestinal epithelial cells (IECs) in order to reach the DCs and modulate the immune response. We show that T. suis E/S products reduce the barrier function and the expression of the tight junction proteins EMP-1 and claudin-4 in IEC CMT93/69 monolayers in a glycan-dependent manner. This resulted...

  4. Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.

    Science.gov (United States)

    Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B

    2017-11-01

    Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models ( Villin-CreER T2 ;Klf5 fl/fl designated as Klf5 ΔIND and Villin-Cre;Klf5 fl/fl as Klf5 ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND ). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2 , which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2 , a gene encoding a major component of desmosome structures. NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function

  5. Investigation of the functional lifetime of TRISOPLASTr in relation to chemical compositions of pore water solutions in barriers

    NARCIS (Netherlands)

    Boels, D.; Beest, te H.; Zweers, H.; Groeneveld, P.

    2003-01-01

    Trisoplastr is a mixture of sand, bentonite and a polymer, used amongst others as landfill cover as well as barriers. Its permeability is generally lower than 1-2 x 10-11 m/s. Trisoplast keeps its functionality even in contact with different kinds of liquids, is not susceptible to cyclic drying and

  6. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro

    NARCIS (Netherlands)

    Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de

    2005-01-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of

  7. Modulating the skin barrier function by DMSO: molecular dynamics simulations of hydrophilic and hydrophobic transmembrane pores

    NARCIS (Netherlands)

    den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.

    2008-01-01

    The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these

  8. Effects of carprofen on the integrity and barrier function of canine colonic mucosa.

    Science.gov (United States)

    Briere, Catherine A; Hosgood, Giselle; Morgan, Timothy W; Hedlund, Cheryl S; Hicks, Merrin; McConnico, Rebecca S

    2008-02-01

    To measure effects of carprofen on conductance and permeability to mannitol and histologic appearance in canine colonic mucosa. Colonic mucosa from 13 mature mixed-breed dogs. Procedures-Sections of mucosa from the transverse colon and proximal and distal portions of the descending colon were obtained immediately after dogs were euthanized. Sections were mounted in Ussing chambers. Carprofen (400 microg/mL) was added to the bathing solution for treated sections. Conductance was calculated at 15-minute intervals for 240 minutes. Flux of mannitol was calculated for three 1-hour periods. Histologic examination of sections was performed after experiments concluded. Conductance was graphed against time for each chamber, and area under each curve was calculated. Conductance X time, flux of mannitol, and frequency distribution of histologic findings were analyzed for an effect of region and carprofen. Carprofen significantly increased mean conductance X time, compared with values for control (untreated) sections for all regions of colon. Carprofen significantly increased mean flux of mannitol from period 1 to period 2 and from period 2 to period 3 for all regions of colon. Carprofen caused a significant proportion of sections to have severe sloughing of cells and erosions involving >or= 10% of the epithelium, compared with control sections. Carprofen increased in vitro conductance and permeability to mannitol in canine colonic mucosa. Carprofen resulted in sloughing of cells and erosion of the colonic mucosa. These findings suggested that carprofen can compromise the integrity and barrier function of the colonic mucosa of dogs.

  9. Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation

    DEFF Research Database (Denmark)

    Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina

    2007-01-01

    12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...

  10. The blood-brain barrier: structure, function and therapeutic approaches to cross it.

    Science.gov (United States)

    Tajes, Marta; Ramos-Fernández, Eva; Weng-Jiang, Xian; Bosch-Morató, Mònica; Guivernau, Biuse; Eraso-Pichot, Abel; Salvador, Bertrán; Fernàndez-Busquets, Xavier; Roquer, Jaume; Muñoz, Francisco J

    2014-08-01

    The blood-brain barrier (BBB) is constituted by a specialized vascular endothelium that interacts directly with astrocytes, neurons and pericytes. It protects the brain from the molecules of the systemic circulation but it has to be overcome for the proper treatment of brain cancer, psychiatric disorders or neurodegenerative diseases, which are dramatically increasing as the population ages. In the present work we have revised the current knowledge on the cellular structure of the BBB and the different procedures utilized currently and those proposed to cross it. Chemical modifications of the drugs, such as increasing their lipophilicity, turn them more prone to be internalized in the brain. Other mechanisms are the use of molecular tools to bind the drugs such as small immunoglobulins, liposomes or nanoparticles that will act as Trojan Horses favoring the drug delivery in brain. This fusion of the classical pharmacology with nanotechnology has opened a wide field to many different approaches with promising results to hypothesize that BBB will not be a major problem for the new generation of neuroactive drugs. The present review provides an overview of all state-of-the-art of the BBB structure and function, as well as of the classic strategies and these appeared in recent years to deliver drugs into the brain for the treatment of Central Nervous System (CNS) diseases.

  11. EMMPRIN Modulates Epithelial Barrier Function through a MMP–Mediated Occludin Cleavage

    Science.gov (United States)

    Huet, Eric; Vallée, Benoit; Delbé, Jean; Mourah, Samia; Prulière-Escabasse, Virginie; Tremouilleres, Magali; Kadomatsu, Kenji; Doan, Serge; Baudouin, Christophe; Menashi, Suzanne; Gabison, Eric E.

    2011-01-01

    Dry eye is a common disease that develops as a result of alteration of tear fluid, leading to osmotic stress and a perturbed epithelial barrier. Matrix metalloproteinase-9 (MMP-9) may be important in dry eye disease, as its genetic knockout conferred resistance to the epithelial disruption. We show that extracellular matrix metalloproteinase inducer (EMMPRIN; also termed CD147), an inducer of MMP expression, participates in the pathogenesis of dry eye through MMP-mediated cleavage of occludin, an important component of tight junctions. EMMPRIN expression was increased on the ocular surface of dry eye patients and correlated with those of MMP-9. High osmolarity in cell culture, mimicking dry eye conditions, increased both EMMPRIN and MMP-9 and resulted in the disruption of epithelial junctions through the cleavage of occludin. Exogenously added recombinant EMMPRIN had similar effects that were abrogated in the presence of the MMP inhibitor marimastat. Membrane occludin immunostaining was markedly increased in the apical corneal epithelium of both EMMPRIN and MMP-9 knock-out mice. Furthermore, an inverse correlation between EMMPRIN and occludin membrane staining was consistently observed both in vitro and in vivo as a function of corneal epithelial cells differentiation. These data suggest a possible role of EMMPRIN in regulating the amount of occludin at the cell surface in homeostasis beyond pathological situations such as dry eye disease, and EMMPRIN may be essential for the formation and maintenance of organized epithelial structure. PMID:21777561

  12. AKAP12 mediates barrier functions of fibrotic scars during CNS repair.

    Directory of Open Access Journals (Sweden)

    Jong-Ho Cha

    Full Text Available The repair process after CNS injury shows a well-organized cascade of three distinct stages: inflammation, new tissue formation, and remodeling. In the new tissue formation stage, various cells migrate and form the fibrotic scar surrounding the lesion site. The fibrotic scar is known as an obstacle for axonal regeneration in the remodeling stage. However, the role of the fibrotic scar in the new tissue formation stage remains largely unknown. We found that the number of A-kinase anchoring protein 12 (AKAP12-positive cells in the fibrotic scar was increased over time, and the cells formed a structure which traps various immune cells. Furthermore, the AKAP12-positive cells strongly express junction proteins which enable the structure to function as a physical barrier. In in vivo validation, AKAP12 knock-out (KO mice showed leakage from a lesion, resulting from an impaired structure with the loss of the junction complex. Consistently, focal brain injury in the AKAP12 KO mice led to extended inflammation and more severe tissue damage compared to the wild type (WT mice. Accordingly, our results suggest that AKAP12-positive cells in the fibrotic scar may restrict excessive inflammation, demonstrating certain mechanisms that could underlie the beneficial actions of the fibrotic scar in the new tissue formation stage during the CNS repair process.

  13. Macleaya cordata Extract Decreased Diarrhea Score and Enhanced Intestinal Barrier Function in Growing Piglets

    Directory of Open Access Journals (Sweden)

    Gang Liu

    2016-01-01

    Full Text Available Macleaya cordata extract is of great scientific and practical interest to researchers, due to its antimicrobial and anti-inflammatory responses within experimental animals. This study was designed to determine the diarrhea score and innate immunity of growing piglets after they had received Macleaya cordata extract supplements. A total of 240 growing pigs were randomly assigned to one of three dietary treatments, with 8 replicates per treatment and 10 piglets per replicate. All pigs received a basal diet containing similar amounts of nutrients. The three treatments were a control (no additive, an antibiotic (200 mg/kg colistin, and the Macleaya cordata extract supplement group (40 mg/kg Macleaya cordata extract. The diarrhea score was calculated after D 28. The jejunal samples were obtained from five piglets selected randomly from each treatment on D 28. In comparison with the control group, the dietary Macleaya cordata extract and colistin group demonstrated a substantially decreased diarrhea score. The introduction of Macleaya cordata extract supplements to the diet significantly increased volumes of ZO-1 and claudin-1, particularly in comparison with the pigs in the control group (P<0.05. The findings indicate that Macleaya cordata extract does enhance intestinal barrier function in growing piglets and that it could be used as a viable substitute for antibiotics.

  14. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

    DEFF Research Database (Denmark)

    Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

    2006-01-01

    most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...

  15. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2018-01-01

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  16. I. Fission Probabilities, Fission Barriers, and Shell Effects. II. Particle Structure Functions

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Kexing [Univ. of California, Berkeley, CA (United States)

    1999-05-01

    In Part I, fission excitation functions of osmium isotopes 185,186, 187, 189 Os produced in 3He +182,183, 184, 186W reactions, and of polonium isotopes 209,210, 211, 212Po produced in 3He/4He + 206, 207, 208Pb reactions, were measured with high precision. These excitation functions have been analyzed in detail based upon the transition state formalism. The fission barriers, and shell effects for the corresponding nuclei are extracted from the detailed analyses. A novel approach has been developed to determine upper limits of the transient time of the fission process. The upper limits are constrained by the fission probabilities of neighboring isotopes. The upper limits for the transient time set with this new method are 15x 10–21 sec and 25x 10–21 sec for 0s and Po compound nuclei, respectively. In Part II, we report on a search for evidence of the optical modulations in the energy spectra of alpha particles emitted from hot compound nuclei. The optical modulations are expected to arise from the ~-particle interaction with the rest of the nucleus as the particle prepares to exit. Some evidence for the modulations has been observed in the alpha spectra measured in the 3He-induced reactions, 3He + natAg in particular. The identification of the modulations involves a technique that subtracts the bulk statistical background from the measured alpha spectra, in order for the modulations to become visible in the residuals. Due to insufficient knowledge of the background spectra, however, the presented evidence should only be regarded as preliminary and tentative.

  17. Identification of blood-brain barrier function following subarachnoid hemorrhage in rats at different stages

    Institute of Scientific and Technical Information of China (English)

    Zongyi Xie; Weiwei Shen; Ying Ma; Yuan Cheng

    2008-01-01

    BACKGROUND: Recent studies have indicated that blood-brain barrier (BBB) disruption following subarachnoid hemorrhage (SAH) significantly correlates with the development of brain injury and poor prognosis of patients subjected to SAH. OBJECTIVE: To investigate both functional and structural changes related to BBB in various phases after SAH in rats through quantitative and qualitative methods.DESIGN, TIME AND SETTING: This experiment, a completely randomized design and controlled experiment, was performed at the Department of Neurosurgery, the Second Affiliated Hospital of Chongqing University of Medical Sciences from June 2006 to March 2007.MATERIALS: A total of 128 female, healthy, Sprague-Dawley rats were selected for this study. Main reagents and instruments: Evans Blue dye (Sigma Company, USA), fluorescence spectrophotometer (Shimadzu Company, Japan), and transmission electron microscope (Olympus Company, Japan). MAIN OUTCOME MEASURES: Brain tissue water content was determined by the wet-dry method. BBB permeability in the cerebral cortex was determined by Evans Blue dye and fluorescent spectrophotometer. The ultrastructural changes in BBB were observed with transmission electron microscope.RESULTS: Compared with the sham-operated group, SAH induced a significant increase in brain water content between 24 and 60 hours (F = 888.32, P 0.05). Electron microscopy demonstrated only a mild perivascular edema at 24 hours after SAH. By 36 hours, a notable perivascular edema was associated with a collapse of the capillary. Astrocytic endfeet surrounding the capillary were prominently swollen in the edematous areas. The above-mentioned abnormal ultrastructural changes in the BBB were reversed by 72 hours after SAH. No obvious morphological changes in the BBB were detected in the sham-operated rats.CONCLUSION: These results directly suggest that SAH could induce rapid changes in BBB function and structure during the acute phases of BBB breakdown. Moreover, these dynamic

  18. Influence of sunflower seed oil or baby lotion on the skin barrier function of newborns: A pilot study.

    Science.gov (United States)

    Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie

    2017-12-01

    Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.

  19. Permeability measurement of some barrier materials as a function of temperature and pressure

    International Nuclear Information System (INIS)

    Maqsood, M.; Faisal, S.; Ali, J.; Usman, A.; Alamgir, K.; Farooq, K.

    2011-01-01

    Barrier materials possess the ability to restrict the passage of gases, vapors, and organic liquids through their boundaries. These barrier materials have large number of applications in industry and scientific research. To measure the permeability of barrier materials, a specific gas flow system has been developed, pure helium gas is used to measure the back ground reading through SS-316. The permeability and break-through time has been measured through Inconel X-750, NBR and Viton below and above the atmospheric pressure and at different temperatures 20 deg. C, 40 deg. C and 70 deg. C. (author)

  20. Addressing barriers to eco-innovation: Exploring the finance mobilisation functions of institutional innovation intermediaries

    NARCIS (Netherlands)

    Polzin, Friedemann; Flotow, von Paschen; Klerkx, L.W.A.

    2016-01-01

    This research article explores the role of institutional innovation intermediaries in accelerating the commercialisation of (clean) technologies. Drawing on the finance and innovation intermediaries literatures, we show that financial barriers to eco-innovation can be partly overcome by particular

  1. Use of radial basis functions for meshless numerical solutions applied to financial engineering barrier options

    Directory of Open Access Journals (Sweden)

    Gisele Tessari Santos

    2009-08-01

    Full Text Available A large number of financial engineering problems involve non-linear equations with non-linear or time-dependent boundary conditions. Despite available analytical solutions, many classical and modified forms of the well-known Black-Scholes (BS equation require fast and accurate numerical solutions. This work introduces the radial basis function (RBF method as applied to the solution of the BS equation with non-linear boundary conditions, related to path-dependent barrier options. Furthermore, the diffusional method for solving advective-diffusive equations is explored as to its effectiveness to solve BS equations. Cubic and Thin-Plate Spline (TPS radial basis functions were employed and evaluated as to their effectiveness to solve barrier option problems. The numerical results, when compared against analytical solutions, allow affirming that the RBF method is very accurate and easy to be implemented. When the RBF method is applied, the diffusional method leads to the same results as those obtained from the classical formulation of Black-Scholes equation.Muitos problemas de engenharia financeira envolvem equações não-lineares com condições de contorno não-lineares ou dependentes do tempo. Apesar de soluções analíticas disponíveis, várias formas clássicas e modificadas da conhecida equação de Black-Scholes (BS requerem soluções numéricas rápidas e acuradas. Este trabalho introduz o método de função de base radial (RBF aplicado à solução da equação BS com condições de contorno não-lineares relacionadas a opções de barreira dependentes da trajetória. Além disso, explora-se o método difusional para solucionar equações advectivo-difusivas quanto à sua efetividade para solucionar equações BS. Utilizam-se funções de base radial Cúbica e Thin-Plate Spline (TPS, aplicadas à solução de problemas de opções de barreiras. Os resultados numéricos, quando comparados com as soluções analíticas, permitem afirmar

  2. Impedance analysis of GPCR-mediated changes in endothelial barrier function: overview and fundamental considerations for stable and reproducible measurements.

    Science.gov (United States)

    Stolwijk, Judith A; Matrougui, Khalid; Renken, Christian W; Trebak, Mohamed

    2015-10-01

    The past 20 years has seen significant growth in using impedance-based assays to understand the molecular underpinning of endothelial and epithelial barrier function in response to physiological agonists and pharmacological and toxicological compounds. Most studies on barrier function use G protein-coupled receptor (GPCR) agonists which couple to fast and transient changes in barrier properties. The power of impedance-based techniques such as electric cell-substrate impedance sensing (ECIS) resides in its ability to detect minute changes in cell layer integrity label-free and in real-time ranging from seconds to days. We provide a comprehensive overview of the biophysical principles, applications, and recent developments in impedance-based methodologies. Despite extensive application of impedance analysis in endothelial barrier research, little attention has been paid to data analysis and critical experimental variables, which are both essential for signal stability and reproducibility. We describe the rationale behind common ECIS data presentation and interpretation and illustrate practical guidelines to improve signal intensity by adapting technical parameters such as electrode layout, monitoring frequency, or parameter (resistance versus impedance magnitude). Moreover, we discuss the impact of experimental parameters, including cell source, liquid handling, and agonist preparation on signal intensity and kinetics. Our discussions are supported by experimental data obtained from human microvascular endothelial cells challenged with three GPCR agonists, thrombin, histamine, and sphingosine-1-phosphate.

  3. Effects of Lactobacillus johnsonii and Lactobacillus reuteri on gut barrier function and heat shock proteins in intestinal porcine epithelial cells.

    Science.gov (United States)

    Liu, Hao-Yu; Roos, Stefan; Jonsson, Hans; Ahl, David; Dicksved, Johan; Lindberg, Jan Erik; Lundh, Torbjörn

    2015-04-01

    Heat shock proteins (HSPs) are a set of highly conserved proteins that can serve as intestinal gate keepers in gut homeostasis. Here, effects of a probiotic, Lactobacillus rhamnosus GG (LGG), and two novel porcine isolates, Lactobacillus johnsonii strain P47-HY and Lactobacillus reuteri strain P43-HUV, on cytoprotective HSP expression and gut barrier function, were investigated in a porcine IPEC-J2 intestinal epithelial cell line model. The IPEC-J2 cells polarized on a permeable filter exhibited villus-like cell phenotype with development of apical microvilli. Western blot analysis detected HSP expression in IPEC-J2 and revealed that L. johnsonii and L. reuteri strains were able to significantly induce HSP27, despite high basal expression in IPEC-J2, whereas LGG did not. For HSP72, only the supernatant of L. reuteri induced the expression, which was comparable to the heat shock treatment, which indicated that HSP72 expression was more stimulus specific. The protective effect of lactobacilli was further studied in IPEC-J2 under an enterotoxigenic Escherichia coli (ETEC) challenge. ETEC caused intestinal barrier destruction, as reflected by loss of cell-cell contact, reduced IPEC-J2 cell viability and transepithelial electrical resistance, and disruption of tight junction protein zonula occludens-1. In contrast, the L. reuteri treatment substantially counteracted these detrimental effects and preserved the barrier function. L. johnsonii and LGG also achieved barrier protection, partly by directly inhibiting ETEC attachment. Together, the results indicate that specific strains of Lactobacillus can enhance gut barrier function through cytoprotective HSP induction and fortify the cell protection against ETEC challenge through tight junction protein modulation and direct interaction with pathogens. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  4. Studying the varied shapes of gold clusters by an elegant optimization algorithm that hybridizes the density functional tight-binding theory and the density functional theory

    Science.gov (United States)

    Yen, Tsung-Wen; Lim, Thong-Leng; Yoon, Tiem-Leong; Lai, S. K.

    2017-11-01

    We combined a new parametrized density functional tight-binding (DFTB) theory (Fihey et al. 2015) with an unbiased modified basin hopping (MBH) optimization algorithm (Yen and Lai 2015) and applied it to calculate the lowest energy structures of Au clusters. From the calculated topologies and their conformational changes, we find that this DFTB/MBH method is a necessary procedure for a systematic study of the structural development of Au clusters but is somewhat insufficient for a quantitative study. As a result, we propose an extended hybridized algorithm. This improved algorithm proceeds in two steps. In the first step, the DFTB theory is employed to calculate the total energy of the cluster and this step (through running DFTB/MBH optimization for given Monte-Carlo steps) is meant to efficiently bring the Au cluster near to the region of the lowest energy minimum since the cluster as a whole has explicitly considered the interactions of valence electrons with ions, albeit semi-quantitatively. Then, in the second succeeding step, the energy-minimum searching process will continue with a skilledly replacement of the energy function calculated by the DFTB theory in the first step by one calculated in the full density functional theory (DFT). In these subsequent calculations, we couple the DFT energy also with the MBH strategy and proceed with the DFT/MBH optimization until the lowest energy value is found. We checked that this extended hybridized algorithm successfully predicts the twisted pyramidal structure for the Au40 cluster and correctly confirms also the linear shape of C8 which our previous DFTB/MBH method failed to do so. Perhaps more remarkable is the topological growth of Aun: it changes from a planar (n =3-11) → an oblate-like cage (n =12-15) → a hollow-shape cage (n =16-18) and finally a pyramidal-like cage (n =19, 20). These varied forms of the cluster's shapes are consistent with those reported in the literature.

  5. Integrating Robot Support Functions into Varied Activities at Returning Hospital Visits: Supporting Child’s Self-Management of Diabetes

    NARCIS (Netherlands)

    Looije, L.; Neerincx, M.A.; Peters, J.K.; Blanson Henkemans, O.

    2016-01-01

    Persistent progress in the self-management of their disease is important and challenging for children with diabetes. The European ALIZ-e project developed and tested a set of core functions for a social robot that may help to establish such progress. These functions were studied in different set-ups

  6. Role of functionally dominant species in varying environmental regimes: evidence for the performance-enhancing effect of biodiversity

    Directory of Open Access Journals (Sweden)

    Langenheder Silke

    2012-07-01

    Full Text Available Abstract Background Theory suggests that biodiversity can act as a buffer against disturbances and environmental variability via two major mechanisms: Firstly, a stabilising effect by decreasing the temporal variance in ecosystem functioning due to compensatory processes; and secondly, a performance enhancing effect by raising the level of community response through the selection of better performing species. Empirical evidence for the stabilizing effect of biodiversity is readily available, whereas experimental confirmation of the performance-enhancing effect of biodiversity is sparse. Results Here, we test the effect of different environmental regimes (constant versus fluctuating temperature on bacterial biodiversity-ecosystem functioning relations. We show that positive effects of species richness on ecosystem functioning are enhanced by stronger temperature fluctuations due to the increased performance of individual species. Conclusions Our results provide evidence for the performance enhancing effect and suggest that selection towards functionally dominant species is likely to benefit the maintenance of ecosystem functioning under more variable conditions.

  7. Role of functionally dominant species in varying environmental regimes: evidence for the performance-enhancing effect of biodiversity.

    Science.gov (United States)

    Langenheder, Silke; Bulling, Mark T; Prosser, James I; Solan, Martin

    2012-07-30

    Theory suggests that biodiversity can act as a buffer against disturbances and environmental variability via two major mechanisms: Firstly, a stabilising effect by decreasing the temporal variance in ecosystem functioning due to compensatory processes; and secondly, a performance enhancing effect by raising the level of community response through the selection of better performing species. Empirical evidence for the stabilizing effect of biodiversity is readily available, whereas experimental confirmation of the performance-enhancing effect of biodiversity is sparse. Here, we test the effect of different environmental regimes (constant versus fluctuating temperature) on bacterial biodiversity-ecosystem functioning relations. We show that positive effects of species richness on ecosystem functioning are enhanced by stronger temperature fluctuations due to the increased performance of individual species. Our results provide evidence for the performance enhancing effect and suggest that selection towards functionally dominant species is likely to benefit the maintenance of ecosystem functioning under more variable conditions.

  8. Glycoprotein A33 deficiency: a new mouse model of impaired intestinal epithelial barrier function and inflammatory disease

    Directory of Open Access Journals (Sweden)

    Benjamin B. Williams

    2015-08-01

    Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms

  9. Mechanism of protection of transepithelial barrier function by Lactobacillus salivarius: strain dependence and attenuation by bacteriocin production.

    Science.gov (United States)

    Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W

    2012-11-01

    Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.

  10. HIV-1 impairs human retinal pigment epithelial barrier function: possible association with the pathogenesis of HIV-associated retinopathy.

    Science.gov (United States)

    Tan, Suiyi; Duan, Heng; Xun, Tianrong; Ci, Wei; Qiu, Jiayin; Yu, Fei; Zhao, Xuyan; Wu, Linxuan; Li, Lin; Lu, Lu; Jiang, Shibo; Liu, Shuwen

    2014-07-01

    The breakdown of human retinal pigment epithelial (HRPE) barrier is considered as the etiology of retinopathy, which affects the quality of life of HIV/AIDS patients. Here we demonstrate that HIV-1 could directly impair HRPE barrier function, which leads to the translocation of HIV-1 and bacteria. HRPE cells (D407) were grown to form polarized, confluent monolayers and treated with different HIV-1 infectious clones. A significant increase of monolayer permeability, as measured by trans-epithelial electrical resistance (TEER) and apical-basolateral movements of sodium fluorescein, was observed. Disrupted tightness of HRPE barrier was associated with the downregulation of several tight junction proteins in D407 cells, including ZO-1, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4, and Claudin-5, after exposure to HIV-1, without affecting the viability of cells. HIV-1 gp120 was shown to participate in the alteration of barrier properties, as evidenced by decreased TEER and weakened expression of tight junction proteins in D407 monolayers after exposure to pseudotyped HIV-1, UV-inactivated HIV-1, and free gp120, but not to an envelope (Env)-defective mutant of HIV. Furthermore, exposure to HIV-1 particles could induce the release of pro-inflammatory cytokines in D407, including IL-6 and MCP-1, both of which downregulated the expression of ZO-1 in the HRPE barrier. Disrupted HRPE monolayer allowed translocation of HIV-1 and bacteria across the epithelium. Overall, these findings suggest that HIV-1 may exploit its Env glycoprotein to induce an inflammatory state in HRPE cells, which could result in impairment of HRPE monolayer integrity, allowing virus and bacteria existing in ocular fluids to cross the epithelium and penetrate the HRPE barrier. Our study highlights the role of HIV-1 in the pathogenesis of HIV/AIDS-related retinopathy and suggests potential therapeutic targets for this ocular complication.

  11. The functions of grainy head-like proteins in animals and fungi and the evolution of apical extracellular barriers.

    Directory of Open Access Journals (Sweden)

    Adam Paré

    Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.

  12. Functionally gradient materials for thermal barrier coatings in advanced gas turbine systems

    Energy Technology Data Exchange (ETDEWEB)

    Banovic, S.W.; Barmak, K.; Chan, H.M. [Lehigh Univ., Bethlehem, PA (United States)] [and others

    1995-10-01

    New designs for advanced gas turbine engines for power production are required to have higher operating temperatures in order to increase efficiency. However, elevated temperatures will increase the magnitude and severity of environmental degradation of critical turbine components (e.g. combustor parts, turbine blades, etc{hor_ellipsis}). To offset this problem, the usage of thermal barrier coatings (TBCs) has become popular by allowing an increase in maximum inlet temperatures for an operating engine. Although thermal barrier technology is over thirty years old, the principle failure mechanism is the spallation of the ceramic coating at or near the ceramic/bond coat interface. Therefore, it is desirable to develop a coating that combines the thermal barrier qualities of the ceramic layer and the corrosion protection by the metallic bond coat without the detrimental effects associated with the localization of the ceramic/metal interface to a single plane.

  13. Probabilistic migration modelling focused on functional barrier efficiency and low migration concepts in support of risk assessment.

    Science.gov (United States)

    Brandsch, Rainer

    2017-10-01

    Migration modelling provides reliable migration estimates from food-contact materials (FCM) to food or food simulants based on mass-transfer parameters like diffusion and partition coefficients related to individual materials. In most cases, mass-transfer parameters are not readily available from the literature and for this reason are estimated with a given uncertainty. Historically, uncertainty was accounted for by introducing upper limit concepts first, turning out to be of limited applicability due to highly overestimated migration results. Probabilistic migration modelling gives the possibility to consider uncertainty of the mass-transfer parameters as well as other model inputs. With respect to a functional barrier, the most important parameters among others are the diffusion properties of the functional barrier and its thickness. A software tool that accepts distribution as inputs and is capable of applying Monte Carlo methods, i.e., random sampling from the input distributions of the relevant parameters (i.e., diffusion coefficient and layer thickness), predicts migration results with related uncertainty and confidence intervals. The capabilities of probabilistic migration modelling are presented in the view of three case studies (1) sensitivity analysis, (2) functional barrier efficiency and (3) validation by experimental testing. Based on the predicted migration by probabilistic migration modelling and related exposure estimates, safety evaluation of new materials in the context of existing or new packaging concepts is possible. Identifying associated migration risk and potential safety concerns in the early stage of packaging development is possible. Furthermore, dedicated material selection exhibiting required functional barrier efficiency under application conditions becomes feasible. Validation of the migration risk assessment by probabilistic migration modelling through a minimum of dedicated experimental testing is strongly recommended.

  14. Intestinal infection with Giardia spp. reduces epithelial barrier function in a myosin light chain kinase-dependent fashion.

    Science.gov (United States)

    Scott, Kevin G-E; Meddings, Jonathon B; Kirk, David R; Lees-Miller, Susan P; Buret, André G

    2002-10-01

    Giardiasis causes malabsorptive diarrhea, and symptoms can be present in the absence of any significant morphologic injury to the intestinal mucosa. The effects of giardiasis on epithelial permeability in vivo remain unknown, and the role of T cells and myosin light chain kinase (MLCK) in altered intestinal barrier function is unclear. This study was conducted to determine whether Giardia spp. alters intestinal permeability in vivo, to assess whether these abnormalities are dependent on T cells, and to assess the role of MLCK in altered epithelial barrier function. Immunocompetent and isogenic athymic mice were inoculated with axenic Giardia muris trophozoites or sterile vehicle (control), then assessed for trophozoite colonization and gastrointestinal permeability. Mechanistic studies using nontransformed human duodenal epithelial monolayers (SCBN) determined the effects of Giardia on myosin light chain (MLC) phosphorylation, transepithelial fluorescein isothiocyanate-dextran fluxes, cytoskeletal F-actin, tight junctional zonula occludens-1 (ZO-1), and MLCK. Giardia infection caused a significant increase in small intestinal, but not gastric or colonic, permeability that correlated with trophozoite colonization in both immunocompetent and athymic mice. In vitro, Giardia increased permeability and phosphorylation of MLC and reorganized F-actin and ZO-1. These alterations were abolished with an MLCK inhibitor. Disruption of small intestinal barrier function is T cell independent, disappears on parasite clearance, and correlates with reorganization of cytoskeletal F-actin and tight junctional ZO-1 in an MLCK-dependent fashion.

  15. Chronic liver injury in mice promotes impairment of skin barrier function via tumor necrosis factor-alpha.

    Science.gov (United States)

    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya

    2016-09-01

    Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.

  16. Non-invasive assessment of barrier integrity and function of the human gut

    NARCIS (Netherlands)

    Grootjans, J.; Thuijls, G.; Verdam, F.J.; Derikx, J.P.M.; Lenaerts, K.; Buurman, W.A.

    2010-01-01

    Over the past decades evidence has been accumulating that intestinal barrier integrity loss plays a key role in the development and perpetuation of a variety of disease states including inflammatory bowel disease and celiac disease, and is a key player in the onset of sepsis and multiple organ

  17. Systems pharmacology and blood-brain barrier functionality in Parkinson's disease

    NARCIS (Netherlands)

    Ravenstijn, Paulien Gerarda Maria

    2009-01-01

    Parkinson’s disease is a progressive neurodegenerative disease, which is composed of many components, each caused by interplay of a number of genetic and nongenetic causes. As the blood-brain barrier (BBB) is a key player in the relationship between plasma and brain pharmacokinetics, the influences

  18. Amygdala-prefrontal cortex resting-state functional connectivity varies with first depressive or manic episode in bipolar disorder.

    Science.gov (United States)

    Wei, Shengnan; Geng, Haiyang; Jiang, Xiaowei; Zhou, Qian; Chang, Miao; Zhou, Yifang; Xu, Ke; Tang, Yanqing; Wang, Fei

    2017-02-22

    Bipolar disorder (BD) is one of the most complex mental illnesses, characterized by interactive depressive and manic states that are 2 contrary symptoms of disease states. The bilateral amygdala and prefrontal cortex (PFC) appear to play critical roles in BD; however, abnormalities seem to manifest differently in the 2 states and may provide further insight into underlying mechanisms. Sixteen participants with first-episode depressive and 13 participants with first-episode manic states of bipolar disorder as well as 30 healthy control (HC) participants underwent resting-state functional magnetic resonance imaging (fMRI). Resting-state functional connectivity (rsFC) between the bilateral amygdala and PFC was compared among the 3 groups. Compared with depressive state participants of the BD group, manic state participants of the BD group showed a significant decrease in rsFC between the amygdala and right orbital frontal cortex (pamygdala and left middle frontal cortex was significantly decreased in depressive and manic state participants of the BD group when compared with the HC group (pamygdala- left PFC functional connectivity might present the trait feature for BD, while deficits in amygdala- right PFC functional connectivity might be specific to manic episode, compared to depressive episode. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Knee Muscle Strength at Varying Angular Velocities and Associations with Gross Motor Function in Ambulatory Children with Cerebral Palsy

    Science.gov (United States)

    Hong, Wei-Hsien; Chen, Hseih-Ching; Shen, I-Hsuan; Chen, Chung-Yao; Chen, Chia-Ling; Chung, Chia-Ying

    2012-01-01

    The aim of this study was to evaluate the relationships of muscle strength at different angular velocities and gross motor functions in ambulatory children with cerebral palsy (CP). This study included 33 ambulatory children with spastic CP aged 6-15 years and 15 children with normal development. Children with CP were categorized into level I (n =…

  20. Pavlovian Extinction of the Discriminative Stimulus Effects of Nicotine and Ethanol in Rats Varies as a Function of Context

    Science.gov (United States)

    Troisi, Joseph R., II

    2011-01-01

    Operant extinction contingencies can undermine the discriminative stimulus effects of drugs. Here, nicotine (0.4 mg/kg) and ethanol (0.8 g/kg) first functioned as either an S[superscript D] or S[superscript Delta], in a counterbalanced one-lever go/no-go (across sessions) operant drug discrimination procedure. Pavlovian extinction in the training…

  1. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

    Science.gov (United States)

    van Smeden, Jeroen; Bouwstra, Joke A

    2016-01-01

    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  2. Neural Response to Biological Motion in Healthy Adults Varies as a Function of Autistic-Like Traits

    Directory of Open Access Journals (Sweden)

    Meghan H. Puglia

    2017-07-01

    Full Text Available Perception of biological motion is an important social cognitive ability that has been mapped to specialized brain regions. Perceptual deficits and neural differences during biological motion perception have previously been associated with autism, a disorder classified by social and communication difficulties and repetitive and restricted interests and behaviors. However, the traits associated with autism are not limited to diagnostic categories, but are normally distributed within the general population and show the same patterns of heritability across the continuum. In the current study, we investigate whether self-reported autistic-like traits in healthy adults are associated with variable neural response during passive viewing of biological motion displays. Results show that more autistic-like traits, particularly those associated with the communication domain, are associated with increased neural response in key regions involved in social cognitive processes, including prefrontal and left temporal cortices. This distinct pattern of activation might reflect differential neurodevelopmental processes for individuals with varying autistic-like traits, and highlights the importance of considering the full trait continuum in future work.

  3. Beyond the rhizosphere: growth and function of arbuscular mycorrhizal external hyphae in sands of varying pore sizes

    DEFF Research Database (Denmark)

    Drew, E.A.; Murray, R.S.; Smith, S.E.

    2003-01-01

    Research on nutrient acquisition by symbiotic arbuscular mycorrhizal (AM) fungi has mainly focused on the root fungus interface and less attention has been given to the growth and functioning of external hyphae in the bulk soil. The growth and function of external hyphae may be affected....... intraradices obtained a greater proportion of P at a distance from the host roots. Differences in P acquisition were not correlated with production of external hyphae in the four media zones and changes in sand pore size did not affect the ability of the fungi studied to acquire P at a distance from the host...... roots. Production of external hyphae in HC2 was influenced by fungal species and media treatment. Both fungi produced maximum amounts of external hyphae in the soil medium. Sand pore size affected growth of G. intraradices (but not G. mosseae) and hyphal diameter distributions of both fungi. The results...

  4. Rational Functions with a General Distribution of Poles on the Real Line Orthogonal with Respect to Varying Exponential Weights: I

    International Nuclear Information System (INIS)

    McLaughlin, K. T.-R.; Vartanian, A. H.; Zhou, X.

    2008-01-01

    Orthogonal rational functions are characterized in terms of a family of matrix Riemann-Hilbert problems on R, and a related family of energy minimisation problems is presented. Existence, uniqueness, and regularity properties of the equilibrium measures which solve the energy minimisation problems are established. These measures are used to derive a family of 'model' matrix Riemann-Hilbert problems which are amenable to asymptotic analysis via the Deift-Zhou non-linear steepest-descent method

  5. Assessing the performance of a differential evolution algorithm in structural damage detection by varying the objective function

    OpenAIRE

    Villalba-Morales, Jesús Daniel; Laier, José Elias

    2014-01-01

    Structural damage detection has become an important research topic in certain segments of the engineering community. These methodologies occasionally formulate an optimization problem by defining an objective function based on dynamic parameters, with metaheuristics used to find the solution. In this study, damage localization and quantification is performed by an Adaptive Differential Evolution algorithm, which solves the associated optimization problem. Furthermore, this paper looks at the ...

