Preferrential rearrangement in normal rabbits of the 3' VHa allotype gene that is deleted in Alicia mutants; somatic hypermutation/conversion may play a major role in generating the heterogeneity of rabbit heavy chain variable region sequences.

Science.gov (United States)

Allegrucci, M; Young-Cooper, G O; Alexander, C B; Newman, B A; Mage, R G

1991-02-01

The rabbit is unique in having well-defined allotypes in the variable region of the heavy chain. Products of the VHa locus, (with alleles a1, a2, and a3), account for the majority of the serum immunoglobulins. A small percentage of the serum immunoglobulins are a-negative. In 1986, Kelus and Weiss described a mutation that depressed the expression of the Ig VH a2 genes in an a1/a2 rabbit. From this animal the Alicia rabbit strain was developed and the mutation was termed ali. We previously showed, using Southern analysis and the transverse alternating field electrophoresis technique, that the difference between the ali rabbit and normal is a relatively small deletion including some of the most 3' VH genes. The most JH proximal 3' VH1 genes in DNA from normal rabbits of a1, a2 and a3 haplotypes encode a1, a2 and a3 molecules respectively, and it has been suggested that these genes are responsible for allelic inheritance of VHa allotypes. The present study suggests that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression in rabbits because VH gene(s) in this region are the target(s) of preferential VDJ rearrangements. This raises the possibility that mechanisms such as somatic gene conversion and hypermutation are at work to generate the antibody repertoire in this species. Our data support the view that the 3' VH1 gene may be the preferred target for rearrangement in normal rabbits, and for the normal chromosome in heterozygous ali animals. However, homozygous ali rabbits with a deletion that removed the a2-encoding VH1 on both chromosomes do survive, rearrange other VH genes and produce normal levels of immunoglobulins as well as a significant percentage of B cells which bear the a2 allotype. This challenges the view that one VH gene, VH1, is solely responsible for the inheritance pattern of VHa allotypes.

B lymphocyte selection and age-related changes in VH gene usage in mutant Alicia rabbits.

Science.gov (United States)

Zhu, X; Boonthum, A; Zhai, S K; Knight, K L

1999-09-15

Young Alicia rabbits use VHa-negative genes, VHx and VHy, in most VDJ genes, and their serum Ig is VHa negative. However, as Alicia rabbits age, VHa2 allotype Ig is produced at high levels. We investigated which VH gene segments are used in the VDJ genes of a2 Ig-secreting hybridomas and of a2 Ig+ B cells from adult Alicia rabbits. We found that 21 of the 25 VDJ genes used the a2-encoding genes, VH4 or VH7; the other four VDJ genes used four unknown VH gene segments. Because VH4 and VH7 are rarely found in VDJ genes of normal or young Alicia rabbits, we investigated the timing of rearrangement of these genes in Alicia rabbits. During fetal development, VH4 was used in 60-80% of nonproductively rearranged VDJ genes, and VHx and VHy together were used in 10-26%. These data indicate that during B lymphopoiesis VH4 is preferentially rearranged. However, the percentage of productive VHx- and VHy-utilizing VDJ genes increased from 38% at day 21 of gestation to 89% at birth (gestation day 31), whereas the percentage of VH4-utilizing VDJ genes remained at 15%. These data suggest that during fetal development, either VH4-utilizing B-lineage cells are selectively eliminated, or B cells with VHx- and VHy-utilizing VDJ genes are selectively expanded, or both. The accumulation of peripheral VH4-utilizing a2 B cells with age indicates that these B cells might be selectively expanded in the periphery. We discuss the possible selection mechanisms that regulate VH gene segment usage in rabbit B cells during lymphopoiesis and in the periphery.

vh@nnlo-v2: new physics in Higgs Strahlung

Science.gov (United States)

Harlander, Robert V.; Klappert, Jonas; Liebler, Stefan; Simon, Lukas

2018-05-01

Introducing version 2 of the code vh@nnlo [1], we study the effects of a number of new-physics scenarios on the Higgs-Strahlung process. In particular, the cross section is evaluated within a general 2HDM and the MSSM. While the Drell-Yan-like contributions are consistently taken into account by a simple rescaling of the SM result, the gluon-initiated contribution is supplemented by squark-loop mediated amplitudes, and by the s-channel exchange of additional scalars which may lead to conspicuous interference effects. The latter holds as well for bottom-quark initiated Higgs Strahlung, which is also included in the new version of vh@nnlo. Using an orthogonal rotation of the three Higgs CP eigenstates in the 2HDM and the MSSM, vh@nnlo incorporates a simple means of CP mixing in these models. Moreover, the effect of vector-like quarks in the SM on the gluon-initiated contribution can be studied. Beyond concrete models, vh@nnlo allows to include the effect of higher-dimensional operators on the production of CP-even Higgs bosons. Transverse momentum distributions of the final state Higgs boson and invariant mass distributions of the Vϕ final state for the gluon- and bottom-quark initiated contributions can be studied. Distributions for the Drell-Yan-like component of Higgs Strahlung can be included through a link to MCFM. vh@nnlo can also be linked to FeynHiggs and 2HDMC for the calculation of Higgs masses and mixing angles. It can also read these parameters from an SLHA-file as produced by standard spectrum generators. Throughout the manuscript, we highlight new-physics effects in various numerical examples, both at the inclusive level and for distributions.

VH repertoire in progeny of long term lymphoid-cultured cells used to reconstitute immunodeficient mice

International Nuclear Information System (INIS)

Denis, K.A.; Timson, L.K.; Witte, O.N.

1989-01-01

VH gene utilization in the progeny of long term lymphoid-cultured cells used for reconstitution of severe combined immunodeficient mice under varying conditions was determined. Hybridomas made from the spleens of these animals were evaluated for clonality and donor origin and a panel of 146 independent hybridomas were subsequently examined for VH expression. Hybridomas derived from the spleens of SCID mice reconstituted with fresh cells, used as a control, utilized VH families in proportion to their numerical representation in the genome. However, hybridomas from the spleens of mice reconstituted with long term cultured cells utilized a predominance of the two VH gene families most proximal to JH, characteristic of cells early in B lymphocyte development. Coinjection of thymocytes with cultured fetal liver cells, to provide good levels of T lymphocytes, did not alter this pattern of VH utilization. Irradiation (3 Gy) of the mice before cultured cell injection, which leads to more complete reconstitution of the B cell compartment, was effective in removing this bias in the VH repertoire. Hybridomas derived from these mice expressed their VH genes more in proportion to family size, characteristic of cells later in B lymphocyte development. In this manner, long term lymphoid-cultured cells can be used to study the transitions that occur in VH repertoire expression which appear to be mediated by either B lymphocyte developmental microenvironment or population size

Depth-dependent Vertical-to-Horizontal (V/H) Ratios of Free-Field Ground Motion Response Spectra for Deeply Embedded Nuclear Structures

Energy Technology Data Exchange (ETDEWEB)

Wei, X. [Brookhaven National Lab. (BNL), Upton, NY (United States); Braverman, J. [Brookhaven National Lab. (BNL), Upton, NY (United States); Miranda, M. [Brookhaven National Lab. (BNL), Upton, NY (United States); Rosario, M. E. [Brookhaven National Lab. (BNL), Upton, NY (United States); Costantino, C. J. [Brookhaven National Lab. (BNL), Upton, NY (United States)

2015-02-01

This report documents the results of a study to determine the depth-dependent V/H ratios of ground motion response spectra in the free field. The V/H ratios reported herein were developed from a worldwide database of surface and downhole acceleration recordings obtained from 45 vertical array stations. This database was specifically compiled for this project, and includes information from a diversity of active tectonic regions (California, Alaska, Taiwan, Japan), site conditions (rock to soft soil), ground motion intensity levels (PGAs between 0.01 g and 0.50 g), magnitudes (between ML 2.78 and JMA 8.1), epicentral distances (between 3.2 km and 812 km), and source depths (between 1.2 km and 112 km), as well as sensors at surface and at a wide range of depths relevant to the project. To study the significance of the depth effect, V/H ratios from all the records were sorted into a number of depth bins relevant to the project, and statistics (average, standard deviation, coefficient of variation, 16th, 50th, and 84th percentiles) of the V/H ratios within each bin were computed. Similar analyses were repeated, controlling for different site conditions, ground motion intensity levels, array locations, and source depths, to study their relative effect on the V/H ratios. Our findings confirm the importance of the depth effect on the V/H ratios. The research findings in this report can be used to provide guidance on the significance of the depth effect, and the extent to which this effect should be considered in the seismic design of deeply embedded SMR structures and NPP structures in general.

Poloidal rotation and the evolution of H-mode and VH-mode profiles

International Nuclear Information System (INIS)

Hinton, F.L.; Staebler, G.M.; Kim, Y.B.

1993-12-01

The physics which determines poloidal rotation, and its role in the development of profiles during H- and VH-modes, is discussed. A simple phenomenological transport model, which incorporates the rvec E x rvec B flow shear suppression of turbulence, is shown to predict profile evolution similar to that observed experimentally during H-mode and VH-mode

VH mode accessibility and global H-mode properties in previous and present JET configurations

Energy Technology Data Exchange (ETDEWEB)

Jones, T T.C.; Ali-Arshad, S; Bures, M; Christiansen, J P; Esch, H P.L. de; Fishpool, G; Jarvis, O N; Koenig, R; Lawson, K D; Lomas, P J; Marcus, F B; Sartori, R; Schunke, B; Smeulders, P; Stork, D; Taroni, A; Thomas, P R; Thomsen, K [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking

1994-07-01

In JET VH modes, there is a distinct confinement transition following the cessation of ELMs, observed in a wide variety of tokamak operating conditions, using both NBI and ICRF heating methods. Important factors which influence VH mode accessibility such as magnetic configuration and vessel conditions have been identified. The new JET pumped divertor configuration has much improved plasma shaping control and power and particle exhaust capability and should permit exploitation of plasmas with VH confinement properties over an even wider range of operating regimes, particularly at high plasma current; first H-modes have been obtained in the 1994 JET operating period and initial results are reported. (authors). 7 refs., 6 figs.

Three monoclonal antibodies to the VHS virus glycoprotein: comparison of reactivity in relation to differences in immunoglobulin variable domain gene sequences

DEFF Research Database (Denmark)

Lorenzen, Niels; Cupit, P.M.; Secombes, C.J.

2000-01-01

and their neutralising activity was evident. Binding kinetic analyses by plasmon resonance identified differences in the dissociation rate constant (kd) as a possible explanation for the different reactivity levels of the MAbs. The Ig variable heavy (VH) and light (V kappa) domain gene sequences of the three hybridomas...... were compared. The inferred amino acid sequence of the two neutralising antibody VH domains differed by three amino acid residues (97% identity) and only one residue difference was evident in the Vk. domains. In contrast, IP1H3 shared only 38 and 39% identity with the 3F1A2 and 3F1H10 VH domains...... respectively and 49 and 50% identity with the 3F1A2 and 3F1H10 VK domains respectively. The neutralising antibodies were produced by hybridomas originating from the same fusion and the high nucleotide sequence homology of the variable Ig gene regions indicated that the plasma cell partners of the hybridomas...

Impurity penetration and transport during VH-mode on DIII-D

International Nuclear Information System (INIS)

Lippmann, S.I.; Evans, T.E.; Jackson, G.L.; West, W.P.

1992-05-01

A new modeling effort is made in order to understand the observed relatively low levels of impurity contamination during the VH-mode phase on DIII-D, as compared to those observed during the H-mode phase of selected discharges. The key element is the inclusion of the real 2-D flux surface geometry in the prediction of impurity penetration of sputtered atoms through the scrape-off layer into the core plasma. Of the elements which determine the impurity content in the plasma: sputtering yield, penetration, and core transport, the penetration through the scrape-off layer is found to be the most determinative factor. The low impurity content in VH-mode is attributed to the development of a scrape-off layer with higher density and temperature properties than those normally obtained in H-mode

Immunoglobulin diversification in B cell malignancies: internal splicing of heavy chain variable region as a by-product of somatic hypermutation

NARCIS (Netherlands)

Bende, R. J.; Aarts, W. M.; Pals, S. T.; van Noesel, C. J. M.

2002-01-01

In this study we describe alternative splicing of somatically mutated immunoglobulin (Ig) variable heavy chain (V-H) genes in three distinct primary B cell non-Hodgkin's lymphomas (B-NHL). In two V4-34 expressing lymphomas, ie a post-germinal center type B cell chronic lymphocytic leukemia (B-CLL)

A novel variable antibody fragment dimerized by leucine zippers with enhanced neutralizing potency against rabies virus G protein compared to its corresponding single-chain variable antibody fragment.

Science.gov (United States)

Li, Zhuang; Cheng, Yue; Xi, Hualong; Gu, Tiejun; Yuan, Ruosen; Chen, Xiaoxu; Jiang, Chunlai; Kong, Wei; Wu, Yongge

2015-12-01

Fatal rabies can be prevented effectively by post-exposure prophylactic (PEP) with rabies immunoglobulin (RIG). Single-chain variable fragments (scFv), which are composed of a variable heavy chain (VH) and a variable light chain (VL) connected by a peptide linker, can potentially be used to replace RIG. However, in our previous study, a scFv (scFV57S) specific for the rabies virus (RV) G protein showed a lower neutralizing potency than that of its parent IgG due to lower stability and altered peptide assembly pattern. In monoclonal antibodies, the VH and VL interact non-covalently, while in scFvs the VH is connected covalently with the VL by the artificial linker. In this study, we constructed and expressed two peptides 57VL-JUN-HIS and 57VH-FOS-HA in Escherichia coli. The well-known Fos and Jun leucine zippers were utilized to dimerize VH and VL similarly to the IgG counterpart. The two peptides assembled to form zipFv57S in vitro. Due to the greater similarity in structure with IgG, the zipFv57S protein showed a higher binding ability and affinity resulting in notable improvement of in vitro neutralizing activity over its corresponding scFv. The zipFv57S protein was also found to be more stable and showed similar protective rate as RIG in mice challenged with a lethal dose of RV. Our results not only indicated zipFv57S as an ideal alternative for RIG in PEP but also offered a novel and efficient hetero-dimerization pattern of VH and VL leading to enhanced neutralizing potency. Copyright © 2015. Published by Elsevier Ltd.

Genomic analysis of a 1 Mb region near the telomere of Hessian fly chromosome X2 and avirulence gene vH13

Directory of Open Access Journals (Sweden)

Chen Ming-Shun

2006-01-01

Full Text Available Abstract Background To have an insight into the Mayetiola destructor (Hessian fly genome, we performed an in silico comparative genomic analysis utilizing genetic mapping, genomic sequence and EST sequence data along with data available from public databases. Results Chromosome walking and FISH were utilized to identify a contig of 50 BAC clones near the telomere of the short arm of Hessian fly chromosome X2 and near the avirulence gene vH13. These clones enabled us to correlate physical and genetic distance in this region of the Hessian fly genome. Sequence data from these BAC ends encompassing a 760 kb region, and a fully sequenced and assembled 42.6 kb BAC clone, was utilized to perform a comparative genomic study. In silico gene prediction combined with BLAST analyses was used to determine putative orthology to the sequenced dipteran genomes of the fruit fly, Drosophila melanogaster, and the malaria mosquito, Anopheles gambiae, and to infer evolutionary relationships. Conclusion This initial effort enables us to advance our understanding of the structure, composition and evolution of the genome of this important agricultural pest and is an invaluable tool for a whole genome sequencing effort.

Fundamental characteristics of the immunoglobulin VH repertoire of chickens in comparison with those of humans, mice, and camelids.

Science.gov (United States)

Wu, Leeying; Oficjalska, Katarzyna; Lambert, Matthew; Fennell, Brian J; Darmanin-Sheehan, Alfredo; Ní Shúilleabháin, Deirdre; Autin, Bénédicte; Cummins, Emma; Tchistiakova, Lioudmila; Bloom, Laird; Paulsen, Janet; Gill, Davinder; Cunningham, Orla; Finlay, William J J

2012-01-01

Examination of 1269 unique naive chicken V(H) sequences showed that the majority of positions in the framework (FW) regions were maintained as germline, with high mutation rates observed in the CDRs. Many FW mutations could be clearly related to the modulation of CDR structure or the V(H)-V(L) interface. CDRs 1 and 2 of the V(H) exhibited frequent mutation in solvent-exposed positions, but conservation of common structural residues also found in human CDRs at the same positions. In comparison with humans and mice, the chicken CDR3 repertoire was skewed toward longer sequences, was dominated by small amino acids (G/S/A/C/T), and had higher cysteine (chicken, 9.4%; human, 1.6%; and mouse, 0.25%) but lower tyrosine content (chicken, 9.2%; human, 16.8%; and mouse 26.4%). A strong correlation (R(2) = 0.97) was observed between increasing CDR3 length and higher cysteine content. This suggests that noncanonical disulfides are strongly favored in chickens, potentially increasing CDR stability and complexity in the topology of the combining site. The probable formation of disulfide bonds between CDR3 and CDR1, FW2, or CDR2 was also observed, as described in camelids. All features of the naive repertoire were fully replicated in the target-selected, phage-displayed repertoire. The isolation of a chicken Fab with four noncanonical cysteines in the V(H) that exhibits 64 nM (K(D)) binding affinity for its target proved these constituents to be part of the humoral response, not artifacts. This study supports the hypothesis that disulfide bond-constrained CDR3s are a structural diversification strategy in the restricted germline v-gene repertoire of chickens.

Magnetovoltage Measurements and Field Sweep Rate Dependence of V-H curves in Superconducting Polycrystalline Y1Ba2Cu3O7-x

International Nuclear Information System (INIS)

Yetis, H; Altinkok, A; Olutas, M; Kilic, A; Kilic, K; Cetin, O

2006-01-01

Magnetovoltage measurements (V-H curves) were carried out in superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material as a function of current (I), temperature (T), field sweep rate (dH/dt) and field orientation with respect to the transport current. A relative decrease in the dissipation measured in V-H curves was observed as dH/dt is increased, which implies that the time spent to plot the whole cycle has an importance on the evolution of the V-H curves. Thus, it could be possible to observe the relaxation effects in magnetovoltage measurements. In addition, the several significant steps and plateaus in V-H curves evolve depending on the magnitude of the transport current and also dH/dt. These observations were attributed to locking of the flux lines to decrease or increase in size of the easy motion flow channels. The strong hysteresis effects in V-H curves were discussed mainly by means of the flux trapping within the granularity of sample and the different degree of the inhomogeneous flux motion with respect to the sweeping of the external magnetic field up and down

The role of the radial electric field in confinement and transport in H-mode and VH-mode discharges in the DIII-D tokamak

International Nuclear Information System (INIS)

Gohil, P.; Burrell, K.H.; Groebner, R.J.; Osborne, T.H.; Doyle, E.J.; Rettig, C.L.

1993-08-01

Measurements of the radial electric field, E r , with high spatial and high time resolution in H-mode and VH-mode discharges in the DIII-D tokamak have revealed the significant influence of the shear in E r on confinement and transport in these discharges. These measurements are made using the DIII-D Charge Exchange Recombination (CER) System. At the L-H transition in DIII-D plasmas, a negative well-like E r profile develops just within the magnetic separatrix. A region of shear in E r results, which extends 1 to 2 cm into the plasma from the separatrix. At the transition, this region of sheared E r exhibits the greatest increase in impurity ion poloidal rotation velocity and the greatest reduction in plasma fluctuations. A transport barrier is formed in this same region of E x B velocity shear as is signified by large increases in the observed gradients of the ion temperature, the carbon density, the electron temperature and electron density. The development of the region of sheared E r , the increase in impurity ion poloidal rotation, the reduction in plasma turbulence, and the transport barrier all occur simultaneously at the L-H transition. Measurements of the radial electric field, plasma turbulence, thermal transport, and energy confinement have been performed for a wide range of plasma conditions and configurations. The results support the supposition that the progression of improving confinement at the L-H transition, into the H-mode and then into the VH-mode can be explained by the hypothesis of the suppression of plasma turbulence by the increasing penetration of the region of sheared E x B velocity into the plasma interior

The role of electric field shear stabilization of turbulence in the H-mode to VH-mode transition in DIII-D

International Nuclear Information System (INIS)

Burrell, K.H.; Osborne, T.H.; Groebner, R.J.; Rettig, C.L.

1993-01-01

VH-mode plasma exhibit energy confinement times up to 2.4 times the DIII-D/JET H-mode scaling relation and up to 3.9 times the value given by ITER89-P L-mode scaling. If this confinement improvement can be exploited in reactor plasmas, smaller prototype reactors with significantly lower unit cost can be produced. Accordingly, understanding and optimizing the confinement improvement is of significant interest. One of the possible explanations for this bulk confinement improvement is stabilization of turbulence by shear in the radial electric field, similar to the present explanation for the confinement improvement at the extreme plasma edge at the L to H transition. Preliminary measurements have shown that the region of the plasma where the electric field gradient is steepest broadens when the plasma goes from H-mode to VH-mode. More recent measurements have confirmed this broadening and have shown that the change in the electric field gradient occurs prior to the change in the thermal transport. In addition, transport analysis shows that the electric field shear increases in the same region between magnetic flux coordinate p=0.6 and 0.9 where the local thermal transport decreases. Furthermore, far infra-red (FIR) scattering measurements have detected density fluctuations in the region around p=0.8 which could be responsible for enhanced transport and which disappear at the time that the electric shear increases. These fluctuations appear as bursts of density fluctuations in the 0.5 to 1.5 MHz range. The time between bursts increases as the electric field shear increases. Once these bursts disappear, the major change in confinement takes place in most discharges. When isolated bursts occur, the heat and angular momentum pulse connected with the burst are detectable on the plasma profile diagnostics. (author) 13 refs., 4 figs

Side chain requirements for affinity and specificity in D5, an HIV-1 antibody derived from the VH1-69 germline segment.

Science.gov (United States)

Stewart, Alex; Harrison, Joseph S; Regula, Lauren K; Lai, Jonathan R

2013-04-08

Analysis of factors contributing to high affinity antibody-protein interactions provides insight into natural antibody evolution, and guides the design of antibodies with new or enhanced function. We previously studied the interaction between antibody D5 and its target, a designed protein based on HIV-1 gp41 known as 5-Helix, as a model system [Da Silva, G. F.; Harrison, J. S.; Lai, J. R., Biochemistry, 2010, 49, 5464-5472]. Antibody D5 represents an interesting case study because it is derived from the VH1-69 germline segment; this germline segment is characterized by a hydrophobic second heavy chain complementarity determining region (HCDR2) that constitutes the major functional paratope in D5 and several antibodies derived from the same progenitor. Here we explore side chain requirements for affinity and specificity in D5 using phage display. Two D5-based libraries were prepared that contained diversity in all three light chain complementarity determining regions (LCDRs 1-3), and in the third HCDR (HCDR3). The first library allowed residues to vary among a restricted set of six amino acids (Tyr/Ala/Asp/Ser/His/Pro; D5-Lib-I). The second library was designed based on a survey of existing VH1-69 antibody structures (D5-Lib-II). Both libraries were subjected to multiple rounds of selection against 5-Helix, and individual clones characterized. We found that selectants from D5-Lib-I generally had moderate affinity and specificity, while many clones from D5-Lib-II exhibited D5-like properties. Additional analysis of the D5-Lib-II functional population revealed position-specific biases for particular amino acids, many that differed from the identity of those side chains in D5. Together these results suggest that there is some permissiveness for alternative side chains in the LCDRs and HCDR3 of D5, but that replacement with a minimal set of residues is not tolerated in this scaffold for 5-Helix recognition. This work provides novel information about this high

Draft Genome Sequence of Vibrio parahaemolyticus VH3, Isolated from an Aquaculture Environment in Greece

DEFF Research Database (Denmark)

Castillo, Daniel; Jun, Jin Woo; D'Alvise, Paul

2015-01-01

Vibrio parahaemolyticus is an important foodborne pathogen responsible for gastroenteritis outbreaks globally. It has also been identified as an important pathogen in aquatic organisms. Here, we report a draft genome sequence of V. parahaemolyticus, strain VH3, isolated from farmed juvenile greater...

TriFabs—Trivalent IgG-Shaped Bispecific Antibody Derivatives: Design, Generation, Characterization and Application for Targeted Payload Delivery

Directory of Open Access Journals (Sweden)

Klaus Mayer

2015-11-01

Full Text Available TriFabs are IgG-shaped bispecific antibodies (bsAbs composed of two regular Fab arms fused via flexible linker peptides to one asymmetric third Fab-sized binding module. This third module replaces the IgG Fc region and is composed of the variable region of the heavy chain (VH fused to CH3 with “knob”-mutations, and the variable region of the light chain (VL fused to CH3 with matching “holes”. The hinge region does not contain disulfides to facilitate antigen access to the third binding site. To compensate for the loss of hinge-disulfides between heavy chains, CH3 knob-hole heterodimers are linked by S354C-Y349C disulphides, and VH and VL of the stem region may be linked via VH44C-VL100C disulphides. TriFabs which bind one antigen bivalent in the same manner as IgGs and the second antigen monovalent “in between” these Fabs can be applied to simultaneously engage two antigens, or for targeted delivery of small and large (fluorescent or cytotoxic payloads.

Development of single chain variable fragment (scFv) antibodies against Xylella fastidiosa subsp. pauca by phage display.

Science.gov (United States)

Yuan, Qing; Jordan, Ramon; Brlansky, Ronald H; Istomina, Olga; Hartung, John

2015-10-01

Xylella fastidiosa is a member of the gamma proteobacteria. It is fastidious, insect-vectored and xylem-limited and causes a variety of diseases, some severe, on a wide range of economically important perennial crops, including grape and citrus. Antibody based detection assays are commercially available for X. fastidiosa, and are effective at the species, but not at the subspecies level. We have made a library of scFv antibody fragments directed against X. fastidiosa subsp. pauca strain 9a5c (citrus) by using phage display technology. Antibody gene repertoires were PCR-amplified using 23 primers for the heavy chain variable region (V(H)) and 21 primers for the light chain variable region (V(L)). The V(H) and V(L) were joined by overlap extension PCR, and then the genes of the scFv library were ligated into the phage vector pKM19. The library contained 1.2×10(7) independent clones with full-length scFv inserts. In each of 3cycles of affinity-selection with 9a5c, about 1.0×10(12) phage were used for panning with 4.1×10(6), 7.1×10(6), 2.1×10(7) phage recovered after the first, second and third cycles, respectively. Sixty-six percent of clones from the final library bound X. fastidiosa 9a5c in an ELISA. Some of these scFv antibodies recognized strain 9a5c and did not recognize X. fastidiosa strains that cause Pierce's disease of grapevine. Published by Elsevier B.V.

Climatological variability in regional air pollution

International Nuclear Information System (INIS)

Shannon, J.D.; Trexler, E.C. Jr.

1995-01-01

Although some air pollution modeling studies examine events that have already occurred (e.g., the Chernobyl plume) with relevant meteorological conditions largely known, most pollution modeling studies address expected or potential scenarios for the future. Future meteorological conditions, the major pollutant forcing function other than emissions, are inherently uncertain although much relevant information is contained in past observational data. For convenience in our discussions of regional pollutant variability unrelated to emission changes, we define meteorological variability as short-term (within-season) pollutant variability and climatological variability as year-to-year changes in seasonal averages and accumulations of pollutant variables. In observations and in some of our simulations the effects are confounded because for seasons of two different years both the mean and the within-season character of a pollutant variable may change. Effects of climatological and meteorological variability on means and distributions of air pollution parameters, particularly those related to regional visibility, are illustrated. Over periods of up to a decade climatological variability may mask or overstate improvements resulting from emission controls. The importance of including climatological uncertainties in assessing potential policies, particularly when based partly on calculated source-receptor relationships, is highlighted

A Strategy for Generating a Broad-Spectrum Monoclonal Antibody and Soluble Single-Chain Variable Fragments against Plant Potyviruses

Science.gov (United States)

Liu, Han-Lin; Lin, Wei-Fang; Hu, Wen-Chi; Lee, Yung-An

2015-01-01

Potyviruses are major pathogens that often cause mixed infection in calla lilies. To reduce the time and cost of virus indexing, a detection method for the simultaneous targeting of multiple potyviruses was developed by generating a broad-spectrum monoclonal antibody (MAb) for detecting the greatest possible number of potyviruses. The conserved 121-amino-acid core regions of the capsid proteins of Dasheen mosaic potyvirus (DsMV), Konjak mosaic potyvirus (KoMV), and Zantedeschia mild mosaic potyvirus (ZaMMV) were sequentially concatenated and expressed as a recombinant protein for immunization. After hybridoma cell fusion and selection, one stable cell line that secreted a group-specific antibody, named C4 MAb, was selected. In the reaction spectrum test, the C4 MAb detected at least 14 potyviruses by indirect enzyme-linked immunosorbent assay (I-ELISA) and Western blot analysis. Furthermore, the variable regions of the heavy (VH) and light (VL) chains of the C4 MAb were separately cloned and constructed as single-chain variable fragments (scFvs) for expression in Escherichia coli. Moreover, the pectate lyase E (PelE) signal peptide of Erwinia chrysanthemi S3-1 was added to promote the secretion of C4 scFvs into the medium. According to Western blot analysis and I-ELISA, the soluble C4 scFv (VL-VH) fragment showed a binding specificity similar to that of the C4 MAb. Our results demonstrate that a recombinant protein derived from fusion of the conserved regions of viral proteins has the potential to produce a broad-spectrum MAb against a large group of viruses and that the PelE signal peptide can improve the secretion of scFvs in E. coli. PMID:26209665

ATLAS searches for VH, HH, VV, V+$\\gamma$/$\\gamma\\gamma$ resonances

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00441490; The ATLAS collaboration

2017-01-01

The discovery of a Higgs boson at the Large Hadron Collider motivates searches for physics beyond the Standard Model in channels involving coupling to the Higgs boson. A search for massive resonances decaying into couples of bosons is described. The considered final states are: $HH$, $VH$, $VV$, $V\\gamma$ and $\\gamma\\gamma$ with $V$ indicating either the $W$ or the $Z$ boson. Final states with different number of leptons or photons and where, in many cases, at least one Higgs decays into a b-quark pair are studied using different jet reconstruction techniques which allow to optimize the signal acceptance for low or high Higgs boson transverse momentum. The most recent diboson resonance searches using LHC Run 2 data are described.

Anatomical and Physiological Changes after Paclitaxel-Coated Balloon for Atherosclerotic De Novo Coronary Lesions: Serial IVUS-VH and FFR Study.

Directory of Open Access Journals (Sweden)

Soe Hee Ann

Full Text Available To assess the serial changes of de novo coronary lesions treated with paclitaxel-coated balloon (PCB using intravascular ultrasound virtual histology (IVUS-VH and fractional flow reserve (FFR.This prospective observational study enrolled 27 patients with coronary artery disease treated with PCB who underwent coronary angiography, IVUS-VH and FFR before, immediately after intervention and at 9 months. 28 de novo lesions were successfully treated with PCB. Angiographic late luminal loss was 0.02 ± 0.27 mm. Mean vessel and lumen areas showed increase at 9 months (12.0 ± 3.5 mm(2 to 13.2 ± 3.9 mm(2, p <0.001; and 5.4 ± 1.2 mm(2 to 6.5 ± 1.8 mm(2, p <0.001, respectively. Although mean plaque area was unchanged (6.6 ± 2.6 mm2 to 6.6 ± 2.4 mm(2, p = 0.269, percent atheroma volume decreased significantly (53.4 ± 7.9% to 49.5 ± 6.4%, p = 0.002. The proportion of plaque compositions including fibrous, fibrofatty, dense calcium and necrotic core by IVUS-VH was unchanged at 9 months. The FFR of the treated lesion was 0.71 ± 0.13 pre-procedure, 0.87 ± 0.06 post-procedure and 0.84 ± 0.06 at follow-up.De novo coronary lesions treated with PCB showed persistent anatomical and physiological patency with plaque redistribution and vessel remodeling without chronic elastic recoil or plaque compositional change during follow-up.

Effects of short-term variability of meteorological variables on soil temperature in permafrost regions

Science.gov (United States)

Beer, Christian; Porada, Philipp; Ekici, Altug; Brakebusch, Matthias

2018-03-01

Effects of the short-term temporal variability of meteorological variables on soil temperature in northern high-latitude regions have been investigated. For this, a process-oriented land surface model has been driven using an artificially manipulated climate dataset. Short-term climate variability mainly impacts snow depth, and the thermal diffusivity of lichens and bryophytes. These impacts of climate variability on insulating surface layers together substantially alter the heat exchange between atmosphere and soil. As a result, soil temperature is 0.1 to 0.8 °C higher when climate variability is reduced. Earth system models project warming of the Arctic region but also increasing variability of meteorological variables and more often extreme meteorological events. Therefore, our results show that projected future increases in permafrost temperature and active-layer thickness in response to climate change will be lower (i) when taking into account future changes in short-term variability of meteorological variables and (ii) when representing dynamic snow and lichen and bryophyte functions in land surface models.

Jet substructure and probes of CP violation in Vh production

Energy Technology Data Exchange (ETDEWEB)

Godbole, R.M. [Centre for High Energy Physics, Indian Institute of Science,Sir C.V. Raman Road, Bangalore 560012 (India); Miller, D.J. [School of Physics and Astronomy, Scottish Universities Physics Alliance, University of Glasgow,University Avenue, Glasgow G12 8QQ, Scotland (United Kingdom); Mohan, K.A. [Centre for High Energy Physics, Indian Institute of Science,Sir C.V. Raman Road, Bangalore 560012 (India); White, C.D. [School of Physics and Astronomy, Scottish Universities Physics Alliance, University of Glasgow,University Avenue, Glasgow G12 8QQ, Scotland (United Kingdom)

2015-04-20

We analyse the hVV (V=W,Z) vertex in a model independent way using Vh production. To that end, we consider possible corrections to the Standard Model Higgs Lagrangian, in the form of higher dimensional operators which parametrise the effects of new physics. In our analysis, we pay special attention to linear observables that can be used to probe CP violation in the same. By considering the associated production of a Higgs boson with a vector boson (W or Z), we use jet substructure methods to define angular observables which are sensitive to new physics effects, including an asymmetry which is linearly sensitive to the presence of CP odd effects. We demonstrate how to use these observables to place bounds on the presence of higher dimensional operators, and quantify these statements using a log likelihood analysis. Our approach allows one to probe separately the hZZ and hWW vertices, involving arbitrary combinations of BSM operators, at the Large Hadron Collider.

The complementarity-determining region sequences in IgY antivenom hypervariable regions

Directory of Open Access Journals (Sweden)

David Gitirana da Rocha

2017-08-01

Full Text Available The data presented in this article are related to the research article entitled "Development of IgY antibodies against anti-snake toxins endowed with highly lethal neutralizing activity" (da Rocha et al., 2017 [1]. Complementarity-determining region (CDR sequences are variable antibody (Ab sequences that respond with specificity, duration and strength to identify and bind to antigen (Ag epitopes. B lymphocytes isolated from hens immunized with Bitis arietans (Ba and anti-Crotalus durissus terrificus (Cdt venoms and expressing high specificity, affinity and toxicity neutralizing antibody titers were used as DNA sources. The VLF1, CDR1, CDR2, VLR1 and CDR3 sequences were validated by BLASTp, and values corresponding to IgY VL and VH anti-Ba or anti-Cdt venoms were identified, registered [Gallus gallus IgY Fv Light chain (GU815099/Gallus gallus IgY Fv Heavy chain (GU815098] and used for molecular modeling of IgY scFv anti-Ba. The resulting CDR1, CDR2 and CDR3 sequences were combined to construct the three - dimensional structure of the Ab paratope.

Eh-pH diagrams of the V-H2O system at 25,60 and 1000C

International Nuclear Information System (INIS)

Silva, F.T. da; Ogasawara, T.; Cassa, J.C.S.

1987-01-01

Free energies of the formation of vanadium ions in aqueous solutions at elevated temperatures were determined. Eh-pH diagrams at 25 0 C, 60 0 C and 100 0 C at different vanadium concentrations, using microcomputers were calculated and obtained. The effects of temperature and vanadium concentration on the predominance of vanadium species were examined. The Eh-pH diagrams for the V-H 2 O system were evaluated by comparisons with experimental data. (Author) [pt

Regional simulation of interannual variability over South America

Science.gov (United States)

Misra, V.; Dirmeyer, P. A.; Kirtman, B. P.; Juang, H.-M. Henry; Kanamitsu, M.

2002-08-01

Three regional climate simulations covering the austral summer season during three contrasting phases of the El Niño-Southern Oscillation cycle were conducted with the Regional Spectral Model (RSM) developed at the National Centers for Environmental Prediction (NCEP). The simulated interannual variability of precipitation over the Amazon River Basin, the Intertropical Convergence Zone, the Pacific and Atlantic Ocean basins, and extratropical South America compare reasonably well with observations. The RSM optimally filters the peturbations about a time-varying base field, thereby enhancing the information content of the global NCEP reanalysis. The model is better than the reanalysis in reproducing the observed interannual variability of outgoing longwave radiation at both high frequencies (3-30 days) and intraseasonal (30-60 days) scales. The low-level jet shows a peak in its speed in 1998 and a minimum in the 1999 simulations. The lag correlation of the jet index with convection over various areas in continental South America indicates that the jet induces precipitation over the Pampas region downstream. A detailed moisture budget was conducted over various subregions. This budget reveals that moisture flux convergence determines most of the interannual variability of precipitation over the Amazon Basin, the Atlantic Intertropical Convergence Zone, and the Nordeste region of Brazil. However, both surface evaporation and surface moisture flux convergence were found to be critical in determining the interannual variability of precipitation over the southern Pampas, Gran Chaco area, and the South Atlantic Convergence Zone.

Construction and sequencing analysis of scFv antibody fragment derived from monoclonal antibody against norfloxacin (Nor155

Directory of Open Access Journals (Sweden)

J. Mala

2017-06-01

Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.

Differences in Allelic Frequency and CDRH3 Region Limit the Engagement of HIV Env Immunogens by Putative VRC01 Neutralizing Antibody Precursors

Directory of Open Access Journals (Sweden)

Christina Yacoob

2016-11-01

Full Text Available Elicitation of broadly neutralizing antibodies remains a long-standing goal of HIV vaccine research. Although such antibodies can arise during HIV-1 infection, gaps in our knowledge of their germline, pre-immune precursor forms, as well as on their interaction with viral Env, limit our ability to elicit them through vaccination. Studies of broadly neutralizing antibodies from the VRC01-class provide insight into progenitor B cell receptors (BCRs that could develop into this class of antibodies. Here, we employed high-throughput heavy chain variable region (VH/light chain variable region (VL deep sequencing, combined with biophysical, structural, and modeling antibody analyses, to interrogate circulating potential VRC01-progenitor BCRs in healthy individuals. Our study reveals that not all humans are equally predisposed to generate VRC01-class antibodies, not all predicted progenitor VRC01-expressing B cells can bind to Env, and the CDRH3 region of germline VRC01 antibodies influence their ability to recognize HIV-1. These findings will be critical to the design of optimized immunogens that should consider CDRH3 interactions.

Coral bleaching pathways under the control of regional temperature variability

Science.gov (United States)

Langlais, C. E.; Lenton, A.; Heron, S. F.; Evenhuis, C.; Sen Gupta, A.; Brown, J. N.; Kuchinke, M.

2017-11-01

Increasing sea surface temperatures (SSTs) are predicted to adversely impact coral populations worldwide through increasing thermal bleaching events. Future bleaching is unlikely to be spatially uniform. Therefore, understanding what determines regional differences will be critical for adaptation management. Here, using a cumulative heat stress metric, we show that characteristics of regional SST determine the future bleaching risk patterns. Incorporating observed information on SST variability, in assessing future bleaching risk, provides novel options for management strategies. As a consequence, the known biases in climate model variability and the uncertainties in regional warming rate across climate models are less detrimental than previously thought. We also show that the thresholds used to indicate reef viability can strongly influence a decision on what constitutes a potential refugia. Observing and understanding the drivers of regional variability, and the viability limits of coral reefs, is therefore critical for making meaningful projections of coral bleaching risk.

Measure of uncertainty in regional grade variability

NARCIS (Netherlands)

Tutmez, B.; Kaymak, U.; Melin, P.; Castillo, O.; Gomez Ramirez, E.; Kacprzyk, J.; Pedrycz, W.

2007-01-01

Because the geological events are neither homogeneous nor isotropic, the geological investigations are characterized by particularly high uncertainties. This paper presents a hybrid methodology for measuring of uncertainty in regional grade variability. In order to evaluate the fuzziness in grade

Independent variable complexity for regional regression of the flow duration curve in ungauged basins

Science.gov (United States)

Fouad, Geoffrey; Skupin, André; Hope, Allen

2016-04-01

The flow duration curve (FDC) is one of the most widely used tools to quantify streamflow. Its percentile flows are often required for water resource applications, but these values must be predicted for ungauged basins with insufficient or no streamflow data. Regional regression is a commonly used approach for predicting percentile flows that involves identifying hydrologic regions and calibrating regression models to each region. The independent variables used to describe the physiographic and climatic setting of the basins are a critical component of regional regression, yet few studies have investigated their effect on resulting predictions. In this study, the complexity of the independent variables needed for regional regression is investigated. Different levels of variable complexity are applied for a regional regression consisting of 918 basins in the US. Both the hydrologic regions and regression models are determined according to the different sets of variables, and the accuracy of resulting predictions is assessed. The different sets of variables include (1) a simple set of three variables strongly tied to the FDC (mean annual precipitation, potential evapotranspiration, and baseflow index), (2) a traditional set of variables describing the average physiographic and climatic conditions of the basins, and (3) a more complex set of variables extending the traditional variables to include statistics describing the distribution of physiographic data and temporal components of climatic data. The latter set of variables is not typically used in regional regression, and is evaluated for its potential to predict percentile flows. The simplest set of only three variables performed similarly to the other more complex sets of variables. Traditional variables used to describe climate, topography, and soil offered little more to the predictions, and the experimental set of variables describing the distribution of basin data in more detail did not improve predictions

Regional impacts of ocean color on tropical Pacific variability

Science.gov (United States)

Anderson, W.; Gnanadesikan, A.; Wittenberg, A.

2009-08-01

The role of the penetration length scale of shortwave radiation into the surface ocean and its impact on tropical Pacific variability is investigated with a fully coupled ocean, atmosphere, land and ice model. Previous work has shown that removal of all ocean color results in a system that tends strongly towards an El Niño state. Results from a suite of surface chlorophyll perturbation experiments show that the mean state and variability of the tropical Pacific is highly sensitive to the concentration and distribution of ocean chlorophyll. Setting the near-oligotrophic regions to contain optically pure water warms the mean state and suppresses variability in the western tropical Pacific. Doing the same above the shadow zones of the tropical Pacific also warms the mean state but enhances the variability. It is shown that increasing penetration can both deepen the pycnocline (which tends to damp El Niño) while shifting the mean circulation so that the wind response to temperature changes is altered. Depending on what region is involved this change in the wind stress can either strengthen or weaken ENSO variability.

Characterization of additional rabbit IgM allotypes and the effect of suppression of a VH locus allotypes on the expression of n Cμ locus allotype

International Nuclear Information System (INIS)

Gilman-Sachs, A.; Roux, K.H.; Horing, W.J.; Dray, S.

1982-01-01

Anti-allotype antisera were produced that identified eight rabbit IgM allotypic specificities, n80, n81, n82, n83, n84, n85, n86, and n87. The n locus Cμ genes controlling these IgM allotypic specificities are closely linked to the a (VH subgroup) locus. The genes controlling these allotypic specificities were found to be in the heavy chain chromosomal region and were assigned to 11 haplotypes present in our rabbit colony. The n locus and a locus genes appeared in the haplotypes in six combinations: a 1 n 81 , a 2 n/sup 81,n87/, a 1 n/sup 80,83/, a 2 n/sup 80,82,87/, a 3 n/sup 81,84,85/ and a 3 n/sup 80,84,86,87/. By radioprecipitation analysis, 70 to 80% of serum IgM reacts with the antiserum directed to each n locus allotypic specificity found encoded in one haplotype; thus, each allotypic specificity of the haplotype is present on the same IgM molecule. When sera from a locus allotype-suppressed homozygous rabbits were tested for expression of each n locus allotypic specificity, n80, n81, and n87 were still expressed, whereas n82, n83, n84, n85, and n86 were not. These data provide direct evidence that some IgM specificities are expressed independently of the a locus (i.e., ''true''), and other s are dependent on the expression of an a locus specificity (i.e., conformational). The expression of the ''true'' allotypic specificities probably reflects genetic control of the germline Cμ gene, and the expression of ''conformationally dependent'' allotypic specificities probably reflects the interaction of VH and Cμ gene segments. This distinction is important and must be recognized when evaluating the genetics and structure of the IgM molecule

Regional impacts of ocean color on tropical Pacific variability

Directory of Open Access Journals (Sweden)

W. Anderson

2009-08-01

Full Text Available The role of the penetration length scale of shortwave radiation into the surface ocean and its impact on tropical Pacific variability is investigated with a fully coupled ocean, atmosphere, land and ice model. Previous work has shown that removal of all ocean color results in a system that tends strongly towards an El Niño state. Results from a suite of surface chlorophyll perturbation experiments show that the mean state and variability of the tropical Pacific is highly sensitive to the concentration and distribution of ocean chlorophyll. Setting the near-oligotrophic regions to contain optically pure water warms the mean state and suppresses variability in the western tropical Pacific. Doing the same above the shadow zones of the tropical Pacific also warms the mean state but enhances the variability. It is shown that increasing penetration can both deepen the pycnocline (which tends to damp El Niño while shifting the mean circulation so that the wind response to temperature changes is altered. Depending on what region is involved this change in the wind stress can either strengthen or weaken ENSO variability.

Redirecting Specificity of T cells Using the Sleeping Beauty System to Express Chimeric Antigen Receptors by Mix-and-Matching of VL and VH Domains Targeting CD123+ Tumors.

Directory of Open Access Journals (Sweden)

Radhika Thokala

Full Text Available Adoptive immunotherapy infusing T cells with engineered specificity for CD19 expressed on B- cell malignancies is generating enthusiasm to extend this approach to other hematological malignancies, such as acute myelogenous leukemia (AML. CD123, or interleukin 3 receptor alpha, is overexpressed on most AML and some lymphoid malignancies, such as acute lymphocytic leukemia (ALL, and has been an effective target for T cells expressing chimeric antigen receptors (CARs. The prototypical CAR encodes a VH and VL from one monoclonal antibody (mAb, coupled to a transmembrane domain and one or more cytoplasmic signaling domains. Previous studies showed that treatment of an experimental AML model with CD123-specific CAR T cells was therapeutic, but at the cost of impaired myelopoiesis, highlighting the need for systems to define the antigen threshold for CAR recognition. Here, we show that CARs can be engineered using VH and VL chains derived from different CD123-specific mAbs to generate a panel of CAR+ T cells. While all CARs exhibited specificity to CD123, one VH and VL combination had reduced lysis of normal hematopoietic stem cells. This CAR's in vivo anti-tumor activity was similar whether signaling occurred via chimeric CD28 or CD137, prolonging survival in both AML and ALL models. Co-expression of inducible caspase 9 eliminated CAR+ T cells. These data help support the use of CD123-specific CARs for treatment of CD123+ hematologic malignancies.

Internal variability in a regional climate model over West Africa

Energy Technology Data Exchange (ETDEWEB)

Vanvyve, Emilie; Ypersele, Jean-Pascal van [Universite catholique de Louvain, Institut d' astronomie et de geophysique Georges Lemaitre, Louvain-la-Neuve (Belgium); Hall, Nicholas [Laboratoire d' Etudes en Geophysique et Oceanographie Spatiales/Centre National d' Etudes Spatiales, Toulouse Cedex 9 (France); Messager, Christophe [University of Leeds, Institute for Atmospheric Science, Environment, School of Earth and Environment, Leeds (United Kingdom); Leroux, Stephanie [Universite Joseph Fourier, Laboratoire d' etude des Transferts en Hydrologie et Environnement, BP53, Grenoble Cedex 9 (France)

2008-02-15

Sensitivity studies with regional climate models are often performed on the basis of a few simulations for which the difference is analysed and the statistical significance is often taken for granted. In this study we present some simple measures of the confidence limits for these types of experiments by analysing the internal variability of a regional climate model run over West Africa. Two 1-year long simulations, differing only in their initial conditions, are compared. The difference between the two runs gives a measure of the internal variability of the model and an indication of which timescales are reliable for analysis. The results are analysed for a range of timescales and spatial scales, and quantitative measures of the confidence limits for regional model simulations are diagnosed for a selection of study areas for rainfall, low level temperature and wind. As the averaging period or spatial scale is increased, the signal due to internal variability gets smaller and confidence in the simulations increases. This occurs more rapidly for variations in precipitation, which appear essentially random, than for dynamical variables, which show some organisation on larger scales. (orig.)

Strong influence of variable treatment on the performance of numerically defined ecological regions.

Science.gov (United States)

Snelder, Ton; Lehmann, Anthony; Lamouroux, Nicolas; Leathwick, John; Allenbach, Karin

2009-10-01

Numerical clustering has frequently been used to define hierarchically organized ecological regionalizations, but there has been little robust evaluation of their performance (i.e., the degree to which regions discriminate areas with similar ecological character). In this study we investigated the effect of the weighting and treatment of input variables on the performance of regionalizations defined by agglomerative clustering across a range of hierarchical levels. For this purpose, we developed three ecological regionalizations of Switzerland of increasing complexity using agglomerative clustering. Environmental data for our analysis were drawn from a 400 m grid and consisted of estimates of 11 environmental variables for each grid cell describing climate, topography and lithology. Regionalization 1 was defined from the environmental variables which were given equal weights. We used the same variables in Regionalization 2 but weighted and transformed them on the basis of a dissimilarity model that was fitted to land cover composition data derived for a random sample of cells from interpretation of aerial photographs. Regionalization 3 was a further two-stage development of Regionalization 2 where specific classifications, also weighted and transformed using dissimilarity models, were applied to 25 small scale "sub-domains" defined by Regionalization 2. Performance was assessed in terms of the discrimination of land cover composition for an independent set of sites using classification strength (CS), which measured the similarity of land cover composition within classes and the dissimilarity between classes. Regionalization 2 performed significantly better than Regionalization 1, but the largest gains in performance, compared to Regionalization 1, occurred at coarse hierarchical levels (i.e., CS did not increase significantly beyond the 25-region level). Regionalization 3 performed better than Regionalization 2 beyond the 25-region level and CS values continued to

Intraregional and inter-regional variability of herbicide sensitivity in common arable weed populations

DEFF Research Database (Denmark)

de Mol, Friederike; Gerowitt, Bärbel; Kaczmarek, Sylwia

2015-01-01

The question on intraregional versus inter-regional variability in herbicide sensitivity for weed populations is of major importance, both in extrapolation of model parameters and in herbicide zonal approval procedures. We hypothesised that inter-regional variability in herbicide sensitivity for ...

The discrete and localized nature of the variable emission from active regions

Science.gov (United States)

Arndt, Martina Belz; Habbal, Shadia Rifai; Karovska, Margarita

1994-01-01

Using data from the Extreme Ultraviolet (EUV) Spectroheliometer on Skylab, we study the empirical characteristics of the variable emission in active regions. These simultaneous multi-wavelength observations clearly confirm that active regions consist of a complex of loops at different temperatures. The variable emission from this complex has very well-defined properties that can be quantitatively summarized as follows: (1) It is localized predominantly around the footpoints where it occurs at discrete locations. (2) The strongest variability does not necessarily coincide with the most intense emission. (3) The fraction of the area of the footpoints, (delta n)/N, that exhibits variable emission, varies by +/- 15% as a function of time, at any of the wavelengths measured. It also varies very little from footpoint to footpoint. (4) This fractional variation is temperature dependent with a maximum around 10(exp 5) K. (5) The ratio of the intensity of the variable to the average background emission, (delta I)/(bar-I), also changes with temperature. In addition, we find that these distinctive characteristics persist even when flares occur within the active region.

High-resolution regional climate model evaluation using variable-resolution CESM over California

Science.gov (United States)

Huang, X.; Rhoades, A.; Ullrich, P. A.; Zarzycki, C. M.

2015-12-01

Understanding the effect of climate change at regional scales remains a topic of intensive research. Though computational constraints remain a problem, high horizontal resolution is needed to represent topographic forcing, which is a significant driver of local climate variability. Although regional climate models (RCMs) have traditionally been used at these scales, variable-resolution global climate models (VRGCMs) have recently arisen as an alternative for studying regional weather and climate allowing two-way interaction between these domains without the need for nudging. In this study, the recently developed variable-resolution option within the Community Earth System Model (CESM) is assessed for long-term regional climate modeling over California. Our variable-resolution simulations will focus on relatively high resolutions for climate assessment, namely 28km and 14km regional resolution, which are much more typical for dynamically downscaled studies. For comparison with the more widely used RCM method, the Weather Research and Forecasting (WRF) model will be used for simulations at 27km and 9km. All simulations use the AMIP (Atmospheric Model Intercomparison Project) protocols. The time period is from 1979-01-01 to 2005-12-31 (UTC), and year 1979 was discarded as spin up time. The mean climatology across California's diverse climate zones, including temperature and precipitation, is analyzed and contrasted with the Weather Research and Forcasting (WRF) model (as a traditional RCM), regional reanalysis, gridded observational datasets and uniform high-resolution CESM at 0.25 degree with the finite volume (FV) dynamical core. The results show that variable-resolution CESM is competitive in representing regional climatology on both annual and seasonal time scales. This assessment adds value to the use of VRGCMs for projecting climate change over the coming century and improve our understanding of both past and future regional climate related to fine

Neonatal ventral hippocampus lesion alters the dopamine content in the limbic regions in postpubertal rats.

Science.gov (United States)

Alquicer, Glenda; Silva-Gómez, Adriana B; Peralta, Fernando; Flores, Gonzalo

2004-04-01

The neonatal ventral Hippocampus (nVH) lesion in rats has been used as a model to test the hypothesis that early neurodevelopmental abnormalities lead to behavioral changes putatively linked to schizophrenia. The schizophrenic patients tend to social isolation. In addition, considerable evidence from behavioral and neurochemistry studies strongly implicate the dopamine (DA) system and the medial part of the prefrontal cortex (mPFC) in the pathophysiology of the social isolation syndrome. In order to assess effects of the postweaning social isolation (pwSI) on the DA system of the nVH lesions, we investigated the DA content and its metabolite, DOPAC in different limbic subregions in rats postpubertally at postnatal day (P) 78 following nVH lesions at P7 with and without pwSI for 8 weeks. The DA and DOPAC were measured by HPLC with electrochemical detection. The nVH lesion induces increase in the DA content in the hippocampus with no effect in the mPFC, nucleus accumbens and caudate-putamen, while the pwSI induces major increase in the DA content in limbic subregions such as the mPFC, nucleus accumbens and hipocampus with opposite effect in the caudate-putamen. These results suggest that while pwSI has an effect in the postpubertal content of DA in both sham and nVH lesions in rats, the nVH-lesioned rats appear to be affected to a greater extent than the sham animals underscoring the influence of pwSI differences in the development of behaviors in the nVH-lesioned animals.

An Application of the Direct Coulomb Electron Pair Production Process to the Energy Measurement of the "VH-Group" in the "Knee" Region of the "All-Particle" Energy Spectrum

Science.gov (United States)

Derrickson, J. H.; Wu, J.; Christl, M. J.; Fountain, W. F.; Parnell, T. A.