  6. The cluster index of regularly varying sequences with applications to limit theory for functions of multivariate Markov chains

    DEFF Research Database (Denmark)

    Mikosch, Thomas Valentin; Wintenberger, Olivier

    2014-01-01

    We introduce the cluster index of a multivariate stationary sequence and characterize the index in terms of the spectral tail process. This index plays a major role in limit theory for partial sums of sequences. We illustrate the use of the cluster index by characterizing infinite variance stable...... limit distributions and precise large deviation results for sums of multivariate functions acting on a stationary Markov chain under a drift condition....

  7. Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

    2008-09-29

    Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

  8. Test Plan to Assess Fire Effects on the Function of an Engineered Surface Barrier

    International Nuclear Information System (INIS)

    Ward, Anderson L.; Berlin, Gregory T.; Cammann, Jerry W.; Leary, Kevin D.; Link, Steven O.

    2008-01-01

    Wildfire is a frequent perturbation in shrub steppe ecosystems, altering the flora, fauna, atmosphere, and soil of these systems. Research on the fire effects has focused mostly on natural ecosystems with essentially no attention on engineered systems like surface barriers. The scope of the project is to use a simulated wildfire to induce changes in an engineered surface barrier and document the effects on barrier performance. The main objective is to quantify the effects of burning and the resulting post-fire conditions on alterations in soil physical properties; hydrologic response, particularly the water balance; geochemical properties; and biological properties. A secondary objective is to use the lessons learned to maximize fire protection in the design of long-term monitoring systems based on electronic sensors. A simulated wildfire will be initiated, controlled and monitored at the 200-BP-1 barrier in collaboration with the Hanford Fire Department during the fall of 2008. The north half of the barrier will be divided into nine 12 x 12 m plots, each of which will be randomly assigned a fuel load of 2 kg m-2 or 4 kg m-2. Each plot will be ignited around the perimeter and flames allowed to carry to the centre. Any remaining unburned vegetation will be manually burned off using a drip torch. Progress of the fire and its effects will be monitored using point measurements of thermal, hydrologic, and biotic variables. Three measures of fire intensity will be used to characterize fire behavior: (1) flame height, (2) the maximum temperature at three vertical profile levels, and (3) total duration of elevated temperature at these levels. Pre-burn plant information, including species diversity, plant height, and canopy diameter will be measured on shrubs from the plots to be burned and from control plots at the McGee ranch. General assessments of shrub survival, recovery, and recruitment will be made after the fire. Near-surface soil samples will be collected pre- and

  9. Deposition and characterization of plasma sprayed Ni-5A1/ magnesia stabilized zirconia based functionally graded thermal barrier coating

    International Nuclear Information System (INIS)

    Baig, M N; Khalid, F A

    2014-01-01

    Thermal barrier coatings (TBCs) are employed to protect hot section components in industrial and aerospace gas turbine engines. Conventional TBCs frequently fail due to high residual stresses and difference between coefficient of thermal expansion (CTE) of the substrate and coatings. Functionally graded thermal barrier coatings (FG-TBCs) with gradual variation in composition have been proposed to minimize the problem. In this work, a five layered functionally graded thermal barrier coating system was deposited by atmospheric plasma spray (APS) technique on Nimonic 90 substrates using Ni-5Al as bond coat (BC) and magnesia stabilized zirconia as top coat (TC). The coatings were characterized by SEM, EDS, XRD and optical profilometer. Microhardness and coefficient of thermal expansion of the five layers deposited as individual coatings were also measured. The deposited coating system was oxidized at 800°C. SEM analysis showed that five layers were successfully deposited by APS to produce a FG-TBC. The results also showed that roughness (Ra) of the individual layers decreased with an increase in TC content in the coatings. It was found that microhardness and CTE values gradually changed from bond coat to cermet layers to top coat. The oxidized coated sample revealed parabolic behavior and changes in the surface morphology and composition of coating

  10. Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat

    NARCIS (Netherlands)

    Visser, J. T. J.; Lammers, K.; Hoogendijk, A.; Boer, M. W.; Brugman, S.; Beijer-Liefers, S.; Zandvoort, A.; Harmsen, H.; Welling, G.; Stellaard, F.; Bos, N. A.; Fasano, A.; Rozing, J.

    2010-01-01

    Aims/hypothesis Impaired intestinal barrier function is observed in type I diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading

  11. Fission excitation function for 19F + 194,196,198Pt at near and above barrier energies

    Directory of Open Access Journals (Sweden)

    Singh Varinderjit

    2015-01-01

    Full Text Available Fission excitation functions for 19F + 194,196,198Pt reactions populating 213,215,217Fr compound nuclei are reported. Out of these three compound nuclei, 213Fr is a shell closed (N=126 compound nucleus and the other two are away from the shell closure. From a comparison of the experimental fission cross-sections with the statistical model predictions, it is observed that the fission cross-sections are underestimated by the statistical model predictions using shell corrected finite range rotating liquid drop model (FRLDM fission barriers. Further the FRLDM fission barriers are reduced to fit the fission cross-sections over the entire measured energy range.

  12. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    DEFF Research Database (Denmark)

    Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

    2010-01-01

    chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...

  13. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis.

    Science.gov (United States)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    2017-08-01

    Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Assessment of imputation methods using varying ecological information to fill the gaps in a tree functional trait database

    Science.gov (United States)

    Poyatos, Rafael; Sus, Oliver; Vilà-Cabrera, Albert; Vayreda, Jordi; Badiella, Llorenç; Mencuccini, Maurizio; Martínez-Vilalta, Jordi

    2016-04-01

    Plant functional traits are increasingly being used in ecosystem ecology thanks to the growing availability of large ecological databases. However, these databases usually contain a large fraction of missing data because measuring plant functional traits systematically is labour-intensive and because most databases are compilations of datasets with different sampling designs. As a result, within a given database, there is an inevitable variability in the number of traits available for each data entry and/or the species coverage in a given geographical area. The presence of missing data may severely bias trait-based analyses, such as the quantification of trait covariation or trait-environment relationships and may hamper efforts towards trait-based modelling of ecosystem biogeochemical cycles. Several data imputation (i.e. gap-filling) methods have been recently tested on compiled functional trait databases, but the performance of imputation methods applied to a functional trait database with a regular spatial sampling has not been thoroughly studied. Here, we assess the effects of data imputation on five tree functional traits (leaf biomass to sapwood area ratio, foliar nitrogen, maximum height, specific leaf area and wood density) in the Ecological and Forest Inventory of Catalonia, an extensive spatial database (covering 31900 km2). We tested the performance of species mean imputation, single imputation by the k-nearest neighbors algorithm (kNN) and a multiple imputation method, Multivariate Imputation with Chained Equations (MICE) at different levels of missing data (10%, 30%, 50%, and 80%). We also assessed the changes in imputation performance when additional predictors (species identity, climate, forest structure, spatial structure) were added in kNN and MICE imputations. We evaluated the imputed datasets using a battery of indexes describing departure from the complete dataset in trait distribution, in the mean prediction error, in the correlation matrix

  15. Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.

    Science.gov (United States)

    Draelos, Zoe D

    2005-01-01

    The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.

  16. Elastic and Viscoelastic Stresses of Nonlinear Rotating Functionally Graded Solid and Annular Disks with Gradually Varying Thickness

    Directory of Open Access Journals (Sweden)

    Allam M. N. M.

    2017-12-01

    Full Text Available Analytical and numerical nonlinear solutions for rotating variable-thickness functionally graded solid and annular disks with viscoelastic orthotropic material properties are presented by using the method of successive approximations.Variable material properties such as Young’s moduli, density and thickness of the disk, are first introduced to obtain the governing equation. As a second step, the method of successive approximations is proposed to get the nonlinear solution of the problem. In the third step, the method of effective moduli is deduced to reduce the problem to the corresponding one of a homogeneous but anisotropic material. The results of viscoelastic stresses and radial displacement are obtained for annular and solid disks of different profiles and graphically illustrated. The calculated results are compared and the effects due to many parameters are discussed.

  17. Relationships between depth and δ15N of Arctic benthos vary among regions and trophic functional groups

    Science.gov (United States)

    Stasko, Ashley D.; Bluhm, Bodil A.; Reist, James D.; Swanson, Heidi; Power, Michael

    2018-05-01

    Stable isotope ratios of nitrogen (δ15N) of benthic primary consumers are often significantly related to water depth. This relationship is commonly attributed to preferential uptake of 14N from sinking particulate organic matter (POM) by microbes, and suggests that relationships between δ15N and water depth may be affected by local POM sources and flux dynamics. We examined the relationships between δ15N and water depth (20-500 m) for six trophic functional groups using a mixed effects modelling approach, and compared relationships between two contiguous Arctic marine ecosystems with different POM sources and sinking export dynamics: the Canadian Beaufort Sea and Amundsen Gulf. We demonstrate for the first time in the Arctic that δ15N values of mobile epifaunal carnivores increased as a function of depth when considered separately from benthopelagic and infaunal carnivores, which contrarily did not exhibit increasing δ15N with depth. The δ15N of suspension/filter feeders, infaunal deposit feeders and bulk sediment also increased with water depth, and the slopes of the relationships were steeper in the Amundsen Gulf than in the Beaufort Sea. We propose that regional differences in slopes reflect differences in POM sources exported to the benthos. In the Beaufort Sea, terrestrial POM discharged from the Mackenzie River quantitatively dominates the sedimentary organic matter across the continental shelf and slope, dampening change in δ15N of benthic POM with depth. In the Amundsen Gulf, we attribute a faster rate of change in δ15N of POM with increasing depth to larger contributions of marine-derived POM to the benthic sedimentary pool, which had likely undergone extensive biological transformation in the productive offshore pelagic zone. Differences in POM input regimes among regions should be considered when comparing food webs using stable isotopes, as such differences may impact the rate at which consumer δ15N changes with depth.

  18. Subcortical BOLD responses during visual sexual stimulation vary as a function of implicit porn associations in women.

    Science.gov (United States)

    Borg, Charmaine; de Jong, Peter J; Georgiadis, Janniko R

    2014-02-01

    Lifetime experiences shape people's attitudes toward sexual stimuli. Visual sexual stimulation (VSS), for instance, may be perceived as pleasurable by some, but as disgusting or ambiguous by others. VSS depicting explicit penile-vaginal penetration (PEN) is relevant in this respect, because the act of penetration is a core sexual activity. In this study, 20 women without sexual complaints participated. We used functional magnetic resonance imaging and a single-target implicit association task to investigate how brain responses to PEN were modulated by the initial associations in memory (PEN-'hot' vs PEN-disgust) with such hardcore pornographic stimuli. Many brain areas responded to PEN in the same way they responded to disgust stimuli, and PEN-induced brain activity was prone to modulation by subjective disgust ratings toward PEN stimuli. The relative implicit PEN-disgust (relative to PEN-'hot') associations exclusively modulated PEN-induced brain responses: comparatively negative (PEN-disgust) implicit associations with pornography predicted the strongest PEN-related responses in the basal forebrain (including nucleus accumbens and bed nucleus of stria terminalis), midbrain and amygdala. Since these areas are often implicated in visual sexual processing, the present findings should be taken as a warning: apparently their involvement may also indicate a negative or ambivalent attitude toward sexual stimuli.

  19. Subcortical BOLD responses during visual sexual stimulation vary as a function of implicit porn associations in women

    Science.gov (United States)

    de Jong, Peter J.; Georgiadis, Janniko R.

    2014-01-01

    Lifetime experiences shape people’s attitudes toward sexual stimuli. Visual sexual stimulation (VSS), for instance, may be perceived as pleasurable by some, but as disgusting or ambiguous by others. VSS depicting explicit penile–vaginal penetration (PEN) is relevant in this respect, because the act of penetration is a core sexual activity. In this study, 20 women without sexual complaints participated. We used functional magnetic resonance imaging and a single-target implicit association task to investigate how brain responses to PEN were modulated by the initial associations in memory (PEN-‘hot’ vs PEN-disgust) with such hardcore pornographic stimuli. Many brain areas responded to PEN in the same way they responded to disgust stimuli, and PEN-induced brain activity was prone to modulation by subjective disgust ratings toward PEN stimuli. The relative implicit PEN-disgust (relative to PEN-‘hot’) associations exclusively modulated PEN-induced brain responses: comparatively negative (PEN-disgust) implicit associations with pornography predicted the strongest PEN-related responses in the basal forebrain (including nucleus accumbens and bed nucleus of stria terminalis), midbrain and amygdala. Since these areas are often implicated in visual sexual processing, the present findings should be taken as a warning: apparently their involvement may also indicate a negative or ambivalent attitude toward sexual stimuli. PMID:23051899

  20. Deployment of attention to emotional pictures varies as a function of externally-oriented thinking: An eye tracking investigation.

    Science.gov (United States)

    Wiebe, Alex; Kersting, Anette; Suslow, Thomas

    2017-06-01

    Alexithymia is a multidimensional personality construct including the components difficulties identifying feelings (DIF), difficulties describing feelings (DDF), and externally oriented thinking (EOT). Different features of alexithymia are thought to reflect specific deficits in the cognitive processing and regulation of emotions. The aim of the present study was to examine for the first time patterns of deployment of attention as a function of alexithymia components in healthy persons by using eye-tracking technology. It was assumed that EOT is linked to avoidance of negative images. 99 healthy adults viewed freely pictures consisting of anxiety-related, depression-related, positive, and neutral images while gaze behavior was registered. Alexithymia was assessed by the 20-Item Toronto Alexithymia Scale. Measures of anxiety, depression, and (visual-perceptual) intelligence were also administered. A main effect of emotion condition on dwell times was observed. Viewing time was lowest for neutral images, longer for depression-related and happy images, and longest for anxiety-related images. Gender and EOT had significant effects on dwell times. EOT correlated negatively with dwell time on depression-related (but not anxiety-related) images. There were no correlations of dwell times with depression, trait anxiety, intelligence, DIF, or DDF. Alexithymia was assessed exclusively by self-report. Our results show that EOT but not DIF or DDF influences attention deployment to simultaneously presented emotional pictures. EOT may reduce attention allocation to dysphoric information. This attentional characteristic of EOT individuals might have mood protecting effects but also detrimental impacts on social relationships and coping competencies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  2. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  3. Ginger Extract Suppresses Inflammatory Response and Maintains Barrier Function in Human Colonic Epithelial Caco-2 Cells Exposed to Inflammatory Mediators.

    Science.gov (United States)

    Kim, Yunyoung; Kim, Dong-Min; Kim, Ji Yeon

    2017-05-01

    The beneficial effects of ginger in the management of gastrointestinal disturbances have been reported. In this study, the anti-inflammatory potential of ginger extract was assessed in a cellular model of gut inflammation. In addition, the effects of ginger extract and its major active compounds on intestinal barrier function were evaluated. The response of Caco-2 cells following exposure to a mixture of inflammatory mediators [interleukin [IL]-1β, 25 ng/mL; lipopolysaccharides [LPS], 10 ng/mL; tumor necrosis factor [TNF]-α, 50 ng/mL; and interferon [INF]-γ, 50 ng/mL] were assessed by measuring the levels of secreted IL-6 and IL-8. In addition, the mRNA levels of cyclooxygenase-2 and inducible nitric oxide synthase were measured. Moreover, the degree of nuclear factor (NF)-κB inhibition was examined, and the intestinal barrier function was determined by measuring the transepithelial electrical resistance (TEER) and fluorescein isothiocyanate (FITC)-dextran transfer. It was observed that ginger extract and its constituents improved inflammatory responses by decreasing the levels of nitrite, PGE2, IL-6, and IL-8 via NF-κB inhibition. The ginger extract also increased the TEER and decreased the transfer of FITC-dextran from the apical side of the epithelium to the basolateral side. Taken together, these results show that ginger extract may be developed as a functional food for the maintenance of gastrointestinal health. © 2017 Institute of Food Technologists®.

  4. Altered free radical metabolism in acute mountain sickness: implications for dynamic cerebral autoregulation and blood-brain barrier function

    DEFF Research Database (Denmark)

    Bailey, D M; Evans, K A; James, P E

    2008-01-01

    We tested the hypothesis that dynamic cerebral autoregulation (CA) and blood-brain barrier (BBB) function would be compromised in acute mountain sickness (AMS) subsequent to a hypoxia-mediated alteration in systemic free radical metabolism. Eighteen male lowlanders were examined in normoxia (21% O...... developed clinical AMS (AMS+) and were more hypoxaemic relative to subjects without AMS (AMS-). A more marked increase in the venous concentration of the ascorbate radical (A(*-)), lipid hydroperoxides (LOOH) and increased susceptibility of low-density lipoprotein (LDL) to oxidation was observed during...

  5. Blood-ocular and blood-brain barrier function in streptozocin-induced diabetes in rats

    International Nuclear Information System (INIS)

    Maeepea, O.; Karlsson, C.; Alm, A.

    1984-01-01

    Edetic acid labeled with chromium 51 was injected intravenously in normal rats and in rats with streptozocin-induced diabetes. One hour after the injection the animals were killed and the concentrations of edetic acid 51Cr in vitreous body, retina, and brain were determined. No significant difference was observed between the two groups for either tissue. In a second series, a mixture of tritiated 1-glucose and aminohippuric acid tagged with carbon 14 was injected instead of edetic acid. A substantial accumulation of aminohippuric acid 14C compared with tritiated 1-glucose was observed in the vitreous body and the brain of diabetic rats in comparison with the control group. It is concluded that untreated streptozocin-induced diabetes in rats for one to two weeks will not cause a generalized increase in the permeability of the blood-ocular or the blood-brain barriers, but organic acids may accumulate in the vitreous body as well as in the brain as a consequence of reduced outward transport through these barriers

  6. Anthrax lethal toxin disrupts intestinal barrier function and causes systemic infections with enteric bacteria.

    Directory of Open Access Journals (Sweden)

    Chen Sun

    Full Text Available A variety of intestinal pathogens have virulence factors that target mitogen activated protein kinase (MAPK signaling pathways, including Bacillus anthracis. Anthrax lethal toxin (LT has specific proteolytic activity against the upstream regulators of MAPKs, the MAPK kinases (MKKs. Using a murine model of intoxication, we show that LT causes the dose-dependent disruption of intestinal epithelial integrity, characterized by mucosal erosion, ulceration, and bleeding. This pathology correlates with an LT-dependent blockade of intestinal crypt cell proliferation, accompanied by marked apoptosis in the villus tips. C57BL/6J mice treated with intravenous LT nearly uniformly develop systemic infections with commensal enteric organisms within 72 hours of administration. LT-dependent intestinal pathology depends upon its proteolytic activity and is partially attenuated by co-administration of broad spectrum antibiotics, indicating that it is both a cause and an effect of infection. These findings indicate that targeting of MAPK signaling pathways by anthrax LT compromises the structural integrity of the mucosal layer, serving to undermine the effectiveness of the intestinal barrier. Combined with the well-described immunosuppressive effects of LT, this disruption of the intestinal barrier provides a potential mechanism for host invasion via the enteric route, a common portal of entry during the natural infection cycle of Bacillus anthracis.

  7. Barrier Systems

    NARCIS (Netherlands)

    Heteren, S. van

    2015-01-01

    Barrier-system dynamics are a function of antecedent topography and substrate lithology, Relative sea-level (RSL) changes, sediment availability and type, climate, vegetation type and cover, and various aero- and hydrodynamic processes during fair-weather conditions and extreme events. Global change

  8. Pilot study of lithium to restore intestinal barrier function in severe graft-versus-host disease.

    Directory of Open Access Journals (Sweden)

    Gideon Steinbach

    Full Text Available Severe intestinal graft-vs-host disease (GVHD after allogeneic hematopoietic cell transplantation (HCT causes mucosal ulceration and induces innate and adaptive immune responses that amplify and perpetuate GVHD and the associated barrier dysfunction. Pharmacological agents to target mucosal barrier dysfunction in GVHD are needed. We hypothesized that induction of Wnt signaling by lithium, an inhibitor of glycogen synthase kinase (GSK3, would potentiate intestinal crypt proliferation and mucosal repair and that inhibition of GSK3 in inflammatory cells would attenuate the deregulated inflammatory response to mucosal injury. We conducted an observational pilot study to provide data for the potential design of a randomized study of lithium. Twenty patients with steroid refractory intestinal GVHD meeting enrollment criteria were given oral lithium carbonate. GVHD was otherwise treated per current practice, including 2 mg/kg per day of prednisone equivalent. Seventeen patients had extensive mucosal denudation (extreme endoscopic grade 3 in the duodenum or colon. We observed that 8 of 12 patients (67% had a complete remission (CR of GVHD and survived more than 1 year (median 5 years when lithium administration was started promptly within 3 days of endoscopic diagnosis of denuded mucosa. When lithium was started promptly and less than 7 days from salvage therapy for refractory GVHD, 8 of 10 patients (80% had a CR and survived more than 1 year. In perspective, a review of 1447 consecutive adult HCT patients in the preceding 6 years at our cancer center showed 0% one-year survival in 27 patients with stage 3-4 intestinal GVHD and grade 3 endoscopic appearance in the duodenum or colon. Toxicities included fatigue, somnolence, confusion or blunted affect in 50% of the patients. The favorable outcomes in patients who received prompt lithium therapy appear to support the future conduct of a randomized study of lithium for management of severe GVHD with

  9. Myosin light chain kinase knockout improves gut barrier function and confers a survival advantage in polymicrobial sepsis.

    Science.gov (United States)

    Lorentz, C Adam; Liang, Zhe; Meng, Mei; Chen, Ching-Wen; Yoseph, Benyam P; Breed, Elise R; Mittal, Rohit; Klingensmith, Nathan J; Farris, Alton B; Burd, Eileen M; Koval, Michael; Ford, Mandy L; Coopersmith, Craig M

    2017-06-07

    Sepsis-induced intestinal hyperpermeability is mediated by disruption of the epithelial tight junction, which is closely associated with the peri-junctional actin-myosin ring. Myosin light chain kinase (MLCK) phosphorylates the myosin regulatory light chain, resulting in increased permeability. The purpose of this study was to determine whether genetic deletion of MLCK would alter gut barrier function and survival from sepsis. MLCK -/- and wild type (WT) mice were subjected to cecal ligation and puncture and assayed for both survival and mechanistic studies. Survival was significantly increased in MLCK -/- mice (95% vs. 24%, p<0.0001). Intestinal permeability increased in septic WT mice compared to unmanipulated mice. In contrast, permeability in septic MLCK -/- mice was similar to that seen in unmanipulated animals. Improved gut barrier function in MLCK -/- mice was associated with increases in the tight junction mediators ZO-1 and claudin 15 without alterations in claudin 1, 2, 3, 4, 5, 7, 8, 13, occludin or JAM-A. Other components of intestinal integrity (apoptosis, proliferation and villus length) were unaffected by MLCK deletion as were local peritoneal inflammation and distant lung injury. Systemic IL-10 was decreased greater than 10-fold in MLCK -/- mice; however, survival was similar between septic MLCK -/- mice given exogenous IL-10 or vehicle. These data demonstrate that deletion of MLCK improves survival following sepsis, associated with normalization of intestinal permeability and selected tight junction proteins.

  10. A dosing algorithm for metformin based on the relationships between exposure and renal clearance of metformin in patients with varying degrees of kidney function.

    Science.gov (United States)

    Duong, Janna K; Kroonen, M Y A M; Kumar, S S; Heerspink, H L; Kirkpatrick, C M; Graham, G G; Williams, K M; Day, R O

    2017-08-01

    The aims of this study were to investigate the relationship between metformin exposure, renal clearance (CL R ), and apparent non-renal clearance of metformin (CL NR /F) in patients with varying degrees of kidney function and to develop dosing recommendations. Plasma and urine samples were collected from three studies consisting of patients with varying degrees of kidney function (creatinine clearance, CL CR ; range, 14-112 mL/min). A population pharmacokinetic model was built (NONMEM) in which the oral availability (F) was fixed to 0.55 with an estimated inter-individual variability (IIV). Simulations were performed to estimate AUC 0-τ , CL R , and CL NR /F. The data (66 patients, 327 observations) were best described by a two-compartment model, and CL CR was a covariate for CL R . Mean CL R was 17 L/h (CV 22%) and mean CL NR /F was 1.6 L/h (69%).The median recovery of metformin in urine was 49% (range 19-75%) over a dosage interval. When CL R increased due to improved renal function, AUC 0-τ decreased proportionally, while CL NR /F did not change with kidney function. Target doses (mg/day) of metformin can be reached using CL CR /3 × 100 to obtain median AUC 0-12 of 18-26 mg/L/h for metformin IR and AUC 0-24 of 38-51 mg/L/h for metformin XR, with C max  kidney function to maintain consistent drug exposure. However, there is still marked IIV and therapeutic drug monitoring of metformin plasma concentrations is recommended.

  11. Performance of Density Functional Theory Procedures for the Calculation of Proton-Exchange Barriers: Unusual Behavior of M06-Type Functionals.

    Science.gov (United States)

    Chan, Bun; Gilbert, Andrew T B; Gill, Peter M W; Radom, Leo

    2014-09-09

    We have examined the performance of a variety of density functional theory procedures for the calculation of complexation energies and proton-exchange barriers, with a focus on the Minnesota-class of functionals that are generally highly robust and generally show good accuracy. A curious observation is that M05-type and M06-type methods show an atypical decrease in calculated barriers with increasing proportion of Hartree-Fock exchange. To obtain a clearer picture of the performance of the underlying components of M05-type and M06-type functionals, we have investigated the combination of MPW-type and PBE-type exchange and B95-type and PBE-type correlation procedures. We find that, for the extensive E3 test set, the general performance of the various hybrid-DFT procedures improves in the following order: PBE1-B95 → PBE1-PBE → MPW1-PBE → PW6-B95. As M05-type and M06-type procedures are related to PBE1-B95, it would be of interest to formulate and examine the general performance of an alternative Minnesota DFT method related to PW6-B95.

  12. Ballistic transport through graphene nanostructures of velocity and potential barriers

    International Nuclear Information System (INIS)

    Krstajic, P M; Vasilopoulos, P

    2011-01-01

    We investigate the electronic properties of graphene nanostructures when the Fermi velocity and the electrostatic potential vary in space. First, we consider the transmission T and conductance G through single and double barriers. We show that G for velocity barriers differs markedly from that for potential barriers for energies below the height of the latter and it exhibits periodic oscillations as a function of the energy for strong velocity modulation. Special attention is given to superlattices (SLs). It is shown that an applied bias can efficiently widen or shrink the allowed minibands of velocity-modulated SLs. The spectrum in the Kronig-Penney limit is periodic in the strength of the barriers. Collimation of an electron beam incident on an SL with velocity and potential barriers is present but it disappears when the potential barriers are absent. The number of additional Dirac points may change considerably if barriers and wells have sufficiently different Fermi velocities.

  13. Analysis and identification of time-invariant systems, time-varying systems, and multi-delay systems using orthogonal hybrid functions theory and algorithms with Matlab

    CERN Document Server

    Deb, Anish; Sarkar, Gautam

    2016-01-01

    This book introduces a new set of orthogonal hybrid functions (HF) which approximates time functions in a piecewise linear manner which is very suitable for practical applications. The book presents an analysis of different systems namely, time-invariant system, time-varying system, multi-delay systems---both homogeneous and non-homogeneous type- and the solutions are obtained in the form of discrete samples. The book also investigates system identification problems for many of the above systems. The book is spread over 15 chapters and contains 180 black and white figures, 18 colour figures, 85 tables and 56 illustrative examples. MATLAB codes for many such examples are included at the end of the book.

  14. Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.

    Science.gov (United States)

    Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna

    2018-01-21

    Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Characterisation and functional properties of antimicrobial bio-barriers formed by natural fibres.

    Science.gov (United States)

    Tomšič, Brigita; Ilec, Eva; Žerjav, Metka; Hladnik, Aleš; Simončič, Andrej; Simončič, Barbara

    2014-10-01

    Antimicrobial bio-barriers formed on cotton (CO), silk (SE), and woollen (WO) fabrics were prepared by the application of 3-(trimethoxysilyl)-propyldimethyloctadecyl ammonium chloride (Si-QAC) at 11 concentrations ranging from 0.5% to 20% using an exhaustion method. The presence of the Si-QAC coating on the treated fabric samples was detected by X-ray photoelectron spectroscopy. The bromophenol blue reagent was used to determine the concentration of quaternary ammonium groups in the coating. The antimicrobial activity of the coated fibres against Gram-negative and Gram-positive bacteria (Escherichia coli and Staphylococcus aureus), fungi (Aspergillus niger and Chaetomium globosum), and soil microflora was assessed using standard microbiological methods. The antimicrobial protection of the fibres increased with increases in the applied concentration of Si-QAC. The fibre type strongly influenced the antimicrobial activity of Si-QAC. Si-QAC was most effective for CO fibres, less effective for WO fibres, and least effective for SE fibres, suggesting that Si-QAC is less accessible for interactions with microorganisms when applied to protein fibres than to cellulose. Although Si-QAC reduced the microbial growth, it did not significantly hinder the biodegradability or sustainability of the coated fibres when exposed to soil microflora. The extent of rotting was more influenced by the morphological and chemical properties of the fibres than by the presence of Si-QAC. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Early effects of gliadin on enterocyte intracellular signalling involved in intestinal barrier function.

    Science.gov (United States)

    Clemente, M G; De Virgiliis, S; Kang, J S; Macatagney, R; Musu, M P; Di Pierro, M R; Drago, S; Congia, M; Fasano, A

    2003-02-01

    Despite the progress made in understanding the immunological aspects of the pathogenesis of coeliac disease (CD), the early steps that allow gliadin to cross the intestinal barrier are still largely unknown. The aim of this study was to establish whether gliadin activates a zonulin dependent enterocyte intracellular signalling pathway(s) leading to increased intestinal permeability. The effect of gliadin on the enterocyte actin cytoskeleton was studied on rat intestinal epithelial (IEC-6) cell cultures by fluorescence microscopy and spectrofluorimetry. Zonulin concentration was measured on cell culture supernatants by enzyme linked immunosorbent assay. Transepithelial intestinal resistance (Rt) was measured on ex vivo intestinal tissues mounted in Ussing chambers. Incubation of cells with gliadin led to a reversible protein kinase C (PKC) mediated actin polymerisation temporarily coincident with zonulin release. A significant reduction in Rt was observed after gliadin addition on rabbit intestinal mucosa mounted in Ussing chambers. Pretreatment with the zonulin inhibitor FZI/0 abolished the gliadin induced actin polymerisation and Rt reduction but not zonulin release. Gliadin induces zonulin release in intestinal epithelial cells in vitro. Activation of the zonulin pathway by PKC mediated cytoskeleton reorganisation and tight junction opening leads to a rapid increase in intestinal permeability.

  17. Dengue Virus Infection Differentially Regulates Endothelial Barrier Function over Time through Type I Interferon Effects

    Science.gov (United States)

    Liu, Ping; Woda, Marcia; Ennis, Francis A.; Libraty, Daniel H.

    2013-01-01

    Background The morbidity and mortality resulting from dengue hemorrhagic fever (DHF) are largely caused by endothelial barrier dysfunction and a unique vascular leakage syndrome. The mechanisms that lead to the location and timing of vascular leakage in DHF are poorly understood. We hypothesized that direct viral effects on endothelial responsiveness to inflammatory and angiogenesis mediators can explain the DHF vascular leakage syndrome. Methods We used an in vitro model of human endothelium to study the combined effects of dengue virus (DENV) type 2 (DENV2) infection and inflammatory mediators on paracellular macromolecule permeability over time. Results Over the initial 72 h after infection, DENV2 suppressed tumor necrosis factor (TNF)–α–mediated hyperpermeability in human umbilical vein endothelial cell (HUVEC) monolayers. This suppressive effect was mediated by type I interferon (IFN). By 1 week, TNF-α stimulation of DENV2-infected HUVECs synergistically increased cell cycling, angiogenic changes, and macromolecule permeability. This late effect could be prevented by the addition of exogenous type I IFN. Conclusions DENV infection of primary human endothelial cells differentially modulates TNF-α–driven angiogenesis and hyperpermeability over time. Type I IFN plays a central role in this process. Our findings suggest a rational model for the DHF vascular leakage syndrome. PMID:19530939

  18. Microbial Community and Functional Structure Significantly Varied among Distinct Types of Paddy Soils But Responded Differently along Gradients of Soil Depth Layers

    Directory of Open Access Journals (Sweden)

    Ren Bai

    2017-05-01

    Full Text Available Paddy rice fields occupy broad agricultural area in China and cover diverse soil types. Microbial community in paddy soils is of great interest since many microorganisms are involved in soil functional processes. In the present study, Illumina Mi-Seq sequencing and functional gene array (GeoChip 4.2 techniques were combined to investigate soil microbial communities and functional gene patterns across the three soil types including an Inceptisol (Binhai, an Oxisol (Leizhou, and an Ultisol (Taoyuan along four profile depths (up to 70 cm in depth in mesocosm incubation columns. Detrended correspondence analysis revealed that distinctly differentiation in microbial community existed among soil types and profile depths, while the manifest variance in functional structure was only observed among soil types and two rice growth stages, but not across profile depths. Along the profile depth within each soil type, Acidobacteria, Chloroflexi, and Firmicutes increased whereas Cyanobacteria, β-proteobacteria, and Verrucomicrobia declined, suggesting their specific ecophysiological properties. Compared to bacterial community, the archaeal community showed a more contrasting pattern with the predominant groups within phyla Euryarchaeota, Thaumarchaeota, and Crenarchaeota largely varying among soil types and depths. Phylogenetic molecular ecological network (pMEN analysis further indicated that the pattern of bacterial and archaeal communities interactions changed with soil depth and the highest modularity of microbial community occurred in top soils, implying a relatively higher system resistance to environmental change compared to communities in deeper soil layers. Meanwhile, microbial communities had higher connectivity in deeper soils in comparison with upper soils, suggesting less microbial interaction in surface soils. Structure equation models were developed and the models indicated that pH was the most representative characteristics of soil type and

  19. Microbial Community and Functional Structure Significantly Varied among Distinct Types of Paddy Soils But Responded Differently along Gradients of Soil Depth Layers.

    Science.gov (United States)

    Bai, Ren; Wang, Jun-Tao; Deng, Ye; He, Ji-Zheng; Feng, Kai; Zhang, Li-Mei

    2017-01-01

    Paddy rice fields occupy broad agricultural area in China and cover diverse soil types. Microbial community in paddy soils is of great interest since many microorganisms are involved in soil functional processes. In the present study, Illumina Mi-Seq sequencing and functional gene array (GeoChip 4.2) techniques were combined to investigate soil microbial communities and functional gene patterns across the three soil types including an Inceptisol (Binhai), an Oxisol (Leizhou), and an Ultisol (Taoyuan) along four profile depths (up to 70 cm in depth) in mesocosm incubation columns. Detrended correspondence analysis revealed that distinctly differentiation in microbial community existed among soil types and profile depths, while the manifest variance in functional structure was only observed among soil types and two rice growth stages, but not across profile depths. Along the profile depth within each soil type, Acidobacteria , Chloroflexi , and Firmicutes increased whereas Cyanobacteria , β -proteobacteria , and Verrucomicrobia declined, suggesting their specific ecophysiological properties. Compared to bacterial community, the archaeal community showed a more contrasting pattern with the predominant groups within phyla Euryarchaeota , Thaumarchaeota , and Crenarchaeota largely varying among soil types and depths. Phylogenetic molecular ecological network (pMEN) analysis further indicated that the pattern of bacterial and archaeal communities interactions changed with soil depth and the highest modularity of microbial community occurred in top soils, implying a relatively higher system resistance to environmental change compared to communities in deeper soil layers. Meanwhile, microbial communities had higher connectivity in deeper soils in comparison with upper soils, suggesting less microbial interaction in surface soils. Structure equation models were developed and the models indicated that pH was the most representative characteristics of soil type and

  20. Hydrogel-forming microneedles increase in volume during swelling in skin, but skin barrier function recovery is unaffected

    Science.gov (United States)

    Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David

    2014-01-01

    We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895

  1. Potential of Lactobacillus plantarum CCFM639 in Protecting against Aluminum Toxicity Mediated by Intestinal Barrier Function and Oxidative Stress.

    Science.gov (United States)

    Yu, Leilei; Zhai, Qixiao; Tian, Fengwei; Liu, Xiaoming; Wang, Gang; Zhao, Jianxin; Zhang, Hao; Narbad, Arjan; Chen, Wei

    2016-12-02

    Aluminum (Al) is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy) were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury.

  2. Potential of Lactobacillus plantarum CCFM639 in Protecting against Aluminum Toxicity Mediated by Intestinal Barrier Function and Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Leilei Yu

    2016-12-01

    Full Text Available Aluminum (Al is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury.

  3. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro.

    Science.gov (United States)

    Buist, Harrie E; van de Sandt, Johannes J M; van Burgsteden, Johan A; de Heer, Cees

    2005-10-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of repeated exposure. The influence of repeated and single exposure to representative biocidal active substances on the skin barrier was investigated in vitro. The biocidal active substances selected were alkyldimethylbenzylammonium chloride (ADBAC), boric acid, deltamethrin, dimethyldidecylammonium chloride (DDAC), formaldehyde, permethrin, piperonyl butoxide, sodium bromide, and tebuconazole. Of these nine compounds, only the quaternary ammonium chlorides ADBAC and DDAC had a clear and consistent influence on skin permeability of the marker compounds tritiated water and [(14)C]propoxur. For these compounds, repeated exposure increased skin permeability more than single exposure. At high concentrations the difference between single and repeated exposure was quantitatively significant: repeated exposure to 300 mg/L ADBAC increased skin permeability two to threefold in comparison to single exposure. Therefore, single and repeated exposure to specific biocidal products may significantly increase skin permeability, especially when used undiluted.

  4. Multistability of memristive Cohen-Grossberg neural networks with non-monotonic piecewise linear activation functions and time-varying delays.

    Science.gov (United States)

    Nie, Xiaobing; Zheng, Wei Xing; Cao, Jinde

    2015-11-01

    The problem of coexistence and dynamical behaviors of multiple equilibrium points is addressed for a class of memristive Cohen-Grossberg neural networks with non-monotonic piecewise linear activation functions and time-varying delays. By virtue of the fixed point theorem, nonsmooth analysis theory and other analytical tools, some sufficient conditions are established to guarantee that such n-dimensional memristive Cohen-Grossberg neural networks can have 5(n) equilibrium points, among which 3(n) equilibrium points are locally exponentially stable. It is shown that greater storage capacity can be achieved by neural networks with the non-monotonic activation functions introduced herein than the ones with Mexican-hat-type activation function. In addition, unlike most existing multistability results of neural networks with monotonic activation functions, those obtained 3(n) locally stable equilibrium points are located both in saturated regions and unsaturated regions. The theoretical findings are verified by an illustrative example with computer simulations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Fabrication of High Gas Barrier Epoxy Nanocomposites: An Approach Based on Layered Silicate Functionalized by a Compatible and Reactive Modifier of Epoxy-Diamine Adduct

    Directory of Open Access Journals (Sweden)

    Ran Wei

    2018-05-01

    Full Text Available To solve the drawbacks of poor dispersion and weak interface in gas barrier nanocomposites, a novel epoxy-diamine adduct (DDA was synthesized by reacting epoxy monomer DGEBA with curing agent D400 to functionalize montmorillonite (MMT, which could provide complete compatibility and reactivity with a DGEBA/D400 epoxy matrix. Thereafter, sodium type montmorillonite (Na-MMT and organic-MMTs functionalized by DDA and polyether amines were incorporated with epoxy to manufacture nanocomposites. The effects of MMT functionalization on the morphology and gas barrier property of nanocomposites were evaluated. The results showed that DDA was successfully synthesized, terminating with epoxy and amine groups. By simulating the small-angle neutron scattering data with a sandwich structure model, the optimal dispersion/exfoliation of MMT was observed in a DDA-MMT/DGEBA nanocomposite with a mean radius of 751 Å, a layer thickness of 30.8 Å, and only two layers in each tactoid. Moreover, the DDA-MMT/DGEBA nanocomposite exhibited the best N2 barrier properties, which were about five times those of neat epoxy. Based on a modified Nielsen model, it was clarified that this excellent gas barrier property was due to the homogeneously dispersed lamellas with almost exfoliated structures. The improved morphology and barrier property confirmed the superiority of the adduct, which provides a general method for developing gas barrier nanocomposites.

  6. Varying coefficient function models to explore interactions between maternal nutritional status and prenatal methylmercury toxicity in the Seychelles Child Development Nutrition Study

    International Nuclear Information System (INIS)

    Lynch, Miranda L.; Huang, Li-Shan; Cox, Christopher; Strain, J.J.; Myers, Gary J.; Bonham, Maxine P.; Shamlaye, Conrad F.; Stokes-Riner, Abbie; Wallace, Julie M.W.; Duffy, Emeir M.; Clarkson, Thomas W.; Davidson, Philip W.

    2011-01-01

    Maternal consumption of fish during the gestational period exposes the fetus to both nutrients, especially the long-chain polyunsaturated fatty acids (LCPUFAs), believed to be beneficial for fetal brain development, as well as to the neurotoxicant methylmercury (MeHg). We recently reported that nutrients present in fish may modify MeHg neurotoxicity. Understanding the apparent interaction of MeHg exposure and nutrients present in fish is complicated by the limitations of modeling methods. In this study we fit varying coefficient function models to data from the Seychelles Child Development Nutrition Study (SCDNS) cohort to assess the association of dietary nutrients and children's development. This cohort of mother-child pairs in the Republic of Seychelles had fish consumption averaging 9 meals per week. Maternal nutritional status was assessed for five different nutritional components known to be present in fish (n-3 LCPUFA, n-6 LCPUFA, iron status, iodine status, and choline) and associated with children's neurological development. We also included prenatal MeHg exposure (measured in maternal hair). We examined two child neurodevelopmental outcomes (Bayley Scales Infant Development-II (BSID-II) Mental Developmental Index (MDI) and Psychomotor Developmental Index (PDI)), each administered at 9 and at 30 months. The varying coefficient models allow the possible interactions between each nutritional component and MeHg to be modeled as a smoothly varying function of MeHg as an effect modifier. Iron, iodine, choline, and n-6 LCPUFA had little or no observable modulation at different MeHg exposures. In contrast the n-3 LCPUFA docosahexaenoic acid (DHA) had beneficial effects on the BSID-II PDI that were reduced or absent at higher MeHg exposures. This study presents a useful modeling method that can be brought to bear on questions involving interactions between covariates, and illustrates the continuing importance of viewing fish consumption during pregnancy as a case

  7. Varying coefficient function models to explore interactions between maternal nutritional status and prenatal methylmercury toxicity in the Seychelles Child Development Nutrition Study

    Energy Technology Data Exchange (ETDEWEB)

    Lynch, Miranda L., E-mail: Miranda_Lynch@urmc.rochester.edu [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States); Huang, Li-Shan [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States); Cox, Christopher [Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Strain, J.J. [University of Ulster, Coleraine, Northern Ireland (United Kingdom); Myers, Gary J. [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States); Bonham, Maxine P. [University of Ulster, Coleraine, Northern Ireland (United Kingdom); Shamlaye, Conrad F. [Ministry of Health, Republic of Seychelles (Seychelles); Stokes-Riner, Abbie [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States); Wallace, Julie M.W.; Duffy, Emeir M. [University of Ulster, Coleraine, Northern Ireland (United Kingdom); Clarkson, Thomas W.; Davidson, Philip W. [University of Rochester School of Medicine and Dentistry, Rochester, NY 14642 (United States)

    2011-01-15

    Maternal consumption of fish during the gestational period exposes the fetus to both nutrients, especially the long-chain polyunsaturated fatty acids (LCPUFAs), believed to be beneficial for fetal brain development, as well as to the neurotoxicant methylmercury (MeHg). We recently reported that nutrients present in fish may modify MeHg neurotoxicity. Understanding the apparent interaction of MeHg exposure and nutrients present in fish is complicated by the limitations of modeling methods. In this study we fit varying coefficient function models to data from the Seychelles Child Development Nutrition Study (SCDNS) cohort to assess the association of dietary nutrients and children's development. This cohort of mother-child pairs in the Republic of Seychelles had fish consumption averaging 9 meals per week. Maternal nutritional status was assessed for five different nutritional components known to be present in fish (n-3 LCPUFA, n-6 LCPUFA, iron status, iodine status, and choline) and associated with children's neurological development. We also included prenatal MeHg exposure (measured in maternal hair). We examined two child neurodevelopmental outcomes (Bayley Scales Infant Development-II (BSID-II) Mental Developmental Index (MDI) and Psychomotor Developmental Index (PDI)), each administered at 9 and at 30 months. The varying coefficient models allow the possible interactions between each nutritional component and MeHg to be modeled as a smoothly varying function of MeHg as an effect modifier. Iron, iodine, choline, and n-6 LCPUFA had little or no observable modulation at different MeHg exposures. In contrast the n-3 LCPUFA docosahexaenoic acid (DHA) had beneficial effects on the BSID-II PDI that were reduced or absent at higher MeHg exposures. This study presents a useful modeling method that can be brought to bear on questions involving interactions between covariates, and illustrates the continuing importance of viewing fish consumption during pregnancy

  8. Permeating disciplines: Overcoming barriers between molecular simulations and classical structure-function approaches in biological ion transport.

    Science.gov (United States)

    Howard, Rebecca J; Carnevale, Vincenzo; Delemotte, Lucie; Hellmich, Ute A; Rothberg, Brad S

    2018-04-01

    Ion translocation across biological barriers is a fundamental requirement for life. In many cases, controlling this process-for example with neuroactive drugs-demands an understanding of rapid and reversible structural changes in membrane-embedded proteins, including ion channels and transporters. Classical approaches to electrophysiology and structural biology have provided valuable insights into several such proteins over macroscopic, often discontinuous scales of space and time. Integrating these observations into meaningful mechanistic models now relies increasingly on computational methods, particularly molecular dynamics simulations, while surfacing important challenges in data management and conceptual alignment. Here, we seek to provide contemporary context, concrete examples, and a look to the future for bridging disciplinary gaps in biological ion transport. This article is part of a Special Issue entitled: Beyond the Structure-Function Horizon of Membrane Proteins edited by Ute Hellmich, Rupak Doshi and Benjamin McIlwain. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Host Epithelial Interactions with Helicobacter Pylori: A Role for Disrupted Gastric Barrier Function in the Clinical Outcome of Infection?

    Directory of Open Access Journals (Sweden)

    Andre G Buret

    2005-01-01

    Full Text Available Infection of the human stomach with Helicobacter pylori may develop into gastritis, ulceration, adenocarcinoma and mucosal lymphomas. The pathogenic mechanisms that determine the clinical outcome from this microbial-epithelial interaction remain poorly understood. An increasing number of reports suggests that disruptions of epithelial barrier function may contribute to pathology and postinfectious complications in a variety of gastrointestinal infections. The aim of this review is to critically discuss the implications of H pylori persistence on gastric disease, with emphasis on the role of myosin light chain kinase, claudins and matrix metalloproteinases in gastric permeability defects, and their contribution to the development of cancer. These mechanisms and the associated signalling events may represent novel therapeutic targets to control disease processes induced by H pylori, a microbial pathogen that colonizes the stomach of over 50% of the human population.

  10. Functional nanoparticles exploit the bile acid pathway to overcome multiple barriers of the intestinal epithelium for oral insulin delivery

    DEFF Research Database (Denmark)

    Fan, Weiwei; Xia, Dengning; Zhu, Quanlei

    2018-01-01

    , especially to avoid lysosomal degradation, and basolateral release. Here, the functional material, deoxycholic acid-conjugated chitosan, is synthesized and loaded with the model protein drug insulin into deoxycholic acid-modified nanoparticles (DNPs). The DNPs designed in this study are demonstrated......Oral absorption of protein/peptide-loaded nanoparticles is often limited by multiple barriers of the intestinal epithelium. In addition to mucus translocation and apical endocytosis, highly efficient transepithelial absorption of nanoparticles requires successful intracellular trafficking...... to endolysosomal escape of DNPs. Additionally, DNPs can interact with a cytosolic ileal bile acid-binding protein that facilitates the intracellular trafficking and basolateral release of insulin. In rats, intravital two-photon microscopy also reveals that the transport of DNPs into the intestinal villi...

  11. Effects of Locally Applied Glycerol and Xylitol on the Hydration, Barrier Function and Morphological Parameters of the Skin.

    Science.gov (United States)

    Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor

    2017-02-08

    Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.

  12. Clinical effectiveness of low-power laser radiation and functioning of hemosalivatory barrier in patients with rheumatic diseases

    Science.gov (United States)

    Gladkova, Natalia D.; Karachistov, Alexander B.; Komarova, Lia G.; Alekseeva, Olga P.; Grunina, Elena A.

    1996-11-01

    We have estimated the clinical effectiveness of several regimes and ways of low power laser therapy (LT) on the basis of a double 'blind', placebo-controlling randomizing comparative test in 454 patients with rheumatic diseases (RD). LT for RD has a well-expressed placebo effect. The level of clinical effect of LT for RD is not so high. We couldn't achieve 'a considerable improvement' in any cases, 'an improvement' was secured in only 18 percent. LT should be viewed as a symptomatic means, with a primary anesthetic and feebly expressed anti-inflammatory effect, which can not influence the course of the rheumatoid process. Only in 15 percent of patients with RD, a sufficient functioning of hemo-salivary barrier was observed, the latter providing a reserve for adaption mechanism, which leads under the influence of stressor agents of medium strength not only to anesthetic, but also to moderately expressed anti- inflammatory effect.

  13. Development of a vernix caseosa substitute : a novel strategy to improve skin barrier function and repair

    NARCIS (Netherlands)

    Rißmann, Robert

    2009-01-01

    Vernix caseosa (VC) is the cheesy, white cream that covers the skin of the human fetus and the newborn. VC is a protective cream, which consists of water containing dead cells that are embedded in lipids. This natural cream is suggested to feature multiple biological functions such as facilitating

  14. Excitation functions for deuterium-induced reactions on 194Pt near the coulomb barrier

    Czech Academy of Sciences Publication Activity Database

    Kulko, A. A.; Skobelev, N. K.; Kroha, Václav; Penionzhkevich, Y. E.; Mrázek, Jaromír; Burjan, Václav; Hons, Zdeněk; Šimečková, Eva; Piskoř, Štěpán; Kugler, Andrej; Demekhina, N. A.; Sobolev, Yu. G.; Chuvilskaya, T. V.; Shirokova, K.; Kuterbekov, K.

    2012-01-01

    Roč. 9, 6-7 (2012), s. 502-507 ISSN 1547-4771 R&D Projects: GA MŠk LA08002 Institutional support: RVO:61389005 Keywords : nucelar reactions * excitation functions * charged particle activation Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders

  15. Does the disruption of horizontal anterior ciliary vessels affect the blood-aqueous barrier function?

    Science.gov (United States)

    Pan, Meihua; Yang, Mei; Xie, Renyi; Zhao, Zhimin; Huang, Xingxing

    2017-12-01

    To investigate the significance of the anterior ciliary vessels (ACVs) preservation during the conventional horizontal strabismus surgery. Patients (≥ 8 years) with horizontal strabismus were randomly allocated into group 1 (with ACV preservation) and group 2 (without ACV preservation). The surgical eyes in group 1 were further divided into group A (one rectus muscle operated) and group B (two rectus muscles operated). Similarly, eyes in group 2 were divided into group C (one rectus muscle operated) and group D (two rectus muscles operated). The success rate of ACV preservation was calculated. The anterior chamber flare measurements of each eye by laser flare photometry were recorded on the day prior to and after operation. The flare values between groups and between pre- and post-operation in each group were compared by one-way analysis of variance and a paired t-test respectively. In groups A and B, the success rate of ACV preservation was 82% (27/33) and 70% (28/40)respectively, and the flare values between pre- and post-operation showed no significant differences(4.378 ± 1.527, 4.544 ± 1.452, P = 0.526; 4.625 ± 1.090, 4.989 ± 1.468, P = 0.101 respectively). However, the postoperative values were significantly increased in group C and group D(4.661 ± 1.031, 5.039 ± 1.310, P = 0.025; 4.933 ± 1.691, 5.502 ± 1.430, P = 0.000 respectively). The postoperative flare readings of group D were significantly higher than group B, while group A and group C had no significant variation. ACV preservation probably has clinical significance in reducing the undesirable influence on the blood-aqueous barrier.

  16. Evolution of cement based materials in a repository for radioactive waste and their chemical barrier function

    International Nuclear Information System (INIS)

    Kienzler, Bernhard; Metz, Volker; Schlieker, Martina; Bohnert, Elke

    2015-01-01

    The use of cementitious materials in nuclear waste management is quite widespread. It covers the solidification of low/intermediate-level liquid as well as solid wastes (e.g. laboratory wastes) and serves as shielding. For both high-level and intermediate-low level activity repositories, cement/concrete likewise plays an important role. It is used as construction material for underground and surface disposals, but more importantly it serves as barrier or sealing material. For the requirements of waste conditioning, special cement mixtures have been developed. These include special mixtures for the solidification of evaporator concentrates, borate binding additives and for spilling solid wastes. In recent years, low-pH cements were strongly discussed especially for repository applications, e.g. (Celine CAU DIT COUMES 2008; Garcia-Sineriz, et al. 2008). Examples for relevant systems are Calcium Silicate Cements (ordinary Portland cement (OPC) based) or Calcium Aluminates Cements (CAC). Low-pH pore solutions are achieved by reduction of the portlandite content by partial substitution of OPC by mineral admixtures with high silica content. The blends follow the pozzolanic reaction consuming Ca(OH) 2 . Potential admixtures are silica fume (SF) and fly ashes (FA). In these mixtures, super plasticizers are required, consisting of polycarboxilate or naphthalene formaldehyde as well as various accelerating admixtures (Garcia-Sineriz, et al. 2008). The pH regime of concrete/cement materials may stabilize radionuclides in solution. Newly formed alteration products retain or release radionuclides. An important degradation product of celluloses in cement is iso-saccharin acid. According to Glaus 2004 (Glaus and van Loon 2004), it reacts with radionuclides forming dissolved complexes. Apart from potentially impacting radionuclide solubility limitations, concrete additives, radionuclides or other strong complexants compete for surface sites for sorbing onto cement phases. In

  17. Tranexamic Acid Attenuates The Loss of Lung Barrier Function in a Rat Model of Polytrauma And Hemorrhage With Resuscitation.

    Science.gov (United States)

    Wu, Xiaowu; Dubick, Michael A; Schwacha, Martin G; Cap, Andrew P; Darlington, Daniel N

    2017-04-01

    Severe trauma, hemorrhage, and resuscitation can lead to a trauma-related acute lung injury that involves rapid infiltration of immune cells and platelets. This infiltration involves exymatic degradation of matrix proteins, including plasmin, and causes loss of barrier function. Since tranexamic acid (TXA) inhibits plasminogen/ plasmin binding to target substrates, it may attenuate loss of barrier function after severe trauma, hemorrhage, and resuscitation. Sprague-Dawley rats were subjected to polytrauma (laparotomy, and trauma to intestines, liver, right leg skeletal muscle, and right femur fracture), then bled 40% of their blood volume. One hour after completion of polytrauma and hemorrhage, resuscitation was begun with fresh whole blood (FWB) or FWB with prior bolus administration of TXA (10 mg/kg in 0.2 mL). Polytrauma, hemorrhage, and resuscitation with FWB led to an elevation in lung water content that was significantly reduced with TXA administration. Polytrauma and hemorrhage led to rise in the number of neutrophils/monocytes and platelets in the lungs, and a rise in myeloperoxidase (MPO), neutrophil elastase and complement C5a content. While resuscitation with FWB significantly reduced the cellular infiltrate and MPO, FWB/TXA further reduced the levels of neutrophil/monocytes, neutrophil elastase, and complement C5a. Polytrauma and hemorrhage led to rise in lung plasmin activity that was significantly reduced with either FWB or FWB/TXA resuscitation. Severe trauma and hemorrhage leads to increases in lung water content, and immune cell, platelets, MPO, elastase, and C5a content in lung tissue, all markers of inflammation and acute lung injury. The addition of TXA to FWB resuscitation markedly attenuated the rise in these parameters suggesting its utility in treating acute lung injury.

  18. Effects of ambient air particulate exposure on blood-gas barrier permeability and lung function

    DEFF Research Database (Denmark)

    Bräuner, Elvira Vaclavik; Mortensen, Jann; Møller, Peter

    2009-01-01

    function and Clara cell 16 (CC16) protein release in healthy young subjects. Twenty-nine nonsmokers participated in a randomized, two-factor crossover study with or without biking exercise for 180 min and with 24-h exposure to particle-rich (6169-15,362 particles/cm(3); 7.0-11.6 microg/m(3) PM(2.5); 7...

  19. Breaking through barriers: using technology to address executive function weaknesses and improve student achievement.

    Science.gov (United States)

    Schwartz, David M

    2014-01-01

    Assistive technologies provide significant capabilities for improving student achievement. Improved accessibility, cost, and diversity of applications make integration of technology a powerful tool to compensate for executive function weaknesses and deficits and their impact on student performance, learning, and achievement. These tools can be used to compensate for decreased working memory, poor time management, poor planning and organization, poor initiation, and decreased memory. Assistive technology provides mechanisms to assist students with diverse strengths and weaknesses in mastering core curricular concepts.

  20. Dual functional MoS2/graphene interlayer as an efficient polysulfide barrier for advanced lithium-sulfur batteries

    International Nuclear Information System (INIS)

    Guo, Pengqian; Liu, Dequan; Liu, Zhengjiao; Shang, Xiaonan; Liu, Qiming; He, Deyan

    2017-01-01

    Highlights: •Dual functional MoS 2 /graphene interlayer was first used as an efficient polysulfide-trapping shield for lithium-sulfur batteries. •MoS 2 /graphene interlayer shows strong chemical interactions with LiPSs. •MoS 2 /graphene interlayer forms a 3D network to facilitate electron and ion transfer during the discharge-charge processes. •The resultant lithium-sulfur batteries exhibit a superior rate capacity and improved cycling capacity. -- Abstract: A dual functional interlayer consisted of composited two-dimensional MoS 2 and graphene has been developed as an efficient polysulfide barrier for lithium-sulfur batteries (LSBs). With such a configuration, LSBs show a superior rate capacity and improved cycling capacity. The excellent electrochemical performance can be attributed to the strong bonding interactions between the MoS 2 /graphene interlayer and the formed lithium polysulfides (LiPSs) as well as the good electrical conductivity of the MoS 2 /graphene composite. The MoS 2 /graphene interlayer can physically block LiPSs by the graphene nanosheets and chemically suppress the dissolution of LiPSs by the polar MoS 2 nanoflowers. Such a dual functional interlayer further provides a good contact with the surface of the sulfur cathode, acts as an upper current collector and greatly improves the sulfur utilization and the rate capability of LSBs.

  1. Treatment of barrier evolution: the SKB perspective

    International Nuclear Information System (INIS)

    Hedin, A.

    2002-01-01

    This paper serves as a point of departure for the discussions to be held within the Working Group of Technical Topic entitled 'Barriers and System Performances within a safety case: Their functioning and Evolution with Time'. The paper gives the SKB perspective of the issues to be discussed within the Working Group for this Topic. The following issues to be discussed by the Working Group are: What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? What is the requested or required performance versus the expected or realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? What is the issue associated with the geosphere stability for different geological systems? How is barriers and system performances as a function of time evaluated (and presented and communicated) in a safety case? What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)

  2. Varying coefficient function models to explore interactions between maternal nutritional status and prenatal methylmercury toxicity in the Seychelles Child Development Nutrition Study.

    Science.gov (United States)

    Lynch, Miranda L; Huang, Li-Shan; Cox, Christopher; Strain, J J; Myers, Gary J; Bonham, Maxine P; Shamlaye, Conrad F; Stokes-Riner, Abbie; Wallace, Julie M W; Duffy, Emeir M; Clarkson, Thomas W; Davidson, Philip W

    2011-01-01

    Maternal consumption of fish during the gestational period exposes the fetus to both nutrients, especially the long-chain polyunsaturated fatty acids (LCPUFAs), believed to be beneficial for fetal brain development, as well as to the neurotoxicant methylmercury (MeHg). We recently reported that nutrients present in fish may modify MeHg neurotoxicity. Understanding the apparent interaction of MeHg exposure and nutrients present in fish is complicated by the limitations of modeling methods. In this study we fit varying coefficient function models to data from the Seychelles Child Development Nutrition Study (SCDNS) cohort to assess the association of dietary nutrients and children's development. This cohort of mother-child pairs in the Republic of Seychelles had fish consumption averaging 9 meals per week. Maternal nutritional status was assessed for five different nutritional components known to be present in fish (n-3 LCPUFA, n-6 LCPUFA, iron status, iodine status, and choline) and associated with children's neurological development. We also included prenatal MeHg exposure (measured in maternal hair). We examined two child neurodevelopmental outcomes (Bayley Scales Infant Development-II (BSID-II) Mental Developmental Index (MDI) and Psychomotor Developmental Index (PDI)), each administered at 9 and at 30 months. The varying coefficient models allow the possible interactions between each nutritional component and MeHg to be modeled as a smoothly varying function of MeHg as an effect modifier. Iron, iodine, choline, and n-6 LCPUFA had little or no observable modulation at different MeHg exposures. In contrast the n-3 LCPUFA docosahexaenoic acid (DHA) had beneficial effects on the BSID-II PDI that were reduced or absent at higher MeHg exposures. This study presents a useful modeling method that can be brought to bear on questions involving interactions between covariates, and illustrates the continuing importance of viewing fish consumption during pregnancy as a case

  3. A method for partial volume correction of PET-imaged tumor heterogeneity using expectation maximization with a spatially varying point spread function

    International Nuclear Information System (INIS)

    Barbee, David L; Holden, James E; Nickles, Robert J; Jeraj, Robert; Flynn, Ryan T

    2010-01-01

    Tumor heterogeneities observed in positron emission tomography (PET) imaging are frequently compromised by partial volume effects which may affect treatment prognosis, assessment or future implementations such as biologically optimized treatment planning (dose painting). This paper presents a method for partial volume correction of PET-imaged heterogeneous tumors. A point source was scanned on a GE Discovery LS at positions of increasing radii from the scanner's center to obtain the spatially varying point spread function (PSF). PSF images were fit in three dimensions to Gaussian distributions using least squares optimization. Continuous expressions were devised for each Gaussian width as a function of radial distance, allowing for generation of the system PSF at any position in space. A spatially varying partial volume correction (SV-PVC) technique was developed using expectation maximization (EM) and a stopping criterion based on the method's correction matrix generated for each iteration. The SV-PVC was validated using a standard tumor phantom and a tumor heterogeneity phantom and was applied to a heterogeneous patient tumor. SV-PVC results were compared to results obtained from spatially invariant partial volume correction (SINV-PVC), which used directionally uniform three-dimensional kernels. SV-PVC of the standard tumor phantom increased the maximum observed sphere activity by 55 and 40% for 10 and 13 mm diameter spheres, respectively. Tumor heterogeneity phantom results demonstrated that as net changes in the EM correction matrix decreased below 35%, further iterations improved overall quantitative accuracy by less than 1%. SV-PVC of clinically observed tumors frequently exhibited changes of ±30% in regions of heterogeneity. The SV-PVC method implemented spatially varying kernel widths and automatically determined the number of iterations for optimal restoration, parameters which are arbitrarily chosen in SINV-PVC. Comparing SV-PVC to SINV-PVC demonstrated

  4. Modulation of ocular surface glycocalyx barrier function by a galectin-3 N-terminal deletion mutant and membrane-anchored synthetic glycopolymers.

    Directory of Open Access Journals (Sweden)

    Jerome Mauris

    Full Text Available BACKGROUND: Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. CONCLUSIONS/SIGNIFICANCE: These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery.

  5. Endothelial dysfunction and functional status of intestinal mucosal barrier in asphyxiated low birth weight infants

    Directory of Open Access Journals (Sweden)

    Huseynova S.A.

    2016-03-01

    Full Text Available Aim of study. The main prpose of present study was to determine the effect of endothelial dysfunction to the levels of markers of functional state of digestive system in infants with perinatal hypoxia. Materials and methods. The neuronal dysfunction was detected basing on the levels of NSE and NR2 antibodies. The functional state of gastrointestinal tract was estimated by IFABP, sLFABP, MUC-2, ITF, LBP. As the markers of endothelial dysfunction it was detected endotelin-1 and NO. The concentrations of markers were determined in peripheral blood of 66 preterm newborns exposure intrauterine hypoxia with 32–36 weeks of gestational age, which were classified as asphyxiated (1st group, n=30, non asphyxiated (2nd group, n=36 infants. Control group consisted of 22 healthy preterm babies. Results. It was not detected significant difference of NSE and NR2 antibodies levels between 1st and 2nd groups. The endothelin-1 concentrations significantly decreased in asphyxiated group in the background of high NO levels. The elevated level of IFABP in asphyxiated infants associated with compensative increasing of ITF and low anti endotoxine immunity. Conclusion. Endothelial dysfunction is one of the main factor resulting in hypoxic-ischemic injury of gastrointestinal tract in asphyxiated low birth weight infants.

  6. Oral and fecal Campylobacter concisus strains perturb barrier function by apoptosis induction in HT-29/B6 intestinal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Hans Linde Nielsen

    Full Text Available Campylobacter concisus infections of the gastrointestinal tract can be accompanied by diarrhea and inflammation, whereas colonization of the human oral cavity might have a commensal nature. We focus on the pathophysiology of C. concisus and the effects of different clinical oral and fecal C. concisus strains on human HT-29/B6 colon cells. Six oral and eight fecal strains of C. concisus were isolated. Mucus-producing HT-29/B6 epithelial monolayers were infected with the C. concisus strains. Transepithelial electrical resistance (R(t and tracer fluxes of different molecule size were measured in Ussing chambers. Tight junction (TJ protein expression was determined by Western blotting, and subcellular TJ distribution was analyzed by confocal laser-scanning microscopy. Apoptosis induction was examined by TUNEL-staining and Western blot of caspase-3 activation. All strains invaded confluent HT-29/B6 cells and impaired epithelial barrier function, characterized by a time- and dose-dependent decrease in R(t either after infection from the apical side but even more from the basolateral compartment. TJ protein expression changes were sparse, only in apoptotic areas of infected monolayers TJ proteins were redistributed. Solely the barrier-forming TJ protein claudin-5 showed a reduced expression level to 66±8% (P<0.05, by expression regulation from the gene. Concomitantly, Lactate dehydrogenase release was elevated to 3.1±0.3% versus 0.7±0.1% in control (P<0.001, suggesting cytotoxic effects. Furthermore, oral and fecal C. concisus strains elevated apoptotic events to 5-fold. C. concisus-infected monolayers revealed an increased permeability for 332 Da fluorescein (1.74±0.13 vs. 0.56±0.17 10(-6 cm/s in control, P<0.05 but showed no difference in permeability for 4 kDa FITC-dextran (FD-4. The same was true in camptothecin-exposed monolayers, where camptothecin was used for apoptosis induction.In conclusion, epithelial barrier dysfunction by oral and

  7. [Implementation of functional autonomy measurement system: barriers and facilitators in PISE-Dordogne project].

    Science.gov (United States)

    Gervais, Pauline; Hébert, Réjean; Lamontagne, Julie; Tousignant, Michel

    2011-12-01

    The objectives of the study were to identify the adjustments made during the implantation and the conditions favouring or limiting the SMAF utilisation. A multiqualitative quote was developed. The Functional autonomy measurement system (SMAF) was implanted in 11 French medico-social establishments. Analyses were made with the mixed type thematic method from Miles and Huberman. Principal adjustments that have been made during implantation concern the informatics assistance and clinical support. Strategic, organizational and individual factors explained adhesion level of actors and the subsequent flow of implantation. Establishment of SMAF and of the software eSMAF® in the medico-social establishments rests on a certain number of conditions which could be identified during the study. These conditions made it possible to work out structured recommendations for future implementations.

  8. Impaired barrier function by dietary fructo-oligosaccharides (FOS in rats is accompanied by increased colonic mitochondrial gene expression

    Directory of Open Access Journals (Sweden)

    Kramer Evelien

    2008-03-01

    well as three other peptide hormone genes; peptide YY, pancreatic polypeptide and cholecystokinin. Conclusion We conclude that altered energy metabolism may underly colonic barrier function disruption due to FOS feeding in rats.

  9. Acute Effects of Viral Exposure on P-Glycoprotein Function in the Mouse Fetal Blood-Brain Barrier

    Directory of Open Access Journals (Sweden)

    Enrrico Bloise

    2017-02-01

    Full Text Available Background/Aims: Viral infection during pregnancy is known to affect the fetal brain. The toll-like receptor (TLR-3 is a pattern recognition receptor activated by viruses known to elicit adverse fetal neurological outcomes. The P-glycoprotein (P-gp efflux transporter protects the developing fetus by limiting the transfer of substrates across both the placenta and the fetal blood-brain barrier (BBB. As such, inhibition of P-gp at these blood-barrier sites may result in increased exposure of the developing fetus to environmental toxins and xenobiotics present in the maternal circulation. We hypothesized that viral exposure during pregnancy would impair P-gp function in the placenta and in the developing BBB. Here we investigated whether the TLR-3 ligand, polyinosinic:polycytidylic acid (PolyI:C, increased accumulation of one P-gp substrate in the fetus and in the developing fetal brain. Methods: Pregnant C57BL/6 mice (GD15.5 were injected (i.p. with PolyI:C (5 mg/kg or 10 mg/kg or vehicle (saline. [3H]digoxin (P-gp substrate was injected (i.v. 3 or 23h post-treatment and animals were euthanized 1h later. Maternal plasma, ‘fetal-units’ (fetal membranes, amniotic fluid and whole fetus, and fetal brains were collected. Results: PolyI:C exposure (4h significantly elevated maternal plasma IL-6 (P<0.001 and increased [3H]digoxin accumulation in the fetal brain (P<0.05. In contrast, 24h after PolyI:C exposure, no effect on IL-6 or fetal brain accumulation of P-gp substrate was observed. Conclusion: Viral infection modeled by PolyI:C causes acute increases in fetal brain accumulation of P-gp substrates and by doing so, may increase fetal brain exposure to xenobiotics and environmental toxins present in the maternal circulation.

  10. SH2 domain-containing protein tyrosine phosphatase 2 and focal adhesion kinase protein interactions regulate pulmonary endothelium barrier function.

    Science.gov (United States)

    Chichger, Havovi; Braza, Julie; Duong, Huetran; Harrington, Elizabeth O

    2015-06-01

    Enhanced protein tyrosine phosphorylation is associated with changes in vascular permeability through formation and dissolution of adherens junctions and regulation of stress fiber formation. Inhibition of the protein tyrosine phosphorylase SH2 domain-containing protein tyrosine phosphatase 2 (SHP2) increases tyrosine phosphorylation of vascular endothelial cadherin and β-catenin, resulting in disruption of the endothelial monolayer and edema formation in the pulmonary endothelium. Vascular permeability is a hallmark of acute lung injury (ALI); thus, enhanced SHP2 activity offers potential therapeutic value for the pulmonary vasculature in diseases such as ALI, but this has not been characterized. To assess whether SHP2 activity mediates protection against edema in the endothelium, we assessed the effect of molecular activation of SHP2 on lung endothelial barrier function in response to the edemagenic agents LPS and thrombin. Both LPS and thrombin reduced SHP2 activity, correlated with decreased focal adhesion kinase (FAK) phosphorylation (Y(397) and Y(925)) and diminished SHP2 protein-protein associations with FAK. Overexpression of constitutively active SHP2 (SHP2(D61A)) enhanced baseline endothelial monolayer resistance and completely blocked LPS- and thrombin-induced permeability in vitro and significantly blunted pulmonary edema formation induced by either endotoxin (LPS) or Pseudomonas aeruginosa exposure in vivo. Chemical inhibition of FAK decreased SHP2 protein-protein interactions with FAK concomitant with increased permeability; however, overexpression of SHP2(D61A) rescued the endothelium and maintained FAK activity and FAK-SHP2 protein interactions. Our data suggest that SHP2 activation offers the pulmonary endothelium protection against barrier permeability mediators downstream of the FAK signaling pathway. We postulate that further studies into the promotion of SHP2 activation in the pulmonary endothelium may offer a therapeutic approach for patients

  11. Effect of ruminal acidosis and short-term low feed intake on indicators of gastrointestinal barrier function in Holstein steers.

    Science.gov (United States)

    Pederzolli, Rae-Leigh A; Van Kessel, Andrew G; Campbell, John; Hendrick, Steve; Wood, Katie M; Penner, Gregory B

    2018-02-15

    The objective of this study was to determine effect of ruminal acidosis (RA) and low feed intake [LFI] on the regional barrier function of the gastrointestinal tract. Twenty-one Holstein steers were fed for ad libitum intake for 5 d (control [CON]), fed at 25% of ad libitum intake for 5 d (LFI), or provided 2 d of ad libitum intake followed by 1-d of feed restriction (25% of ad libitum intake), 1 d where 30% of ad libitum dry matter intake (DMI) was provided as pelleted barley followed by the full allocation (RA) and fed for ad libitum intake the following day. Tissues and digesta from the rumen, omasum, duodenum, jejunum, ileum, cecum, proximal, and distal colon were collected. Permeability was assessed using the mucosal-to-serosal flux of inulin (JMS-inulin) and mannitol (JMS-mannitol). Digesta pH was 0.81, 0.63, and 0.42 pH units less for RA than CON in the rumen, cecum, and proximal colon; while, LFI had pH that was 0.47 and 0.36 pH units greater in the rumen and proximal colon compared to CON. Total ruminal short-chain fatty acid (SCFA) concentration were less for LFI (92 mM; P = 0.010) and RA (87 mM; P = 0.007) than CON (172 mM) steers. In the proximal colon, the proportion of butyrate (P = 0.025 and P = 0.022) and isobutyrate (P = 0.019 and P = 0.019) were greater, and acetate (P = 0.028 and P = 0.028) was less for LFI and RA, respectively, when compared to CON steers. Ruminal papillae length, width, perimeter, and surface area were 1.21 mm, 0.78 mm, 3.84 mm, and 11.15 mm2 less for LFI than CON; while, RA decreased papillae width by 0.52 mm relative to CON. The JMS-mannitol was less for LFI steers than CON in the proximal colon (P = 0.041) and in the distal colon (P = 0.015). Increased gene expression for claudin 1, occludin, tight-cell junction protein 1 and 2, and toll-like receptor 4 were detected for LFI relative to CON in the rumen, jejunum, and proximal colon. For RA steers, expression of toll-like receptor 4 in the rumen, and occludin and tight

  12. Can the Discrepancy between Locally and Globally Derived Neutral Hydrogen Mass Functions be Explained by a Varying Value of M ⋆?

    Science.gov (United States)

    Minchin, Robert F.