1999-01-01

The "all-particle" cosmic ray energy spectrum appears to be exhibiting a significant change in the spectral index just above approximately 3000 TeV. This could indicate (1) a change in the propagation of the cosmic rays in the galactic medium, and/or (2) the upper limit of the supernova shock wave acceleration mechanism, and/or (3) a new source of high-energy cosmic rays. Air shower and JACEE data indicate the spectral change is associated with a composition change to a heavier element mixture whereas DICE does not indicate this. A detector concept will be presented that utilizes the energy dependence of the production of direct Coulomb electron-positron pairs by energetic heavy ions. Monte Carlo simulations of a direct electron pair detector consisting of Pb target foils interleaved with planes of 1-mm square scintillating optical fibers will be discussed. The goal is to design a large area, non-saturating instrument to measure the energy spectrum of the individual cosmic ray elements in the "VH-group" for energies greater than 10 TeV/nucleon.

Impact of region contouring variability on image-based focal therapy evaluation

Science.gov (United States)

Gibson, Eli; Donaldson, Ian A.; Shah, Taimur T.; Hu, Yipeng; Ahmed, Hashim U.; Barratt, Dean C.

2016-03-01

Motivation: Focal therapy is an emerging low-morbidity treatment option for low-intermediate risk prostate cancer; however, challenges remain in accurately delivering treatment to specified targets and determining treatment success. Registered multi-parametric magnetic resonance imaging (MPMRI) acquired before and after treatment can support focal therapy evaluation and optimization; however, contouring variability, when defining the prostate, the clinical target volume (CTV) and the ablation region in images, reduces the precision of quantitative image-based focal therapy evaluation metrics. To inform the interpretation and clarify the limitations of such metrics, we investigated inter-observer contouring variability and its impact on four metrics. Methods: Pre-therapy and 2-week-post-therapy standard-of-care MPMRI were acquired from 5 focal cryotherapy patients. Two clinicians independently contoured, on each slice, the prostate (pre- and post-treatment) and the dominant index lesion CTV (pre-treatment) in the T2-weighted MRI, and the ablated region (post-treatment) in the dynamic-contrast- enhanced MRI. For each combination of clinician contours, post-treatment images were registered to pre-treatment images using a 3D biomechanical-model-based registration of prostate surfaces, and four metrics were computed: the proportion of the target tissue region that was ablated and the target:ablated region volume ratio for each of two targets (the CTV and an expanded planning target volume). Variance components analysis was used to measure the contribution of each type of contour to the variance in the therapy evaluation metrics. Conclusions: 14-23% of evaluation metric variance was attributable to contouring variability (including 6-12% from ablation region contouring); reducing this variability could improve the precision of focal therapy evaluation metrics.

The Search for VH → VWW Standard Model Higgs Production in the Trilepton Signature 5.9fb-1 of Data from p(bar p) Collisions at √s = 1.96 GeV

International Nuclear Information System (INIS)

Nett, Jason Michael

2010-01-01

We present here the search for Standard Model VH → VWW → lll + E T (missing energy due to neutrinos) production, where V is a W or Z weak vector boson, which uses up to 5.9 fb -1 of integrated luminosity. This analysis has recently added to the CDF high-mass Higgs group three new signal topologies characterized by a tri-lepton signature, which are chosen to isolate the VH → VWW associated production signals in the three-lepton signature. As such, we define three new regions for a WH analysis, a ZH 1-jet analysis, and a ZH (ge) 2-jet analysis with which we expect to contribute an additional ∼ 5.8% (for m H = 165 GeV) acceptance to the current H → WW dilepton analysis. The ZH trilepton regions are defined by events passing a Z-boson selection: events having at least one lepton pairing (among three possible pairings) with opposite sign, same flavor, and a dilepton invariant mass within (76.0, 106.0) GeV - a ± 15 GeV window around the Z-boson mass. The WH trilepton region is then defined as the set of trilepton events that are complement to those chosen by the Z-boson selection. These three new event topologies make a substantial contribution to the H → WW group result. As a measure of the sensitivity of this search, we compute the median expected limit on the at 95% confidence level ('C.L.') on the production cross section (effectively the rate of production) for a Standard Model Higgs boson and report the result as a ratio to the theoretical production cross section. An observed limit ratio of one or less at a given mass would rule out the production of a Standard Model Higgs boson at that mass with 95% confidence. At m H = 165 GeV, the WH analysis expected limits reach 7.2 times the standard model cross section; the ZH 1-jet analysis is set at 29 times the expected standard model cross section; the ZH (ge) 2-jet analysis is set at 9.9 times the expected standard model cross section; and the combined trilepton analysis is set at 4.9 times the expected

Development of a localized probabilistic sensitivity method to determine random variable regional importance

International Nuclear Information System (INIS)

Millwater, Harry; Singh, Gulshan; Cortina, Miguel

2012-01-01

There are many methods to identify the important variable out of a set of random variables, i.e., “inter-variable” importance; however, to date there are no comparable methods to identify the “region” of importance within a random variable, i.e., “intra-variable” importance. Knowledge of the critical region of an input random variable (tail, near-tail, and central region) can provide valuable information towards characterizing, understanding, and improving a model through additional modeling or testing. As a result, an intra-variable probabilistic sensitivity method was developed and demonstrated for independent random variables that computes the partial derivative of a probabilistic response with respect to a localized perturbation in the CDF values of each random variable. These sensitivities are then normalized in absolute value with respect to the largest sensitivity within a distribution to indicate the region of importance. The methodology is implemented using the Score Function kernel-based method such that existing samples can be used to compute sensitivities for negligible cost. Numerical examples demonstrate the accuracy of the method through comparisons with finite difference and numerical integration quadrature estimates. - Highlights: ► Probabilistic sensitivity methodology. ► Determines the “region” of importance within random variables such as left tail, near tail, center, right tail, etc. ► Uses the Score Function approach to reuse the samples, hence, negligible cost. ► No restrictions on the random variable types or limit states.

Integrated Variable Speed Limits Control and Ramp Metering for Bottleneck Regions on Freeway

Directory of Open Access Journals (Sweden)

Ming-hui Ma

2015-01-01

Full Text Available To enhance the efficiency of the existing freeway system and therefore to mitigate traffic congestion and related problems on the freeway mainline lane-drop bottleneck region, the advanced strategy for bottleneck control is essential. This paper proposes a method that integrates variable speed limits and ramp metering for freeway bottleneck region control to relieve the chaos in bottleneck region. To this end, based on the analyses of spatial-temporal patterns of traffic flow, a macroscopic traffic flow model is extended to describe the traffic flow operating characteristic by considering the impacts of variable speed limits in mainstream bottleneck region. In addition, to achieve the goal of balancing the priority of the vehicles on mainline and on-ramp, increasing capacity, and reducing travel delay on bottleneck region, an improved control model, as well as an advanced control strategy that integrates variable speed limits and ramp metering, is developed. The proposed method is tested in simulation for a real freeway infrastructure feed and calibrates real traffic variables. The results demonstrate that the proposed method can substantially improve the traffic flow efficiency of mainline and on-ramp and enhance the quality of traffic flow at the investigated freeway mainline bottleneck.

Structural considerations for functional anti-EGFR × anti-CD3 bispecific diabodies in light of domain order and binding affinity.

Science.gov (United States)

Asano, Ryutaro; Nagai, Keisuke; Makabe, Koki; Takahashi, Kento; Kumagai, Takashi; Kawaguchi, Hiroko; Ogata, Hiromi; Arai, Kyoko; Umetsu, Mitsuo; Kumagai, Izumi

2018-03-02

We previously reported a functional humanized bispecific diabody (bsDb) that targeted EGFR and CD3 (hEx3-Db) and enhancement of its cytotoxicity by rearranging the domain order in the V domain. Here, we further dissected the effect of domain order in bsDbs on their cross-linking ability and binding kinetics to elucidate general rules regarding the design of functional bsDbs. Using Ex3-Db as a model system, we first classified the four possible domain orders as anti-parallel (where both chimeric single-chain components are variable heavy domain (VH)-variable light domain (VL) or VL-VH order) and parallel types (both chimeric single-chain components are mixed with VH-VL and VL-VH order). Although anti-parallel Ex3-Dbs could cross-link the soluble target antigens, their cross-linking ability between soluble targets had no correlation with their growth inhibitory effects. In contrast, the binding affinity of one of the two constructs with a parallel-arrangement V domain was particularly low, and structural modeling supported this phenomenon. Similar results were observed with E2x3-Dbs, in which the V region of the anti-EGFR antibody clone in hEx3 was replaced with that of another anti-EGFR clone. Only anti-parallel types showed affinity-dependent cancer inhibitory effects in each molecule, and E2x3-LH (both components in VL-VH order) showed the most intense anti-tumor activity in vitro and in vivo . Our results showed that, in addition to rearranging the domain order of bsDbs, increasing their binding affinity may be an ideal strategy for enhancing the cytotoxicity of anti-parallel constructs and that E2x3-LH is particularly attractive as a candidate next-generation anti-cancer drug.

Airborne black carbon concentrations over an urban region in western India-temporal variability, effects of meteorology, and source regions.

Science.gov (United States)

Bapna, Mukund; Sunder Raman, Ramya; Ramachandran, S; Rajesh, T A

2013-03-01

This study characterizes over 5 years of high time resolution (5 min), airborne black carbon (BC) concentrations (July 2003 to December 2008) measured over Ahmedabad, an urban region in western India. The data were used to obtain different time averages of BC concentrations, and these averages were then used to assess the diurnal, seasonal, and annual variability of BC over the study region. Assessment of diurnal variations revealed a strong association between BC concentrations and vehicular traffic. Peaks in BC concentration were co-incident with the morning (0730 to 0830, LST) and late evening (1930 to 2030, LST) rush hour traffic. Additionally, diurnal variability in BC concentrations during major festivals (Diwali and Dushera during the months of October/November) revealed an increase in BC concentrations due to fireworks displays. Maximum half hourly BC concentrations during the festival days were as high as 79.8 μg m(-3). However, the high concentrations rapidly decayed suggesting that local meteorology during the festive season was favorable for aerosol dispersion. A multiple linear regression (MLR) model with BC as the dependent variable and meteorological parameters as independent variables was fitted. The variability in temperature, humidity, wind speed, and wind direction accounted for about 49% of the variability in measured BC concentrations. Conditional probability function (CPF) analysis was used to identify the geographical location of local source regions contributing to the effective BC measured (at 880 nm) at the receptor site. The east north-east (ENE) direction to the receptor was identified as a major source region. National highway (NH8) and two coal-fired thermal power stations (at Gandhinagar and Sabarmati) were located in the identified direction, suggesting that local traffic and power plant emissions were likely contributors to the measured BC.

Regional frameworks applied to hydrology: can landscape-based frameworks capture the hydrologic variability?

Science.gov (United States)

R. McManamay; D. Orth; C. Dolloff; E. Frimpong

2011-01-01

Regional frameworks have been used extensively in recent years to aid in broad-scale management. Widely used landscape-based regional frameworks, such as hydrologic landscape regions (HLRs) and physiographic provinces, may provide predictive tools of hydrologic variability. However, hydrologic-based regional frameworks, created using only streamflow data, are also...

Assessment of regional air pollution variability in Istanbul

International Nuclear Information System (INIS)

Sen, Z.; Oztopal, A.

2001-01-01

Air pollution concentrations have temporal and spatial variations depending on the prevailing weather conditions, topographic features, city building heights and locations. When the measurements of air pollutants are available at set measurement sites, the regional variability degree of air pollutants is quantified using the point cumulative semi-variogram (PCSV). This technique provides a systematic method for calculating the changes in the concentrations of air pollutants with distance from a specific site. Regional variations of sulphur dioxide (SO 2 ) and total suspended particulate (TSP) matter concentrations in Istanbul city were evaluated using the PCSV concept. The data were available from 16 different air pollution measurement stations scattered all over the city for a period from 1988 to 1994. Monthly regional variation maps were drawn in and around the city at different radii of influence. These maps provide a reference for measuring future changes of air pollution in the city. (author)

Characterizing CDOM Spectral Variability Across Diverse Regions and Spectral Ranges

Science.gov (United States)

Grunert, Brice K.; Mouw, Colleen B.; Ciochetto, Audrey B.

2018-01-01

Satellite remote sensing of colored dissolved organic matter (CDOM) has focused on CDOM absorption (aCDOM) at a reference wavelength, as its magnitude provides insight into the underwater light field and large-scale biogeochemical processes. CDOM spectral slope, SCDOM, has been treated as a constant or semiconstant parameter in satellite retrievals of aCDOM despite significant regional and temporal variabilities. SCDOM and other optical metrics provide insights into CDOM composition, processing, food web dynamics, and carbon cycling. To date, much of this work relies on fluorescence techniques or aCDOM in spectral ranges unavailable to current and planned satellite sensors (e.g., global variability in SCDOM and fit deviations in the aCDOM spectra using the recently proposed Gaussian decomposition method. From this, we investigate if global variability in retrieved SCDOM and Gaussian components is significant and regionally distinct. We iteratively decreased the spectral range considered and analyzed the number, location, and magnitude of fitted Gaussian components to understand if a reduced spectral range impacts information obtained within a common spectral window. We compared the fitted slope from the Gaussian decomposition method to absorption-based indices that indicate CDOM composition to determine the ability of satellite-derived slope to inform the analysis and modeling of large-scale biogeochemical processes. Finally, we present implications of the observed variability for remote sensing of CDOM characteristics via SCDOM.

Impact of Variable-Resolution Meshes on Regional Climate Simulations

Science.gov (United States)

Fowler, L. D.; Skamarock, W. C.; Bruyere, C. L.

2014-12-01

The Model for Prediction Across Scales (MPAS) is currently being used for seasonal-scale simulations on globally-uniform and regionally-refined meshes. Our ongoing research aims at analyzing simulations of tropical convective activity and tropical cyclone development during one hurricane season over the North Atlantic Ocean, contrasting statistics obtained with a variable-resolution mesh against those obtained with a quasi-uniform mesh. Analyses focus on the spatial distribution, frequency, and intensity of convective and grid-scale precipitations, and their relative contributions to the total precipitation as a function of the horizontal scale. Multi-month simulations initialized on May 1st 2005 using ERA-Interim re-analyses indicate that MPAS performs satisfactorily as a regional climate model for different combinations of horizontal resolutions and transitions between the coarse and refined meshes. Results highlight seamless transitions for convection, cloud microphysics, radiation, and land-surface processes between the quasi-uniform and locally- refined meshes, despite the fact that the physics parameterizations were not developed for variable resolution meshes. Our goal of analyzing the performance of MPAS is twofold. First, we want to establish that MPAS can be successfully used as a regional climate model, bypassing the need for nesting and nudging techniques at the edges of the computational domain as done in traditional regional climate modeling. Second, we want to assess the performance of our convective and cloud microphysics parameterizations as the horizontal resolution varies between the lower-resolution quasi-uniform and higher-resolution locally-refined areas of the global domain.

Search for $VH\\rightarrow$ leptons + $b\\bar{b}$ with the ATLAS experiment at the LHC

CERN Document Server

AUTHOR|(CDS)2079589

The search for a Higgs boson decaying to a $b\\bar{b}$ pair is one of the key analyses ongoing at the ATLAS experiment. Despite being the largest branching ratio decay for a Standard Model Higgs boson, a large dataset is necessary to perform this analysis because of the very large backgrounds affecting the measurement. To discriminate the electroweak $H\\rightarrow b\\bar{b}$ signal from the large QCD backgrounds, the associated production of the Higgs with a $W$ or a $Z$ boson decaying leptonically is used. Different techniques have been proposed to enhance the signal over background ratio in the $VH(b\\bar{b})$ channel, from dedicated kinematic cuts, to a single large radius jet to identify the two collimated $b$'s in the Higgs high transverse momentum regime, to multivariate techniques. The high-$p_{\\mathrm{T}}$ approach, using a large radius jet to identify the $b$'s coming from the Higgs decay, has been tested against an analysis based on kinematic cuts for a dataset of $4.7$ fb$^{-1}$ luminosity at $\\sqrt{s...

Morphometric variability of Arctodiaptomus salinus (Copepoda) in the Mediterranean-Black Sea region

OpenAIRE

ANUFRIIEVA, Elena V.; SHADRIN, Nickolai V.

2015-01-01

Inter-species variability in morphological traits creates a need to know the range of variability of characteristics in the species for taxonomic and ecological tasks. Copepoda Arctodiaptomus salinus, which inhabits water bodies across Eurasia and North Africa, plays a dominant role in plankton of different water bodies-from fresh to hypersaline. This work assesses the intra- and inter-population morphometric variability of A. salinus in the Mediterranean-Black Sea region and discusses some o...

Clinical features of progressive vacuolar hepatopathy in Scottish Terriers with and without hepatocellular carcinoma: 114 cases (1980-2013).

Science.gov (United States)

Cortright, Catherine C; Center, Sharon A; Randolph, John F; McDonough, Sean P; Fecteau, Kellie A; Warner, Karen L; Chiapella, Ann M; Pierce, Rhonda L; Graham, A Heather; Wall, Linda J; Heidgerd, John H; Degen, Melisa A; Lucia, Patricia A; Erb, Hollis N

2014-10-01

To characterize signalment, clinical features, clinicopathologic variables, hepatic ultrasonographic characteristics, endocrinologic profiles, treatment response, and age at death of Scottish Terriers with progressive vacuolar hepatopathy (VH) with or without hepatocellular carcinoma (HCC). Retrospective case series. 114 Scottish Terriers with progressive VH. Electronic databases from 1980 to 2013 were searched for adult (age > 1 year) Scottish Terriers with histopathologic diagnoses of diffuse glycogen-like VH. Available sections of liver specimens were histologically reevaluated to confirm diffuse VH with or without HCC; 8 dogs with HCC only had neoplastic tissue available. Physical examination, clinicopathologic, treatment, and survival data were obtained. 39 of 114 (34%) dogs with VH had HCC detected at surgery or necropsy or by abdominal ultrasonography. Histologic findings indicated that HCC was seemingly preceded by dysplastic hepatocellular foci. No significant differences were found in clinicopathologic variables or age at death between VH-affected dogs with or without HCC. Fifteen of 26 (58%) dogs with high hepatic copper concentrations had histologic features consistent with copper-associated hepatopathy. Although signs consistent with hyperadrenocorticism were observed in 40% (46/114) of dogs, definitive diagnosis was inconsistently confirmed. Assessment of adrenal sex hormone concentrations before and after ACTH administration identified high progesterone and androstenedione concentrations in 88% (22/25) and 80% (20/25) of tested dogs, respectively. Results suggested that VH in Scottish Terriers may be linked to adrenal steroidogenesis and a predisposition to HCC. In dogs with VH, frequent serum biochemical analysis and ultrasonographic surveillance for early tumor detection are recommended.

An observational and modeling study of the regional impacts of climate variability

Science.gov (United States)

Horton, Radley M.

Climate variability has large impacts on humans and their agricultural systems. Farmers are at the center of this agricultural network, but it is often agricultural planners---regional planners, extension agents, commodity groups and cooperatives---that translate climate information for users. Global climate models (GCMs) are a leading tool for understanding and predicting climate and climate change. Armed with climate projections and forecasts, agricultural planners adapt their decision-making to optimize outcomes. This thesis explores what GCMs can, and cannot, tell us about climate variability and change at regional scales. The question is important, since high-quality regional climate projections could assist farmers and regional planners in key management decisions, contributing to better agricultural outcomes. To answer these questions, climate variability and its regional impacts are explored in observations and models for the current and future climate. The goals are to identify impacts of observed variability, assess model simulation of variability, and explore how climate variability and its impacts may change under enhanced greenhouse warming. Chapter One explores how well Goddard Institute for Space Studies (GISS) atmospheric models, forced by historical sea surface temperatures (SST), simulate climatology and large-scale features during the exceptionally strong 1997--1999 El Nino Southern Oscillation (ENSO) cycle. Reasonable performance in this 'proof of concept' test is considered a minimum requirement for further study of variability in models. All model versions produce appropriate local changes with ENSO, indicating that with correct ocean temperatures these versions are capable of simulating the large-scale effects of ENSO around the globe. A high vertical resolution model (VHR) provides the best simulation. Evidence is also presented that SST anomalies outside the tropical Pacific may play a key role in generating remote teleconnections even

Life-history strategies associated with local population variability confer regional stability.

Science.gov (United States)

Pribil, Stanislav; Houlahan, Jeff E

2003-07-07

A widely held ecological tenet is that, at the local scale, populations of K-selected species (i.e. low fecundity, long lifespan and large body size) will be less variable than populations of r-selected species (i.e. high fecundity, short lifespan and small body size). We examined the relationship between long-term population trends and life-history attributes for 185 bird species in the Czech Republic and found that, at regional spatial scales and over moderate temporal scales (100-120 years), K-selected bird species were more likely to show both large increases and decreases in population size than r-selected species. We conclude that life-history attributes commonly associated with variable populations at the local scale, confer stability at the regional scale.

Moment-to-Moment BOLD Signal Variability Reflects Regional Changes in Neural Flexibility across the Lifespan.

Science.gov (United States)

Nomi, Jason S; Bolt, Taylor S; Ezie, C E Chiemeka; Uddin, Lucina Q; Heller, Aaron S

2017-05-31

Variability of neuronal responses is thought to underlie flexible and optimal brain function. Because previous work investigating BOLD signal variability has been conducted within task-based fMRI contexts on adults and older individuals, very little is currently known regarding regional changes in spontaneous BOLD signal variability in the human brain across the lifespan. The current study used resting-state fMRI data from a large sample of male and female human participants covering a wide age range (6-85 years) across two different fMRI acquisition parameters (TR = 0.645 and 1.4 s). Variability in brain regions including a key node of the salience network (anterior insula) increased linearly across the lifespan across datasets. In contrast, variability in most other large-scale networks decreased linearly over the lifespan. These results demonstrate unique lifespan trajectories of BOLD variability related to specific regions of the brain and add to a growing literature demonstrating the importance of identifying normative trajectories of functional brain maturation. SIGNIFICANCE STATEMENT Although brain signal variability has traditionally been considered a source of unwanted noise, recent work demonstrates that variability in brain signals during task performance is related to brain maturation in old age as well as individual differences in behavioral performance. The current results demonstrate that intrinsic fluctuations in resting-state variability exhibit unique maturation trajectories in specific brain regions and systems, particularly those supporting salience detection. These results have implications for investigations of brain development and aging, as well as interpretations of brain function underlying behavioral changes across the lifespan. Copyright © 2017 the authors 0270-6474/17/375539-10$15.00/0.

Morphometric variability of Arctodiaptomus salinus (Copepoda) in the Mediterranean-Black Sea region.

Science.gov (United States)

Anufriieva, Elena V; Shadrin, Nickolai V

2015-11-18

Inter-species variability in morphological traits creates a need to know the range of variability of characteristics in the species for taxonomic and ecological tasks. Copepoda Arctodiaptomus salinus, which inhabits water bodies across Eurasia and North Africa, plays a dominant role in plankton of different water bodies-from fresh to hypersaline. This work assesses the intra- and inter-population morphometric variability of A. salinus in the Mediterranean-Black Sea region and discusses some observed regularities. The variability of linear body parameters and proportions was studied. The impacts of salinity, temperature, and population density on morphological characteristics and their variability can manifest themselves in different ways at the intra- and inter-population levels. A significant effect of salinity, pH and temperature on the body proportions was not found. Their intra-population variability is dependent on temperature and salinity. Sexual dimorphism of A. salinus manifests in different linear parameters, proportions, and their variability. There were no effects of temperature, pH and salinity on the female/male parameter ratio. There were significant differences in the body proportions of males and females in different populations. The influence of temperature, salinity, and population density can be attributed to 80%-90% of intra-population variability of A. salinus. However, these factors can explain less than 40% of inter-population differences. Significant differences in the body proportions of males and females from different populations may suggest that some local populations of A. salinus in the Mediterranean-Black Sea region are in the initial stages of differentiation.

Extreme Variables in Star Forming Regions

Science.gov (United States)

Contreras Peña, Carlos Eduardo

2015-01-01

in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| explained as arising from shock-excited emission caused by molecular outflows. Whether these molecular outflows are related to outbursts events cannot be confirmed from our data. Adding the GPS and VVV spectroscopic results, we find that between 6 and 14 objects are new additions to the FUor class from their close resemblance to the near-infrared spectra of FUors, and at least 23 more objects are new additions to the eruptive variable class. For most of these we are unable to classify them into any of the original definitions for this variable class. In any case, we are adding up to 37 new stars to the eruptive variable class which would double the current number of known objects. We note that most objects are found to be deeply embedded optically invisible stars, thus increasing the number of objects belonging to this subclass by a much larger factor. In general, objects in our samples which are found to be likely eruptive variable stars show a mixture of

Mesopause region temperature variability and its trend in southern Brazil

Science.gov (United States)

Venturini, Mateus S.; Bageston, José V.; Caetano, Nattan R.; Peres, Lucas V.; Bencherif, Hassan; Schuch, Nelson J.

2018-03-01

Nowadays, the study of the upper atmosphere is increasing, mostly because of the need to understand the patterns of Earth's atmosphere. Since studies on global warming have become very important for the development of new technologies, understanding all regions of the atmosphere becomes an unavoidable task. In this paper, we aim to analyze the temperature variability and its trend in the mesosphere and lower thermosphere (MLT) region during a period of 12 years (from 2003 to 2014). For this purpose, three different heights, i.e., 85, 90 and 95 km, were focused on in order to investigate the upper atmosphere, and a geographic region different to other studies was chosen, in the southern region of Brazil, centered in the city of Santa Maria, RS (29°41'02'' S; 53°48'25'' W). In order to reach the objectives of this work, temperature data from the SABER instrument (Sounding of the Atmosphere using Broadband Emission Radiometry), aboard NASA's Thermosphere Ionosphere Mesosphere Energetics Dynamics (TIMED) satellite, were used. Finally, two cases were studied related to distinct grids of latitude/longitude used to obtain the mean temperature profiles. The first case considered a grid of 20° × 20° lat/long, centered in Santa Maria, RS, Brazil. In the second case, the region was reduced to a size of 15° × 15° in order to compare the results and discuss the two cases in terms of differences or similarities in temperature trends. Observations show that the size of the geographical area used for the average temperature profiles can influence the results of variability and trend of the temperature. In addition, reducing the time duration of analyses from 24 to 12 h a day also influences the trend significantly. For the smaller geographical region (15° × 15°) and the 12 h daily time window (09:00-21:00 UT) it was found that the main contributions for the temperature variability at the three heights were the annual and semi-annual cycles and the solar flux influence

Regionalizing Africa: Patterns of Precipitation Variability in Observations and Global Climate Models

Science.gov (United States)

Badr, Hamada S.; Dezfuli, Amin K.; Zaitchik, Benjamin F.; Peters-Lidard, Christa D.

2016-01-01

Many studies have documented dramatic climatic and environmental changes that have affected Africa over different time scales. These studies often raise questions regarding the spatial extent and regional connectivity of changes inferred from observations and proxies and/or derived from climate models. Objective regionalization offers a tool for addressing these questions. To demonstrate this potential, applications of hierarchical climate regionalizations of Africa using observations and GCM historical simulations and future projections are presented. First, Africa is regionalized based on interannual precipitation variability using Climate Hazards Group Infrared Precipitation with Stations (CHIRPS) data for the period 19812014. A number of data processing techniques and clustering algorithms are tested to ensure a robust definition of climate regions. These regionalization results highlight the seasonal and even month-to-month specificity of regional climate associations across the continent, emphasizing the need to consider time of year as well as research question when defining a coherent region for climate analysis. CHIRPS regions are then compared to those of five GCMs for the historic period, with a focus on boreal summer. Results show that some GCMs capture the climatic coherence of the Sahel and associated teleconnections in a manner that is similar to observations, while other models break the Sahel into uncorrelated subregions or produce a Sahel-like region of variability that is spatially displaced from observations. Finally, shifts in climate regions under projected twenty-first-century climate change for different GCMs and emissions pathways are examined. A projected change is found in the coherence of the Sahel, in which the western and eastern Sahel become distinct regions with different teleconnections. This pattern is most pronounced in high-emissions scenarios.

Constancy despite variability: Local and regional macrofaunal diversity in intertidal seagrass beds

Science.gov (United States)

Boyé, Aurélien; Legendre, Pierre; Grall, Jacques; Gauthier, Olivier

2017-12-01

The importance of seagrass habitat for the diversity of benthic fauna has been extensively studied worldwide. Most of the information available is, however, about α diversity while little consideration has been given to β diversity. To fill the knowledge gaps regarding the variability of epifaunal and infaunal seagrass assemblages at large spatial and temporal scales, we scrutinized an extensive dataset covering five years of monitoring of eight intertidal Zostera marina meadows around Brittany (France). High species richness arose at the regional scale from the combination of high local diversity of the meadows and substantial among-meadows β diversity. Epifauna and infauna appeared as distinct self-communities as they displayed different spatial and temporal patterns and varied in their responses to local hydrological conditions. Infauna had higher total β diversity than epifauna due to a tighter link to the great variability of local environmental conditions in the region. Both exhibited substantial variations in species composition and community structure with variations of dominant species that were accompanied by extensive change in numerous rare species. The dominant epifaunal species were all grazers. Changes in species composition were induced mostly by species replacement and rarely by richness differences between meadows. Indeed, species richness remained within a narrow range for all seagrass beds, suggesting a potential carrying capacity for species richness of the meadows. Overall, all meadows contributed equally to the regional turnover of seagrass macrofauna, emphasizing high variability and complementarity among beds at the regional scale. The implications of this substantial within-seagrass variability for the functioning of benthic ecosystems at broad scale and for conservation purposes in habitat mosaics warrant further investigations but our results clearly advocate taking into account within-habitat variation when evaluating the diversity

Long-term Variability of H2CO Masers in Star-forming Regions

Science.gov (United States)

Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.

2017-10-01

We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.

Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

Mitochondrial DNA control region variability in wild boars from west Balkans

Directory of Open Access Journals (Sweden)

Đan Mihajla

2013-01-01

Full Text Available The wild boar (Sus scrofa is one of most abundant game species in hunting areas of Balkan region. The large fraction of pre-glacial genetic diversity in wild boar populations from the Balkans was addressed due to high proportion of unique mtDNA haplotypes found in Greece, indicating Balkan as main refugial area for wild boars. The aim of the present study is to characterize mitochondrial DNA control region variability in wild boars from different areas in the West Balkan region, in order to evaluate level of genetic variability, to detect unique haplotypes and to infer possible structuring. The total number of 163 individuals from different sampling localities were included in the study. A fragment of the mtDNA control region was amplified and sequenced by standard procedures. Population genetic analyses were performed using several computer packages: BioEdit, ARLEQUIN 3.5.1.2., Network 4.6.0.0 and MEGA5. Eleven different haplotypes were identified and haplotype diversity was 0.676, nucleotide diversity 0.0026, and the average number of nucleotide differences (k 1.169. The mismatch distribution and neutrality tests indicated the expansion of the all populations. It is shown that high level of genetic diversity is present in the wild boars from the West Balkan region and we have managed to detect regional unique haplotypes in high frequency. Genetic diversity differences have been found in regional wild boar groups, clustering them in two main clusters, but further speculations on the reasons for the observed clustering are prevented due to restricted informativness of the single locus marker. Obtained knowledge of genetic variation in the wild boar may be relevant for improving knowledge of the phylogeny and phylogeography of the wild boars, but as well as for hunting societies and responsible authorities for the effective control of wild boar populations.

Modelling and prediction of crop losses from NOAA polar-orbiting operational satellites

Directory of Open Access Journals (Sweden)

Felix Kogan

2016-05-01

Full Text Available Weather-related crop losses have always been a concern for farmers, governments, traders, and policy-makers for the purpose of balanced food supply/demands, trade, and distribution of aid to the nations in need. Among weather disasters, drought plays a major role in large-scale crop losses. This paper discusses utility of operational satellite-based vegetation health (VH indices for modelling cereal yield and for early warning of drought-related crop losses. The indices were tested in Saratov oblast (SO, one of the principal grain growing regions of Russia. Correlation and regression analysis were applied to model cereal yield from VH indices during 1982–2001. A strong correlation between mean SO's cereal yield and VH indices were found during the critical period of cereals, which starts two–three weeks before and ends two–three weeks after the heading stage. Several models were constructed where VH indices served as independent variables (predictors. The models were validated independently based on SO cereal yield during 1982–2012. Drought-related cereal yield losses can be predicted three months in advance of harvest and six–eight months in advance of official grain production statistic is released. The error of production losses prediction is 7%–10%. The error of prediction drops to 3%–5% in the years of intensive droughts.

Comparing domain interactions within antibody Fabs with kappa and lambda light chains.

Science.gov (United States)

Toughiri, Raheleh; Wu, Xiufeng; Ruiz, Diana; Huang, Flora; Crissman, John W; Dickey, Mark; Froning, Karen; Conner, Elaine M; Cujec, Thomas P; Demarest, Stephen J

2016-10-01

IgG antibodies are multi-domain proteins with complex inter-domain interactions. Human IgG heavy chains (HCs) associate with light chains (LCs) of the κ or λ isotype to form mature antibodies capable of binding antigen. The HC/LC interaction involves 4 domains: VH and CH1 from the HC and VL and CL from the LC. Human Fabs with κ LCs have been well characterized for their unfolding behaviors and demonstrate a significant level of cooperativity and stabilization when all 4 domains are intact. Very little is known regarding the thermodynamic properties of human Fabs with λ LCs. Here, we dissect the domain contributions to Fab stability for both κ and λ LC-containing Fabs. We find the cooperativity of unfolding between the constant domains, CH1/Cλ, and variable domains, VH/Vλ, within λ LC-containing Fabs is significantly weaker than that of κ LC-containing Fabs. The data suggests there may not be an evolutionary necessity for strong variable/constant domain cooperativity within λ LC-containing Fabs. After investigating the biophysical properties of Fabs with mismatched variable and constant domain subunits (e.g., VH/Vκ paired with CH1/Cλ or T cell receptor Cα/Cβ), the major role of the constant domains for both κ- and λ-containing Fabs may be to reduce the hydrophobic exposure at the VH/VL interface. Even though Fabs with these non-native pairings were thermodynamically less stable, they secreted well from mammalian cells as well behaved monodisperse proteins, which was in contrast to what was observed with the VH/Vκ and VH/Vλ scFvs that secreted as a mixture of monomer and aggregates.

Capturing subregional variability in regional-scale climate change vulnerability assessments of natural resources

Science.gov (United States)

Polly C. Buotte; David L. Peterson; Kevin S. McKelvey; Jeffrey A. Hicke

2016-01-01

Natural resource vulnerability to climate change can depend on the climatology and ecological conditions at a particular site. Here we present a conceptual framework for incorporating spatial variability in natural resource vulnerability to climate change in a regional-scale assessment. The framework was implemented in the first regional-scale vulnerability...

Climate Drivers of Spatiotemporal Variability of Precipitation in the Source Region of Yangtze River

Science.gov (United States)

Du, Y.; Berndtsson, R.; An, D.; Yuan, F.

2017-12-01

Variability of precipitation regime has significant influence on the environment sustainability in the source region of Yangtze River, especially when the vegetation degradation and biodiversity reduction have already occurred. Understanding the linkage between variability of local precipitation and global teleconnection patterns is essential for water resources management. Based on physical reasoning, indices of the climate drivers can provide a practical way of predicting precipitation. Due to high seasonal variability of precipitation, climate drivers of the seasonal precipitation also varies. However, few reports have gone through the teleconnections between large scale patterns with seasonal precipitation in the source region of Yangtze River. The objectives of this study are therefore (1) assessment of temporal trend and spatial variability of precipitation in the source region of Yangtze River; (2) identification of climate indices with strong influence on seasonal precipitation anomalies; (3) prediction of seasonal precipitation based on revealed climate indices. Principal component analysis and Spearman rank correlation were used to detect significant relationships. A feed-forward artificial neural network(ANN) was developed to predict seasonal precipitation using significant correlated climate indices. Different influencing climate indices were revealed for precipitation in each season, with significant level and lag times. Significant influencing factors were selected to be the predictors for ANN model. With correlation coefficients between observed and simulated precipitation over 0.5, the results were eligible to predict the precipitation of spring, summer and winter using teleconnections, which can improve integrated water resources management in the source region of Yangtze River.

Improving preparedness of farmers to Climate Variability: A case study of Vidarbha region of Maharashtra, India

Science.gov (United States)

Swami, D.; Parthasarathy, D.; Dave, P.

2016-12-01

A key objective of the ongoing research is to understand the risk and vulnerability of agriculture and farming communities with respect to multiple climate change attributes, particularly monsoon variability and hydrology such as ground water availability. Climate Variability has always been a feature affecting Indian agriculture but the nature and characteristics of this variability is not well understood. Indian monsoon patterns are highly variable and most of the studies focus on larger domain such as Central India or Western coast (Ghosh et al., 2009) but district level analysis is missing i.e. the linkage between agriculture and climate variables at finer scale has not been investigated comprehensively. For example, Eastern Vidarbha region in Maharashtra is considered as one of the most agriculturally sensitive region in India, where every year a large number of farmers commit suicide. The main reasons for large number of suicides are climate related stressors such as droughts, hail storms, and monsoon variability aggravated with poor socio-economic conditions. Present study has tried to explore the areas in Vidarbha region of Maharashtra where famers and crop productivity, specifically cotton, sorghum, is highly vulnerable to monsoon variability, hydrological and socio-economic variables which are further modelled to determine the maximal contributing factor towards crops and farmers' vulnerability. After analysis using primary and secondary data, it will aid in decision making regarding field operations such as time of sowing, harvesting and irrigation requirements by optimizing the cropping pattern with climatic, hydrological and socio-economic variables. It also suggests the adaptation strategies to farmers regarding different types of cropping and water harvesting practices, optimized dates and timings for harvesting, sowing, water and nutrient requirements of particular crops according to the specific region. Primarily along with secondary analysis

Use of molecular modeling and site-directed mutagenesis to define the structural basis for the immune response to carbohydrate xenoantigens

Directory of Open Access Journals (Sweden)

Yew Margaret

2007-03-01

Full Text Available Abstract Background Natural antibodies directed at carbohydrates reject porcine xenografts. They are initially expressed in germline configuration and are encoded by a small number of structurally-related germline progenitors. The transplantation of genetically-modified pig organs prevents hyperacute rejection, but delayed graft rejection still occurs, partly due to humoral responses. IgVH genes encoding induced xenoantibodies are predominantly, not exclusively, derived from germline progenitors in the VH3 family. We have previously identified the immunoglobulin heavy chain genes encoding VH3 xenoantibodies in patients and primates. In this manuscript, we complete the structural analysis of induced xenoantibodies by identifying the IgVH genes encoding the small proportion of VH4 xenoantibodies and the germline progenitors encoding xenoantibody light chains. This information has been used to define the xenoantibody/carbohydrate binding site using computer-simulated modeling. Results The VH4-59 gene encodes antibodies in the VH4 family that are induced in human patients mounting active xenoantibody responses. The light chain of xenoantibodies is encoded by DPK5 and HSIGKV134. The structural information obtained by sequencing analysis was used to create computer-simulated models. Key contact sites for xenoantibody/carbohydrate interaction for VH3 family xenoantibodies include amino acids in sites 31, 33, 50, 57, 58 and the CDR3 region of the IgVH gene. Site-directed mutagenesis indicates that mutations in predicted contact sites alter binding to carbohydrate xenoantigens. Computer-simulated modeling suggests that the CDR3 region directly influences binding. Conclusion Xenoantibodies induced during early and delayed xenograft responses are predominantly encoded by genes in the VH3 family, with a small proportion encoded by VH4 germline progenitors. This restricted group can be identified by the unique canonical structure of the light chain, heavy

Analysis of the relation between socioeconomic variables and truck trips in the metropolitan region of Rio de Janeiro

Directory of Open Access Journals (Sweden)

Beatriz Lagnier Gil Ferreira

2016-04-01

Full Text Available The goal of this paper is to analyze the relation between socioeconomic variables and freight trip generation, regarding the Metropolitan Region of Rio de Janeiro, through the use of linear regression models. A systematic literature review is conducted in order to identify which independent variables could be used in the models. The variables found are mostly related to the establishment, such as number of employees, floor area, number of stores among others; and socioeconomic variables, such as population, households and jobs in the region. The relation between the latter and number of truck trips is verified with linear regression models, and the results show that the models are valid and the variables are able to explain the freight flow in the region studied, contributing to  the region’s transport planning and  to the strategic planning  of companies that operate in the region.

Two centuries of observed atmospheric variability and change over the North Sea region

Science.gov (United States)

Stendel, Martin; van den Besselaar, Else; Hannachi, Abdel; Kent, Elizabeth; Lefebvre, Christiana; Rosenhagen, Gudrun; Schenk, Frederik; van der Schrier, Gerard; Woollings, Tim

2016-04-01

In the upcoming North Sea Region Climate Change Assessment (NOSCCA), we present a synthesis of current knowledge about past, present and possible future climate change in the North Sea region. A climate change assessment from published scientific work has been conducted as a kind of regional IPCC report, and a book has been produced that will be published by Springer in 2016. In the framework of the NOSCCA project, we examine past and present studies of variability and changes in atmospheric variables within the North Sea region over the instrumental period, roughly the past 200 years, based on observations and reanalyses. The variables addressed in this presentation are large-scale circulation, pressure and wind, surface air temperature, precipitation and radiative properties (clouds, solar radiation, and sunshine duration). While air temperature over land, not unexpectedly, has increased everywhere in the North Sea region, with strongest trends in spring and in the north of the region, a precipitation increase has been observed in the north and a decrease in the south of the region. This pattern goes along with a north-eastward shift of storm tracks and is in agreement with climate model projections under enhanced greenhouse gas concentrations. For other variables, it is not obvious which part of the observed changes may be due to anthropogenic activities and which is internally forced. It remains also unclear to what extent atmospheric circulation over the North Sea region is influenced by distant factors, in particular Arctic sea-ice decline in recent decades. There are indications of an increase in the number of deep cyclones (but not in the total number of cyclones), while storminess since the late 19th century shows no robust trends. The persistence of circulation types appears to have increased over the last century, and consequently, there is an indication for 'more extreme' extreme events. However, changes in extreme weather events are difficult to assess

No evidence for the use of DIR, D-D fusions, chromosome 15 open reading frames or VH replacement in the peripheral repertoire was found on application of an improved algorithm, JointML, to 6329 human immunoglobulin H rearrangements

DEFF Research Database (Denmark)

Ohm-Laursen, Line; Nielsen, Morten; Larsen, Stine R

2006-01-01

gene (VH) replacement. Safe conclusions require large, well-defined sequence samples and algorithms minimizing stochastic assignment of segments. Two computer programs were developed for analysis of heavy chain joints. JointHMM is a profile hidden Markow model, while JointML is a maximum...

Effects of Recent Regional Soil Moisture Variability on Global Net Ecosystem CO2 Exchange

Science.gov (United States)

Jones, L. A.; Madani, N.; Kimball, J. S.; Reichle, R. H.; Colliander, A.

2017-12-01

Soil moisture exerts a major regional control on the inter-annual variability of the global land sink for atmospheric CO2. In semi-arid regions, annual biomass production is closely coupled to variability in soil moisture availability, while in cold-season-affected regions, summer drought offsets the effects of advancing spring phenology. Availability of satellite solar-induced fluorescence (SIF) observations and improvements in atmospheric inversions has led to unprecedented ability to monitor atmospheric sink strength. However, discrepancies still exist between such top-down estimates as atmospheric inversion and bottom-up process and satellite driven models, indicating that relative strength, mechanisms, and interaction of driving factors remain poorly understood. We use soil moisture fields informed by Soil Moisture Active Passive Mission (SMAP) observations to compare recent (2015-2017) and historic (2000-2014) variability in net ecosystem land-atmosphere CO2 exchange (NEE). The operational SMAP Level 4 Carbon (L4C) product relates ground-based flux tower measurements to other bottom-up and global top-down estimates to underlying soil moisture and other driving conditions using data-assimilation-based SMAP Level 4 Soil Moisture (L4SM). Droughts in coastal Brazil, South Africa, Eastern Africa, and an anomalous wet period in Eastern Australia were observed by L4C. A seasonal seesaw pattern of below-normal sink strength at high latitudes relative to slightly above-normal sink strength for mid-latitudes was also observed. Whereas SMAP-based soil moisture is relatively informative for short-term temporal variability, soil moisture biases that vary in space and with season constrain the ability of the L4C estimates to accurately resolve NEE. Such biases might be caused by irrigation and plant-accessible ground-water. Nevertheless, SMAP L4C daily NEE estimates connect top-down estimates to variability of effective driving factors for accurate estimates of regional

NEAR-INFRARED VARIABILITY AMONG YOUNG STELLAR OBJECTS IN THE STAR FORMATION REGION CYGNUS OB7

Energy Technology Data Exchange (ETDEWEB)

Wolk, Scott J.; Rice, Thomas S. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Aspin, Colin [Institute for Astronomy, University of Hawaii at Manoa, 640 North Aohoku Place, Hilo, HI 96720 (United States)

2013-08-20

We present an analysis of near-infrared time-series photometry in J, H, and K bands for about 100 epochs of a 1 Degree-Sign Multiplication-Sign 1 Degree-Sign region of the Lynds 1003/1004 dark cloud in the Cygnus OB7 region. Augmented by data from the Wide-field Infrared Survey Explorer, we identify 96 candidate disk bearing young stellar objects (YSOs) in the region. Of these, 30 are clearly Class I or earlier. Using the Wide-Field Imaging Camera on the United Kingdom Infrared Telescope, we were able to obtain photometry over three observing seasons, with photometric uncertainty better than 0.05 mag down to J Almost-Equal-To 17. We study detailed light curves and color trajectories of {approx}50 of the YSOs in the monitored field. We investigate the variability and periodicity of the YSOs and find the data are consistent with all YSOs being variable in these wavelengths on timescales of a few years. We divide the variability into four observational classes: (1) stars with periodic variability stable over long timescales, (2) variables which exhibit short-lived cyclic behavior, (3) long-duration variables, and (4) stochastic variables. Some YSO variability defies simple classification. We can explain much of the observed variability as being due to dynamic and rotational changes in the disk, including an asymmetric or changing blocking fraction, changes to the inner disk hole size, as well as changes to the accretion rate. Overall, we find that the Class I:Class II ratio of the cluster is consistent with an age of <1 Myr, with at least one individual, wildly varying source {approx}100, 000 yr old. We have also discovered a Class II eclipsing binary system with a period of 17.87 days.

YSOVAR: Mid-infrared variability in the star-forming region Lynds 1688

Energy Technology Data Exchange (ETDEWEB)

Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States); Covey, K. R. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Allen, L. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Meng, H. Y. A. [Infrared Processing and Analysis Center, California Institute of Technology, MC 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Morales-Calderón, M. [Centro de Astrobiología (INTA-CSIC), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Canada (Spain); Parks, J. R. [Department of Physics and Astronomy, Georgia State University, 25 Park Place South, Atlanta, GA 30303 (United States); Song, Inseok, E-mail: hguenther@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)

2014-12-01

The emission from young stellar objects (YSOs) in the mid-infrared (mid-IR) is dominated by the inner rim of their circumstellar disks. We present IR data from the Young Stellar Object VARiability (YSOVAR) survey of ∼800 objects in the direction of the Lynds 1688 (L1688) star-forming region over four visibility windows spanning 1.6 yr using the Spitzer Space Telescope in its warm mission phase. Among all light curves, 57 sources are cluster members identified based on their spectral energy distribution and X-ray emission. Almost all cluster members show significant variability. The amplitude of the variability is larger in more embedded YSOs. Ten out of 57 cluster members have periodic variations in the light curves with periods typically between three and seven days, but even for those sources, significant variability in addition to the periodic signal can be seen. No period is stable over 1.6 yr. Nonperiodic light curves often still show a preferred timescale of variability that is longer for more embedded sources. About half of all sources exhibit redder colors in a fainter state. This is compatible with time-variable absorption toward the YSO. The other half becomes bluer when fainter. These colors can only be explained with significant changes in the structure of the inner disk. No relation between mid-IR variability and stellar effective temperature or X-ray spectrum is found.

Hydroclimatic variability in the Lake Mondsee region and its relationships with large-scale climate anomaly patterns

Science.gov (United States)

Rimbu, Norel; Ionita, Monica; Swierczynski, Tina; Brauer, Achim; Kämpf, Lucas; Czymzik, Markus

2017-04-01

Flood triggered detrital layers in varved sediments of Lake Mondsee, located at the northern fringe of the European Alps (47°48'N,13°23'E), provide an important archive of regional hydroclimatic variability during the mid- to late Holocene. To improve the interpretation of the flood layer record in terms of large-scale climate variability, we investigate the relationships between observational hydrological records from the region, like the Mondsee lake level, the runoff of the lake's main inflow Griesler Ache, with observed precipitation and global climate patterns. The lake level shows a strong positive linear trend during the observational period in all seasons. Additionally, lake level presents important interannual to multidecadal variations. These variations are associated with distinct seasonal atmospheric circulation patterns. A pronounced anomalous anticyclonic center over the Iberian Peninsula is associated with high lake levels values during winter. This center moves southwestward during spring, summer and autumn. In the same time, a cyclonic anomaly center is recorded over central and western Europe. This anomalous circulation extends southwestward from winter to autumn. Similar atmospheric circulation patterns are associated with river runoff and precipitation variability from the region. High lake levels are associated with positive local precipitation anomalies in all seasons as well as with negative local temperature anomalies during spring, summer and autumn. A correlation analysis reveals that lake level, runoff and precipitation variability is related to large-scale sea surface temperature anomaly patterns in all seasons suggesting a possible impact of large-scale climatic modes, like the North Atlantic Oscillation and Atlantic Multidecadal Oscillation on hydroclimatic variability in the Lake Mondsee region. The results presented in this study can be used for a more robust interpretation of the long flood layer record from Lake Mondsee sediments

Using gene co-expression network analysis to predict biomarkers for chronic lymphocytic leukemia

Directory of Open Access Journals (Sweden)

Borlawsky Tara B

2010-10-01

Full Text Available Abstract Background Chronic lymphocytic leukemia (CLL is the most common adult leukemia. It is a highly heterogeneous disease, and can be divided roughly into indolent and progressive stages based on classic clinical markers. Immunoglobin heavy chain variable region (IgVH mutational status was found to be associated with patient survival outcome, and biomarkers linked to the IgVH status has been a focus in the CLL prognosis research field. However, biomarkers highly correlated with IgVH mutational status which can accurately predict the survival outcome are yet to be discovered. Results In this paper, we investigate the use of gene co-expression network analysis to identify potential biomarkers for CLL. Specifically we focused on the co-expression network involving ZAP70, a well characterized biomarker for CLL. We selected 23 microarray datasets corresponding to multiple types of cancer from the Gene Expression Omnibus (GEO and used the frequent network mining algorithm CODENSE to identify highly connected gene co-expression networks spanning the entire genome, then evaluated the genes in the co-expression network in which ZAP70 is involved. We then applied a set of feature selection methods to further select genes which are capable of predicting IgVH mutation status from the ZAP70 co-expression network. Conclusions We have identified a set of genes that are potential CLL prognostic biomarkers IL2RB, CD8A, CD247, LAG3 and KLRK1, which can predict CLL patient IgVH mutational status with high accuracies. Their prognostic capabilities were cross-validated by applying these biomarker candidates to classify patients into different outcome groups using a CLL microarray datasets with clinical information.

The Tokar Gap Jet: Regional Circulation, Diurnal Variability, and Moisture Transport Based on Numerical Simulations

KAUST Repository

Davis, Shannon R.; Pratt, Lawrence J.; Jiang, Houshuo

2015-01-01

The structure, variability, and regional connectivity of the Tokar Gap jet (TGJ) are described using WRF Model analyses and supporting atmospheric datasets from the East African–Red Sea–Arabian Peninsula (EARSAP) region during summer 2008. Sources

Characterization of the Deep Water Surface Wave Variability in the California Current Region

Science.gov (United States)

Villas Bôas, Ana B.; Gille, Sarah T.; Mazloff, Matthew R.; Cornuelle, Bruce D.

2017-11-01

Surface waves are crucial for the dynamics of the upper ocean not only because they mediate exchanges of momentum, heat, energy, and gases between the ocean and the atmosphere, but also because they determine the sea state. The surface wave field in a given region is set by the combination of local and remote forcing. The present work characterizes the seasonal variability of the deep water surface wave field in the California Current region, as retrieved from over two decades of satellite altimetry data combined with wave buoys and wave model hindcast (WaveWatch III). In particular, the extent to which the local wind modulates the variability of the significant wave height, peak period, and peak direction is assessed. During spring/summer, regional-scale wind events of up to 10 m/s are the dominant forcing for waves off the California coast, leading to relatively short-period waves (8-10 s) that come predominantly from the north-northwest. The wave climatology throughout the California Current region shows average significant wave heights exceeding 2 m during most of the year, which may have implications for the planning and retrieval methods of the Surface Water and Ocean Topography (SWOT) satellite mission.

Variability and change of sea level and its components in the Indo-Pacific region during the altimetry era

Science.gov (United States)

Wu, Quran; Zhang, Xuebin; Church, John A.; Hu, Jianyu

2017-03-01

Previous studies have shown that regional sea level exhibits interannual and decadal variations associated with the modes of climate variability. A better understanding of those low-frequency sea level variations benefits the detection and attribution of climate change signals. Nonetheless, the contributions of thermosteric, halosteric, and mass sea level components to sea level variability and trend patterns remain unclear. By focusing on signals associated with dominant climate modes in the Indo-Pacific region, we estimate the interannual and decadal fingerprints and trend of each sea level component utilizing a multivariate linear regression of two adjoint-based ocean reanalyses. Sea level interannual, decadal, and trend patterns primarily come from thermosteric sea level (TSSL). Halosteric sea level (HSSL) is of regional importance in the Pacific Ocean on decadal time scale and dominates sea level trends in the northeast subtropical Pacific. The compensation between TSSL and HSSL is identified in their decadal variability and trends. The interannual and decadal variability of temperature generally peak at subsurface around 100 m but that of salinity tend to be surface-intensified. Decadal temperature and salinity signals extend deeper into the ocean in some regions than their interannual equivalents. Mass sea level (MassSL) is critical for the interannual and decadal variability of sea level over shelf seas. Inconsistencies exist in MassSL trend patterns among various estimates. This study highlights regions where multiple processes work together to control sea level variability and change. Further work is required to better understand the interaction of different processes in those regions.

Optical photometric variable stars towards the Galactic H II region NGC 2282

Science.gov (United States)

Dutta, Somnath; Mondal, Soumen; Joshi, Santosh; Jose, Jessy; Das, Ramkrishna; Ghosh, Supriyo

2018-05-01

We report here CCD I-band time series photometry of a young (2-5 Myr) cluster NGC 2282, in order to identify and understand the variability of pre-main-sequence (PMS) stars. The I-band photometry, down to ˜20.5 mag, enables us to probe the variability towards the lower mass end (˜0.1 M⊙) of PMS stars. From the light curves of 1627 stars, we identified 62 new photometric variable candidates. Their association with the region was established from H α emission and infrared (IR) excess. Among 62 variables, 30 young variables exhibit H α emission, near-IR (NIR)/mid-IR (MIR) excess or both and are candidate members of the cluster. Out of 62 variables, 41 are periodic variables, with a rotation rate ranging from 0.2-7 d. The period distribution exhibits a median period at ˜1 d, as in many young clusters (e.g. NGC 2264, ONC, etc.), but it follows a unimodal distribution, unlike others that have bimodality, with slow rotators peaking at ˜6-8 d. To investigate the rotation-disc and variability-disc connection, we derived the NIR excess from Δ(I - K) and the MIR excess from Spitzer [3.6]-[4.5] μm data. No conclusive evidence of slow rotation with the presence of discs around stars and fast rotation for discless stars is obtained from our periodic variables. A clear increasing trend of the variability amplitude with IR excess is found for all variables.