    2017-09-01

    I investigate whether it is possible to reconcile the recent Arecibo Legacy Fast Arecibo L-band Feed Array (ALFALFA) observation that the neutral hydrogen mass function (HIMF) across different galactic densities has the same, non-flat, faint-end slope, with observations of isolated galaxies and many galaxy groups that show their HIMFs to have flat faint-end slopes. I find that a fairly simple model in which the position of the knee in the mass function of each individual group is allowed to vary is able to account for both of these observations. If this model reflects reality, the ALFALFA results point to an interesting “conspiracy” whereby the differing group HIMFs always sum up to form global HIMFs with the same faint-end slope in different environments. More generally, this result implies that global environmental HIMFs do not necessarily reflect the HIMFs in individual groups belonging to that environment and cannot be used to directly measure variations in group-specific HIMFs with environment.

  13. Can the Discrepancy between Locally and Globally Derived Neutral Hydrogen Mass Functions be Explained by a Varying Value of M {sup *}?

    Energy Technology Data Exchange (ETDEWEB)

    Minchin, Robert F., E-mail: rminchin@naic.edu [Arecibo Observatory, Universities Space Research Association, HC3 Box 53995, Arecibo, PR 00612 (United States)

    2017-09-20

    I investigate whether it is possible to reconcile the recent Arecibo Legacy Fast Arecibo L-band Feed Array (ALFALFA) observation that the neutral hydrogen mass function (HIMF) across different galactic densities has the same, non-flat, faint-end slope, with observations of isolated galaxies and many galaxy groups that show their HIMFs to have flat faint-end slopes. I find that a fairly simple model in which the position of the knee in the mass function of each individual group is allowed to vary is able to account for both of these observations. If this model reflects reality, the ALFALFA results point to an interesting “conspiracy” whereby the differing group HIMFs always sum up to form global HIMFs with the same faint-end slope in different environments. More generally, this result implies that global environmental HIMFs do not necessarily reflect the HIMFs in individual groups belonging to that environment and cannot be used to directly measure variations in group-specific HIMFs with environment.

  14. Rapid and clean amine functionalization of carbon nanotubes in a dielectric barrier discharge reactor for biosensor development

    International Nuclear Information System (INIS)

    Khodadadei, Fatemeh; Ghourchian, Hedayatollah; Soltanieh, Mansour; Hosseinalipour, Mohammad; Mortazavi, Yadollah

    2014-01-01

    Multiwalled carbon nanotubes (MWCNTs) were amine-functionalized using the process of dielectric barrier discharge (DBD) plasma treatment. The scanning electron microscope micrographs and Fourier transform infra-red spectroscopy clearly demonstrated that the carbon skeleton structure of the plasma-treated MWCNTs was preserved and amine groups were coupled to MWCNTs during this process. The amine-functionalized MWCNTs were then fixed on glassy carbon (GC) electrode and glucose oxidase (GO X ) as a model enzyme was immobilized on the modified GC electrode. Direct electron transfer between the redox active center of the immobilized GO X and the plasma-treated MWCNTs was investigated through cyclic voltammetry. The well-defined, quasi-reversible redox peaks of the immobilized GO X revealed that GO X retained its activity such that it could specifically catalyze the oxidation of glucose with great efficiency. The obtained enzyme electrode was used for glucose biosensing with the linear range from 17 to 646 μM and sensitivity of 12.3 μA/mM cm 2 . Based on the signal to noise ratio of 3, the detection limit was estimated to be 9 μM. The Michaelis–Menten constant for immobilized GO X was as low as 480 μM

  15. Asymmetric Barrier Lyapunov Function-Based Wheel Slip Control for Antilock Braking System

    Directory of Open Access Journals (Sweden)

    Xiaolei Chen

    2015-01-01

    Full Text Available As an important device of the aircraft landing system, the antilock braking system (ABS has a function to avoid aircraft wheels self-locking. To deal with the strong nonlinear characteristics, complex nonlinear control schemes are applied in ABS. However, none of existing control schemes focus on the braking operating status, which directly reflects wheels self-locking degree. In this paper, the braking operating status region is divided into three regions: the healthy region, the light slip region, and the deep slip region. An ABLF-based wheel slip controller is proposed for ABS to constrain the braking system operating status in the healthy region and the light slip region. Therefore the ABS will be prevented from operating in the deep slip region. Under the proposed control scheme, self-locking is avoided completely and zero steady state error tracking of the wheel optimal slip ratio is implemented. The Hardware-In-Loop (HIL experiments have validated the effectiveness of the proposed controller.

  16. Defects in small intestinal epithelial barrier function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine.

    Science.gov (United States)

    Moeser, Adam J; Borst, Luke B; Overman, Beth L; Pittman, Jeremy S

    2012-10-01

    The objective of this study was to investigate intestinal function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine. Jejunum and distal ileum from control and pigs exhibiting PFTS was harvested at weaning, 4 and 11 days post-weaning (PW) for intestinal barrier function studies and histological analyses (n=6 pigs per group). Marked disturbances in intestinal barrier function was observed in PFTS pigs, compared with controls, indicated by lower (p<0.05) TER and increased (p<0.01) permeability to FITC dextran (4 kDa). Intestines from weaned pigs, subjected to a 4-day fast, exhibited minor disturbances in intestinal barrier function. Villus atrophy and crypt hyperplasia were observed in the PFTS intestine compared with control and fasted pigs. These data demonstrate that PFTS is associated with profound disturbances in intestinal epithelial barrier function and alterations in mucosal and epithelial morphology in which anorexia is not the sole factor. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Time-varying BRDFs.

    Science.gov (United States)

    Sun, Bo; Sunkavalli, Kalyan; Ramamoorthi, Ravi; Belhumeur, Peter N; Nayar, Shree K

    2007-01-01

    The properties of virtually all real-world materials change with time, causing their bidirectional reflectance distribution functions (BRDFs) to be time varying. However, none of the existing BRDF models and databases take time variation into consideration; they represent the appearance of a material at a single time instance. In this paper, we address the acquisition, analysis, modeling, and rendering of a wide range of time-varying BRDFs (TVBRDFs). We have developed an acquisition system that is capable of sampling a material's BRDF at multiple time instances, with each time sample acquired within 36 sec. We have used this acquisition system to measure the BRDFs of a wide range of time-varying phenomena, which include the drying of various types of paints (watercolor, spray, and oil), the drying of wet rough surfaces (cement, plaster, and fabrics), the accumulation of dusts (household and joint compound) on surfaces, and the melting of materials (chocolate). Analytic BRDF functions are fit to these measurements and the model parameters' variations with time are analyzed. Each category exhibits interesting and sometimes nonintuitive parameter trends. These parameter trends are then used to develop analytic TVBRDF models. The analytic TVBRDF models enable us to apply effects such as paint drying and dust accumulation to arbitrary surfaces and novel materials.

  18. Dietary Lactobacillus rhamnosus GG Supplementation Improves the Mucosal Barrier Function in the Intestine of Weaned Piglets Challenged by Porcine Rotavirus.

    Directory of Open Access Journals (Sweden)

    Xiangbing Mao

    Full Text Available Lactobacillus rhamnosus GG (LGG has been regarded as a safe probiotic strain. The aim of this study was to investigate whether dietary LGG supplementation could alleviate diarrhea via improving jejunal mucosal barrier function in the weaned piglets challenged by RV, and further analyze the potential roles for apoptosis of jejunal mucosal cells and intestinal microbiota. A total of 24 crossbred barrows weaned at 21 d of age were assigned randomly to 1 of 2 diets: the basal diet and LGG supplementing diet. On day 11, all pigs were orally infused RV or the sterile essential medium. RV infusion increased the diarrhea rate, increased the RV-Ab, NSP4 and IL-2 concentrations and the Bax mRNA levels of jejunal mucosa (P<0.05, decreased the villus height, villus height: crypt depth, the sIgA, IL-4 and mucin 1 concentrations and the ZO-1, occludin and Bcl-2 mRNA levels of jejunal mucosa (P<0.05, and affected the microbiota of ileum and cecum (P<0.05 in the weaned pigs. Dietary LGG supplementation increased the villus height and villus height: crypt depth, the sIgA, IL-4, mucin 1 and mucin 2 concentrations, and the ZO-1, occludin and Bcl-2 mRNA levels of the jejunal mucosa (P<0.05 reduced the Bax mRNA levels of the jejunal mucosa (P<0.05 in weaned pigs. Furthermore, dietary LGG supplementation alleviated the increase of diarrhea rate in the weaned pigs challenged by RV (P<0.05, and relieve the effect of RV infection on the villus height, crypt depth and the villus height: crypt depth of the jejunal mucosa (P<0.05, the NSP4, sIgA, IL-2, IL-4, mucin 1 and mucin 2 concentrations of jejunal mucosa (P<0.05, the ZO-1, occludin, Bax and Bcl-2 mRNA levels of the jejunal mucosa (P<0.05, and the microbiota of ileum and cecum (P<0.05 in the weaned pigs challenged by RV. These results suggest that supplementing LGG in diets alleviated the diarrhea of weaned piglets challenged by RV via inhibiting the virus multiplication and improving the jejunal mucosal barrier

  19. Barrier properties of cultured retinal pigment epithelium.

    Science.gov (United States)

    Rizzolo, Lawrence J

    2014-09-01

    The principal function of an epithelium is to form a dynamic barrier that regulates movement between body compartments. Each epithelium is specialized with barrier functions that are specific for the tissues it serves. The apical surface commonly faces a lumen, but the retinal pigment epithelium (RPE) appears to be unique by a facing solid tissue, the sensory retina. Nonetheless, there exists a thin (subretinal) space that can become fluid filled during pathology. RPE separates the subretinal space from the blood supply of the outer retina, thereby forming the outer blood-retinal barrier. The intricate interaction between the RPE and sensory retina presents challenges for learning how accurately culture models reflect native behavior. The challenge is heightened by findings that detail the variation of RPE barrier proteins both among species and at different stages of the life cycle. Among the striking differences is the expression of claudin family members. Claudins are the tight junction proteins that regulate ion diffusion across the spaces that lie between the cells of a monolayer. Claudin expression by RPE varies with species and life-stage, which implies functional differences among commonly used animal models. Investigators have turned to transcriptomics to supplement functional studies when comparing native and cultured tissue. The most detailed studies of the outer blood-retinal barrier have focused on human RPE with transcriptome and functional studies reported for human fetal, adult, and stem-cell derived RPE. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Fluoxetine and vitamin C synergistically inhibits blood-spinal cord barrier disruption and improves functional recovery after spinal cord injury.

    Science.gov (United States)

    Lee, Jee Y; Choi, Hae Y; Yune, Tae Y

    2016-10-01

    Recently we reported that fluoxetine (10 mg/kg) improves functional recovery by attenuating blood spinal cord barrier (BSCB) disruption after spinal cord injury (SCI). Here we investigated whether a low-dose of fluoxetine (1 mg/kg) and vitamin C (100 mg/kg), separately not possessing any protective effect, prevents BSCB disruption and improves functional recovery when combined. After a moderate contusion injury at T9 in rat, a low-dose of fluoxetine and vitamin C, or the combination of both was administered intraperitoneally immediately after SCI and further treated once a day for 14 d. Co-treatment with fluoxetine and vitamin C significantly attenuated BSCB permeability at 1 d after SCI. When only fluoxetine or vitamin C was treated after injury, however, there was no effect on BSCB disruption. Co-treatment with fluoxetine and vitamin C also significantly inhibited the expression and activation of MMP-9 at 8 h and 1 d after injury, respectively, and the infiltration of neutrophils (at 1 d) and macrophages (at 5 d) and the expression of inflammatory mediators (at 2 h, 6 h, 8 h or 24 h after injury) were significantly inhibited by co-treatment with fluoxetine and vitamin C. Furthermore, the combination of fluoxetine and vitamin C attenuated apoptotic cell death at 1 d and 5 d and improved locomotor function at 5 weeks after SCI. These results demonstrate the synergistic effect combination of low-dose fluoxetine and vitamin C on BSCB disruption after SCI and furthermore support the effectiveness of the combination treatment regimen for the management of acute SCI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Toll-Like Receptor 2 Activation by beta 2 -> 1-Fructans Protects Barrier Function of T84 Human Intestinal Epithelial Cells in a Chain Length-Dependent Manner

    NARCIS (Netherlands)

    Vogt, Leonie M.; Meyer, Diederick; Pullens, Gerdie; Faas, Marijke M.; Venema, Koen; Ramasamy, Uttara; Schols, Henk A.; de Vos, Paul

    Dietary fiber intake is associated with lower incidence and mortality from disease, but the underlying mechanisms of these protective effects are unclear. We hypothesized that beta 2 -> 1-fructan dietary fibers confer protection on intestinal epithelial cell barrier function via Toll-like receptor 2

  2. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; A randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; Vos, De Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm J.H.M.; Wit, De Nicole J.W.; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein

  3. Delivery of siRNA silencing P-gp in peptide-functionalized nanoparticles causes efflux modulation at the blood-brain barrier

    DEFF Research Database (Denmark)

    Gomes, Maria João; Kennedy, Patrick J; Martins, Susana

    2017-01-01

    AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...

  4. South African Teachers' Attitudes toward Learners with Barriers to Learning: Attention-Deficit and Hyperactivity Disorder and Little or No Functional Speech

    Science.gov (United States)

    Bornman, Juan; Donohue, Dana K.

    2013-01-01

    This study examined teachers' attitudes toward learners with two types of barriers to learning: a learner with attention-deficit and hyperactivity disorder (ADHD), and a learner with little or no functional speech (LNFS). The results indicated that although teachers reported that the learner with ADHD would be more disruptive in class and have a…

  5. Analysis of complete fusion excitation functions for 7Li+152Sm, 197Au and 209Bi reactions at around barrier energies

    International Nuclear Information System (INIS)

    Kharab, Rajesh; Chahal, Rajiv; Kumar, Rajiv

    2017-01-01

    In the present work we have analyzed the fusion excitation function for CF process using the simple Wong’s formula in conjunction with the energy dependent Woods-Saxon potential (EDWSP) in near barrier energy region for 7 Li+ 152 Sm, 197 Au and 209 Bi reactions

  6. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; a randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; Vos, de Paul; Boekschoten, Mark; Govers, Coen; Pieters, Harm J.H.M.; Wit, de Nicole; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein rearrangement,

  7. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; a randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; de Vos, Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm-Jan H M; de Wit, Nicole J. W.; Bron, Peter A.; Masclee, Ad A M; Troost, Freddy J

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein

  8. Information barriers

    International Nuclear Information System (INIS)

    Fuller, J.L.; Wolford, J.

    2001-01-01

    Full text: An information barrier (IB) consists of procedures and technology that prevent the release of sensitive information during a joint inspection of a sensitive nuclear item, and provides confidence that the measurement system into which it has been integrated functions exactly as designed and constructed. Work in the U.S. on radiation detection system information barriers dates back at least to 1990, even though the terminology is more recent. In January 1999 the Joint DoD-DOE Information Barrier Working Group was formed in the United States to help coordinate technical efforts related to information barrier R and D. This paper presents an overview of the efforts of this group, by its Chairs, as well as recommendations for further information barrier R and D. Progress on the demonstration of monitoring systems containing IBs is also provided. From the U.S. perspective, the basic, top-level functional requirements for the information barrier portion of an integrated radiation signature-information barrier inspection system are twofold: The host must be assured that his classified information is protected from disclosure to the inspecting party; and The inspecting party must be confident that the integrated inspection system measures, processes, and presents the radiation-signature-based measurement conclusion in an accurate and reproducible manner. It is the position of the United States that in the absence of any agreement to share classified nuclear weapons design information in the conduct of an inspection regime, the requirement to protect host country classified warhead design information is paramount and admits no tradeoff versus the confidence provided to the inspecting party in the accuracy and reproducibility of the measurements. The U.S. has reached an internal consensus on several critical design elements that define a general standard for radiation signature information barrier design. These criteria have stood the test of time under intense

  9. Effect of glutamine-enriched nutritional support on intestinal mucosal barrier function, MMP-2, MMP-9 and immune function in patients with advanced gastric cancer during perioperative chemotherapy.

    Science.gov (United States)

    Wang, Juan; Li, Yanfen; Qi, Yuanling

    2017-09-01

    We studied the effects of glutamine-enriched nutritional support on intestinal mucosal barrier, matrix metalloproteinase (MMP)-2, MMP-9 and immune function during perioperative chemotherapy in patients with advanced gastric cancer. The study was conducted on 94 patients with advanced gastric cancer admitted from April 2015 to March 2016. They were randomly divided into observation and control groups, n=47. Control group was given basic nutritional support whereas glutamine-enriched nutritional support was given to patients in observation group. High-performance liquid chromatography was used to measure lactulose and mannitol ratio in urine (L/M) and ELISA was used to measure D-lactate levels before chemotherapy and in the 1st, 2nd and 3rd cycle of chemotherapy. Immunoglobulin level was detected by immune turbidimetry assay, T lymphocyte subsets were determined by flow cytometry after 3 cycles of chemotherapy, MMP-2 and MMP-9 of patients were compared between the two groups. The serious adverse reactions incidence (grade and IV) of patients were observed. To evaluate the life quality of patients, QLQ-C30 was used after 6 months. The levels of L/M and D-lactate in both groups after the first cycle of chemotherapy were significantly higher than that before chemotherapy; they began to decline after the second or third cycle, but were still significantly higher than the levels before chemotherapy (pgroups after 1st, 2nd, 3rd cycle after chemotherapy, L/M and D-lactate levels of patients in the observation group were significantly lower than in the control group (pgroup was significantly lower than control group (pgroup were significantly higher than control group (pnutritional support can effectively protect the intestinal mucosal barrier function in patients with advanced gastric cancer in their perioperative chemotherapy, improve the level of MMP-2 and MMP-9 in patients with advanced gastric cancer, enhance their immune function, reduce the incidence of adverse

  10. EMMPRIN modulates epithelial barrier function through a MMP-mediated occludin cleavage: implications in dry eye disease.

    Science.gov (United States)

    Huet, Eric; Vallée, Benoit; Delbé, Jean; Mourah, Samia; Prulière-Escabasse, Virginie; Tremouilleres, Magali; Kadomatsu, Kenji; Doan, Serge; Baudouin, Christophe; Menashi, Suzanne; Gabison, Eric E

    2011-09-01

    Dry eye is a common disease that develops as a result of alteration of tear fluid, leading to osmotic stress and a perturbed epithelial barrier. Matrix metalloproteinase-9 (MMP-9) may be important in dry eye disease, as its genetic knockout conferred resistance to the epithelial disruption. We show that extracellular matrix metalloproteinase inducer (EMMPRIN; also termed CD147), an inducer of MMP expression, participates in the pathogenesis of dry eye through MMP-mediated cleavage of occludin, an important component of tight junctions. EMMPRIN expression was increased on the ocular surface of dry eye patients and correlated with those of MMP-9. High osmolarity in cell culture, mimicking dry eye conditions, increased both EMMPRIN and MMP-9 and resulted in the disruption of epithelial junctions through the cleavage of occludin. Exogenously added recombinant EMMPRIN had similar effects that were abrogated in the presence of the MMP inhibitor marimastat. Membrane occludin immunostaining was markedly increased in the apical corneal epithelium of both EMMPRIN and MMP-9 knock-out mice. Furthermore, an inverse correlation between EMMPRIN and occludin membrane staining was consistently observed both in vitro and in vivo as a function of corneal epithelial cells differentiation. These data suggest a possible role of EMMPRIN in regulating the amount of occludin at the cell surface in homeostasis beyond pathological situations such as dry eye disease, and EMMPRIN may be essential for the formation and maintenance of organized epithelial structure. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  11. Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

    International Nuclear Information System (INIS)

    Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae; Park, Sang Chul

    2010-01-01

    One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin α, karyopherin β, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

  12. Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Park, Sang Chul, E-mail: scpark@snu.ac.kr [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)

    2010-01-01

    One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin {alpha}, karyopherin {beta}, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

  13. Alterations in blood-brain barrier function following acute hypertension: comparison of the blood-to-brain transfer of horseradish peroxidase with that of alpha-aminisobutyric acid

    International Nuclear Information System (INIS)

    Ellison, M.D.B.

    1985-01-01

    The blood-brain barrier (BBB) selectively restricts the blood-to-brain passage of many solutes owing to unique properties of cerebrovascular endothelial cell membranes. To date, experimental study of the BBB has been accomplished primarily through the use of two different methodological approaches. Morphological studies have mostly employed large molecular weight (MW) tracers to detect morphological alterations underlying increased permeability. Physiological studies, employing smaller, more physiologic tracers have successfully described, quantitatively, certain functional aspects of blood-to-brain transfer. The current work attempts to merge these two approaches and to consider barrier function/dysfunction from both a morphological and a functional perspective. Specifically, the study compares in rats, following acute hypertension, the cerebrovascular passage of 14 C-alpha-aminoisobutyric acid (AIB) and that of horseradish peroxidase (HRP). The blood-to-brain passage of AIB and HRP were compared following acute hypertension, with regard to both the distributions of the tracer extravasation patterns and the magnitude of tracer extravasation. The results of this study suggest that traditional morphological barrier studies alone do not reveal all aspects of altered barrier status and that multiple mechanisms underlying increased BBB permeability may operate simultaneously during BBB dysfunction

  14. Influence of intestinal early enteral nutrition therapy on intestinal barrier function and immune response of patients with radiation enteritis

    International Nuclear Information System (INIS)

    Liu Guohui; Kang Xin; Chen Gong; Wang Guangyi

    2012-01-01

    Objective: To investigate the influence of early enteral nutrition therapy on the intestinal barrier function and immune response of the patients with radiation enteritis (ER) so as to find a relatively simple and effective method to treat RE. Methods: Fifty-six patients with radiation enteritis (RE) diagnosed by colonoscopy, X-rays, and pathology were randomly divided into 2 equal groups: experimental group undergoing enteral nutrition therapy, and control group undergoing conventional therapy only. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Five cases from the experimental group and 5 cases from the control group underwent second-time operation because of incomplete intestinal obstruction, intestinal stenosis, or recurrent tumor respectively. The biopsy specimens of the terminal ileum or distal descending colon taken during the first and second operations underwent pathological examination. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Results: There were no significant differences in the intestinal function and blood immunological indices between these 2 groups. The levels of DAO, D-lactic acid, and endotoxin,and the L/M ratio 11 days after admission of the experiment group were all significantly lower than those of the control group (t=2.568, 2.427, 2.143, 2.443, P<0.05), and all those indices 21 days after admission of the experiment group were all much more significantly lower in comparison with the control group (t=6.019, 12.834, 7.837, 7.997, P<0.01). The levels of IgG, IgM, and IgA, and CD4/CD8 ratio 11 days after admission of the experimental group were all significantly higher than

  15. Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat.

    Science.gov (United States)

    Visser, J T J; Lammers, K; Hoogendijk, A; Boer, M W; Brugman, S; Beijer-Liefers, S; Zandvoort, A; Harmsen, H; Welling, G; Stellaard, F; Bos, N A; Fasano, A; Rozing, J

    2010-12-01

    Impaired intestinal barrier function is observed in type 1 diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading to type 1 diabetes. Since a hydrolysed casein (HC) diet prevents autoimmune diabetes onset in diabetes-prone (DP)-BioBreeding (BB) rats, we studied the role of the HC diet on intestinal barrier function and, therefore, prevention of autoimmune diabetes onset in this animal model. DP-BB rats were fed the HC diet from weaning onwards and monitored for autoimmune diabetes development. Intestinal permeability was assessed in vivo by lactulose-mannitol test and ex vivo by measuring transepithelial electrical resistance (TEER). Levels of serum zonulin, a physiological tight junction modulator, were measured by ELISA. Ileal mRNA expression of Myo9b, Cldn1, Cldn2 and Ocln (which encode the tight junction-related proteins myosin IXb, claudin-1, claudin-2 and occludin) and Il-10, Tgf-ß (also known as Il10 and Tgfb, respectively, which encode regulatory cytokines) was analysed by quantitative PCR. The HC diet reduced autoimmune diabetes by 50% in DP-BB rats. In DP-BB rats, prediabetic gut permeability negatively correlated with the moment of autoimmune diabetes onset. The improved intestinal barrier function that was induced by HC diet in DP-BB rats was visualised by decreasing lactulose:mannitol ratio, decreasing serum zonulin levels and increasing ileal TEER. The HC diet modified ileal mRNA expression of Myo9b, and Cldn1 and Cldn2, but left Ocln expression unaltered. Improved intestinal barrier function might be an important intermediate in the prevention of autoimmune diabetes by the HC diet in DP-BB rats. Effects on tight junctions, ileal cytokines and zonulin production might be important mechanisms for this effect.

  16. The function of waste immobilization as a barrier against radionuclide release in the frame of an overall risk assessment

    International Nuclear Information System (INIS)

    Girardi, F.

    1983-01-01

    The general approach to safety assurance in disposal of radioactive waste is the 'multibarrier' or 'defence-in-depth' approach. Research has been mostly directed to characterize individual barriers in order to learn what performance may be expected from the barrier when utilized in a hypothetical safety system. The knowledge available is briefly reviewed, with special reference to ongoing activities carried out within the framework of the waste management programme of the European Communities. The interaction between different barriers in a geological disposal environment is not sufficiently well known to permit a full appreciation of the long-term behaviour of a barrier system. Examples of studies under way within the programme mentioned above are outlined briefly. On the basis of the information available, immobilization of high-level waste in borosilicate glass appears an acceptable barrier, well-integrated in the various barrier systems. Studies on the long-term properties of conditioned alpha-contaminated waste deserve a high priority in order to make a balanced evaluation of the long-term risks of the various waste types. (author)

  17. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

    2017-12-18

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  18. Probiotic-derived polyphosphate enhances the epithelial barrier function and maintains intestinal homeostasis through integrin-p38 MAPK pathway.

    Directory of Open Access Journals (Sweden)

    Shuichi Segawa

    Full Text Available Probiotics exhibit beneficial effects on human health, particularly in the maintenance of intestinal homeostasis in a complex manner notwithstanding the diversity of an intestinal flora between individuals. Thus, it is highly probable that some common molecules secreted by probiotic and/or commensal bacteria contribute to the maintenance of intestinal homeostasis and protect the intestinal epithelium from injurious stimuli. To address this question, we aimed to isolate the cytoprotective compound from a lactobacillus strain, Lactobacillus brevis SBC8803 which possess the ability to induce cytoprotective heat shock proteins in mouse small intestine. L. brevis was incubated in MRS broth and the supernatant was passed through with a 0.2-µm filter. Caco2/bbe cells were treated with the culture supernatant, and HSP27 expression was evaluated by Western blotting. HSP27-inducible components were separated by ammonium sulfate precipitation, DEAE anion exchange chromatography, gel filtration, and HPLC. Finally, we identified that the HSP27-inducible fraction was polyphosphate (poly P, a simple repeated structure of phosphates, which is a common product of lactobacilli and other bacteria associated with intestinal microflora without any definitive physiological functions. Then, poly P was synthesized by poly P-synthesizing enzyme polyphosphate kinase. The synthesized poly P significantly induced HSP27 from Caco2/BBE cells. In addition, Poly P suppressed the oxidant-induced intestinal permeability in the mouse small intestine and pharmacological inhibitors of p38 MAPK and integrins counteract its protective effect. Daily intrarectal administration of poly P (10 µg improved the inflammation grade and survival rate in 4% sodium dextran sulfate-administered mice. This study, for the first time, demonstrated that poly P is the molecule responsible for maintaining intestinal barrier actions which are mediated through the intestinal integrin β1-p38 MAPK.

  19. The SETD8/PR-Set7 Methyltransferase Functions as a Barrier to Prevent Senescence-Associated Metabolic Remodeling

    Directory of Open Access Journals (Sweden)

    Hiroshi Tanaka

    2017-02-01

    Full Text Available Summary: Cellular senescence is an irreversible growth arrest that contributes to development, tumor suppression, and age-related conditions. Senescent cells show active metabolism compared with proliferating cells, but the underlying mechanisms remain unclear. Here we show that the SETD8/PR-Set7 methyltransferase, which catalyzes mono-methylation of histone H4 at lysine 20 (H4K20me1, suppresses nucleolar and mitochondrial activities to prevent cellular senescence. SETD8 protein was selectively downregulated in both oncogene-induced and replicative senescence. Inhibition of SETD8 alone was sufficient to trigger senescence. Under these states, the expression of genes encoding ribosomal proteins (RPs and ribosomal RNAs as well as the cyclin-dependent kinase (CDK inhibitor p16INK4A was increased, with a corresponding reduction of H4K20me1 at each locus. As a result, the loss of SETD8 concurrently stimulated nucleolar function and retinoblastoma protein-mediated mitochondrial metabolism. In conclusion, our data demonstrate that SETD8 acts as a barrier to prevent cellular senescence through chromatin-mediated regulation of senescence-associated metabolic remodeling. : Tanaka et al. show that SETD8/PR-Set7 methyltransferase represses senescence-associated genes including ribosomal proteins, ribosomal RNAs, and p16INK4A by catalyzing mono-methylation of histone H4 at lysine 20. Depletion of SETD8 derepresses these genes, resulting in nucleolar and mitochondrial coactivation characteristic of senescence-associated metabolic remodeling. Keywords: SETD8/PR-Set7, H4K20 methylation, senescence-associated metabolic remodeling, nucleolus, mitochondria

  20. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2017-12-01

    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  1. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  2. Dipole moment and polarizability of impurity doped quantum dots under anisotropy, spatially-varying effective mass and dielectric screening function: Interplay with noise

    Science.gov (United States)

    Ghosh, Anuja; Ghosh, Manas

    2018-01-01

    Present work explores the profiles of polarizability (αp) and electric dipole moment (μ) of impurity doped GaAs quantum dot (QD) under the aegis of spatially-varying effective mass, spatially-varying dielectric constant and anisotropy of the system. Presence of noise has also been invoked to examine how its intervention further tunes αp and μ. Noise term maintains a Gaussian white feature and it has been incorporated to the system through two different roadways; additive and multiplicative. The various facets of influence of spatially-varying effective mass, spatially-varying dielectric constant and anisotropy on αp and μ depend quite delicately on presence/absence of noise and also on the mode through which noise has been administered. The outcomes of the study manifest viable routes to harness the dipole moment and polarizability of doped QD system through the interplay between noise, anisotropy and variable effective mass and dielectric constant of the system.

  3. Fusion barrier distributions from capture and quasi-elastic excitation functions measured in reaction 36S, 48Ca, 64Ni+238U

    International Nuclear Information System (INIS)

    Kozulin, E. M.

    2009-01-01

    The subbarrier fusion enhancement in reactions with heavy ions were explained by taking into account coupling between relative motion and intrinsic degrees of freedom of interacting nuclei. The coupling of reaction channels manifests itself in the potential barrier between interacting nuclei giving rise to a distribution of fusion barrier instead of single barrier.Capture and quasi-elastic scattering excitation functions at backward angles were measured for 3 6S , 4 8C a, 6 4N i+2 38U reactions systems at energies close and below the Coulomb barrier (i.e. when the influence of the shell effects on the fusion and characteristics of the decay of the composite system is considerable). Representations of the barrier distributions were extracted from both capture and quasi-elastic data. The experimental representations of barrier distributions were compared with coupled-channel calculations using CCFULL code. The major part of these experiments has been performed at the U-400 accelerator of the Flerov Laboratory of Nuclear Reactions (JINR, Dubna); at the TANDEM-ALPI accelerator of the LNL (INFN, Legnaro, Italy) and at the Accelerator Laboratory of University of Jyvaeskylae (JYFL, Finland) using a time-of-flight spectrometer of fission fragments CORSET (CORrelation SET-up.) The extraction of the masses and Total Kinetic Energy (TKE) of the binary reaction products is based upon the analysis of the two-body velocity In the case of the fusion-fission and quasi-fission processes, the observed peculiarities of mass and energy distributions of the fragments, the ratio between the fusion-fission and quasi-fission cross sections are determined deformations of interaction nuclei and angular momentum carried in the di-nuclear system and the shell structure of the formed fragments. In this work, the high-precision capture and quasi-elastic scattering excitation function data are presented.The influence of projectile and target excitations and nucleon transfer on fusion barrier

  4. Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.

    Science.gov (United States)

    Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W

    2013-11-01

    The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

    Science.gov (United States)

    Han, Seung Hoon; Park, Ji Woong

    2017-11-01

    The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

  6. Change of the work function and potential barrier transparency of W(100) and GaAs(110) single crystals during removing the inherent surface oxide layer

    International Nuclear Information System (INIS)

    Asalkhanov, Yu.I.; Saneev, Eh.L.

    2002-01-01

    Changes of current voltage characteristics of slow monoenergetic electron beam through the surfaces of W(100) and GaAs(100) single crystals have been measured in the process of surface oxide layers elimination. It is shown that work function is decreased and transparency coefficient of surface potential barrier is increased under increasing the temperature of vacuum annealing. Peculiarities of surface potential change under oxide layer elimination in metals and semiconductors are discussed [ru

  7. Regional increase in P-glycoprotein function in the blood-brain barrier of patients with chronic schizophrenia : A PET study with [C-11]verapamil as a probe for P-glycoprotein function

    NARCIS (Netherlands)

    de Klerk, Onno L.; Willemsen, Antoon T. M.; Bosker, Fokko J.; Bartels, Anna L.; Hendrikse, N. Harry; den Boer, Johan A.; Dierckx, Rudy A.

    2010-01-01

    P-glycoprotein (P-gp), a major efflux pump in the blood-brain barrier (BBB) has a profound effect on entry of drugs, peptides and other substances into the central nervous system (CNS). The brain's permeability can be negatively influenced by modulation of the transport function of P-gp.

  8. Creating Live Interactions to Mitigate Barriers (CLIMB): A Mobile Intervention to Improve Social Functioning in People With Chronic Psychotic Disorders

    Science.gov (United States)

    Schlosser, Danielle; Nahum, Mor

    2016-01-01

    Background Numerous psychosocial interventions for individuals with chronic psychotic disorders (CPD) have shown positive effects on social cognitive and functional outcome measures. However, access to and engagement with these interventions remains limited. This is partly because these interventions require specially trained therapists, are not available in all clinical settings, and have a high scheduling burden for participants, usually requiring a commitment of several weeks. Delivering interventions remotely via mobile devices may facilitate access, improve scheduling flexibility, and decrease participant burden, thus improving adherence to intervention requirements. To address these needs, we designed the Creating Live Interactions to Mitigate Barriers (CLIMB) digital intervention, which aims to enhance social functioning in people with CPD. CLIMB consists of two treatment components: a computerized social cognition training (SCT) program and optimized remote group therapy (ORGT). ORGT is an innovative treatment that combines remote group therapy with group texting (short message service, SMS). Objectives The objectives of this single-arm study were to investigate the feasibility of delivering 6 weeks of CLIMB to people with CPD and explore the initial effects on outcomes. Methods Participants were recruited, screened and enrolled via the Internet, and delivered assessments and interventions remotely using provided tablets (iPads). Participants were asked to complete 18 hours of SCT and to attend 6 remote group therapy sessions. To assess feasibility, adherence to study procedures, attrition rates, engagement metrics, and acceptability of the intervention were evaluated. Changes on measures of social cognition, quality of life, and symptoms were also explored. Results In total, 27 participants were enrolled over 12 months. Remote assessments were completed successfully on 96% (26/27) of the enrolled participants. Retention in the 6-week trial was 78% (21

  9. Enhanced cerebral uptake of receptor ligands by modulation of P-glycoprotein function in the blood-brain barrier

    NARCIS (Netherlands)

    Doze, P; Van Waarde, A; Elsinga, P H; Hendrikse, N H; Vaalburg, W

    Low cerebral uptake of some therapeutic drugs can be enhanced by modulation of P-glycoprotein (P-gp), an ATP-driven drug efflux pump at the blood-brain barrier (BBB). We investigated the possibility of increasing cerebral uptake of the beta-adrenergic ligands S-1'-[(18)F]-fluorocarazolol (FCAR) and

  10. Monitoring functionality and durability of the New York State Highway 30 turtle barrier and adjacent nesting substrate.

    Science.gov (United States)

    2012-08-01

    In 2008, the NYS Department of Transportation installed a wildlife barrier along NYS Route 30 in Tupper Lake, Franklin County, NY. The major objectives of the study that is the subject of this report were to: evaluate the effectiveness of the Route 3...

  11. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis

    NARCIS (Netherlands)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    Scope: Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on

  12. Chaotic correlations in barrier billiards with arbitrary barriers

    International Nuclear Information System (INIS)

    Osbaldestin, A H; Adamson, L N C

    2013-01-01

    We study autocorrelation functions in symmetric barrier billiards for golden mean trajectories with arbitrary barriers. Renormalization analysis reveals the presence of a chaotic invariant set and thus that, for a typical barrier, there are chaotic correlations. The chaotic renormalization set is the analogue of the so-called orchid that arises in a generalized Harper equation. (paper)

  13. Linking Ventilator Injury-Induced Leak across the Blood-Gas Barrier to Derangements in Murine Lung Function

    Directory of Open Access Journals (Sweden)

    Bradford J. Smith

    2017-07-01

    Full Text Available Mechanical ventilation is vital to the management of acute respiratory distress syndrome, but it frequently leads to ventilator-induced lung injury (VILI. Understanding the pathophysiological processes involved in the development of VILI is an essential prerequisite for improving lung-protective ventilation strategies. The goal of this study was to relate the amount and nature of material accumulated in the airspaces to biomarkers of injury and the derecruitment behavior of the lung in VILI. Forty-nine BALB/c mice were mechanically ventilated with combinations of tidal volume and end-expiratory pressures to produce varying degrees of overdistension and atelectasis while lung function was periodically assessed. Total protein, serum protein, and E-Cadherin levels were measured in bronchoalveolar lavage fluid (BALF. Tissue injury was assessed by histological scoring. We found that both high tidal volume and zero positive end-expiratory pressure were necessary to produce significant VILI. Increased BALF protein content was correlated with increased lung derecruitability, elevated peak pressures, and histological evidence of tissue injury. Blood derived molecules were present in the BALF in proportion to histological injury scores and epithelial injury, reflected by E-Cadherin levels in BALF. We conclude that repetitive recruitment is an important factor in the pathogenesis of VILI that exacerbates injury associated with tidal overdistension. Furthermore, the dynamic mechanical behavior of the injured lung provides a means to assess both the degree of tissue injury and the nature and amount of blood-derived fluid and proteins that accumulate in the airspaces.