Statistical test of reproducibility and operator variance in thin-section modal analysis of textures and phenocrysts in the Topopah Spring member, drill hole USW VH-2, Crater Flat, Nye County, Nevada

International Nuclear Information System (INIS)

Moore, L.M.; Byers, F.M. Jr.; Broxton, D.E.

1989-06-01

A thin-section operator-variance test was given to the 2 junior authors, petrographers, by the senior author, a statistician, using 16 thin sections cut from core plugs drilled by the US Geological Survey from drill hole USW VH-2 standard (HCQ) drill core. The thin sections are samples of Topopah Spring devitrified rhyolite tuff from four textural zones, in ascending order: (1) lower nonlithophysal, (2) lower lithopysal, (3) middle nonlithophysal, and (4) upper lithophysal. Drill hole USW-VH-2 is near the center of the Crater Flat, about 6 miles WSW of the Yucca Mountain in Exploration Block. The original thin-section labels were opaqued out with removable enamel and renumbered with alpha-numeric labels. The sliders were then given to the petrographer operators for quantitative thin-section modal (point-count) analysis of cryptocrystalline, spherulitic, granophyric, and void textures, as well as phenocryst minerals. Between operator variance was tested by giving the two petrographers the same slide, and within-operator variance was tested by the same operator the same slide to count in a second test set, administered at least three months after the first set. Both operators were unaware that they were receiving the same slide to recount. 14 figs., 6 tabs

Regions of variability for a class of analytic and locally univalent ...

Indian Academy of Sciences (India)

f ′′(0) whenever f varies over the class C(A,B). Keywords. Janowski class; univalent functions; variability regions. 2000 Mathematics Subject Classification. 30C45. 1. Introduction and preliminary results. Let C be the complex plane. We use the following notations for open and closed discs with center c and radius r in the ...

Interannual variability in the extent of wetland-stream connectivity within the Prairie Pothole Region

Science.gov (United States)

Melanie Vanderhoof; Laurie Alexander

2016-01-01

The degree of hydrological connectivity between wetland systems and downstream receiving waters can be expected to influence the volume and variability of stream discharge. The Prairie Pothole Region contains a high density of depressional wetland features, a consequence of glacial retreat. Spatial variability in wetland density, drainage evolution, and precipitation...

Regional variability of farmer decision making and irrigation water use: insights from a data-scarce region of North India

Science.gov (United States)

O'Keeffe, Jimmy; Buytaert, Wouter; Brozović, Nick; Mijic, Ana

2014-05-01

Over the last fifty years, changes in agriculture brought about by the Green Revolution have transformed India from a famine-prone, drought-susceptible country into the worlds' third largest grain producer and one of the most intensively irrigated parts of the globe. Regionally, cheap energy, subsidised seeds and fertilisers, and in some areas Government purchase guarantees for grain promote the intensification of farming. While this allows farmers to survive, it also aggravates the drain agriculture is having on resources, particularly energy and water. Analysis at a regional scale, however, masks the considerable spatial variability that exists on a more localised level and must be taken into consideration to understand correctly aggregate system response to policy, hydrologic, and climatic change. In this study we present and analyse the results from over 100 farmer interviews conducted in the data-scarce districts of Jalaun and Sitapur on the Gangetic Plains of Uttar Pradesh during the post monsoon period of 2013. Variables such as the volumes and timing of irrigation water applied, sources of water, methods of abstraction and irrigation, and costs incurred are mapped, using qualitative data analysis and GIS. Large differences between the districts emerge, for instance in the region of Jalaun where cheaper canal water is available in addition to groundwater. This has enabled farmers to afford more water efficient technologies such as sprinklers, a practice not found in Sitapur which depends almost exclusively on more expensive diesel pumps. Results are used to delineate the spatial variability in water use practices, along with farmer behaviour and decision making. The primary data are compared with socio-economic information taken from regionally produced statistical abstracts. The combined data are used to identify the main drivers that influence farmer decision-making, which is in turn leading to groundwater overdraught in many parts of North India. Finally

ESA STSE “SST Diurnal Variability: Regional Extend - Implications in Atmospheric Modelling”

DEFF Research Database (Denmark)

Karagali, Ioanna

The diurnal variability of SST, driven by the coincident occurrence of low enough wind and solar heating, has been observed in various regions of the global ocean [4, 5, 6]. Atmospheric, oceanic and climate models are not adequately resolving the daily SST cycle, resulting in biases of the total...

Linking the uncertainty of low frequency variability in tropical forcing in regional climate change

Energy Technology Data Exchange (ETDEWEB)

Forest, Chris E. [Pennsylvania State Univ., University Park, PA (United States). Dept. of Meteorology; Barsugli, Joseph J. [Univ. of Colorado, Boulder, CO (United States). CIRES; Li, Wei [Pennsylvania State Univ., University Park, PA (United States). Dept. of Meteorology

2015-02-20

The project utilizes multiple atmospheric general circulation models (AGCMs) to examine the regional climate sensitivity to tropical sea surface temperature forcing through a series of ensemble experiments. The overall goal for this work is to use the global teleconnection operator (GTO) as a metric to assess the impact of model structural differences on the uncertainties in regional climate variability.

Relationship between Eurasian large-scale patterns and regional climate variability over the Black and Baltic Seas

Energy Technology Data Exchange (ETDEWEB)

Stankunavicius, G.; Pupienis, D. [Vilnius Univ. (Lithuania). Dept. of Hydrology and Climatology; Basharin, D. [National Academy of Science of Ukraine, Sevastopol (Ukraine). Sevastopol Marine Hydrophysical Inst.

2012-11-01

Using a NCEP/NCAR Reanalysis dataset and the empirical orthogonal function (EOF) analysis approach we studied interannual to decadal variabilities of the sea-level air pressure (SLP) and the surface air temperature (SAT) fields over Eurasia during the 2nd part of the 20th century. Our results agree with those of the previous studies, which conclude that Eurasian trends are the result of storm-path changes driven by the interdecadal behaviour of the NAO-like meridional dipole pattern in the Atlantic. On interannual and decadal time scales, significant synchronous correlations between correspondent modes of SAT and SLP EOF patterns were found. This fact suggests that there is a strong and stable Eurasian interrelationship between SAT and SLP large-scale fields which affects the local climate of two sub-regions: the Black and Baltic Seas. The climate variability in these sub-regions was studied in terms of Eurasian large-scale surface-temperature and air-pressure patterns responses. We concluded that the sub-regional climate variability substantially differs over the Black and Baltic Seas, and depends on different Eurasian large-scale patterns. We showed that the Baltic Sea region is influenced by the patterns arising primary from NAO-like meridional dipole, as well as Scandinavian patterns, while the Black Sea's SAT/SLP variability is influenced mainly by the second mode EOF (eastern Atlantic) and large scale tropospheric wave structures. (orig.)

The terroir of vineyards - climatic variability in an Austrian wine-growing region

Science.gov (United States)

Gerersdorfer, T.

2010-09-01

The description of a terroir is a concept in viticulture that relates the sensory attributes of wine to the environmental conditions in which the grapes grow. Many factors are involved including climate, soil, cultivar, human practices and all these factors interact manifold. The study area of Carnuntum is a small wine-growing region in the eastern part of Austria. It is rich of Roman remains which play a major role in tourism and the marketing strategies of the wines as well. An interdisciplinary study on the environmental characteristics particularly with regard to growing conditions of grapes was started in this region. The study is concerned with the description of the physiogeographic properties of the region and with the investigation of the dominating viticultural functions. Grape-vines depend on climatic conditions to a high extent. Compared to other influencing factors like soil, climate plays a significant role. In the framework of this interdisciplinary project climatic variability within the Carnuntum wine-growing region is investigated. On the one hand microclimatic variations are influenced by soil type and by canopy management. On the other hand the variability is a result of the topoclimate (altitude, aspect and slope) and therefore relief is a major terroir factor. Results of microclimatic measurements and variations are presented with focus on the interpretation of the relationship between relief, structure of the vineyards and the climatic conditions within the course of a full year period.

Internal and external variability in regional simulations of the Iberian Peninsula climate over the last millennium

Directory of Open Access Journals (Sweden)

J. J. Gómez-Navarro

2012-01-01

Full Text Available In this study we analyse the role of internal variability in regional climate simulations through a comparison of two regional paleoclimate simulations for the last millennium. They share the same external forcings and model configuration, differing only in the initial condition used to run the driving global model simulation. A comparison of these simulations allows us to study the role of internal variability in climate models at regional scales, and how it affects the long-term evolution of climate variables such as temperature and precipitation. The results indicate that, although temperature is homogeneously sensitive to the effect of external forcings, the evolution of precipitation is more strongly governed by random unpredictable internal dynamics. There are, however, some areas where the role of internal variability is lower than expected, allowing precipitation to respond to the external forcings. In this respect, we explore the underlying physical mechanisms responsible for it. This study identifies areas, depending on the season, in which a direct comparison between model simulations of precipitation and climate reconstructions would be meaningful, but also other areas where good agreement between them should not be expected even if both are perfect.

Uncertainties in Future Regional Sea Level Trends: How to Deal with the Internal Climate Variability?

Science.gov (United States)

Becker, M.; Karpytchev, M.; Hu, A.; Deser, C.; Lennartz-Sassinek, S.

2017-12-01

Today, the Climate models (CM) are the main tools for forecasting sea level rise (SLR) at global and regional scales. The CM forecasts are accompanied by inherent uncertainties. Understanding and reducing these uncertainties is becoming a matter of increasing urgency in order to provide robust estimates of SLR impact on coastal societies, which need sustainable choices of climate adaptation strategy. These CM uncertainties are linked to structural model formulation, initial conditions, emission scenario and internal variability. The internal variability is due to complex non-linear interactions within the Earth Climate System and can induce diverse quasi-periodic oscillatory modes and long-term persistences. To quantify the effects of internal variability, most studies used multi-model ensembles or sea level projections from a single model ran with perturbed initial conditions. However, large ensembles are not generally available, or too small, and computationally expensive. In this study, we use a power-law scaling of sea level fluctuations, as observed in many other geophysical signals and natural systems, which can be used to characterize the internal climate variability. From this specific statistical framework, we (1) use the pre-industrial control run of the National Center for Atmospheric Research Community Climate System Model (NCAR-CCSM) to test the robustness of the power-law scaling hypothesis; (2) employ the power-law statistics as a tool for assessing the spread of regional sea level projections due to the internal climate variability for the 21st century NCAR-CCSM; (3) compare the uncertainties in predicted sea level changes obtained from a NCAR-CCSM multi-member ensemble simulations with estimates derived for power-law processes, and (4) explore the sensitivity of spatial patterns of the internal variability and its effects on regional sea level projections.

Regional and landscape-scale variability of Landsat-observed vegetation dynamics in northwest Siberian tundra

International Nuclear Information System (INIS)

Frost, Gerald V; Epstein, Howard E; Walker, Donald A

2014-01-01

Widespread increases in Arctic tundra productivity have been documented for decades using coarse-scale satellite observations, but finer-scale observations indicate that changes have been very uneven, with a high degree of landscape- and regional-scale heterogeneity. Here we analyze time-series of the Normalized Difference Vegetation Index (NDVI) observed by Landsat (1984–2012), to assess landscape- and regional-scale variability of tundra vegetation dynamics in the northwest Siberian Low Arctic, a little-studied region with varied soils, landscape histories, and permafrost attributes. We also estimate spatio-temporal rates of land-cover change associated with expansion of tall alder (Alnus) shrublands, by integrating Landsat time-series with very-high-resolution imagery dating to the mid-1960s. We compiled Landsat time-series for eleven widely-distributed landscapes, and performed linear regression of NDVI values on a per-pixel basis. We found positive net NDVI trends (‘greening’) in nine of eleven landscapes. Net greening occurred in alder shrublands in all landscapes, and strong greening tended to correspond to shrublands that developed since the 1960s. Much of the spatial variability of greening within landscapes was linked to landscape physiography and permafrost attributes, while between-landscape variability largely corresponded to differences in surficial geology. We conclude that continued increases in tundra productivity in the region are likely in upland tundra landscapes with fine-textured, cryoturbated soils; these areas currently tend to support discontinuous vegetation cover, but are highly susceptible to rapid increases in vegetation cover, as well as land-cover changes associated with the development of tall shrublands. (paper)

Tannat grape composition responses to spatial variability of temperature in an Uruguay's coastal wine region

Science.gov (United States)

Fourment, Mercedes; Ferrer, Milka; González-Neves, Gustavo; Barbeau, Gérard; Bonnardot, Valérie; Quénol, Hervé

2017-09-01

Spatial variability of temperature was studied in relation to the berry basic composition and secondary compounds of the Tannat cultivar at harvest from vineyards located in Canelones and Montevideo, the most important wine region of Uruguay. Monitoring of berries and recording of temperature were performed in 10 commercial vineyards of Tannat situated in the southern coastal wine region of the country for three vintages (2012, 2013, and 2014). Results from a multivariate correlation analysis between berry composition and temperature over the three vintages showed that (1) Tannat responses to spatial variability of temperature were different over the vintages, (2) correlations between secondary metabolites and temperature were higher than those between primary metabolites, and (3) correlation values between berry composition and climate variables increased when ripening occurred under dry conditions (below average rainfall). For a particular studied vintage (2013), temperatures explained 82.5% of the spatial variability of the berry composition. Daily thermal amplitude was found to be the most important spatial mode of variability with lower values recorded at plots nearest to the sea and more exposed to La Plata River. The highest levels in secondary compounds were found in berries issued from plots situated as far as 18.3 km from La Plata River. The increasing knowledge of temperature spatial variability and its impact on grape berry composition contributes to providing possible issues to adapt grapevine to climate change.

Multi-region and single-cell sequencing reveal variable genomic heterogeneity in rectal cancer.

Science.gov (United States)

Liu, Mingshan; Liu, Yang; Di, Jiabo; Su, Zhe; Yang, Hong; Jiang, Beihai; Wang, Zaozao; Zhuang, Meng; Bai, Fan; Su, Xiangqian

2017-11-23

Colorectal cancer is a heterogeneous group of malignancies with complex molecular subtypes. While colon cancer has been widely investigated, studies on rectal cancer are very limited. Here, we performed multi-region whole-exome sequencing and single-cell whole-genome sequencing to examine the genomic intratumor heterogeneity (ITH) of rectal tumors. We sequenced nine tumor regions and 88 single cells from two rectal cancer patients with tumors of the same molecular classification and characterized their mutation profiles and somatic copy number alterations (SCNAs) at the multi-region and the single-cell levels. A variable extent of genomic heterogeneity was observed between the two patients, and the degree of ITH increased when analyzed on the single-cell level. We found that major SCNAs were early events in cancer development and inherited steadily. Single-cell sequencing revealed mutations and SCNAs which were hidden in bulk sequencing. In summary, we studied the ITH of rectal cancer at regional and single-cell resolution and demonstrated that variable heterogeneity existed in two patients. The mutational scenarios and SCNA profiles of two patients with treatment naïve from the same molecular subtype are quite different. Our results suggest each tumor possesses its own architecture, which may result in different diagnosis, prognosis, and drug responses. Remarkable ITH exists in the two patients we have studied, providing a preliminary impression of ITH in rectal cancer.

Regional climate change: Precipitation variability in mountainous part of Bulgaria

Directory of Open Access Journals (Sweden)

Nikolova Nina

2007-01-01

Full Text Available The aim of paper is to analyze temporal and spatial changes in monthly precipitation as well as extremely dry and wet months in mountainous part of Bulgaria. Study precipitation variability in mountainous part is very important because this part is the region where the rivers take its source from. Extreme values of monthly precipitation are important information for better understanding of the whole variability and trends in precipitation time series. The mean investigated period is 1951-2005 and the reference period is so called temporary climate - 1961- 1990. Extreme dry precipitation months are defined as a month whose monthly precipitation is lower than 10% of gamma distribution in the reference period 1961-1990. Extreme wet months are determined with respect to 90% percentiles of gamma distribution (monthly precipitation is higher than 90%. The result of the research show that in mountainous part of Bulgaria during 1950s and 1960s number of extremely wet months is higher than number of dry months. Decreasing of monthly precipitation is a feature for 1980s. This dry period continues till 2004. The years 2000 makes impression as driest year in high mountains with about 7 extremely dry months. The second dry year is 1993. The negative precipitation anomaly is most clearly determined during last decade at study area. The present research points out that fluctuation of precipitation in mountainous part of Bulgaria are coinciding with regional and global climate trends.

Climatological variability in modeling of long-term regional transport and deposition of air pollutants

International Nuclear Information System (INIS)

Shannon, J.D.

1984-01-01

In a growing number of emission policy analyses, regulatory proceedings, and cost/benefit assessments, numerical models of long-range transport and deposition of air pollutants have been exercised to estimate source-receptor (S-R) relationships--for the particular meteorological conditions input to the model. The representativeness of the meteorological conditions, or the variability of the model estimates with climatological input from different years or corresponding seasons from different years, is seldom evaluated. Here, two full years (1980 and 1981) of meteorological data, as well as data from January and July of 1978, are used in the Advanced Statistical Trajectory Regional Air Pollution (ASTRAP) model (Shannon, 1981), one of the eight Memorandum of Intent (MOI) models, to estimate deposition for the S-R matrix combination of eleven source regions and nine receptors used in the MOI reports. (S-R matrices of dimensions 40 by 9 were also examined in the MOI reports.) Improvements in the ASTRAP model and in the emission inventory since the earlier work require recalculation of the two-month 1978 simulation in order for the comparison to isolate the effect of meteorological variability. The source regions are listed, and the receptor regions are provide. For completeness, an additional source region, the western states and provinces, has been added, as well as a total for the 48 contiguous states and 10 provinces. 4 references, 9 tables

Interannual variability of mass transport in the Canary region from LADCP data

Science.gov (United States)

Comas-Rodríguez, Isis; Hernández-Guerra, Alonso; Vélez-Belchí, Pedro; Fraile-Nuez, Eugenio

2010-05-01

The variability of the Canary Current is a widely studied topic regarding its role as eastern boundary of the North Atlantic Subtropical Gyre. The Canary region provides indeed an interesting study area in terms of estimating variability scales of the Subtropical Gyre as well as the water masses dynamics. RAPROCAN (RAdial PROfunda de CANarias - Canary deep hydrographic section) is a project based on the reaching of these goals through the obtaining of hydrographic measures during cruises taking place approximately along 29°N, to the North of the Canary Archipelago, twice a year since 2006. The full depth sampling carried out allows the study of temperature and salinity distribution and the calculation of mass transports across the section. The transport estimates are compared to those obtained from previous measurements and estimates in the region. Therefore, transports and their variability through the last decade are quantified. The most significant advance made to previous works is the use of LADCP (Lowered Acoustic Doppler Current Profiler) data informing the initial geostrophic calculations. Thus, corrections are applied to each geostrophic profile considering the reference velocity obtained from LADCP data. ADCP-referenced transport estimates are obtained, providing a successful comparison between the velocity fields obtained from the hydrographic measures. While this work shows the interannual variability observed in winter since 1997, preliminary results confirm previous hypotheses about the magnitude of the Canary Current. Those results including LADCP data also provide new aspects in the circulation distribution across the Canary Archipelago. Also moored current meter data were taken into account in the up close study of the Current through the Lanzarote Passage. Interesting conclusions were drawn that certify the usefulness of LADCP data in referencing geostrophic calculations, while corroborating the results obtained through this methodology. Hence

Long term precipitation trends and variability within the Mediterranean region

Directory of Open Access Journals (Sweden)

C. M. Philandras

2011-12-01

Full Text Available In this study, the trends and variability of annual precipitation totals and annual rain days over land within the Mediterranean region are analyzed. Long term ground-based observations concerning, on one hand, monthly precipitation totals (1900–2010 and rain days (1965–2010 from 40 meteorological stations within the Mediterranean region were obtained from the Hellenic National Meteorological Service and the World Climate Data and Monitoring Programme (WCDMP of the World Meteorological Organization. On the other hand, high spatial resolution (0.5° × 0.5° gridded monthly data CRU TS 3.1 were acquired from the Climatic Research Unit, University of East Anglia, for the period 1901–2009. The two datasets were compared by means of trends and variability, while the influence of the North Atlantic Oscillation (NAO in the Mediterranean precipitation was examined. In the process, the climatic changes in the precipitation regime between the period 1961–1990 (reference period and the period 2071–2100 (future climate were presented using climate model simulations (RACMO2.1/KNMI. The future climate projections were based on SRES A1B.

The findings of the analysis showed that statistically significant (95% confidence level negative trends of the annual precipitation totals exist in the majority of Mediterranean regions during the period 1901–2009, with an exception of northern Africa, southern Italy and western Iberian peninsula, where slight positive trends (not statistically significant at 95% CL appear. Concerning the annual number of rain days, a pronounced decrease of 20 %, statistically significant (95% confidence level, appears in representative meteorological stations of east Mediterranean, while the trends are insignificant for west and central Mediterranean. Additionally, NAO index was found to be anticorrelated with the precipitation totals and the number of rain days mainly in Spain, southern France, Italy and Greece. These

Climate change/variability science and adaptive strategies for state and regional transportation decision making.

Science.gov (United States)

2010-04-01

The objective of this study was to generate a baseline understanding of current policy responses to climate : change/variability at the state and regional transportation-planning and -decision levels. Specifically, : researchers were interested in th...

Influence of Climate Variability on US Regional Homicide Rates

Science.gov (United States)

Harp, R. D.; Karnauskas, K. B.

2017-12-01

Recent studies have found consistent evidence of a relationship between temperature and criminal behavior. However, despite agreement in the overall relationship, little progress has been made in distinguishing between two proposed explanatory theories. The General Affective Aggression Model (GAAM) suggests that high temperatures create periods of higher heat stress that enhance individual aggressiveness, whereas the Routine Activities Theory (RAT) theorizes that individuals are more likely to be outdoors interacting with others during periods of pleasant weather with a resulting increase in both interpersonal interactions and victim availability. Further, few studies have considered this relationship within the context of climate change in a quantitative manner. In an effort to distinguish between the two theories, and to examine the statistical relationships on a broader spatial scale than previously, we combined data from the Supplementary Homicide Report (SHR—compiled by the Federal Bureau of Investigation) and the North American Regional Reanalysis (NARR—compiled by the National Centers for Environmental Protection, a branch of the National Oceanic and Atmospheric Administration). US homicide data described by the SHR was compared with seven relevant observed climate variables (temperature, dew point, relative humidity, accumulated precipitation, accumulated snowfall, snow cover, and snow depth) provided by the NARR atmospheric reanalysis. Relationships between homicide rates and climate variables, as well as reveal regional spatial patterns will be presented and discussed, along with the implications due to future climate change. This research lays the groundwork for the refinement of estimates of an oft-overlooked climate change impact, which has previously been estimated to cause an additional 22,000 murders between 2010 and 2099, including providing important constraints for empirical models of future violent crime incidences in the face of global

Randomized comparison of total laparoscopic, laparoscopically assisted vaginal and vaginal hysterectomies for myomatous uteri.

Science.gov (United States)

Sesti, Francesco; Cosi, Veronica; Calonzi, Francesca; Ruggeri, Velia; Pietropolli, Adalgisa; Di Francesco, Lucia; Piccione, Emilio

2014-09-01

To compare the operative data and early postoperative outcomes of total laparoscopic hysterectomy (TLH), laparoscopically assisted vaginal hysterectomy (LAVH) and vaginal hysterectomy (VH). One hundred and eight women requiring hysterectomy for enlarged myomatous uterus were randomly allocated into three treatment arms: TLH (n = 36); LAVH (n = 36); VH (n = 36). Randomization procedure was based on a computer-generated list. The primary outcome was the discharge time comparison. The secondary outcomes were operating time, blood loss, paralytic ileus time, intraoperative complications, postoperative pain, and early postoperative complications. The mean discharge time was shorter after VH than after LAVH and TLH (P = 0.001). Operating time significantly influenced the discharge time, considered as a dependent variable in general linear model analysis (P = 0.006). In contrast, blood loss did not influence the discharge time (P = 0.55).The mean operating time was significantly shorter in VH than in TLH and LAVH groups (P = 0.000).The intraoperative blood loss was greater during LAVH than during TLH and VH (P = 0.000).Paralytic ileus time was shorter after VH than after TLH and LAVH (P = 0.000). No intraoperative complications or conversion to laparotomy occurred. VH was the faster operative technique with smaller blood loss and shorter discharge time compared with the others two techniques. So, VH should be considered the preferred approach in patients with enlarged myomatous uteri. When VH is not feasible or salpingo-oophorectomy is required, LAVH or TLH should be considered as valid alternatives. It is necessary to continue prospective comparative studies between the various surgical options to identify the best approach for hysterectomy in each single woman.

Monoclonal Antibodies Directed toward the Hepatitis C Virus Glycoprotein E2 Detect Antigenic Differences Modulated by the N-Terminal Hypervariable Region 1 (HVR1), HVR2, and Intergenotypic Variable Region.

Science.gov (United States)

Alhammad, Yousef; Gu, Jun; Boo, Irene; Harrison, David; McCaffrey, Kathleen; Vietheer, Patricia T; Edwards, Stirling; Quinn, Charles; Coulibaly, Fásseli; Poumbourios, Pantelis; Drummer, Heidi E

2015-12-01

Hepatitis C virus (HCV) envelope glycoproteins E1 and E2 form a heterodimer and mediate receptor interactions and viral fusion. Both E1 and E2 are targets of the neutralizing antibody (NAb) response and are candidates for the production of vaccines that generate humoral immunity. Previous studies demonstrated that N-terminal hypervariable region 1 (HVR1) can modulate the neutralization potential of monoclonal antibodies (MAbs), but no information is available on the influence of HVR2 or the intergenotypic variable region (igVR) on antigenicity. In this study, we examined how the variable regions influence the antigenicity of the receptor binding domain of E2 spanning HCV polyprotein residues 384 to 661 (E2661) using a panel of MAbs raised against E2661 and E2661 lacking HVR1, HVR2, and the igVR (Δ123) and well-characterized MAbs isolated from infected humans. We show for a subset of both neutralizing and nonneutralizing MAbs that all three variable regions decrease the ability of MAbs to bind E2661 and reduce the ability of MAbs to inhibit E2-CD81 interactions. In addition, we describe a new MAb directed toward the region spanning residues 411 to 428 of E2 (MAb24) that demonstrates broad neutralization against all 7 genotypes of HCV. The ability of MAb24 to inhibit E2-CD81 interactions is strongly influenced by the three variable regions. Our data suggest that HVR1, HVR2, and the igVR modulate exposure of epitopes on the core domain of E2 and their ability to prevent E2-CD81 interactions. These studies suggest that the function of HVR2 and the igVR is to modulate antibody recognition of glycoprotein E2 and may contribute to immune evasion. This study reveals conformational and antigenic differences between the Δ123 and intact E2661 glycoproteins and provides new structural and functional data about the three variable regions and their role in occluding neutralizing and nonneutralizing epitopes on the E2 core domain. The variable regions may therefore function to

Characterization of DegQVh, a serine protease and a protective immunogen from a pathogenic Vibrio harveyi strain.

Science.gov (United States)

Zhang, Wei-wei; Sun, Kun; Cheng, Shuang; Sun, Li

2008-10-01

Vibrio harveyi is an important marine pathogen that can infect a number of aquaculture species. V. harveyi degQ (degQ(Vh)), the gene encoding a DegQ homologue, was cloned from T4, a pathogenic V. harveyi strain isolated from diseased fish. DegQ(Vh) was closely related to the HtrA family members identified in other Vibrio species and could complement the temperature-sensitive phenotype of an Escherichia coli strain defective in degP. Expression of degQ(Vh) in T4 was modulated by temperature, possibly through the sigma(E)-like factor. Enzymatic analyses demonstrated that the recombinant DegQ(Vh) protein expressed in and purified from E. coli was an active serine protease whose activity required the integrity of the catalytic site and the PDZ domains. The optimal temperature and pH of the recombinant DegQ(Vh) protein were 50 degrees C and pH 8.0. A vaccination study indicated that the purified recombinant DegQ(Vh) was a protective immunogen that could confer protection upon fish against infection by V. harveyi. In order to improve the efficiency of DegQ(Vh) as a vaccine, a genetic construct in the form of the plasmid pAQ1 was built, in which the DNA encoding the processed DegQ(Vh) protein was fused with the DNA encoding the secretion region of AgaV, an extracellular beta-agarase. The E. coli strain harboring pAQ1 could express and secrete the chimeric DegQ(Vh) protein into the culture supernatant. Vaccination of fish with viable E. coli expressing chimeric degQ(Vh) significantly (P < 0.001) enhanced the survival of fish against V. harveyi challenge, which was possibly due to the relatively prolonged exposure of the immune system to the recombinant antigen produced constitutively, albeit at a gradually decreasing level, by the carrier strain.

Evaluating the Impact of Localized GCM Grid Refinement on Regional Tropical Cyclone Climatology and Synoptic Variability using Variable-Resolution CAM-SE

Science.gov (United States)

Zarzycki, C.; Jablonowski, C.

2013-12-01

Using General Circulation Models (GCMs) to resolve sub-synoptic features in climate simulations has traditionally been difficult due to a multitude of atmospheric processes operating at subgrid scales requiring significant parameterization. For example, at traditional GCM horizontal grid resolutions of 50-300 km, tropical cyclones are generally under-resolved. This paper explores a novel variable-resolution global modeling approach that allows for high spatial resolutions in areas of interest, such as low-latitude ocean basins where tropical cyclogenesis occurs. Such multi-resolution GCM designs allow for targeted use of computing resources at the regional level while maintaining a globally-continuous model domain and may serve to bridge the gap between GCMs with uniform grids and boundary-forced limited area models. A statically-nested, variable-resolution option has recently been introduced into the Community Atmosphere Model's (CAM) Spectral Element (SE) dynamical core. A 110 km CAM-SE grid with a 28 km nest over the Atlantic Ocean has been coupled to land, ocean, and ice components within the Community Earth System Model (CESM). We present the results of a multi-decadal climate simulation using Atmospheric Model Intercomparison Project (AMIP) protocols, which force the model with historical sea surface temperatures and airborne chemical species. To investigate whether refinement improves the representation of tropical cyclones, we compare Atlantic storm statistics to observations with specific focus paid to intensity profiles and track densities. The resolution dependance of both cyclone structure and objective detection between refined and unrefined basins is explored. In addition, we discuss the potential impact of using variable-resolution grids on the large-scale synoptic interannual variability by comparing refined grid simulations to reanalysis data as well as an unrefined, globally-uniform CAM-SE simulation with identical forcing. We also evaluate the

Climatic variability of river outflow in the Pantanal region and the influence of sea surface temperature

Science.gov (United States)

Silva, Carlos Batista; Silva, Maria Elisa Siqueira; Ambrizzi, Tércio

2017-07-01

This paper investigates possible linear relationships between climate, hydrology, and oceanic surface variability in the Pantanal region (in South America's central area), over interannual and interdecadal time ranges. In order to verify the mentioned relations, lagged correlation analysis and linear adjustment between river discharge at the Pantanal region and sea surface temperature were used. Composite analysis for atmospheric fields, air humidity flux divergence, and atmospheric circulation at low and high levels, for the period between 1970 and 2003, was analyzed. Results suggest that the river discharge in the Pantanal region is linearly associated with interdecadal and interannual oscillations in the Pacific and Atlantic oceans, making them good predictors to continental hydrological variables. Considering oceanic areas, 51 % of the annual discharge in the Pantanal region can be linearly explained by mean sea surface temperature (SST) in the Subtropical North Pacific, Tropical North Pacific, Extratropical South Pacific, and Extratropical North Atlantic over the period. Considering a forecast approach in seasonal scale, 66 % of the monthly discharge variance in Pantanal, 3 months ahead of SST, is explained by the oceanic variables, providing accuracy around 65 %. Annual discharge values in the Pantanal region are strongly related to the Pacific Decadal Oscillation (PDO) variability (with 52 % of linear correlation), making it possible to consider an interdecadal variability and a consequent subdivision of the whole period in three parts: 1st (1970-1977), 2nd (1978-1996), and 3rd (1997-2003) subperiods. The three subperiods coincide with distinct PDO phases: negative, positive, and negative, respectively. Convergence of humidity flux at low levels and the circulation pattern at high levels help to explain the drier and wetter subperiods. During the wetter 2nd subperiod, the air humidity convergence at low levels is much more evident than during the other two

Climate variability and wine quality over Portuguese regions

Science.gov (United States)

Gouveia, Célia M.; Gani, Érico A.; Liberato, Margarida L. R.

2015-04-01

characterized in each region by high/low quality wines. Finally, we also investigated how climate variability is related to DOC wine quality for different regions using North Atlantic Oscillation (NAO) index. Results reveal a strong dependence of wine quality for all regions on maximum temperature and precipitation during spring and summer (the growing season) as expected. However the role of temperature on wine quality seems to be distinct among the diverse regions probably due to their different climate zoning. Moreover, it is shown that the differences associated with high/low quality wine are in agreement with different synoptic fields patterns. Our results suggest that this type of analysis may be used in developing a tool that may help anticipating a vintage/high quality year, based on already available seasonal climate outlooks. Santo F.E., de Lima M.I.P., Ramos A.M., Trigo R.M., Trends in seasonal surface air temperature in mainland Portugal, since 1941, International Journal Climatolology, 34: 1814-1837, doi: 10.1002/joc.3803 (2014) de Lima M.I.P., Santo F.E., Ramos A.M. , Trigo, R.M., Trends and correlations in annual extreme precipitation indices for mainland Portugal, 1941-2007, Theoretical and Applied Climatology, DOI:10.1007/s00704-013-1079-6 (2014) Acknowledgements: This work was partially supported by national funds through FCT (Fundação para a Ciência e a Tecnologia, Portugal) under project QSECA (PTDC/AAGGLO/4155/2012).

Engineered Bovine Antibodies in the Development of Novel Therapeutics, Immunomodulators and Vaccines

Directory of Open Access Journals (Sweden)

Madhuri Koti

2014-05-01

Full Text Available Some bovine antibodies across all classes are unique, such as the CDR3 of the variable heavy-domain (VH CDR3, which is exceptionally long (up to 66 amino acids, unlike most conventional antibodies where the VH CDR3 loops range from 10 to 25 amino acids. The exceptionally long VH CDR3 is encoded by unusually long germline IGHD genes together with insertion of novel “a” nucleotide rich conserved short nucleotide sequence (CSNS specifically at the IGH V-D junction. Such an exceptionally long VH CDR3 confers unique “knob and stalk” structural architecture where the knob, formed by intra-VH CDR3 disulfide bridges, is separated by 20 Å solvent exposed stalk composed of anti-parallel beta strands. The substitution of the knob with cytokines, such as, erythropoietin and granulocyte colony stimulating factor 3 (granulocyte colony stimulating factor, results in expression of functional fusion proteins with enhanced pharmacokinetics. The beta stranded stalk can be substituted with other rigid structures, for example, repeat alpha helices to form coiled-coil that mimics the beta-stranded stalk and, thus, opens opportunities for insertion of this structure in the CDRs of antibodies across species. Given the versatility of such a structural platform in bovine antibody VH CDR3, it provides the opportunity for the development of new generation of diagnostics, therapeutics, vaccines and immunomodulating drugs.

Some aspects of regional flow of variable-density groundwater in crystalline basement rock of Sweden

International Nuclear Information System (INIS)

Voss, C.I.; Andersson, Johan

1991-12-01

The distribution of saltwaters in the Baltic shield in Sweden is consistent with ongoing but incomplete Holocene flushing and depends on the geometry and connectivity of conductive structures at both regional and local scales, and on the surface topography. Numerical simulation of regional variable-density fluid flow during Holocene land-rise and coastal regression shows that the existence of any old saltwater, whether derived from submarine recharge in regions below Sweden's highest post-glacial coastline or geochemical processes, is an indication either of slow fluid movements through the bedrock over long times, or of long travel distances through fracture systems before arriving at measurement points. During the land-rise period, regional flow is not affected by the variable density of fluids in the upper few kilometers of the shield and the topography of the water table is the only driving force. The spatial distribution of meteoric flushing water and pre-Holocene waters may be complex, with the possibility of relatively fresh water in fracture zones below salty units even at depths of a few kilometers. The domination of the topographic driving force implies that deep saltwater is not necessarily stagnant, and significant saltwater flows may be expected to occur in well-connected horizons even at depth. Local topography variation and fracture zone location combine to create a complex flow field in which local topographic driving forces extend to considerable depth in some areas, whereas regional topographic forces predominate in others. Thus, a pattern may be difficult to discern in measurements of the regional saltwater distribution, although it is clear that the coastal region is the major zone of discharge for deeper pre-Holocene fluids. During the land-rise period, regional flow equilibrates with changing climatic conditions and coastal positions, while the distribution of flushing water and older waters lags and will perpetually change between successive

Regional Community Climate Simulations with variable resolution meshes in the Community Earth System Model

Science.gov (United States)

Zarzycki, C. M.; Gettelman, A.; Callaghan, P.

2017-12-01

Accurately predicting weather extremes such as precipitation (floods and droughts) and temperature (heat waves) requires high resolution to resolve mesoscale dynamics and topography at horizontal scales of 10-30km. Simulating such resolutions globally for climate scales (years to decades) remains computationally impractical. Simulating only a small region of the planet is more tractable at these scales for climate applications. This work describes global simulations using variable-resolution static meshes with multiple dynamical cores that target the continental United States using developmental versions of the Community Earth System Model version 2 (CESM2). CESM2 is tested in idealized, aquaplanet and full physics configurations to evaluate variable mesh simulations against uniform high and uniform low resolution simulations at resolutions down to 15km. Different physical parameterization suites are also evaluated to gauge their sensitivity to resolution. Idealized variable-resolution mesh cases compare well to high resolution tests. More recent versions of the atmospheric physics, including cloud schemes for CESM2, are more stable with respect to changes in horizontal resolution. Most of the sensitivity is due to sensitivity to timestep and interactions between deep convection and large scale condensation, expected from the closure methods. The resulting full physics model produces a comparable climate to the global low resolution mesh and similar high frequency statistics in the high resolution region. Some biases are reduced (orographic precipitation in the western United States), but biases do not necessarily go away at high resolution (e.g. summertime JJA surface Temp). The simulations are able to reproduce uniform high resolution results, making them an effective tool for regional climate studies and are available in CESM2.

A residue-specific shift in stability and amyloidogenicity of antibody variable domains.

Science.gov (United States)

Nokwe, Cardine N; Zacharias, Martin; Yagi, Hisashi; Hora, Manuel; Reif, Bernd; Goto, Yuji; Buchner, Johannes

2014-09-26

Variable (V) domains of antibodies are essential for antigen recognition by our adaptive immune system. However, some variants of the light chain V domains (VL) form pathogenic amyloid fibrils in patients. It is so far unclear which residues play a key role in governing these processes. Here, we show that the conserved residue 2 of VL domains is crucial for controlling its thermodynamic stability and fibril formation. Hydrophobic side chains at position 2 stabilize the domain, whereas charged residues destabilize and lead to amyloid fibril formation. NMR experiments identified several segments within the core of the VL domain to be affected by changes in residue 2. Furthermore, molecular dynamic simulations showed that hydrophobic side chains at position 2 remain buried in a hydrophobic pocket, and charged side chains show a high flexibility. This results in a predicted difference in the dissociation free energy of ∼10 kJ mol(-1), which is in excellent agreement with our experimental values. Interestingly, this switch point is found only in VL domains of the κ family and not in VLλ or in VH domains, despite a highly similar domain architecture. Our results reveal novel insight into the architecture of variable domains and the prerequisites for formation of amyloid fibrils. This might also contribute to the rational design of stable variable antibody domains. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

[Effects of land use and environmental factors on the variability of soil quality indicators in hilly Loess Plateau region of China].

Science.gov (United States)

Xu, Ming-Xiang; Liu, Guo-Bin; Zhao, Yun-Ge

2011-02-01

Classical statistics methods were adopted to analyze the soil quality variability, its affecting factors, and affecting degree at a regional scale (700 km2) in the central part of hilly Loess Plateau region of China. There existed great differences in the variability of test soil quality indicators. Soil pH, structural coefficient, silt content, specific gravity, bulk density, total porosity, capillary porosity, and catalase activity were the indicators with weak variability; soil nutrients (N, P, and K) contents, CaCO3 content, cation exchange capacity (CEC), clay content, micro-aggregate mean mass diameter, aggregate mean mass diameter, water-stable aggregates, respiration rate, microbial quotient, invertase and phosphatase activities, respiratory quotient, and microbial carbon and nitrogen showed medium variation; while soil labile organic carbon and phosphorus contents, erosion-resistance, permeability coefficient, and urease activity were the indicators with strong variability. The variability of soil CaCO3, total P and K, CEC, texture, and specific gravity, etc. was correlated with topography and other environmental factors, while the variability of dynamic soil quality indicators, including soil organic matter content, nitrogen content, water-stable aggregates, permeability, microbial biomass carbon and nitrogen, enzyme activities, and respiration rate, was mainly correlated with land use type. Overall, land use pattern explained 97% of the variability of soil quality indicators in the region. It was suggested that in the evaluation of soil quality in hilly Loess Plateau region, land use type and environmental factors should be fully considered.

Changes of extreme precipitation and nonlinear influence of climate variables over monsoon region in China

KAUST Repository

Gao, Tao; Wang, Huixia Judy; Zhou, Tianjun

2017-01-01

of precipitation extremes over monsoon regions in China (MRC). However, research on monsoon extremes in China and their associations with climate variables is limited. In this study, we examine the space-time variations of extreme precipitation across the MRC

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Variability in the Water Footprint of Arable Crop Production across European Regions

Directory of Open Access Journals (Sweden)

Anne Gobin

2017-02-01

Full Text Available Crop growth and yield are affected by water use during the season: the green water footprint (WF accounts for rain water, the blue WF for irrigation and the grey WF for diluting agri-chemicals. We calibrated crop yield for FAO’s water balance model “Aquacrop” at field level. We collected weather, soil and crop inputs for 45 locations for the period 1992–2012. Calibrated model runs were conducted for wheat, barley, grain maize, oilseed rape, potato and sugar beet. The WF of cereals could be up to 20 times larger than the WF of tuber and root crops; the largest share was attributed to the green WF. The green and blue WF compared favourably with global benchmark values (R2 = 0.64–0.80; d = 0.91–0.95. The variability in the WF of arable crops across different regions in Europe is mainly due to variability in crop yield ( c v ¯ = 45% and to a lesser extent to variability in crop water use ( c v ¯ = 21%. The WF variability between countries ( c v ¯ = 14% is lower than the variability between seasons ( c v ¯ = 22% and between crops ( c v ¯ = 46%. Though modelled yields increased up to 50% under sprinkler irrigation, the water footprint still increased between 1% and 25%. Confronted with drainage and runoff, the grey WF tended to overestimate the contribution of nitrogen to the surface and groundwater. The results showed that the water footprint provides a measurable indicator that may support European water governance.

Intraseasonal variability of organized convective systems in the Central Andes: Relationship to Regional Dynamical Features

Science.gov (United States)

Mohr, K. I.; Slayback, D. A.; Nicholls, S.; Yager, K.

2013-12-01

The Andes extend from the west coast of Colombia (10N) to the southern tip of Chile (53S). In southern Peru and Bolivia, the Central Andes is split into separate eastern and western cordilleras, with a high plateau (≥ 3000 m), the Altiplano, between them. Because 90% of the Earth's tropical mountain glaciers are located in the Central Andes, our study focuses on this region, defining its zonal extent as 7S-21S and the meridional extent as the terrain 1000 m and greater. Although intense convection occurs during the wet season in the Altiplano, it is not included in the lists of regions with frequent or the most intense convection. The scarcity of in-situ observations with sufficient density and temporal resolution to resolve individual storms or even mesoscale-organized cloud systems and documented biases in microwave-based rainfall products in poorly gauged mountainous regions have impeded the development of an extensive literature on convection and convective systems in this region. With the tropical glaciers receding at unprecedented rates, leaving seasonal precipitation as an increasingly important input to the water balance in alpine valley ecosystems and streams, understanding the nature and characteristics of the seasonal precipitation becomes increasingly important for the rural economies in this region. Previous work in analyzing precipitation in the Central Andes has emphasized interannual variability with respect to ENSO, this is the first study to focus on shorter scale variability with respect to organized convection. The present study took advantage of the University of Utah's Precipitation Features database compiled from 14 years of TRMM observations (1998-2012), supplemented by field observations of rainfall and streamflow, historical gauge data, and long-term WRF-simulations, to analyze the intraseasonal variability of precipitating systems and their relationship regional dynamical features such as the Bolivian High. Through time series and

Transforming p21 ras protein: flexibility in the major variable region linking the catalytic and membrane-anchoring domains

DEFF Research Database (Denmark)

Willumsen, B M; Papageorge, A G; Hubbert, N

1985-01-01

or increasing it to 50 amino acids has relatively little effect on the capacity of the gene to induce morphological transformation of NIH 3T3 cells. Assays of GTP binding, GTPase and autophosphorylating activities of such mutant v-rasH-encoded proteins synthesized in bacteria indicated that the sequences...... that is required for post-translational processing, membrane localization and transforming activity of the proteins. We have now used the viral oncogene (v-rasH) of Harvey sarcoma virus to study the major variable region by deleting or duplicating parts of the gene. Reducing this region to five amino acids...... that encode these biochemical activities are located upstream from the major variable region. In the context of transformation, we propose that the region of sequence heterogeneity serves principally to connect the N-terminal catalytic domain with amino acids at the C terminus that are required to anchor...

Validation of EURO-CORDEX regional climate models in reproducing the variability of precipitation extremes in Romania

Science.gov (United States)

Dumitrescu, Alexandru; Busuioc, Aristita

2016-04-01

EURO-CORDEX is the European branch of the international CORDEX initiative that aims to provide improved regional climate change projections for Europe. The main objective of this paper is to document the performance of the individual models in reproducing the variability of precipitation extremes in Romania. Here three EURO-CORDEX regional climate models (RCMs) ensemble (scenario RCP4.5) are analysed and inter-compared: DMI-HIRHAM5, KNMI-RACMO2.2 and MPI-REMO. Compared to previous studies, when the RCM validation regarding the Romanian climate has mainly been made on mean state and at station scale, a more quantitative approach of precipitation extremes is proposed. In this respect, to have a more reliable comparison with observation, a high resolution daily precipitation gridded data set was used as observational reference (CLIMHYDEX project). The comparison between the RCM outputs and observed grid point values has been made by calculating three extremes precipitation indices, recommended by the Expert Team on Climate Change Detection Indices (ETCCDI), for the 1976-2005 period: R10MM, annual count of days when precipitation ≥10mm; RX5DAY, annual maximum 5-day precipitation and R95P%, precipitation fraction of annual total precipitation due to daily precipitation > 95th percentile. The RCMs capability to reproduce the mean state for these variables, as well as the main modes of their spatial variability (given by the first three EOF patterns), are analysed. The investigation confirms the ability of RCMs to simulate the main features of the precipitation extreme variability over Romania, but some deficiencies in reproducing of their regional characteristics were found (for example, overestimation of the mea state, especially over the extra Carpathian regions). This work has been realised within the research project "Changes in climate extremes and associated impact in hydrological events in Romania" (CLIMHYDEX), code PN II-ID-2011-2-0073, financed by the Romanian

Coupled decadal variability of the North Atlantic Oscillation, regional rainfall and karst spring discharges in the Campania region (southern Italy

Directory of Open Access Journals (Sweden)

P. De Vita

2012-05-01

Full Text Available Thus far, studies on climate change have focused mainly on the variability of the atmospheric and surface components of the hydrologic cycle, investigating the impact of this variability on the environment, especially with respect to the risks of desertification, droughts and floods. Conversely, the impacts of climate change on the recharge of aquifers and on the variability of groundwater flow have been less investigated, especially in Mediterranean karst areas whose water supply systems depend heavily upon groundwater exploitation.

In this paper, long-term climatic variability and its influence on groundwater recharge were analysed by examining decadal patterns of precipitation, air temperature and spring discharges in the Campania region (southern Italy, coupled with the North Atlantic Oscillation (NAO.

The time series of precipitation and air temperature were gathered over 90 yr, from 1921 to 2010, using 18 rain gauges and 9 air temperature stations with the most continuous functioning. The time series of the winter NAO index and of the discharges of 3 karst springs, selected from those feeding the major aqueducts systems, were collected for the same period.

Regional normalised indexes of the precipitation, air temperature and karst spring discharges were calculated, and different methods were applied to analyse the related time series, including long-term trend analysis using smoothing numerical techniques, cross-correlation and Fourier analysis.

The investigation of the normalised indexes highlighted the existence of long-term complex periodicities, from 2 to more than 30 yr, with differences in average values of up to approximately ±30% for precipitation and karst spring discharges, which were both strongly correlated with the winter NAO index.

Although the effects of the North Atlantic Oscillation (NAO had already been demonstrated in the long-term precipitation and streamflow patterns of

Near-surface wind variability over the broader Adriatic region: insights from an ensemble of regional climate models

Science.gov (United States)

Belušić, Andreina; Prtenjak, Maja Telišman; Güttler, Ivan; Ban, Nikolina; Leutwyler, David; Schär, Christoph

2018-06-01

Over the past few decades the horizontal resolution of regional climate models (RCMs) has steadily increased, leading to a better representation of small-scale topographic features and more details in simulating dynamical aspects, especially in coastal regions and over complex terrain. Due to its complex terrain, the broader Adriatic region represents a major challenge to state-of-the-art RCMs in simulating local wind systems realistically. The objective of this study is to identify the added value in near-surface wind due to the refined grid spacing of RCMs. For this purpose, we use a multi-model ensemble composed of CORDEX regional climate simulations at 0.11° and 0.44° grid spacing, forced by the ERA-Interim reanalysis, a COSMO convection-parameterizing simulation at 0.11° and a COSMO convection-resolving simulation at 0.02° grid spacing. Surface station observations from this region and satellite QuikSCAT data over the Adriatic Sea have been compared against daily output obtained from the available simulations. Both day-to-day wind and its frequency distribution are examined. The results indicate that the 0.44° RCMs rarely outperform ERA-Interim reanalysis, while the performance of the high-resolution simulations surpasses that of ERA-Interim. We also disclose that refining the grid spacing to a few km is needed to properly capture the small-scale wind systems. Finally, we show that the simulations frequently yield the accurate angle of local wind regimes, such as for the Bora flow, but overestimate the associated wind magnitude. Finally, spectral analysis shows good agreement between measurements and simulations, indicating the correct temporal variability of the wind speed.

Analysis of source regions and meteorological factors for the variability of spring PM10 concentrations in Seoul, Korea

Science.gov (United States)

Lee, Jangho; Kim, Kwang-Yul

2018-02-01

CSEOF analysis is applied for the springtime (March, April, May) daily PM10 concentrations measured at 23 Ministry of Environment stations in Seoul, Korea for the period of 2003-2012. Six meteorological variables at 12 pressure levels are also acquired from the ERA Interim reanalysis datasets. CSEOF analysis is conducted for each meteorological variable over East Asia. Regression analysis is conducted in CSEOF space between the PM10 concentrations and individual meteorological variables to identify associated atmospheric conditions for each CSEOF mode. By adding the regressed loading vectors with the mean meteorological fields, the daily atmospheric conditions are obtained for the first five CSEOF modes. Then, HYSPLIT model is run with the atmospheric conditions for each CSEOF mode in order to back trace the air parcels and dust reaching Seoul. The K-means clustering algorithm is applied to identify major source regions for each CSEOF mode of the PM10 concentrations in Seoul. Three main source regions identified based on the mean fields are: (1) northern Taklamakan Desert (NTD), (2) Gobi Desert and (GD), and (3) East China industrial area (ECI). The main source regions for the mean meteorological fields are consistent with those of previous study; 41% of the source locations are located in GD followed by ECI (37%) and NTD (21%). Back trajectory calculations based on CSEOF analysis of meteorological variables identify distinct source characteristics associated with each CSEOF mode and greatly facilitate the interpretation of the PM10 variability in Seoul in terms of transportation route and meteorological conditions including the source area.

YSOVAR: MID-INFRARED VARIABILITY AMONG YSOs IN THE STAR FORMATION REGION GGD12-15

Energy Technology Data Exchange (ETDEWEB)

Wolk, Scott J.; Günther, H. Moritz; Poppenhaeger, Katja; Forbrich, J. [Harvard–Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [NASA Ames Research Center, M/S 244-5 Moffett Field, CA 94035 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 E. California Blvd., Pasadena, CA 91125 (United States); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [Department of Physics Astronomy and Materials Science, Missouri State University, Springfield, MO 65897 (United States); Covey, K. R. [Department of Physics and Astronomy, Western Washington Univ., Bellingham, WA 98225-9164 (United States); Song, Inseok, E-mail: swolk@cfa.harvard.edu [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)

2015-11-15

We present an IR-monitoring survey with the Spitzer Space Telescope of the star-forming region GGD 12-15. More than 1000 objects were monitored, including about 350 objects within the central 5′, which is found to be especially dense in cluster members. The monitoring took place over 38 days and is part of the Young Stellar Object VARiability project. The region was also the subject of a contemporaneous 67 ks Chandra observation. The field includes 119 previously identified pre-main sequence star candidates. X-rays are detected from 164 objects, 90 of which are identified with cluster members. Overall, we find that about half the objects in the central 5′ are young stellar objects (YSOs) based on a combination of their spectral energy distribution, IR variability, and X-ray emission. Most of the stars with IR excess relative to a photosphere show large amplitude (>0.1 mag) mid-infrared (mid-IR) variability. There are 39 periodic sources, and all but one is found to be a cluster member. Almost half of the periodic sources do not show IR excesses. Overall, more than 85% of the Class I, flat spectrum, and Class II sources are found to vary. The amplitude of the variability is larger in more embedded YSOs. Most of the Class I/II objects exhibit redder colors in a fainter state, which is compatible with time-variable extinction. A few become bluer when fainter, which can be explained with significant changes in the structure of the inner disk. A search for changes in the IR due to X-ray events is carried out, but the low number of flares prevented an analysis of the direct impact of X-ray flares on the IR light curves. However, we find that X-ray detected Class II sources have longer timescales for change in the MIR than a similar set of non-X-ray detected Class IIs.

Understanding Short-Term Nonmigrating Tidal Variability in the Ionospheric Dynamo Region from SABER Using Information Theory and Bayesian Statistics

Science.gov (United States)

Kumari, K.; Oberheide, J.

2017-12-01

Nonmigrating tidal diagnostics of SABER temperature observations in the ionospheric dynamo region reveal a large amount of variability on time-scales of a few days to weeks. In this paper, we discuss the physical reasons for the observed short-term tidal variability using a novel approach based on Information theory and Bayesian statistics. We diagnose short-term tidal variability as a function of season, QBO, ENSO, and solar cycle and other drivers using time dependent probability density functions, Shannon entropy and Kullback-Leibler divergence. The statistical significance of the approach and its predictive capability is exemplified using SABER tidal diagnostics with emphasis on the responses to the QBO and solar cycle. Implications for F-region plasma density will be discussed.

Climate variability and land cover change over the North American monsoon region (Invited)

Science.gov (United States)

Zeng, X.; Scheftic, W. D.; Broxton, P. D.

2013-12-01

The North American Monsoon System over Mexico and southwestern United States represents a weather/climate and ecosystem coupled "macrosystem". The weather and climate affect the seasonal and interannual variability of ecosystem, while the ecosystem change affects surface energy, water, and carbon fluxes that, in turn, affect weather and climate. Furthermore, long-term weather/climate data have a much coarser horizontal resolution than the satellite land cover data. Here the North American Regional Reanalysis (NARR) data at 32 km grid spacing will be combined with various satellite remote sensing products at 1 km and/or 8 km resolution from AVHRR, MODIS, and SPOT for the period of 1982 to present. Our analysis includes: a) precipitation, wind, and precipitable water data from NARR to characterize the North American monsoon; b) land cover type, normalized difference vegetation index (NDVI), green vegetation fraction, and leaf-area index (LAI) data to characterize the seasonal and interannual variability of ecosystem; c) assessing the consistency of various satellite products; and d) testing the coherence in the weather/climate and ecosystem variability.

Regional regression models of percentile flows for the contiguous United States: Expert versus data-driven independent variable selection

Directory of Open Access Journals (Sweden)

Geoffrey Fouad

2018-06-01

New hydrological insights for the region: A set of three variables selected based on an expert assessment of factors that influence percentile flows performed similarly to larger sets of variables selected using a data-driven method. Expert assessment variables included mean annual precipitation, potential evapotranspiration, and baseflow index. Larger sets of up to 37 variables contributed little, if any, additional predictive information. Variables used to describe the distribution of basin data (e.g. standard deviation were not useful, and average values were sufficient to characterize physical and climatic basin conditions. Effectiveness of the expert assessment variables may be due to the high degree of multicollinearity (i.e. cross-correlation among additional variables. A tool is provided in the Supplementary material to predict percentile flows based on the three expert assessment variables. Future work should develop new variables with a strong understanding of the processes related to percentile flows.

Intraseasonal variability in the far-east pacific: investigation of the role of air-sea coupling in a regional coupled model

Energy Technology Data Exchange (ETDEWEB)

Small, R.J. [Naval Research Laboratory, Jacobs Technology, Stennis Space Center, MS (United States); University of Hawaii, International Pacific Research Center, POST 401, Honolulu, HI (United States); Xie, Shang-Ping [University of Hawaii, International Pacific Research Center, POST 401, Honolulu, HI (United States); University of Hawaii, Department of Meteorology, School of Ocean and Earth Science and Technology, Honolulu, HI (United States); Maloney, Eric D. [Colorado State University, Department of Atmospheric Science, Fort Collins, CO (United States); Szoeke, Simon P. de [Oregon State University, College of Oceanic and Atmospheric Sciences, Corvallis, OR (United States); Miyama, Toru [Frontier Research for Global Change, Yokohama (Japan)

2011-03-15

Intraseasonal variability in the eastern Pacific warm pool in summer is studied, using a regional ocean-atmosphere model, a linear baroclinic model (LBM), and satellite observations. The atmospheric component of the model is forced by lateral boundary conditions from reanalysis data. The aim is to quantify the importance to atmospheric deep convection of local air-sea coupling. In particular, the effect of sea surface temperature (SST) anomalies on surface heat fluxes is examined. Intraseasonal (20-90 day) east Pacific warm-pool zonal wind and outgoing longwave radiation (OLR) variability in the regional coupled model are correlated at 0.8 and 0.6 with observations, respectively, significant at the 99% confidence level. The strength of the intraseasonal variability in the coupled model, as measured by the variance of outgoing longwave radiation, is close in magnitude to that observed, but with a maximum located about 10 further west. East Pacific warm pool intraseasonal convection and winds agree in phase with those from observations, suggesting that remote forcing at the boundaries associated with the Madden-Julian oscillation determines the phase of intraseasonal convection in the east Pacific warm pool. When the ocean model component is replaced by weekly reanalysis SST in an atmosphere-only experiment, there is a slight improvement in the location of the highest OLR variance. Further sensitivity experiments with the regional atmosphere-only model in which intraseasonal SST variability is removed indicate that convective variability has only a weak dependence on the SST variability, but a stronger dependence on the climatological mean SST distribution. A scaling analysis confirms that wind speed anomalies give a much larger contribution to the intraseasonal evaporation signal than SST anomalies, in both model and observations. A LBM is used to show that local feedbacks would serve to amplify intraseasonal convection and the large-scale circulation. Further

IDENTIFICATION OF THOSE VARIABLES THAT HAVE A SIGNIFICANT INFLUENCE ON THE EXPECTED NUMBER OF DAYS OF STAYING IN THE CENTRE DEVELOPMENT REGION OF ROMANIA

Directory of Open Access Journals (Sweden)

Erika KULCSÁR

2010-06-01

Full Text Available I started from the assumption that there are more variables that have a significant influence on the expected number of days of staying in the Centre Development Region. To identify those variables this paper includes the analysis of variance with two variables that are not interacting, in this case the dependent variable is the question "How many days did you plan to stay in Centre Development Region?" and the independent variables are: "What is the purpose of your stay?" "What is the highest level of education?". Given that there are cases when interactions occur between variables, I also analyzed the interaction effects between the two independent variables. The paper also includes an ANOVA analysis with three variables between which interactions relationships occur. After identifying the dependency relations between the variables I found that the inclusion of the third variable, namely the "Marital status" of respondents, adds value to the model. Following the results obtained by ANOVA analysis, I identified those socio-demographic characteristics that, in my opinion, companies that operate on tourist market in the Center Development Region should consider when fundamenting marketing strategies in tourism.

Exploring the Links in Monthly to Decadal Variability of the Atmospheric Water Balance Over the Wettest Regions in ERA-20C

Science.gov (United States)

Nogueira, M.

2017-10-01

Monthly-to-decadal variability of the regional precipitation over Intertropical Convergence Zone and north-Atlantic and north-Pacific storm tracks was investigated using ERA-20C reanalysis. Satellite-based precipitation (P) and evaporation (E) climatological patterns were well reproduced by ERA-20C. Regional P and E monthly time series displayed 20% differences, but these decreased rapidly with time scale ( 10% at yearly time scales). Spectral analysis showed good scale-by-scale statistical agreement between ERA-20C and observations. Using ERA-Interim showed no improvement despite the much wider range of information assimilated (including satellites). Remarkably high Detrended Cross-Correlation Analysis coefficients (ρDCCA > 0.7 and often ρDCCA > 0.9) revealed tight links between the nonperiodic variability of P, moisture divergence (DIV), and pressure velocity (ω) at monthly-to-decadal time scales over all the wet regions. In contrast, ρDCCA was essentially nonsignificant between nonperiodic P and E or sea surface temperature (SST). Thus, the nonperiodic monthly-to-decadal variability of precipitation in these regions is almost fully controlled by dynamics and not by local E or SST (suggested by Clausius-Clapeyron relation). Analysis of regional nonperiodic standard deviations and power spectra (and respective spectral exponents, β) provided further robustness to this conclusion. Finally, clear transitions in β for P, DIV, and ω between tropical and storm track regions were found. The latter is dominated by transient storms, with energy accumulation at synoptic scales and β β values (0.2 to 0.4) were found in the tropics, implying longer-range autocorrelations and slower decreasing variability and information creation with time scale, consistent with the important forcing from internal modes of variability (e.g., El Niño-Southern Oscillation).

Climate related diseases. Current regional variability and projections to the year 2100

Directory of Open Access Journals (Sweden)

Błażejczyk Krzysztof

2018-03-01

Full Text Available The health of individuals and societies depends on different factors including atmospheric conditions which influence humans in direct and indirect ways. The paper presents regional variability of some climate related diseases (CRD in Poland: salmonellosis intoxications, Lyme boreliosis, skin cancers (morbidity and mortality, influenza, overcooling deaths, as well as respiratory and circulatory mortality. The research consisted of two stages: 1 statistical modelling basing on past data and 2 projections of CRD for three SRES scenarios of climate change (A1B, A2, B1 to the year 2100. Several simple and multiply regression models were found for the relationships between climate variables and CRD. The models were applied to project future levels of CRD. At the end of 21st century we must expect increase in: circulatory mortality, Lyme boreliosis infections and skin cancer morbidity and mortality. There is also projected decrease in: respiratory mortality, overcooling deaths and influenza infections.

Collaborative Research: Improving Decadal Prediction of Arctic Climate Variability and Change Using a Regional Arctic

Energy Technology Data Exchange (ETDEWEB)

Gutowski, William J. [Iowa State Univ., Ames, IA (United States)

2017-12-28

This project developed and applied a regional Arctic System model for enhanced decadal predictions. It built on successful research by four of the current PIs with support from the DOE Climate Change Prediction Program, which has resulted in the development of a fully coupled Regional Arctic Climate Model (RACM) consisting of atmosphere, land-hydrology, ocean and sea ice components. An expanded RACM, a Regional Arctic System Model (RASM), has been set up to include ice sheets, ice caps, mountain glaciers, and dynamic vegetation to allow investigation of coupled physical processes responsible for decadal-scale climate change and variability in the Arctic. RASM can have high spatial resolution (~4-20 times higher than currently practical in global models) to advance modeling of critical processes and determine the need for their explicit representation in Global Earth System Models (GESMs). The pan-Arctic region is a key indicator of the state of global climate through polar amplification. However, a system-level understanding of critical arctic processes and feedbacks needs further development. Rapid climate change has occurred in a number of Arctic System components during the past few decades, including retreat of the perennial sea ice cover, increased surface melting of the Greenland ice sheet, acceleration and thinning of outlet glaciers, reduced snow cover, thawing permafrost, and shifts in vegetation. Such changes could have significant ramifications for global sea level, the ocean thermohaline circulation and heat budget, ecosystems, native communities, natural resource exploration, and commercial transportation. The overarching goal of the RASM project has been to advance understanding of past and present states of arctic climate and to improve seasonal to decadal predictions. To do this the project has focused on variability and long-term change of energy and freshwater flows through the arctic climate system. The three foci of this research are: - Changes

The spread amongst ENSEMBLES regional scenarios: regional climate models, driving general circulation models and interannual variability

Energy Technology Data Exchange (ETDEWEB)

Deque, M.; Somot, S. [Meteo-France, Centre National de Recherches Meteorologiques, CNRS/GAME, Toulouse Cedex 01 (France); Sanchez-Gomez, E. [Cerfacs/CNRS, SUC URA1875, Toulouse Cedex 01 (France); Goodess, C.M. [University of East Anglia, Climatic Research Unit, Norwich (United Kingdom); Jacob, D. [Max Planck Institute for Meteorology, Hamburg (Germany); Lenderink, G. [KNMI, Postbus 201, De Bilt (Netherlands); Christensen, O.B. [Danish Meteorological Institute, Copenhagen Oe (Denmark)

2012-03-15

Various combinations of thirteen regional climate models (RCM) and six general circulation models (GCM) were used in FP6-ENSEMBLES. The response to the SRES-A1B greenhouse gas concentration scenario over Europe, calculated as the difference between the 2021-2050 and the 1961-1990 means can be viewed as an expected value about which various uncertainties exist. Uncertainties are measured here by variance explained for temperature and precipitation changes over eight European sub-areas. Three sources of uncertainty can be evaluated from the ENSEMBLES database. Sampling uncertainty is due to the fact that the model climate is estimated as an average over a finite number of years (30) despite a non-negligible interannual variability. Regional model uncertainty is due to the fact that the RCMs use different techniques to discretize the equations and to represent sub-grid effects. Global model uncertainty is due to the fact that the RCMs have been driven by different GCMs. Two methods are presented to fill the many empty cells of the ENSEMBLES RCM x GCM matrix. The first one is based on the same approach as in FP5-PRUDENCE. The second one uses the concept of weather regimes to attempt to separate the contribution of the GCM and the RCM. The variance of the climate response is analyzed with respect to the contribution of the GCM and the RCM. The two filling methods agree that the main contributor to the spread is the choice of the GCM, except for summer precipitation where the choice of the RCM dominates the uncertainty. Of course the implication of the GCM to the spread varies with the region, being maximum in the South-western part of Europe, whereas the continental parts are more sensitive to the choice of the RCM. The third cause of spread is systematically the interannual variability. The total uncertainty about temperature is not large enough to mask the 2021-2050 response which shows a similar pattern to the one obtained for 2071-2100 in PRUDENCE. The uncertainty

Relevance of the immunoglobulin VH somatic mutation status in patients with chronic lymphocytic leukemia treated with fludarabine, cyclophosphamide, and rituximab (FCR) or related chemoimmunotherapy regimens.

Science.gov (United States)

Lin, Katherine I; Tam, Constantine S; Keating, Michael J; Wierda, William G; O'Brien, Susan; Lerner, Susan; Coombes, Kevin R; Schlette, Ellen; Ferrajoli, Alessandra; Barron, Lynn L; Kipps, Thomas J; Rassenti, Laura; Faderl, Stefan; Kantarjian, Hagop; Abruzzo, Lynne V

2009-04-02

Although immunoglobulin V(H) mutation status (IgV(H) MS) is prognostic in patients with chronic lymphocytic leukemia (CLL) who are treated with alkylating agents or single-agent fludarabine, its significance in the era of chemoimmunotherapy is not known. We determined the IgV(H) somatic mutation status (MS) in 177 patients enrolled in a phase 2 study of fludarabine, cyclophosphamide, and rituximab (FCR) and in 127 patients treated with subsequent chemoimmunotherapy protocols. IgV(H) MS did not impact significantly on the complete remission (CR) rate of patients receiving FCR or related regimens. However, CR duration was significantly shorter in patients with CLL that used unmutated IgV(H) than those whose CLL used mutated IgV(H) (TTP 47% vs 82% at 6 years, P IgV(H) MS emerged as the only determinant of remission duration (hazard ratio 3.8, P IgV(H) status.

Co-evolution of affinity and stability of grafted amyloid-motif domain antibodies.

Science.gov (United States)

Julian, Mark C; Lee, Christine C; Tiller, Kathryn E; Rabia, Lilia A; Day, Evan K; Schick, Arthur J; Tessier, Peter M

2015-10-01

An attractive approach for designing lead antibody candidates is to mimic natural protein interactions by grafting peptide recognition motifs into the complementarity-determining regions (CDRs). We are using this approach to generate single-domain (VH) antibodies specific for amyloid-forming proteins such as the Alzheimer's Aβ peptide. Here, we use random mutagenesis and yeast surface display to improve the binding affinity of a lead VH domain grafted with Aβ residues 33-42 in CDR3. Interestingly, co-selection for improved Aβ binding and VH display on the surface of yeast yields antibody domains with improved affinity and reduced stability. The highest affinity VH domains were strongly destabilized on the surface of yeast as well as unfolded when isolated as autonomous domains. In contrast, stable VH domains with improved affinity were reliably identified using yeast surface display by replacing the display antibody that recognizes a linear epitope tag at the terminus of both folded and unfolded VH domains with a conformational ligand (Protein A) that recognizes a discontinuous epitope on the framework of folded VH domains. Importantly, we find that selection for improved stability using Protein A without simultaneous co-selection for improved Aβ binding leads to strong enrichment for stabilizing mutations that reduce antigen binding. Our findings highlight the importance of simultaneously optimizing affinity and stability to improve the rapid isolation of well-folded and specific antibody fragments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Development of anti-bovine IgA single chain variable fragment and its application in diagnosis of foot-and-mouth disease

Science.gov (United States)

Sridevi, N. V.; Shukra, A. M.; Neelakantam, B.; Anilkumar, J.; Madhanmohan, M.; Rajan, S.; Dev Chandran

2014-01-01

Recombinant antibody fragments like single chain variable fragments (scFvs) represent an attractive yet powerful alternative to immunoglobulins and hold great potential in the development of clinical diagnostic/therapeutic reagents. Structurally, scFvs are the smallest antibody fragments capable of retaining the antigen-binding capacity of whole antibodies and are composed of an immunoglobulin (Ig) variable light (VL) and variable heavy (VH) chain joined by a flexible polypeptide linker. In the present study, we constructed a scFv against bovine IgA from a hybridoma cell line IL-A71 that secretes a monoclonal antibody against bovine IgA using recombinant DNA technology. The scFv was expressed in Escherichia coli and purified using immobilized metal affinity chromatography (IMAC). The binding activity and specificity of the scFv was established by its non-reactivity toward other classes of immunoglobulins as determined by enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis. Kinetic measurement of the scFv indicated that the recombinant antibody fragment had an affinity in picomolar range toward purified IgA. Furthermore, the scFv was used to develop a sensitive ELISA for the detection of foot and mouth disease virus (FMDV) carrier animals. PMID:24678404

Sensitivity of extreme precipitation to temperature: the variability of scaling factors from a regional to local perspective

Science.gov (United States)

Schroeer, K.; Kirchengast, G.

2018-06-01

Potential increases in extreme rainfall induced hazards in a warming climate have motivated studies to link precipitation intensities to temperature. Increases exceeding the Clausius-Clapeyron (CC) rate of 6-7%/°C-1 are seen in short-duration, convective, high-percentile rainfall at mid latitudes, but the rates of change cease or revert at regionally variable threshold temperatures due to moisture limitations. It is unclear, however, what these findings mean in term of the actual risk of extreme precipitation on a regional to local scale. When conditioning precipitation intensities on local temperatures, key influences on the scaling relationship such as from the annual cycle and regional weather patterns need better understanding. Here we analyze these influences, using sub-hourly to daily precipitation data from a dense network of 189 stations in south-eastern Austria. We find that the temperature sensitivities in the mountainous western region are lower than in the eastern lowlands. This is due to the different weather patterns that cause extreme precipitation in these regions. Sub-hourly and hourly intensities intensify at super-CC and CC-rates, respectively, up to temperatures of about 17 °C. However, we also find that, because of the regional and seasonal variability of the precipitation intensities, a smaller scaling factor can imply a larger absolute change in intensity. Our insights underline that temperature precipitation scaling requires careful interpretation of the intent and setting of the study. When this is considered, conditional scaling factors can help to better understand which influences control the intensification of rainfall with temperature on a regional scale.

Climate and climate variability of the wind power resources in the Great Lakes region of the United States

Science.gov (United States)

X. Li; S. Zhong; X. Bian; W.E. Heilman

2010-01-01

The climate and climate variability of low-level winds over the Great Lakes region of the United States is examined using 30 year (1979-2008) wind records from the recently released North American Regional Reanalysis (NARR), a three-dimensional, high-spatial and temporal resolution, and dynamically consistent climate data set. The analyses focus on spatial distribution...

Using non-systematic surveys to investigate effects of regional climate variability on Australasian gannets in the Hauraki Gulf, New Zealand

Science.gov (United States)

Srinivasan, Mridula; Dassis, Mariela; Benn, Emily; Stockin, Karen A.; Martinez, Emmanuelle; Machovsky-Capuska, Gabriel E.

2015-05-01

Few studies have investigated regional and natural climate variability on seabird populations using ocean reanalysis datasets (e.g. Simple Ocean Data Assimilation (SODA)) that integrate atmospheric information to supplement ocean observations and provide improved estimates of ocean conditions. Herein we use a non-systematic dataset on Australasian gannets (Morus serrator) from 2001 to 2009 to identify potential connections between Gannet Sightings Per Unit Effort (GSPUE) and climate and oceanographic variability in a region of known importance for breeding seabirds, the Hauraki Gulf (HG), New Zealand. While no statistically significant relationships between GSPUE and global climate indices were determined, there was a significant correlation between GSPUE and regional SST anomaly for HG. Also, there appears to be a strong link between global climate indices and regional climate in the HG. Further, based on cross-correlation function coefficients and lagged multiple regression models, we identified potential leading and lagging climate variables, and climate variables but with limited predictive capacity in forecasting future GSPUE. Despite significant inter-annual variability and marginally cooler SSTs since 2001, gannet sightings appear to be increasing. We hypothesize that at present underlying physical changes in the marine ecosystem may be insufficient to affect supply of preferred gannet main prey (pilchard Sardinops spp.), which tolerate a wide thermal range. Our study showcases the potential scientific value of lengthy non-systematic data streams and when designed properly (i.e., contain abundance, flock size, and spatial data), can yield useful information in climate impact studies on seabirds and other marine fauna. Such information can be invaluable for enhancing conservation measures for protected species in fiscally constrained research environments.

Representing major soil variability at regional scale by constrained Latin Hypercube Sampling of remote sensing data

NARCIS (Netherlands)

Mulder, V.L.; Bruin, de S.; Schaepman, M.E.

2013-01-01

This paper presents a sparse, remote sensing-based sampling approach making use of conditioned Latin Hypercube Sampling (cLHS) to assess variability in soil properties at regional scale. The method optimizes the sampling scheme for a defined spatial population based on selected covariates, which are

Increased topographical variability of task-related activation in perceptive and motor associative regions in adult autistics

Directory of Open Access Journals (Sweden)

Marie-Pier Poulin-Lord

2014-01-01

Conclusion: Different and possibly unique strategies are used by each autistic individual. That enhanced variability in localization of activations in the autistic group is found in regions typically more variable in non-autistics raises the possibility that autism involves an enhancement and/or an alteration of typical plasticity mechanisms. The current study also highlights the necessity to verify, in fMRI studies involving autistic people, that hypoactivation at the group level does not result from each individual successfully completing a task using a unique brain allocation, even by comparison to his own group.

Rainfall variability, climate change and regionalization in the African monsoon region

International Nuclear Information System (INIS)

Fontaine, Bernard; Roucou, Pascal; Vigaud, Nicolas; Camara, Moctar; Konare, Abdourahamane; Sanda, Seidou Ibrah; Diedhiou, Arona; Janicot, Serge

2012-01-01

This summary recalls some results at the end of the AMMA international experiment (2003-2010) in terms of variability of the African monsoon at the intra-seasonal to multi-decadal scales and of climate prospective. The results confirmed the weight of surface temperatures and marine tele-connections for inter-annual and decadal fluctuations and stressed the importance of atmospheric variability. They also described the dominant modes of intra-seasonal variability as their interactions with the surface. Several hypotheses involving memory effects related to soil water and vegetation, particularly in boreal spring and autumn have also been made. Prospective analysis from model output suggests rainfall surplus around 2050 over the Eastern-central Sahel and relative deficit to the West. Phase 2 of AMMA (2010-2020) will focus more on aspects that have a high social impact in direct collaboration with meteorological services predictability, prediction scores, operational indicators, evaluation of the part of anthropogenic forcing in the current and future variations. (authors)

Variability of the extent of the Hadley circulation in the southern hemisphere: a regional perspective

Science.gov (United States)

Nguyen, H.; Hendon, H. H.; Lim, E.-P.; Boschat, G.; Maloney, E.; Timbal, B.

2018-01-01

In order to understand the regional impacts of variations in the extent of the Hadley circulation in the Southern Hemisphere, regional Hadley circulations are defined in three sectors centered on the main tropical heat sources over Africa, Asia-Pacific (Maritime Continent) and the Americas. These regional circulations are defined by computing a streamfunction from the divergent component of the meridional wind. A major finding from this study is that year-to-year variability in the extent of the hemispheric Hadley circulation in the Southern Hemisphere is primarily governed by variations of the extent of the Hadley circulation in the Asia-Pacific sector, especially during austral spring and summer when there is little co-variability with the African sector, and the American sector exhibits an out of phase behavior. An expanded Hadley circulation in the Southern Hemisphere (both hemispherically and in the Asia-Pacific sector) is associated with La Niña conditions and a poleward expansion of the tropical wet zone in the Asia-Pacific sector. While La Niña also promotes expansion in the American and African sectors during austral winter, these tropical conditions tend to promote contraction in the two sectors during austral summer as a result of compensating convergence over the Americas and Africa sectors: a process driven by variations in the Walker circulation and Rossby wave trains emanating from the tropical Indian Ocean.

Improving plot- and regional-scale crop models for simulating impacts of climate variability and extremes

Science.gov (United States)

Tao, F.; Rötter, R.

2013-12-01

Many studies on global climate report that climate variability is increasing with more frequent and intense extreme events1. There are quite large uncertainties from both the plot- and regional-scale models in simulating impacts of climate variability and extremes on crop development, growth and productivity2,3. One key to reducing the uncertainties is better exploitation of experimental data to eliminate crop model deficiencies and develop better algorithms that more adequately capture the impacts of extreme events, such as high temperature and drought, on crop performance4,5. In the present study, in a first step, the inter-annual variability in wheat yield and climate from 1971 to 2012 in Finland was investigated. Using statistical approaches the impacts of climate variability and extremes on wheat growth and productivity were quantified. In a second step, a plot-scale model, WOFOST6, and a regional-scale crop model, MCWLA7, were calibrated and validated, and applied to simulate wheat growth and yield variability from 1971-2012. Next, the estimated impacts of high temperature stress, cold damage, and drought stress on crop growth and productivity based on the statistical approaches, and on crop simulation models WOFOST and MCWLA were compared. Then, the impact mechanisms of climate extremes on crop growth and productivity in the WOFOST model and MCWLA model were identified, and subsequently, the various algorithm and impact functions were fitted against the long-term crop trial data. Finally, the impact mechanisms, algorithms and functions in WOFOST model and MCWLA model were improved to better simulate the impacts of climate variability and extremes, particularly high temperature stress, cold damage and drought stress for location-specific and large area climate impact assessments. Our studies provide a good example of how to improve, in parallel, the plot- and regional-scale models for simulating impacts of climate variability and extremes, as needed for

Variability in large-scale wind power generation: Variability in large-scale wind power generation

Energy Technology Data Exchange (ETDEWEB)

Kiviluoma, Juha [VTT Technical Research Centre of Finland, Espoo Finland; Holttinen, Hannele [VTT Technical Research Centre of Finland, Espoo Finland; Weir, David [Energy Department, Norwegian Water Resources and Energy Directorate, Oslo Norway; Scharff, Richard [KTH Royal Institute of Technology, Electric Power Systems, Stockholm Sweden; Söder, Lennart [Royal Institute of Technology, Electric Power Systems, Stockholm Sweden; Menemenlis, Nickie [Institut de recherche Hydro-Québec, Montreal Canada; Cutululis, Nicolaos A. [DTU, Wind Energy, Roskilde Denmark; Danti Lopez, Irene [Electricity Research Centre, University College Dublin, Dublin Ireland; Lannoye, Eamonn [Electric Power Research Institute, Palo Alto California USA; Estanqueiro, Ana [LNEG, Laboratorio Nacional de Energia e Geologia, UESEO, Lisbon Spain; Gomez-Lazaro, Emilio [Renewable Energy Research Institute and DIEEAC/EDII-AB, Castilla-La Mancha University, Albacete Spain; Zhang, Qin [State Grid Corporation of China, Beijing China; Bai, Jianhua [State Grid Energy Research Institute Beijing, Beijing China; Wan, Yih-Huei [National Renewable Energy Laboratory, Transmission and Grid Integration Group, Golden Colorado USA; Milligan, Michael [National Renewable Energy Laboratory, Transmission and Grid Integration Group, Golden Colorado USA

2015-10-25

The paper demonstrates the characteristics of wind power variability and net load variability in multiple power systems based on real data from multiple years. Demonstrated characteristics include probability distribution for different ramp durations, seasonal and diurnal variability and low net load events. The comparison shows regions with low variability (Sweden, Spain and Germany), medium variability (Portugal, Ireland, Finland and Denmark) and regions with higher variability (Quebec, Bonneville Power Administration and Electric Reliability Council of Texas in North America; Gansu, Jilin and Liaoning in China; and Norway and offshore wind power in Denmark). For regions with low variability, the maximum 1 h wind ramps are below 10% of nominal capacity, and for regions with high variability, they may be close to 30%. Wind power variability is mainly explained by the extent of geographical spread, but also higher capacity factor causes higher variability. It was also shown how wind power ramps are autocorrelated and dependent on the operating output level. When wind power was concentrated in smaller area, there were outliers with high changes in wind output, which were not present in large areas with well-dispersed wind power.

Santa Ana Winds of Southern California: Their Climatology and Variability Spanning 6.5 Decades from Regional Dynamical Modelling

Science.gov (United States)

Guzman-Morales, J.; Gershunov, A.

2015-12-01

Santa Ana Winds (SAWs) are an integral feature of the regional climate of Southern California/Northern Baja California region. In spite of their tremendous episodic impacts on the health, economy and mood of the region, climate-scale behavior of SAW is poorly understood. In the present work, we identify SAWs in mesoscale dynamical downscaling of a global reanalysis product and construct an hourly SAW catalogue spanning 65 years. We describe the long-term SAW climatology at relevant time-space resolutions, i.e, we developed local and regional SAW indices and analyse their variability on hourly, daily, annual, and multi-decadal timescales. Local and regional SAW indices are validated with available anemometer observations. Characteristic behaviors are revealed, e.g. the SAW intensity-duration relationship. At interdecadal time scales, we find that seasonal SAW activity is sensitive to prominent large-scale low-frequency modes of climate variability rooted in the tropical and north Pacific ocean-atmosphere system that are also known to affect the hydroclimate of this region. Lastly, we do not find any long-term trend in SAW frequency and intensity as previously reported. Instead, we identify a significant long-term trend in SAW behavior whereby contribution of extreme SAW events to total seasonal SAW activity has been increasing at the expense of moderate events. These findings motivate further investigation on SAW evolution in future climate and its impact on wildfires.

Multi-Site and Multi-Variables Statistical Downscaling Technique in the Monsoon Dominated Region of Pakistan

Science.gov (United States)

Khan, Firdos; Pilz, Jürgen

2016-04-01

South Asia is under the severe impacts of changing climate and global warming. The last two decades showed that climate change or global warming is happening and the first decade of 21st century is considered as the warmest decade over Pakistan ever in history where temperature reached 53 0C in 2010. Consequently, the spatio-temporal distribution and intensity of precipitation is badly effected and causes floods, cyclones and hurricanes in the region which further have impacts on agriculture, water, health etc. To cope with the situation, it is important to conduct impact assessment studies and take adaptation and mitigation remedies. For impact assessment studies, we need climate variables at higher resolution. Downscaling techniques are used to produce climate variables at higher resolution; these techniques are broadly divided into two types, statistical downscaling and dynamical downscaling. The target location of this study is the monsoon dominated region of Pakistan. One reason for choosing this area is because the contribution of monsoon rains in this area is more than 80 % of the total rainfall. This study evaluates a statistical downscaling technique which can be then used for downscaling climatic variables. Two statistical techniques i.e. quantile regression and copula modeling are combined in order to produce realistic results for climate variables in the area under-study. To reduce the dimension of input data and deal with multicollinearity problems, empirical orthogonal functions will be used. Advantages of this new method are: (1) it is more robust to outliers as compared to ordinary least squares estimates and other estimation methods based on central tendency and dispersion measures; (2) it preserves the dependence among variables and among sites and (3) it can be used to combine different types of distributions. This is important in our case because we are dealing with climatic variables having different distributions over different meteorological

Changes of extreme precipitation and nonlinear influence of climate variables over monsoon region in China

KAUST Repository

Gao, Tao

2017-07-19

The El Niño-Southern Oscillation (ENSO), Indian Ocean Dipole (IOD), North Atlantic Oscillation (NAO), Atlantic Multidecadal Oscillation (AMO) and Pacific decadal oscillation (PDO) are well understood to be major drivers for the variability of precipitation extremes over monsoon regions in China (MRC). However, research on monsoon extremes in China and their associations with climate variables is limited. In this study, we examine the space-time variations of extreme precipitation across the MRC, and assess the time-varying influences of the climate drivers using Bayesian dynamic linear regression and their combined nonlinear effects through fitting generalized additive models. Results suggest that the central-east and south China is dominated by less frequent but more intense precipitation. Extreme rainfalls show significant positive trends, coupled with a significant decline of dry spells, indicating an increasing chance of occurrence of flood-induced disasters in the MRC during 1960–2014. Majority of the regional indices display some abrupt shifts during the 1990s. The influences of climate variables on monsoon extremes exhibit distinct interannual or interdecadal variations. IOD, ENSO and AMO have strong impacts on monsoon and extreme precipitation, especially during the 1990s, which is generally consistent with the abrupt shifts in precipitation regimes around this period. Moreover, ENSO mainly affects moderate rainfalls and dry spells, while IOD has a more significant impact on precipitation extremes. These findings could be helpful for improving the forecasting of monsoon extremes in China and the evaluations of climate models.

Quantifying uncertainty due to internal variability using high-resolution regional climate model simulations

Science.gov (United States)

Gutmann, E. D.; Ikeda, K.; Deser, C.; Rasmussen, R.; Clark, M. P.; Arnold, J. R.

2015-12-01

The uncertainty in future climate predictions is as large or larger than the mean climate change signal. As such, any predictions of future climate need to incorporate and quantify the sources of this uncertainty. One of the largest sources comes from the internal, chaotic, variability within the climate system itself. This variability has been approximated using the 30 ensemble members of the Community Earth System Model (CESM) large ensemble. Here we examine the wet and dry end members of this ensemble for cool-season precipitation in the Colorado Rocky Mountains with a set of high-resolution regional climate model simulations. We have used the Weather Research and Forecasting model (WRF) to simulate the periods 1990-2000, 2025-2035, and 2070-2080 on a 4km grid. These simulations show that the broad patterns of change depicted in CESM are inherited by the high-resolution simulations; however, the differences in the height and location of the mountains in the WRF simulation, relative to the CESM simulation, means that the location and magnitude of the precipitation changes are very different. We further show that high-resolution simulations with the Intermediate Complexity Atmospheric Research model (ICAR) predict a similar spatial pattern in the change signal as WRF for these ensemble members. We then use ICAR to examine the rest of the CESM Large Ensemble as well as the uncertainty in the regional climate model due to the choice of physics parameterizations.

Assessing Regional Scale Variability in Extreme Value Statistics Under Altered Climate Scenarios

Energy Technology Data Exchange (ETDEWEB)

Brunsell, Nathaniel [Univ. of Kansas, Lawrence, KS (United States); Mechem, David [Univ. of Kansas, Lawrence, KS (United States); Ma, Chunsheng [Wichita State Univ., KS (United States)

2015-02-20

Recent studies have suggested that low-frequency modes of climate variability can significantly influence regional climate. The climatology associated with extreme events has been shown to be particularly sensitive. This has profound implications for droughts, heat waves, and food production. We propose to examine regional climate simulations conducted over the continental United States by applying a recently developed technique which combines wavelet multi–resolution analysis with information theory metrics. This research is motivated by two fundamental questions concerning the spatial and temporal structure of extreme events. These questions are 1) what temporal scales of the extreme value distributions are most sensitive to alteration by low-frequency climate forcings and 2) what is the nature of the spatial structure of variation in these timescales? The primary objective is to assess to what extent information theory metrics can be useful in characterizing the nature of extreme weather phenomena. Specifically, we hypothesize that (1) changes in the nature of extreme events will impact the temporal probability density functions and that information theory metrics will be sensitive these changes and (2) via a wavelet multi–resolution analysis, we will be able to characterize the relative contribution of different timescales on the stochastic nature of extreme events. In order to address these hypotheses, we propose a unique combination of an established regional climate modeling approach and advanced statistical techniques to assess the effects of low-frequency modes on climate extremes over North America. The behavior of climate extremes in RCM simulations for the 20th century will be compared with statistics calculated from the United States Historical Climatology Network (USHCN) and simulations from the North American Regional Climate Change Assessment Program (NARCCAP). This effort will serve to establish the baseline behavior of climate extremes, the

Improving solubility and refolding efficiency of human V(H)s by a novel mutational approach.

Science.gov (United States)

Tanha, Jamshid; Nguyen, Thanh-Dung; Ng, Andy; Ryan, Shannon; Ni, Feng; Mackenzie, Roger

2006-11-01

The antibody V(H) domains of camelids tend to be soluble and to resist aggregation, in contrast to human V(H) domains. For immunotherapy, attempts have therefore been made to improve the properties of human V(H)s by camelization of a small set of framework residues. Here, we have identified through sequence comparison of well-folded llama V(H) domains an alternative set of residues (not typically camelid) for mutation. Thus, the solubility and thermal refolding efficiency of a typical human V(H), derived from the human antibody BT32/A6, were improved by introduction of two mutations in framework region (FR) 1 and 4 to generate BT32/A6.L1. Three more mutations in FR3 of BT32/A6.L1 further improved the thermal refolding efficiency while retaining solubility and cooperative melting profiles. To demonstrate practical utility, BT32/A6.L1 was used to construct a phage display library from which were isolated human V(H)s with good antigen binding activity and solubility. The engineered human V(H) domains described here may be useful for immunotherapy, due to their expected low immunogenicity, and in applications involving transient high temperatures, due to their efficient refolding after thermal denaturation.

A new high molecular weight immunoglobulin class from the carcharhine shark: implications for the properties of the primordial immunoglobulin.

Science.gov (United States)

Berstein, R M; Schluter, S F; Shen, S; Marchalonis, J J

1996-04-16

All immunoglobulins and T-cell receptors throughout phylogeny share regions of highly conserved amino acid sequence. To identify possible primitive immunoglobulins and immunoglobulin-like molecules, we utilized 3' RACE (rapid amplification of cDNA ends) and a highly conserved constant region consensus amino acid sequence to isolate a new immunoglobulin class from the sandbar shark Carcharhinus plumbeus. The immunoglobulin, termed IgW, in its secreted form consists of 782 amino acids and is expressed in both the thymus and the spleen. The molecule overall most closely resembles mu chains of the skate and human and a new putative antigen binding molecule isolated from the nurse shark (NAR). The full-length IgW chain has a variable region resembling human and shark heavy-chain (VH) sequences and a novel joining segment containing the WGXGT motif characteristic of H chains. However, unlike any other H-chain-type molecule, it contains six constant (C) domains. The first C domain contains the cysteine residue characteristic of C mu1 that would allow dimerization with a light (L) chain. The fourth and sixth domains also contain comparable cysteines that would enable dimerization with other H chains or homodimerization. Comparison of the sequences of IgW V and C domains shows homology greater than that found in comparisons among VH and C mu or VL, or CL thereby suggesting that IgW may retain features of the primordial immunoglobulin in evolution.

Magnetic Field Diagnostics and Spatio-Temporal Variability of the Solar Transition Region

Science.gov (United States)

Peter, H.

2013-12-01

Magnetic field diagnostics of the transition region from the chromosphere to the corona faces us with the problem that one has to apply extreme-ultraviolet (EUV) spectro-polarimetry. While for the coronal diagnostics techniques already exist in the form of infrared coronagraphy above the limb and radio observations on the disk, one has to investigate EUV observations for the transition region. However, so far the success of such observations has been limited, but various current projects aim to obtain spectro-polarimetric data in the extreme UV in the near future. Therefore it is timely to study the polarimetric signals we can expect from these observations through realistic forward modeling. We employ a 3D magneto-hydrodynamic (MHD) forward model of the solar corona and synthesize the Stokes I and Stokes V profiles of C iv (1548 Å). A signal well above 0.001 in Stokes V can be expected even if one integrates for several minutes to reach the required signal-to-noise ratio, and despite the rapidly changing intensity in the model (just as in observations). This variability of the intensity is often used as an argument against transition region magnetic diagnostics, which requires exposure times of minutes. However, the magnetic field is evolving much slower than the intensity, and therefore the degree of (circular) polarization remains rather constant when one integrates in time. Our study shows that it is possible to measure the transition region magnetic field if a polarimetric accuracy on the order of 0.001 can be reached, which we can expect from planned instrumentation.

Source, variability, and transformation of nitrate in a regional karst aquifer: Edwards aquifer, central Texas.

Science.gov (United States)

Musgrove, MaryLynn; Opsahl, Stephen P.; Mahler, Barbara J.; Herrington, Chris; Sample, Thomas; Banta, John

2016-01-01

Many karst regions are undergoing rapid population growth and expansion of urban land accompanied by increases in wastewater generation and changing patterns of nitrate (NO3−) loading to surface and groundwater. We investigate variability and sources of NO3− in a regional karst aquifer system, the Edwards aquifer of central Texas. Samples from streams recharging the aquifer, groundwater wells, and springs were collected during 2008–12 from the Barton Springs and San Antonio segments of the Edwards aquifer and analyzed for nitrogen (N) species concentrations and NO3− stable isotopes (δ15N and δ18O). These data were augmented by historical data collected from 1937 to 2007. NO3− concentrations and discharge data indicate that short-term variability (days to months) in groundwater NO3− concentrations in the Barton Springs segment is controlled by occurrence of individual storms and multi-annual wet-dry cycles, whereas the lack of short-term variability in groundwater in the San Antonio segment indicates the dominance of transport along regional flow paths. In both segments, longer-term increases (years to decades) in NO3− concentrations cannot be attributed to hydrologic conditions; rather, isotopic ratios and land-use change indicate that septic systems and land application of treated wastewater might be the source of increased loading of NO3−. These results highlight the vulnerability of karst aquifers to NO3− contamination from urban wastewater. An analysis of N-species loading in recharge and discharge for the Barton Springs segment during 2008–10 indicates an overall mass balance in total N, but recharge contains higher concentrations of organic N and lower concentrations of NO3−than does discharge, consistent with nitrification of organic N within the aquifer and consumption of dissolved oxygen. This study demonstrates that subaqueous nitrification of organic N in the aquifer, as opposed to in soils, might be a previously

Decomposing global crop yield variability

Science.gov (United States)

Ben-Ari, Tamara; Makowski, David

2014-11-01

Recent food crises have highlighted the need to better understand the between-year variability of agricultural production. Although increasing future production seems necessary, the globalization of commodity markets suggests that the food system would also benefit from enhanced supplies stability through a reduction in the year-to-year variability. Here, we develop an analytical expression decomposing global crop yield interannual variability into three informative components that quantify how evenly are croplands distributed in the world, the proportion of cultivated areas allocated to regions of above or below average variability and the covariation between yields in distinct world regions. This decomposition is used to identify drivers of interannual yield variations for four major crops (i.e., maize, rice, soybean and wheat) over the period 1961-2012. We show that maize production is fairly spread but marked by one prominent region with high levels of crop yield interannual variability (which encompasses the North American corn belt in the USA, and Canada). In contrast, global rice yields have a small variability because, although spatially concentrated, much of the production is located in regions of below-average variability (i.e., South, Eastern and South Eastern Asia). Because of these contrasted land use allocations, an even cultivated land distribution across regions would reduce global maize yield variance, but increase the variance of global yield rice. Intermediate results are obtained for soybean and wheat for which croplands are mainly located in regions with close-to-average variability. At the scale of large world regions, we find that covariances of regional yields have a negligible contribution to global yield variance. The proposed decomposition could be applied at any spatial and time scales, including the yearly time step. By addressing global crop production stability (or lack thereof) our results contribute to the understanding of a key

Spatial and temporal variability of rainfall in the Tocantins-Araguaia hydrographic region

Directory of Open Access Journals (Sweden)

Glauber Epifanio Loureiro

2015-01-01

Full Text Available Current paper examines the space-time dynamics of yearly rainfall of the Tocantins-Araguaia Hydrographic Region (TAHR, foregrounded on rainfall volume from isohyet maps and interpolated by Kriging geo-statistical method.  Rainfall space dynamics was undertaken by the analysis of descriptive statistics, Index of Meteorological Irregularity (IMI and Variation Coefficient. Temporal dynamics was analyzed through the distribution of total annual volume precipitation for each TAHR sub-basin by the Standardized Anomaly Index, trend and magnitude test provided by Mann-Kendall and Sen Tests. Results correlated with meteorological anomalies of the Atlantic (Dipole and Pacific (ENOS Oceans show a highly heterogeneous rainfall behavior with temporal variability. Or rather, a decrease of rainfall extensiveness during years of intense meteorological anomaly with a rainfall increase south of the High Tocantins and Araguaia sub-basins and a decrease of rainfall in the Lower Tocantins sub-basin, with El Niño features. Although the Mann-Kendall test does not show statistically a significant trend for rainfall in the TAHR region, Sen’s estimator reveals a decrease in rainfall in the High Tocantins (-1.24 km³ year-1 and Araguaia (-1.13 km³ year-1 sub-basins and a rainfall increase in the Lower Tocantins sub-basin (0.53 km³ year-1 and in the TAHR region (-1.5 km³ year-1.

Contributions of internal climate variability to mitigation of projected future regional sea level rise

Science.gov (United States)

Hu, A.; Bates, S. C.

2017-12-01

Observations indicate that the global mean surface temperature is rising, so does the global mean sea level. Sea level rise (SLR) can impose significant impacts on island and coastal communities, especially when SLR is compounded with storm surges. Here, via analyzing results from two sets of ensemble simulations from the Community Earth System Model version 1, we investigate how the potential SLR benefits through mitigating the future emission scenarios from business as usual to a mild-mitigation over the 21st Century would be affected by internal climate variability. Results show that there is almost no SLR benefit in the near term due to the large SLR variability due to the internal ocean dynamics. However, toward the end of the 21st century, the SLR benefit can be as much as a 26±1% reduction of the global mean SLR due to seawater thermal expansion. Regionally, the benefits from this mitigation for both near and long terms are heterogeneous. They vary from just a 11±5% SLR reduction in Melbourne, Australia to a 35±6% reduction in London. The processes contributing to these regional differences are the coupling of the wind-driven ocean circulation with the decadal scale sea surface temperature mode in the Pacific and Southern Oceans, and the changes of the thermohaline circulation and the mid-latitude air-sea coupling in the Atlantic.

Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions

International Nuclear Information System (INIS)

Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia

2013-01-01

16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.

Bifunctional Anti-Non-Amyloid Component α-Synuclein Nanobodies Are Protective In Situ.

Directory of Open Access Journals (Sweden)

David C Butler

Full Text Available Misfolding, abnormal accumulation, and secretion of α-Synuclein (α-Syn are closely associated with synucleinopathies, including Parkinson's disease (PD. VH14 is a human single domain intrabody selected against the non-amyloid component (NAC hydrophobic interaction region of α-Syn, which is critical for initial aggregation. Using neuronal cell lines, we show that as a bifunctional nanobody fused to a proteasome targeting signal, VH14PEST can counteract heterologous proteostatic effects of mutant α-Syn on mutant huntingtin Exon1 and protect against α-Syn toxicity using propidium iodide or Annexin V readouts. We compared this anti-NAC candidate to NbSyn87, which binds to the C-terminus of α-Syn. NbSyn87PEST degrades α-Syn as well or better than VH14PEST. However, while both candidates reduced toxicity, VH14PEST appears more effective in both proteostatic stress and toxicity assays. These results show that the approach of reducing intracellular monomeric targets with novel antibody engineering technology should allow in vivo modulation of proteostatic pathologies.

Antarctic climate variability on regional and continental scales over the last 2000 years

Directory of Open Access Journals (Sweden)

B. Stenni

2017-11-01

Full Text Available Climate trends in the Antarctic region remain poorly characterized, owing to the brevity and scarcity of direct climate observations and the large magnitude of interannual to decadal-scale climate variability. Here, within the framework of the PAGES Antarctica2k working group, we build an enlarged database of ice core water stable isotope records from Antarctica, consisting of 112 records. We produce both unweighted and weighted isotopic (δ18O composites and temperature reconstructions since 0 CE, binned at 5- and 10-year resolution, for seven climatically distinct regions covering the Antarctic continent. Following earlier work of the Antarctica2k working group, we also produce composites and reconstructions for the broader regions of East Antarctica, West Antarctica and the whole continent. We use three methods for our temperature reconstructions: (i a temperature scaling based on the δ18O–temperature relationship output from an ECHAM5-wiso model simulation nudged to ERA-Interim atmospheric reanalyses from 1979 to 2013, and adjusted for the West Antarctic Ice Sheet region to borehole temperature data, (ii a temperature scaling of the isotopic normalized anomalies to the variance of the regional reanalysis temperature and (iii a composite-plus-scaling approach used in a previous continent-scale reconstruction of Antarctic temperature since 1 CE but applied to the new Antarctic ice core database. Our new reconstructions confirm a significant cooling trend from 0 to 1900 CE across all Antarctic regions where records extend back into the 1st millennium, with the exception of the Wilkes Land coast and Weddell Sea coast regions. Within this long-term cooling trend from 0 to 1900 CE, we find that the warmest period occurs between 300 and 1000 CE, and the coldest interval occurs from 1200 to 1900 CE. Since 1900 CE, significant warming trends are identified for the West Antarctic Ice Sheet, the Dronning Maud Land coast and the

Spatiotemporal Variability and Covariability of Temperature, Precipitation, Soil Moisture, and Vegetation in North America for Regional Climate Model Applications

Science.gov (United States)

Castro, C. L.; Beltran-Przekurat, A. B.; Pielke, R. A.

2007-05-01

Previous work has established that the dominant modes of Pacific SSTs influence the summer climate of North America through large-scale forcing, and this effect is most pronounced during the early part of the season. It is hypothesized, then, that land surface influences become more dominant in the latter part of the season as remote teleconnection influences diminish. As a first step toward investigation of this hypothesis in a regional climate model (RCM) framework, the statistically signficant spatiotemporal patterns of variability and covariability in North American precipitation (specified by the standardized precipitation index, or SPI), soil moisture, and vegetation are determined for timescales from a month to six months. To specify these respective data we use: CPC gauge- derived precipitation (1950-2000), Variable Infiltration Capacity (VIC) Model and NOAH Model NLDAS soil moisture and temperature, and the Global Inventory Modeling and Mapping Studies Normalized Difference Vegetation Index (GIMMS-NDVI). The principal statistical tool used is multiple taper frequency singular value decomposition (MTM-SVD), and this is supplemented by wavelet analysis for specific areas of interest. The significant interannual variability in all of these data occur at a timescale of about 7 to 9 years and appears to be the integrated effect of remote SST forcing from the Pacific. Considering the entire year, the spatial pattern for precipitation resembles the typical ENSO winter signature. If the summer season is considered seperately, the out of phase relationship between precipitation anomalies in the central U.S. and core monsoon region is apparent. The largest soil moisture anomalies occur in the central U.S., since precipitation in this region has a consistent relationship to Pacific SSTs for the entire year. This helps to explain the approximately 20 year periodicity in drought conditions there. Unlike soil moisture, the largest anomalies in vegetation occur in the

VH-92A Presidential Helicopter (VH-92A)

Science.gov (United States)

2015-12-01

provide safe, reliable, and timely transportation for the President, Vice President, Foreign Heads of State, and other official parties as directed by...the Director of the White House Military Office. Presidential helicopter transportation requirements are executed by Marine Helicopter Squadron One...Review Jul 2016 Jul 2016 Jan 2017 Jul 2016 Milestone C Jan 2019 Jan 2019 Jul 2019 Jan 2019 IOT &E Complete Mar 2020 Mar 2020 Sep 2020 Mar 2020 IOC Jul

Source, variability, and transformation of nitrate in a regional karst aquifer: Edwards aquifer, central Texas

Energy Technology Data Exchange (ETDEWEB)

Musgrove, M., E-mail: mmusgrov@usgs.gov [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Opsahl, S.P. [U.S. Geological Survey, 5563 DeZavala, Ste. 290, San Antonio, TX 78249 (United States); Mahler, B.J. [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Herrington, C. [City of Austin Watershed Protection Department, Austin, TX 78704 (United States); Sample, T.L. [U.S. Geological Survey, 19241 David Memorial Dr., Ste. 180, Conroe, TX 77385 (United States); Banta, J.R. [U.S. Geological Survey, 5563 DeZavala, Ste. 290, San Antonio, TX 78249 (United States)

2016-10-15

Many karst regions are undergoing rapid population growth and expansion of urban land accompanied by increases in wastewater generation and changing patterns of nitrate (NO{sub 3}{sup −}) loading to surface and groundwater. We investigate variability and sources of NO{sub 3}{sup −} in a regional karst aquifer system, the Edwards aquifer of central Texas. Samples from streams recharging the aquifer, groundwater wells, and springs were collected during 2008–12 from the Barton Springs and San Antonio segments of the Edwards aquifer and analyzed for nitrogen (N) species concentrations and NO{sub 3}{sup −} stable isotopes (δ{sup 15}N and δ{sup 18}O). These data were augmented by historical data collected from 1937 to 2007. NO{sub 3}{sup −} concentrations and discharge data indicate that short-term variability (days to months) in groundwater NO{sub 3}{sup −} concentrations in the Barton Springs segment is controlled by occurrence of individual storms and multi-annual wet-dry cycles, whereas the lack of short-term variability in groundwater in the San Antonio segment indicates the dominance of transport along regional flow paths. In both segments, longer-term increases (years to decades) in NO{sub 3}{sup −} concentrations cannot be attributed to hydrologic conditions; rather, isotopic ratios and land-use change indicate that septic systems and land application of treated wastewater might be the source of increased loading of NO{sub 3}{sup −}. These results highlight the vulnerability of karst aquifers to NO{sub 3}{sup −} contamination from urban wastewater. An analysis of N-species loading in recharge and discharge for the Barton Springs segment during 2008–10 indicates an overall mass balance in total N, but recharge contains higher concentrations of organic N and lower concentrations of NO{sub 3}{sup −} than does discharge, consistent with nitrification of organic N within the aquifer and consumption of dissolved oxygen. This study demonstrates

Source, variability, and transformation of nitrate in a regional karst aquifer: Edwards aquifer, central Texas

International Nuclear Information System (INIS)

Musgrove, M.; Opsahl, S.P.; Mahler, B.J.; Herrington, C.; Sample, T.L.; Banta, J.R.

2016-01-01

Many karst regions are undergoing rapid population growth and expansion of urban land accompanied by increases in wastewater generation and changing patterns of nitrate (NO 3 − ) loading to surface and groundwater. We investigate variability and sources of NO 3 − in a regional karst aquifer system, the Edwards aquifer of central Texas. Samples from streams recharging the aquifer, groundwater wells, and springs were collected during 2008–12 from the Barton Springs and San Antonio segments of the Edwards aquifer and analyzed for nitrogen (N) species concentrations and NO 3 − stable isotopes (δ 15 N and δ 18 O). These data were augmented by historical data collected from 1937 to 2007. NO 3 − concentrations and discharge data indicate that short-term variability (days to months) in groundwater NO 3 − concentrations in the Barton Springs segment is controlled by occurrence of individual storms and multi-annual wet-dry cycles, whereas the lack of short-term variability in groundwater in the San Antonio segment indicates the dominance of transport along regional flow paths. In both segments, longer-term increases (years to decades) in NO 3 − concentrations cannot be attributed to hydrologic conditions; rather, isotopic ratios and land-use change indicate that septic systems and land application of treated wastewater might be the source of increased loading of NO 3 − . These results highlight the vulnerability of karst aquifers to NO 3 − contamination from urban wastewater. An analysis of N-species loading in recharge and discharge for the Barton Springs segment during 2008–10 indicates an overall mass balance in total N, but recharge contains higher concentrations of organic N and lower concentrations of NO 3 − than does discharge, consistent with nitrification of organic N within the aquifer and consumption of dissolved oxygen. This study demonstrates that subaqueous nitrification of organic N in the aquifer, as opposed to in soils, might be a

Coupled ocean-atmosphere surface variability and its climate impacts in the tropical Atlantic region

Science.gov (United States)

Fontaine, B.; Janicot, Serge; Roucou, P.