  14. Alterations in Factors Involved in Differentiation and Barrier Function in the Epithelium in Oral and Genital Lichen Planus.

    Science.gov (United States)

    Danielsson, Karin; Ebrahimi, Majid; Nylander, Elisabet; Wahlin, Ylva Britt; Nylander, Karin

    2017-02-08

    Lichen planus is a chronic recurrent inflammatory disease affecting both skin and mucosa, mainly in oral and/or genital regions. Keratinocytes go through a well-regulated process of proliferation and differentiation, alterations in which may result in defects in the protective epithelial barrier. Long-term barrier impairment might lead to chronic inflammation. In order to broaden our understanding of the differentiation process in mucosal lichen planus, we mapped the expression of 4 factors known to be involved in differentiation. Biopsies were collected from oral and genital lichen planus lesions and normal controls. Altered expression of all 4 factors in epithelium from lichen planus lesions was found, clearly indicating disturbed epithelial differentiation in lichen planus lesions.

  15. Single blinded, randomized, placebo-controlled study on the effects of ciclosporin on cutaneous barrier function and immunological response in atopic beagles.

    Science.gov (United States)

    White, Amelia G; Santoro, Domenico; Ahrens, Kim; Marsella, Rosanna

    2018-03-01

    Ciclosporin (CsA) is a common treatment for canine atopic dermatitis (cAD). cAD is a very common skin disease with a multifactorial pathogenesis due to complex interactions between the host and the environment. The purpose of this study was to describe the physical and immunological effects of CsA in cAD using a canine model of AD. Fourteen beagles were enrolled; seven received CsA orally every 24 h for 28 days, and seven received placebo. All dogs were exposed to relevant allergens, house dust mite solution, one day prior to treatment and once weekly thereafter for 28 consecutive days. Canine atopic dermatitis extent and severity index-03 (CADESI-03) and skin biopsies were performed on day 0, 14, and 28. Quantitative RT-PCR was used to determine levels of cutaneous cytokines and barrier function markers. Indirect immunofluorescence was used to determine protein expression and distribution of nuclear messengers, barrier function and inflammatory [thymic stromal lymphopoietin (TSLP)] markers. The data were tested for normality and then the upaired two samples Student's t-test and the repeated measurements ANOVA, followed by the Dunnett's Multiple Comparison Test as post-hoc analysis, were performed. A P value of immunologic milieu or barrier markers despite evident improvement of physical signs in the treatment group. Although this study confirmed the usefulness of CsA for the treatment of cAD, a clear involvement of CsA on some of the currently known immunological alterations present in cAD was not determined. However, it is important to note that there was no measurable exacerbation of skin barrier dysfunction secondary to CsA administration in this model. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Energy barriers in patterned media

    NARCIS (Netherlands)

    de Vries, Jeroen

    2013-01-01

    Due to the fact that thermal activation aids in overcoming the energy barrier, the required field for reversal varies from instance to instance for the same island. This thermally induced switching field distribution can be used to determine the difference in energy barrier of magneticallyweak and

  17. The pH-sensing receptor OGR1 improves barrier function of epithelial cells and inhibits migration in an acidic environment.

    Science.gov (United States)

    de Vallière, Cheryl; Vidal, Solange; Clay, Ieuan; Jurisic, Giorgia; Tcymbarevich, Irina; Lang, Silvia; Ludwig, Marie-Gabrielle; Okoniewski, Michal; Eloranta, Jyrki J; Kullak-Ublick, Gerd A; Wagner, Carsten A; Rogler, Gerhard; Seuwen, Klaus

    2015-09-15

    The pH-sensing receptor ovarian cancer G protein-coupled receptor 1 (OGR1; GPR68) is expressed in the gut. Inflammatory bowel disease is typically associated with a decrease in local pH, which may lead to altered epithelial barrier function and subsequent gastrointestinal repair involving epithelial cell adhesion and migration. As the mechanisms underlying the response to pH changes are not well understood, we have investigated OGR1-mediated, pH-dependent signaling pathways in intestinal epithelial cells. Caco-2 cells stably overexpressing OGR1 were created and validated as tools to study OGR1 signaling. Barrier function, migration, and proliferation were measured using electric cell-substrate impedance-sensing technology. Localization of the tight junction proteins zonula occludens protein 1 and occludin and the rearrangement of cytoskeletal actin were examined by confocal microscopy. Paracellular permeability and protein and gene expression analysis using DNA microarrays were performed on filter-grown Caco-2 monolayers. We report that an acidic pH shift from pH 7.8 to 6.6 improved barrier function and stimulated reorganization of filamentous actin with prominent basal stress fiber formation. Cell migration and proliferation during in vitro wound healing were inhibited. Gene expression analysis revealed significant upregulation of genes related to cytoskeleton remodeling, cell adhesion, and growth factor signaling. We conclude that acidic extracellular pH can have a signaling function and impact the physiology of intestinal epithelial cells. The deconstruction of OGR1-dependent signaling may aid our understanding of mucosal inflammation mechanisms. Copyright © 2015 the American Physiological Society.

  18. Study on the thyroid function of thoroughbred females in varying stages of pregnancy using 'in vitro' tests /sup 125/I-T/sub 3/ and /sup 125/I-T/sub 4/

    Energy Technology Data Exchange (ETDEWEB)

    de Martin, B W [Sao Paulo Univ. (Brazil). Faculdade de Medicina Veterinaria e Zootecnia

    1975-01-01

    A study is made on the thyroid function of thoroughbred female equines, aged between five through twelve years, in varying stages of pregnancy, using 'in vitro' tests /sup 125/I.T/sub 3/ and /sup 125/I-T/sub 4/.

  19. Antenatal Corticosteroids and Postnatal Fluid Restriction Produce Differential Effects on AQP3 Expression, Water Handling, and Barrier Function in Perinatal Rat Epidermis

    Directory of Open Access Journals (Sweden)

    Johan Agren

    2010-01-01

    Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.

  20. Noncollinear Spin States for Density Functional Calculations of Open-Shell and Multi-Configurational Systems: Dissociation of MnO and NiO and Barrier Heights of O3, BeH2, and H4.

    Science.gov (United States)

    Luo, Sijie; Truhlar, Donald G

    2013-12-10

    When the spins of molecular orbitals are allowed to be aligned with different directions in space rather than being aligned collinearly, the resulting noncollinear spin orbitals add extra flexibility to variational optimization of the orbitals, and solutions obtained with collinear spin orbitals may be unstable with respect to becoming noncollinear in the expanded variational space. The goal of the present work is to explore whether and in what way the molecular orbitals of the Kohn-Sham density functional theory become noncollinear when fully optimized for multi-reference molecules, transition states, and reaction paths. (We note that a noncollinear determinant has intermediate flexibility between a collinear determinant and a linear combination of many collinear determinants with completely independent coefficients. However, the Kohn-Sham method is defined to involve the variational optimization of a single determinant, and a noncollinear determinant represents the limit of complete optimization in the Kohn-Sham scheme.) We compare the results obtained with the noncollinear Kohn-Sham (NKS) scheme to those obtained with the widely used unrestricted Kohn-Sham (UKS) scheme for two types of multi-reference systems. For the dissociation of the MnO and NiO transition metal oxides, we find UKS fails to dissociate to the ground states of neutral atoms, while NKS dissociates to the correct limit and predicts potential energy curves that vary smoothly at intermediate bond lengths. This is due to the instability of UKS solutions at large bond distances. For barrier heights of O3, BeH2, and H4, NKS is shown to stabilize the multi-reference transition states by expanding the variational space. Although the errors vary because they are closely coupled with the capability of the employed exchange-correlation functionals in treating the multi-configurational states, these findings demonstrate that results with collinear spin orbitals should be further scrutinized, and future

  1. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  2. Perinatal supplementation of 4-phenylbutyrate and glutamine attenuates endoplasmic reticulum stress and improves colonic epithelial barrier function in rats born with intrauterine growth restriction.

    Science.gov (United States)

    Désir-Vigné, Axel; Haure-Mirande, Vianney; de Coppet, Pierre; Darmaun, Dominique; Le Dréan, Gwenola; Segain, Jean-Pierre

    2018-05-01

    Intrauterine growth restriction (IUGR) can affect the structure and function of the intestinal barrier and increase digestive disease risk in adulthood. Using the rat model of maternal dietary protein restriction (8% vs. 20%), we found that the colon of IUGR offspring displayed decreased mRNA expression of epithelial barrier proteins MUC2 and occludin during development. This was associated with increased mRNA expression of endoplasmic reticulum (ER) stress marker XBP1s and increased colonic permeability measured in Ussing chambers. We hypothesized that ER stress contributes to colonic barrier alterations and that perinatal supplementation of dams with ER stress modulators, phenylbutyrate and glutamine (PG) could prevent these defects in IUGR offspring. We first demonstrated that ER stress induction by tunicamycin or thapsigargin increased the permeability of rat colonic tissues mounted in Ussing chamber and that PG treatment prevented this effect. Therefore, we supplemented the diet of control and IUGR dams with PG during gestation and lactation. Real-time polymerase chain reaction and histological analysis of colons from 120-day-old offspring revealed that perinatal PG treatment partially prevented the increased expression of ER stress markers but reversed the reduction of crypt depth and goblet cell number in IUGR rats. In dextran sodium sulfate-induced injury and recovery experiments, the colon of IUGR rats without perinatal PG treatment showed higher XBP1s mRNA levels and histological scores of inflammation than IUGR rats with perinatal PG treatment. In conclusion, these data suggest that perinatal supplementation with PG could alleviate ER stress and prevent epithelial barrier dysfunction in IUGR offspring. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Additive impairment of the barrier function and irritation by biogenic amines and sodium lauryl sulphate: a controlled in vivo tandem irritation study.

    Science.gov (United States)

    Fluhr, J W; Kelterer, D; Fuchs, S; Kaatz, M; Grieshaber, R; Kleesz, P; Elsner, P

    2005-01-01

    Biogenic amines are potential irritants e.g. in fish-, meat-, milk- and egg-processing professions like cooks, butchers and bakers. The aim of this study was to test the irritative and barrier-disrupting properties of the biogenic amines ammonium hydroxide (AM), dimethylamine (DMA) and trimethylamine (TMA). A repeated sequential irritation of 30 min twice per day was performed over a total of 4 days (tandem repeated irritation test) on the back of 20 healthy volunteers of both sexes with AM, DMA, TMA and sodium lauryl sulphate (SLS). The epidermal barrier function was assessed with a Tewameter TM 210, stratum corneum surface pH was measured with a Skin-pH-Meter 900, inflammation was assessed with a Chromameter CR-300 on the a* axis for redness and a visual score was recorded. All tested biogenic amines (AM, DMA and TMA) induced a barrier disruption and a pH increase paralleled with a 1-day-delayed onset of inflammatory signs. These effects were further enhanced and accelerated by a sequential application of SLS together with the biogenic amines, and inflammation occurred earlier than with the single compounds. Acetic acid (AA) in contrast did only show mild barrier disruption and no significant inflammatory signs. Our system allowed a ranking of the different compounds in their irritative potential in the tandem irritation with SLS: SLS > NaOH > TMA > AA > AM > DMA. The results are suggestive that in the food-processing industry the simultaneous contact with biogenic amines and harmful detergents like SLS should be minimized. Copyright 2005 S. Karger AG, Basel.

  4. Trail making test performance in youth varies as a function of anatomical coupling between the prefrontal cortex and distributed cortical regions

    Directory of Open Access Journals (Sweden)

    Nancy Raitano Lee

    2014-07-01

    Full Text Available While researchers have gained a richer understanding of the neural correlates of executive function in adulthood, much less is known about how these abilities are represented in the developing brain and what structural brain networks underlie them. Thus, the current study examined how individual differences in executive function, as measured by the Trail Making Test (TMT, relate to structural covariance in the pediatric brain. The sample included 146 unrelated, typically developing youth (80 females, ages 9-14 years, who completed a structural MRI scan of the brain and the Halstead-Reitan TMT (intermediate form. TMT scores used to index executive function included those that evaluated set-shifting ability: Trails B time (number-letter sequencing and the difference in time between Trails B and A (number sequencing only. Anatomical coupling was measured by examining correlations between mean cortical thickness (MCT across the entire cortical ribbon and individual vertex thickness measured at ~81,000 vertices. To examine how TMT scores related to anatomical coupling strength, linear regression was utilized and the interaction between age-normed TMT scores and both age and sex-normed MCT was used to predict vertex thickness. Results revealed that stronger Trails B scores were associated with greater anatomical coupling between a large swath of prefrontal cortex and the rest of cortex. For the difference between Trails B and A, a network of regions in the frontal, temporal and parietal lobes was found to be more tightly coupled with the rest of cortex in stronger performers. This study is the first to highlight the importance of structural covariance in the prediction of individual differences in executive function skills in youth. Thus, it adds to the growing literature on the neural correlates of childhood executive functions and identifies neuroanatomic coupling as a biological substrate that may contribute to executive function and dysfunction in

  5. Trail making test performance in youth varies as a function of anatomical coupling between the prefrontal cortex and distributed cortical regions

    Science.gov (United States)

    Lee, Nancy Raitano; Wallace, Gregory L.; Raznahan, Armin; Clasen, Liv S.; Giedd, Jay N.

    2014-01-01

    While researchers have gained a richer understanding of the neural correlates of executive function in adulthood, much less is known about how these abilities are represented in the developing brain and what structural brain networks underlie them. Thus, the current study examined how individual differences in executive function, as measured by the Trail Making Test (TMT), relate to structural covariance in the pediatric brain. The sample included 146 unrelated, typically developing youth (80 females), ages 9–14 years, who completed a structural MRI scan of the brain and the Halstead-Reitan TMT (intermediate form). TMT scores used to index executive function included those that evaluated set-shifting ability: Trails B time (number-letter sequencing) and the difference in time between Trails B and A (number sequencing only). Anatomical coupling was measured by examining correlations between mean cortical thickness (MCT) across the entire cortical ribbon and individual vertex thickness measured at ~81,000 vertices. To examine how TMT scores related to anatomical coupling strength, linear regression was utilized and the interaction between age-normed TMT scores and both age and sex-normed MCT was used to predict vertex thickness. Results revealed that stronger Trails B scores were associated with greater anatomical coupling between a large swath of prefrontal cortex and the rest of cortex. For the difference between Trails B and A, a network of regions in the frontal, temporal, and parietal lobes was found to be more tightly coupled with the rest of cortex in stronger performers. This study is the first to highlight the importance of structural covariance in in the prediction of individual differences in executive function skills in youth. Thus, it adds to the growing literature on the neural correlates of childhood executive functions and identifies neuroanatomic coupling as a biological substrate that may contribute to executive function and dysfunction in

  6. Acute exposure to ergot alkaloids from endophyte-infected tall fescue does not alter absorptive or barrier function of the isolated bovine ruminal epithelium.

    Science.gov (United States)

    Foote, A P; Penner, G B; Walpole, M E; Klotz, J L; Brown, K R; Bush, L P; Harmon, D L

    2014-07-01

    Ergot alkaloids in endophyte-infected (Neotyphodium coenophialum) tall fescue (Lolium arundinaceum) have been shown to cause a reduction in blood flow to the rumen epithelium as well as a decrease in volatile fatty acids (VFA) absorption from the washed rumen of steers. Previous data also indicates that incubating an extract of endophyte-infected tall fescue seed causes an increase in the amount of VFA absorbed per unit of blood flow, which could result from an alteration in the absorptive or barrier function of the rumen epithelium. An experiment was conducted to determine the acute effects of an endophyte-infected tall fescue seed extract (EXT) on total, passive or facilitated acetate and butyrate flux across the isolated bovine rumen as well as the barrier function measured by inulin flux and tissue conductance (G t ). Flux of ergovaline across the rumen epithelium was also evaluated. Rumen tissue from the caudal dorsal sac of Holstein steers (n=6), fed a common diet, was collected and isolated shortly after slaughter and mounted between two halves of Ussing chambers. In vitro treatments included vehicle control (80% methanol, 0.5% of total volume), Low EXT (50 ng ergovaline/ml) and High EXT (250 ng ergovaline/ml). Results indicate that there is no effect of acute exposure to ergot alkaloids on total, passive or facilitated flux of acetate or butyrate across the isolate bovine rumen epithelium (P>0.51). Inulin flux (P=0.16) and G t (P>0.17) were not affected by EXT treatment, indicating no alteration in barrier function due to acute ergot alkaloid exposure. Ergovaline was detected in the serosal buffer of the High EXT treatment indicating that the flux rate is ~0.25 to 0.44 ng/cm2 per hour. Data indicate that specific pathways for VFA absorption and barrier function of the rumen epithelium are not affected by acute exposure to ergot alkaloids from tall fescue at the concentrations tested. Ergovaline has the potential to be absorbed from the rumen of cattle that

  7. Evaluation of skin surface hydration state and barrier function of stratum corneum of dorsa of hands and heels treated with PROTECT X2 skin protective cream.

    Science.gov (United States)

    Kubota, Takahiro

    2012-06-01

    Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents

  8. Varying Associations Between Body Mass Index and Physical and Cognitive Function in Three Samples of Older Adults Living in Different Settings.

    Science.gov (United States)

    Kiesswetter, Eva; Schrader, Eva; Diekmann, Rebecca; Sieber, Cornel Christian; Volkert, Dorothee

    2015-10-01

    The study investigates variations in the associations between body mass index (BMI) and (a) physical and (b) cognitive function across three samples of older adults living in different settings, and moreover determines if the association between BMI and physical function is confounded by cognitive abilities. One hundred ninety-five patients of a geriatric day hospital, 322 persons receiving home care (HC), and 183 nursing home (NH) residents were examined regarding BMI, cognitive (Mini-Mental State Examination), and physical function (Barthel Index for activities of daily living). Differences in Mini-Mental State Examination and activities of daily living scores between BMI groups (Examination impairments increased from the geriatric day hospital over the HC to the NH sample, whereas prevalence rates of obesity and severe obesity (35%, 33%, 25%) decreased. In geriatric day hospital patients cognitive and physical function did not differ between BMI groups. In the HC and NH samples, cognitive abilities were highest in obese and severely obese subjects. Unadjusted mean activities of daily living scores differed between BMI groups in HC receivers (51.6±32.2, 61.8±26.1, 67.5±28.3, 72.0±23.4, 66.2±24.2, p = .002) and NH residents (35.6±28.6, 48.1±25.7, 39.9±28.7, 50.8±24.0, 57.1±28.2, p = .029). In both samples significance was lost after adjustment indicating cognitive function as dominant confounder. In older adults the associations between BMI and physical and cognitive function were dependent on the health and care status corresponding to the setting. In the HC and the NH samples, cognitive status, as measured by the Mini-Mental State Examination, emerged as an important confounder within the association between BMI and physical function. © The Author 2015. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Effect of wild-type Shigella species and attenuated Shigella vaccine candidates on small intestinal barrier function, antigen trafficking, and cytokine release.

    Directory of Open Access Journals (Sweden)

    Maria Fiorentino

    Full Text Available Bacterial dysentery due to Shigella species is a major cause of morbidity and mortality worldwide. The pathogenesis of Shigella is based on the bacteria's ability to invade and replicate within the colonic epithelium, resulting in severe intestinal inflammatory response and epithelial destruction. Although the mechanisms of pathogenesis of Shigella in the colon have been extensively studied, little is known on the effect of wild-type Shigella on the small intestine and the role of the host response in the development of the disease. Moreover, to the best of our knowledge no studies have described the effects of apically administered Shigella flexneri 2a and S. dysenteriae 1 vaccine strains on human small intestinal enterocytes. The aim of this study was to assess the coordinated functional and immunological human epithelial responses evoked by strains of Shigella and candidate vaccines on small intestinal enterocytes. To model the interactions of Shigella with the intestinal mucosa, we apically exposed monolayers of human intestinal Caco2 cells to increasing bacterial inocula. We monitored changes in paracellular permeability, examined the organization of tight-junctions and the pro-inflammatory response of epithelial cells. Shigella infection of Caco2 monolayers caused severe mucosal damage, apparent as a drastic increase in paracellular permeability and disruption of tight junctions at the cell-cell boundary. Secretion of pro-inflammatory IL-8 was independent of epithelial barrier dysfunction. Shigella vaccine strains elicited a pro-inflammatory response without affecting the intestinal barrier integrity. Our data show that wild-type Shigella infection causes a severe alteration of the barrier function of a small intestinal cell monolayer (a proxy for mucosa and might contribute (along with enterotoxins to the induction of watery diarrhea. Diarrhea may be a mechanism by which the host attempts to eliminate harmful bacteria and transport them

  10. Intestinal Barrier Function and the Gut Microbiome Are Differentially Affected in Mice Fed a Western-Style Diet or Drinking Water Supplemented with Fructose.

    Science.gov (United States)

    Volynets, Valentina; Louis, Sandrine; Pretz, Dominik; Lang, Lisa; Ostaff, Maureen J; Wehkamp, Jan; Bischoff, Stephan C

    2017-05-01

    Background: The consumption of a Western-style diet (WSD) and high fructose intake are risk factors for metabolic diseases. The underlying mechanisms are largely unclear. Objective: To unravel the mechanisms by which a WSD and fructose promote metabolic disease, we investigated their effects on the gut microbiome and barrier function. Methods: Adult female C57BL/6J mice were fed a sugar- and fat-rich WSD or control diet (CD) for 12 wk and given access to tap water or fructose-supplemented water. The microbiota was analyzed with the use of 16S rRNA gene sequencing. Barrier function was studied with the use of permeability tests, and endotoxin, mucus thickness, and gene expressions were measured. Results: The WSD increased body weight gain but not endotoxin translocation compared with the CD. In contrast, high fructose intake increased endotoxin translocation 2.6- and 3.8-fold in the groups fed the CD + fructose and WSD + fructose, respectively, compared with the CD group. The WSD + fructose treatment also induced a loss of mucus thickness in the colon (-46%) and reduced defensin expression in the ileum and colon. The lactulose:mannitol ratio in the WSD + fructose mice was 1.8-fold higher than in the CD mice. Microbiota analysis revealed that fructose, but not the WSD, increased the Firmicutes:Bacteroidetes ratio by 88% for CD + fructose and 63% for WSD + fructose compared with the CD group. Bifidobacterium abundance was greater in the WSD mice than in the CD mice (63-fold) and in the WSD + fructose mice than in the CD + fructose mice (330-fold). Conclusions: The consumption of a WSD or high fructose intake differentially affects gut permeability and the microbiome. Whether these differences are related to the distinct clinical outcomes, whereby the WSD primarily promotes weight gain and high fructose intake causes barrier dysfunction, needs to be investigated in future studies. © 2017 American Society for Nutrition.

  11. Molecular Characterization of Barrier Properties in Follicle-Associated Epithelium of Porcine Peyer's Patches Reveals Major Sealing Function of Claudin-4

    Directory of Open Access Journals (Sweden)

    Judith Radloff

    2017-08-01

    Full Text Available The pig represents a preferred model for the analysis of intestinal immunology. However, the barrier of the follicle-associated epithelium (FAE covering porcine Peyer's patches (PP has not yet been characterized in detail. This study aimed to perform this characterization in order to pave the way toward an understanding of the functional contribution of epithelial barrier properties in gut immunology. Porcine tissue specimens were taken from the distal small intestine in order to obtain electrophysiological data of PP FAE and neighboring villous epithelium (VE, employing the Ussing chamber technique. Transepithelial resistance (TER and paracellular fluorescein flux were measured, and tissues were morphometrically compared. In selfsame tissues, expression and localization of major tight junction (TJ proteins (claudin-1, -2, -3, -4, -5, and -8 were analyzed. PP FAE specimens showed a higher TER and a lower apparent permeability for sodium fluorescein than VE. Immunoblotting revealed an expression of all claudins within both epithelia, with markedly stronger expression of the sealing TJ protein claudin-4 in PP FAE compared with the neighboring VE. Immunohistochemistry confirmed the expression and localization of all claudins in both PP FAE and VE, with stronger claudin-4 abundance in PP FAE. The results are in accordance with the physiological function of the FAE, which strongly regulates and limits antigen uptake determining a mandatory transcellular route for antigen presentation, highlighting the importance of this structure for the first steps of the intestinal immune response. Thus, this study provides detailed insights into the specific barrier properties of the porcine FAE covering intestinal PP, at the interface of intestinal immunology and barriology.

  12. Fine-scale genetic mapping of a hybrid sterility factor between Drosophila simulans and D. mauritiana: the varied and elusive functions of "speciation genes"

    Directory of Open Access Journals (Sweden)

    Lemos Bernardo

    2010-12-01

    Full Text Available Abstract Background Hybrid male sterility (HMS is a usual outcome of hybridization between closely related animal species. It arises because interactions between alleles that are functional within one species may be disrupted in hybrids. The identification of genes leading to hybrid sterility is of great interest for understanding the evolutionary process of speciation. In the current work we used marked P-element insertions as dominant markers to efficiently locate one genetic factor causing a severe reduction in fertility in hybrid males of Drosophila simulans and D. mauritiana. Results Our mapping effort identified a region of 9 kb on chromosome 3, containing three complete and one partial coding sequences. Within this region, two annotated genes are suggested as candidates for the HMS factor, based on the comparative molecular characterization and public-source information. Gene Taf1 is partially contained in the region, but yet shows high polymorphism with four fixed non-synonymous substitutions between the two species. Its molecular functions involve sequence-specific DNA binding and transcription factor activity. Gene agt is a small, intronless gene, whose molecular function is annotated as methylated-DNA-protein-cysteine S-methyltransferase activity. High polymorphism and one fixed non-synonymous substitution suggest this is a fast evolving gene. The gene trees of both genes perfectly separate D. simulans and D. mauritiana into monophyletic groups. Analysis of gene expression using microarray revealed trends that were similar to those previously found in comparisons between whole-genome hybrids and parental species. Conclusions The identification following confirmation of the HMS candidate gene will add another case study leading to understanding the evolutionary process of hybrid incompatibility.

  13. Function of SSA subfamily of Hsp70 within and across species varies widely in complementing Saccharomyces cerevisiae cell growth and prion propagation.

    Directory of Open Access Journals (Sweden)

    Deepak Sharma

    2009-08-01

    Full Text Available The cytosol of most eukaryotic cells contains multiple highly conserved Hsp70 orthologs that differ mainly by their spatio-temporal expression patterns. Hsp70s play essential roles in protein folding, transport or degradation, and are major players of cellular quality control processes. However, while several reports suggest that specialized functions of Hsp70 orthologs were selected through evolution, few studies addressed systematically this issue.We compared the ability of Ssa1p-Ssa4p from Saccharomyces cerevisiae and Ssa5p-Ssa8p from the evolutionary distant yeast Yarrowia lipolytica to perform Hsp70-dependent tasks when expressed as the sole Hsp70 for S. cerevisiae in vivo. We show that Hsp70 isoforms (i supported yeast viability yet with markedly different growth rates, (ii influenced the propagation and stability of the [PSI(+] and [URE3] prions, but iii did not significantly affect the proteasomal degradation rate of CFTR. Additionally, we show that individual Hsp70 orthologs did not induce the formation of different prion strains, but rather influenced the aggregation properties of Sup35 in vivo. Finally, we show that [URE3] curing by the overexpression of Ydj1p is Hsp70-isoform dependent.Despite very high homology and overlapping functions, the different Hsp70 orthologs have evolved to possess distinct activities that are required to cope with different types of substrates or stress situations. Yeast prions provide a very sensitive model to uncover this functional specialization and to explore the intricate network of chaperone/co-chaperone/substrates interactions.

  14. Fine-scale genetic mapping of a hybrid sterility factor between Drosophila simulans and D. mauritiana: the varied and elusive functions of "speciation genes".

    Science.gov (United States)

    Araripe, Luciana O; Montenegro, Horácio; Lemos, Bernardo; Hartl, Daniel L

    2010-12-14

    Hybrid male sterility (HMS) is a usual outcome of hybridization between closely related animal species. It arises because interactions between alleles that are functional within one species may be disrupted in hybrids. The identification of genes leading to hybrid sterility is of great interest for understanding the evolutionary process of speciation. In the current work we used marked P-element insertions as dominant markers to efficiently locate one genetic factor causing a severe reduction in fertility in hybrid males of Drosophila simulans and D. mauritiana. Our mapping effort identified a region of 9 kb on chromosome 3, containing three complete and one partial coding sequences. Within this region, two annotated genes are suggested as candidates for the HMS factor, based on the comparative molecular characterization and public-source information. Gene Taf1 is partially contained in the region, but yet shows high polymorphism with four fixed non-synonymous substitutions between the two species. Its molecular functions involve sequence-specific DNA binding and transcription factor activity. Gene agt is a small, intronless gene, whose molecular function is annotated as methylated-DNA-protein-cysteine S-methyltransferase activity. High polymorphism and one fixed non-synonymous substitution suggest this is a fast evolving gene. The gene trees of both genes perfectly separate D. simulans and D. mauritiana into monophyletic groups. Analysis of gene expression using microarray revealed trends that were similar to those previously found in comparisons between whole-genome hybrids and parental species. The identification following confirmation of the HMS candidate gene will add another case study leading to understanding the evolutionary process of hybrid incompatibility.

  15. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  16. Probing the Differential Tissue Distribution and Bioaccumulation Behavior of Per- and Polyfluoroalkyl Substances of Varying Chain-Lengths, Isomeric Structures and Functional Groups in Crucian Carp.

    Science.gov (United States)

    Shi, Yali; Vestergren, Robin; Nost, Therese Haugdahl; Zhou, Zhen; Cai, Yaqi

    2018-04-17

    Understanding the bioaccumulation mechanisms of per- and polyfluoroalkyl substances (PFASs) across different chain-lengths, isomers and functional groups represents a monumental scientific challenge with implications for chemical regulation. Here, we investigate how the differential tissue distribution and bioaccumulation behavior of 25 PFASs in crucian carp from two field sites impacted by point sources can provide information about the processes governing uptake, distribution and elimination of PFASs. Median tissue/blood ratios (TBRs) were consistently 90% of the amount of PFASs in the organism. Principal component analyses of TBRs and RBBs showed that the functional group was a relatively more important predictor of internal distribution than chain-length for PFASs. Whole body bioaccumulation factors (BAFs) for short-chain PFASs deviated from the positive relationship with hydrophobicity observed for longer-chain homologues. Overall, our results suggest that TBR, RBB, and BAF patterns were most consistent with protein binding mechanisms although partitioning to phospholipids may contribute to the accumulation of long-chain PFASs in specific tissues.

  17. Dietary acid load and renal function have varying effects on blood acid-base status and exercise performance across age and sex.

    Science.gov (United States)

    Hietavala, Enni-Maria; Stout, Jeffrey R; Frassetto, Lynda A; Puurtinen, Risto; Pitkänen, Hannu; Selänne, Harri; Suominen, Harri; Mero, Antti A

    2017-12-01

    Diet composition influences acid-base status of the body. This may become more relevant as renal functional capacity declines with aging. We examined the effects of low (LD) versus high dietary acid load (HD) on blood acid-base status and exercise performance. Participants included 22 adolescents, 33 young adults (YA), and 33 elderly (EL), who followed a 7-day LD and HD in a randomized order. At the end of both diet periods the subjects performed a cycle ergometer test (3 × 10 min at 35%, 55%, 75%, and (except EL) until exhaustion at 100% of maximal oxygen uptake). At the beginning of and after the diet periods, blood samples were collected at rest and after all workloads. Oxygen uptake, respiratory exchange ratio (RER), and heart rate (HR) were monitored during cycling. In YA and EL, bicarbonate (HCO 3 - ) and base excess (BE) decreased over the HD period, and HCO 3 - , BE, and pH were lower at rest after HD compared with LD. In YA and EL women, HCO 3 - and BE were lower at submaximal workloads after HD compared with LD. In YA women, the maximal workload was 19% shorter and maximal oxygen uptake, RER, and HR were lower after HD compared with LD. Our data uniquely suggests that better renal function is associated with higher availability of bases, which may diminish exercise-induced acidosis and improve maximal aerobic performance. Differences in glomerular filtration rate between the subject groups likely explains the larger effects of dietary acid load in the elderly compared with younger subjects and in women compared with men.

  18. Vehicle barrier systems

    International Nuclear Information System (INIS)

    Sena, P.A.

    1986-01-01

    The ground vehicle is one of the most effective tools available to an adversary force. Vehicles can be used to penetrate many types of perimeter barriers, transport equipment and personnel rapidly over long distances, and deliver large amounts of explosives directly to facilities in suicide missions. The function of a vehicle barrier system is to detain or disable a defined threat vehicle at a selected distance from a protected facility. Numerous facilities are installing, or planning to install, vehicle barrier systems and many of these facilities are requesting guidance to do so adequately. Therefore, vehicle barriers are being evaluated to determine their stopping capabilities so that systems can be designed that are both balanced and capable of providing a desired degree of protection. Equally important, many of the considerations that should be taken into account when establishing a vehicle barrier system have been identified. These considerations which pertain to site preparation, barrier selection, system integration and operation, and vehicle/barrier interaction, are discussed in this paper

  19. Lipid rafts regulate PCB153-induced disruption of occludin and brain endothelial barrier function through protein phosphatase 2A and matrix metalloproteinase-2

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Sung Yong, E-mail: seum@miami.edu; Jaraki, Dima; András, Ibolya E.; Toborek, Michal

    2015-09-15

    Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2′,4,4′,5,5′-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1 h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24 h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs. - Highlights: • PCB153 disturbed human brain endothelial barrier through disruption of occludin. • Lipid raft-associated PP

  20. Barrier mechanisms in the Drosophila blood-brain barrier

    Directory of Open Access Journals (Sweden)

    Samantha Jane Hindle

    2014-12-01

    Full Text Available The invertebrate blood-brain barrier field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through GPCR signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate blood-brain barrier has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many blood-brain barrier mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the blood-brain barrier can govern whole animal physiologies. This includes novel functions of blood-brain barrier gap junctions in orchestrating synchronized neuroblast proliferation, and of blood-brain barrier secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate blood-brain barrier anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.

  1. Reversed Effects of Intermittent Theta Burst Stimulation following Motor Training That Vary as a Function of Training-Induced Changes in Corticospinal Excitability

    Directory of Open Access Journals (Sweden)

    Tino Stöckel

    2015-01-01

    Full Text Available Intermittent theta burst stimulation (iTBS has the potential to enhance corticospinal excitability (CSE and subsequent motor learning. However, the effects of iTBS following motor learning are unknown. The purpose of the present study was to explore the effect of iTBS on CSE and performance following motor learning. Therefore twenty-four healthy participants practiced a ballistic motor task for a total of 150 movements. iTBS was subsequently applied to the trained motor cortex (STIM group or the vertex (SHAM group. Performance and CSE were assessed before motor learning and before and after iTBS. Training significantly increased performance and CSE in both groups. In STIM group participants, subsequent iTBS significantly reduced motor performance with smaller reductions in CSE. CSE changes as a result of motor learning were negatively correlated with both the CSE changes and performance changes as a result of iTBS. No significant effects of iTBS were found for SHAM group participants. We conclude that iTBS has the potential to degrade prior motor learning as a function of training-induced CSE changes. That means the expected LTP-like effects of iTBS are reversed following motor learning.

  2. Reversed Effects of Intermittent Theta Burst Stimulation following Motor Training That Vary as a Function of Training-Induced Changes in Corticospinal Excitability.

    Science.gov (United States)

    Stöckel, Tino; Summers, Jeffery J; Hinder, Mark R

    2015-01-01

    Intermittent theta burst stimulation (iTBS) has the potential to enhance corticospinal excitability (CSE) and subsequent motor learning. However, the effects of iTBS following motor learning are unknown. The purpose of the present study was to explore the effect of iTBS on CSE and performance following motor learning. Therefore twenty-four healthy participants practiced a ballistic motor task for a total of 150 movements. iTBS was subsequently applied to the trained motor cortex (STIM group) or the vertex (SHAM group). Performance and CSE were assessed before motor learning and before and after iTBS. Training significantly increased performance and CSE in both groups. In STIM group participants, subsequent iTBS significantly reduced motor performance with smaller reductions in CSE. CSE changes as a result of motor learning were negatively correlated with both the CSE changes and performance changes as a result of iTBS. No significant effects of iTBS were found for SHAM group participants. We conclude that iTBS has the potential to degrade prior motor learning as a function of training-induced CSE changes. That means the expected LTP-like effects of iTBS are reversed following motor learning.

  3. Protective barrier development: Overview

    International Nuclear Information System (INIS)

    Wing, N.R.; Gee, G.W.