This study examines time evolution and statistical relationships involving the two leading ocean-atmosphere coupled modes of variability in the tropical Atlantic and some climate anomalies over the tropical 120°W-60°W region using selected historical files (75-y near global SSTs and precipitation over land), more recent observed data (30-y SST and pseudo wind stress in the tropical Atlantic) and reanalyses from the US National Centers for Environmental Prediction (NCEP/NCAR) reanalysis System on the period 1968-1997: surface air temperature, sea level pressure, moist static energy content at 850 hPa, precipitable water and precipitation. The first coupled mode detected through singular value decomposition of the SST and pseudo wind-stress data over the tropical Atlantic (30°N-20°S) expresses a modulation in the thermal transequatorial gradient of SST anomalies conducted by one month leading wind-stress anomalies mainly in the tropical north Atlantic during northern winter and fall. It features a slight dipole structure in the meridional plane. Its time variability is dominated by a quasi-decadal signal well observed in the last 20-30 ys and, when projected over longer-term SST data, in the 1920s and 1930s but with shorter periods. The second coupled mode is more confined to the south-equatorial tropical Atlantic in the northern summer and explains considerably less wind-stress/SST cross-covariance. Its time series features an interannual variability dominated by shorter frequencies with increased variance in the 1960s and 1970s before 1977. Correlations between these modes and the ENSO-like Nino3 index lead to decreasing amplitude of thermal anomalies in the tropical Atlantic during warm episodes in the Pacific. This could explain the nonstationarity of meridional anomaly gradients on seasonal and interannual time scales. Overall the relationships between the oceanic component of the coupled modes and the climate anomaly patterns denote thermodynamical

Observed Regional Climate Variability during the Last 50 Years in Reindeer Herding Cooperatives of Finnish Fell Lapland

Directory of Open Access Journals (Sweden)

Élise Lépy

2017-10-01

Full Text Available In Finnish Lapland, reindeer herders’ activity is strongly dependent on the surrounding natural environment, which is directly exposed to environmental changes and climatic variations. By assessing whether there is any evidence of change in climate in Fell Lapland over the last 50 years, this paper attempts to link global climatic trends with local conditions and respond to the need of information at the local level. It aims at assessing the changes in temperature, precipitation and snow cover at a regional and local scale, as well as determining the climatic trends for the period 1960–2011. Statistical methods were used to conduct analyses of the regional homogeneity, the annual and seasonal variability, and the cold intensity. The results show that the regional climate is not homogeneous and differences exist between locations. Nevertheless, it can be concluded that, in general, a warming trend is discernible for the period 1960–2011, frost and thaw cycles slightly increase, and variations in mean temperatures are more important in the winter. Precipitation is more variable according to the site but, in general, precipitation is increasing with time, especially in the winter, and the snow cover does not seem to contain any discernible trend.

Efficient visibility-driven medical image visualisation via adaptive binned visibility histogram.

Science.gov (United States)

Jung, Younhyun; Kim, Jinman; Kumar, Ashnil; Feng, David Dagan; Fulham, Michael

2016-07-01

'Visibility' is a fundamental optical property that represents the observable, by users, proportion of the voxels in a volume during interactive volume rendering. The manipulation of this 'visibility' improves the volume rendering processes; for instance by ensuring the visibility of regions of interest (ROIs) or by guiding the identification of an optimal rendering view-point. The construction of visibility histograms (VHs), which represent the distribution of all the visibility of all voxels in the rendered volume, enables users to explore the volume with real-time feedback about occlusion patterns among spatially related structures during volume rendering manipulations. Volume rendered medical images have been a primary beneficiary of VH given the need to ensure that specific ROIs are visible relative to the surrounding structures, e.g. the visualisation of tumours that may otherwise be occluded by neighbouring structures. VH construction and its subsequent manipulations, however, are computationally expensive due to the histogram binning of the visibilities. This limits the real-time application of VH to medical images that have large intensity ranges and volume dimensions and require a large number of histogram bins. In this study, we introduce an efficient adaptive binned visibility histogram (AB-VH) in which a smaller number of histogram bins are used to represent the visibility distribution of the full VH. We adaptively bin medical images by using a cluster analysis algorithm that groups the voxels according to their intensity similarities into a smaller subset of bins while preserving the distribution of the intensity range of the original images. We increase efficiency by exploiting the parallel computation and multiple render targets (MRT) extension of the modern graphical processing units (GPUs) and this enables efficient computation of the histogram. We show the application of our method to single-modality computed tomography (CT), magnetic resonance

Using a predictive model to evaluate spatiotemporal variability in streamflow permanence across the Pacific Northwest region

Science.gov (United States)

Jaeger, K. L.

2017-12-01

The U.S. Geological Survey (USGS) has developed the PRObability Of Streamflow PERmanence (PROSPER) model, a GIS-based empirical model that provides predictions of the annual probability of a stream channel having year-round flow (Streamflow permanence probability; SPP) for any unregulated and minimally-impaired stream channel in the Pacific Northwest (Washington, Oregon, Idaho, western Montana). The model provides annual predictions for 2004-2016 at a 30-m spatial resolution based on monthly or annually updated values of climatic conditions, and static physiographic variables associated with the upstream basin. Prediction locations correspond to the channel network consistent with the National Hydrography Dataset stream grid and are publicly available through the USGS StreamStats platform (https://water.usgs.gov/osw/streamstats/). In snowmelt-driven systems, the most informative predictor variable was mean upstream snow water equivalent on May 1, which highlights the influence of late spring snow cover for supporting streamflow in mountain river networks. In non-snowmelt-driven systems, the most informative variable was mean annual precipitation. Streamflow permanence probabilities varied across the study area by geography and from year-to-year. Notably lower SPP corresponded to the climatically drier subregions of the study area. Higher SPP were concentrated in coastal and higher elevation mountain regions. In addition, SPP appeared to trend with average hydroclimatic conditions, which were also geographically coherent. The year-to-year variability lends support for the growing recognition of the spatiotemporal dynamism of streamflow permanence. An analysis of three focus basins located in contrasting geographical and hydroclimatic settings demonstrates differences in the sensitivity of streamflow permanence to antecedent climate conditions as a function of geography. Consequently, results suggest that PROSPER model can be a useful tool to evaluate regions of the

Prevalence and variability of use of home mechanical ventilators, positive airway pressure and oxygen devices in the Lombardy region, Italy.

Science.gov (United States)

Vitacca, Michele; Barbano, Luca; Colombo, Daniele; Leoni, Olivia; Guffanti, Enrico

2018-01-29

Few studies have analyzed the prevalence and accessibility of home mechanical ventilation (HMV) in Italy. We aimed to investigate the prevalence and prescription variability of HMV as well as of long-term oxygen therapy (LTOT) and continuous positive airway pressure (CPAP), in the Lombardy Region. Prescribing rates of HMV (both noninvasive and tracheostomies), CPAP (auto-CPAP, CPAP/other sleep machines) and LTOT (liquid-O2, O2-gas, concentrators) in the 15 Local Healthcare districts of Lombardy were gathered from billing data for 2012 and compared. Crude rates (per 100,000 population) and rates for the different healthcare districts were calculated. In 2012, 6325 patients were on HMV (crude prescription rate: 63/100,000) with a high variation across districts (8/100,000 in Milano 1 vs 150/100,000 in Pavia). There were 14,237 patients on CPAP (crude prescription rate: 142/100,000; CPAP/other sleep machines 95.3% vs auto-CPAP 4.7%) with also high intra-regional variation (56/100,000 in Mantova vs. 260/100,000 in Pavia). There were 21,826 patients on LTOT (prescription rate: 217/100,000 rate; liquid-O2 94%, O2-gas 2.08%, O2-concentrators 3.8%), with again high intra-regional variation (100/100,000 in Bergamo vs 410/100,000 in Valle Camonica). The crude rate of HMV prescriptions in Lombardy is very high, with a high intra-regional variability in prescribing HMV, LTOT and CPAP which is partly explainable by the accessibility to specialist centers with HMV/sleep-study facilities. Analysis of administrative data and variability mapping can help identify areas of reduced access for an improved standardization of services. An audit among Health Payer and prescribers to interpret the described huge variability could be welcomed.

In situ study of the impact of inter- and intra-reader variability on region of interest (ROI) analysis in preclinical molecular imaging.

Science.gov (United States)

Habte, Frezghi; Budhiraja, Shradha; Keren, Shay; Doyle, Timothy C; Levin, Craig S; Paik, David S

2013-01-01

We estimated reader-dependent variability of region of interest (ROI) analysis and evaluated its impact on preclinical quantitative molecular imaging. To estimate reader variability, we used five independent image datasets acquired each using microPET and multispectral fluorescence imaging (MSFI). We also selected ten experienced researchers who utilize molecular imaging in the same environment that they typically perform their own studies. Nine investigators blinded to the data type completed the ROI analysis by drawing ROIs manually that delineate the tumor regions to the best of their knowledge and repeated the measurements three times, non-consecutively. Extracted mean intensities of voxels within each ROI are used to compute the coefficient of variation (CV) and characterize the inter- and intra-reader variability. The impact of variability was assessed through random samples iterated from normal distributions for control and experimental groups on hypothesis testing and computing statistical power by varying subject size, measured difference between groups and CV. The results indicate that inter-reader variability was 22.5% for microPET and 72.2% for MSFI. Additionally, mean intra-reader variability was 10.1% for microPET and 26.4% for MSFI. Repeated statistical testing showed that a total variability of CV variability has been observed mainly due to differences in the ROI placement and geometry drawn between readers, which may adversely affect statistical power and erroneously lead to negative study outcomes.

Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

Directory of Open Access Journals (Sweden)

Dongkyoon Kim

2017-12-01

Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.

Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

Science.gov (United States)

Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

Use of variability modes to evaluate AR4 climate models over the Euro-Atlantic region

Energy Technology Data Exchange (ETDEWEB)

Casado, M.J.; Pastor, M.A. [Agencia Estatal de Meteorologia (AEMET), Madrid (Spain)

2012-01-15

This paper analyzes the ability of the multi-model simulations from the Fourth Assessment Report of the Intergovernmental Panel on Climate Change (IPCC) to simulate the main leading modes of variability over the Euro-Atlantic region in winter: the North-Atlantic Oscillation (NAO), the Scandinavian mode (SCAND), the East/Atlantic Oscillation (EA) and the East Atlantic/Western Russia mode (EA/WR). These modes of variability have been evaluated both spatially, by analyzing the intensity and location of their anomaly centres, as well as temporally, by focusing on the probability density functions and e-folding time scales. The choice of variability modes as a tool for climate model assessment can be justified by the fact that modes of variability determine local climatic conditions and their likely change may have important implications for future climate changes. It is found that all the models considered are able to simulate reasonably well these four variability modes, the SCAND being the mode which is best spatially simulated. From a temporal point of view the NAO and SCAND modes are the best simulated. UKMO-HadGEM1 and CGCM3.1(T63) are the models best at reproducing spatial characteristics, whereas CCSM3 and CGCM3.1(T63) are the best ones with regard to the temporal features. GISS-AOM is the model showing the worst performance, in terms of both spatial and temporal features. These results may bring new insight into the selection and use of specific models to simulate Euro-Atlantic climate, with some models being clearly more successful in simulating patterns of temporal and spatial variability than others. (orig.)

Delayed Gadolinium-Enhanced MRI of Cartilage (dGEMRIC): Intra- and Interobserver Variability in Standardized Drawing of Regions of Interest

International Nuclear Information System (INIS)

Tiderius, C.J.; Tjoernstrand, J.; Aakeson, P.; Soedersten, K.; Dahlberg, L.; Leander, P.

2004-01-01

Purpose: To establish the reproducibility of a standardized region of interest (ROI) drawing procedure in delayed gadolinium-enhanced magnetic resonance imaging (MRI) of cartilage (dGEMRIC). Material and Methods: A large ROI in lateral and medial femoral weight-bearing cartilage was drawn in images of 12 healthy male volunteers by 6 investigators with different skills in MRI. The procedure was done twice, with a 1-week interval. Calculated T1-values were evaluated for intra- and interobserver variability. Results: The mean interobserver variability for both compartments ranged between 1.3% and 2.3% for the 6 different investigators without correlation to their experience in MRI. Post-contrast intra-observer variability was low in both the lateral and the medial femoral cartilage, 2.6% and 1.5%, respectively. The larger variability in lateral than in medial cartilage was related to slightly longer and thinner ROIs. Conclusion: Intra-observer variability and interobserver variability are both low when a large standardized ROI is used in dGEMRIC. The experience of the investigator does not affect the variability, which further supports a clinical applicability of the method

Role of climate variability in the heatstroke death rates of Kanto region in Japan

Science.gov (United States)

Akihiko, Takaya; Morioka, Yushi; Behera, Swadhin K.

2014-07-01

The death toll by heatstroke in Japan, especially in Kanto region, has sharply increased since 1994 together with large interannual variability. The surface air temperature and humidity observed during boreal summers of 1980-2010 were examined to understand the role of climate in the death toll. The extremely hot days, when the daily maximum temperature exceeds 35°C, are more strongly associated with the death toll than the conventional Wet Bulb Globe Temperature index. The extremely hot days tend to be associated with El Niño/Southern Oscillation or the Indian Ocean Dipole, suggesting a potential link with tropical climate variability to the heatstroke related deaths. Also, the influence of these climate modes on the death toll has strengthened since 1994 probably related to global warming. It is possible to develop early warning systems based on seasonal climate predictions since recent climate models show excellent predictability skills for those climate modes.

Characterization of Campylobacter jejuni applying flaA short variable region sequencing, multilocus sequencing and Fourier transform infrared spectroscopy

DEFF Research Database (Denmark)

Josefsen, Mathilde Hartmann; Bonnichsen, Lise; Larsson, Jonas

flaA short variable region sequencing and phenetic Fourier transform infrared (FTIR) spectroscopy was applied on a collection of 102 Campylobacter jejuni isolated from continuous sampling of organic, free range geese and chickens. FTIR has been shown to serve as a valuable tool in typing...

Viral hepatitis in Latin America and the Caribbean: a public health challenge

Directory of Open Access Journals (Sweden)

Núria Díez-Padrisa

2013-10-01

Full Text Available Viral hepatitis (VH is an emergent concern in public health agendas worldwide. More than one million people die annually from hepatitis and 57% and 78% of global cirrhosis and hepatocellular carcinoma cases, respectively, are caused by VH. The burden of disease caused by hepatitis in Latin America and the Caribbean (LAC is high. Data on hepatitis has been collected in several countries, but more accurate and comparable studies are needed. Hepatitis B vaccination and screening of donated blood are routine practices in the region. However, integrated policies covering prevention and control of disease caused by all types of hepatitis viruses are scarce. Existing preventive measures need to be reinforced. Attention must be paid to at-risk populations, awareness campaigns, and water and food safety. Affordable access to diagnosis and treatment, population screening, referral to health services and monitoring of positive cases are among the main challenges currently posed by VH in LAC. The World Health Organization framework and Pan American Health Organization regional strategy, defined in response to resolution WHA63.18 of the World Health Assembly, may help to overcome these difficulties. Successful experiences in the fight against hepatitis in some LAC countries may also provide very interesting solutions for the region.

The Tokar Gap Jet: Regional Circulation, Diurnal Variability, and Moisture Transport Based on Numerical Simulations

KAUST Repository

Davis, Shannon R.

2015-05-14

The structure, variability, and regional connectivity of the Tokar Gap jet (TGJ) are described using WRF Model analyses and supporting atmospheric datasets from the East African–Red Sea–Arabian Peninsula (EARSAP) region during summer 2008. Sources of the TGJ’s unique quasi-diurnal nature and association with atypically high atmospheric moisture transport are traced back to larger-scale atmospheric dynamics influencing its forcing. These include seasonal shifts in the intertropical convergence zone (ITCZ), variability of the monsoon and North African wind regimes, and ties to other orographic flow patterns. Strong modulation of the TGJ by regional processes such as the desert heating cycle, wind convergence at the ITCZ surface front, and the local land–sea breeze cycle are described. Two case studies present the interplay of these influences in detail. The first of these was an “extreme” gap wind event on 12 July, in which horizontal velocities in the Tokar Gap exceeded 26 m s−1 and the flow from the jet extended the full width of the Red Sea basin. This event coincided with development of a large mesoscale convective complex (MCC) and precipitation at the entrance of the Tokar Gap as well as smaller gaps downstream along the Arabian Peninsula. More typical behavior of the TGJ during the 2008 summer is discussed using a second case study on 19 July. Downwind impact of the TGJ is evaluated using Lagrangian model trajectories and analysis of the lateral moisture fluxes (LMFs) during jet events. These results suggest means by which TGJ contributes to large LMFs and has potential bearing upon Sahelian rainfall and MCC development.

Observations of regional and local variability in the optical properties of maritime clouds

Energy Technology Data Exchange (ETDEWEB)

White, A.B. [Univ. of Colorado at Boulder/National Oceanic and Atmospheric Administration, Boulder, CO (United States); Fairall, C.W. [Environmental Technology Lab., Boulder, CO (United States)

1996-04-01

White and Fairall (1995) calculated the optical properties of the marine boundary layer (MBL) clouds observed during the Atlantic Stratocumulus Transition Experiment (ASTEX) and compared their results with the results obtained by Fairall et al. for the MBL clouds observed during the First International Satellite Climatology Program (ISSCP) Regional Experiment (FIRE). They found a factor of two difference in the optical depth versus liquid water relationship that applies to the clouds observed in each case. In the present study, we present evidence to support this difference. We also investigate the local variability exhibited in the ASTEX optical properties using measurements of the boundary layer aerosol concentration.

Local-scale models reveal ecological niche variability in amphibian and reptile communities from two contrasting biogeographic regions

Directory of Open Access Journals (Sweden)

Alberto Muñoz

2016-10-01

Full Text Available Ecological Niche Models (ENMs are widely used to describe how environmental factors influence species distribution. Modelling at a local scale, compared to a large scale within a high environmental gradient, can improve our understanding of ecological species niches. The main goal of this study is to assess and compare the contribution of environmental variables to amphibian and reptile ENMs in two Spanish national parks located in contrasting biogeographic regions, i.e., the Mediterranean and the Atlantic area. The ENMs were built with maximum entropy modelling using 11 environmental variables in each territory. The contributions of these variables to the models were analysed and classified using various statistical procedures (Mann–Whitney U tests, Principal Components Analysis and General Linear Models. Distance to the hydrological network was consistently the most relevant variable for both parks and taxonomic classes. Topographic variables (i.e., slope and altitude were the second most predictive variables, followed by climatic variables. Differences in variable contribution were observed between parks and taxonomic classes. Variables related to water availability had the larger contribution to the models in the Mediterranean park, while topography variables were decisive in the Atlantic park. Specific response curves to environmental variables were in accordance with the biogeographic affinity of species (Mediterranean and non-Mediterranean species and taxonomy (amphibians and reptiles. Interestingly, these results were observed for species located in both parks, particularly those situated at their range limits. Our findings show that ecological niche models built at local scale reveal differences in habitat preferences within a wide environmental gradient. Therefore, modelling at local scales rather than assuming large-scale models could be preferable for the establishment of conservation strategies for herptile species in natural

Local-scale models reveal ecological niche variability in amphibian and reptile communities from two contrasting biogeographic regions

Science.gov (United States)

Santos, Xavier; Felicísimo, Ángel M.

2016-01-01

Ecological Niche Models (ENMs) are widely used to describe how environmental factors influence species distribution. Modelling at a local scale, compared to a large scale within a high environmental gradient, can improve our understanding of ecological species niches. The main goal of this study is to assess and compare the contribution of environmental variables to amphibian and reptile ENMs in two Spanish national parks located in contrasting biogeographic regions, i.e., the Mediterranean and the Atlantic area. The ENMs were built with maximum entropy modelling using 11 environmental variables in each territory. The contributions of these variables to the models were analysed and classified using various statistical procedures (Mann–Whitney U tests, Principal Components Analysis and General Linear Models). Distance to the hydrological network was consistently the most relevant variable for both parks and taxonomic classes. Topographic variables (i.e., slope and altitude) were the second most predictive variables, followed by climatic variables. Differences in variable contribution were observed between parks and taxonomic classes. Variables related to water availability had the larger contribution to the models in the Mediterranean park, while topography variables were decisive in the Atlantic park. Specific response curves to environmental variables were in accordance with the biogeographic affinity of species (Mediterranean and non-Mediterranean species) and taxonomy (amphibians and reptiles). Interestingly, these results were observed for species located in both parks, particularly those situated at their range limits. Our findings show that ecological niche models built at local scale reveal differences in habitat preferences within a wide environmental gradient. Therefore, modelling at local scales rather than assuming large-scale models could be preferable for the establishment of conservation strategies for herptile species in natural parks. PMID

Accounting for CO2 variability over East Asia with a regional joint inversion system and its preliminary evaluation

Science.gov (United States)

Kou, Xingxia; Tian, Xiangjun; Zhang, Meigen; Peng, Zhen; Zhang, Xiaoling

2017-10-01

A regional surface carbon dioxide (CO2) flux inversion system, the Tan-Tracker-Region, was developed by incorporating an assimilation scheme into the Community Multiscale Air Quality (CMAQ) regional chemical transport model to resolve fine-scale CO2 variability over East Asia. The proper orthogonal decomposition-based ensemble four-dimensional variational data assimilation approach (POD-4DVar) is the core algorithm for the joint assimilation framework, and simultaneous assimilations of CO2 concentrations and surface CO2 fluxes are applied to help reduce the uncertainty in initial CO2 concentrations. A persistence dynamical model was developed to describe the evolution of the surface CO2 fluxes and help avoid the "signal-to-noise" problem; thus, CO2 fluxes could be estimated as a whole at the model grid scale, with better use of observation information. The performance of the regional inversion system was evaluated through a group of single-observation-based observing system simulation experiments (OSSEs). The results of the experiments suggest that a reliable performance of Tan-Tracker-Region is dependent on certain assimilation parameter choices, for example, an optimized window length of approximately 3 h, an ensemble size of approximately 100, and a covariance localization radius of approximately 320 km. This is probably due to the strong diurnal variation and spatial heterogeneity in the fine-scale CMAQ simulation, which could affect the performance of the regional inversion system. In addition, because all observations can be artificially obtained in OSSEs, the performance of Tan-Tracker-Region was further evaluated through different densities of the artificial observation network in different CO2 flux situations. The results indicate that more observation sites would be useful to systematically improve the estimation of CO2 concentration and flux in large areas over the model domain. The work presented here forms a foundation for future research in which a

Aerosol and rainfall variability over the Indian monsoon region: distributions, trends and coupling

Directory of Open Access Journals (Sweden)

R. Gautam

2009-09-01

Full Text Available Aerosol solar absorption over the Indian monsoon region has a potential role of modulating the monsoon circulation and rainfall distribution as suggested by recent studies based on model simulations. Prior to the onset of the monsoon, northern India is influenced by significant dust transport that constitutes the bulk of the regional aerosol loading over the Gangetic-Himalayan region. In this paper, a multi-sensor characterization of the increasing pre-monsoon aerosol loading over northern India, in terms of their spatial, temporal and vertical distribution is presented. Aerosol transport from the northwestern arid regions into the Indo-Gangetic Plains and over the foothills of the Himalayas is found to be vertically extended to elevated altitudes (up to 5 km as observed from the space-borne lidar measurements (CALIPSO. In relation with the enhanced pre-monsoon aerosol loading and the associated solar absorption effects on tropospheric temperature anomalies, this paper investigates the monsoon rainfall variability over India in recent past decades from an observational viewpoint. It is found that the early summer monsoon rainfall over India is on the rise since 1950s, as indicated by historical rainfall data, with over 20% increase for the period 1950–2004. This large sustained increase in the early summer rainfall is led by the observed strengthening of the pre-monsoon tropospheric land-sea thermal gradient over the Indian monsoon region as indicated by microwave satellite measurements (MSU of tropospheric temperatures from 1979–2007. Combined analysis of changes in tropospheric temperatures and summer monsoon rainfall in the past three decades, suggest a future possibility of an emerging rainfall pattern of a wetter monsoon over South Asia in early summer followed by a drier period.

Casscf/ci Calculations for First Row Transition Metal Hydrides - the TIH(4-PHI), VH(5-DELTA), CRH(6-SIGMA-PLUS), MNH(7-SIGMA-PLUS), FEH(4,6-DELTA) and NIH(2-DELTA) States

Science.gov (United States)

Walch, S. P.; Bauschlicher, C. W., Jr.

1983-04-01

Calculations are performed for the predicted ground states of TiH(4-phi), VH(5-delta), CrH(6-sigma-plus), MnH(7-sigma-plus), Fett(4,6-delta) and NiH(2-delta). For FeH both the 6-delta and 4-delta states are studied, since both are likely candidates for the ground state. The ground state symmetries are predicted based on a combination of atomic coupling arguments and coupling of 4s(2)3d(n) and 4s(1)3d(n+1) terms in the molecular system. Electron correlation is included by a CASSCF/CI (SD) treatment. The CASSCF includes near-degeneracy effects, while correlation of the 3d electrons in included at the CI level.

Continental and Marine Environmental changes in Europe induced by Global Climate variability and Regional Paleogeography Changes

OpenAIRE

Popescu , Speranta - Maria

2008-01-01

version originale; My PhD and post-doctorate researches have focused on paleoclimatic, paleogeographical and paleoenvironmental reconstruction of the Mediterranean Basin and its adjacent seas (i.e. the residual former Paratethys) since 11 Ma. During this time-interval the Mediterranean marine and continental environments were affected by significant paleogeographic changes, forced by global climate and sea-level variability, plate tectonics and regional uplift of Alps s.l. and Carpathians. Tw...

Tidal and sub-tidal sea level variability at the northern shelf of the Brazilian Northeast Region.

Science.gov (United States)

Frota, Felipe F; Truccolo, Eliane C; Schettini, Carlos A F

2016-09-01

A characterization of the sea level variability at tidal and sub-tidal frequencies at the northern shore of the Brazilian Northeast shelf for the period 2009-2011 is presented. The sea level data used was obtained from the Permanent Geodetic Tide Network from the Brazilian Institute of Geography and Statistics for the Fortaleza gauge station. Local wind data was also used to assess its effects on the low-frequency sea level variability. The variability of the sea level was investigated by classical harmonic analysis and by morphology assessment over the tidal signal. The low frequencies were obtained by low-pass filtering. The tidal range oscillated with the highest value of 3.3 m during the equinox and the lowest value of 0.7 m during the solstice. Differences between the spring and neap tides were as high as 1 m. A total of 59 tidal constituents were obtained from harmonic analysis, and the regional tide was classified as semi-diurnal pure with a form number of 0.11. An assessment of the monthly variability of the main tidal constituents (M2, S2, N2, O1, and K1) indicated that the main semi-diurnal solar S2 presented the highest variability, ranging from 0.21 to 0.41 m; it was the main element altering the form number through the years. The low frequency sea-level variability is negligible, although there is a persistent signal with an energy peak in the 10-15 day period, and it cannot be explained by the effects of local winds.

Late Holocene climate variability in the southwestern Mediterranean region: an integrated marine and terrestrial geochemical approach

Directory of Open Access Journals (Sweden)

C. Martín-Puertas

2010-12-01

Full Text Available A combination of marine (Alboran Sea cores, ODP 976 and TTR 300 G and terrestrial (Zoñar Lake, Andalucia, Spain geochemical proxies provides a high-resolution reconstruction of climate variability and human influence in the southwestern Mediterranean region for the last 4000 years at inter-centennial resolution. Proxies respond to changes in precipitation rather than temperature alone. Our combined terrestrial and marine archive documents a succession of dry and wet periods coherent with the North Atlantic climate signal. A dry period occurred prior to 2.7 cal ka BP – synchronously to the global aridity crisis of the third-millennium BC – and during the Medieval Climate Anomaly (1.4–0.7 cal ka BP. Wetter conditions prevailed from 2.7 to 1.4 cal ka BP. Hydrological signatures during the Little Ice Age are highly variable but consistent with more humidity than the Medieval Climate Anomaly. Additionally, Pb anomalies in sediments at the end of the Bronze Age suggest anthropogenic pollution earlier than the Roman Empire development in the Iberian Peninsula. The Late Holocene climate evolution of the in the study area confirms the see-saw pattern between the eastern and western Mediterranean regions and the higher influence of the North Atlantic dynamics in the western Mediterranean.

Intra-seasonal and Inter-annual variability of Bowen Ratio over rain-shadow region of North peninsular India

Science.gov (United States)

Morwal, S. B.; Narkhedkar, S. G.; Padmakumari, B.; Maheskumar, R. S.; Deshpande, C. G.; Kulkarni, J. R.

2017-05-01

Intra-seasonal and inter-annual variability of Bowen Ratio (BR) have been studied over the rain-shadow region of north peninsular India during summer monsoon season. Daily grid point data of latent heat flux (LHF), sensible heat flux (SHF) from NCEP/NCAR Reanalysis for the period 1970-2014 have been used to compute daily area-mean BR. Daily grid point rainfall data at a resolution of 0.25° × 0.25° from APHRODITE's Water Resources for the available period 1970-2007 have been used to study the association between rainfall and BR. The study revealed that BR rapidly decreases from 4.1 to 0.29 in the month of June and then remains nearly constant at the same value (≤0.1) in the rest of the season. High values of BR in the first half of June are indicative of intense thermals and convective clouds with higher bases. Low values of BR from July to September period are indicative of weak thermals and convective clouds with lower bases. Intra-seasonal and inter-annual variability of BR is found to be inversely related to precipitation over the region. BR analysis indicates that the land surface characteristics of the study region during July-September are similar to that over oceanic regions as far as intensity of thermals and associated cloud microphysical properties are concerned. Similar variation of BR is found in El Nino and La Nina years. During June, an increasing trend is observed in SHF and BR and decreasing trend in LHF from 1976 to 2014. Increasing trend in the SHF is statistically significant.

Features of ozone intraannual variability in polar regions based on ozone sounding data obtained at the Resolute and Amundsen-Scott stations

Energy Technology Data Exchange (ETDEWEB)

Gruzdev, A.N.; Sitnov, S.A. (AN SSSR, Institut Fiziki Atmosfery, Moscow (USSR))

1991-04-01

Ozone sounding data obtained at the Resolute and Amundsen-Scott stations are used to analyze ozone intraannual variability in Southern and Northern polar regions. For the Arctic, in particular, features associated with winter stratospheric warmings, stratospheric-tropospheric exchange, and the isolated evolution of surface ozone are noted. Correlative connections between ozone and temperature making it possible to concretize ozone variability mechanisms are analyzed. 31 refs.

Variable-density ground-water flow and paleohydrology in the Waste Isolation Pilot Plant (WIPP) region, southeastern New Mexico

International Nuclear Information System (INIS)

Davies, P.B.

1989-01-01

Variable-density groundwater flow was studied near the Waste Isolation Pilot Plant in southeastern New Mexico. An analysis of the relative magnitude of pressure-related and density-related flow-driving forces indicates that density-related gravity effects are not significant at the plant and to the west but are significant in areas to the north, northeast, and south. A regional-scale model of variable-density groundwater flow in the Culebra Dolomite member of the Rustler Formation indicates that the flow velocities are relatively rapid west of the site and extremely slow east and northeast of the site. In the transition zone between those two extremes, which includes the plant, velocities are highly variable. Sensitivity simulations indicates that the central and western parts of the region, including the plant, are fairly well isolated from the eastern and northeastern boundaries. Vertical-flux simulations indicate that as much as 25% of total inflow to the Culebra could be entering as vertical flow, with most of this flow occurring west of the plant. A simple cross-sectional model was developed to examine the flow system as it drains through time following recharge during a past glacial pluvial. This model indicates that the system as a whole drains very slowly and that it apparently could have sustained flow from purely transient drainage following recharge of the system during the Pleistocene

The prevalence of visual hallucinations in non-affective psychosis, and the role of perception and attention.

Science.gov (United States)

van Ommen, M M; van Beilen, M; Cornelissen, F W; Smid, H G O M; Knegtering, H; Aleman, A; van Laar, T

2016-06-01

Little is known about visual hallucinations (VH) in psychosis. We investigated the prevalence and the role of bottom-up and top-down processing in VH. The prevailing view is that VH are probably related to altered top-down processing, rather than to distorted bottom-up processing. Conversely, VH in Parkinson's disease are associated with impaired visual perception and attention, as proposed by the Perception and Attention Deficit (PAD) model. Auditory hallucinations (AH) in psychosis, however, are thought to be related to increased attention. Our retrospective database study included 1119 patients with non-affective psychosis and 586 controls. The Community Assessment of Psychic Experiences established the VH rate. Scores on visual perception tests [Degraded Facial Affect Recognition (DFAR), Benton Facial Recognition Task] and attention tests [Response Set-shifting Task, Continuous Performance Test-HQ (CPT-HQ)] were compared between 75 VH patients, 706 non-VH patients and 485 non-VH controls. The lifetime VH rate was 37%. The patient groups performed similarly on cognitive tasks; both groups showed worse perception (DFAR) than controls. Non-VH patients showed worse attention (CPT-HQ) than controls, whereas VH patients did not perform differently. We did not find significant VH-related impairments in bottom-up processing or direct top-down alterations. However, the results suggest a relatively spared attentional performance in VH patients, whereas face perception and processing speed were equally impaired in both patient groups relative to controls. This would match better with the increased attention hypothesis than with the PAD model. Our finding that VH frequently co-occur with AH may support an increased attention-induced 'hallucination proneness'.

Changes of regional climate variability in central Europe during the past 250 years

Science.gov (United States)

Böhm, R.

2012-05-01

The paper uses the data potential of very long and homogenized instrumental climate time series in the south central Europe for analyzing one feature which is very dominant in the climate change debate --whether anthropogenic climate warming causes or goes along with an increase of climate extremes. The monthly resolved data of the HISTALP data collection provide 58 single series for the three climate elements, air pressure, air temperature and precipitation, that start earlier than 1831 and extend back to 1760 in some cases. Trends and long-term low frequent climate evolution is only shortly touched in the paper. The main goal is the analysis of trends or changes of high frequent interannual and interseasonal variability. In other words, it is features like extremely hot summers, very cold winters, excessively dry or wet seasons which the study aims at. The methods used are based on detrended highpass series whose variance is analyzed in discrete 30-year windows moving over the entire instrumental period. The analysis of discrete subintervals relies on the unique number of 8 (for precipitation 7) such "normal periods". The second approach is based on the same subintervals though not in fixed but moving windows over the entire instrumental period. The first result of the study is the clear evidence that there has been no increase of variability during the past 250 years in the region. The second finding is similar but concentrates on the recent three decades which are of particular interest because they are the first 30 years with dominating anthropogenic greenhouse gas forcing. We can show that also this recent anthropogenic normal period shows no widening of the PDF (probability density function) compared to the preceding ones. The third finding is based on the moving window technique. It shows that interannual variability changes show a clear centennial oscillating structure for all three climate elements in the region. For the time being we have no explanation

Persistent changes in ability to express long-term potentiation/depression in the rat hippocampus after juvenile/adult stress.

Science.gov (United States)

Maggio, Nicola; Segal, Menahem

2011-04-15

The ventral hippocampus (VH) was recently shown to express lower magnitude long-term potentiation (LTP) compared with the dorsal hippocampus (DH). Exposure to acute stress reversed this difference, and VH slices from stressed rats expressed larger LTP than that produced in the DH, which was reduced by stress. Stressful experience in adolescence has been shown to produce long-lasting effects on animal behavior and on ability to express LTP/long-term depression (LTD) of reactivity to afferent stimulation in the adult. We are interested in possible interactions between juvenile and adult stress in their effects of adult plasticity. We studied the effects of a composite juvenile (28-30 days) stress, followed by a reminder stressful experience in the young adult (60 days) rat, on the ability to produce LTP and LTD in CA1 region of slices of the VH and DH. Juvenile or adult stress produced a transient decrease in ability to express LTP in DH and a parallel increase in LTP in VH. Stress in the young adult after juvenile stress produced a striking prolongation of the DH/VH disparity with respect to the ability to express both LTP and LTD into the adulthood of the rat. These results have important implications for the impact of juvenile stress on adult neuronal plasticity and on the understanding the functions of the different sectors of the hippocampus. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Analysis of IgG4-positive clones in affected organs of IgG4-related disease.

Science.gov (United States)

Kakuchi, Yasushi; Yamada, Kazunori; Ito, Kiyoaki; Hara, Satoshi; Fujii, Hiroshi; Yamagishi, Masakazu; Kawano, Mitsuhiro

2016-11-01

We investigated class switch reaction (CSR) in affected organs and evaluated whether the same or genetically related clones exist in IgG4-RD. We studied three patients with IgG4-RD. Total cellular RNA was extracted from salivary glands and peripheral blood and lung tissue. Activation-induced cytidine deaminase (AID) and immunoglobulin heavy chain third complementarity determining region (IgVH-CDR3) of IgM and IgG4 were detected by reverse transcription polymerase chain reaction (RT-PCR). We analyzed the clonal relationship of infiltrating IgG4-positive cells, as compared with IgM. We determined the existence of common clones among organs and patients. AID was expressed in salivary glands of all patients and lung tissue in one. Closely related IgVH-CDR3 sequences in infiltrating IgG4-positive cells were detected in salivary glands and lung tissue. Identical IgVH-CDR3 sequence between IgM and IgG4 in salivary glands was detected in one patient, indicating CSR in salivary glands. Identical IgVH-CDR3 sequences of IgG4-positive cells were detected between salivary glands and peripheral blood in two patients. Four identical sequences of IgVH-CDR3 existed between patients. Interestingly, one of the four sequences was detected in all patients. Our results demonstrate the existence of common antigen(s) shared by patients with IgG4-RD.

Sensitivity of Sahelian Precipitation to Desert Dust under ENSO variability: a regional modeling study

Science.gov (United States)

Jordan, A.; Zaitchik, B. F.; Gnanadesikan, A.

2016-12-01

Mineral dust is estimated to comprise over half the total global aerosol burden, with a majority coming from the Sahara and Sahel region. Bounded by the Sahara Desert to the north and the Sahelian Savannah to the south, the Sahel experiences high interannual rainfall variability and a short rainy season during the boreal summer months. Observation-based data for the past three decades indicates a reduced dust emission trend, together with an increase in greening and surface roughness within the Sahel. Climate models used to study regional precipitation changes due to Saharan dust yield varied results, both in sign convention and magnitude. Inconsistency of model estimates drives future climate projections for the region that are highly varied and uncertain. We use the NASA-Unified Weather Research and Forecasting (NU-WRF) model to quantify the interaction and feedback between desert dust aerosol and Sahelian precipitation. Using nested domains at fine spatial resolution we resolve changes to mesoscale atmospheric circulation patterns due to dust, for representative phases of El Niño-Southern Oscillation (ENSO). The NU-WRF regional earth system model offers both advanced land surface data and resolvable detail of the mechanisms of the impact of Saharan dust. Results are compared to our previous work assessed over the Western Sahel using the Geophysical Fluid Dynamics Laboratory (GFDL) CM2Mc global climate model, and to other previous regional climate model studies. This prompts further research to help explain the dust-precipitation relationship and recent North African dust emission trends. This presentation will offer a quantitative analysis of differences in radiation budget, energy and moisture fluxes, and atmospheric dynamics due to desert dust aerosol over the Sahel.

Collaborative Proposal: Improving Decadal Prediction of Arctic Climate Variability and Change Using a Regional Arctic System Model (RASM)

Energy Technology Data Exchange (ETDEWEB)

Maslowski, Wieslaw [Naval Postgraduate School, Monterey, CA (United States). Dept. of Oceanography; Cassano, John J. [Univ. of Colorado, Boulder, CO (United States); Gutowski, Jr., William J. [Iowa State Univ., Ames, IA (United States); Lipscomb, William H. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Nijssen, Bart [Univ. of Washington, Seattle, WA (United States); Roberts, Andrew [Naval Postgraduate School, Monterey, CA (United States). Dept. of Oceanography; Robertson, William [Univ. of Texas, El Paso, TX (United States); Tulaczyk, Slawek [Univ. of California, Santa Cruz, CA (United States); Zeng, Xubin [Univ. of Arizona, Tucson, AZ (United States)

2011-05-15

The primary outcome of the project was the development of the Regional Arctic System Model (RASM) and evaluation of its individual model components, coupling among them and fully coupled model results. Overall, we have demonstrated that RASM produces realistic mean and seasonal surface climate as well as its interannual and decadal variability and trends.

Temporal and spatial variability of frost-free seasons in the Great Lakes region of the United States

Science.gov (United States)

Lejiang Yu; Shiyuan Zhong; Xindi Bian; Warren E. Heilman; Jeffrey A. Andresen

2014-01-01

The frequency and timing of frost events and the length of the growing season are critical limiting factors in many human and natural ecosystems. This study investigates the temporal and spatial variability of the date of last spring frost (LSF), the date of first fall frost (FFF), and the length of the frost-free season (FFS) in the Great Lakes region of the United...

Collaborative Proposal: Improving Decadal Prediction of Arctic Climate Variability and Change Using a Regional Arctic System Model (RASM)

Energy Technology Data Exchange (ETDEWEB)

Maslowski, Wieslaw [Naval Postgraduate School, Monterey, CA (United States)

2016-10-17

This project aims to develop, apply and evaluate a regional Arctic System model (RASM) for enhanced decadal predictions. Its overarching goal is to advance understanding of the past and present states of arctic climate and to facilitate improvements in seasonal to decadal predictions. In particular, it will focus on variability and long-term change of energy and freshwater flows through the arctic climate system. The project will also address modes of natural climate variability as well as extreme and rapid climate change in a region of the Earth that is: (i) a key indicator of the state of global climate through polar amplification and (ii) which is undergoing environmental transitions not seen in instrumental records. RASM will readily allow the addition of other earth system components, such as ecosystem or biochemistry models, thus allowing it to facilitate studies of climate impacts (e.g., droughts and fires) and of ecosystem adaptations to these impacts. As such, RASM is expected to become a foundation for more complete Arctic System models and part of a model hierarchy important for improving climate modeling and predictions.

A Tat-grafted anti-nucleic acid antibody acquires nuclear-localization property and a preference for TAR RNA

International Nuclear Information System (INIS)

Jeong, Jong-Geun; Kim, Dong-Sik; Kim, Yong-Sung; Kwon, Myung-Hee

2011-01-01

Highlights: → We generate ' H3 Tat-3D8' by grafting Tat 48-60 peptide to VH CDR of 3D8 scFv antibody. → H3 Tat-3D8 antibody retains nucleic acid binding and hydrolyzing activities. → H3 Tat-3D8 acquires a preference for TAR RNA structure. → Properties of Tat 48-60 is transferred to an antibody via Tat-grafting into a CDR. -- Abstract: The 3D8 single chain variable fragment (3D8 scFv) is an anti-nucleic acid antibody that can hydrolyze nucleic acids and enter the cytosol of cells without reaching the nucleus. The Tat peptide, derived from the basic region of the HIV-1 Tat protein, translocates to cell nuclei and has TAR RNA binding activity. In this study, we generated a Tat-grafted antibody ( H3 Tat-3D8) by replacing complementarity-determining region 3 (CDR3) within the VH domain of the 3D8 scFv with a Tat 48-60 peptide (GRKKRRQRRRPPQ). H3 Tat-3D8 retained the DNA-binding and DNA-hydrolyzing activity of the scFv, and translocated to the nuclei of HeLa cells and preferentially recognized TAR RNA. Thus, the properties associated with the Tat peptide were transferred to the antibody via Tat-grafting without loss of the intrinsic DNA-binding and hydrolyzing activities of the 3D8 scFv antibody.

A Study of Precipitation Climatology and Its Variability over Europe Using an Advanced Regional Model (WRF)

KAUST Repository

Dasari, Hari Prasad

2015-03-06

In recent years long-term precipitation trends on a regional scale have been given emphasis due to the impacts of global warming on regional hydrology. In this study, regional precipitation trends are simulated over the Europe continent for a 60-year period in 1950-2010 using an advanced regional model, WRF, to study extreme precipitation events over Europe. The model runs continuously for each year during the period at a horizontal resolution of 25 km with initial/ boundary conditions derived from the National Center for Environmental Prediction (NCEP) 2.5 degree reanalysis data sets. The E-OBS 0.25 degree rainfall observation analysis is used for model validation. Results indicate that the model could reproduce the spatial annual rainfall pattern over Europe with low amounts (250 - 750 mm) in Iberian Peninsula, moderate to large amounts (750 - 1500 mm) in central, eastern and northeastern parts of Europe and extremely heavy falls (1500 - 2000 mm) in hilly areas of Alps with a slight overestimation in Alps and underestimation in other parts of Europe. The regional model integrations showed increasing errors (mean absolute errors) and decreasing correlations with increasing time scale (daily to seasonal). Rainfall is simulated relatively better in Iberian Peninsula, northwest and central parts of Europe. A large spatial variability with the highest number of wet days over eastern, central Europe and Alps (~200 days/year) and less number of wet days over Iberian Peninsula (≤150 days/year) is also found in agreement with observations. The model could simulate the spatial rainfall climate variability reasonably well with low rainfall days (1 - 10 mm/days) in almost all zones, heavy rainfall events in western, northern, southeastern hilly and coastal zones and extremely heavy rainfall events in northern coastal zones. An increasing trend of heavy rainfall in central, southern and southeastern parts, a decreasing trend in Iberian Peninsula and a steady trend in other

Multiresponse semiparametric regression for modelling the effect of regional socio-economic variables on the use of information technology

Science.gov (United States)

Wibowo, Wahyu; Wene, Chatrien; Budiantara, I. Nyoman; Permatasari, Erma Oktania

2017-03-01

Multiresponse semiparametric regression is simultaneous equation regression model and fusion of parametric and nonparametric model. The regression model comprise several models and each model has two components, parametric and nonparametric. The used model has linear function as parametric and polynomial truncated spline as nonparametric component. The model can handle both linearity and nonlinearity relationship between response and the sets of predictor variables. The aim of this paper is to demonstrate the application of the regression model for modeling of effect of regional socio-economic on use of information technology. More specific, the response variables are percentage of households has access to internet and percentage of households has personal computer. Then, predictor variables are percentage of literacy people, percentage of electrification and percentage of economic growth. Based on identification of the relationship between response and predictor variable, economic growth is treated as nonparametric predictor and the others are parametric predictors. The result shows that the multiresponse semiparametric regression can be applied well as indicate by the high coefficient determination, 90 percent.

ESA STSE Project “Sea Surface Temperature Diurnal Variability: Regional Extend – Implications in Atmospheric Modelling”

DEFF Research Database (Denmark)

Karagali, Ioanna

of the vertical extend of diurnal signals. Drifting buoys provide measurements close to the surface but are not always available. Moored buoys are generally not able to resolve the daily SST signal, which strongly weakens with depth within the upper water column. For such reasons, the General Ocean Turbulence......, atmospheric and oceanic modelling, bio-chemical processes and oceanic CO2 studies. The diurnal variability of SST, driven by the coincident occurrence of low enough wind and solar heating, is currently not properly understood. Atmospheric, oceanic and climate models are currently not adequately resolving...... the daily SST variability, resulting in biases of the total heat budget estimates and therefore, demised model accuracies. The ESA STSE funded project SSTDV:R.EX.-IM.A.M. aimed at characterising the regional extend of diurnal SST signals and their impact in atmospheric modelling. This study will briefly...

Multidetector computed tomography virtual hysterosalpingography in the investigation of the uterus and fallopian tubes

International Nuclear Information System (INIS)

Carrascosa, Patricia; Baronio, Mariano; Capunay, Carlos; Lopez, Elba Martin; Vallejos, Javier; Borghi, Mario; Sueldo, Carlos; Papier, Sergio

2008-01-01

Objective: To compare the efficacy of multidetector CT virtual hysterosalpingography (MDCT-VH) with conventional X-ray hysterosalpingography (HSG) in the evaluation of patients with diagnosis of infertility. Methods: Sixty patients with diagnosis of infertility scheduled to perform a HSG, were evaluated with 16-row (n = 50) and 64-row (n = 10) MDCT-VH. In 35 patients the examination was performed without a tenaculum. The HSGs were carried out using standard technique. The HSG and MDCT-VH findings were compared. The duration for both examinations and patient discomfort were documented. The sensitivity and specificity of MDCT-VH for the detection of uterine pathology and tubal obstruction were calculated using the exact binomial method. Agreement between the two methods was assessed by the Cohen's kappa method (k). Results: The mean duration for MDCT-VH (16 and 64-rows) was 5 ± 3 min, whereas for HSG was 28 ± 3. The MDCT-VH without a tenaculum was the procedure with less patient discomfort. Sensitivity, specificity and inter-method agreement for the detection of uterine pathology were 100%, 92% and k = 0.92 for 16-row MDCT-VH and 100%, 100% and k = 1 for 64-row MDCT-VH, respectively. Sensitivity and specificity for detection of tubal obstruction were 80% and 80% for 16-row MDCT-VH and 100% and 100% for 64-row MDCT-VH, respectively; inter-method agreement for the visualization of the tubes was k = 0.54 for 16-row MDCT-VH and k = 1 for 64-row MDCT-VH. Conclusion: This study demonstrated the feasibility of evaluating the female reproductive system by MDCT-VH. 64-Row MDCT-VH could be an alternative diagnostic technique in the infertility workup algorithm. A larger study is in progress to validate these encouraging results

Multidetector computed tomography virtual hysterosalpingography in the investigation of the uterus and fallopian tubes

Energy Technology Data Exchange (ETDEWEB)

Carrascosa, Patricia [Diagnostico Maipu, Av. Maipu 1668, Vicente Lopez B1602ABQ, Buenos Aires (Argentina)], E-mail: patriciacarrascosa@diagnosticomaipu.com.ar; Baronio, Mariano [CEGYR, Viamonte 1438, Capital Federal C1055ABB (Argentina); Capunay, Carlos; Lopez, Elba Martin; Vallejos, Javier [Diagnostico Maipu, Av. Maipu 1668, Vicente Lopez B1602ABQ, Buenos Aires (Argentina); Borghi, Mario; Sueldo, Carlos; Papier, Sergio [CEGYR, Viamonte 1438, Capital Federal C1055ABB (Argentina)

2008-09-15

Objective: To compare the efficacy of multidetector CT virtual hysterosalpingography (MDCT-VH) with conventional X-ray hysterosalpingography (HSG) in the evaluation of patients with diagnosis of infertility. Methods: Sixty patients with diagnosis of infertility scheduled to perform a HSG, were evaluated with 16-row (n = 50) and 64-row (n = 10) MDCT-VH. In 35 patients the examination was performed without a tenaculum. The HSGs were carried out using standard technique. The HSG and MDCT-VH findings were compared. The duration for both examinations and patient discomfort were documented. The sensitivity and specificity of MDCT-VH for the detection of uterine pathology and tubal obstruction were calculated using the exact binomial method. Agreement between the two methods was assessed by the Cohen's kappa method (k). Results: The mean duration for MDCT-VH (16 and 64-rows) was 5 {+-} 3 min, whereas for HSG was 28 {+-} 3. The MDCT-VH without a tenaculum was the procedure with less patient discomfort. Sensitivity, specificity and inter-method agreement for the detection of uterine pathology were 100%, 92% and k = 0.92 for 16-row MDCT-VH and 100%, 100% and k = 1 for 64-row MDCT-VH, respectively. Sensitivity and specificity for detection of tubal obstruction were 80% and 80% for 16-row MDCT-VH and 100% and 100% for 64-row MDCT-VH, respectively; inter-method agreement for the visualization of the tubes was k = 0.54 for 16-row MDCT-VH and k = 1 for 64-row MDCT-VH. Conclusion: This study demonstrated the feasibility of evaluating the female reproductive system by MDCT-VH. 64-Row MDCT-VH could be an alternative diagnostic technique in the infertility workup algorithm. A larger study is in progress to validate these encouraging results.

Variability among the Most Rapidly Evolving Plastid Genomic Regions is Lineage-Specific: Implications of Pairwise Genome Comparisons in Pyrus (Rosaceae) and Other Angiosperms for Marker Choice

Science.gov (United States)

Ter-Voskanyan, Hasmik; Allgaier, Martin; Borsch, Thomas

2014-01-01

Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae)—a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC–trnV, trnR–atpA, ndhF–rpl32, psbM–trnD, and trnQ–rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters). Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid), Olea (asterids) and Cymbidium (monocots) showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF–rpl32 and trnK–rps16) were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations

Variability among the most rapidly evolving plastid genomic regions is lineage-specific: implications of pairwise genome comparisons in Pyrus (Rosaceae and other angiosperms for marker choice.

Directory of Open Access Journals (Sweden)

Nadja Korotkova

Full Text Available Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae-a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC-trnV, trnR-atpA, ndhF-rpl32, psbM-trnD, and trnQ-rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters. Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid, Olea (asterids and Cymbidium (monocots showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF-rpl32 and trnK-rps16 were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations. Sequencing

Quantifying the effects of climate variability and human activities on runoff for Kaidu River Basin in arid region of northwest China

Science.gov (United States)

Chen, Zhongsheng; Chen, Yaning; Li, Baofu

2013-02-01

Much attention has recently been focused on the effects that climate variability and human activities have had on runoff. In this study, data from the Kaidu River Basin in the arid region of northwest China were analyzed to investigate changes in annual runoff during the period of 1960-2009. The nonparametric Mann-Kendall test and the Mann-Kendall-Sneyers test were used to identify trend and step change point in the annual runoff. It was found that the basin had a significant increasing trend in annual runoff. Step change point in annual runoff was identified in the basin, which occurred in the year around 1993 dividing the long-term runoff series into a natural period (1960-1993) and a human-induced period (1994-2009). Then, the hydrologic sensitivity analysis method was employed to evaluate the effects of climate variability and human activities on mean annual runoff for the human-induced period based on precipitation and potential evapotranspiration. In 1994-2009, climate variability was the main factor that increased runoff with contribution of 90.5 %, while the increasing percentage due to human activities only accounted for 9.5 %, showing that runoff in the Kaidu River Basin is more sensitive to climate variability than human activities. This study quantitatively distinguishes the effects between climate variability and human activities on runoff, which can do duty for a reference for regional water resources assessment and management.

Physical linkage of a human immunoglobulin heavy chain variable region gene segment to diversity and joining region elements

International Nuclear Information System (INIS)

Schroeder, H.W. Jr.; Walter, M.A.; Hofker, M.H.; Ebens, A.; Van Dijk, K.W.; Liao, L.C.; Cox, D.W.; Milner, E.C.B.; Perlmutter, R.M.

1988-01-01

Antibody genes are assembled from a series of germ-line gene segments that are juxtaposed during the maturation of B lymphocytes. Although diversification of the adult antibody repertoire results in large part from the combinatorial joining of these gene segments, a restricted set of antibody heavy chain variable (V H ), diversity (D H ), and joining (J H ) region gene segments appears preferentially in the human fetal repertoire. The authors report here that one of these early-expressed V H elements (termed V H 6) is the most 3' V H gene segment, positioned 77 kilobases on the 5' side of the J H locus and immediately adjacent to a set of previously described D H sequences. In addition to providing a physical map linking human V H , D H , and J H elements, these results support the view that the programmed development of the antibody V H repertoire is determined in part by the chromosomal position of these gene segments

Low numbers of repeat units in variable number of tandem repeats (VNTR) regions of white spot syndrome virus are correlated with disease outbreaks

NARCIS (Netherlands)

Tran Thi Tuyet, H.; Zwart, M.P.; Phuong, N.T.; Jong, de M.C.M.; Vlak, J.M.

2012-01-01

White spot syndrome virus (WSSV) is the most important pathogen in shrimp farming systems worldwide including the Mekong Delta, Vietnam. The genome of WSSV is characterized by the presence of two major 'indel regions' found at ORF14/15 and ORF23/24 (WSSV-Thailand) and three regions with variable

Protection against syphilis correlates with specificity of antibodies to the variable regions of Treponema pallidum repeat protein K.

Science.gov (United States)

Morgan, Cecilia A; Lukehart, Sheila A; Van Voorhis, Wesley C

2003-10-01

Syphilis has been recognized as a disease since the late 1400s, yet there is no practical vaccine available. One impediment to the development of a vaccine is the lack of understanding of multiple reinfections in humans despite the development of robust immune responses during the first episode. It has been shown that the Treponema pallidum repeat protein K (TprK) differs in seven discrete variable (V) regions in isolates and that the antibody response during infection is directed to these V regions. Immunization with TprK confers significant protection against infection with the homologous strain. We hypothesize that the antigenic diversity of TprK is involved in immune evasion, which contributes to the lack of heterologous protection. Here, using the rabbit model, we show a correlation between limited heterologous protection and tprK diversity in the challenge inoculum. We demonstrate that antibody responses to the V regions of one TprK molecule show limited cross-reactivity with heterologous TprK V regions.

Interannual Variability of Regional Hadley Circulation Intensity Over Western Pacific During Boreal Winter and Its Climatic Impact Over Asia-Australia Region

Science.gov (United States)

Huang, Ruping; Chen, Shangfeng; Chen, Wen; Hu, Peng

2018-01-01

This study investigates interannual variability of boreal winter regional Hadley circulation over western Pacific (WPHC) and its climatic impacts. A WPHC intensity index (WPHCI) is defined as the vertical shear of the divergent meridional winds. It shows that WPHCI correlates well with the El Niño-Southern Oscillation (ENSO). To investigate roles of the ENSO-unrelated part of WPHCI (WPHCIres), variables that are linearly related to the Niño-3 index have been removed. It reveals that meridional sea surface temperature gradient over the western Pacific plays an essential role in modulating the WPHCIres. The climatic impacts of WPHCIres are further investigated. Below-normal (above-normal) precipitation appears over south China (North Australia) when WPHCIres is stronger. This is due to the marked convergence (divergence) anomalies at the upper troposphere, divergence (convergence) at the lower troposphere, and the accompanied downward (upward) motion over south China (North Australia), which suppresses (enhances) precipitation there. In addition, a pronounced increase in surface air temperature (SAT) appears over south and central China when WPHCIres is stronger. A temperature diagnostic analysis suggests that the increase in SAT tendency over central China is primarily due to the warm zonal temperature advection and subsidence-induced adiabatic heating. In addition, the increase in SAT tendency over south China is primarily contributed by the warm meridional temperature advection. Further analysis shows that the correlation of WPHCIres with the East Asian winter monsoon (EAWM) is weak. Thus, this study may provide additional sources besides EAWM and ENSO to improve understanding of the Asia-Australia climate variability.

Characterizing isotopic variability of primary production and consumers in Great Plains ecosystems during protracted regional drought

Science.gov (United States)

Haveles, A. W.; Fox-Dobbs, K.; Talmadge, K. A.; Fetrow, A.; Fox, D. L.

2012-12-01

Over the last few years (2010-2012), the Great Plains of the central USA experienced protracted drought conditions, including historically severe drought during Summer, 2011. Drought severity in the region generally decreases with increasing latitude, but episodic drought is a fundamental trait of grassland ecosystems. Documenting above ground energy and nutrient flow with current drought is critical to understanding responses of grassland ecosystems in the region to predicted increased episodicity of rainfall and recurrence of drought due to anthropogenic climate change. Characterization of biogeochemical variability of modern ecosystems at the microhabitat, local landscape, and regional scales is also necessary to interpret biogeochemical records of ancient grasslands based on paleosols and fossil mammals. Here, we characterize three grassland ecosystems that span the drought gradient in the Great Plains (sites in the Texas panhandle, southwest Kansas, and northwest Nebraska). We measured δ13C and δ15N values of plants and consumers to characterize the biogeochemical variability within each ecosystem. Vegetation at each site is a mix of trees, shrubs, herbs, and cool- and warm-growing season grasses (C3 and C4, respectively). Thus, consumers have access to isotopically distinct sources of forage that vary in abundance with microhabitat (e.g., open grassland, shrub thicket, riparian woodland). Observations indicate herbivorous arthropod (grasshoppers and crickets) abundance follows drought severity, with high abundance of many species in Texas, and low abundance of few species in Nebraska. Small mammal (rodents) abundance follows the inverse pattern with 0.8%, 3.2% and 17.2% capture success in Texas, Kansas and Nebraska, respectively. The inverse abundance patterns of consumer groups may result from greater sensitivity of small mammal consumers with high metabolic needs to lower local net primary productivity and forage quality under drought conditions. As a

Influence of soil physical and chemical variables on species composition and richness of plants in the arid region of Tabuk, Saudi Arabia

Directory of Open Access Journals (Sweden)

Al-Mutairi Khalid Awadh

2017-06-01

Full Text Available The present study aims to investigate the effect of soil physical and chemical variables on the species richness and the floristic composition in four sites (Alwaz, Alqan, Sharma and Zetah of Tabuk region in the Northwestern part of Arabian Peninsula. Only organic matter (OM, pH and calcium (Ca showed significant differences (P < 0.05 amongst the four studied sites. Only magnesium and sodium were selected in the forward regression model and showed to be strong drivers of species richness of plants in Tabuk region (Adj-R2 = 0.438, F2,13 = 6.85, P = 0.009. The multivariate analysis of canonical correspondence analysis (CCA was applied to reveal the effect of the physical and chemical variables on the species composition of the plants. The CCA classifies the plant species into three groups based on their preference to the environmental variables. The first group of plant species (Group 1 is characterised by positive preference to the chloride (Cl and negative relationship with OM and pH. The second group (Group 2 is positively correlated with most of the soil variables such as OM, calcium (Ca, potassium (K, bicarbonate (HCO3, electrical conductivity (EC, sulphate (SO4 and sodium (Na. The third group (Group 3 has positive relationship with carbonate (CO3 and negative relationship with EC and magnesium (Mg. The chloride, sodium, sulphate, EC and carbonate are the main environmental factors influencing the plant species composition in Tabuk region. The cluster analysis based on the Euclidian measure shows that Alqan and Zetah have closer species composition compared to Sharma.

Regional variability of nitrate fluxes in the unsaturated zone and groundwater, Wisconsin, USA

Science.gov (United States)

Green, Christopher T.; Liao, Lixia; Nolan, Bernard T.; Juckem, Paul F.; Shope, Christopher L.; Tesoriero, Anthony J.; Jurgens, Bryant

2018-01-01

Process-based modeling of regional NO3− fluxes to groundwater is critical for understanding and managing water quality, but the complexity of NO3− reactive transport processes make implementation a challenge. This study introduces a regional vertical flux method (VFM) for efficient estimation of reactive transport of NO3− in the vadose zone and groundwater. The regional VFM was applied to 443 well samples in central-eastern Wisconsin. Chemical measurements included O2, NO3−, N2 from denitrification, and atmospheric tracers of groundwater age including carbon-14, chlorofluorocarbons, tritium, and tritiogenic helium. VFM results were consistent with observed chemistry, and calibrated parameters were in-line with estimates from previous studies. Results indicated that (1) unsaturated zone travel times were a substantial portion of the transit time to wells and streams (2) since 1945 fractions of applied N leached to groundwater have increased for manure-N, possibly due to increased injection of liquid manure, and decreased for fertilizer-N, and (3) under current practices and conditions, approximately 60% of the shallow aquifer will eventually be affected by downward migration of NO3−, with denitrification protecting the remaining 40%. Recharge variability strongly affected the unsaturated zone lag times and the eventual depth of the NO3− front. Principal components regression demonstrated that VFM parameters and predictions were significantly correlated with hydrogeochemical landscape features. The diverse and sometimes conflicting aspects of N management (e.g. limiting N volatilization versus limiting N losses to groundwater) warrant continued development of large-scale holistic strategies to manage water quality and quantity.

Regional Variability of Nitrate Fluxes in the Unsaturated Zone and Groundwater, Wisconsin, USA

Science.gov (United States)

Green, Christopher T.; Liao, Lixia; Nolan, Bernard T.; Juckem, Paul F.; Shope, Christopher L.; Tesoriero, Anthony J.; Jurgens, Bryant C.

2018-01-01

Process-based modeling of regional NO3- fluxes to groundwater is critical for understanding and managing water quality, but the complexity of NO3- reactive transport processes makes implementation a challenge. This study introduces a regional vertical flux method (VFM) for efficient estimation of reactive transport of NO3- in the vadose zone and groundwater. The regional VFM was applied to 443 well samples in central-eastern Wisconsin. Chemical measurements included O2, NO3-, N2 from denitrification, and atmospheric tracers of groundwater age including carbon-14, chlorofluorocarbons, tritium, and tritiogenic helium. VFM results were consistent with observed chemistry, and calibrated parameters were in-line with estimates from previous studies. Results indicated that (1) unsaturated zone travel times were a substantial portion of the transit time to wells and streams, (2) since 1945 fractions of applied N leached to groundwater have increased for manure-N, possibly due to increased injection of liquid manure, and decreased for fertilizer-N, and (3) under current practices and conditions, approximately 60% of the shallow aquifer will eventually be affected by downward migration of NO3-, with denitrification protecting the remaining 40%. Recharge variability strongly affected the unsaturated zone lag times and the eventual depth of the NO3- front. Principal components regression demonstrated that VFM parameters and predictions were significantly correlated with hydrogeochemical landscape features. The diverse and sometimes conflicting aspects of N management (e.g., limiting N volatilization versus limiting N losses to groundwater) warrant continued development of large-scale holistic strategies to manage water quality and quantity.

Regional precipitation variability in East Asia related to climate and environmental factors during 1979-2012

Science.gov (United States)

Deng, Yinyin; Gao, Tao; Gao, Huiwang; Yao, Xiaohong; Xie, Lian

2014-01-01

This paper studies the inter-annual precipitation variations in different regions of East Asia from oceans to interior areas in China during 1979 – 2012. The results computed by Empirical Orthogonal Functions (EOF) demonstrate that the annual precipitation changes are mainly related to the El Niño-Southern Oscillation, East Asian summer monsoon and aerosols. We also found that the increased Sea surface temperature (SST) could explain the precipitation changes over the Northwest Pacific in the dry season (Oct. – May) and the East China Sea and the South China Sea in the rainy season (Jun. – Sep.). The precipitation changes over the ocean unexplained by SST were likely due to the water vapor transport dominated by dynamic factors. With the increased SST, the moisture transported from oceans to interior land was likely redistributed and caused the complicated regional variability of precipitation. Moreover, the impacts of aerosols on cloud and precipitation varied with different pollution levels and different seasons. PMID:25033387

Exploration of factors affecting the onset and maturation course of follicular lymphoma through simulations of the germinal center.

Science.gov (United States)

Fenwick, Michael K; Escobedo, Fernando A

2009-08-01

Genetic mutations frequently observed in human follicular lymphoma (FL) B-cells result in aberrant expression of the anti-apoptotic protein bcl-2 and surface immunoglobulins (Igs) which display one or more novel variable (V) region N-glycosylation motifs. In the present study, we develop a simulation model of the germinal center (GC) to explore how these mutations might influence the emergence and clonal expansion of key mutants which provoke FL development. The simulations employ a stochastic method for calculating the cellular dynamics, which incorporates actual IgV region sequences and a simplified hypermutation scheme. We first bring our simulations into agreement with experimental data for well-characterized normal and bcl-2(+) anti-hapten GC responses in mice to provide a model for understanding how bcl-2 expression leads to permissive selection and memory cell differentiation of weakly competitive B-cells. However, as bcl-2 expression in the GC alone is thought to be insufficient for FL development, we next monitor simulated IgV region mutations to determine the emergence times of key mutants displaying aberrant N-glycosylation motifs recurrently observed in human FL IgV regions. Simulations of 26 germline V(H) gene segments indicate that particular IgV regions have a dynamical selective advantage by virtue of the speed with which one or more of their key sites can generate N-glycosylation motifs upon hypermutation. Separate calculations attribute the high occurrence frequency of such IgV regions in FL to an ability to produce key mutants at a fast enough rate to overcome stochastic processes in the GC that hinder clonal expansion. Altogether, these simulations characterize three pathways for FL maturation through positively selected N-glycosylations, namely, via one of two key sites within germline V(H) region gene segments, or via a site in the third heavy chain complementarity-determining region (CDR-H3) that is generated from VDJ recombination.

The validated hypoallergenic cosmetics rating system: its 30-year evolution and effect on the prevalence of cosmetic reactions.

Science.gov (United States)

Verallo-Rowell, Vermén M

2011-01-01

The validated hypoallergenic (vh) rating system was initiated in 1988 to try to objectively validate the "hypoallergenic" claim in cosmetics. To show how the system rates cosmetic hypoallergenicity and to compare the prevalence of cosmetic contact dermatitis (CCD) among users of regular cosmetics versus cosmetics with high VH numbers. (1) Made a VH list based on top allergens from patch-test results published by the North American Contact Dermatitis Group (NACDG) and the European Surveillance System on Contact Allergies (ESSCA); (2) reviewed global regulatory, cosmetic, drug, packaging, and manufacturing practices to show how allergens may contaminate products; (3) compared cosmetic ingredients lists against the VH list to obtain the VH rating (the more allergens absent, the higher the VH rating); and (4) obtained CCD prevalence among users of regular cosmetics versus users of cosmetics with high VH ratings. (1) Two VH lists (1988, 2003) included only cosmetic allergens in the NACDG surveys, the third (2007) included cosmetic and potential contaminant noncosmetic allergens, and the fourth (2010) adds ESSCA patch-test surveys. (2) CCD prevalence is 0.05 to 0.12% (average, 0.08%) among users of cosmetics with high VH ratings versus 2.4 to 36.3% among users of regular cosmetics. The VH rating system is shown to objectively validate the hypoallergenic cosmetics claim.

Finding stability regions for preserving efficiency classification of variable returns to scale technology in data envelopment analysis

Science.gov (United States)

Zamani, P.; Borzouei, M.

2016-12-01

This paper addresses issue of sensitivity of efficiency classification of variable returns to scale (VRS) technology for enhancing the credibility of data envelopment analysis (DEA) results in practical applications when an additional decision making unit (DMU) needs to be added to the set being considered. It also develops a structured approach to assisting practitioners in making an appropriate selection of variation range for inputs and outputs of additional DMU so that this DMU be efficient and the efficiency classification of VRS technology remains unchanged. This stability region is simply specified by the concept of defining hyperplanes of production possibility set of VRS technology and the corresponding halfspaces. Furthermore, this study determines a stability region for the additional DMU within which, in addition to efficiency classification, the efficiency score of a specific inefficient DMU is preserved and also using a simulation method, a region in which some specific efficient DMUs become inefficient is provided.

Regional impacts of ocean color on tropical Pacific variability

OpenAIRE

W. Anderson; A. Gnanadesikan; A. Wittenberg

2009-01-01

The role of the penetration length scale of shortwave radiation into the surface ocean and its impact on tropical Pacific variability is investigated with a fully coupled ocean, atmosphere, land and ice model. Previous work has shown that removal of all ocean color results in a system that tends strongly towards an El Niño state. Results from a suite of surface chlorophyll perturbation experiments show that the mean state and variability of the tropical Pacific is highly se...

Regional variability among nonlinear chlorophyll-phosphorus relationships in lakes

Science.gov (United States)

Filstrup, Christopher T.; Wagner, Tyler; Soranno, Patricia A.; Stanley, Emily H.; Stow, Craig A.; Webster, Katherine E.; Downing, John A.

2014-01-01

The relationship between chlorophyll a (Chl a) and total phosphorus (TP) is a fundamental relationship in lakes that reflects multiple aspects of ecosystem function and is also used in the regulation and management of inland waters. The exact form of this relationship has substantial implications on its meaning and its use. We assembled a spatially extensive data set to examine whether nonlinear models are a better fit for Chl a—TP relationships than traditional log-linear models, whether there were regional differences in the form of the relationships, and, if so, which regional factors were related to these differences. We analyzed a data set from 2105 temperate lakes across 35 ecoregions by fitting and comparing two different nonlinear models and one log-linear model. The two nonlinear models fit the data better than the log-linear model. In addition, the parameters for the best-fitting model varied among regions: the maximum and lower Chl aasymptotes were positively and negatively related to percent regional pasture land use, respectively, and the rate at which chlorophyll increased with TP was negatively related to percent regional wetland cover. Lakes in regions with more pasture fields had higher maximum chlorophyll concentrations at high TP concentrations but lower minimum chlorophyll concentrations at low TP concentrations. Lakes in regions with less wetland cover showed a steeper Chl a—TP relationship than wetland-rich regions. Interpretation of Chl a—TP relationships depends on regional differences, and theory and management based on a monolithic relationship may be inaccurate.

Impacts of Present and Future Climate Variability on Agriculture and Forestry in the Temperate Regions. Europe

International Nuclear Information System (INIS)

Maracchi, G.; Sirotenko, O.; Bindi, M.

2005-01-01

Agriculture and forestry will be particularly sensitive to changes in mean climate and climate variability in the northern and southern regions of Europe. Agriculture may be positively affected by climate change in the northern areas through the introduction of new crop species and varieties, higher crop production and expansion of suitable areas for crop cultivation. The disadvantages may be determined by an increase in need for plant protection, risk of nutrient leaching and accelerated breakdown of soil organic matter. In the southern areas the benefits of the projected climate change will be limited, while the disadvantages will be predominant. The increased water use efficiency caused by increasing CO2 will compensate for some of the negative effects of increasing water limitation and extreme weather events, but lower harvestable yields, higher yield variability and reduction in suitable areas of traditional crops are expected for these areas. Forestry in the Mediterranean region may be mainly affected by increases in drought and forest fires. In northern Europe, the increased precipitation is expected to be large enough to compensate for the increased evapotranspiration. On the other hand, however, increased precipitation, cloudiness and rain days and the reduced duration of snow cover and soil frost may negatively affect forest work and timber logging determining lower profitability of forest production and a decrease in recreational possibilities. Adaptation management strategies should be introduced, as effective tools, to reduce the negative impacts of climate change on agricultural and forestry sectors

Phase Variability of the Recent Climate in the North Atlantic Region

Science.gov (United States)

Serykh, Ilya; Anisimov, Mikhail; Byshev, Vladimir; Neiman, Victor; Romanov, Juri; Sidorova, Alexandra

2014-05-01

The atmospheric pressure and near-surface temperature differences between the Azores High and the Icelandic Low for the period of 1900-2012 within the spatial-temporal average-out (20º latitude, 20º longitude and 12 years) were considered. The secular term of phase states of the system under consideration was found to divide into three non-intersecting subsets. Each of that was put in consequence with one of three climatic scenarios related to the periods of 1905-1935 (relatively warm phase), 1940-1970 (colder phase) and 1980-2000 (warmer phase). A life time of such a scenario lasted about 20-35 years, and the transition from one scenario to another covered 4-6 years, i.e. it run comparatively quickly. The revealed non-overlapping sub-aggregates of the thermodynamic indices related to each particular climate scenario gave an idea to follow the circulation peculiarities and the interrelated temperature differences within the limits of the Northern Atlantic ocean-atmosphere regional system. The results of this analysis bear evidence that the most probable intermittent strengthening and weakening of Hadley and Ferrell circulations occurred there in coincided phase. The analogous character of the climate system behavior was also detected in some other regional atmospheric activity centers that can be considered as a witness on the global nature of the detected phase type of modern climate inter-decadal variability. Hence, we have the grounds to suppose that mentioned above the short-period inter-decadal excitations of the modern climate have a global nature and appears everywhere. Finally, the attention was paid to the fact that at the early XXI century the thermodynamic state of the Northern Atlantic regional climate system has shown a tendency to face towards the situation, similar to the cooler scenario of the 1940-1970. We used the heat content of upper 700m Atlantic Ocean layer data from NODC to calculate its anomalies for the periods of 1955-1970, 1980-2000 and

Body Image and Anti-Fat Attitudes: An Experimental Study Using a Haptic Virtual Reality Environment to Replicate Human Touch.

Science.gov (United States)

Tremblay, Line; Roy-Vaillancourt, Mélina; Chebbi, Brahim; Bouchard, Stéphane; Daoust, Michael; Dénommée, Jessica; Thorpe, Moriah

2016-02-01

It is well documented that anti-fat attitudes influence the interactions individuals have with overweight people. However, testing attitudes through self-report measures is challenging. In the present study, we explore the use of a haptic virtual reality environment to physically interact with overweight virtual human (VH). We verify the hypothesis that duration and strength of virtual touch vary according to the characteristics of VH in ways similar to those encountered from interaction with real people in anti-fat attitude studies. A group of 61 participants were randomly assigned to one of the experimental conditions involving giving a virtual hug to a female or a male VH of either normal or overweight. We found significant associations between body image satisfaction and anti-fat attitudes and sex differences on these measures. We also found a significant interaction effect of the sex of the participants, sex of the VH, and the body size of the VH. Female participants hugged longer the overweight female VH than overweight male VH. Male participants hugged longer the normal-weight VH than the overweight VH. We conclude that virtual touch is a promising method of measuring attitudes, emotion and social interactions.

Climate Variability and Change in the Mediterranean Region

Science.gov (United States)

Lionello, Piero; Özsoy, Emin; Planton, Serge; Zanchetta, Giovanni

2017-04-01

This special issue collects new research results on the climate of the Mediterranean region. It covers traditional topics of the MedCLIVAR programme (www.medclivar.eu, Lionello et al. 2006, Lionello et al. 2012b) being devoted to papers addressing on-going and future climate changes in the Mediterranean region and their impacts on its environment.

Self-organizing map network-based precipitation regionalization for the Tibetan Plateau and regional precipitation variability

Science.gov (United States)

Wang, Nini; Yin, Jianchuan

2017-12-01

A precipitation-based regionalization for the Tibetan Plateau (TP) was investigated for regional precipitation trend analysis and frequency analysis using data from 1113 grid points covering the period 1900-2014. The results utilizing self-organizing map (SOM) network suggest that four clusters of precipitation coherent zones can be identified, including the southwestern edge, the southern edge, the southeastern region, and the north central region. Regionalization results of the SOM network satisfactorily represent the influences of the atmospheric circulation systems such as the East Asian summer monsoon, the south Asian summer monsoon, and the mid-latitude westerlies. Regionalization results also well display the direct impacts of physical geographical features of the TP such as orography, topography, and land-sea distribution. Regional-scale annual precipitation trend as well as regional differences of annual and seasonal total precipitation were investigated by precipitation index such as precipitation concentration index (PCI) and Standardized Anomaly Index (SAI). Results demonstrate significant negative long-term linear trends in southeastern TP and the north central part of the TP, indicating arid and semi-arid regions in the TP are getting drier. The empirical mode decomposition (EMD) method shows an evolution of the main cycle with 4 and 12 months for all the representative grids of four sub-regions. The cross-wavelet analysis suggests that predominant and effective period of Indian Ocean Dipole (IOD) on monthly precipitation is around ˜12 months, except for the representative grid of the northwestern region.

Synoptic meteorological modes of variability for fine particulate matter (PM2.5) air quality in major metropolitan regions of China

Science.gov (United States)

Leung, Danny M.; Tai, Amos P. K.; Mickley, Loretta J.; Moch, Jonathan M.; van Donkelaar, Aaron; Shen, Lu; Martin, Randall V.

2018-05-01

In his study, we use a combination of multivariate statistical methods to understand the relationships of PM2.5 with local meteorology and synoptic weather patterns in different regions of China across various timescales. Using June 2014 to May 2017 daily total PM2.5 observations from ˜ 1500 monitors, all deseasonalized and detrended to focus on synoptic-scale variations, we find strong correlations of daily PM2.5 with all selected meteorological variables (e.g., positive correlation with temperature but negative correlation with sea-level pressure throughout China; positive and negative correlation with relative humidity in northern and southern China, respectively). The spatial patterns suggest that the apparent correlations with individual meteorological variables may arise from common association with synoptic systems. Based on a principal component analysis of 1998-2017 meteorological data to diagnose distinct meteorological modes that dominate synoptic weather in four major regions of China, we find strong correlations of PM2.5 with several synoptic modes that explain 10 to 40 % of daily PM2.5 variability. These modes include monsoonal flows and cold frontal passages in northern and central China associated with the Siberian High, onshore flows in eastern China, and frontal rainstorms in southern China. Using the Beijing-Tianjin-Hebei (BTH) region as a case study, we further find strong interannual correlations of regionally averaged satellite-derived annual mean PM2.5 with annual mean relative humidity (RH; positive) and springtime fluctuation frequency of the Siberian High (negative). We apply the resulting PM2.5-to-climate sensitivities to the Intergovernmental Panel on Climate Change (IPCC) Coupled Model Intercomparison Project Phase 5 (CMIP5) climate projections to predict future PM2.5 by the 2050s due to climate change, and find a modest decrease of ˜ 0.5 µg m-3 in annual mean PM2.5 in the BTH region due to more frequent cold frontal ventilation

Change features and regional distribution of temperature trend and variability joint mode in mainland China

Science.gov (United States)

Chen, Xi; Li, Ning; Zhang, Zhengtao; Feng, Jieling; Wang, Ye

2018-05-01

Adaption for temperature should be suitable to local conditions for regional differences in temperature change features. This paper proposed to utilize nine temperature modes that joint the trend (increasing/decreasing/unchanged) with variability (intensifying/weakening/unchanged) to investigate features of temperature change in mainland China. Monthly temperature data over the period 1960-2013 were obtained from 522 national basic and reference meteorological stations. Here, temperature trend (TT) was reflected by the trend of mean annual temperature (MAT) and the uptrend (downtrend) of inter-monthly sliding standard deviation (SSD) series with a sliding length of 29 years (348 months) was used for representing the intensification (weakening) of temperature variability (TV). The Mann-Kendall method and the least squares method were applied to assess the significance and quantify the magnitude of trend in MAT and SSD time series, respectively. The results show that there is a consistent warming trend throughout the country except for only three stations in which a cooling trend is identified. Moreover, the overall increasing rate in the north of 35° N is the highest, over 0.4 °C/decade for most stations. TV is weakened for almost 98% of the stations, indicating the low instability of temperature at a national scale. Finally, temperature mode (TM), for more than 90% of the stations, is the combination of an increasing TT with a weakened TV (mode 8). So, it is more important for people to adapt to the increasing temperature in these regions. Compared to using annual temperature data to calculate SSD, monthly data can accurately reflect the inter-monthly change of temperature and reserve more initial characteristics of temperature.

Stability engineering of anti-EGFR scFv antibodies by rational design of a lambda-to-kappa swap of the VL framework using a structure-guided approach.

Science.gov (United States)

Lehmann, Andreas; Wixted, Josephine H F; Shapovalov, Maxim V; Roder, Heinrich; Dunbrack, Roland L; Robinson, Matthew K

2015-01-01

Phage-display technology facilitates rapid selection of antigen-specific single-chain variable fragment (scFv) antibodies from large recombinant libraries. ScFv antibodies, composed of a VH and VL domain, are readily engineered into multimeric formats for the development of diagnostics and targeted therapies. However, the recombinant nature of the selection strategy can result in VH and VL domains with sub-optimal biophysical properties, such as reduced thermodynamic stability and enhanced aggregation propensity, which lead to poor production and limited application. We found that the C10 anti-epidermal growth factor receptor (EGFR) scFv, and its affinity mutant, P2224, exhibit weak production from E. coli. Interestingly, these scFv contain a fusion of lambda3 and lambda1 V-region (LV3 and LV1) genes, most likely the result of a PCR aberration during library construction. To enhance the biophysical properties of these scFvs, we utilized a structure-based approach to replace and redesign the pre-existing framework of the VL domain to one that best pairs with the existing VH. We describe a method to exchange lambda sequences with a more stable kappa3 framework (KV3) within the VL domain that incorporates the original lambda DE-loop. The resulting scFvs, C10KV3_LV1DE and P2224KV3_LV1DE, are more thermodynamically stable and easier to produce from bacterial culture. Additionally, C10KV3_LV1DE and P2224KV3_LV1DE retain binding affinity to EGFR, suggesting that such a dramatic framework swap does not significantly affect scFv binding. We provide here a novel strategy for redesigning the light chain of problematic scFvs to enhance their stability and therapeutic applicability.

Shark IgW C region diversification through RNA processing and isotype switching.

Science.gov (United States)

Zhang, Cecilia; Du Pasquier, Louis; Hsu, Ellen

2013-09-15

Sharks and skates represent the earliest vertebrates with an adaptive immune system based on lymphocyte Ag receptors generated by V(D)J recombination. Shark B cells express two classical Igs, IgM and IgW, encoded by an early, alternative gene organization consisting of numerous autonomous miniloci, where the individual gene cluster carries a few rearranging gene segments and one C region, μ or ω. We have characterized eight distinct Ig miniloci encoding the nurse shark ω H chain. Each cluster consists of VH, D, and JH segments and six to eight C domain exons. Two interspersed secretory exons, in addition to the 3'-most C exon with tailpiece, provide the gene cluster with the ability to generate at least six secreted isoforms that differ as to polypeptide length and C domain combination. All clusters appear to be functional, as judged by the capability for rearrangement and absence of defects in the deduced amino acid sequence. We previously showed that IgW VDJ can perform isotype switching to μ C regions; in this study, we found that switching also occurs between ω clusters. Thus, C region diversification for any IgW VDJ can take place at the DNA level by switching to other ω or μ C regions, as well as by RNA processing to generate different C isoforms. The wide array of pathogens recognized by Abs requires different disposal pathways, and our findings demonstrate complex and unique pathways for C effector function diversity that evolved independently in cartilaginous fishes.

Isolation of Osteosarcoma-Associated Human Antibodies from a Combinatorial Fab Phage Display Library

Directory of Open Access Journals (Sweden)

Carmela Dantas-Barbosa

2009-01-01

Full Text Available Osteosarcoma, a highly malignant disease, is the most common primary bone tumor and is frequently found in children and adolescents. In order to isolate antibodies against osteosarcoma antigens, a combinatorial osteosarcoma Fab library displayed on the surface of phages was used. After three rounds of selection on the surface of tumor cells, several osteosarcoma-reactive Fabs were detected. From these Fabs, five were better characterized, and despite having differences in their VH (heavy chain variable domain and Vκ (kappa chain variable domain regions, they all bound to a protein with the same molecular mass. Further analysis by cell ELISA and immunocytochemistry suggested that the Fabs recognize a membrane-associated tumor antigen expressed in higher amounts in neoplasic cells than in normal tissue. These results suggest that the human Fabs selected in this work are a valuable tool for the study of this neoplasia.

Regional softwood sawmill processing variables as influenced by productive capacity

Science.gov (United States)

P. H. Steele; F. G. Wagner; K. E. Skog

The relationship between annual softwood sawmill production and lumber processing variables was examined using data from Sawmill Improvement Program (SIP) studies of 650 softwood mills. The variables were lumber recovery factor (LRF); headrig and resaw kerf width; total sawing variation, rough green size, and oversizing-undersizing for 4/4 and 8/4 lumber; planer...

N-linked glycosylation of the immunoglobulin variable region

NARCIS (Netherlands)

van de Bovenkamp, Fleur S.; Derksen, Ninotska I. L.; Ooijevaar-de Heer, Pleuni; van Schie, Karin A.; Kruithof, Simone; Berkowska, Magdalena A.; van der Schoot, C. Ellen; Ijspeert, Hanna; van der Burg, Mirjam; Gils, Ann; Hafkenscheid, Lise; Toes, René E. M.; Rombouts, Yoann; Plomp, Rosina; Wuhrer, Manfred; van Ham, S. Marieke; Vidarsson, Gestur; Rispens, Theo

2018-01-01

N-glycosylation sites are introduced at positions in which glycans can affect antigen binding as a result of a specific clustering of progenitor glycosylation sites in the germline sequences of variable domain genes. By analyzing multiple human monoclonal and polyclonal (auto)antibody responses, we

Behavior of variable V3 region from 16S rDNA of lactic acid bacteria in denaturing gradient gel electrophoresis.

Science.gov (United States)

Ercolini, D; Moschetti, G; Blaiotta, G; Coppola, S

2001-03-01

Separation of amplified V3 region from 16S rDNA by denaturing gradient gel electrophoresis (DGGE) was tested as a tool for differentiation of lactic acid bacteria commonly isolated from food. Variable V3 regions of 21 reference strains and 34 wild strains referred to species belonging to the genera Pediococcus, Enterococcus, Lactococcus, Lactobacillus, Leuconostoc, Weissella, and Streptococcus were analyzed. DGGE profiles obtained were species-specific for most of the cultures tested. Moreover, it was possible to group the remaining LAB reference strains according to the migration of their 16S V3 region in the denaturing gel. The results are discussed with reference to their potential in the analysis of LAB communities in food, besides shedding light on taxonomic aspects.

Variability of hepatitis C virus hypervariable region 1 (HVR-1) during the early phase of pegylated interferon and ribavirin therapy.

Science.gov (United States)

Caraballo Cortés, K; Laskus, T; Bukowska-Ośko, I; Pawełczyk, A; Berak, H; Horban, A; Fic, M; Radkowski, M

2012-01-01

Genetic variability of hepatitis C virus (HCV) is considered to be an important factor defining viral pathogenesis, persistence and resistance to treatment. The aim of the present study was to characterize HCV genetic heterogeneity within a hypervariable region 1 (HVR-1) before and during the early period of pegylated interferon alfa (PEG-IFN-α) and ribavirin treatment in correlation with treatment outcome. The study involved 24 patients treated with PEG-IFN-α and ribavirin whose sera were collected before (baseline) and at 7, 14, 21 28 and 56 day of treatment. HCV HVR-1 region was amplified by nested RT- PCR and subjected to SSCP (single strand conformational polymorphism) analysis. SSCP changes of HCV HVR-1 over time in each patient were compared to treatment outcome results. In 2/11 (18%) SVR+ and 8/13 (62%) SVR- treated patients, HVR-1 genetic changes manifested by new SSCP bands (new genetic variants) and were significantly more frequent in nonresponders (P HVR-1 variability during the early phase of PEG-IFN-α and ribavirin therapy may be predictive of treatment outcome.

Characterization of chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) in Shanghai, China: molecular and cytogenetic characteristics, IgV gene restriction and hypermutation patterns.

Science.gov (United States)

Irons, Richard D; Le, Anh; Bao, Liming; Zhu, Xiongzeng; Ryder, John; Wang, Xiao Qin; Ji, Meirong; Chen, Yan; Wu, Xichun; Lin, Guowei

2009-12-01

The clinical, cytogenetic and molecular features of chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL), a disease previously considered to be rare in Asia, were examined in consecutive series of 70 cases diagnosed by our laboratory over a 30-month period. Clonal abnormalities were observed in 80% of CLL/SLL cases using a combination of conventional cytogenetic and fluorescence in situ hybridization (FISH) analysis. Those involving 14q32/IGH were the most frequent (24 cases), followed by trisomy 12 and 11q abnormalities. IgV(H) gene usage was non-random with over-representation of V(H)4-34, V(H)3-23 and a previously unreported increase in V(H)3-48 gene use. Somatic hypermutation (SHM) of IgV(H) germline sequences was observed in 56.5% of cases with stereotyped patterns of SHM observed in V(H)4-34 heavy chain complimentary-determining (HCDR1) and framework region CFR2 sequences. These findings in a Chinese population suggest subtle geographical differences in IgV(H) gene usage while the remarkably specific pattern of SHM suggest that a relatively limited set of antigens may be involved in the development of this disease worldwide. IgV(H) gene mutation status was a significant predictor of initial survival in CLL/SLL. However, an influence of karyotype on prognosis was not observed.

Comparison of seasonal variability in European domestic radon measurements

Science.gov (United States)

Groves-Kirkby, C. J.; Denman, A. R.; Phillips, P. S.; Crockett, R. G. M.; Sinclair, J. M.

2010-03-01

Analysis of published data characterising seasonal variability of domestic radon concentrations in Europe and elsewhere shows significant variability between different countries and between regions where regional data is available. Comparison is facilitated by application of the Gini Coefficient methodology to reported seasonal variation data. Overall, radon-rich sedimentary strata, particularly high-porosity limestones, exhibit high seasonal variation, while radon-rich igneous lithologies demonstrate relatively constant, but somewhat higher, radon concentrations. High-variability regions include the Pennines and South Downs in England, Languedoc and Brittany in France, and especially Switzerland. Low-variability high-radon regions include the granite-rich Cornwall/Devon peninsula in England, and Auvergne and Ardennes in France, all components of the Devonian-Carboniferous Hercynian belt.

Peucedanum ostruthium (L. Koch: Morphological and phytochemical variability of twelve accessions from the Swiss alpine region

Directory of Open Access Journals (Sweden)

McCardell, Jessica Heather

2016-07-01

Full Text Available Ostruthin, a natural bioactive compound mainly occurring in the roots of Peucedanum ostruthium, is the focus of this study. P. ostruthium was collected from twelve locations in the Swiss alpine region and reared in an experimental field, subdivided into twelve lots over two years. In the spring and fall, a portion of each of the twelve accessions was harvested and separated into above and below ground plant parts. The dried plants were then extracted with 60 % ethanol using accelerated solvent extraction (ASE and analyzed using high pressure liquid chromatography (HPLC.The above and below ground plant parts were then analyzed concerning their dry matter yield (DMY, their ostruthin concentration and their ostruthin yield. Focusing on ostruthin, it was found that the below ground plant parts harvested in the fall rendered the highest ostruthin yield. Furthermore, a variability concerning ostruthin among the twelve accessions was found. This variability among the accessions is of interest with regards to a breeding program used to develop a cultivar with a high ostruthin yield.

Ultrafast 2-dimensional image monitoring and array-based passive cavitation detection for ultrasound contrast agent destruction in a variably sized region.

Science.gov (United States)

Xu, Shanshan; Hu, Hong; Jiang, Hujie; Xu, Zhi'an; Wan, Mingxi

2014-11-01

A combined approach was proposed, based on programmable ultrasound equipment, to simultaneously monitor surviving microbubbles and detect cavitation activity during microbubble destruction in a variably sized region for use in ultrasound contrast agent (UCA)-enhanced therapeutic ultrasound applications. A variably sized focal region wherein the acoustic pressure was above the UCA fragmentation threshold was synthesized at frequencies of 3, 4, 5, and 6 MHz with a linear broadband imaging probe. The UCAs' temporal and spatial distribution during the microbubbles' destruction was monitored in a 2-dimensional imaging plane at 5 MHz and a frame rate of 400 Hz, and simultaneously, broadband noise emissions during the microbubbles' fragmentation were extracted by using the backscattered signals produced by the focused release bursts (ie, destruction pulses) themselves. Afterward, the temporal evolution of broadband noise emission, the surviving microbubbles in a region of interest (ROI), and the destruction area in a static UCA suspension were computed. Then the inertial cavitation dose, destruction rate of microbubbles in the ROI, and area of the destruction region were determined. It was found that an increasing pulse length and a decreasing transmit aperture and excitation frequency were correlated with an increased inertial cavitation dose, microbubble destruction rate, and destruction area. Furthermore, it was obvious that the microbubble destruction rate was significantly correlated with the inertial cavitation dose (P cavitation dose could be regulated by manipulating the transmission parameters. © 2014 by the American Institute of Ultrasound in Medicine.

Relationship between thin cap fibroatheroma identified by virtual histology and angioscopic yellow plaque in quantitative analysis with colorimetry.

Science.gov (United States)

Yamamoto, Masanori; Takano, Masamichi; Okamatsu, Kentaro; Murakami, Daisuke; Inami, Shigenobu; Xie, Yong; Seimiya, Koji; Ohba, Takayoshi; Seino, Yoshihiko; Mizuno, Kyoichi

2009-03-01

Thin cap fibroatheroma (TCFA) is considered to be a vulnerable plaque. Virtual Histology-intravascular ultrasound (VH-IVUS) can precisely identify TCFA in vivo. Intense yellow plaque on angioscopy determined by quantitative colorimetry with L a b color space corresponds with histological TCFA; in particular, a plaque of color b value >23 indicates an atheroma with a fibrous cap thickness colorimetry was investigated. Fifty-seven culprit plaques in 57 patients were evaluated by VH-IVUS and angioscopy. VH-TCFA was defined as a plaque with a necrotic core >10% of plaque area without overlying fibrous tissue, and angioscopic TCFA was a plaque with b value >23. The frequency of angioscopic TCFA was higher in the VH-TCFA group than in the VH-non-TCFA group (74% vs 23%, P=0.0002). Moreover, yellow color intensity (b value) significantly correlated with plaque classification on VH-IVUS. When TCFA detected with angioscopy was used as the gold standard, the sensitivity, specificity, and accuracy for TCFA with VH-IVUS was 68%, 81%, and 75%, respectively. VH-TCFA strongly correlated with angioscopic TCFA determined by a quantitative analysis with colorimetry.

Providing a non-deterministic representation of spatial variability of precipitation in the Everest region

Directory of Open Access Journals (Sweden)

J. Eeckman

2017-09-01

Full Text Available This paper provides a new representation of the effect of altitude on precipitation that represents spatial and temporal variability in precipitation in the Everest region. Exclusive observation data are used to infer a piecewise linear function for the relation between altitude and precipitation and significant seasonal variations are highlighted. An original ensemble approach is applied to provide non-deterministic water budgets for middle and high-mountain catchments. Physical processes at the soil–atmosphere interface are represented through the Interactions Soil–Biosphere–Atmosphere (ISBA surface scheme. Uncertainties associated with the model parametrization are limited by the integration of in situ measurements of soils and vegetation properties. Uncertainties associated with the representation of the orographic effect are shown to account for up to 16 % of annual total precipitation. Annual evapotranspiration is shown to represent 26 % ± 1 % of annual total precipitation for the mid-altitude catchment and 34% ± 3 % for the high-altitude catchment. Snowfall contribution is shown to be neglectable for the mid-altitude catchment, and it represents up to 44 % ± 8 % of total precipitation for the high-altitude catchment. These simulations on the local scale enhance current knowledge of the spatial variability in hydroclimatic processes in high- and mid-altitude mountain environments.

[Influencing factors of visual hallucinations in patients with Parkinson's disease and its relationship with sleep disorders].

Science.gov (United States)

Wu, D D; Li, S H; Jin, L Y; Jin, Y; Cui, Y Y; Zhao, H; Liu, H J; Ma, X X; Su, W; Chen, H B

2016-04-05

To investigate the prevalence and influencing factors of visual hallucinations in patients with Parkinson's disease(PD), and to analyze the relationship between visual hallucinations and sleep disorders. We recruited 187 patients with PD(H-Y Ⅰ-Ⅲ) from outpatient department in Beijing Hospital. The patients were investigated for general information and the use of medicine. The patients were divided into visual hallucination(VH) group and non-hallucination(non-VH) group. A comparison study was conducted between two groups. We investigated the sleep disorders of PD patients according to Non Motor Symptom Quest(NMSquest) and Parkinson's disease sleep scale(PDSS). Logistic stepwise multiple regression procedures were used to determine the best predictive model of visual hallucinations in patients with PD. (1) 42 cases(22.5%) of PD patients were accompanied by visual hallucinations; (2) the VH group and non-VH group had no difference in age, sex, duration of illness, the scores of Minimum Mental State Examination(MMSE) and levodopa equivalent doses (LED). The scores of Unified Parkinson's Disease Rating Scale(UPDRS) Ⅰ, the Hamilton Rating Scale for Anxiety(HAMA) and the Hamilton Rating Scale for Depression(HAMD) in VH group were significantly higher than those in non-VH group[3.5(2, 5) vs 2 (1, 3); 10(6.75, 15) vs 8(5, 11); 11(7.75, 17) vs 9(5, 13); Psleep behavior disorder(RBD) in VH group were significantly higher than those in non-VH group(61.9% vs 40.7%, 71.4% vs 47.6%, P0.05). The score of PDSS in VH group was significantly lower than that in non-VH group[111(92.75, 128.25) vs 123(109, 135), Psleep disorder are independently associated with VH in PD.

Ecosystem stability in space: α, β and γ variability.

Science.gov (United States)

Wang, Shaopeng; Loreau, Michel

2014-08-01

The past two decades have seen great progress in understanding the mechanisms of ecosystem stability in local ecological systems. There is, however, an urgent need to extend existing knowledge to larger spatial scales to match the scale of management and conservation. Here, we develop a general theoretical framework to study the stability and variability of ecosystems at multiple scales. Analogously to the partitioning of biodiversity, we propose the concepts of alpha, beta and gamma variability. Gamma variability at regional (metacommunity) scale can be partitioned into local alpha variability and spatial beta variability, either multiplicatively or additively. On average, variability decreases from local to regional scales, which creates a negative variability-area relationship. Our partitioning framework suggests that mechanisms of regional ecosystem stability can be understood by investigating the influence of ecological factors on alpha and beta variability. Diversity can provide insurance effects at the various levels of variability, thus generating alpha, beta and gamma diversity-stability relationships. As a consequence, the loss of biodiversity and habitat impairs ecosystem stability at the regional scale. Overall, our framework enables a synthetic understanding of ecosystem stability at multiple scales and has practical implications for landscape management. © 2014 John Wiley & Sons Ltd/CNRS.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Comparison of seasonal variability in European domestic radon measurements

Directory of Open Access Journals (Sweden)

C. J. Groves-Kirkby

2010-03-01

Full Text Available Analysis of published data characterising seasonal variability of domestic radon concentrations in Europe and elsewhere shows significant variability between different countries and between regions where regional data is available. Comparison is facilitated by application of the Gini Coefficient methodology to reported seasonal variation data. Overall, radon-rich sedimentary strata, particularly high-porosity limestones, exhibit high seasonal variation, while radon-rich igneous lithologies demonstrate relatively constant, but somewhat higher, radon concentrations. High-variability regions include the Pennines and South Downs in England, Languedoc and Brittany in France, and especially Switzerland. Low-variability high-radon regions include the granite-rich Cornwall/Devon peninsula in England, and Auvergne and Ardennes in France, all components of the Devonian-Carboniferous Hercynian belt.

Early twenty-first-century droughts during the warmest climate

Directory of Open Access Journals (Sweden)

Felix Kogan

2016-01-01

Full Text Available The first 13 years of the twenty-first century have begun with a series of widespread, long and intensive droughts around the world. Extreme and severe-to-extreme intensity droughts covered 2%–6% and 7%–16% of the world land, respectively, affecting environment, economies and humans. These droughts reduced agricultural production, leading to food shortages, human health deterioration, poverty, regional disturbances, population migration and death. This feature article is a travelogue of the twenty-first-century global and regional droughts during the warmest years of the past 100 years. These droughts were identified and monitored with the National Oceanic and Atmospheric Administration operational space technology, called vegetation health (VH, which has the longest period of observation and provides good data quality. The VH method was used for assessment of vegetation condition or health, including drought early detection and monitoring. The VH method is based on operational satellites data estimating both land surface greenness (NDVI and thermal conditions. The twenty-first-century droughts in the USA, Russia, Australia and Horn of Africa were intensive, long, covered large areas and caused huge losses in agricultural production, which affected food security and led to food riots in some countries. This research also investigates drought dynamics presenting no definite conclusion about drought intensification or/and expansion during the time of the warmest globe.

Construction of a Single Chain Variable Fragment Antibody (scFv) against Carbaryl and Its Interaction with Carbaryl.

Science.gov (United States)

Xiuyuan, Zhang; Zhihong, Huang; Lixia, Wang; Xiaonan, Liu

2015-05-01

Carbaryl is a low molecular weight insecticide that inhibits cholinesterase. Residues of carbaryl in food and the environment have damaged human health. A high-specificity scFv that can identify carbaryl is still lacking. In the present study, an anti-carbaryl scFv gene was prepared by cloning VL and VH genes from hybridoma cells secreting monoclonal antibody, then VH and VL were fused together using splicing by overlap extension (SOE) PCR with a flexible polypeptide linker connector (Gly4Ser)3, and then the scFv-pET-26b recombinant plasmid was constructed and transformed into E. coli BL21 for expression using IPTG as an inducer. The expressed recombinant protein was identified by SDS-PAGE and ELISA. The three-dimensional structure of the anti-carbaryl scFv was constructed by computer modeling, and carbaryl was docked to the scFv model to obtain the structure of the binding complex. The binding site was composed of Ala51, Ser52, Ile51, Gly54, Ser56, Arg98, and Gly100. This helps to understand the mechanism of interaction between anti-carbaryl antibody and antigen. Furthermore, it provides guidance for in vitro affinity maturation of anti-carbaryl antibody.

Protection against Syphilis Correlates with Specificity of Antibodies to the Variable Regions of Treponema pallidum Repeat Protein K

OpenAIRE

Morgan, Cecilia A.; Lukehart, Sheila A.; Van Voorhis, Wesley C.

2003-01-01

Syphilis has been recognized as a disease since the late 1400s, yet there is no practical vaccine available. One impediment to the development of a vaccine is the lack of understanding of multiple reinfections in humans despite the development of robust immune responses during the first episode. It has been shown that the Treponema pallidum repeat protein K (TprK) differs in seven discrete variable (V) regions in isolates and that the antibody response during infection is directed to these V ...

Seasonal Variability in European Radon Measurements

Science.gov (United States)

Groves-Kirkby, C. J.; Denman, A. R.; Phillips, P. S.; Crockett, R. G. M.; Sinclair, J. M.

2009-04-01

In temperate climates, domestic radon concentration levels are generally seasonally dependent, the level in the home reflecting the convolution of two time-dependent functions. These are the source soil-gas radon concentration itself, and the principal force driving radon into the building from the soil, namely the pressure-difference between interior and exterior environment. While the meteorological influence can be regarded as relatively uniform on a European scale, its variability being defined largely by the influence of North-Atlantic weather systems, soil-gas radon is generally more variable as it is essentially geologically dependent. Seasonal variability of domestic radon concentration can therefore be expected to exhibit geographical variability, as is indeed the case. To compensate for the variability of domestic radon levels when assessing the long term radon health risks, the results of individual short-term measurements are generally converted to equivalent mean annual levels by application of a Seasonal Correction Factor (SCF). This is a multiplying factor, typically derived from measurements of a large number of homes, applied to the measured short-term radon concentration to provide a meaningful annual mean concentration for dose-estimation purposes. Following concern as to the universal applicability of a single SCF set, detailed studies in both the UK and France have reported location-specific SCF sets for different regions of each country. Further results indicate that SCFs applicable to the UK differ significantly from those applicable elsewhere in Europe and North America in both amplitude and phase, supporting the thesis that seasonal variability in indoor radon concentration cannot realistically be compensated for by a single national or international SCF scheme. Published data characterising the seasonal variability of European national domestic radon concentrations, has been collated and analysed, with the objective of identifying

The impacts of aerosol loading, composition, and water uptake on aerosol extinction variability in the Baltimore–Washington, D.C. region

Directory of Open Access Journals (Sweden)

A. J. Beyersdorf

2016-01-01

Full Text Available In order to utilize satellite-based aerosol measurements for the determination of air quality, the relationship between aerosol optical properties (wavelength-dependent, column-integrated extinction measured by satellites and mass measurements of aerosol loading (PM2.5 used for air quality monitoring must be understood. This connection varies with many factors including those specific to the aerosol type – such as composition, size, and hygroscopicity – and to the surrounding atmosphere, such as temperature, relative humidity (RH, and altitude, all of which can vary spatially and temporally. During the DISCOVER-AQ (Deriving Information on Surface conditions from Column and Vertically Resolved Observations Relevant to Air Quality project, extensive in situ atmospheric profiling in the Baltimore, MD–Washington, D.C. region was performed during 14 flights in July 2011. Identical flight plans and profile locations throughout the project provide meaningful statistics for determining the variability in and correlations between aerosol loading, composition, optical properties, and meteorological conditions. Measured water-soluble aerosol mass was composed primarily of ammonium sulfate (campaign average of 32 % and organics (57 %. A distinct difference in composition was observed, with high-loading days having a proportionally larger percentage of sulfate due to transport from the Ohio River Valley. This composition shift caused a change in the aerosol water-uptake potential (hygroscopicity such that higher relative contributions of inorganics increased the bulk aerosol hygroscopicity. These days also tended to have higher relative humidity, causing an increase in the water content of the aerosol. Conversely, low-aerosol-loading days had lower sulfate and higher black carbon contributions, causing lower single-scattering albedos (SSAs. The average black carbon concentrations were 240 ng m−3 in the lowest 1 km, decreasing to 35�

Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

International Nuclear Information System (INIS)

Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

1995-06-01

MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

Hierarchical probabilistic regionalization of volcanism for Sengan region in Japan using multivariate statistical techniques and geostatistical interpolation techniques

International Nuclear Information System (INIS)

Park, Jinyong; Balasingham, P.; McKenna, Sean Andrew; Kulatilake, Pinnaduwa H. S. W.

2004-01-01

Sandia National Laboratories, under contract to Nuclear Waste Management Organization of Japan (NUMO), is performing research on regional classification of given sites in Japan with respect to potential volcanic disruption using multivariate statistics and geo-statistical interpolation techniques. This report provides results obtained for hierarchical probabilistic regionalization of volcanism for the Sengan region in Japan by applying multivariate statistical techniques and geostatistical interpolation techniques on the geologic data provided by NUMO. A workshop report produced in September 2003 by Sandia National Laboratories (Arnold et al., 2003) on volcanism lists a set of most important geologic variables as well as some secondary information related to volcanism. Geologic data extracted for the Sengan region in Japan from the data provided by NUMO revealed that data are not available at the same locations for all the important geologic variables. In other words, the geologic variable vectors were found to be incomplete spatially. However, it is necessary to have complete geologic variable vectors to perform multivariate statistical analyses. As a first step towards constructing complete geologic variable vectors, the Universal Transverse Mercator (UTM) zone 54 projected coordinate system and a 1 km square regular grid system were selected. The data available for each geologic variable on a geographic coordinate system were transferred to the aforementioned grid system. Also the recorded data on volcanic activity for Sengan region were produced on the same grid system. Each geologic variable map was compared with the recorded volcanic activity map to determine the geologic variables that are most important for volcanism. In the regionalized classification procedure, this step is known as the variable selection step. The following variables were determined as most important for volcanism: geothermal gradient, groundwater temperature, heat discharge, groundwater

In a patient with biclonal Waldenstrom macroglobulinemia only one clone expands in three-dimensional culture and includes putative cancer stem cells.

Science.gov (United States)

Kirshner, Julia; Thulien, Kyle J; Kriangkum, Jitra; Motz, Sarah; Belch, Andrew R; Pilarski, Linda M

2011-02-01

A small percentage of cases of Waldenstrom macroglobulinemia (WM) present with biclonality, defined here as the rearrangement of two distinct VDJ gene segments. Here we investigated the expansion of two clones from a patient with WM expressing molecularly detectable clonotypic gene rearrangements, one V(H)3 and one V(H)4. Biclonality was determined in blood and bone marrow mononuclear cells using real-time quantitative PCR (RQ-PCR). V(H)4 expressing cells but not V(H)3 expressing cells underwent clonal expansion in 3-D culture of reconstructed WM bone marrow. After 3-D culture, secondary culture in a colony forming unit assay, and RQ-PCR, only the V(H)4 clone was shown to harbor a subpopulation with characteristics of cancer stem cells, including proliferative quiescence, self-regeneration, and the ability to generate clonotypic progeny, suggesting that the V(H)4, but not the V(H)3, clone is clinically significant. Enrichment of potential WM stem cells in 3-D cultures holds promise for monitoring their response to treatment and for testing new therapies.

Smart platform for the time since death determination from vitreous humor cystine.