    1990-01-01

    Protective barrier and warning marker systems are being developed to isolate wastes disposed of near the earth's surface at the Hanford Site. The barrier is designed to function in an arid to semiarid climate, to limit infiltration and percolation of water through the waste zone to near-zero, to be maintenance free, and to last up to 10,000 yr. Natural materials (e.g., fine soil, sand, gravel, riprap, clay, asphalt) have been selected to optimize barrier performance and longevity and to create an integrated structure with redundant features. These materials isolate wastes by limiting water drainage; reducing the likelihood of plant, animal, and human intrusion; controlling emission of noxious gases; and minimizing erosion. Westinghouse Hanford Company and Pacific Northwest Laboratory efforts to assess the performance of various barrier and marker designs will be discussed

  4. Alterations in Gut Microbiome Composition and Barrier Function Are Associated with Reproductive and Metabolic Defects in Women with Polycystic Ovary Syndrome (PCOS): A Pilot Study.

    Science.gov (United States)

    Lindheim, Lisa; Bashir, Mina; Münzker, Julia; Trummer, Christian; Zachhuber, Verena; Leber, Bettina; Horvath, Angela; Pieber, Thomas R; Gorkiewicz, Gregor; Stadlbauer, Vanessa; Obermayer-Pietsch, Barbara

    2017-01-01

    Polycystic ovary syndrome (PCOS) is a common female endocrinopathy of unclear origin characterized by hyperandrogenism, oligo-/anovulation, and ovarian cysts. Women with PCOS frequently display overweight, insulin resistance, and systemic low-grade inflammation. We hypothesized that endotoxemia resulting from a leaky gut is associated with inflammation, insulin resistance, fat accumulation, and hyperandrogenemia in PCOS. In this pilot study, we compared the stool microbiome, gut permeability, and inflammatory status of women with PCOS and healthy controls. 16S rRNA gene amplicon sequencing was performed on stool samples from 24 PCOS patients and 19 healthy controls. Data processing and microbiome analysis were conducted in mothur and QIIME using different relative abundance cut-offs. Gut barrier integrity, endotoxemia, and inflammatory status were evaluated using serum and stool markers and associations with reproductive, metabolic, and anthropometric parameters were investigated. The stool microbiome of PCOS patients showed a lower diversity and an altered phylogenetic composition compared to controls. We did not observe significant differences in any taxa with a relative abundance>1%. When looking at rare taxa, the relative abundance of bacteria from the phylum Tenericutes, the order ML615J-28 (phylum Tenericutes) and the family S24-7 (phylum Bacteroidetes) was significantly lower and associated with reproductive parameters in PCOS patients. Patients showed alterations in some, but not all markers of gut barrier function and endotoxemia. Patients with PCOS have a lower diversity and an altered phylogenetic profile in their stool microbiome, which is associated with clinical parameters. Gut barrier dysfunction and endotoxemia were not driving factors in this patient cohort, but may contribute to the clinical phenotype in certain PCOS patients.

  5. Alterations in Gut Microbiome Composition and Barrier Function Are Associated with Reproductive and Metabolic Defects in Women with Polycystic Ovary Syndrome (PCOS: A Pilot Study.

    Directory of Open Access Journals (Sweden)

    Lisa Lindheim

    Full Text Available Polycystic ovary syndrome (PCOS is a common female endocrinopathy of unclear origin characterized by hyperandrogenism, oligo-/anovulation, and ovarian cysts. Women with PCOS frequently display overweight, insulin resistance, and systemic low-grade inflammation. We hypothesized that endotoxemia resulting from a leaky gut is associated with inflammation, insulin resistance, fat accumulation, and hyperandrogenemia in PCOS. In this pilot study, we compared the stool microbiome, gut permeability, and inflammatory status of women with PCOS and healthy controls.16S rRNA gene amplicon sequencing was performed on stool samples from 24 PCOS patients and 19 healthy controls. Data processing and microbiome analysis were conducted in mothur and QIIME using different relative abundance cut-offs. Gut barrier integrity, endotoxemia, and inflammatory status were evaluated using serum and stool markers and associations with reproductive, metabolic, and anthropometric parameters were investigated.The stool microbiome of PCOS patients showed a lower diversity and an altered phylogenetic composition compared to controls. We did not observe significant differences in any taxa with a relative abundance>1%. When looking at rare taxa, the relative abundance of bacteria from the phylum Tenericutes, the order ML615J-28 (phylum Tenericutes and the family S24-7 (phylum Bacteroidetes was significantly lower and associated with reproductive parameters in PCOS patients. Patients showed alterations in some, but not all markers of gut barrier function and endotoxemia.Patients with PCOS have a lower diversity and an altered phylogenetic profile in their stool microbiome, which is associated with clinical parameters. Gut barrier dysfunction and endotoxemia were not driving factors in this patient cohort, but may contribute to the clinical phenotype in certain PCOS patients.

  6. Development of a novel multi-functional active membrane capping barrier for the remediation of nitrobenzene-contaminated sediment.

    Science.gov (United States)

    Wang, Qing; Li, Yi; Wang, Chao; Wu, Yue; Wang, Peifang

    2014-07-15

    A novel bio-reactive capping barrier composed of polysulfone/granular activated carbon (PS/GAC) hybrid membranes immobilized with microorganism was developed for the remediation of nitrobenzene in sediments. The SEM observation demonstrated that all the membranes had a dense top layer and a porous sublayer, this structure can block the transfer of nitrobenzene from sediment to the water and enhance nitrobenzene degradation. Adsorption behaviors of nitrobenzene on membranes showed that the membrane impregnated with GAC had better performance than the pure PS membrane. The values of Kads increased from 4.64 (without GAC) to 6.19 (1:2 GAC). 20mg/L nitrobenzene can be completely degraded by Pseudomonas putida immobilized on membranes. The biodegradation rate of activated carbon-filled membrane system was little higher than that of pure PS membrane system. For remediation experiments, only about 21.7, 28.3 and 43.9% of nitrobenzene in the sediment was removed by the end of the experiments for PS/GAC membrane, sand-alone and sand amended with activated carbon capping systems, respectively. While for PS/GAC+microorganisms capping system, more than 70% of nitrobenzene loss was observed. This demonstrated that nitrobenzene can be effectively removed from contaminated sediments by microbial degradation in the bio-reactive capping system. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Gut barrier function and systemic endotoxemia after laparotomy or laparoscopic resection for colon cancer: A prospective randomized study

    Directory of Open Access Journals (Sweden)

    Mario Schietroma

    2016-01-01

    Full Text Available Purpose: The gut barrier is altered in certain pathologic conditions (shock, trauma, or surgical stress, resulting in bacterial and/or endotoxin translocation from the gut lumen into the systemic circulation. In this prospective randomized study, we investigated the effect of surgery on intestinal permeability (IP and endotoxemia in patients undergoing elective colectomy for colon cancer by comparing the laparoscopic with the open approach. Patients and Methods: A hundred twenty-three consecutive patients underwent colectomy for colon cancer: 61 cases were open resection (OR and 62 cases were laparoscopic resection (LR. IP was measured preoperatively and at days 1 and 3 after surgery. Serial venous blood sample were taken at 0, 30, 60, 90, 120, and 180 min, and at 12, 24, and 48 h after surgery for endotoxin measurement. Results: IP was significantly increased in the open and closed group at day 1 compared with the preoperative level (P < 0.05, but no difference was found between laparoscopic and open surgery group. The concentration endotoxin systemic increased significantly in the both groups during the course of surgery and returned to baseline levels at the second day. No difference was found between laparoscopic and open surgery. A significant correlation was observed between the maximum systemic endotoxin concentration and IP measured at day 1 in the open group and in the laparoscopic group. Conclusion: An increase in IP, and systemic endotoxemia were observed during the open and laparoscopic resection for colon cancer, without significant statistically difference between the two groups.

  8. Host-dependent zonulin secretion causes the impairment of the small intestine barrier function after bacterial exposure.

    Science.gov (United States)

    El Asmar, Ramzi; Panigrahi, Pinaki; Bamford, Penelope; Berti, Irene; Not, Tarcisio; Coppa, Giovanni V; Catassi, Carlo; Fasano, Alessio; El Asmar, Rahzi

    2002-11-01

    Enteric infections have been implicated in the pathogenesis of both food intolerance and autoimmune diseases secondary to the impairment of the intestinal barrier. On the basis of our recent discovery of zonulin, a modulator of small-intestinal tight junctions, we asked whether microorganisms might induce zonulin secretion and increased small-intestinal permeability. Both ex vivo mammalian small intestines and intestinal cell monolayers were exposed to either pathogenic or nonpathogenic enterobacteria. Zonulin production and changes in paracellular permeability were monitored in Ussing chambers and micro-snapwells. Zonula occludens 1 protein redistribution after bacteria colonization was evaluated on cell monolayers. Small intestines exposed to enteric bacteria secreted zonulin. This secretion was independent of either the species of the small intestines or the virulence of the microorganisms tested, occurred only on the luminal aspect of the bacteria-exposed small-intestinal mucosa, and was followed by a decrease in small-intestinal tissue resistance (transepithelial electrical resistance). The transepithelial electrical resistance decrement was secondary to the zonulin-induced tight junction disassembly, as also shown by the disengagement of the protein zonula occludens 1 protein from the tight junctional complex. This zonulin-driven opening of the paracellular pathway may represent a defensive mechanism, which flushes out microorganisms and contributes to the host response against bacterial colonization of the small intestine.

  9. Hypothermia-induced loss of endothelial barrier function is restored after dopamine pretreatment : Role of p42/p44 activation

    NARCIS (Netherlands)

    Brinkkoetter, Paul-Thomas; Beck, Grietje C.; Gottmann, Uwe; Loesel, Ralf; Schnetzke, Ulf; Rudic, Boris; Hanusch, Christine; Rafat, Neysan; Liu, Zhenzi; Weiss, Christel; Leuvinik, Henri G. D.; Ploeg, Rutger; Braun, Claude; Schnuelle, Peter; van der Woude, Fokko J.; Yard, Benito A.

    2006-01-01

    Background. Donor dopamine usage is associated with improved immediate graft function after renal transplantation. Although prolonged cold preservation results in an increased vascular permeability, the present study was conducted to examine in vitro and in vivo if dopamine Pretreatment influences

  10. Impact of exogenous lipase supplementation on growth, intestinal function, mucosal immune and physical barrier, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Liu, Sen; Feng, Lin; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Zeng, Yun-Yun; Xu, Shu-De; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

    2016-08-01

    This study investigated the effects of exogenous lipase supplementation on the growth performance, intestinal growth and function, immune response and physical barrier function, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella). A total of 450 grass carp (255.02 ± 0.34 g) were fed five diets for 60 days. There were 5 dietary treatments that included a normal protein and lipid diet containing 30% crude protein (CP) with 5% ether extract (EE), and the low-protein and high-lipid diets (28% CP, 6% EE) supplemented with graded levels of exogenous lipase supplementation activity at 0, 1193, 2560 and 3730 U/kg diet. The results indicated that compared with a normal protein and lipid diet (30% CP, 5% EE), a low-protein and high-lipid diet (28% CP, 6% EE) (un-supplemented lipase) improved lysozyme activities and complement component 3 contents in the distal intestine (DI), interleukin 10 mRNA expression in the proximal intestine (PI), and glutathione S-transferases activity and glutathione content in the intestine of young grass carp. In addition, in low-protein and high-lipid diets, optimal exogenous lipase supplementation significantly increased acid phosphatase (ACP) activities and complement component 3 (C3) contents (P exogenous lipase supplementation significantly decreased reactive oxygen species (ROS), malondialdehyde (MDA) and protein carbonyl (PC) contents (P exogenous lipase supplementation significantly elevated the mRNA levels of tight junction proteins (Occludin, zonula occludens 1, Claudin b, Claudin c and Claudin 3) (P exogenous lipase supplementation improved growth, intestinal growth and function, intestinal immunity, physical barrier, and regulated the mRNA expression of related signal molecules of fish. The optimal level of exogenous lipase supplementation in young grass carp (255-771 g) was estimated to be 1193 U kg(-1) diet. Copyright © 2016. Published by Elsevier Ltd.

  11. Transplantation of in vitro cultured endothelial progenitor cells repairs the blood-brain barrier and improves cognitive function of APP/PS1 transgenic AD mice.

    Science.gov (United States)

    Zhang, Shishuang; Zhi, Yongle; Li, Fei; Huang, Shan; Gao, Huabin; Han, Zhaoli; Ge, Xintong; Li, Dai; Chen, Fanglian; Kong, Xiaodong; Lei, Ping

    2018-04-15

    To date, the pathogenesis of Alzheimer's disease (AD) remains unclear. It is well-known that excessive deposition of Aβ in the brain is a crucial part of the pathogenesis of AD. In recent years, the AD neurovascular unit hypothesis has attracted much attention. Impairment of the blood-brain barrier (BBB) leads to abnormal amyloid-β (Aβ) transport, and chronic cerebral hypoperfusion causes Aβ deposition throughout the onset and progression of AD. Endothelial progenitor cells (EPCs) are the universal cells for repairing blood vessels. Our previous studies have shown that a reduced number of EPCs in the peripheral blood results in cerebral vascular repair disorder, cerebral hypoperfusion and neurodegeneration, which might be related to the cognitive dysfunction of AD patients. This study was designed to confirm whether EPCs transplantation could repair the blood-brain barrier, stimulate angiogenesis and reduce Aβ deposition in AD. The expression of ZO-1, Occludin and Claudin-5 was up-regulated in APP/PS1 transgenic mice after hippocampal transplantation of EPCs. Consistent with previous studies, EPC transplants also increased the microvessel density. We observed that Aβ senile plaque deposition was decreased and hippocampal cell apoptosis was reduced after EPCs transplantation. The Morris water maze test showed that spatial learning and memory functions were significantly improved in mice transplanted with EPCs. Consequently, EPCs could up-regulate the expression of tight junction proteins, repair BBB tight junction function, stimulate angiogenesis, promote Aβ clearance, and decrease neuronal loss, ultimately improve cognitive function. Taken together, these data demonstrate EPCs may play an important role in the therapeutic implications for vascular dysfunction in AD. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Three-dimensional culture conditions differentially affect astrocyte modulation of brain endothelial barrier function in response to transforming growth factor β1.

    Science.gov (United States)

    Hawkins, Brian T; Grego, Sonia; Sellgren, Katelyn L

    2015-05-22

    Blood-brain barrier (BBB) function is regulated by dynamic interactions among cell types within the neurovascular unit, including astrocytes and endothelial cells. Co-culture models of the BBB typically involve astrocytes seeded on two-dimensional (2D) surfaces, which recent studies indicate cause astrocytes to express a phenotype similar to that of reactive astrocytes in situ. We hypothesized that the culture conditions of astrocytes would differentially affect their ability to modulate BBB function in vitro. Brain endothelial cells were grown alone or in co-culture with astrocytes. Astrocytes were grown either as conventional (2D) monolayers, or in a collagen-based gel which allows them to grow in a three-dimensional (3D) construct. Astrocytes were viable in 3D conditions, and displayed a marked reduction in their expression of glial fibrillary acidic protein (GFAP), suggesting reduced activation. Stimulation of astrocytes with transforming growth factor (TGF)β1 decreased transendothelial electrical resistance (TEER) and reduced expression of claudin-5 in co-cultures, whereas treatment of endothelial cells in the absence of astrocytes was without effect. The effect of TGFβ1 on TEER was significantly more pronounced in endothelial cells cultured with 3D astrocytes compared to 2D astrocytes. These results demonstrate that astrocyte culture conditions differentially affect their ability to modulate brain endothelial barrier function, and suggest a direct relationship between reactive gliosis and BBB permeability. Moreover, these studies demonstrate the potential importance of physiologically relevant culture conditions to in vitro modeling of disease processes that affect the neurovascular unit. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Predictors of functional outcome vary by the hemisphere of involvement in major ischemic stroke treated with intra-arterial therapy: a retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Pryor Johnny C

    2010-04-01

    Full Text Available Abstract Background Conflicting data exists regarding the effect of hemispheric lateralization on acute ischemic stroke outcome. Some of this variability may be related to heterogeneous study populations, particularly with respect to the level of arterial occlusion. Furthermore, little is known about the relationship between stroke lateralization and predictors of outcome. The purpose of this study was to characterize the impact of stroke lateralization on both functional outcome and its predictors in a well-defined population of anterior circulation proximal artery occlusions treated with IAT. Methods Thirty-five consecutive left- and 35 consecutive right-sided stroke patients with intracranial ICA and/or MCA occlusions who underwent IAT were retrospectively analyzed. Ischemic change on pre-treatment imaging was quantified. Reperfusion success was graded using the Mori scale. Good outcome at three months was defined as an mRS ≤ 2. Left- and right-sided strokes were compared for outcome and its predictors. Result Of 70 patients with median NIHSS score of 18 (IQR, 14-21, 19 (27.1% had a good outcome. There were 21 terminal ICA and 49 MCA occlusions. There was no difference in the rate of good outcomes between left- (n = 9 and right-sided (n = 10 strokes (p = 0.99. There were no significant differences in occlusion level, age, ischemic change on initial imaging and degree of reperfusion between left- and right-sided strokes. Left-sided strokes had higher baseline NIHSS scores (p = 0.02 and lower admission SBP (p = 0.009. Independent predictors of outcome for left-sided strokes were NIHSS (p = 0.0002 and reperfusion (p = 0.006, and for right-sided strokes were age (p = 0.002 and reperfusion (p = 0.003. In univariate analysis, pre-treatment ischemic change on NCCT was associated with outcome only for left-sided strokes (p = 0.05. Conclusions In anterior circulation proximal artery occlusions treated with IAT, hemispheric lateralization influences

  14. Fish oil improves motor function, limits blood-brain barrier disruption, and reduces Mmp9 gene expression in a rat model of juvenile traumatic brain injury.

    Science.gov (United States)

    Russell, K L; Berman, N E J; Gregg, P R A; Levant, B

    2014-01-01

    The effects of an oral fish oil treatment regimen on sensorimotor, blood-brain barrier, and biochemical outcomes of traumatic brain injury (TBI) were investigated in a juvenile rat model. Seventeen-day old Long-Evans rats were given a 15mL/kg fish oil (2.01g/kg EPA, 1.34g/kg DHA) or soybean oil dose via oral gavage 30min prior to being subjected to a controlled cortical impact injury or sham surgery, followed by daily doses for seven days. Fish oil treatment resulted in less severe hindlimb deficits after TBI as assessed with the beam walk test, decreased cerebral IgG infiltration, and decreased TBI-induced expression of the Mmp9 gene one day after injury. These results indicate that fish oil improved functional outcome after TBI resulting, at least in part from decreased disruption of the blood-brain barrier through a mechanism that includes attenuation of TBI-induced expression of Mmp9. © 2013 Elsevier Ltd. All rights reserved.

  15. A novel role for inhibitor of apoptosis (IAP) proteins as regulators of endothelial barrier function by mediating RhoA activation.

    Science.gov (United States)

    Hornburger, Michael C; Mayer, Bettina A; Leonhardt, Stefanie; Willer, Elisabeth A; Zahler, Stefan; Beyerle, Andrea; Rajalingam, Krishnaraj; Vollmar, Angelika M; Fürst, Robert

    2014-04-01

    Inhibitor of apoptosis (IAP) proteins, such as XIAP or cIAP1/2, are important regulators of apoptosis in cancer cells, and IAP antagonists are currently evaluated as antitumor agents. Beyond their function in cancer cells, this study demonstrates a novel role of IAPs as regulators of vascular endothelial permeability. Two structurally different IAP antagonists, ABT and Smac085, as well as silencing of IAPs, reduced the thrombin receptor-activating peptide (TRAP)-induced barrier dysfunction in human endothelial cells as assessed by measuring macromolecular permeability or transendothelial electrical resistance. ABT diminished thrombin-evoked stress fiber formation, activation of myosin light chain 2, and disassembly of adherens junctions independent of calcium signaling, protein kinase C, and mitogen-activated protein kinases. Interestingly, ABT and silencing of IAPs, in particular XIAP, reduced the TRAP-evoked RhoA activation, whereas Rac1 was not affected. XIAP and, to a lesser extent, cIAP1 were found to directly interact with RhoA independently of the RhoA activation status. Under cell-free conditions, XIAP did not induce an ubiquitination of RhoA. In summary, our work discloses IAPs as crucial regulators of endothelial permeability and suggests IAP inhibition as interesting approach for the prevention of endothelial barrier dysfunction.

  16. Response function of an HPGe detector simulated through MCNP 4A varying the density and chemical composition of the matrix; Funcion respuesta de un detector HPGe simulada mediante MCNP 4A variando la densidad y composicion quimica de la matriz

    Energy Technology Data Exchange (ETDEWEB)

    Leal A, B.; Mireles G, F.; Quirino T, L.; Pinedo, J.L. [Universidad Autonoma de Zacatecas, Zacatecas (Mexico)]. e-mail: bleal79@yahoo.com.mx

    2005-07-01

    In the area of the Radiological Safety it is required of a calibrated detection system in energy and efficiency for the determination of the concentration in activity in samples that vary in chemical composition and by this in density. The area of Nuclear Engineering requires to find the grade of isotopic enrichment of the uranium of the Sub-critic Nuclear Chicago 9000 Mark. Given the experimental importance that has the determination from the curves of efficiency to the effects of establishing the quantitative results, is appealed to the simulation of the response function of the detector used in the Regional Center of Nuclear Studies inside the range of energy of 80 keV to 1400 keV varying the density of the matrix and the chemical composition by means of the application of the Monte Carlo code MCNP-4A. The obtained results in the simulation of the response function of the detector show a grade of acceptance in the range from 500 to 1400 keV energy, with a smaller percentage discrepancy to 10%, in the range of low energy that its go from 59 to 400 keV, the percentage discrepancy varies from 17% until 30%, which is manifested in the opposing isotopic relationship for 5 fuel rods of the Sub critic nuclear assemble. (Author)

  17. Functional Behavior Assessments and Behavior Intervention Plans in Rural Schools: An Exploration of the Need, Barriers, and Recommendations

    Science.gov (United States)

    Oram, Lindsay; Owens, Sarah; Maras, Melissa

    2016-01-01

    A wealth of research highlights negative outcomes associated with mental and behavioral health problems in children and adolescents. Prevention-based frameworks have been developed to provide prevention and early intervention in the school setting. Tertiary behavioral supports often include the use of functional behavior assessments (FBAs) and…

  18. Salmosan, a β-galactomannan-rich product, in combination with Lactobacillus plantarum contributes to restore intestinal epithelial barrier function by modulation of cytokine production.

    Science.gov (United States)

    Brufau, M Teresa; Campo-Sabariz, Joan; Carné, Sergi; Ferrer, Ruth; Martín-Venegas, Raquel

    2017-03-01

    Mannan-oligosaccharides (MOSs) are mannose-rich substrates with several intestinal health-promoting properties. The aim of this study was to investigate the potential capacity of Salmosan (S-βGM), a β-galactomannan-rich MOS product, to restore epithelial barrier function independently from its capacity to reduce bacterial invasion. In addition, the combination of S-βGM with the proven probiotic Lactobacillus plantarum (LP) was also tested. Paracellular permeability was assessed by transepithelial electrical resistance (TER) in co-cultures of Caco-2 cells and macrophages (differentiated from THP-1 cells) stimulated with LPS of Salmonella Enteritidis and in Caco-2 cell cultures stimulated with TNF-α in the absence or presence of 500 μg/ml S-βGM, LP (MOI 10) or a combination of both. In both culture models, TER was significantly reduced up to 25% by LPS or TNF-α stimulation, and the addition of S-βGM or LP alone did not modify TER, whereas the combination of both restored TER to values of nonstimulated cells. Under LPS stimulation, TNF-α production was significantly increased by 10-fold, whereas IL-10 and IL-6 levels were not modified. The combination of S-βGM and LP reduced TNF-α production to nonstimulated cell values and significantly increased IL-10 and IL-6 levels (5- and 7.5-fold, respectively). Moreover, S-βGM has the capacity to induce an increase of fivefold in LP growth. In conclusion, we have demonstrated that S-βGM in combination with LP protects epithelial barrier function by modulation of cytokine secretion, thus giving an additional value to this MOS as a potential symbiotic. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis

    DEFF Research Database (Denmark)

    List, Karin; Haudenschild, Christian C; Szabo, Roman

    2002-01-01

    of Matriptase/MT-SP1 also seriously affected hair follicle development resulting in generalized follicular hypoplasia, absence of erupted vibrissae, lack of vibrissal hair canal formation, ingrown vibrissae, and wholesale abortion of vibrissal follicles. Furthermore, Matriptase/MT-SP1-deficiency resulted...... in dramatically increased thymocyte apoptosis, and depletion of thymocytes. This study demonstrates that Matriptase/MT-SP1 has pleiotropic functions in the development of the epidermis, hair follicles, and cellular immune system....

  20. A study of the barrier function of the upper respiratory tract covering epithelium in the event of combined respiratory tract injuries

    International Nuclear Information System (INIS)

    Ivanov, Z.; Kolev, K.; Dermendzhiev, Kh.; Nikolova, M.; Kantardzhiev, V.

    1976-01-01

    Functional and morphologic impairment of upper respiratory tract mucous membranes after chronic exposure to the three major occupational noxious agents in ore mining - radon-222, silica dust, and respirable dust - has been studied experimentally. Over a 6-month period, rats were given daily treatments, with the agents applied either individually or in combination. Radon-222 (at 1 x 10 -10 Ci/l, corresponding to the maximum permissible concentrotion in uranium mine atmospheres) and respirable dust (dispersed silicogen at 100 mg/m 3 ) were administered four hours daily in toxicological chambers. Monodisperse silica dust was given by tracheal tube, at 50 mg in 1 ml of saline per rat. At the end of the treatment period, the barrier function of the respiratory epithelium was tested, and found to have been affected, by measuring beta radioactivity in blood following introduction into -the animal's nasopharynx of a 32 P-labelled staphylococcus culture. The most severe degree if impairment was found to result from simultaneous exposure to radon and respirable dust. Any of ti'e agents given individually caused a similar degree of impairment. Intratracheal administration of silicic acid anhydride appeared to have no deleterious consequences. The evidence for functional impairment was supported by histologic findings, indicating Jevelopment of ulcerous bronchitis, metaplasia of cylindrical epithelium, etc., after both individual and combined radon exposure. (A.B.)

  1. Altered Function and Expression of ABC Transporters at the Blood–Brain Barrier and Increased Brain Distribution of Phenobarbital in Acute Liver Failure Mice

    Directory of Open Access Journals (Sweden)

    Li Liu

    2018-03-01

    Full Text Available This study investigated alterations in the function and expression of P-glycoprotein (P-GP, breast cancer resistance protein (BCRP, and multidrug resistance-associated protein 2 (MRP2 at the blood–brain barrier (BBB of acute liver failure (ALF mice and its clinical significance. ALF mice were developed using intraperitoneal injection of thioacetamide. P-GP, BCRP, and MRP2 functions were determined by measuring the ratios of brain-to-plasma concentration of rhodamine 123, prazosin, and dinitrophenyl-S-glutathione, respectively. The mRNA and proteins expression levels of P-GP, BCRP, and MRP2 were evaluated with quantitative real-time PCR and western blot, respectively. MDCK-MDR1 and HCMEC/D3 cells were used to document the effects of the abnormally altered components in serum of ALF mice on the function and expression of P-GP. The clinical significance of alteration in P-GP function and expression was investigated by determining the distribution of the P-GP substrate phenobarbital (60 mg/kg, intravenous administration in the brain and loss of righting reflex (LORR induced by the drug (100 mg/kg. The results showed that ALF significantly downregulated the function and expression of both P-GP and BCRP, but increased the function and expression of MRP2 in the brain of mice. Cell study showed that increased chenodeoxycholic acid may be a reason behind the downregulated P-GP function and expression. Compared with control mice, ALF mice showed a significantly higher brain concentration of phenobarbital and higher brain-to-plasma concentration ratios. In accordance, ALF mice showed a significantly larger duration of LORR and shorter latency time of LORR by phenobarbital, inferring the enhanced pharmacological effect of phenobarbital on the central nervous system (CNS. In conclusion, the function and expression of P-GP and BCRP decreased, while the function and expression of MRP2 increased in the brain of ALF mice. The attenuated function and expression

  2. Penetration through the Skin Barrier

    DEFF Research Database (Denmark)

    Nielsen, Jesper Bo; Benfeldt, Eva; Holmgaard, Rikke

    2016-01-01

    The skin is a strong and flexible organ with barrier properties essential for maintaining homeostasis and thereby human life. Characterizing this barrier is the ability to prevent some chemicals from crossing the barrier while allowing others, including medicinal products, to pass at varying rates......-through diffusion cells) as well as in vivo methods (microdialysis and microperfusion). Then follows a discussion with examples of how different characteristics of the skin (age, site and integrity) and of the penetrants (size, solubility, ionization, logPow and vehicles) affect the kinetics of percutaneous...

  3. Using the International Classification of Functioning, Disability and Health (ICF) to address facilitators and barriers to participation at work.

    Science.gov (United States)

    Martins, Anabela Correia

    2015-01-01

    The International Classification of Functioning, Disability and Health (ICF) was approved by the World Health Assembly in 2001. Ten years later, strong arguments have arisen regarding the added value of ICF to the policies on employment and the outcomes at the workplace. As a conceptual framework, ICF has universality because of its inclusive and comprehensive view of human functioning. At a practical level ICF can be used to quantify the impact of impairment on an individual's ability to act in his/her environment and to assess interventions to minimize the impact of disability and maximize functioning. To explore key indicators of social participation (life habits) of persons with disabilities, particularly related to work, among environmental and personal factors. Data were collected by self-administered questionnaires from a convenience sample of 149 working-age persons with disabilities. Social participation is a construct composed by multiple components and employment domain is the strongest indicator of participation. Correlations between social participation and personal factors, such as self-efficacy and attitudes towards disability were moderate. Those who are employed scored higher quality of life in terms of satisfaction with life, more positive attitudes toward disabilities and higher self-efficacy than the ones who are retired or unemployed. Persons using adapted wheelchair and those who were involved in wheelchair selection scored higher in social participation in general, performance at work, and quality of life. Age and disability duration were not associated with participants' employment status. These findings suggest that rehabilitation and vocational agents, like physiotherapists and other professionals, should have knowledge and understanding of the multiple factors that influence persons with disabilities' participation at work. Programs should provide appropriate wheelchairs, skills training, empowerment and problem-solving strategies in

  4. Inadequate functional health literacy in Spanish as a barrier to cervical cancer screening among immigrant Latinas in New York City.

    Science.gov (United States)

    Garbers, Samantha; Chiasson, Mary Ann

    2004-10-01

    The objective of this study was to examine the association between inadequate functional health literacy in Spanish among low-income Latinas aged 40 and older and cervical cancer screening knowledge and behavior. Spanish-speaking Latinas aged 40-78 of various nationalities (n = 205) participated in a study that included a survey on cervical cancer knowledge and behavior administered in Spanish and the Spanish version of the Test of Functional Health Literacy in Adults. Compared to those with adequate and marginal health literacy, women with inadequate functional health literacy in Spanish were significantly less likely to have ever had a Papanicolaou (Pap) test (odds ratio, 0.12; 95% confidence interval [CI], 0.04-0.37) or in the last three years (odds ratio, 0.35; 95% CI, 0.18-0.68) and were significantly more likely to have had their last Pap test at a local public hospital (odds ratio, 2.43; 95% CI, 1.18-4.97). Even when controlling for other factors, women with inadequate health literacy were 16.7 times less likely (adjusted odds ratio, 0.06; 95% CI, 0.01-0.55) to have ever had a Pap test. Almost half of the population we studied will have difficulty interpreting written medical materials, even in Spanish. When developing efforts to reach women who have not been screened, programs and service providers need to be aware that the women most in need of information about screening may be more likely to be unable to read any written materials provided to them, regardless of the language or level of simplicity of the materials. Programs and strategies need to be implemented to increase screening prevalence and to minimize the identified gaps in regular screening for Latinas who have low health literacy.

  5. Neurocognitive deficits as a barrier to psychosocial function in schizophrenia: effects on learning, coping, & self-concept.

    Science.gov (United States)

    Lysaker, Paul H; Buck, Kelly D

    2007-07-01

    Recently, research has linked deficits in neurocognition, which emerge early in schizophrenia, with psychosocial impairments. However, it is uncertain how these deficits lead to sustained dysfunction. In this review, we explore how neurocognitive deficits could disrupt function at three levels: learning, coping preference, and self-concept. We offer a model in which neurocognitive impairment may directly limit skills acquisition and the development of a rich personal narrative. We suggest that both limited skills acquisition and an impoverished narrative may subsequently feed into a habitual style of avoidant coping, leading to a cycle of sustained dysfunction. Implications for cognitive, rehabilitation, and psychotherapeutic interventions are discussed.

  6. Hygienic study of barrier function of local water purification facilities in respect to chemical pollutants agrochemicals and surfactants

    Energy Technology Data Exchange (ETDEWEB)

    Il' in, I E

    1984-08-01

    Contamination of water reservoirs is presently a multicomponent phenomenon because pesticides, fertilizers, petroleum products, dyes and surfactants may all be present in water. Efficiency of commonly-employed water purification methods was evaluated: sedimentation, chlorination, filtering, and its related effect or representative groups of agricultural chemicals. The most vulnerable link in the rural water purification system was the filtration; in presence of surfactants, the filtration effectiveness was reduced by 40-50%. The effectiveness of this hauling function of surfactants was related to chemical structure of the polluting compounds and to homologous characteristics of the detergents. The effectiveness of the precipitation of chemical impurities from polluted water depended on their solubility in water. 1 figure.

  7. Optimized functionally graded La2Zr2O7/8YSZ thermal barrier coatings fabricated by suspension plasma spraying

    International Nuclear Information System (INIS)

    Wang, Chaohui; Wang, You; Fan, Shan; You, Yuan; Wang, Liang; Yang, Changlong; Sun, Xiaoguang; Li, Xuewei

    2015-01-01

    In this paper, an optimized functionally graded coating (OFGC) was successfully fabricated by suspension plasma spraying (SPS) with feedstocks of the suspension of nanoparticles. La 2 Zr 2 O 7 /8YSZ OFGC with gradual compositional variation along the through-thickness direction is proposed to mitigate spallation and crack formation owing to the high residual stresses caused by frequent thermal cycling for TBCs. The single ceramic layer coatings (SCLC) of LZ and double ceramic layer coatings (DCLC) of LZ/8YSZ were fabricated by SPS as comparison. The phase composition and microstructure of the SCLC, OFGC and DCLC were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM) and Energy Dispersive Spectrometer (EDS). Moreover, the thermal cycling tests were carried out to evaluate their thermal shock behavior. Changes in weight and morphology of specimens were analyzed during thermal cycling tests. The results showed that OFGC has extended lifetime compared with SCLC and DCLC. The failure of DCLC with clear interface between different ceramic layers occurred via delamination mode, as a result of crack initiation and propagation generated by thermal mismatch between LZ and 8YSZ. While the failure of OFGC occurred in thermally grown oxide (TGO) layers, indicating that the gradual compositional variation avoided thermal stress concentration in the top ceramic layers. - Highlights: • Optimized functionally graded coatings and double ceramic layer coatings were deposited by suspension plasma spray. • The graded area of OFGC is continuously changed from inner 8YSZ to outer La 2 Zr 2 O 7 (LZ). • The OFGC shows a more extended thermal cycling life than the LZ SCLC and LZ/8YSZ DCLC. • Various failure mechanisms were proposed to explain thermal cycling behavior

  8. Lithium chloride contributes to blood-spinal cord barrier integrity and functional recovery from spinal cord injury by stimulating autophagic flux.

    Science.gov (United States)

    Tong, Minji; He, Zili; Lin, Xiaoxiao; Zhou, Yulong; Wang, Qingqing; Zheng, Zengming; Chen, Jian; Xu, Huazi; Tian, Naifeng

    2018-01-22

    Blood-spinal cord barrier (BSCB) disruption following spinal cord injury (SCI) significantly compromises functional neuronal recovery. Autophagy is a potential therapeutic target when seeking to protect the BSCB. We explored the effects of lithium chloride (LiCl) on BSCB permeability and autophagy-induced SCI both in a rat model of SCI and in endothelial cells subjected to oxygen-glucose deprivation. We evaluated BSCB status using the Evans Blue dye extravasation test and measurement of tight junction (TJ) protein levels; we also assessed functional locomotor recovery. We detected autophagy-associated proteins in vivo and in vitro using both Western blotting and immunofluorescence staining. We found that, in a rat model of SCI, LiCl attenuated the elevation in BSCB permeability, improved locomotor recovery, and inhibited the degradation of TJ proteins including occludin and claudin-5. LiCl significantly induced the extent of autophagic flux after SCI by increasing LC3-II and ATG-5 levels, and abolishing p62 accumulation. In addition, a combination of LiCl and the autophagy inhibitor chloroquine not only partially eliminated the BSCB-protective effect of LiCl, but also exacerbated TJ protein degradation both in vivo and in vitro. Together, these findings suggest that LiCl treatment alleviates BSCB disruption and promotes locomotor recovery after SCI, partly by stimulating autophagic flux. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Impaired endothelial barrier function in apolipoprotein M-deficient mice is dependent on sphingosine-1-phosphate receptor 1

    DEFF Research Database (Denmark)

    Christensen, Pernille M; Liu, Catherine H; Swendeman, Steven L

    2016-01-01

    Apolipoprotein M (ApoM) transports sphingosine-1-phosphate (S1P) in plasma, and ApoM-deficient mice (Apom(-/-)) have ∼50% reduced plasma S1P levels. There are 5 known S1P receptors, and S1P induces adherens junction formation between endothelial cells through the S1P1 receptor, which in turn...... suppresses vascular leak. Increased vascular permeability is a hallmark of inflammation. The purpose of this study was to explore the relationships between vascular leakage in ApoM deficiency and S1P1 function in normal physiology and in inflammation. Vascular permeability in the lungs was assessed...... by accumulation of dextran molecules (70 kDa) and was increased ∼40% in Apom(-/-) mice compared to WT (C57Bl6/j) mice. Reconstitution of plasma ApoM/S1P or treatment with an S1P1 receptor agonist (SEW2871) rapidly reversed the vascular leakage to a level similar to that in WT mice, suggesting that it is caused...