Science.gov (United States)

Ansari, Niha; Lodha, Anand; Menon, Shobhana K

2016-12-15

In this work, we report the smart application of AgNPs based sensors for determination of time since death (TSD) via recognition and quantification of vitreous humor (VH) cystine as well as provide the portability for on spot determination of TSD. The lower detection limit was found to be 7.0ng/ml with prominent selectivity. It was found that there is a linear correlation between the VH cystine concentration and TSD as the concentration of cystine increases up to 96h±3.9h. Further for the first time TSD determination is given a smart approach and it proves to have a great utility up to 24h±2.6h. The linear regression equation between TSD (the dependent variable), RGB intensity of cystine concentration till 24h (the independent variable) was found to be TSD=26.69+-0.05*x. The proposed method gives the smart detection, portability, rapidity, sensitivity, selectivity as well as cost effectiveness for determination of time since death. Copyright © 2016 Elsevier B.V. All rights reserved.

Drought Variability and Land Degradation in Semiarid Regions: Assessment Using Remote Sensing Data and Drought Indices (1982–2011

Directory of Open Access Journals (Sweden)

Sergio M. Vicente-Serrano

2015-04-01

Full Text Available We analyzed potential land degradation processes in semiarid regions worldwide using long time series of remote sensing images and the Normalized Difference Vegetation Index (NDVI for the period 1981 to 2011. The objectives of the study were to identify semiarid regions showing a marked decrease in potential vegetation activity, indicative of the occurrence of land degradation processes, and to assess the possible influence of the observed drought trends quantified using the Standardized Precipitation Evapotranspiration Index (SPEI. We found that the NDVI values recorded during the period of maximum vegetation activity (NDVImax predominantly showed a positive evolution in the majority of the semiarid regions assessed, but NDVImax was highly correlated with drought variability, and the trends of drought events influenced trends in NDVImax at the global scale. The semiarid regions that showed most increase in NDVImax (the Sahel, northern Australia, South Africa were characterized by a clear positive trend in the SPEI values, indicative of conditions of greater humidity and lesser drought conditions. While changes in drought severity may be an important driver of NDVI trends and land degradation processes in semiarid regions worldwide, drought did not apparently explain some of the observed changes in NDVImax. This reflects the complexity of vegetation activity processes in the world’s semiarid regions, and the difficulty of defining a universal response to drought in these regions, where a number of factors (natural and anthropogenic may also affect on land degradation.

Drought Variability and Land Degradation in Semiarid Regions: Assessment Using Remote Sensing Data and Drought Indices (1982–2011)

KAUST Repository

Vicente-Serrano, Sergio

2015-04-14

We analyzed potential land degradation processes in semiarid regions worldwide using long time series of remote sensing images and the Normalized Difference Vegetation Index (NDVI) for the period 1981 to 2011. The objectives of the study were to identify semiarid regions showing a marked decrease in potential vegetation activity, indicative of the occurrence of land degradation processes, and to assess the possible influence of the observed drought trends quantified using the Standardized Precipitation Evapotranspiration Index (SPEI). We found that the NDVI values recorded during the period of maximum vegetation activity (NDVImax) predominantly showed a positive evolution in the majority of the semiarid regions assessed, but NDVImax was highly correlated with drought variability, and the trends of drought events influenced trends in NDVImax at the global scale. The semiarid regions that showed most increase in NDVImax (the Sahel, northern Australia, South Africa) were characterized by a clear positive trend in the SPEI values, indicative of conditions of greater humidity and lesser drought conditions. While changes in drought severity may be an important driver of NDVI trends and land degradation processes in semiarid regions worldwide, drought did not apparently explain some of the observed changes in NDVImax. This reflects the complexity of vegetation activity processes in the world’s semiarid regions, and the difficulty of defining a universal response to drought in these regions, where a number of factors (natural and anthropogenic) may also affect on land degradation.

Drought Variability and Land Degradation in Semiarid Regions: Assessment Using Remote Sensing Data and Drought Indices (1982–2011)

KAUST Repository

Vicente-Serrano, Sergio; Cabello, Daniel; Tomá s-Burguera, Miquel; Martí n-Herná ndez, Natalia; Beguerí a, Santiago; Azorin-Molina, Cesar; Kenawy, Ahmed

2015-01-01

We analyzed potential land degradation processes in semiarid regions worldwide using long time series of remote sensing images and the Normalized Difference Vegetation Index (NDVI) for the period 1981 to 2011. The objectives of the study were to identify semiarid regions showing a marked decrease in potential vegetation activity, indicative of the occurrence of land degradation processes, and to assess the possible influence of the observed drought trends quantified using the Standardized Precipitation Evapotranspiration Index (SPEI). We found that the NDVI values recorded during the period of maximum vegetation activity (NDVImax) predominantly showed a positive evolution in the majority of the semiarid regions assessed, but NDVImax was highly correlated with drought variability, and the trends of drought events influenced trends in NDVImax at the global scale. The semiarid regions that showed most increase in NDVImax (the Sahel, northern Australia, South Africa) were characterized by a clear positive trend in the SPEI values, indicative of conditions of greater humidity and lesser drought conditions. While changes in drought severity may be an important driver of NDVI trends and land degradation processes in semiarid regions worldwide, drought did not apparently explain some of the observed changes in NDVImax. This reflects the complexity of vegetation activity processes in the world’s semiarid regions, and the difficulty of defining a universal response to drought in these regions, where a number of factors (natural and anthropogenic) may also affect on land degradation.

Dicty_cDB: VHD492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHD492 (Link to dictyBase) - - - Contig-U15308-1 - (Link to Original site) - - VHD492...Z 675 - - - - Show VHD492 Library VH (Link to library) Clone ID VHD492 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHD4-D/VHD492Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHD492 (VHD492Q) /CSM/VH/VHD4-D/VHD492Q.Seq.d/ XXXXXXXXXXCTTCATC...xkiipink Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHD492 (VHD492Q) /CSM/VH/VHD4-D/VHD492

Efficient generation of monoclonal antibodies from single rhesus macaque antibody secreting cells.

Science.gov (United States)

Meng, Weixu; Li, Leike; Xiong, Wei; Fan, Xuejun; Deng, Hui; Bett, Andrew J; Chen, Zhifeng; Tang, Aimin; Cox, Kara S; Joyce, Joseph G; Freed, Daniel C; Thoryk, Elizabeth; Fu, Tong-Ming; Casimiro, Danilo R; Zhang, Ningyan; A Vora, Kalpit; An, Zhiqiang

2015-01-01

Nonhuman primates (NHPs) are used as a preclinical model for vaccine development, and the antibody profiles to experimental vaccines in NHPs can provide critical information for both vaccine design and translation to clinical efficacy. However, an efficient protocol for generating monoclonal antibodies from single antibody secreting cells of NHPs is currently lacking. In this study we established a robust protocol for cloning immunoglobulin (IG) variable domain genes from single rhesus macaque (Macaca mulatta) antibody secreting cells. A sorting strategy was developed using a panel of molecular markers (CD3, CD19, CD20, surface IgG, intracellular IgG, CD27, Ki67 and CD38) to identify the kinetics of B cell response after vaccination. Specific primers for the rhesus macaque IG genes were designed and validated using cDNA isolated from macaque peripheral blood mononuclear cells. Cloning efficiency was averaged at 90% for variable heavy (VH) and light (VL) domains, and 78.5% of the clones (n = 335) were matched VH and VL pairs. Sequence analysis revealed that diverse IGHV subgroups (for VH) and IGKV and IGLV subgroups (for VL) were represented in the cloned antibodies. The protocol was tested in a study using an experimental dengue vaccine candidate. About 26.6% of the monoclonal antibodies cloned from the vaccinated rhesus macaques react with the dengue vaccine antigens. These results validate the protocol for cloning monoclonal antibodies in response to vaccination from single macaque antibody secreting cells, which have general applicability for determining monoclonal antibody profiles in response to other immunogens or vaccine studies of interest in NHPs.

Interannual variability in the atmospheric CO2 rectification over a boreal forest region

Science.gov (United States)

Chen, Baozhang; Chen, Jing M.; Worthy, Douglas E. J.

2005-08-01

Ecosystem CO2 exchange with the atmosphere and the planetary boundary layer (PBL) dynamics are correlated diurnally and seasonally. The strength of this kind of covariation is quantified as the rectifier effect, and it affects the vertical gradient of CO2 and thus the global CO2 distribution pattern. An 11-year (1990-1996, 1999-2002), continuous CO2 record from Fraserdale, Ontario (49°52'29.9″N, 81°34'12.3″W), along with a coupled vertical diffusion scheme (VDS) and ecosystem model named Boreal Ecosystem Productivity Simulator (BEPS), are used to investigate the interannual variability of the rectifier effect over a boreal forest region. The coupled model performed well (r2 = 0.70 and 0.87, at 40 m at hourly and daily time steps, respectively) in simulating CO2 vertical diffusion processes. The simulated annual atmospheric rectifier effect varies from 3.99 to 5.52 ppm, while the diurnal rectifying effect accounted for about a quarter of the annual total (22.8˜28.9%).The atmospheric rectification of CO2 is not simply influenced by terrestrial source and sink strengths, but by seasonal and diurnal variations in the land CO2 flux and their interaction with PBL dynamics. Air temperature and moisture are found to be the dominant climatic factors controlling the rectifier effect. The annual rectifier effect is highly correlated with annual mean temperature (r2 = 0.84), while annual mean air relative humidity can explain 51% of the interannual variation in rectification. Seasonal rectifier effect is also found to be more sensitive to climate variability than diurnal rectifier effect.

Genetic variability of watermelon accessions based on microsatellite markers.

Science.gov (United States)

de S Gama, R N C; Santos, C A F; de C S Dias, R

2013-03-13

We analyzed the genetic variability of 40 watermelon accessions collected from 8 regions of Northeastern Brazil using microsatellite markers, in order to suggest strategies of conservation and utilization of genetic variability in this species. These accessions are not commercial cultivars. They were sampled in areas of traditional farmers that usually keep their own seeds for future plantings year after year. An UPGMA dendrogram was generated from a distance matrix of the Jaccard coefficient, based on 41 alleles of 13 microsatellite loci. Analysis of molecular variance was made by partitioning between and within geographical regions. The similarity coefficient between accessions ranged from 37 to 96%; the dendrogram gave a co-phenetic value of 0.80. The among population genetic variability was high ( (^)ϕST = 0.319). Specific clusters of accessions sampled in 3 regions of Maranhão were observed while the other 5 regions did not presented specific clusters by regions. We conclude that watermelon genetic variability is not uniformly dispersed in the regions analyzed, indicating that geographical barriers or edaphoclimatic conditions have limited open mating. We suggest sampling a greater number of populations, so regional species diversity will be better represented and preserved in the germplasm bank.

Suppression of Aggrus/podoplanin-induced platelet aggregation and pulmonary metastasis by a single-chain antibody variable region fragment

International Nuclear Information System (INIS)

Miyata, Kenichi; Takagi, Satoshi; Sato, Shigeo; Morioka, Hiroshi; Shiba, Kiyotaka; Minamisawa, Tamiko; Takami, Miho; Fujita, Naoya

2014-01-01

Almost all highly metastatic tumor cells possess high platelet aggregating abilities, thereby form large tumor cell-platelet aggregates in the microvasculature. Embolization of tumor cells in the microvasculature is considered to be the first step in metastasis to distant organs. We previously identified the platelet aggregation-inducing factor expressed on the surfaces of highly metastatic tumor cells and named as Aggrus. Aggrus was observed to be identical to the marker protein podoplanin (alternative names, T1α, OTS-8, and others). Aggrus is frequently overexpressed in several types of tumors and enhances platelet aggregation by interacting with the platelet receptor C-type lectin-like receptor 2 (CLEC-2). Here, we generated a novel single-chain antibody variable region fragment (scFv) by linking the variable regions of heavy and light chains of the neutralizing anti-human Aggrus monoclonal antibody MS-1 with a flexible peptide linker. Unfortunately, the generated KM10 scFv failed to suppress Aggrus-induced platelet aggregation in vitro. Therefore, we performed phage display screening and finally obtained a high-affinity scFv, K-11. K-11 scFv was able to suppress Aggrus-induced platelet aggregation in vitro. Moreover, K-11 scFv prevented the formation of pulmonary metastasis in vivo. These results suggest that K-11 scFv may be useful as metastasis inhibitory scFv and is expected to aid in the development of preclinical and clinical examinations of Aggrus-targeted cancer therapies

Genetic variability and population structure of Plasmodium falciparum parasite populations from different malaria ecological regions of Kenya.

Science.gov (United States)

Ingasia, Luicer A; Cheruiyot, Jelagat; Okoth, Sheila Akinyi; Andagalu, Ben; Kamau, Edwin

2016-04-01

Transmission intensity, movement of human and vector hosts, biogeographical features, and malaria control measures are some of the important factors that determine Plasmodium falciparum parasite genetic variability and population structure. Kenya has different malaria ecologies which might require different disease intervention methods. Refined parasite population genetic studies are critical for informing malaria control and elimination strategies. This study describes the genetic diversity and population structure of P. falciparum parasites from the different malaria ecological zones in Kenya. Twelve multi-locus microsatellite (MS) loci previously described were genotyped in 225 P. falciparum isolates collected between 2012 and 2013 from five sites; three in lowland endemic regions (Kisumu, Kombewa, and Malindi) and two in highland, epidemic regions (Kisii and Kericho). Parasites from the lowland endemic and highland epidemic regions of western Kenya had high genetic diversity compared to coastal lowland endemic region of Kenya [Malindi]. The Kenyan parasites had a mean genetic differentiation index (FST) of 0.072 (p=0.011). The multi-locus genetic analysis of the 12 MS revealed all the parasites had unique haplotypes. Significant linkage disequilibrium (LD) was observed in all the five parasite populations. Kisumu had the most significant index of association values (0.16; pKenya after introduction of the artemether-lumefantrine is important in refining the spread of drug resistant strains and malaria transmission for more effective control and eventual elimination of malaria in Kenya. Copyright © 2015. Published by Elsevier B.V.

Incidence of vertical phoria on postural control during binocular vision: what perspective for prevention to nonspecific chronic pain management?

Science.gov (United States)

Matheron, Eric; Kapoula, Zoï

2015-01-01

Vertical heterophoria (VH) is the latent vertical misalignment of the eyes when the retinal images are dissociated, vertical orthophoria (VO) when there is no misalignment. Studies on postural control, during binocular vision in upright stance, reported that healthy subjects with small VH vs. VO are less stable, but the experimental cancellation of VH with an appropriate prism improves postural stability. The same behavior was recorded in nonspecific chronic back pain subjects, all with VH. It was hypothesized that, without refraction problems, VH indicates a perturbation of the somaesthetic cues required in the sensorimotor loops involved in postural control and the capacity of the CNS to optimally integrate these cues, suggesting prevention possibilities. Sensorimotor conflict can induce pain and modify sensory perception in some healthy subjects; some nonspecific pain or chronic pain could result from such prolonged conflict in which VH could be a sign, with new theoretical and clinical implications.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Dicty_cDB: VHK246 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK246 (Link to dictyBase) - - - Contig-U16440-1 VHK246P (Link to Original site) VHK2...46F 617 VHK246Z 760 VHK246P 1357 - - Show VHK246 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-B/VHK246Q.Seq.d/ Representative seq. ID VHK2...46P (Link to Original site) Representative DNA sequence >VHK246 (VHK246Q) /CSM/VH/VHK2-B/VHK2...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHK246 (VHK246Q) /CSM/VH/VHK2-B/VHK2

Understanding resilience of pastoralists to climate change and variability in the Southern Afar Region, Ethiopia

Directory of Open Access Journals (Sweden)

Muluken Mekuyie

Full Text Available Change in climate and climate extremes are acknowledged as a vital challenge to pastoral production systems. Alternative systems that are accessible to a household in order to make a living could determine the household’s resilience at a given point in time. This study was conducted in the Southern Afar region in Ethiopia to understand the resilience of pastoralists to climate change and variability. A household questionnaire survey and focus group discussions were employed to collect primary data at household level. A total of 250 pastoral households were sampled using stratified random sampling. The data obtained were analysed using descriptive statistics and principal component analysis. The resilience of households to climate shocks and stresses was determined using a two-step modelling approach by clustering households into livelihood groups, gender and districts. The results indicated that agro-pastoral households were more resilient than pastoralists to climate-induced shock. Furthermore, households in the Gewane district were more resilient than those in the Amibara district. Female-headed households were less resilient than male-headed households. Enhancing livestock assets and productivity, social safety nets, access to market, credit, extension services and education, improving irrigation crop farming, and providing farm inputs significantly enhanced the resilience of pastoralists to climate change and variability. Keywords: Asset, Livelihood, Climate shock, Pastoralist, Resilience

The Climate Variability & Predictability (CVP) Program at NOAA - Observing and Understanding Processes Affecting the Propagation of Intraseasonal Oscillations in the Maritime Continent Region

Science.gov (United States)

Lucas, S. E.

2017-12-01

The Climate Variability & Predictability (CVP) Program supports research aimed at providing process-level understanding of the climate system through observation, modeling, analysis, and field studies. This vital knowledge is needed to improve climate models and predictions so that scientists can better anticipate the impacts of future climate variability and change. To achieve its mission, the CVP Program supports research carried out at NOAA and other federal laboratories, NOAA Cooperative Institutes, and academic institutions. The Program also coordinates its sponsored projects with major national and international scientific bodies including the World Climate Research Programme (WCRP), the International and U.S. Climate Variability and Predictability (CLIVAR/US CLIVAR) Program, and the U.S. Global Change Research Program (USGCRP). The CVP program sits within NOAA's Climate Program Office (http://cpo.noaa.gov/CVP). In 2017, the CVP Program had a call for proposals focused on observing and understanding processes affecting the propagation of intraseasonal oscillations in the Maritime Continent region. This poster will present the recently funded CVP projects, the expected scientific outcomes, the geographic areas of their work in the Maritime Continent region, and the collaborations with the Office of Naval Research, Indonesian Agency for Meteorology, Climatology and Geophysics (BMKG), Japan Agency for Marine-Earth Science and Technology (JAMSTEC) and other partners.

Hospitalizations for ambulatory care sensitive conditions and quality of primary care: their relation with socioeconomic and health care variables in the Madrid regional health service (Spain).

Science.gov (United States)

Magán, Purificación; Alberquilla, Angel; Otero, Angel; Ribera, José Manuel

2011-01-01

Hospitalizations for ambulatory care sensitive conditions (ACSH) have been proposed as an indirect indicator of the effectiveness and quality of care provided by primary health care. To investigate the association of ACSH rates with population socioeconomic factors and with characteristics of primary health care. Cross-sectional, ecologic study. Using hospital discharge data, ACSH were selected from the list of conditions validated for Spain. All 34 health districts in the Region of Madrid, Spain. Individuals aged 65 years or older residing in the region of Madrid between 2001 and 2003, inclusive. Age- and gender-adjusted ACSH rates in each health district. The adjusted ACSH rate per 1000 population was 35.37 in men and 20.45 in women. In the Poisson regression analysis, an inverse relation was seen between ACSH rates and the socioeconomic variables. Physician workload was the only health care variable with a statistically significant relation (rate ratio of 1.066 [95% CI; 1.041-1.091]). These results were similar in the analyses disaggregated by gender. In the multivariate analyses that included health care variables, none of the health care variables were statistically significant. ACSH may be more closely related with socioeconomic variables than with characteristics of primary care activity. Therefore, other factors outside the health system must be considered to improve health outcomes in the population.

The prevalence of visual hallucinations in non-affective psychosis, and the role of perception and attention

NARCIS (Netherlands)

Ommen, van Marouska; van Beilen, M; Cornelissen, F W; Smid, H.G.O.M.; Knegtering, H; Aleman, A; van Laar, T

Background. Little is known about visual hallucinations (VH) in psychosis. We investigated the prevalence and the role of bottom-up and top-down processing in VH. The prevailing view is that VH are probably related to altered top-down processing, rather than to distorted bottom-up processing.

Left-right functional asymmetry of ventral hippocampus depends on aversiveness of situations.

Science.gov (United States)

Sakaguchi, Yukitoshi; Sakurai, Yoshio

2017-05-15

Many studies suggest that animals exhibit lateralized behaviors during aversive situations, and almost all animals exhibit right hemisphere-dominant behaviors associated with fear or anxiety. However, which brain structure in each hemisphere underlies such lateralized function is unclear. In this study, we focused on the hippocampus and investigated the effects of bilateral and unilateral lesions of the ventral hippocampus (VH) on anxiety-like behavior using the successive alleys test. We also examined the expression of c-fos in the VH, which was induced by an aversive situation. Results revealed that consistent right VH dominance trended with the anxiety level. Weaker anxiety induced both right and left VH functions, whereas stronger anxiety induced right VH function. From these results, we conclude that animals are able to adaptively regulate their behaviors to avoid aversive stimuli by changing the functional dominance of their left and right VH. Copyright © 2017 Elsevier B.V. All rights reserved.

Unstable lysogeny and pseudolysogeny in Vibrio harveyi siphovirus-like phage 1.

Science.gov (United States)

Khemayan, Krit; Pasharawipas, Tirasak; Puiprom, Orapim; Sriurairatana, Siriporn; Suthienkul, Orasa; Flegel, Timothy W

2006-02-01

Exposure of Vibrio harveyi (strain VH1114) to V. harveyi siphovirus-like phage 1 (VHS1) resulted in the production of a low percentage of lysogenized clones of variable stability. These were retrieved most easily as small colonies within dot plaques. Analysis revealed that VHS1 prophage was most likely carried by VH1114 as an episome rather than integrated into the host chromosome. In the late exponential growth phase, lysogenized VH1114 continuously produced VHS1 but also gave rise to a large number of cured progeny. The absence of phage DNA in the cured progeny was confirmed by the absence of VHS1 DNA in Southern blot and PCR assays. Curiously, these very stable, cured subclones did not show the parental phenotype of clear plaques with VHS1 but instead showed turbid plaques, both in overlaid lawns and in dot plaque assays. This phenotypic difference from the original parental isolate suggested that transient lysogeny by VHS1 had resulted in a stable genetic change in the cured clones. Such clones may be called pseudolysogens (i.e., false lysogens), since they have undergone transient lysogeny and have retained some resistance to full lytic phage development, despite the loss of viable or detectable prophage.

OptMAVEn--a new framework for the de novo design of antibody variable region models targeting specific antigen epitopes.

Directory of Open Access Journals (Sweden)

Tong Li

Full Text Available Antibody-based therapeutics provides novel and efficacious treatments for a number of diseases. Traditional experimental approaches for designing therapeutic antibodies rely on raising antibodies against a target antigen in an immunized animal or directed evolution of antibodies with low affinity for the desired antigen. However, these methods remain time consuming, cannot target a specific epitope and do not lead to broad design principles informing other studies. Computational design methods can overcome some of these limitations by using biophysics models to rationally select antibody parts that maximize affinity for a target antigen epitope. This has been addressed to some extend by OptCDR for the design of complementary determining regions. Here, we extend this earlier contribution by addressing the de novo design of a model of the entire antibody variable region against a given antigen epitope while safeguarding for immunogenicity (Optimal Method for Antibody Variable region Engineering, OptMAVEn. OptMAVEn simulates in silico the in vivo steps of antibody generation and evolution, and is capable of capturing the critical structural features responsible for affinity maturation of antibodies. In addition, a humanization procedure was developed and incorporated into OptMAVEn to minimize the potential immunogenicity of the designed antibody models. As case studies, OptMAVEn was applied to design models of neutralizing antibodies targeting influenza hemagglutinin and HIV gp120. For both HA and gp120, novel computational antibody models with numerous interactions with their target epitopes were generated. The observed rates of mutations and types of amino acid changes during in silico affinity maturation are consistent with what has been observed during in vivo affinity maturation. The results demonstrate that OptMAVEn can efficiently generate diverse computational antibody models with both optimized binding affinity to antigens and reduced

Seasonal variability in virtual height of ionospheric f/sub 2/ layer at the pakistan atmospheric region

International Nuclear Information System (INIS)

Jilani, A.A.; Afridi, F.A.K.; Mian, K.; Zai, M.A.K.Y.

2013-01-01

The aim of this study was to assess the seasonal variability in virtual height of ionospheric F/sub 2/ layer for Pakistan's atmospheric region (PAR). In this communication virtual height variations have been analyzed by the descriptive statistical techniques. These methodologies comprise an autoregressive strategy, linear regression and polynomial regression. The relevance of these models has been illuminated using predicted values of different parameters under the seasonal variation of ionospheric F/sub 2/ layer in virtual height that affect the radio wave propagation through the ionosphere. These techniques are implemented to theorize the physical process of varying the virtual heights that leads this study towards formulating the variations due to interaction of radio wave propagation with this ionospheric layer. (author)

Crystal structure of a human single domain antibody dimer formed through V(H-V(H non-covalent interactions.

Directory of Open Access Journals (Sweden)

Toya Nath Baral

Full Text Available Single-domain antibodies (sdAbs derived from human V(H are considered to be less soluble and prone to aggregate which makes it difficult to determine the crystal structures. In this study, we isolated and characterized two anti-human epidermal growth factor receptor-2 (HER2 sdAbs, Gr3 and Gr6, from a synthetic human V(H phage display library. Size exclusion chromatography and surface plasmon resonance analyses demonstrated that Gr3 is a monomer, but that Gr6 is a strict dimer. To understand this different molecular behavior, we solved the crystal structure of Gr6 to 1.6 Å resolution. The crystal structure revealed that the homodimer assembly of Gr6 closely mimics the V(H-V(L heterodimer of immunoglobulin variable domains and the dimerization interface is dominated by hydrophobic interactions.

Pleurodeles Waltl Humoral Immune Response under Spaceflight Conditions

Science.gov (United States)

Bascove, Matthieu; Touche, Nadege; Frippiat, Jean-Pol

2008-06-01

The immune system is an important regulatory mechanism affected by spaceflights. In a previous work, we performed a first study of the humoral immune response induced by the immunization of Pleurodeles waltl during a 5 months stay onboard the Mir space station. This analysis indicated that heavy-chain variable domains of specific IgM are encoded by genes of the VHII and VHVI families. However, the contributions of these two families to IgM heavy-chains are different in flown animals [1]. To better understand this immune response modification, we have now determined how individual VH genes have been used to build specific IgM binding sites in animals immunized on earth or in space. This new study revealed quantitative and qualitative modifications in VH genes expression. These data confirm that a spaceflight might affect the humoral response.

Quorum sensing influences Vibrio harveyi growth rates in a manner not fully accounted for by the marker effect of bioluminescence.

Science.gov (United States)

Nackerdien, Zeena E; Keynan, Alexander; Bassler, Bonnie L; Lederberg, Joshua; Thaler, David S

2008-02-27

The light-emitting Vibrios provide excellent material for studying the interaction of cellular communication with growth rate because bioluminescence is a convenient marker for quorum sensing. However, the use of bioluminescence as a marker is complicated because bioluminescence itself may affect growth rate, e.g. by diverting energy. The marker effect was explored via growth rate studies in isogenic Vibrio harveyi (Vh) strains altered in quorum sensing on the one hand, and bioluminescence on the other. By hypothesis, growth rate is energy limited: mutants deficient in quorum sensing grow faster because wild type quorum sensing unleashes bioluminescence and bioluminescence diverts energy. Findings reported here confirm a role for bioluminescence in limiting Vh growth rate, at least under the conditions tested. However, the results argue that the bioluminescence is insufficient to explain the relationship of growth rate and quorum sensing in Vh. A Vh mutant null for all genes encoding the bioluminescence pathway grew faster than wild type but not as fast as null mutants in quorum sensing. Vh quorum sensing mutants showed altered growth rates that do not always rank with their relative increase or decrease in bioluminescence. In addition, the cell-free culture fluids of a rapidly growing Vibrio parahaemolyticus (Vp) strain increased the growth rate of wild type Vh without significantly altering Vh's bioluminescence. The same cell-free culture fluid increased the bioluminescence of Vh quorum mutants. The effect of quorum sensing on Vh growth rate can be either positive or negative and includes both bioluminescence-dependent and independent components. Bioluminescence tends to slow growth rate but not enough to account for the effects of quorum sensing on growth rate.

Quorum sensing influences Vibrio harveyi growth rates in a manner not fully accounted for by the marker effect of bioluminescence.

Directory of Open Access Journals (Sweden)

Zeena E Nackerdien

2008-02-01

Full Text Available The light-emitting Vibrios provide excellent material for studying the interaction of cellular communication with growth rate because bioluminescence is a convenient marker for quorum sensing. However, the use of bioluminescence as a marker is complicated because bioluminescence itself may affect growth rate, e.g. by diverting energy.The marker effect was explored via growth rate studies in isogenic Vibrio harveyi (Vh strains altered in quorum sensing on the one hand, and bioluminescence on the other. By hypothesis, growth rate is energy limited: mutants deficient in quorum sensing grow faster because wild type quorum sensing unleashes bioluminescence and bioluminescence diverts energy. Findings reported here confirm a role for bioluminescence in limiting Vh growth rate, at least under the conditions tested. However, the results argue that the bioluminescence is insufficient to explain the relationship of growth rate and quorum sensing in Vh. A Vh mutant null for all genes encoding the bioluminescence pathway grew faster than wild type but not as fast as null mutants in quorum sensing. Vh quorum sensing mutants showed altered growth rates that do not always rank with their relative increase or decrease in bioluminescence. In addition, the cell-free culture fluids of a rapidly growing Vibrio parahaemolyticus (Vp strain increased the growth rate of wild type Vh without significantly altering Vh's bioluminescence. The same cell-free culture fluid increased the bioluminescence of Vh quorum mutants.The effect of quorum sensing on Vh growth rate can be either positive or negative and includes both bioluminescence-dependent and independent components. Bioluminescence tends to slow growth rate but not enough to account for the effects of quorum sensing on growth rate.

Prevalence of cardiovascular risk factors, the association with socioeconomic variables in adolescents from low-income region.

Science.gov (United States)

Nascimento-Ferreira, Marcus Vinicius; De Moraes, Augusto Cesar F; Carvalho, Heraclito B; Moreno, Luis A; Gomes Carneiro, André Luiz; dos Reis, Victor Manuel M; Torres-Leal, Francisco Leonardo

2014-01-01

To estimate the prevalence of obesity, overweight, abdominal obesity and high blood pressure in a sample of adolescents from a low-income city in Brazil and to estimate the relationship with the socioeconomic status of the family, the education level of the family provider and the type of school. This cross-sectional study randomly sampled 1,014 adolescents (54.8% girls), between 14-19 years of age, attending high school from Imperatriz (MA). The outcomes of this study were: obesity and overweight, abdominal obesity and high blood pressure (systolic and/ or diastolic). The independent variables were: socioeconomic status (SES) of the family, education level of the family provider (ELFP) and type of school. The confounding variables were: gender, age and physical activity level. Prevalence was estimated, and the association between the endpoints and the independent variables was analyzed using a prevalence ratio (PR), with a 95% confidence interval, estimated by Poisson regression. The overall prevalence of obesity was 3.8%, overweight, 13.1%, abdominal obesity, 22.7% and high blood pressure, 21.3%. The adjusted analysis indicated that girls with high SES showed an increased likelihood to be overweight (PR=1.71 [95% IC: 1.13-2.87]), while private school boys had an increased likelihood of obesity (PR=1.79 [95% CI: 1.04-3.08]) and abdominal obesity (PR =1.64 [95% CI: 1.06-2.54]). The prevalence of CVDR is high in adolescents from this low-income region. Boys from private schools are more likely to have obesity and abdominal obesity, and girls with high SES are more likely to be overweight. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

How 21st century droughts affect food and environmental security

Science.gov (United States)

Kogan, Felix

The first 13th years of the 21st century has begun with a series of widespread, long and intensive droughts around the world. Extreme and severe-to-extreme intensity droughts covered 2-6% and 7-16% of the world land, respectively, affecting environment, economies and humans. These droughts reduced agricultural production, leading to food shortages, human health deterioration, poverty, regional disturbances, population migration and death. This presentation is a travelogue of the 21st century global and regional droughts during the warmest years of the past 100 years. These droughts were identified and monitored with the NOAA operational space technology, called Vegetation Health (VH), which has the longest period of observation and provide good data quality. The VH method was used for assessment of vegetation condition or health, including drought early detection and monitoring. The VH method is based on operational satellites data estimating both land surface greenness (NDVI) and thermal conditions. The 21st century droughts in the USA, Russia, Australia Argentina, Brazil, China, India and other principal grain producing countries were intensive, long, covered large areas and caused huge losses in agricultural production, which affected food and environmental security and led to food riots in some countries. This presentation investigate how droughts affect food and environmental security, if they can be detected earlier, how to monitor their area, intensity, duration and impacts and also their dynamics during the climate warming era with satellite-based vegetation health technology.

[Identification of new conserved and variable regions in the 16S rRNA gene of acetic acid bacteria and acetobacteraceae family].

Science.gov (United States)

Chakravorty, S; Sarkar, S; Gachhui, R

2015-01-01

The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.

Advances in Understanding Decadal Climate Variability

Science.gov (United States)

Busalacchi, Antonio J.

1999-01-01

Recently, a joint Brazil-France-U.S. program, known as PIRATA (Pilot Research moored Array in the Tropical Atlantic), was proposed to begin the deployment of moored measurement platforms in the tropical Atlantic in order to enhance the existing observational data base and subsequent understanding of the processes by which the ocean and atmosphere couple in key regions of the tropical Atlantic Ocean. Empirical studies have suggested that there are strong relationships between tropical Atlantic upper ocean variability, SST, ocean-atmosphere coupling and regional climate variability. During the early 1980's a coordinated set of surface wind, subsurface thermal structure, and subsurface current observations were obtained as part of the U.S.-France SEQUAL-FOCAL process experiment designed to observe the seasonal response of the tropical Atlantic Ocean to surface forcing. Since that time, however, the observational data base for the tropical Atlantic Ocean has disintegrated to a few ship-tracks measuring ocean temperatures and a small collection of tide gauge stations measuring sea level. A more comprehensive set of observations, modeling and empirical studies is now in order to make progress on understanding the regional climate variability. The proposed PIRATA program will use mooring platforms similar to the tropical Pacific Ocean TAO array to measure surface fluxes of momentum and heat and the corresponding changes in the upper ocean thermal structure. It is anticipated that the oceanic data from this monitoring array will also be used in a predictive mode for initialization studies of regional coupled climate models. Of particular interest are zonal and meridional modes of ocean-atmosphere variability within the tropical Atlantic basin that have significant impacts on the regional climate of the bordering continents.

High-resolution spatial databases of monthly climate variables (1961-2010) over a complex terrain region in southwestern China

Science.gov (United States)

Wu, Wei; Xu, An-Ding; Liu, Hong-Bin

2015-01-01

Climate data in gridded format are critical for understanding climate change and its impact on eco-environment. The aim of the current study is to develop spatial databases for three climate variables (maximum, minimum temperatures, and relative humidity) over a large region with complex topography in southwestern China. Five widely used approaches including inverse distance weighting, ordinary kriging, universal kriging, co-kriging, and thin-plate smoothing spline were tested. Root mean square error (RMSE), mean absolute error (MAE), and mean absolute percentage error (MAPE) showed that thin-plate smoothing spline with latitude, longitude, and elevation outperformed other models. Average RMSE, MAE, and MAPE of the best models were 1.16 °C, 0.74 °C, and 7.38 % for maximum temperature; 0.826 °C, 0.58 °C, and 6.41 % for minimum temperature; and 3.44, 2.28, and 3.21 % for relative humidity, respectively. Spatial datasets of annual and monthly climate variables with 1-km resolution covering the period 1961-2010 were then obtained using the best performance methods. Comparative study showed that the current outcomes were in well agreement with public datasets. Based on the gridded datasets, changes in temperature variables were investigated across the study area. Future study might be needed to capture the uncertainty induced by environmental conditions through remote sensing and knowledge-based methods.

Influence of Indian summer monsoon variability on the surface waves in the coastal regions of eastern Arabian Sea

Digital Repository Service at National Institute of Oceanography (India)

SanilKumar, V.; Jesbin, G.

–885, 2016 www.ann-geophys.net/34/871/2016/ doi:10.5194/angeo-34-871-2016 © Author(s) 2016. CC Attribution 3.0 License. Influence of Indian summer monsoon variability on the surface waves in the coastal regions of eastern Arabian Sea V. Sanil Kumar and Jesbin... of the period. The annual average value is ∼ 1.5 m (Anoop et al., 2015). During the non-monsoon period, the land and sea breeze has a signif- icant influence on the wave climate of eastern AS (Glejin Ann. Geophys., 34, 871–885, 2016 www.ann-geophys.net/34...

Variability in the sensitivity among model simulations of permafrost and carbon dynamics in the permafrost region between 1960 and 2009

Science.gov (United States)

McGuire, A. David; Koven, Charles; Lawrence, David M.; Clein, Joy S.; Xia, Jiangyang; Beer, Christian; Burke, Eleanor J.; Chen, Guangsheng; Chen, Xiaodong; Delire, Christine; Jafarov, Elchin; MacDougall, Andrew H.; Marchenko, Sergey S.; Nicolsky, Dmitry J.; Peng, Shushi; Rinke, Annette; Saito, Kazuyuki; Zhang, Wenxin; Alkama, Ramdane; Bohn, Theodore J.; Ciais, Philippe; Decharme, Bertrand; Ekici, Altug; Gouttevin, Isabelle; Hajima, Tomohiro; Hayes, Daniel J.; Ji, Duoying; Krinner, Gerhard; Lettenmaier, Dennis P.; Luo, Yiqi; Miller, Paul A.; Moore, John C.; Romanovsky, Vladimir; Schädel, Christina; Schaefer, Kevin; Schuur, Edward A.G.; Smith, Benjamin; Sueyoshi, Tetsuo; Zhuang, Qianlai

2016-01-01

A significant portion of the large amount of carbon (C) currently stored in soils of the permafrost region in the Northern Hemisphere has the potential to be emitted as the greenhouse gases CO2and CH4 under a warmer climate. In this study we evaluated the variability in the sensitivity of permafrost and C in recent decades among land surface model simulations over the permafrost region between 1960 and 2009. The 15 model simulations all predict a loss of near-surface permafrost (within 3 m) area over the region, but there are large differences in the magnitude of the simulated rates of loss among the models (0.2 to 58.8 × 103 km2 yr−1). Sensitivity simulations indicated that changes in air temperature largely explained changes in permafrost area, although interactions among changes in other environmental variables also played a role. All of the models indicate that both vegetation and soil C storage together have increased by 156 to 954 Tg C yr−1between 1960 and 2009 over the permafrost region even though model analyses indicate that warming alone would decrease soil C storage. Increases in gross primary production (GPP) largely explain the simulated increases in vegetation and soil C. The sensitivity of GPP to increases in atmospheric CO2 was the dominant cause of increases in GPP across the models, but comparison of simulated GPP trends across the 1982–2009 period with that of a global GPP data set indicates that all of the models overestimate the trend in GPP. Disturbance also appears to be an important factor affecting C storage, as models that consider disturbance had lower increases in C storage than models that did not consider disturbance. To improve the modeling of C in the permafrost region, there is the need for the modeling community to standardize structural representation of permafrost and carbon dynamics among models that are used to evaluate the permafrost C feedback and for the modeling and observational communities to

Dicty_cDB: VHK220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK2...20Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

Dicty_cDB: VHK285 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK285 (Link to dictyBase) - - - - - (Link to Original site) VHK2...85F 531 - - - - - - Show VHK285 Library VH (Link to library) Clone ID VHK285 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK2...85Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...85 (VHK285Q) /CSM/VH/VHK2-D/VHK285Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus

OpenAIRE

Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki

2017-01-01

　Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this stu...

Spatiotemporal variability and meteorological control of particulate matter pollution in a large open-pit coal mining region in Colombia

Science.gov (United States)

Morales Rincon, L. A.; Jimenez-Pizarro, R.; Porras-Diaz, H.

2012-12-01

Luis Morales-Rincon (1), Hernan Porras-Diaz (1), Rodrigo Jiménez (2,*) (1) Geomatic Research Group, Department of Civil Engineering, Universidad Industrial de Santander, Bucaramanga, Santander 680002, Colombia; (2) Air Quality Research Group, Department of Chemical and Environmental Engineering, Universidad Nacional de Colombia, Bogota, DC 111321, Colombia *Corresponding author: phone +57-1-316-5000 ext. 14099, fax +57-1-316-5334, e-mail rjimenezp@unal.edu.co The semi-desertic area of Central Cesar, Colombia, produced approximately 44 million tons of coal in 2011. This mining activity has been intensively developed since 2005. There are currently 7 large-scale mining projects in that area. The coal industry has strongly impacted not only the ecosystems, but also the neighboring communities around the coal mines. The main goal of the research work was to characterize spatial and temporal variations of particulate matter (total suspended particulates - TSP - and particulate matter below 10 μm - PM10) as measured at various air quality monitoring stations in Cesar's coal industry region as well as to study the relationship between these variability and meteorological factors. The analysis of the meteorological time series of revealed a complex atmospheric circulation in the region. No clear repetitive diurnal circulation patterns were observed, i.e. statistical mean patterns do not physically represent the actual atmospheric circulation. We attribute this complexity to the interdependence between local and synoptic phenomena over a low altitude, relatively flat area. On the other hand, a comparison of air quality in the mining area with a perimeter station indicates that coal industry in central Cesar has a mayor effect on the levels of particulate matter in the region. Particulate matter concentration is highly variable throughout the year. The strong correlation between TSP and PM10 indicates that secondary aerosols are of minor importance. Furthermore, particle

SPATIAL VARIABILITY IN THE MUDPRAWN UPOGEBIA AFRICANA ...

African Journals Online (AJOL)

A nested sampling design was used to examine the variability in density, biomass, sex ratio and size of the estuarine mudprawn Upogebia africana in six estuaries on the south-east coast of South Africa. The objectives were to test the general hypothesis that there is variability in these variables at the scales of regions, ...

Singular vector decomposition of the internal variability of the Canadian Regional Climate Model

Energy Technology Data Exchange (ETDEWEB)

Diaconescu, Emilia Paula; Laprise, Rene [University of Quebec at Montreal (UQAM), Department of Earth and Atmospheric Sciences, Canadian Network for Regional Climate Modelling and Diagnostics, P.O. Box 8888, Montreal, QC (Canada); Centre ESCER (Etude et Simulation du Climat a l' Echelle Regionale), Montreal, QC (Canada); Zadra, Ayrton [University of Quebec at Montreal (UQAM), Department of Earth and Atmospheric Sciences, Canadian Network for Regional Climate Modelling and Diagnostics, P.O. Box 8888, Montreal, QC (Canada); Environment Canada, Meteorological Research Division, Montreal, QC (Canada); Centre ESCER (Etude et Simulation du Climat a l' Echelle Regionale), Montreal, QC (Canada)

2012-03-15

Previous studies have shown that Regional Climate Models (RCM) internal variability (IV) fluctuates in time depending on synoptic events. This study focuses on the physical understanding of episodes with rapid growth of IV. An ensemble of 21 simulations, differing only in their initial conditions, was run over North America using version 5 of the Canadian RCM (CRCM). The IV is quantified in terms of energy of CRCM perturbations with respect to a reference simulation. The working hypothesis is that IV is arising through rapidly growing perturbations developed in dynamically unstable regions. If indeed IV is triggered by the growth of unstable perturbations, a large proportion of the CRCM perturbations must project onto the most unstable singular vectors (SVs). A set of ten SVs was computed to identify the orthogonal set of perturbations that provide the maximum growth with respect to the dry total-energy norm during the course of the CRCM ensemble of simulations. CRCM perturbations were then projected onto the subspace of SVs. The analysis of one episode of rapid growth of IV is presented in detail. It is shown that a large part of the IV growth is explained by initially small-amplitude unstable perturbations represented by the ten leading SVs, the SV subspace accounting for over 70% of the CRCM IV growth in 36 h. The projection on the leading SV at final time is greater than the projection on the remaining SVs and there is a high similarity between the CRCM perturbations and the leading SV after 24-36 h tangent-linear model integration. The vertical structure of perturbations revealed that the baroclinic conversion is the dominant process in IV growth for this particular episode. (orig.)

Seasonal and Intraseasonal Variability of Mesoscale Convective Systems over the South Asian Monsoon Region

Energy Technology Data Exchange (ETDEWEB)

Virts, Katrina S.; Houze, Robert A.

2016-12-01

Seasonal and intraseasonal differences in mesoscale convective systems (MCSs) over South Asia are examined using A-Train satellites, a ground-based lightning network, and reanalysis fields. Pre-monsoon (April-May) MCSs occur primarily over Bangladesh and the eastern Bay of Bengal. During the monsoon (June-September), small MCSs occur over the Meghalaya Plateau and northeast Himalayan notch, while large and connected MCSs are most widespread over the Bay of Bengal. Monsoon MCSs produce less lightning and exhibit more extensive stratiform and anvil reflectivity structures in CloudSat observations than do pre-monsoon MCSs. During the monsoon season, Bay of Bengal and Meghalaya Plateau MCSs vary with the 30-60 day northward-propagating intraseasonal oscillation, while northeast Himalayan notch MCSs are associated with weak large-scale anomalies but locally enhanced CAPE. During intraseasonal active periods, a zone of enhanced large and connected MCSs, precipitation, and lightning extends from the northeastern Arabian Sea southeast over India and the Bay of Bengal, flanked by suppressed anomalies. Spatial variability is observed within this enhancement zone: lightning is most enhanced where MCSs are less enhanced, and vice versa. Reanalysis composites indicate that Bay of Bengal MCSs are associated with monsoon depressions, which are frequent during active monsoon periods, while Meghalaya Plateau MCSs are most frequent at the end of break periods, as anomalous southwesterly winds strengthen moist advection toward the terrain. Over both regions, MCSs exhibit more extensive stratiform and anvil regions and less lightning when the large-scale environment is moister, and vice versa.

Adaptive antibody diversification through N-linked glycosylation of the immunoglobulin variable region.

Science.gov (United States)

van de Bovenkamp, Fleur S; Derksen, Ninotska I L; Ooijevaar-de Heer, Pleuni; van Schie, Karin A; Kruithof, Simone; Berkowska, Magdalena A; van der Schoot, C Ellen; IJspeert, Hanna; van der Burg, Mirjam; Gils, Ann; Hafkenscheid, Lise; Toes, René E M; Rombouts, Yoann; Plomp, Rosina; Wuhrer, Manfred; van Ham, S Marieke; Vidarsson, Gestur; Rispens, Theo

2018-02-20

A hallmark of B-cell immunity is the generation of a diverse repertoire of antibodies from a limited set of germline V(D)J genes. This repertoire is usually defined in terms of amino acid composition. However, variable domains may also acquire N -linked glycans, a process conditional on the introduction of consensus amino acid motifs ( N -glycosylation sites) during somatic hypermutation. High levels of variable domain glycans have been associated with autoantibodies in rheumatoid arthritis, as well as certain follicular lymphomas. However, the role of these glycans in the humoral immune response remains poorly understood. Interestingly, studies have reported both positive and negative effects on antibody affinity. Our aim was to elucidate the role of variable domain glycans during antigen-specific antibody responses. By analyzing B-cell repertoires by next-generation sequencing, we demonstrate that N -glycosylation sites are introduced at positions in which glycans can affect antigen binding as a result of a specific clustering of progenitor glycosylation sites in the germline sequences of variable domain genes. By analyzing multiple human monoclonal and polyclonal (auto)antibody responses, we subsequently show that this process is subject to selection during antigen-specific antibody responses, skewed toward IgG4, and positively contributes to antigen binding. Together, these results highlight a physiological role for variable domain glycosylation as an additional layer of antibody diversification that modulates antigen binding.

Post-Training Reversible Disconnection of the Ventral Hippocampal-Basolateral Amygdaloid Circuits Impairs Consolidation of Inhibitory Avoidance Memory in Rats

Science.gov (United States)

Wang, Gong-Wu; Liu, Jian; Wang, Xiao-Qin

2017-01-01

The ventral hippocampus (VH) and the basolateral amygdala (BLA) are both crucial in inhibitory avoidance (IA) memory. However, the exact role of the VH-BLA circuit in IA memory consolidation is unclear. This study investigated the effect of post-training reversible disconnection of the VH-BLA circuit in IA memory consolidation. Male Wistar rats…

FY1995 development of a novel rapid immunoassay technology; 1995 nendo shinkina kosoku men'eki sokutei gijutsu no kaihatsu

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-03-01

By utilizing the phenomenon that the antigen induces association of VH and VL, which are the antigen-recognizing fragments of antibody, develop a novel rapid immunoassay technology which will eliminate the defects of conventional immunoassays, such as long measuring time and requirement of expensive large automated apparatus. In addition, develop a methodology to make Fvs with low VH-VL affinity but that associate tightly in the presence of antigen. Using a model anti-hen egg lysozyme antibody HyHEL-10 Fv and BlAcore, we have clarified the kinetic basis of the Fv stabilization by HEL. By labeling HyHEL-10 VH, VL with succinimide esters of fluorescein and tetramethylrhodamin, respectively, at their N-termini, we could successfully detect VH-VL association by the increment of fluorescence resonance energy transfer. As a result, 1 {mu} g/ml of antigen could be detected homogeneously in less than 5 minutes. Some VH-VL association measurement systems were made by utilizing M13 phage display of VH fragments of HyHEL-10, anti-nitrophenacetyl, anti-digoxin antibodies. (NEDO)

Hillslope terracing effects on the spatial variability of plant development as assessed by NDVI in vineyards of the Priorat region (NE Spain).

Science.gov (United States)

Martínez-Casasnovas, José A; Ramos, María Concepción; Espinal-Utgés, Sílvia

2010-04-01

The availability of heavy machinery and the vineyard restructuring and conversion plans of the European Union Common Agricultural Policy (Commission Regulation EC no. 1227/2000 of 31 May 2000) have encouraged the restructuring of many vineyards on hillslopes of Mediterranean Europe, through the creation of terraces to favor the mechanization of agricultural work. Terrace construction requires cutting and filling operations that create soil spatial variability, which affects soil properties and plant development. In the present paper, we study the effects of hillslope terracing on the spatial variability of the normalized difference vegetation index (NDVI) in fields of the Priorat region (NE Spain) during 2004, 2005, and 2006. This index was computed from high-resolution remote sensing data (Quickbird-2). Detailed digital terrain models before and after terrace construction were used to assess the earth movements. The results indicate that terracing by heavy machinery induced high variability on the NDVI values over the years, showing significant differences as effect of the cut and fill operations.

A SYSTEMATIC SEARCH FOR COROTATING INTERACTION REGIONS IN APPARENTLY SINGLE GALACTIC WOLF-RAYET STARS. II. A GLOBAL VIEW OF THE WIND VARIABILITY

International Nuclear Information System (INIS)

Chene, A.-N.; St-Louis, N.

2011-01-01

This study is the second part of a survey searching for large-scale spectroscopic variability in apparently single Wolf-Rayet (WR) stars. In a previous paper (Paper I), we described and characterized the spectroscopic variability level of 25 WR stars observable from the northern hemisphere and found 3 new candidates presenting large-scale wind variability, potentially originating from large-scale structures named corotating interaction regions (CIRs). In this second paper, we discuss an additional 39 stars observable from the southern hemisphere. For each star in our sample, we obtained 4-5 high-resolution spectra with a signal-to-noise ratio of ∼100 and determined its variability level using the approach described in Paper I. In total, 10 new stars are found to show large-scale spectral variability of which 7 present CIR-type changes (WR 8, WR 44, WR55, WR 58, WR 61, WR 63, WR 100). Of the remaining stars, 20 were found to show small-amplitude changes and 9 were found to show no spectral variability as far as can be concluded from the data on hand. Also, we discuss the spectroscopic variability level of all single galactic WR stars that are brighter than v ∼ 12.5, and some WR stars with 12.5 < v ≤ 13.5, i.e., all the stars presented in our two papers and four more stars for which spectra have already been published in the literature. We find that 23/68 stars (33.8%) present large-scale variability, but only 12/54 stars (∼22.1%) are potentially of CIR type. Also, we find that 31/68 stars (45.6%) only show small-scale variability, most likely due to clumping in the wind. Finally, no spectral variability is detected based on the data on hand for 14/68 (20.6%) stars. Interestingly, the variability with the highest amplitude also has the widest mean velocity dispersion.

Comparison of Midterm Efficiency and Complications of Tension-Free Vaginal Tape Alone and Tension-Free Vaginal Tape Performed with Vaginal Hysterectomy

Directory of Open Access Journals (Sweden)

Emre Sinan Güngör

2017-09-01

Full Text Available Aim: To evaluate and compare the results and complications of tension-free vaginal tape (TVT when performed alone or with vaginal hysterectomy (VH and to evaluate the mid-term success rates of TVT for both groups. Methods: A retrospective study was performed on 179 patients who had TVT alone for stress urinary incontinance (SUI or TVT with VH for SUI and vaginal prolapse. Demographic, outcome and complication data were obtained from medical records. The main outcome measures were postoperative SUI and voiding dysfunction. Results: The mean age of the patients who underwent TVT and TVT+VH were 50.2±6.8 and 52.2±8.1, respectively (p>0.05 and the mean parity was 4±2.07 and 4.15±2.02, respectively (p>0.05. The success rate was significantly higher in TVT alone group than in TVT+VH group (93.6% vs. 84.5%, p0.05. Overall complication rate was higher in TVT+VH group (4.2% vs. 9.5%, p<0.05. Postoperative residuel urine volumes were significantly higher than preoperative residuel urine volumes in both groups (p=0.001. Due to mesh rejection, second surgery was performed in one patient from both groups to reomove the mesh. Conclusion: Midterm success rates were significantly higher in TVT group than in TVT+VH group, but success rates in TVT+VH were acceptable. Overall complication rates were higher in TVT+VH group; requirement for a second surgery was similar for both groups.

High interannual variability of sea ice thickness in the Arctic region.

Science.gov (United States)

Laxon, Seymour; Peacock, Neil; Smith, Doug

2003-10-30

Possible future changes in Arctic sea ice cover and thickness, and consequent changes in the ice-albedo feedback, represent one of the largest uncertainties in the prediction of future temperature rise. Knowledge of the natural variability of sea ice thickness is therefore critical for its representation in global climate models. Numerical simulations suggest that Arctic ice thickness varies primarily on decadal timescales owing to changes in wind and ocean stresses on the ice, but observations have been unable to provide a synoptic view of sea ice thickness, which is required to validate the model results. Here we use an eight-year time-series of Arctic ice thickness, derived from satellite altimeter measurements of ice freeboard, to determine the mean thickness field and its variability from 65 degrees N to 81.5 degrees N. Our data reveal a high-frequency interannual variability in mean Arctic ice thickness that is dominated by changes in the amount of summer melt, rather than by changes in circulation. Our results suggest that a continued increase in melt season length would lead to further thinning of Arctic sea ice.

Genetic variability and health of Norway spruce stands in the Regional Directorate of the State Forests in Krosno

Directory of Open Access Journals (Sweden)

Gutkowska Justyna

2017-03-01

Full Text Available The study was conducted in 2015 in six spruce stands situated in different forest districts administratively belonging to the Regional Directorate of State Forests in Krosno. Each spruce population was represented by 30 trees and assessed in terms of their current health status. Genetic analyses were performed on shoot samples from each tree using nine nuclear DNA markers and one mitochondrial DNA marker (nad1. The health status of the trees was described according to the classification developed by Szczepkowski and Tarasiuk (2005 and the correlation between health classes and the level of genetic variability was computed with STATISTICA (α = 0.05.