  10. Floating barrier

    Energy Technology Data Exchange (ETDEWEB)

    1968-05-06

    This floating barrier consists of relatively long elements which can be connected to form a practically continuous assembly. Each element consists of an inflatable tube with an apron of certain height, made of impregnated fabric which is resistant to ocean water and also to hydrocarbons. Means for connecting one element to the following one, and means for attaching ballast to the apron are also provided.

  11. microRNA-4516 Contributes to Different Functions of Epithelial Permeability Barrier by Targeting Poliovirus Receptor Related Protein 1 in Enterovirus 71 and Coxsackievirus A16 Infections

    Directory of Open Access Journals (Sweden)

    Yajie Hu

    2018-04-01

    Full Text Available Enterovirus 71 (EV-A71 and coxsackievirus A16 (CV-A16 remain the predominant etiological agents of hand, foot, and mouth disease (HFMD. The clinical manifestations caused by the two viruses are obviously different. CV-A16 usually triggers a repeated infection, and airway epithelial integrity is often the potential causative factor of respiratory repeated infections. Our previous studies have demonstrated that there were some differentially expressed miRNAs involved in the regulation of adhesion function of epithelial barrier in EV-A71 and CV-A16 infections. In this study, we compared the differences between EV-A71 and CV-A16 infections on the airway epithelial barrier function in human bronchial epithelial (16HBE cells and further screened the key miRNA which leaded to the formation of these differences. Our results showed that more rapid proliferation, more serious destruction of 16HBE cells permeability, more apoptosis and disruption of intercellular adhesion-associated molecules were found in CV-A16 infection as compared to EV-A71 infection. Furthermore, we also identified that microRNA-4516 (miR-4516, which presented down-regulation in EV-A71 infection and up-regulation in CV-A16 infection was an important regulator of intercellular junctions by targeting Poliovirus receptor related protein 1(PVRL1. The expressions of PVRL1, claudin4, ZO-1 and E-cadherin in CV-A16-infected cells were significantly less than those in EV-A71-infected cells, while the expressions of these proteins were subverted when pre-treated with miR-4516-overexpression plasmid in EV-A71 infected and miR-4516-knockdown plasmid in CV-A16 infected 16HBE cells. Thus, these data suggested that the opposite expression of miR-4516 in EV-A71 and CV-A16 infections might be the initial steps leading to different epithelial impairments of 16HBE cells by destroying intercellular adhesion, which finally resulted in different outcomes of EV-A71 and CV-A16 infections.

  12. [Changes in expression of Slingshot protein in hypoxic human intestinal epithelial cell and its relation with barrier function of the cells].

    Science.gov (United States)

    Zhang, Jian; Wang, Pei; He, Wen; Wang, Fengjun

    2016-04-01

    To study the effect of hypoxia on Slingshot protein expression in human intestinal epithelial cell and its relation with changes in barrier function of the cells. The human intestinal epithelial cell line Caco-2 was used to reproduce monolayer-cells. One portion of the monolayer-cell specimens were divided into six parts according to the random number table, and they were respectively exposed to hypoxia for 0 (without hypoxia), 1, 2, 6, 12, and 24 h. Transepithelial electrical resistance (TER) was determined with an ohmmeter. Another portion of the monolayer-cell specimens were exposed to hypoxia as above. Western blotting was used to detect the protein expressions of zonula occludens 1 (ZO-1), occludin, claudin-1, Slingshot-1, Slingshot-2, and Slingshot-3. The remaining portion of the monolayer-cell specimens were also exposed to hypoxia as above. The content of fibrous actin (F-actin) and globular actin (G-actin) was determined by fluorescence method. The sample number of above-mentioned 3 experiments was respectively 10, 10, and 18 at each time point. Data were processed with one-way analysis of variance and Dunnett test. (1) Compared with that of cells exposed to hypoxia for 0 h, TER of cells exposed to hypoxia for 1 to 24 h was significantly reduced (P values below 0.01). (2) Compared with those of cells exposed to hypoxia for 0 h (all were 1.00), the protein expressions of ZO-1, occludin, and claudin-1 of cells exposed to hypoxia for 1 to 24 h were generally lower, especially those of cells exposed to hypoxia for 12 h or 24 h (respectively 0.69 ± 0.20, 0.47 ± 0.15, and 0.47 ± 0.22, Pprotein expressions of Slingshot-1 and Slingshot-3 of cells exposed to hypoxia for 1 to 24 h were not obviously changed (P values above 0.05). The protein expression of Slingshot-2 of cells was decreased at first and then gradually increased from hypoxia hour 1 to 24. The protein expression of Slingshot-2 of cells exposed to hypoxia for 24 h (1.54 ± 0.57) was significantly

  13. Alteration of skin hydration and its barrier function by vehicle and permeation enhancers: a study using TGA, FTIR, TEWL and drug permeation as markers.

    Science.gov (United States)

    Shah, D K; Khandavilli, S; Panchagnula, R

    2008-09-01

    Vehicles and permeation enhancers (PEs) used in transdermal drug delivery (TDD) of a drug can affect skin hydration, integrity and permeation of the solute administered. This investigation was designed to study the effect of the most commonly used vehicles and PEs on rat skin hydration, barrier function and permeation of an amphiphilic drug, imipramine hydrochloride (IMH). An array of well-established techniques were used to confirm the findings of the study. Thermogravimetric analysis (TGA) and Fourier transform infrared (FTIR) spectroscopy were used to determine changes in skin hydration. Alteration of the stratum corneum (SC) structure was investigated using FTIR studies. To monitor the barrier function alteration, transepidermal water loss (TEWL) measurement and permeation studies were performed. Our findings indicate that with hydration, there was an increase in the bound water content of the skin, and pseudoequilibrium of hydration (a drastic decrease in hydration rate) was achieved at around 12 h. Hydration increased the ratio between amide-I and amide-II peaks in FTIR and reduced the C-H stretching peak area. Both propylene glycol (PG) and ethanol (EtOH) dehydrated skin, with the latter showing a predominant effect. Furthermore, it was confirmed that PG and EtOH decreased the bound water content due to alteration in the protein domains and extraction of SC lipids, respectively. The effect of hydration on the SC was found to be similar to that reported for temperature. Permeation studies revealed that the dehydration caused by vehicles decreased IMH flux, whereas the flux was enhanced by PEs. The role of partition was predominant for the permeation of IMH through dehydrated skin. A synergistic effect was observed for PG and menthol in the enhancement of IMH. Further findings provided strong evidence that PG affects protein domains and EtOH extracts lipids from the bilayer. Both PG and EtOH, with or without PEs, increased TEWL. Initial TEWL was well

  14. Effects of Supplementation of the Synbiotic Ecologic® 825/FOS P6 on Intestinal Barrier Function in Healthy Humans: A Randomized Controlled Trial

    Science.gov (United States)

    Wilms, E.; Gerritsen, J.; Smidt, H.; Besseling-van der Vaart, I.; Rijkers, G. T.; Garcia Fuentes, A. R.; Masclee, A. A. M.; Troost, F. J.

    2016-01-01

    Background and Aims Probiotics, prebiotics and synbiotics have been suggested as dietary strategies to improve intestinal barrier function. This study aimed to assess the effect of two weeks synbiotic supplementation on intestinal permeability under basal and stressed conditions. Secondary aims were the assessment of two weeks synbiotic supplementation on systemic immune function and gastrointestinal symptoms including defecation pattern. Design Twenty healthy adults completed a double-blind, controlled, randomized, parallel design study. Intervention Groups either received synbiotic (1.5 × 1010 CFU Ecologic® 825 + 10 g fructo-oligosaccharides (FOS P6) per day) or control supplements for two weeks. Outcomes Intestinal segment specific permeability was assessed non-invasively by oral administration of multiple sugar probes and, subsequently, assessing the excretion of these probes in urine. This test was conducted at baseline and at the end of intervention, in the absence and in the presence of an indomethacin challenge. Indomethacin was applied to induce a compromised gut state. Plasma zonulin, cytokines and chemokines were measured at baseline and at the end of intervention. Gastrointestinal symptoms and stool frequency were recorded at baseline and daily during intervention. Results Significantly more male subjects were in the synbiotic group compared to the control group (P = 0.025). Indomethacin significantly increased urinary lactulose/rhamnose ratio versus without indomethacin, both in the control group (P = 0.005) and in the synbiotic group (P = 0.017). Urinary sugar recoveries and ratios, plasma levels of zonulin, cytokines and chemokines, and gastrointestinal symptom scores were not significantly different after control or synbiotic intervention. Stool frequency within the synbiotic group was significantly increased during synbiotic intervention compared to baseline (P = 0.039) and higher compared to control intervention (P = 0.045). Conclusion Two weeks

  15. Effects of Supplementation of the Synbiotic Ecologic® 825/FOS P6 on Intestinal Barrier Function in Healthy Humans: A Randomized Controlled Trial.

    Science.gov (United States)

    Wilms, E; Gerritsen, J; Smidt, H; Besseling-van der Vaart, I; Rijkers, G T; Garcia Fuentes, A R; Masclee, A A M; Troost, F J

    2016-01-01

    Probiotics, prebiotics and synbiotics have been suggested as dietary strategies to improve intestinal barrier function. This study aimed to assess the effect of two weeks synbiotic supplementation on intestinal permeability under basal and stressed conditions. Secondary aims were the assessment of two weeks synbiotic supplementation on systemic immune function and gastrointestinal symptoms including defecation pattern. Twenty healthy adults completed a double-blind, controlled, randomized, parallel design study. Groups either received synbiotic (1.5 × 1010 CFU Ecologic® 825 + 10 g fructo-oligosaccharides (FOS P6) per day) or control supplements for two weeks. Intestinal segment specific permeability was assessed non-invasively by oral administration of multiple sugar probes and, subsequently, assessing the excretion of these probes in urine. This test was conducted at baseline and at the end of intervention, in the absence and in the presence of an indomethacin challenge. Indomethacin was applied to induce a compromised gut state. Plasma zonulin, cytokines and chemokines were measured at baseline and at the end of intervention. Gastrointestinal symptoms and stool frequency were recorded at baseline and daily during intervention. Significantly more male subjects were in the synbiotic group compared to the control group (P = 0.025). Indomethacin significantly increased urinary lactulose/rhamnose ratio versus without indomethacin, both in the control group (P = 0.005) and in the synbiotic group (P = 0.017). Urinary sugar recoveries and ratios, plasma levels of zonulin, cytokines and chemokines, and gastrointestinal symptom scores were not significantly different after control or synbiotic intervention. Stool frequency within the synbiotic group was significantly increased during synbiotic intervention compared to baseline (P = 0.039) and higher compared to control intervention (P = 0.045). Two weeks Ecologic® 825/FOS P6 supplementation increased stool frequency

  16. Effects of Supplementation of the Synbiotic Ecologic® 825/FOS P6 on Intestinal Barrier Function in Healthy Humans: A Randomized Controlled Trial.

    Directory of Open Access Journals (Sweden)

    E Wilms

    Full Text Available Probiotics, prebiotics and synbiotics have been suggested as dietary strategies to improve intestinal barrier function. This study aimed to assess the effect of two weeks synbiotic supplementation on intestinal permeability under basal and stressed conditions. Secondary aims were the assessment of two weeks synbiotic supplementation on systemic immune function and gastrointestinal symptoms including defecation pattern.Twenty healthy adults completed a double-blind, controlled, randomized, parallel design study.Groups either received synbiotic (1.5 × 1010 CFU Ecologic® 825 + 10 g fructo-oligosaccharides (FOS P6 per day or control supplements for two weeks.Intestinal segment specific permeability was assessed non-invasively by oral administration of multiple sugar probes and, subsequently, assessing the excretion of these probes in urine. This test was conducted at baseline and at the end of intervention, in the absence and in the presence of an indomethacin challenge. Indomethacin was applied to induce a compromised gut state. Plasma zonulin, cytokines and chemokines were measured at baseline and at the end of intervention. Gastrointestinal symptoms and stool frequency were recorded at baseline and daily during intervention.Significantly more male subjects were in the synbiotic group compared to the control group (P = 0.025. Indomethacin significantly increased urinary lactulose/rhamnose ratio versus without indomethacin, both in the control group (P = 0.005 and in the synbiotic group (P = 0.017. Urinary sugar recoveries and ratios, plasma levels of zonulin, cytokines and chemokines, and gastrointestinal symptom scores were not significantly different after control or synbiotic intervention. Stool frequency within the synbiotic group was significantly increased during synbiotic intervention compared to baseline (P = 0.039 and higher compared to control intervention (P = 0.045.Two weeks Ecologic® 825/FOS P6 supplementation increased stool

  17. An in vitro and in vivo study of peptide-functionalized nanoparticles for brain targeting : The importance of selective blood–brain barrier uptake

    NARCIS (Netherlands)

    Bode, Gerard H.; Coué, G.M.J.P.C.; Freese, Christian; Pickl, Karin E.; Sanchez-Purrà, Maria; Albaiges, Berta; Borrós, Salvador; van Winden, Ewoud C.; Tziveleka, Leto Aikaterini; Sideratou, Zili; Engbersen, Johan F.J.; Singh, Smriti; Albrecht, Krystyna; Groll, Jürgen; Möller, Martin; Pötgens, Andy J.G.; Schmitz, Christoph; Fröhlich, Eleonore; Grandfils, Christian; Sinner, Frank M.; Kirkpatrick, C. James; Steinbusch, Harry W.M.; Frank, Hans Georg; Unger, Ronald E.; Martinez-Martinez, Pilar

    2017-01-01

    Targeted delivery of drugs across endothelial barriers remains a formidable challenge, especially in the case of the brain, where the blood–brain barrier severely limits entry of drugs into the central nervous system. Nanoparticle-mediated transport of peptide/protein-based drugs across endothelial

  18. varying elastic parameters distributions

    KAUST Repository

    Moussawi, Ali

    2014-12-01

    The experimental identication of mechanical properties is crucial in mechanics for understanding material behavior and for the development of numerical models. Classical identi cation procedures employ standard shaped specimens, assume that the mechanical elds in the object are homogeneous, and recover global properties. Thus, multiple tests are required for full characterization of a heterogeneous object, leading to a time consuming and costly process. The development of non-contact, full- eld measurement techniques from which complex kinematic elds can be recorded has opened the door to a new way of thinking. From the identi cation point of view, suitable methods can be used to process these complex kinematic elds in order to recover multiple spatially varying parameters through one test or a few tests. The requirement is the development of identi cation techniques that can process these complex experimental data. This thesis introduces a novel identi cation technique called the constitutive compatibility method. The key idea is to de ne stresses as compatible with the observed kinematic eld through the chosen class of constitutive equation, making possible the uncoupling of the identi cation of stress from the identi cation of the material parameters. This uncoupling leads to parametrized solutions in cases where 5 the solution is non-unique (due to unknown traction boundary conditions) as demonstrated on 2D numerical examples. First the theory is outlined and the method is demonstrated in 2D applications. Second, the method is implemented within a domain decomposition framework in order to reduce the cost for processing very large problems. Finally, it is extended to 3D numerical examples. Promising results are shown for 2D and 3D problems.

  19. A synchrotron X-ray diffraction deconvolution method for the measurement of residual stress in thermal barrier coatings as a function of depth.

    Science.gov (United States)

    Li, C; Jacques, S D M; Chen, Y; Daisenberger, D; Xiao, P; Markocsan, N; Nylen, P; Cernik, R J

    2016-12-01

    The average residual stress distribution as a function of depth in an air plasma-sprayed yttria stabilized zirconia top coat used in thermal barrier coating (TBC) systems was measured using synchrotron radiation X-ray diffraction in reflection geometry on station I15 at Diamond Light Source, UK, employing a series of incidence angles. The stress values were calculated from data deconvoluted from diffraction patterns collected at increasing depths. The stress was found to be compressive through the thickness of the TBC and a fluctuation in the trend of the stress profile was indicated in some samples. Typically this fluctuation was observed to increase from the surface to the middle of the coating, decrease a little and then increase again towards the interface. The stress at the interface region was observed to be around 300 MPa, which agrees well with the reported values. The trend of the observed residual stress was found to be related to the crack distribution in the samples, in particular a large crack propagating from the middle of the coating. The method shows promise for the development of a nondestructive test for as-manufactured samples.

  20. Programme on the recyclability of food-packaging materials with respect to food safety considerations: polyethylene terephthalate (PET), paper and board, and plastics covered by functional barriers.

    Science.gov (United States)

    Franz, R

    2002-01-01

    Stimulated by new ecology-driven European and national regulations, news routes of recycling waste appear on the market. Since food packages represent a large percentage of the plastics consumption and since they have a short lifetime, an important approach consists in making new packages from post-consumer used packages. On the other hand, food-packaging regulations in Europe require that packaging materials must be safe. Therefore, potential mass transfer (migration) of harmful recycling-related substances to the food must be excluded and test methods to ensure the safety-in-use of recycled materials for food packaging are needled. As a consequence of this situation, a European research project FAIR-CT98-4318, with the acronym 'Recyclability', was initiated. The project consists of three sections each focusing on a different class of recycled materials: polyethylene terephthalate (PET), paper and board, and plastics covered by functional barriers. The project consortium consists of 28 project members from 11 EU countries. In addition, the project is during its lifetime in discussion with the US Food and Drug Administrations (FDA) to consider also US FDA regulatory viewpoints and to aim, as a consequence, to harmonizable conclusions and recommendations. The paper introduces the project and presents an overview of the project work progress.

  1. Smart parking barrier

    KAUST Repository

    Alharbi, Abdulrazaq M.

    2016-01-01

    positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking

  2. [11C]befloxatone brain kinetics is not influenced by Bcrp function at the blood-brain barrier: A PET study using Bcrp TGEM knockout rats

    International Nuclear Information System (INIS)

    Hosten, Benoit; Jacob, Aude; Saubamea, Bruno; Scherrmann, Jean-Michel; Boisgard, Raphael; Goutal, Sebastien; Dolle, Frederic; Tournier, Nicolas; Cisternino, Salvatore

    2013-01-01

    Knockout (KO) animals are useful tools with which to assess the interplay between P-glycoprotein (P-gp; Abcb1) and the breast cancer resistance protein (Bcrp, Abcg2), two major ABC-transporters expressed at the blood-brain barrier (BBB). However, one major drawback of such deficient models is the possible involvement of compensation between transporters. In the present study, P-gp and Bcrp distribution in the brain as well as P-gp expression levels at the BBB were compared between the Bcrp TGEM KO rat model and the wild-type (WT) strain. Therefore, we used confocal microscopy of brain slices and western blot analysis of the isolated brain microvessels forming the BBB. This deficient rat model was used to assess the influence of Bcrp on the brain and peripheral kinetics of its substrate [ 11 C]befloxatone using positron emission tomography (PET). The influence of additional P-gp inhibition was tested using elacridar (GF120918) 2 mg/kg in Bcrp KO rats. The distribution pattern of P-gp in the brain as well as P-gp expression levels at the BBB was similar in Bcrp-deficient and WT rats. Brain and peripheral kinetics of [ 11 C]befloxatone were not influenced by the lack of Bcrp. Neither was the brain uptake of [ 11 C]befloxatone in Bcrp-deficient rats influenced by the inhibition of P-gp. In conclusion, the Bcrp-deficient rat strain, in which we detected no compensatory mechanism or modification of P-gp expression as compared to WT rats, is a suitable model to study Bcrp function separately from that of P-gp at the BBB. However, although selectively transported by BCRP in vitro, our results suggest that [ 11 C]befloxatone PET imaging might not be biased by impaired function of this transporter in vivo. (authors)

  3. A Long-Term Study to Evaluate Acidic Skin Care Treatment in Nursing Home Residents: Impact on Epidermal Barrier Function and Microflora in Aged Skin.

    Science.gov (United States)

    Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna

    2015-08-01

    The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.

  4. Influence of varying Germanium content on the optical function dispersion of Fe{sub 2}MnSi{sub x}Ge{sub 1-x}: An ab initio study

    Energy Technology Data Exchange (ETDEWEB)

    Reshak, Ali H., E-mail: maalidph@yahoo.co.uk [School of Complex Systems, FFPW, CENAKVA, University of South Bohemia in CB, Nove Hrady 37333 (Czech Republic); School of Material Engineering, Malaysia University of Perlis, P.O. Box 77, d/a Pejabat Pos Besar, 01007 Kangar, Perlis (Malaysia); Charifi, Z., E-mail: charifizoulikha@gmail.com [Physics Department, Faculty of Science, University of M' sila, 28000 M' sila (Algeria); Baaziz, H. [Physics Department, Faculty of Science, University of M' sila, 28000 M' sila (Algeria)

    2013-01-15

    The optical dielectric functions of Fe{sub 2}MnSi{sub 1-x}Ge{sub x} alloys for selected concentrations (x=0.0, 0.25, 0.5, 0.75 and 1.0) were investigated. The ferromagnetic Fe{sub 2}MnSi{sub x}Ge{sub 1-x} is semiconducting with optical band gaps 0.507, 0.531, 0.539, 0.514 and 0.547 eV for the minority spin and is metallic for the majority spin. From the calculated results the half-metallic character and stability of ferromagnetic state for Fe{sub 2}MnSi{sub x}Ge{sub 1-x} is determined. The total magnetic moment is found to be 3.0{mu}{sub B} for all alloys with the most contribution from Mn local magnetic moments. Iron atoms however exhibit much smaller spin moments, about 10% of the bulk value, and the sp atoms have induced magnetic moments due to the proximity of Fe first nearest neighbors, which couple antiferromagnetically with Fe and Mn spin moments. We have employed full-potential linearized augmented plane wave method based on spin-polarized density functional theory. The generalized gradient approximation exchange-correlation potential was used. The edge of optical absorption for {epsilon}{sub 2}({omega}) of spin-down varies between 0.507 (Fe{sub 2}MnGe) and 0.547 eV (Fe{sub 2}MnSi). Since the spin-up shows metallic nature, the Drude term was included in the spin-up optical dielectric functions. This confirms our finding that these materials are half-metallic. Furthermore, the reflectivity, refractivity and the absorption coefficient were calculated. These results show that the materials possess half-metallic character. - Highlights: Black-Right-Pointing-Pointer The optical dielectric functions of Fe{sub 2}MnSi{sub 1-x}Ge{sub x} were investigated. Black-Right-Pointing-Pointer Fe{sub 2}MnSi{sub x}Ge{sub 1-x} is semiconducting for majority spin and is metallic for minority spin. Black-Right-Pointing-Pointer The total magnetic moment is found to be 3.0{mu}{sub B} for all alloys. Black-Right-Pointing-Pointer The edge of optical absorption for {epsilon}{sub 2

  5. Dual Function of Novel Pollen Coat (Surface) Proteins: IgE-binding Capacity and Proteolytic Activity Disrupting the Airway Epithelial Barrier

    Science.gov (United States)

    Bashir, Mohamed Elfatih H.; Ward, Jason M.; Cummings, Matthew; Karrar, Eltayeb E.; Root, Michael; Mohamed, Abu Bekr A.; Naclerio, Robert M.; Preuss, Daphne

    2013-01-01

    Background The pollen coat is the first structure of the pollen to encounter the mucosal immune system upon inhalation. Prior characterizations of pollen allergens have focused on water-soluble, cytoplasmic proteins, but have overlooked much of the extracellular pollen coat. Due to washing with organic solvents when prepared, these pollen coat proteins are typically absent from commercial standardized allergenic extracts (i.e., “de-fatted”), and, as a result, their involvement in allergy has not been explored. Methodology/Principal Findings Using a unique approach to search for pollen allergenic proteins residing in the pollen coat, we employed transmission electron microscopy (TEM) to assess the impact of organic solvents on the structural integrity of the pollen coat. TEM results indicated that de-fatting of Cynodon dactylon (Bermuda grass) pollen (BGP) by use of organic solvents altered the structural integrity of the pollen coat. The novel IgE-binding proteins of the BGP coat include a cysteine protease (CP) and endoxylanase (EXY). The full-length cDNA that encodes the novel IgE-reactive CP was cloned from floral RNA. The EXY and CP were purified to homogeneity and tested for IgE reactivity. The CP from the BGP coat increased the permeability of human airway epithelial cells, caused a clear concentration-dependent detachment of cells, and damaged their barrier integrity. Conclusions/Significance Using an immunoproteomics approach, novel allergenic proteins of the BGP coat were identified. These proteins represent a class of novel dual-function proteins residing on the coat of the pollen grain that have IgE-binding capacity and proteolytic activity, which disrupts the integrity of the airway epithelial barrier. The identification of pollen coat allergens might explain the IgE-negative response to available skin-prick-testing proteins in patients who have positive symptoms. Further study of the role of these pollen coat proteins in allergic responses is

  6. Dual function of novel pollen coat (surface proteins: IgE-binding capacity and proteolytic activity disrupting the airway epithelial barrier.

    Directory of Open Access Journals (Sweden)

    Mohamed Elfatih H Bashir

    Full Text Available BACKGROUND: The pollen coat is the first structure of the pollen to encounter the mucosal immune system upon inhalation. Prior characterizations of pollen allergens have focused on water-soluble, cytoplasmic proteins, but have overlooked much of the extracellular pollen coat. Due to washing with organic solvents when prepared, these pollen coat proteins are typically absent from commercial standardized allergenic extracts (i.e., "de-fatted", and, as a result, their involvement in allergy has not been explored. METHODOLOGY/PRINCIPAL FINDINGS: Using a unique approach to search for pollen allergenic proteins residing in the pollen coat, we employed transmission electron microscopy (TEM to assess the impact of organic solvents on the structural integrity of the pollen coat. TEM results indicated that de-fatting of Cynodon dactylon (Bermuda grass pollen (BGP by use of organic solvents altered the structural integrity of the pollen coat. The novel IgE-binding proteins of the BGP coat include a cysteine protease (CP and endoxylanase (EXY. The full-length cDNA that encodes the novel IgE-reactive CP was cloned from floral RNA. The EXY and CP were purified to homogeneity and tested for IgE reactivity. The CP from the BGP coat increased the permeability of human airway epithelial cells, caused a clear concentration-dependent detachment of cells, and damaged their barrier integrity. CONCLUSIONS/SIGNIFICANCE: Using an immunoproteomics approach, novel allergenic proteins of the BGP coat were identified. These proteins represent a class of novel dual-function proteins residing on the coat of the pollen grain that have IgE-binding capacity and proteolytic activity, which disrupts the integrity of the airway epithelial barrier. The identification of pollen coat allergens might explain the IgE-negative response to available skin-prick-testing proteins in patients who have positive symptoms. Further study of the role of these pollen coat proteins in allergic

  7. Adaptive Neural Network Control for Nonlinear Hydraulic Servo-System with Time-Varying State Constraints

    Directory of Open Access Journals (Sweden)

    Shu-Min Lu

    2017-01-01

    Full Text Available An adaptive neural network control problem is addressed for a class of nonlinear hydraulic servo-systems with time-varying state constraints. In view of the low precision problem of the traditional hydraulic servo-system which is caused by the tracking errors surpassing appropriate bound, the previous works have shown that the constraint for the system is a good way to solve the low precision problem. Meanwhile, compared with constant constraints, the time-varying state constraints are more general in the actual systems. Therefore, when the states of the system are forced to obey bounded time-varying constraint conditions, the high precision tracking performance of the system can be easily realized. In order to achieve this goal, the time-varying barrier Lyapunov function (TVBLF is used to prevent the states from violating time-varying constraints. By the backstepping design, the adaptive controller will be obtained. A radial basis function neural network (RBFNN is used to estimate the uncertainties. Based on analyzing the stability of the hydraulic servo-system, we show that the error signals are bounded in the compacts sets; the time-varying state constrains are never violated and all singles of the hydraulic servo-system are bounded. The simulation and experimental results show that the tracking accuracy of system is improved and the controller has fast tracking ability and strong robustness.

  8. Bifidobacterium longum CCM 7952 Promotes Epithelial Barrier Function and Prevents Acute DSS-Induced Colitis in Strictly Strain-Specific Manner.

    Directory of Open Access Journals (Sweden)

    Dagmar Srutkova

    Full Text Available Reduced microbial diversity has been associated with inflammatory bowel disease (IBD and probiotic bacteria have been proposed for its prevention and/or treatment. Nevertheless, comparative studies of strains of the same subspecies for specific health benefits are scarce. Here we compared two Bifidobacterium longum ssp. longum strains for their capacity to prevent experimental colitis.Immunomodulatory properties of nine probiotic bifidobacteria were assessed by stimulation of murine splenocytes. The immune responses to B. longum ssp. longum CCM 7952 (Bl 7952 and CCDM 372 (Bl 372 were further characterized by stimulation of bone marrow-derived dendritic cell, HEK293/TLR2 or HEK293/NOD2 cells. A mouse model of dextran sulphate sodium (DSS-induced colitis was used to compare their beneficial effects in vivo.The nine bifidobacteria exhibited strain-specific abilities to induce cytokine production. Bl 372 induced higher levels of both pro- and anti-inflammatory cytokines in spleen and dendritic cell cultures compared to Bl 7952. Both strains engaged TLR2 and contain ligands for NOD2. In a mouse model of DSS-induced colitis, Bl 7952, but not Bl 372, reduced clinical symptoms and preserved expression of tight junction proteins. Importantly, Bl 7952 improved intestinal barrier function as demonstrated by reduced FITC-dextran levels in serum.We have shown that Bl 7952, but not Bl 372, protected mice from the development of experimental colitis. Our data suggest that although some immunomodulatory properties might be widespread among the genus Bifidobacterium, others may be rare and characteristic only for a specific strain. Therefore, careful selection might be crucial in providing beneficial outcome in clinical trials with probiotics in IBD.

  9. Coral-macroalgal phase shifts or reef resilience: links with diversity and functional roles of herbivorous fishes on the Great Barrier Reef

    Science.gov (United States)

    Cheal, A. J.; MacNeil, M. Aaron; Cripps, E.; Emslie, M. J.; Jonker, M.; Schaffelke, B.; Sweatman, H.

    2010-12-01

    Changes from coral to macroalgal dominance following disturbances to corals symbolize the global degradation of coral reefs. The development of effective conservation measures depends on understanding the causes of such phase shifts. The prevailing view that coral-macroalgal phase shifts commonly occur due to insufficient grazing by fishes is based on correlation with overfishing and inferences from models and small-scale experiments rather than on long-term quantitative field studies of fish communities at affected and resilient sites. Consequently, the specific characteristics of herbivorous fish communities that most promote reef resilience under natural conditions are not known, though this information is critical for identifying vulnerable ecosystems. In this study, 11 years of field surveys recorded the development of the most persistent coral-macroalgal phase shift (>7 years) yet observed on Australia’s Great Barrier Reef (GBR). This shift followed extensive coral mortality caused by thermal stress (coral bleaching) and damaging storms. Comparisons with two similar reefs that suffered similar disturbances but recovered relatively rapidly demonstrated that the phase shift occurred despite high abundances of one herbivore functional group (scraping/excavating parrotfishes: Labridae). However, the shift was strongly associated with low fish herbivore diversity and low abundances of algal browsers (predominantly Siganidae) and grazers/detritivores (Acanthuridae), suggesting that one or more of these factors underpin reef resilience and so deserve particular protection. Herbivorous fishes are not harvested on the GBR, and the phase shift was not enhanced by unusually high nutrient levels. This shows that unexploited populations of herbivorous fishes cannot ensure reef resilience even under benign conditions and suggests that reefs could lose resilience under relatively low fishing pressure. Predictions of more severe and widespread coral mortality due to global

  10. Functional Expression of P-glycoprotein and Organic Anion Transporting Polypeptides at the Blood-Brain Barrier: Understanding Transport Mechanisms for Improved CNS Drug Delivery?

    Science.gov (United States)

    Abdullahi, Wazir; Davis, Thomas P; Ronaldson, Patrick T

    2017-07-01

    Drug delivery to the central nervous system (CNS) is greatly limited by the blood-brain barrier (BBB). Physical and biochemical properties of the BBB have rendered treatment of CNS diseases, including those with a hypoxia/reoxygenation (H/R) component, extremely difficult. Targeting endogenous BBB transporters from the ATP-binding cassette (ABC) superfamily (i.e., P-glycoprotein (P-gp)) or from the solute carrier (SLC) family (i.e., organic anion transporting polypeptides (OATPs in humans; Oatps in rodents)) has been suggested as a strategy that can improve delivery of drugs to the brain. With respect to P-gp, direct pharmacological inhibition using small molecules or selective regulation by targeting intracellular signaling pathways has been explored. These approaches have been largely unsuccessful due to toxicity issues and unpredictable pharmacokinetics. Therefore, our laboratory has proposed that optimization of CNS drug delivery, particularly for treatment of diseases with an H/R component, can be achieved by targeting Oatp isoforms at the BBB. As the major drug transporting Oatp isoform, Oatp1a4 has demonstrated blood-to-brain transport of substrate drugs with neuroprotective properties. Furthermore, our laboratory has shown that targeting Oatp1a4 regulation (i.e., TGF-β signaling mediated via the ALK-1 and ALK-5 transmembrane receptors) represents an opportunity to control Oatp1a4 functional expression for the purpose of delivering therapeutics to the CNS. In this review, we will discuss limitations of targeting P-gp-mediated transport activity and the advantages of targeting Oatp-mediated transport. Through this discussion, we will also provide critical information on novel approaches to improve CNS drug delivery by targeting endogenous uptake transporters expressed at the BBB.

  11. Influence of dietary inclusion of Bacillus licheniformis on laying performance, egg quality, antioxidant enzyme activities, and intestinal barrier function of laying hens.

    Science.gov (United States)

    Lei, K; Li, Y L; Yu, D Y; Rajput, I R; Li, W F

    2013-09-01

    This experiment was conducted to evaluate the effects of dietary inclusion of Bacillus licheniformis on laying performance, egg quality, antioxidant enzyme activities, and intestinal barrier function of laying hens. Hy-Line Variety W-36 hens (n = 540; 28 wk of age) were randomized into 6 groups, each group with 6 replications (n = 15). The control group received the basal diet formulated with maize and soybean meal. The treatment groups received the same basal diets supplemented with 0.01, 0.02, 0.03, 0.06, and 0.09% Bacillus licheniformis powder (2 × 10(10) cfu/g) for an 8-wk trial. The results showed that dietary supplementation with 0.01 and 0.03% B. licheniformis significantly increased egg production and egg mass. However, no significant differences were observed in egg weight, feed consumption, and feed conversion efficiency among the 6 groups. Supplementation with different levels of B. licheniformis was found to be effective in improvement of egg quality by increasing egg shell thickness and strength. Compared with control, d-lactate content, diamine oxidase activity, and adrenocorticotropic hormone level in serum decreased significantly, and the level of estradiol and follicle-stimulating hormone increased significantly in plasma of all the experimental groups. Dietary supplementation with B. licheniformis increased the intestinal villus height and reduced the crypt depth. In conclusion, dietary inclusion of B. licheniformis could improve laying performance and egg quality significantly in a dose-dependent manner by decreasing the stress response, upregulating the growth hormone, and improving intestinal health.

  12. The Schottky energy barrier dependence of charge injection in organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, I.H.; Davids, P.S.; Smith, D.L. [Los Alamos National Laboratory, Los Alamos, New Mexico87545 (United States); Barashkov, N.N.; Ferraris, J.P. [The University of Texas at Dallas, Richardson, Texas75083 (United States)

    1998-04-01

    We present device model calculations of the current{endash}voltage (I{endash}V) characteristics of organic diodes and compare them with measurements of structures fabricated using MEH-PPV. The structures are designed so that all of the current is injected from one contact. The I{endash}V characteristics are considered as a function of the Schottky energy barrier to charge injection from the contact. Experimentally, the Schottky barrier is varied from essentially zero to more than 1 eV by using different metal contacts. A consistent description of the device I{endash}V characteristics is obtained as the Schottky barrier is varied from small values, less than about 0.4 eV, where the current flow is space-charge limited to larger values where it is contact limited. {copyright} {ital 1998 American Institute of Physics.}

  13. The Schottky energy barrier dependence of charge injection in organic light-emitting diodes

    Science.gov (United States)

    Campbell, I. H.; Davids, P. S.; Smith, D. L.; Barashkov, N. N.; Ferraris, J. P.

    1998-04-01

    We present device model calculations of the current-voltage (I-V) characteristics of organic diodes and compare them with measurements of structures fabricated using MEH-PPV. The structures are designed so that all of the current is injected from one contact. The I-V characteristics are considered as a function of the Schottky energy barrier to charge injection from the contact. Experimentally, the Schottky barrier is varied from essentially zero to more than 1 eV by using different metal contacts. A consistent description of the device I-V characteristics is obtained as the Schottky barrier is varied from small values, less than about 0.4 eV, where the current flow is space-charge limited to larger values where it is contact limited.

  14. A theoretical study of resonant tunneling characteristics in triangular double-barrier diodes

    International Nuclear Information System (INIS)

    Wang Hongmei; Xu Huaizhe; Zhang Yafei

    2006-01-01

    Resonant tunneling characteristics of triangular double-barrier diodes have been investigated systematically in this Letter, using Airy function approach to solve time-independent Schroedinger function in triangular double-barrier structures. Originally, the exact analytic expressions of quasi-bound levels and quasi-level lifetime in symmetrical triangular double-barrier structures have been derived within the effective-mass approximation as a function of structure parameters including well width, slope width and barrier height. Based on our derived analytic expressions, numerical results show that quasi-bound levels and quasi-level lifetime vary nearly linearly with the structure parameters except that the second quasi-level lifetime changes parabolically with slope width. Furthermore, according to our improved transmission coefficient of triangular double-barrier structures under external electric field, the current densities of triangular double-barrier diodes with different slope width at 0 K have been calculated numerically. The results show that the N-shaped negative differential resistance behaviors have been observed in current-voltage characteristics and current-voltage characteristics depend on the slope width

  15. Structure information from fusion barriers

    Indian Academy of Sciences (India)

    Pb, using the coupled reaction channel (CRC) method and correct structure information, have been analysed. The barrier distributions derived from these excitation functions including many of the significant channels are featureless, although these channels have considerable effects on the fusion excitation function.

  16. Barriers to Physical Activity in Individuals with Spinal Cord Injury

    DEFF Research Database (Denmark)

    Roberton, Terri; Bucks, Romola S.; Skinner, Timothy C.

    2011-01-01

    This study examined barriers to physical activity reported individuals with spinal cord injury (SCI) and the degree to which these barriers differed across varying degrees of independence. Participants were 65 individuals recruited from the Western Australian Spinal Cord Injury database. Data...... on physical activity participation and perceived barriers to physical activity participation were collected using a cross-sectional survey and analysed using independent samples t-tests. We found that, regardless of level of ambulation or ability to transfer, few participants reported being physically active....... While there were no significant differences in the amount of barriers reported by individuals with different levels of independence, the type of barriers reported varied across groups....

  17. Long-term reliable physically unclonable function based on oxide tunnel barrier breakdown on two-transistors two-magnetic-tunnel-junctions cell-based embedded spin transfer torque magnetoresistive random access memory

    Science.gov (United States)

    Takaya, Satoshi; Tanamoto, Tetsufumi; Noguchi, Hiroki; Ikegami, Kazutaka; Abe, Keiko; Fujita, Shinobu

    2017-04-01

    Among the diverse applications of spintronics, security for internet-of-things (IoT) devices is one of the most important. A physically unclonable function (PUF) with a spin device (spin transfer torque magnetoresistive random access memory, STT-MRAM) is presented. Oxide tunnel barrier breakdown is used to realize long-term stability for PUFs. A secure PUF has been confirmed by evaluating the Hamming distance of a 32-bit STT-MRAM-PUF fabricated using 65 nm CMOS technology.

  18. Efficacy of IPL device combined with intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with regards to the recovery of skin barrier function: A pilot study.

    Science.gov (United States)

    Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun

    2015-10-01

    Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.

  19. The effects of fluorouracil, epirubicin, and cyclophosphamide (FEC60 on the intestinal barrier function and gut peptides in breast cancer patients: an observational study

    Directory of Open Access Journals (Sweden)

    Russo Francesco

    2013-02-01

    Full Text Available Abstract Background Several GI peptides linked to intestinal barrier function could be involved in the modification of intestinal permeability and the onset of diarrhea during adjuvant chemotherapy. The aim of the study was to evaluate the circulating levels of zonulin, glucagon-like peptide-2 (GLP-2, epidermal growth factor (EGF and ghrelin and their relationship with intestinal permeability and chemotherapy induced diarrhea (CTD. Methods Sixty breast cancer patients undergoing an FEC60 regimen were enrolled, 37 patients completed the study. CTD(+ patients were discriminated by appropriate questionnaire and criteria. During chemotherapy, intestinal permeability was assessed by lactulose/mannitol urinary test on day 0 and day 14. Zonulin, GLP-2, EGF and ghrelin circulating levels were evaluated by ELISA tests at five time-points (days 0, 3, 10, 14, and 21. Results During FEC60 administration, the lactulose/mannitol ratio was significantly higher on day 14 than at baseline. Zonulin levels were not affected by chemotherapy, whereas GLP-2 and EGF levels decreased significantly. GLP-2 levels on day 14 were significantly lower than those on day 0 and day 3, while EGF values were significantly lower on day 10 than at the baseline. In contrast, the total concentrations of ghrelin increased significantly at day 3 compared to days 0 and 21, respectively. Ten patients (27% suffered from diarrhea. On day 14 of chemotherapy, a significant increase of the La/Ma ratio occurred in CTD(+ patients compared to CTD(− patients. With regards to circulating gut peptides, the AUCg of GLP-2 and ghrelin were significantly lower and higher in CTD(+ patients than CTD(− ones, respectively. Finally in CTD(+ patients a significant and inverse correlation between GLP-2 and La/Ma ratio was found on day 14. Conclusions Breast cancer patients undergoing FEC60 showed alterations in the intestinal permeability, which was associated with modifications in the levels of GLP-2

  20. The effects of fluorouracil, epirubicin, and cyclophosphamide (FEC60) on the intestinal barrier function and gut peptides in breast cancer patients: an observational study.

    Science.gov (United States)

    Russo, Francesco; Linsalata, Michele; Clemente, Caterina; D'Attoma, Benedetta; Orlando, Antonella; Campanella, Giovanna; Giotta, Francesco; Riezzo, Giuseppe

    2013-02-04

    Several GI peptides linked to intestinal barrier function could be involved in the modification of intestinal permeability and the onset of diarrhea during adjuvant chemotherapy. The aim of the study was to evaluate the circulating levels of zonulin, glucagon-like peptide-2 (GLP-2), epidermal growth factor (EGF) and ghrelin and their relationship with intestinal permeability and chemotherapy induced diarrhea (CTD). Sixty breast cancer patients undergoing an FEC60 regimen were enrolled, 37 patients completed the study. CTD(+) patients were discriminated by appropriate questionnaire and criteria. During chemotherapy, intestinal permeability was assessed by lactulose/mannitol urinary test on day 0 and day 14. Zonulin, GLP-2, EGF and ghrelin circulating levels were evaluated by ELISA tests at five time-points (days 0, 3, 10, 14, and 21). During FEC60 administration, the lactulose/mannitol ratio was significantly higher on day 14 than at baseline. Zonulin levels were not affected by chemotherapy, whereas GLP-2 and EGF levels decreased significantly. GLP-2 levels on day 14 were significantly lower than those on day 0 and day 3, while EGF values were significantly lower on day 10 than at the baseline. In contrast, the total concentrations of ghrelin increased significantly at day 3 compared to days 0 and 21, respectively. Ten patients (27%) suffered from diarrhea. On day 14 of chemotherapy, a significant increase of the La/Ma ratio occurred in CTD(+) patients compared to CTD(-) patients. With regards to circulating gut peptides, the AUCg of GLP-2 and ghrelin were significantly lower and higher in CTD(+) patients than CTD(-) ones, respectively. Finally in CTD(+) patients a significant and inverse correlation between GLP-2 and La/Ma ratio was found on day 14. Breast cancer patients undergoing FEC60 showed alterations in the intestinal permeability, which was associated with modifications in the levels of GLP-2, ghrelin and EGF. In CTD(+) patients, a different GI peptide

  1. Sprache als Barriere (Language as a Barrier)

    Science.gov (United States)

    Mattheier, Klaus

    1974-01-01

    The concept of language barrier has its derivations in the fields of dialectology, sociology and psychology. In contemporary usage however, the concept has two meanings i.e. regional-cultural barrier and socio-cultural barrier. (Text is in German.) (DS)

  2. The effects of probiotics on barrier function and mucosal pouch microbiota during maintenance treatment for severe pouchitis in patients with ulcerative colitis

    NARCIS (Netherlands)

    Persborn, M.; Gerritsen, J.; Wallon, C.; Carlsson, A.; Akkermans, L.M.A.; Soderholm, J.D.

    2013-01-01

    Background A total of 10-15% of patients with an ileoanal pouch develop severe pouchitis necessitating long-term use of antibiotics or pouch excision. Probiotics reduce the risk of recurrence of pouchitis, but mechanisms behind these effects are not fully understood. Aim To examine mucosal barrier

  3. Time evolution of the Clay Barrier Chemistry in a HLW deep geological disposal in granite

    International Nuclear Information System (INIS)

    Font, I.; Miguel, M. J.; Juncosa, R.

    2000-01-01

    The main goal of a high level waste geological disposal is to guarantee the waste isolation from the biosphere, locking them away into very deep geological formations. The best way to assure the isolation is by means of a multiple barrier system. These barriers, in a serial disposition, should assure the confinement function of the disposal system. Two kinds of barriers are considered: natural barriers (geological formations) and engineered barriers (waste form, container and backfilling and sealing materials). Bentonite is selected as backfilling and sealing materials for HLW disposal into granite formations, due to its very low permeability and its ability to fill the remaining spaces. bentonite has also other interesting properties, such as, the radionuclide retention capacity by sorption processes. Once the clay barrier has been placed, the saturation process starts. The granite groundwater fills up the voids of the bentonite and because of the chemical interactions, the groundwater chemical composition varies. Near field processes, such as canister corrosion, waste leaching and radionuclide release, strongly depends on the water chemical composition. Bentonite pore water composition is such a very important feature of the disposal system and its determination and its evolution have great relevance in the HLW deep geological disposal performance assessment. The process used for the determination of the clay barrier pore water chemistry temporal evolution, and its influence on the performance assessment, are presented in this paper. (Author)

  4. Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

    Science.gov (United States)

    Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.

    2016-01-01

    Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

  5. Measuring solvent barrier properties of paper

    International Nuclear Information System (INIS)

    Bollström, Roger; Saarinen, Jarkko J; Toivakka, Martti; Räty, Jukka

    2012-01-01

    New methods for measuring barrier properties against solvents, acids and bases on dispersion coated paper were developed and investigated. Usability, reliability and repeatability were compared both between the new methods and with the standardized method for measuring barrier properties against water vapor. Barrier properties could be measured with all methods and the results obtained by the different methods were in correlation with each other. A qualitative method based on a trace color provided an indicative result, whereas further developed methods also took into account the durability. The effective barrier lifetime could be measured by measuring the conductivity through the substrate as a function of time, or by utilizing a glass prism where the change in refractive index caused by penetrated liquid was monitored, also as a function of time. Barrier properties against water and humidity were also measured and were found not to be predictors for barrier properties against either solvents, or acids or bases, which supports the need to develop new methods

  6. Contact-metamorphic illitization and related consequences for the functioning of backfill barriers in high level radioactive waste repositories (South Africa)

    International Nuclear Information System (INIS)

    Buehmann, C.

    2000-01-01

    A clay barrier, consisting of smectite, is common to most disposal designs for HLW repositories. Concerns are that elevated temperatures and long time periods may alter the two properties, the barrier is employed: a high swelling as well as cation exchange capacity (CEC). A ''natural analogue'' approach has therefore been attempted to predict smectite characteristics and stability in relation to time/temperature. The following investigations were performed in order to determine changes in swelling capacity and CEC: (1) Conversion of smectite to other clay minerals. (2) Changes in the layer charge characteristics of the clay minerals. (3) Swelling potential measurements of the smectitic interlayer. Smectite was thermally unstable and transformed into illite via illite/smectite interstratifications (I/S) and chlorite at temperature exceeding about 100 deg. C. The swelling potential was directly related to the proportion of smectite. As a conclusion it can be stated that elevated temperatures (> 70 deg. C) result in the transformation of smectite into illite. For backfill purposes it is recommended that the clay content in the backfill barrier should be as high as technically possible and that mixing the bentonite with K-bearing minerals (granite) should be avoided. (author)

  7. Micro pore arrays in free standing cyclic olefin copolymer membranes: fabrication and surface functionalization strategies for in-vitro barrier tissue models

    Science.gov (United States)

    Gel, M.; Kandasamy, S.; Cartledge, K.; Be, C. L.; Haylock, D.

    2013-12-01

    In recent years there has been growing interest in micro engineered in-vitro models of tissues and organs. These models are designed to mimic the in-vivo like physiological conditions with a goal to study human physiology in an organ-specific context or to develop in-vitro disease models. One of the challenges in the development of these models is the formation of barrier tissues in which the permeability is controlled locally by the tissues cultured at the interface. In-vitro models of barrier tissues are typically created by generating a monolayer of cells grown on thin porous membranes. This paper reports a robust preparation method for free standing porous cyclic olefin copolymer (COC) membranes. We also demonstrate that gelatin coated membranes facilitate formation of highly confluent monolayer of HUVECs. Membranes with thickness in the range of 2-3 um incorporating micro pores with diameter approximately 20 um were fabricated and integrated with microfluidic channels. The performance of the device was demonstrated with a model system mimicking the endothelial barrier in bone marrow sinusoids.

  8. Smart parking barrier

    KAUST Repository

    Alharbi, Abdulrazaq M.

    2016-05-06

    Various methods and systems are provided for smart parking barriers. In one example, among others, a smart parking barrier system includes a movable parking barrier located at one end of a parking space, a barrier drive configured to control positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking space and a second position that allows access to the parking space. The parking controller can initiate movement of the movable parking barrier in response to a positive identification of an individual allowed to use the parking space. The parking controller can identify the individual through, e.g., a RFID tag, a mobile device (e.g., a remote control, smartphone, tablet, etc.), an access card, biometric information, or other appropriate identifier.

  9. Barrier mechanisms in the Drosophila blood-brain barrier.

    Science.gov (United States)

    Hindle, Samantha J; Bainton, Roland J

    2014-01-01

    The invertebrate blood-brain barrier (BBB) field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through G-protein coupled receptor signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate BBB has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many BBB mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the BBB can govern whole animal physiologies. This includes novel functions of BBB gap junctions in orchestrating synchronized neuroblast proliferation, and of BBB secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate BBB anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.

  10. Primary angle closure glaucoma (PACG) susceptibility gene PLEKHA7 encodes a novel Rac1/Cdc42 GAP that modulates cell migration and blood-aqueous barrier function.

    Science.gov (United States)

    Lee, Mei-Chin; Shei, William; Chan, Anita S; Chua, Boon-Tin; Goh, Shuang-Ru; Chong, Yaan-Fun; Hilmy, Maryam H; Nongpiur, Monisha E; Baskaran, Mani; Khor, Chiea-Chuen; Aung, Tin; Hunziker, Walter; Vithana, Eranga N

    2017-10-15

    PLEKHA7, a gene recently associated with primary angle closure glaucoma (PACG), encodes an apical junctional protein expressed in components of the blood aqueous barrier (BAB). We found that PLEKHA7 is down-regulated in lens epithelial cells and in iris tissue of PACG patients. PLEKHA7 expression also correlated with the C risk allele of the sentinel SNP rs11024102 with the risk allele carrier groups having significantly reduced PLEKHA7 levels compared to non-risk allele carriers. Silencing of PLEKHA7 in human immortalized non-pigmented ciliary epithelium (h-iNPCE) and primary trabecular meshwork cells, which are intimately linked to BAB and aqueous humor outflow respectively, affected actin cytoskeleton organization. PLEKHA7 specifically interacts with GTP-bound Rac1 and Cdc42, but not RhoA, and the activation status of the two small GTPases is linked to PLEKHA7 expression levels. PLEKHA7 stimulates Rac1 and Cdc42 GTP hydrolysis, without affecting nucleotide exchange, identifying PLEKHA7 as a novel Rac1/Cdc42 GAP. Consistent with the regulatory role of Rac1 and Cdc42 in maintaining the tight junction permeability, silencing of PLEKHA7 compromises the paracellular barrier between h-iNPCE cells. Thus, downregulation of PLEKHA7 in PACG may affect BAB integrity and aqueous humor outflow via its Rac1/Cdc42 GAP activity, thereby contributing to disease etiology. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Ginsenoside Rg1 nanoparticle penetrating the blood–brain barrier to improve the cerebral function of diabetic rats complicated with cerebral infarction

    Directory of Open Access Journals (Sweden)

    Shen J

    2017-09-01

    Full Text Available Junyi Shen, Zhiming Zhao, Wei Shang, Chunli Liu, Beibei Zhang, Lingjie Zhao, Hui Cai Department of Integrated Traditional and Western Medicine, Jinling Hospital, School of Medicine, Nanjing University, Nanjing, China Abstract: Diabetic cerebral infarction is with poorer prognosis and high rates of mortality. Ginsenoside Rg1 (Rg1 has a wide variety of therapeutic values for central nervous system (CNS diseases for the neuron protective effects. However, the blood–brain barrier (BBB restricts Rg1 in reaching the CNS. In this study, we investigated the therapeutic effects of Rg1 nanoparticle (PHRO, fabricated with γ-PGA, L-PAE (H, Rg1, and OX26 antibody, targeting transferrin receptor, on the diabetes rats complicated with diabetic cerebral infarction in vitro and in vivo. Dynamic light scattering analysis shows the average particle size of PHRO was 79±18 nm and the polydispersity index =0.18. The transmission electron microscope images showed that all NPs were spherical in shape with diameters of 89±23 nm. PHRO released Rg1 with sustained release manner and could promote the migration of cerebrovascular endothelial cells and tube formation and even penetrated the BBB in vitro. PHRO could penetrate the BBB with high concentration in brain tissue to reduce the cerebral infarction volume and promote neuronal recovery in vivo. PHRO was promising to be a clinical treatment of diabetes mellitus with cerebral infarction. Keywords: poly-γ-glutamic acid, ginsenoside Rg1, OX26, blood–brain barrier

  12. Adaptive fuzzy dynamic surface control of nonlinear systems with input saturation and time-varying output constraints

    Science.gov (United States)

    Edalati, L.; Khaki Sedigh, A.; Aliyari Shooredeli, M.; Moarefianpour, A.

    2018-02-01

    This paper deals with the design of adaptive fuzzy dynamic surface control for uncertain strict-feedback nonlinear systems with asymmetric time-varying output constraints in the presence of input saturation. To approximate the unknown nonlinear functions and overcome the problem of explosion of complexity, a Fuzzy logic system is combined with the dynamic surface control in the backstepping design technique. To ensure the output constraints satisfaction, an asymmetric time-varying Barrier Lyapunov Function (BLF) is used. Moreover, by applying the minimal learning parameter technique, the number of the online parameters update for each subsystem is reduced to 2. Hence, the semi-globally uniformly ultimately boundedness (SGUUB) of all the closed-loop signals with appropriate tracking error convergence is guaranteed. The effectiveness of the proposed control is demonstrated by two simulation examples.

  13. Time-varying Crash Risk

    DEFF Research Database (Denmark)

    Christoffersen, Peter; Feunoua, Bruno; Jeon, Yoontae

    We estimate a continuous-time model with stochastic volatility and dynamic crash probability for the S&P 500 index and find that market illiquidity dominates other factors in explaining the stock market crash risk. While the crash probability is time-varying, its dynamic depends only weakly on re...

  14. Eestlased Karlovy Varys / J. R.

    Index Scriptorium Estoniae

    J. R.

    2007-01-01

    Ilmar Raagi mängufilm "Klass" osaleb 42. Karlovy Vary rahvusvahelise filmifestivali võistlusprogrammis "East of the West" ja Asko Kase lühimängufilm "Zen läbi prügi" on valitud festivali kõrvalprogrammi "Forum of Independents"

  15. Esmaklassiline Karlovy Vary / Jaanus Noormets

    Index Scriptorium Estoniae

    Noormets, Jaanus

    2007-01-01

    Ilmar Raagi mängufilm "Klass" võitis 42. Karlovy Vary rahvusvahelise filmifestivalil kaks auhinda - ametliku kõrvalvõistlusprogrammi "East of the West" eripreemia "Special mention" ja Euroopa väärtfilmikinode keti Europa Cinemas preemia. Ka Asko Kase lühifilmi "Zen läbi prügi linastumisest ning teistest auhinnasaajatest ning osalejatest

  16. Optimistlik Karlovy Vary / Jaan Ruus

    Index Scriptorium Estoniae

    Ruus, Jaan, 1938-2017

    2007-01-01

    42. Karlovy Vary rahvusvahelise filmifestivali auhinnatud filmidest (žürii esimees Peter Bart). Kristallgloobuse sai Islandi-Saksamaa "Katseklaasilinn" (režii Baltasar Kormakur), parimaks režissööriks tunnistati norralane Bard Breien ("Negatiivse mõtlemise kunst"). Austraallase Michael James Rowlandi "Hea õnne teekond" sai žürii eripreemia

  17. Permeability Barrier Generation in the Martian Lithosphere

    Science.gov (United States)

    Schools, Joe; Montési, Laurent

    2015-11-01

    Permeability barriers develop when a magma produced in the interior of a planet rises into the cooler lithosphere and crystallizes more rapidly than the lithosphere can deform (Sparks and Parmentier, 1991). Crystallization products may then clog the porous network in which melt is propagating, reducing the permeability to almost zero, i.e., forming a permeability barrier. Subsequent melts cannot cross the barrier. Permeability barriers have been useful to explain variations in crustal thickness at mid-ocean ridges on Earth (Magde et al., 1997; Hebert and Montési, 2011; Montési et al., 2011). We explore here under what conditions permeability barriers may form on Mars.We use the MELTS thermodynamic calculator (Ghiorso and Sack, 1995; Ghiorso et al., 2002; Asimow et al., 2004) in conjunction with estimated Martian mantle compositions (Morgan and Anders, 1979; Wänke and Dreibus, 1994; Lodders and Fegley, 1997; Sanloup et al., 1999; Taylor 2013) to model the formation of permeability barriers in the lithosphere of Mars. In order to represent potential past and present conditions of Mars, we vary the lithospheric thickness, mantle potential temperature (heat flux), oxygen fugacity, and water content.Our results show that permeability layers can develop in the thermal boundary layer of the simulated Martian lithosphere if the mantle potential temperature is higher than ~1500°C. The various Martian mantle compositions yield barriers in the same locations, under matching variable conditions. There is no significant difference in barrier location over the range of accepted Martian oxygen fugacity values. Water content is the most significant influence on barrier development as it reduces the temperature of crystallization, allowing melt to rise further into the lithosphere. Our lower temperature and thicker lithosphere model runs, which are likely the most similar to modern Mars, show no permeability barrier generation. Losing the possibility of having a permeability

  18. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of a health claim related to flaxseed oil and vitamin E and maintenance of the skin permeability barrier function pursuant to Article 13(5) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    related to a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function. The food constituent that is the subject of the health claim is a combination of flaxseed oil and vitamin E. The Panel considers that the combination of flaxseed oil and vitamin E...... be drawn from these studies for the scientific substantiation of the claim. The Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function...... is sufficiently characterised. The claimed effect is “contributes to maintain skin permeability barrier function”. The target population proposed by the applicant is healthy adults with dry and sensitive skin. Maintenance of the permeability barrier function of the skin is a beneficial physiological effect...

  19. Therapeutic benefits of enhancing permeability barrier for atopic eczema

    Directory of Open Access Journals (Sweden)

    George Man

    2015-06-01

    Full Text Available The regulatory role of epidermal permeability barrier function in cutaneous inflammation has been well appreciated. While barrier disruption induces cutaneous inflammation, improvement of permeability barrier function alleviates inflammation. Studies have demonstrated that improvement of epidermal permeability barrier function not only prevents the development of atopic eczema, but also delays the relapse of these diseases. Moreover, enhancing the epidermal permeability barrier also alleviates atopic eczema. Furthermore, co-applications of barrier enhancing products with glucocorticoids can increase the therapeutic efficacy and reduce the adverse effects of glucocorticoids in the treatment of atopic eczema. Therefore, utilization of permeability barrier enhancing products alone or in combination with glucocorticoids could be a valuable approach in the treatment of atopic eczema. In this review, we discuss the benefits of improving the epidermal permeability barrier in the management of atopic eczema.

  20. Potential barrier classification by short-time measurement

    International Nuclear Information System (INIS)

    Granot, Er'el; Marchewka, Avi

    2006-01-01

    We investigate the short-time dynamics of a delta-function potential barrier on an initially confined wave packet. There are mainly two conclusions: (A) At short times the probability density of the first particles that passed through the barrier is unaffected by it. (B) When the barrier is absorptive (i.e., its potential is imaginary) it affects the transmitted wave function at shorter times than a real potential barrier. Therefore, it is possible to distinguish between an imaginary and a real potential barrier by measuring its effect at short times only on the transmitting wave function

  1. Potential barrier classification by short-time measurement

    Science.gov (United States)

    Granot, Er'El; Marchewka, Avi

    2006-03-01

    We investigate the short-time dynamics of a delta-function potential barrier on an initially confined wave packet. There are mainly two conclusions: (A) At short times the probability density of the first particles that passed through the barrier is unaffected by it. (B) When the barrier is absorptive (i.e., its potential is imaginary) it affects the transmitted wave function at shorter times than a real potential barrier. Therefore, it is possible to distinguish between an imaginary and a real potential barrier by measuring its effect at short times only on the transmitting wave function.

  2. Curcumin protects intestinal mucosal barrier function of rat enteritis via activation of MKP-1 and attenuation of p38 and NF-κB activation.

    Directory of Open Access Journals (Sweden)

    Wei-Bing Song

    Full Text Available BACKGROUND: Intestinal mucosa barrier (IMB dysfunction results in many notorious diseases for which there are currently few effective treatments. We studied curcumin's protective effect on IMB and examined its mechanism by using methotrexate (MTX induced rat enteritis model and lipopolysaccharide (LPS treated cell death model. METHODOLOGY/PRINCIPAL FINDINGS: Curcumin was intragastrically administrated from the first day, models were made for 7 days. Cells were treated with curcumin for 30 min before exposure to LPS. Rat intestinal mucosa was collected for evaluation of pathological changes. We detected the activities of D-lactate and diamine oxidase (DAO according to previous research and measured the levels of myeloperoxidase (MPO and superoxide dismutase (SOD by colorimetric method. Intercellular adhesion molecule-1 (ICAM-1, tumor necrosis factor α (TNF-α and interleukin 1β (IL-1β were determined by RT-PCR and IL-10 production was determined by ELISA. We found Curcumin decreased the levels of D-lactate, DAO, MPO, ICAM-1, IL-1β and TNF-α, but increased the levels of IL-10 and SOD in rat models. We further confirmed mitogen-activated protein kinase phosphatase-1 (MKP-1 was activated but phospho-p38 was inhibited by curcumin by western blot assay. Finally, NF-κB translocation was monitored by immunofluorescent staining. We showed that curcumin repressed I-κB and interfered with the translocation of NF-κB into nucleus. CONCLUSIONS/SIGNIFICANCE: The effect of curcumin is mediated by the MKP-1-dependent inactivation of p38 and inhibition of NF-κB-mediated transcription. Curcumin, with anti-inflammatory and anti-oxidant activities may be used as an effective reagent for protecting intestinal mucosa barrier and other related intestinal diseases.

  3. Barrier cell sheath formation

    International Nuclear Information System (INIS)

    Kesner, J.

    1980-04-01

    The solution for electrostatic potential within a simply modeled tandem mirror thermal barrier is seen to exhibit a sheath at each edge of the cell. The formation of the sheath requires ion collisionality and the analysis assmes that the collisional trapping rate into the barrier is considerably slower than the barrier pump rate

  4. Nuclear structure and fusion at the barrier

    International Nuclear Information System (INIS)

    Reisdorf, W.

    1985-01-01

    A comparative study of measured fusion excitation functions in the vicinity of the barrier reveals nuclear structure effects, due in particular to the coupling of the fusion process to direct-reaction channels. (orig.)

  5. A comparison of freeway median crash frequency, severity, and barrier strike outcomes by median barrier type.

    Science.gov (United States)

    Russo, Brendan J; Savolainen, Peter T

    2018-08-01

    Median-crossover crashes are among the most hazardous events that can occur on freeways, often resulting in severe or fatal injuries. The primary countermeasure to reduce the occurrence of such crashes is the installation of a median barrier. When installation of a median barrier is warranted, transportation agencies are faced with the decision among various alternatives including concrete barriers, beam guardrail, or high-tension cable barriers. Each barrier type differs in terms of its deflection characteristics upon impact, the required installation and maintenance costs, and the roadway characteristics (e.g., median width) where installation would be feasible. This study involved an investigation of barrier performance through an in-depth analysis of crash frequency and severity data from freeway segments where high-tension cable, thrie-beam, and concrete median barriers were installed. A comprehensive manual review of crash reports was conducted to identify crashes in which a vehicle left the roadway and encroached into the median. This review also involved an examination of crash outcomes when a barrier strike occurred, which included vehicle containment, penetration, or re-direction onto the travel lanes. The manual review of crash reports provided critical supplementary information through narratives and diagrams not normally available through standard fields on police crash report forms. Statistical models were estimated to identify factors that affect the frequency, severity, and outcomes of median-related crashes, with particular emphases on differences between segments with varying median barrier types. Several roadway-, traffic-, and environmental-related characteristics were found to affect these metrics, with results varying across the different barrier types. The results of this study provide transportation agencies with important guidance as to the in-service performance of various types of median barrier. Copyright © 2018 Elsevier Ltd. All rights

  6. (R-[11C]Verapamil PET studies to assess changes in P-glycoprotein expression and functionality in rat blood-brain barrier after exposure to kainate-induced status epilepticus

    Directory of Open Access Journals (Sweden)

    Lammertsma Adriaan A

    2011-01-01

    Full Text Available Abstract Background Increased functionality of efflux transporters at the blood-brain barrier may contribute to decreased drug concentrations at the target site in CNS diseases like epilepsy. In the rat, pharmacoresistant epilepsy can be mimicked by inducing status epilepticus by intraperitoneal injection of kainate, which leads to development of spontaneous seizures after 3 weeks to 3 months. The aim of this study was to investigate potential changes in P-glycoprotein (P-gp expression and functionality at an early stage after induction of status epilepticus by kainate. Methods (R-[11C]verapamil, which is currently the most frequently used positron emission tomography (PET ligand for determining P-gp functionality at the blood-brain barrier, was used in kainate and saline (control treated rats, at 7 days after treatment. To investigate the effect of P-gp on (R-[11C]verapamil brain distribution, both groups were studied without or with co-administration of the P-gp inhibitor tariquidar. P-gp expression was determined using immunohistochemistry in post mortem brains. (R-[11C]verapamil kinetics were analyzed with approaches common in PET research (Logan analysis, and compartmental modelling of individual profiles as well as by population mixed effects modelling (NONMEM. Results All data analysis approaches indicated only modest differences in brain distribution of (R-[11C]verapamil between saline and kainate treated rats, while tariquidar treatment in both groups resulted in a more than 10-fold increase. NONMEM provided most precise parameter estimates. P-gp expression was found to be similar for kainate and saline treated rats. Conclusions P-gp expression and functionality does not seem to change at early stage after induction of anticipated pharmacoresistant epilepsy by kainate.

  7. (R)-[{sup 11}C]Verapamil PET studies to assess changes in P-glycoprotein expression and functionality in rat blood-brain barrier after exposure to kainate-induced status epilepticus

    Energy Technology Data Exchange (ETDEWEB)

    Syvänen, Stina [Division of Pharmacology, LACDR, Leiden University, P.O. Box 9502, 2300 RA Leiden (Netherlands); Luurtsema, Gert [Department of Nuclear Medicine & Molecular Imaging, Groningen University Medical Center, P.O. Box 30.001 9700 RB Groningen (Netherlands); Molthoff, Carla FM; Windhorst, Albert D; Huisman, Marc C; Lammertsma, Adriaan A [Department of Nuclear Medicine & PET Research, VU University Medical Center, P.O. Box 7057, 1007 MB, Amsterdam (Netherlands); Voskuyl, Rob A [Division of Pharmacology, LACDR, Leiden University, P.O. Box 9502, 2300 RA Leiden (Netherlands); Epilepsy Institute of The Netherlands Foundation (SEIN), P.O. Box 21, 2100 AA, Heemstede (Netherlands); Lange, Elizabeth C de [Division of Pharmacology, LACDR, Leiden University, P.O. Box 9502, 2300 RA Leiden (Netherlands)

    2011-01-03

    Increased functionality of efflux transporters at the blood-brain barrier may contribute to decreased drug concentrations at the target site in CNS diseases like epilepsy. In the rat, pharmacoresistant epilepsy can be mimicked by inducing status epilepticus by intraperitoneal injection of kainate, which leads to development of spontaneous seizures after 3 weeks to 3 months. The aim of this study was to investigate potential changes in P-glycoprotein (P-gp) expression and functionality at an early stage after induction of status epilepticus by kainate. (R)-[{sup 11}C]verapamil, which is currently the most frequently used positron emission tomography (PET) ligand for determining P-gp functionality at the blood-brain barrier, was used in kainate and saline (control) treated rats, at 7 days after treatment. To investigate the effect of P-gp on (R)-[{sup 11}C]verapamil brain distribution, both groups were studied without or with co-administration of the P-gp inhibitor tariquidar. P-gp expression was determined using immunohistochemistry in post mortem brains. (R)-[{sup 11}C]verapamil kinetics were analyzed with approaches common in PET research (Logan analysis, and compartmental modelling of individual profiles) as well as by population mixed effects modelling (NONMEM). All data analysis approaches indicated only modest differences in brain distribution of (R)-[{sup 11}C]verapamil between saline and kainate treated rats, while tariquidar treatment in both groups resulted in a more than 10-fold increase. NONMEM provided most precise parameter estimates. P-gp expression was found to be similar for kainate and saline treated rats. P-gp expression and functionality does not seem to change at early stage after induction of anticipated pharmacoresistant epilepsy by kainate.

  8. (R)-[11C]Verapamil PET studies to assess changes in P-glycoprotein expression and functionality in rat blood-brain barrier after exposure to kainate-induced status epilepticus

    International Nuclear Information System (INIS)

    Syvänen, Stina; Luurtsema, Gert; Molthoff, Carla FM; Windhorst, Albert D; Huisman, Marc C; Lammertsma, Adriaan A; Voskuyl, Rob A; Lange, Elizabeth C de

    2011-01-01

    Increased functionality of efflux transporters at the blood-brain barrier may contribute to decreased drug concentrations at the target site in CNS diseases like epilepsy. In the rat, pharmacoresistant epilepsy can be mimicked by inducing status epilepticus by intraperitoneal injection of kainate, which leads to development of spontaneous seizures after 3 weeks to 3 months. The aim of this study was to investigate potential changes in P-glycoprotein (P-gp) expression and functionality at an early stage after induction of status epilepticus by kainate. (R)-[ 11 C]verapamil, which is currently the most frequently used positron emission tomography (PET) ligand for determining P-gp functionality at the blood-brain barrier, was used in kainate and saline (control) treated rats, at 7 days after treatment. To investigate the effect of P-gp on (R)-[ 11 C]verapamil brain distribution, both groups were studied without or with co-administration of the P-gp inhibitor tariquidar. P-gp expression was determined using immunohistochemistry in post mortem brains. (R)-[ 11 C]verapamil kinetics were analyzed with approaches common in PET research (Logan analysis, and compartmental modelling of individual profiles) as well as by population mixed effects modelling (NONMEM). All data analysis approaches indicated only modest differences in brain distribution of (R)-[ 11 C]verapamil between saline and kainate treated rats, while tariquidar treatment in both groups resulted in a more than 10-fold increase. NONMEM provided most precise parameter estimates. P-gp expression was found to be similar for kainate and saline treated rats. P-gp expression and functionality does not seem to change at early stage after induction of anticipated pharmacoresistant epilepsy by kainate

  9. Genetic polymorphisms in varied environments.

    Science.gov (United States)

    Powell, J R

    1971-12-03

    Thirteen experimenital populationis of Drosophila willistoni were maintained in cages, in some of which the environments were relatively constant and in others varied. After 45 weeks, the populations were assayed by gel electrophoresis for polymorphisms at 22 protein loci. The average heterozygosity per individual and the average unmber of alleles per locus were higher in populations maintained in heterogeneous environments than in populations in more constant enviroments.

  10. Barriers to fusion

    International Nuclear Information System (INIS)

    Berriman, A.C.; Butt, R.D.; Dasgupta, M.; Hinde, D.J.; Morton, C.R.; Newton, J.O.

    1999-01-01

    The fusion barrier is formed by the combination of the repulsive Coulomb and attractive nuclear forces. Recent research at the Australian National University has shown that when heavy nuclei collide, instead of a single fusion barrier, there is a set of fusion barriers. These arise due to intrinsic properties of the interacting nuclei such deformation, rotations and vibrations. Thus the range of barrier energies depends on the properties of both nuclei. The transfer of matter between nuclei, forming a neck, can also affect the fusion process. High precision data have been used to determine fusion barrier distributions for many nuclear reactions, leading to new insights into the fusion process

  11. Extremal surface barriers

    International Nuclear Information System (INIS)

    Engelhardt, Netta; Wall, Aron C.

    2014-01-01

    We present a generic condition for Lorentzian manifolds to have a barrier that limits the reach of boundary-anchored extremal surfaces of arbitrary dimension. We show that any surface with nonpositive extrinsic curvature is a barrier, in the sense that extremal surfaces cannot be continuously deformed past it. Furthermore, the outermost barrier surface has nonnegative extrinsic curvature. Under certain conditions, we show that the existence of trapped surfaces implies a barrier, and conversely. In the context of AdS/CFT, these barriers imply that it is impossible to reconstruct the entire bulk using extremal surfaces. We comment on the implications for the firewall controversy

  12. Safety- barrier diagrams

    <