Dicty_cDB: VHK273 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK273 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...73F 620 - - - - - - Show VHK273 Library VH (Link to library) Clone ID VHK273 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK273Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK273 (VHK273Q) /CSM/VH/VHK2-D/VHK273Q.Seq.d/ AACTCTCGAGTGCAAAA...27874 ) Dictyostelium discoideum cDNA clone:ddv63k23, 5' ... 1170 0.0 1 ( BJ42787

Dicty_cDB: VHK256 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK256 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...56F 620 - - - - - - Show VHK256 Library VH (Link to library) Clone ID VHK256 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-C/VHK256Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK256 (VHK256Q) /CSM/VH/VHK2-C/VHK256Q.Seq.d/ AACTCTCGAGTGCAAAA...27874 ) Dictyostelium discoideum cDNA clone:ddv63k23, 5' ... 1170 0.0 1 ( BJ42787

State-of-the-Art for Assessing Earthquake Hazards in the United States. Report 25. Parameters for Specifying Intensity-Related Earthquake Ground Motions.

Science.gov (United States)

1987-09-01

and Sponheuer, W. 1969. Scale of Seismic Intensity: Proc. Fourth World Conf. on Earthquake Engineering, Santiago, Chile . Murphy, J. R., and O’Brien, L...Predom V/H el, V/I Vel V/H Displ V/H sec VIH Period Period Predom Accel cm/sec Vel cm Disp .05 Dur sec sec Period S11 2 0.48 MODIFIED MERCALLI INTENSITY...0.1 0. 0.16 142.20 Long. Vert Hor Vert Ratio Ratio Vert Ratio Vert r io Du r atio Predom Predom VIH Acce V/H Vel V /H Dspi V H sec 1, H Period Period

The impact of an urban-industrial region on the magnitude and variability of persistent organic pollutant deposition to Lake Michigan.

Science.gov (United States)

Hornbuckle, Keri C; Green, Mark L

2003-09-01

A predictive model for gas-phase PCBs and trans-nonachlor over Lake Michigan has been constructed and the resulting data examined for trends. In this paper, we describe the model results to show how the magnitude and variability of a plume of contaminants from the Chicago area contributes to a highly variable region of net contaminant deposition over the entire lake. For the whole lake, gross annual deposition of PCBs is approximately 3200 kg, although the net annual gas exchange is not significantly different from zero. The data-driven model illustrates that on a daily basis, the net exchange of persistent organic pollutants (POPs) can change from net deposition to net volatilization depending on the area of plume impact. These findings suggest that i) control of urban areas can accelerate the rate of volatilization from lakes; and ii) release of POPs from urban areas is largely a result of volatilization processes.

IRAS variables as galactic structure tracers - Classification of the bright variables

Science.gov (United States)

Allen, L. E.; Kleinmann, S. G.; Weinberg, M. D.

1993-01-01

The characteristics of the 'bright infrared variables' (BIRVs), a sample consisting of the 300 brightest stars in the IRAS Point Source Catalog with IRAS variability index VAR of 98 or greater, are investigated with the purpose of establishing which of IRAS variables are AGB stars (e.g., oxygen-rich Miras and carbon stars, as was assumed by Weinberg (1992)). Results of the analysis of optical, infrared, and microwave spectroscopy of these stars indicate that, out of 88 stars in the BIRV sample identified with cataloged variables, 86 can be classified as Miras. Results of a similar analysis performed for a color-selected sample of stars, using the color limits employed by Habing (1988) to select AGB stars, showed that, out of 52 percent of classified stars, 38 percent are non-AGB stars, including H II regions, planetary nebulae, supergiants, and young stellar objects, indicating that studies using color-selected samples are subject to misinterpretation.

Characteristics of aggregation of daily rainfall in a middle-latitudes region during a climate variability in annual rainfall amount

Science.gov (United States)

Lucero, Omar A.; Rozas, Daniel

Climate variability in annual rainfall occurs because the aggregation of daily rainfall changes. A topic open to debate is whether that change takes place because rainfall becomes more intense, or because it rains more often, or a combination of both. The answer to this question is of interest for water resources planning, hydrometeorological design, and agricultural management. Change in the number of rainy days can cause major disruptions in hydrological and ecological systems, with important economic and social effects. Furthermore, the characteristics of daily rainfall aggregation in ongoing climate variability provide a reference to evaluate the capability of GCM to simulate changes in the hydrologic cycle. In this research, we analyze changes in the aggregation of daily rainfall producing a climate positive trend in annual rainfall in central Argentina, in the southern middle-latitudes. This state-of-the-art agricultural region has a semiarid climate with dry and wet seasons. Weather effects in the region influence world-market prices of several crops. Results indicate that the strong positive trend in seasonal and annual rainfall amount is produced by an increase in number of rainy days. This increase takes place in the 3-month periods January-March (summer) and April-June (autumn). These are also the 3-month periods showing a positive trend in the mean of annual rainfall. The mean of the distribution of annual number of rainy day (ANRD) increased in 50% in a 36-year span (starting at 44 days/year). No statistically significant indications on time changes in the probability distribution of daily rainfall amount were found. Non-periodic fluctuations in the time series of annual rainfall were analyzed using an integral wavelet transform. Fluctuations with a time scale of about 10 and 20 years construct the trend in annual rainfall amount. These types of non-periodic fluctuations have been observed in other regions of the world. This suggests that results of

Functional interpretation of representative soil spatial-temporal variability at the Central region of European territory of Russia

Science.gov (United States)

Vasenev, I.

2012-04-01

The essential spatial and temporal variability is mutual feature for most natural and man-changed soils at the Central region of European territory of Russia. The original spatial heterogeneity of forest and forest-steppe soils has been further complicated by a specific land-use history and different-direction soil successions due to environmental changes and human impacts. For demand-driven land-use planning and decision making the quantitative analysis, modeling and functional-ecological interpretation of representative soil cover patterns spatial variability is an important and challenging task that receives increasing attention from scientific society, private companies, governmental and environmental bodies. On basis of long-term different-scale soil mapping, key plot investigation, land quality and land-use evaluation, soil forming and degradation processes modeling, functional-ecological typology of the zonal set of elementary soil cover patterns (ESCP) has been done in representative natural and man transformed ecosystems of the forest, forest-steppe and steppe zones at the Central region of European territory of Russia (ETR). The validation and ranging of the limiting factors of functional quality and ecological state have been made for dominating and most dynamical components of ESCP regional-typological forms - with application of local GIS, traditional regression kriging and correlation tree models. Development, zonal-regional differentiation and verification of the basic set of criteria and algorithms for logically formalized distinguishing of the most "stable" & "hot" areas in soil cover patterns make it possible for quantitative assessment of dominating in them elementary landscape, soil-forming and degradation processes. The received data essentially expand known ranges of the soil forming processes (SFP) rate «in situ». In case of mature forests mutual for them the windthrow impacts and lateral processes make SFPs more active and complex both in

Overview of surface ozone variability in East Asia-North Pacific region during IGAC/APARE (1994--1996).

Science.gov (United States)

Lam, K S; Wang, T J; Wang, T; Tang, J; Kajii, Y; Liu, C M; Shim, S G

2004-01-01

Surface ozone (O3) was measured at Oki Island (Japan), Cheju Island (South Korea), Lanyu Island (Taiwan Province, China), Cape D'Aguilar (Hong Kong SAR) and Lin'an, Longfenshan, Waliguan (China mainland) during January 1994--December 1996 as a component of IGAC/APARE (International Global Atmospheric Chemistry/East Asia-North Pacific Regional Experiment). This paper gave a joint discussion on the observational results at these stations over the study region. Investigations showed that the average of surface O3 mixing ratios at the seven sites are 47.9+/-15.8, 48.1+/-17.9, 30.2+/-16.4, 31.6+/-17.5, 36.3+/-17.5, 34.8+/-11.5 and 48.2+/-9.5 ppbv, respectively. Significant diurnal variations of surface O3 have been observed at Oki, Cheju, D'Aguilar, Lin'an and Longfenshan. Their annual averaged diurnal differences range from 8 to 23 ppbv and differ in each season. Surface O3 at Lanyu and Waliguan do not show strong diurnal variability. Seasonal cycles of surface O3 showed difference at the temperate and the subtropical remote sites. Oki has a summer minimum-spring maximum, while Lanyu has a summer minimum-autumn maximum. The suburban sites at D'Aguilar and Lin'an report high-level O3 in autumn and low level O3 in summer. Surface O3 remains-high in autumn and low in winter at the rural site Longfenshan. For the global background station Waliguan, surface O3 exhibits a broad spring-summer maximum and autumn-winter minimum. The backward air trajectories to these sites have shown different pathways of long-range transport of air pollution from East Asia Continent to North Pacific Ocean. Surface O3 was found to be strongly and positively correlated with CO at Oki and Lanyu, especially in spring and autumn, reflecting the substantial photochemical buildup of O3 on a regional scale. It is believed that the regional sources of pollution in East Asia have enhanced the average surface O3 concentrations in the background atmosphere of North Pacific.

Isotopic source signatures: Impact of regional variability on the δ13CH4 trend and spatial distribution

Science.gov (United States)

Feinberg, Aryeh I.; Coulon, Ancelin; Stenke, Andrea; Schwietzke, Stefan; Peter, Thomas

2018-02-01

The atmospheric methane growth rate has fluctuated over the past three decades, signifying variations in methane sources and sinks. Methane isotopic ratios (δ13CH4) differ between emission categories, and can therefore be used to distinguish which methane sources have changed. However, isotopic modelling studies have mainly focused on uncertainties in methane emissions rather than uncertainties in isotopic source signatures. We simulated atmospheric δ13CH4 for the period 1990-2010 using the global chemistry-climate model SOCOL. Empirically-derived regional variability in the isotopic signatures was introduced in a suite of sensitivity simulations. These simulations were compared to a baseline simulation with commonly used global mean isotopic signatures. We investigated coal, natural gas/oil, wetland, livestock, and biomass burning source signatures to determine whether regional variations impact the observed isotopic trend and spatial distribution. Based on recently published source signature datasets, our calculated global mean isotopic signatures are in general lighter than the commonly used values. Trends in several isotopic signatures were also apparent during the period 1990-2010. Tropical livestock emissions grew during the 2000s, introducing isotopically heavier livestock emissions since tropical livestock consume more C4 vegetation than midlatitude livestock. Chinese coal emissions, which are isotopically heavy compared to other coals, increase during the 2000s leading to higher global values of δ13CH4 for coal emissions. EDGAR v4.2 emissions disagree with the observed atmospheric isotopic trend for almost all simulations, confirming past doubts about this emissions inventory. The agreement between the modelled and observed δ13CH4 interhemispheric differences improves when regional source signatures are used. Even though the simulated results are highly dependent on the choice of methane emission inventories, they emphasize that the commonly used

Nanobodies and Nanobody-Based Human Heavy Chain Antibodies As Antitumor Therapeutics

Directory of Open Access Journals (Sweden)

Peter Bannas

2017-11-01

Full Text Available Monoclonal antibodies have revolutionized cancer therapy. However, delivery to tumor cells in vivo is hampered by the large size (150 kDa of conventional antibodies. The minimal target recognition module of a conventional antibody is composed of two non-covalently associated variable domains (VH and VL. The proper orientation of these domains is mediated by their hydrophobic interface and is stabilized by their linkage to disulfide-linked constant domains (CH1 and CL. VH and VL domains can be fused via a genetic linker into a single-chain variable fragment (scFv. scFv modules in turn can be fused to one another, e.g., to generate a bispecific T-cell engager, or they can be fused in various orientations to antibody hinge and Fc domains to generate bi- and multispecific antibodies. However, the inherent hydrophobic interaction of VH and VL domains limits the stability and solubility of engineered antibodies, often causing aggregation and/or mispairing of V-domains. Nanobodies (15 kDa and nanobody-based human heavy chain antibodies (75 kDa can overcome these limitations. Camelids naturally produce antibodies composed only of heavy chains in which the target recognition module is composed of a single variable domain (VHH or Nb. Advantageous features of nanobodies include their small size, high solubility, high stability, and excellent tissue penetration in vivo. Nanobodies can readily be linked genetically to Fc-domains, other nanobodies, peptide tags, or toxins and can be conjugated chemically at a specific site to drugs, radionuclides, photosensitizers, and nanoparticles. These properties make them particularly suited for specific and efficient targeting of tumors in vivo. Chimeric nanobody-heavy chain antibodies combine advantageous features of nanobodies and human Fc domains in about half the size of a conventional antibody. In this review, we discuss recent developments and perspectives for applications of nanobodies and nanobody

Nanobodies and Nanobody-Based Human Heavy Chain Antibodies As Antitumor Therapeutics.

Science.gov (United States)

Bannas, Peter; Hambach, Julia; Koch-Nolte, Friedrich

2017-01-01

Monoclonal antibodies have revolutionized cancer therapy. However, delivery to tumor cells in vivo is hampered by the large size (150 kDa) of conventional antibodies. The minimal target recognition module of a conventional antibody is composed of two non-covalently associated variable domains (VH and VL). The proper orientation of these domains is mediated by their hydrophobic interface and is stabilized by their linkage to disulfide-linked constant domains (CH1 and CL). VH and VL domains can be fused via a genetic linker into a single-chain variable fragment (scFv). scFv modules in turn can be fused to one another, e.g., to generate a bispecific T-cell engager, or they can be fused in various orientations to antibody hinge and Fc domains to generate bi- and multispecific antibodies. However, the inherent hydrophobic interaction of VH and VL domains limits the stability and solubility of engineered antibodies, often causing aggregation and/or mispairing of V-domains. Nanobodies (15 kDa) and nanobody-based human heavy chain antibodies (75 kDa) can overcome these limitations. Camelids naturally produce antibodies composed only of heavy chains in which the target recognition module is composed of a single variable domain (VHH or Nb). Advantageous features of nanobodies include their small size, high solubility, high stability, and excellent tissue penetration in vivo . Nanobodies can readily be linked genetically to Fc-domains, other nanobodies, peptide tags, or toxins and can be conjugated chemically at a specific site to drugs, radionuclides, photosensitizers, and nanoparticles. These properties make them particularly suited for specific and efficient targeting of tumors in vivo . Chimeric nanobody-heavy chain antibodies combine advantageous features of nanobodies and human Fc domains in about half the size of a conventional antibody. In this review, we discuss recent developments and perspectives for applications of nanobodies and nanobody-based human heavy

Evaluation of Sentinel-1A Data For Above Ground Biomass Estimation in Different Forests in India

Science.gov (United States)

Vadrevu, Krishna Prasad

2017-01-01

Use of remote sensing data for mapping and monitoring of forest biomass across large spatial scales can aid in addressing uncertainties in carbon cycle. Earlier, several researchers reported on the use of Synthetic Aperture Radar (SAR) data for characterizing forest structural parameters and the above ground biomass estimation. However, these studies cannot be generalized and the algorithms cannot be applied to all types of forests without additional information on the forest physiognomy, stand structure and biomass characteristics. The radar backscatter signal also saturates as forest parameters such as biomass and the tree height increase. It is also not clear how different polarizations (VV versus VH) impact the backscatter retrievals in different forested regions. Thus, it is important to evaluate the potential of SAR data in different landscapes for characterizing forest structural parameters. In this study, the SAR data from Sentinel-1A has been used to characterize forest structural parameters including the above ground biomass from tropical forests of India. Ground based data on tree density, basal area and above ground biomass data from thirty-eight different forested sites has been collected to relate to SAR data. After the pre-processing of Sentinel 1-A data for radiometric calibration, geo-correction, terrain correction and speckle filtering, the variability in the backscatter signal in relation tree density, basal area and above biomass density has been investigated. Results from the curve fitting approach suggested exponential model between the Sentinel-1A backscatter versus tree density and above ground biomass whereas the relationship was almost linear with the basal area in the VV polarization mode. Of the different parameters, tree density could explain most of the variations in backscatter. Both VV and VH backscatter signals could explain only thirty and thirty three percent of variation in above biomass in different forest sites of India

Data sets used in the analysis presented in the manuscript “Regional and Hemispheric Influences on Temporal Variability in Baseline Carbon Monoxide and Ozone over the Northeast US”

Data.gov (United States)

U.S. Environmental Protection Agency — This dataset documents that all of the data analyzed in the manuscript "Regional and Hemispheric Influences on Temporal Variability in Baseline Carbon Monoxide and...

Searching for I-band variability in stars in the M/L spectral transition region

Science.gov (United States)

Ramsay, Gavin; Hakala, Pasi; Doyle, J. Gerry

2015-10-01

We report on I-band photometric observations of 21 stars with spectral types between M8 and L4 made using the Isaac Newton Telescope. The total amount of time for observations which had a cadence of test for photometric variability using the Kruskal-Wallis H-test and find that four sources (2MASS J10224821+5825453, 2MASS J07464256+2000321, 2MASS J16262034+3925190 and 2MASS J12464678+4027150) were found to be significantly variable at least on one epoch. Three of these sources are reported as photometrically variable for the first time. If we include sources which were deemed marginally variable, the number of variable sources is 6 (29 per cent). No flares were detected from any source. The percentage of sources which we found were variable is similar to previous studies. We summarize the mechanisms which have been put forward to explain the light curves of brown dwarfs.

Evolution of variable stars

International Nuclear Information System (INIS)

Becker, S.A.

1986-08-01

Throughout the domain of the H R diagram lie groupings of stars whose luminosity varies with time. These variable stars can be classified based on their observed properties into distinct types such as β Cephei stars, δ Cephei stars, and Miras, as well as many other categories. The underlying mechanism for the variability is generally felt to be due to four different causes: geometric effects, rotation, eruptive processes, and pulsation. In this review the focus will be on pulsation variables and how the theory of stellar evolution can be used to explain how the various regions of variability on the H R diagram are populated. To this end a generalized discussion of the evolutionary behavior of a massive star, an intermediate mass star, and a low mass star will be presented. 19 refs., 1 fig., 1 tab

NMDA-NO signaling in the dorsal and ventral hippocampus time-dependently modulates the behavioral responses to forced swimming stress.

Science.gov (United States)

Diniz, Cassiano R A F; Casarotto, Plínio C; Joca, Sâmia R L

2016-07-01

Hodological and genetic differences between dorsal (DH) and ventral (VH) hippocampus may convey distinct behavioral roles. DH is responsible for mediating cognitive process, such as learning and memory, while VH modulates neuroendocrine and emotional-motivational responses to stress. Manipulating glutamatergic NMDA receptors and nitric oxide (NO) systems of the hippocampus induces important changes in behavioral responses to stress. Nevertheless, there is no study concerning functional differences between DH and VH in the modulation of behavioral responses induced by stress models predictive of antidepressant effects. Thus, this study showed that reversible blockade of the DH or VH of animals submitted to the forced swimming test (FST), by using cobalt chloride (calcium-dependent synaptic neurotransmission blocker), was not able to change immobility time. Afterwards, the NMDA-NO system was evaluated in the FST by means of intra-DH or intra-VH administration of NMDA receptor antagonist (AP7), NOS1 and sGC inhibitors (N-PLA and ODQ, respectively). Bilateral intra-DH injections after pretest or before test were able to induce antidepressant-like effects in the FST. On the other hand, bilateral VH administration of AP-7, N-PLA and ODQ induced antidepressant-like effects only when injected before the test. Administration of NO scavenger (C-PTIO) intra-DH, after pretest and before test, or intra-VH before test induced similar results. Increased NOS1 levels was associated to stress exposure in the DH. These results suggest that the glutamatergic-NO system of the DH and VH are both able to modulate behavioral responses in the FST, albeit with differential participation along time after stress exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

Vitreous humor analysis for the detection of xenobiotics in forensic toxicology: a review.

Science.gov (United States)

Bévalot, Fabien; Cartiser, Nathalie; Bottinelli, Charline; Fanton, Laurent; Guitton, Jérôme

2016-01-01

Vitreous humor (VH) is a gelatinous substance contained in the posterior chamber of the eye, playing a mechanical role in the eyeball. It has been the subject of numerous studies in various forensic applications, primarily for the assessment of postmortem interval and for postmortem chemical analysis. Since most of the xenobiotics present in the bloodstream are detected in VH after crossing the selective blood-retinal barrier, VH is an alternative matrix useful for forensic toxicology. VH analysis offers particular advantages over other biological matrices: it is less prone to postmortem redistribution, is easy to collect, has relatively few interfering compounds for the analytical process, and shows sample stability over time after death. The present study is an overview of VH physiology, drug transport and elimination. Collection, storage, analytical techniques and interpretation of results from qualitative and quantitative points of view are dealt with. The distribution of xenobiotics in VH samples is thus discussed and illustrated by a table reporting the concentrations of 106 drugs from more than 300 case reports. For this purpose, a survey was conducted of publications found in the MEDLINE database from 1969 through April 30, 2015.

Wages and Subjective Assessments of Regional Labour Market Pressure

OpenAIRE

Carlsen, Fredrik; Johansen, Kåre

2002-01-01

We utilise a rich set of regional labour market variables to explain regional variation in Norwegian manufacturing wages. In particular, regional indicators of labour market pressure are computed from survey data in which respondents are asked to evaluate local job prospects. We find that average reported satisfaction with local job prospects and other survey-based indicators perform better in regional wage equations than traditional labour market variables, including the regional unemploymen...

Are revised models better models? A skill score assessment of regional interannual variability

Science.gov (United States)

Sperber, Kenneth R.; Participating AMIP Modelling Groups

1999-05-01

Various skill scores are used to assess the performance of revised models relative to their original configurations. The interannual variability of all-India, Sahel and Nordeste rainfall and summer monsoon windshear is examined in integrations performed under the experimental design of the Atmospheric Model Intercomparison Project. For the indices considered, the revised models exhibit greater fidelity at simulating the observed interannual variability. Interannual variability of all-India rainfall is better simulated by models that have a more realistic rainfall climatology in the vicinity of India, indicating the beneficial effect of reducing systematic model error.

NEAR-INFRARED PERIODIC AND OTHER VARIABLE FIELD STARS IN THE FIELD OF THE CYGNUS OB7 STAR-FORMING REGION

Energy Technology Data Exchange (ETDEWEB)

Wolk, Scott J.; Rice, Thomas S. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Aspin, Colin A. [Institute for Astronomy, University of Hawaii at Manoa, 640 North Aohoku Place, Hilo, HI 96720 (United States)

2013-04-15

We present a subset of the results of a three-season, 124 night, near-infrared monitoring campaign of the dark clouds Lynds 1003 and Lynds 1004 in the Cygnus OB7 star-forming region. In this paper, we focus on the field star population. Using three seasons of UKIRT J, H, and K-band observations spanning 1.5 years, we obtained high-quality photometry on 9200 stars down to J = 17 mag, with photometric uncertainty better than 0.04 mag. After excluding known disk-bearing stars we identify 149 variables-1.6% of the sample. Of these, about 60 are strictly periodic, with periods predominantly <2 days. We conclude this group is dominated by eclipsing binaries. A few stars have long period signals of between 20 and 60 days. About 25 stars have weak modulated signals, but it was not clear if these were periodic. Some of the stars in this group may be diskless young stellar objects with relatively large variability due to cool starspots. The remaining {approx}60 stars showed variations which appear to be purely stochastic.

The Ventasso Horse: genetic characterization by microsatellites markers

Directory of Open Access Journals (Sweden)

M. Blasi

2010-04-01

Full Text Available The genetic structure of Ventasso Horse (VH was investigated using 12 microsatellites. The analyses were carried out on 117 VH individuals and the results were compared with those obtained analysing 11 other breeds reared in Italy. All microsatellites were polymorphic in VH and in the other breeds. A total of 124 alleles (from 6 to 19 alleles per microsatellite were detected. Average heterozygosity was 0.743 in VH and ranged from 0.613 to 0.759 in the other breeds. The mean FST value had an average value of 0.0932. Genetic distances were calculated using Nei’s standard genetic distance (Ds. The smallest Ds values were found between VH and Anglo-Arab, Thoroughbred, Maremmano and Lipizzan horse breeds. Phylogenetic trees constructed using neighbour-joining method showed two clear separate clusters: the first includes Bardigiano, Haflinger and Italian Heavy Draught Horse, the second contains the other 9 breeds.

ANALYSIS AND PLANNING OF REGIONAL DEVELOPMENT - CONTEXTUAL VARIABLES TO DEVELOP A MODEL FOR MONITORING FINANCIAL INDICATORS AT REGIONAL LEVEL.

Directory of Open Access Journals (Sweden)

CRIS TINA GRADEA

2013-12-01

Full Text Available Application of quantitative techniques in regional analysis can provide an understanding of both the change in time of regional economic performance and the interdependencies between economic sectors, including the use of projections to test the potential future development of the region. Qualitative techniques allow also the explanation of the reason for regional development patterns occurring in a region and the improvement of analysts' ability to reflect on the results and economic opportunities for a future based on collective experience, wisdom and judgment of the actors in region economies.

Characteristic time series and operation region of the system of two tank reactors (CSTR) with variable division of recirculation stream

International Nuclear Information System (INIS)

Merta, Henryk

2006-01-01

The paper deals with a system of a cascade of two tank reactors, being characterized by the variable stream of recirculating fluid at each stage. The assumed mathematical model enables one to determine the system's dynamics for the case when there is no time delay and for the opposite case. The time series of the conversion degree and of the dimensionless fluid temperature, characteristic for the system considered as well as the operation regions-the latter-basing on Feingenbaum diagrams with respect to the division ratio of the recirculating stream are presented

Dicty_cDB: VHK209 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK209 (Link to dictyBase) - - - Contig-U16260-1 VHK209P (Link to Original site) VHK2...09F 573 VHK209Z 765 VHK209P 1318 - - Show VHK209 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK209Q.Seq.d/ Representative seq. ID VHK2...09P (Link to Original site) Representative DNA sequence >VHK209 (VHK209Q) /CSM/VH/VHK2-A/VHK2...Sequences producing significant alignments: (bits) Value N ( BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k2

Dicty_cDB: VHK221 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK221 (Link to dictyBase) - - - - VHK221P (Link to Original site) VHK221F 603 VHK2...21Z 724 VHK221P 1307 - - Show VHK221 Library VH (Link to library) Clone ID VHK221 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-A/VHK221Q.Seq.d/ Representative seq. ID VHK221P (Link to... Original site) Representative DNA sequence >VHK221 (VHK221Q) /CSM/VH/VHK2-A/VHK221Q.Seq.d/ AACTCTCGAGTGCAAA

Dicty_cDB: VHK207 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK207 (Link to dictyBase) - - - Contig-U16260-1 VHK207P (Link to Original site) VHK2...07F 371 VHK207Z 713 VHK207P 1064 - - Show VHK207 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK207Q.Seq.d/ Representative seq. ID VHK2...07P (Link to Original site) Representative DNA sequence >VHK207 (VHK207Q) /CSM/VH/VHK2-A/VHK2...ducing significant alignments: (bits) Value N ( BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3'

Dicty_cDB: VHK211 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK211 (Link to dictyBase) - - - - VHK211P (Link to Original site) VHK211F 605 VHK2...11Z 118 VHK211P 703 - - Show VHK211 Library VH (Link to library) Clone ID VHK211 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-A/VHK211Q.Seq.d/ Representative seq. ID VHK211P (Link to ...Original site) Representative DNA sequence >VHK211 (VHK211Q) /CSM/VH/VHK2-A/VHK211Q.Seq.d/ AACTCTCGAGTGCAAAA

Dicty_cDB: VHK279 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK279 (Link to dictyBase) - - - - VHK279P (Link to Original site) VHK279F 619 VHK2...79Z 149 VHK279P 748 - - Show VHK279 Library VH (Link to library) Clone ID VHK279 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2...-D/VHK279Q.Seq.d/ Representative seq. ID VHK279P (Link to ...Original site) Representative DNA sequence >VHK279 (VHK279Q) /CSM/VH/VHK2-D/VHK279Q.Seq.d/ AACTCTCGAGTGCAAAA

Dicty_cDB: VHK278 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK278 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...78F 533 - - - - - - Show VHK278 Library VH (Link to library) Clone ID VHK278 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK278Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK278 (VHK278Q) /CSM/VH/VHK2-D/VHK278Q.Seq.d/ AACTCTCGAGTGCAAAA...BJ427875 ) Dictyostelium discoideum cDNA clone:ddv63k24, 5' ... 997 0.0 1 ( BJ427874 ) Dictyostelium discoideum cDNA clone:ddv63k2

Bacterial and Archaeal Communities Variability Associated with Upwelling and Anthropogenic Pressures in the Protection Area of Arraial do Cabo (Cabo Frio region - RJ).

Science.gov (United States)

Coelho-Souza, Sergio A; Araújo, Fábio V; Cury, Juliano C; Jesus, Hugo E; Pereira, Gilberto C; Guimarães, Jean R D; Peixoto, Raquel S; Dávila, Alberto M R; Rosado, Alexandre S

2015-09-01

Upwelling systems contain a high diversity of pelagic microorganisms and their composition and activity are defined by factors like temperature and nutrient concentration. Denaturing gradient gel electrophoresis (DGGE) technique was used to verify the spatial and temporal genetic variability of Bacteria and Archaea in two stations of the Arraial do Cabo coastal region, one under upwelling pressure and another under anthropogenic pressure. In addition, biotic and abiotic variables were measured in surface and deep waters from three other stations between these stations. Six samplings were done during a year and adequately represented the degrees of upwelling and anthropogenic pressures to the system. Principal Component Analysis (PCA) showed negative correlations between the concentrations of ammonia and phosphorous with prokaryotic secondary production and the total heterotrophic bacteria. PCA also showed negative correlation between temperature and the abundance of prokaryotic cells. Bacterial and archaeal compositions were changeable as were the oceanographic conditions, and upwelling had a regional pressure while anthropogenic pressure was punctual. We suggest that the measurement of prokaryotic secondary production was associated with both Bacteria and Archaea activities, and that substrate availability and temperature determine nutrients cycling.

Surfing wave climate variability

Science.gov (United States)

Espejo, Antonio; Losada, Iñigo J.; Méndez, Fernando J.

2014-10-01

International surfing destinations are highly dependent on specific combinations of wind-wave formation, thermal conditions and local bathymetry. Surf quality depends on a vast number of geophysical variables, and analyses of surf quality require the consideration of the seasonal, interannual and long-term variability of surf conditions on a global scale. A multivariable standardized index based on expert judgment is proposed for this purpose. This index makes it possible to analyze surf conditions objectively over a global domain. A summary of global surf resources based on a new index integrating existing wave, wind, tides and sea surface temperature databases is presented. According to general atmospheric circulation and swell propagation patterns, results show that west-facing low to middle-latitude coasts are more suitable for surfing, especially those in the Southern Hemisphere. Month-to-month analysis reveals strong seasonal variations in the occurrence of surfable events, enhancing the frequency of such events in the North Atlantic and the North Pacific. Interannual variability was investigated by comparing occurrence values with global and regional modes of low-frequency climate variability such as El Niño and the North Atlantic Oscillation, revealing their strong influence at both the global and the regional scale. Results of the long-term trends demonstrate an increase in the probability of surfable events on west-facing coasts around the world in recent years. The resulting maps provide useful information for surfers, the surf tourism industry and surf-related coastal planners and stakeholders.

Variabilidade local e regional da evapotranspiração estimada pelo algoritmo SEBAL Local and regional variability of evapotranspiration estimated by SEBAL algorithm

Directory of Open Access Journals (Sweden)

Luis C. J. Moreira

2010-12-01

balance. The hourly evapotranspiration values obtained were greater than 0.60 mm h-1 in irrigated or dense native vegetation areas, from 0.35 to 0.60 mm h-1 in sparse vegetation areas and almost null in degradated areas. The analysis of hourly evapotranspiration means by Tukey test at 5% probability level showed not only a significant variability locally but also at a regional scale in the state of Ceará.

Optimal sulfur amino acid to lysine ratio for post weaning piglets reared under clean or unclean sanitary conditions

Directory of Open Access Journals (Sweden)

Roselyn Kahindi

2017-12-01

Full Text Available Two 14-day experiments, each with 90 (Duroc × [Yorkshire × Landrace]; 7.3 ± 0.6 kg piglets, were conducted to determine the optimum sulfur amino acid (SAA to lysine (Lys ratio (SAA:Lys for piglets when reared under clean or unclean sanitary conditions using performance and non-performance response criteria. Piglets were randomly assigned to the following dietary treatments. The basal diet contained 1.18% standardized ileal digestible (SID Lys, and the SAA:Lys was 52%. In diets 2 to 5, the basal diet was supplemented with 4 graded levels of dl-Met to make SAA:Lys of 56%, 60%, 64% and 68%. In Exp. 1, piglets were housed in disinfected clean room. In Exp. 2, piglets were housed in a room previously occupied by other pigs and was not disinfected. On the last day, blood was collected to measure plasma urea nitrogen (PUN and one pig per pen was euthanized to collect jejunal tissue to measure villus height (VH, crypt depth (CD, and VH:CD. In Exp. 1, increasing SAA:Lys linearly and quadratically increased VH and VH:CD (P < 0.05. In Exp. 2, increasing SAA:Lys linearly increased (P < 0.05 VH and VH:CD and linearly and quadratically decreased PUN (P < 0.05. Estimated PUN and VH-based optimum SAA:Lys requirements for clean and unclean sanitary condition were 60%, 63% and 66%, respectively.

Is Seeing Believing? The Process of Change During Cognitive-behavioural Therapy for Distressing Visual Hallucinations.

Science.gov (United States)

Wilson, Rea; Collerton, Daniel; Freeston, Mark; Christodoulides, Thomas; Dudley, Robert

2016-07-01

People with psychosis often report distressing visual hallucinations (VH). In contrast to auditory hallucinations, there is little empirical evidence on effective interventions. The effectiveness of a novel-focused cognitive-behavioural therapy (CBT) intervention for VH was explored using a multiple baseline single case design with four participants. Change to individual appraisals, emotional and behavioural responses to VH were measured with daily diaries kept throughout the baseline and intervention phase lasting up to 16 sessions. Maintenance of change was tracked during a follow-up period of one month. Changes in appraisals, distress and response in accordance with the theory was evident in two out of four of the cases. However, change occurred within the baseline phase that limited the conclusions that change could be attributed to CBT alone. There was some evidence of clinically significant change and reliable change for two out of four of the cases at follow-up on one of the standardized psychiatric assessments. The research reported here has theoretical and clinical implications for refinement of the model and interventions for distressing VH. Copyright © 2015 John Wiley & Sons, Ltd. Distressing visual hallucinations (VH) are a relatively common symptom of psychosis. Visual hallucinations seem to be associated with greater impairment and disability. We have no specific treatment for VH. The appraisal of the visual experience and the behavioural response is important in maintaining the distress. Cognitive-behavioural therapy for VH at present has limited value. Copyright © 2015 John Wiley & Sons, Ltd.

Regional Variability of Agriculturally-Derived Nitrate-Nitrogen in Shallow Groundwater in China, 2004–2014

Directory of Open Access Journals (Sweden)

Jing Li

2018-05-01

Full Text Available Increasing diffuse nitrate loading of groundwater has long been a major environmental and health concern in China, but little is known about the spatial and temporal variability of nitrate concentrations in groundwater at regional scales. The aim of this study was to assess the spatial distribution and variation of nitrate-nitrogen (NO3−-N concentrations in groundwater. We used groundwater quality monitoring data and soil physical characteristics from 21 agro-ecosystems in China for years 2004 to 2014. The results indicated that NO3−-N concentrations were highly variable in shallow groundwater across the landscape. Over the study period, most of the NO3−-N concentrations were below the World Health Organization permissible limit for drinking water (<10 mg N·L. NO3−-N concentrations in groundwater neither significantly increased nor decreased in most agro-ecosystems, but fluctuated with seasons. In addition, groundwater NO3−-N under purple soil (6.81 mg·L−1 and Aeolian sandy soil (6.02 mg·L−1 were significantly higher (p < 0.05 than that under other soil types, and it was medium-high (4.49 mg·L−1 under aquic cinnamon soil. Elevated nitrate concentrations occurred mainly in oasis agricultural areas of northwestern China, where farmlands with coarse-textured soils use flood irrigation. Therefore, arid and semi-arid areas are expected to sustain high NO3−-N concentrations in groundwater. Mitigation strategies can prevent this problem, and include control of N fertilizer input, balanced fertilization, proper rotation system, adoption of improved irrigation methods, and establishment of environmental policies.

Adaptation of rainfed agriculture to climatic variability in the Mixteca Alta Region of Oaxaca, Mexico

Science.gov (United States)

Rogé, P.; Friedman, A. R.; Astier, M.; Altieri, M.

2015-12-01

The traditional management systems of the Mixteca Alta Region of Oaxaca, Mexico offer historical lessons about resilience to climatic variability. We interviewed small farmers to inquire about the dynamics of abandonment and persistence of a traditional management systems. We interpret farmers' narratives from a perspective of general agroecological resilience. In addition, we facilitated workshops in small farmers described their adaptation to past climate challenges and identified 14 indicators that they subsequently used to evaluate the condition of their agroecosystems. The most recent years presented increasingly extreme climatic and socioeconomic hardships: increased temperatures, delayed rainy seasons, reduced capacity of soils to retain soil moisture, changing cultural norms, and reduced rural labor. Farmers reported that their cropping systems were changing for multiple reasons: more drought, later rainfall onset, decreased rural labor, and introduced labor-saving technologies. Examination of climate data found that farmers' climate narratives were largely consistent with the observational record. There have been increases in temperature and rainfall intensity, and an increase in rainfall seasonality that may be perceived as later rainfall onset. Farmers ranked landscape-scale indicators as more marginal than farmer management or soil quality indicators. From this analysis, farmers proposed strategies to improve the ability of their agroecosystems to cope with climatic variability. Notably, they recognized that social organizing and education are required for landscape-level indicators to be improved. Transformative change is required to develop novel cropping systems and complementary activities to agriculture that will allow for farming to be sustained in the face of these challenges. Climate change adaptation by small farmers involves much more than just a set of farming practices, but also community action to tackle collective problems.

The transfer of seasonal isotopic variability between precipitation and drip water at eight caves in the monsoon regions of China

Science.gov (United States)

Duan, Wuhui; Ruan, Jiaoyang; Luo, Weijun; Li, Tingyong; Tian, Lijun; Zeng, Guangneng; Zhang, Dezhong; Bai, Yijun; Li, Jilong; Tao, Tao; Zhang, Pingzhong; Baker, Andy; Tan, Ming

2016-06-01

This study presents new stable isotope data for precipitation (δ18Op) and drip water (δ18Od) from eight cave sites in the monsoon regions of China (MRC), with monthly to bi-monthly sampling intervals from May-2011 to April-2014, to investigate the regional-scale climate forcing on δ18Op and how the isotopic signals are transmitted to various drip sites. The monthly δ18Op values show negative correlation with surface air temperature at all the cave sites except Shihua Cave, which is opposite to that expected from the temperature effect. In addition, although the monthly δ18Op values are negatively correlated with precipitation at all the cave sites, only three sites are significant at the 95% level. These indicate that, due to the various vapor sources, a large portion of variability in δ18Op in the MRC cannot be explained simply by either temperature or precipitation alone. All the thirty-four drip sites are classified into three types based on the δ18Od variability. About 82% of them are static drips with little discernable variation in δ18Od through the whole study period, but the drip rates of these drips are not necessary constant. Their discharge modes are site-specific and the oxygen isotopic composition of the stalagmites growing from them may record the average of multi-year climatic signals, which are modulated by the seasonality of recharge and potential effects of evaporation, and in some cases infiltration from large rainfall events. About 12% of the thirty-four drip sites are seasonal drips, although the amplitude of δ18Od is narrower than that of δ18Op, the monthly response of δ18Od to coeval precipitation is not completely damped, and some of them follow the seasonal trend of δ18Op very well. These drips may be mainly recharged by present-day precipitation, mixing with some stored water. Thus, the stalagmites growing under them may record portions of the seasonal climatic signals embedded in δ18Op. About 6% of the thirty-four drip sites

Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

Science.gov (United States)

An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

Laparoscopic and vaginal approaches to hysterectomy in the obese.

Science.gov (United States)

Bogani, Giorgio; Cromi, Antonella; Serati, Maurizio; Di Naro, Edoardo; Casarin, Jvan; Pinelli, Ciro; Uccella, Stefano; Leone Roberti Maggiore, Umberto; Marconi, Nicola; Ghezzi, Fabio

2015-06-01

The aim of the study was to compare surgery-related outcomes between laparoscopic (LH) and vaginal (VH) hysterectomy, performed for benign uterine disease (other than pelvic organs prolapse) in obese women. Data of consecutive obese (BMI≥30) patients undergoing LH and VH, between 2000 and 2013, were compared using a propensity-matched analysis. One hundred propensity-matched patient pairs (200 patients) undergoing LH (n=100) and VH (n=100) represented the study group. Baseline demographic characteristics were similar between groups. Patients undergoing LH experienced similar operative time (87.5 (25-360) vs. 85 (25-240)min; p=0.28), slightly lower blood loss (100 (10-3200) vs. 150 (10-800)ml; p=0.006) and shorter length of hospital stay (1 (1-5) vs. 2 (1-5) days; p<0.001) than women undergoing VH. There was no statistically significant difference between LH and VH in complication rate (3% for VH vs. 10% for LH; OR: 3.4; 95%CI: 0.95-13.5; p=0.08). At multivariable analysis complication rates increased as BMI increase (OR: 1.01 (1.00-1.02) for 1-unit increase in BMI; p=0.05). Independently, LH correlated with reduced hospital stay (OR: 0.63 (95%CI: 0.49-0.82); p=0.001) and complication rates (OR: 0.91 (95%CI: 0.85-0.97); p=0.01). In obese women affected by benign uterine disease LH and VH should not be denied on the basis of the mere BMI, per se. In this setting, LH upholds effectiveness of VH, improving postoperative outcomes. However, complication rate increases as BMI increase, regardless surgical route. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The Manchester-Fothergill procedure versus vaginal hysterectomy with uterosacral ligament suspension: a matched historical cohort study.

Science.gov (United States)

Tolstrup, Cæcilie Krogsgaard; Husby, Karen Ruben; Lose, Gunnar; Kopp, Tine Iskov; Viborg, Petra Hall; Kesmodel, Ulrik Schiøler; Klarskov, Niels

2018-03-01

This study compares vaginal hysterectomy with uterosacral ligament suspension (VH) with the Manchester-Fothergill procedure (MP) for treating pelvic organ prolapse (POP) in the apical compartment. Our matched historical cohort study is based on data from four Danish databases and the corresponding electronic medical records. Patients with POP surgically treated with VH (n = 295) or the MP (n = 295) in between 2010 and 2014 were matched for age and preoperative POP stage in the apical compartment. The main outcome was recurrent or de novo POP in any compartment. Secondary outcomes were recurrent or de novo POP in each compartment and complications. The risk of recurrent or de novo POP in any compartment was higher after VH (18.3%) compared with the MP (7.8%) (Hazard ratio, HR = 2.5, 95% confidence interval (CI): 1.3-4.8). Recurrence in the apical compartment occurred in 5.1% after VH vs. 0.3% after the MP (hazard ratio (HR) = 10.0, 95% confidence interval (CI) 1.3-78.1). In the anterior compartment, rates of recurrent or de novo POP were 11.2% after VH vs. 4.1% after the MP (HR = 3.5, 95% CI 1.4-8.7) and in the posterior compartment 12.9% vs. 4.7% (HR = 2.6, 95% CI 1.3-5.4), respectively. There were more perioperative complications (2.7 vs. 0%, p = 0.007) and postoperative intra-abdominal bleeding (2 vs. 0%, p = 0.03) after VH. This study shows that the MP is superior to VH; if there is no other indication for hysterectomy, the MP should be preferred to VH for surgical treatment of POP in the apical compartment.

Preliminary results from the ESA STSE project on SST diurnal variability, its regional extent and implications in atmospheric modelling (SSTDV:R.EX.–IM.A.M.)

DEFF Research Database (Denmark)

Karagali, Ioanna; Hasager, Charlotte Bay; Høyer, Jacob L.

2013-01-01

This study presents some preliminary results of the ESA Support To Science Element (STSE) funded project on the Diurnal Variability of the Sea Surface Temperature, regarding its Regional Extend and Implications in Atmospheric Modelling (SSTDV:R.EX.–IM.A.M.). Comparisons of SEVIRI SST with AATSR...

Next-Generation DNA Sequencing of VH/VL Repertoires: A Primer and Guide to Applications in Single-Domain Antibody Discovery.

Science.gov (United States)

Henry, Kevin A

2018-01-01

Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.

Electronic structure of homoleptic transition metal hydrides: TiH4, VH4, CrH4, MnH4, FeH4, CoH4, and NiH4

International Nuclear Information System (INIS)

Hood, D.M.; Pitzer, R.M.; Schaefer III, H.F.

1979-01-01

Ab initio molecular electronic structure theory has been applied to the family of transition metal tetrahydrides TiH 4 through NiH 4 . For the TiH 4 molecule a wide range of contracted Gaussian basis sets has been tested at the self-consistent-field (SCF) level of theory. The largest basis, labeled M(14s 11p 6d/10s 8p 3d), H(5s 1p/3s 1p), was used for all members of the series and should yield wave functions approaching true Hartree-Fock quality. Predicted SCF dissociation energies (relative to M+4H) and M--H bond distances are TiH 4 132 kcal, 1.70 A; VH 4 86 kcal, 1.64 A; CrH 4 65 kcal, 1.59 A; MnH 4 -- 36 kcal, 1.58 A; FeH 4 0 kcal, 1.58 A; CoH 4 27 kcal, 1.61 A; and NiH 4 18 kcal, 1.75 A. It should be noted immediately that each of these SCF dissociation energies will be increased by electron correlation effects by perhaps as much as 90 kcal. For all of these molecules except TiH 4 excited states have also been studied. One of the most interesting trends seen for these excited states is the shortening of the M--H bond as electrons are transferred from the antibonding 4t 2 orbital to the nonbonding 1e orbitals

Dicty_cDB: VHK294 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK294 (Link to dictyBase) - - - Contig-U15304-1 VHK294P (Link to Original site) VHK2...94F 611 VHK294Z 780 VHK294P 1371 - - Show VHK294 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK294Q.Seq.d/ Representative seq. ID VHK2...94P (Link to Original site) Representative DNA sequence >VHK294 (VHK294Q) /CSM/VH/VHK2-D/VHK2...yscfyw ns*i*ngsgyf**tfttti Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHK294 (VHK2

Dicty_cDB: VHK296 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK296 (Link to dictyBase) - - - Contig-U16260-1 VHK296P (Link to Original site) VHK2...96F 531 VHK296Z 314 VHK296P 825 - - Show VHK296 Library VH (Link to library) Clone ID VHK2... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK296Q.Seq.d/ Representative seq. ID VHK2...96P (Link to Original site) Representative DNA sequence >VHK296 (VHK296Q) /CSM/VH/VHK2-D/VHK2... 5' ... 993 0.0 1 ( BJ427875 ) Dictyostelium discoideum cDNA clone:ddv63k24, 5' ... 993 0.0 1 ( BJ427874 ) D

Dicty_cDB: VHK202 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK202 (Link to dictyBase) - - - Contig-U16260-1 VHK202P (Link to Original site) VHK2...02F 618 VHK202Z 741 VHK202P 1339 - - Show VHK202 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK202Q.Seq.d/ Representative seq. ID VHK2...02P (Link to Original site) Representative DNA sequence >VHK202 (VHK202Q) /CSM/VH/VHK2-A/VHK2...446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3' ... 1449 0.0 1 ( BJ446732 ) Dictyostelium discoide

Dicty_cDB: VHK254 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK254 (Link to dictyBase) - - - Contig-U16260-1 VHK254P (Link to Original site) VHK2...54F 616 VHK254Z 744 VHK254P 1340 - - Show VHK254 Library VH (Link to library) Clone ID VHK2...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-C/VHK254Q.Seq.d/ Representative seq. ID VHK2...54P (Link to Original site) Representative DNA sequence >VHK254 (VHK254Q) /CSM/VH/VHK2-C/VHK2...BJ446805 ) Dictyostelium discoideum cDNA clone:ddv63k21, 3' ... 1455 0.0 1 ( BJ446732 ) Dictyostelium discoi

Application of Regional Drought and Crop Yield Information System to enhance drought monitoring and forecasting in Lower Mekong region

Science.gov (United States)

Jayasinghe, S.; Dutta, R.; Basnayake, S. B.; Granger, S. L.; Andreadis, K. M.; Das, N.; Markert, K. N.; Cutter, P. G.; Towashiraporn, P.; Anderson, E.

2017-12-01

The Lower Mekong Region has been experiencing frequent and prolonged droughts resulting in severe damage to agricultural production leading to food insecurity and impacts on livelihoods of the farming communities. Climate variability further complicates the situation by making drought harder to forecast. The Regional Drought and Crop Yield Information System (RDCYIS), developed by SERVIR-Mekong, helps decision makers to take effective measures through monitoring, analyzing and forecasting of drought conditions and providing early warnings to farmers to make adjustments to cropping calendars. The RDCYIS is built on regionally calibrated Regional Hydrologic Extreme Assessment System (RHEAS) framework that integrates the Variable Infiltration Capacity (VIC) and Decision Support System for Agro-technology Transfer (DSSAT) models, allowing both nowcast and forecast of drought. The RHEAS allows ingestion of numerus freely available earth observation and ground observation data to generate and customize drought related indices, variables and crop yield information for better decision making. The Lower Mekong region has experienced severe drought in 2016 encompassing the region's worst drought in 90 years. This paper presents the simulation of the 2016 drought event using RDCYIS based on its hindcast and forecast capabilities. The regionally calibrated RDCYIS can help capture salient features of drought through a variety of drought indices, soil variables, energy balance variables and water balance variables. The RDCYIS is capable of assimilating soil moisture data from different satellite products and perform ensemble runs to further reduce the uncertainty of it outputs. The calibrated results have correlation coefficient around 0.73 and NSE between 0.4-0.5. Based on the acceptable results of the retrospective runs, the system has the potential to generate reliable drought monitoring and forecasting information to improve decision-makings at operational, technological and

On the mid-infrared variability of candidate eruptive variables (exors): A comparison between Spitzer and WISE data

Energy Technology Data Exchange (ETDEWEB)

Antoniucci, S.; Giannini, T.; Li Causi, G.; Lorenzetti, D., E-mail: simone.antoniucci@oa-roma.inaf.it, E-mail: teresa.giannini@oa-roma.inaf.it, E-mail: gianluca.licausi@oa-roma.inaf.it, E-mail: dario.lorenzetti@oa-roma.inaf.it [INAF-Osservatorio Astronomico di Roma, via Frascati 33, I-00040 Monte Porzio (Italy)

2014-02-10

Aiming to statistically study the variability in the mid-IR of young stellar objects, we have compared the 3.6, 4.5, and 24 μm Spitzer fluxes of 1478 sources belonging to the C2D (Cores to Disks) legacy program with the WISE fluxes at 3.4, 4.6, and 22 μm. From this comparison, we have selected a robust sample of 34 variable sources. Their variations were classified per spectral Class (according to the widely accepted scheme of Class I/flat/II/III protostars), and per star forming region. On average, the number of variable sources decreases with increasing Class and is definitely higher in Perseus and Ophiuchus than in Chamaeleon and Lupus. According to the paradigm Class ≡ Evolution, the photometric variability can be considered to be a feature more pronounced in less evolved protostars, and, as such, related to accretion processes. Moreover, our statistical findings agree with the current knowledge of star formation activity in different regions. The 34 selected variables were further investigated for similarities with known young eruptive variables, namely the EXors. In particular, we analyzed (1) the shape of the spectral energy distribution, (2) the IR excess over the stellar photosphere, (3) magnitude versus color variations, and (4) output parameters of model fitting. This first systematic search for EXors ends up with 11 bona fide candidates that can be considered as suitable targets for monitoring or future investigations.

Modular and aggregation resistant Vh antibodies from a phage display library

DEFF Research Database (Denmark)

Friis, Niels Anton; Mandrup, Ole Aalund; Lykkemark, Simon

2012-01-01

through immunisation of sharks or camels, or alternatively from recombinant libraries1. The domain antibodies have certain advantages, both pharmacologically and technically. Here we report the construction of a semi-synthetic and highly modular antibody library, based on a human framework (V3-23/D47......Directed evolution of antibodies through phage display is a powerful technique for producing binders of various biological targets. One of the recent innovations in the fi eld is the domain antibody, an antibody consisting only of a single variable domain. These anti bodies can be obtained either......). The antibody scaffold has been codon optimised to improve expression, and the CDR’s have been created using trinucleotide synthesis. These methods give a strict control over the randomisations, and the ability to design a library with minimal aggregation propensity. To facilitate further manipulation, unique...

Predicting superdeformed rotational band-head spin in A ∼ 190 mass region using variable moment of inertia model

International Nuclear Information System (INIS)

Uma, V.S.; Goel, Alpana; Yadav, Archana; Jain, A.K.

2016-01-01

The band-head spin (I 0 ) of superdeformed (SD) rotational bands in A ∼ 190 mass region is predicted using the variable moment of inertia (VMI) model for 66 SD rotational bands. The superdeformed rotational bands exhibited considerably good rotational property and rigid behaviour. The transition energies were dependent on the prescribed band-head spins. The ratio of transition energies over spin Eγ/ 2 I (RTEOS) vs. angular momentum (I) have confirmed the rigid behaviour, provided the band-head spin value is assigned correctly. There is a good agreement between the calculated and the observed transition energies. This method gives a very comprehensive interpretation for spin assignment of SD rotational bands which could help in designing future experiments for SD bands. (author)

Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension.

Science.gov (United States)

Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei

2016-11-21

Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2 -/- mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis.

Low-frequency variability of surface air temperature over the Barents Sea

NARCIS (Netherlands)

Linden, van der Eveline C.; Bintanja, Richard; Hazeleger, Wilco; Graversen, R.G.

2016-01-01

The predominant decadal to multidecadal variability in the Arctic region is a feature that is not yet well-understood. It is shown that the Barents Sea is a key region for Arctic-wide variability. This is an important topic because low-frequency changes in the ocean might lead to large variations

Technical Note: An operational landslide early warning system at regional scale based on space-time-variable rainfall thresholds

Science.gov (United States)

Segoni, S.; Battistini, A.; Rossi, G.; Rosi, A.; Lagomarsino, D.; Catani, F.; Moretti, S.; Casagli, N.

2015-04-01

We set up an early warning system for rainfall-induced landslides in Tuscany (23 000 km2). The system is based on a set of state-of-the-art intensity-duration rainfall thresholds (Segoni et al., 2014b) and makes use of LAMI (Limited Area Model Italy) rainfall forecasts and real-time rainfall data provided by an automated network of more than 300 rain gauges. The system was implemented in a WebGIS to ease the operational use in civil protection procedures: it is simple and intuitive to consult, and it provides different outputs. When switching among different views, the system is able to focus both on monitoring of real-time data and on forecasting at different lead times up to 48 h. Moreover, the system can switch between a basic data view where a synoptic scenario of the hazard can be shown all over the region and a more in-depth view were the rainfall path of rain gauges can be displayed and constantly compared with rainfall thresholds. To better account for the variability of the geomorphological and meteorological settings encountered in Tuscany, the region is subdivided into 25 alert zones, each provided with a specific threshold. The warning system reflects this subdivision: using a network of more than 300 rain gauges, it allows for the monitoring of each alert zone separately so that warnings can be issued independently. An important feature of the warning system is that the visualization of the thresholds in the WebGIS interface may vary in time depending on when the starting time of the rainfall event is set. The starting time of the rainfall event is considered as a variable by the early warning system: whenever new rainfall data are available, a recursive algorithm identifies the starting time for which the rainfall path is closest to or overcomes the threshold. This is considered the most hazardous condition, and it is displayed by the WebGIS interface. The early warning system is used to forecast and monitor the landslide hazard in the whole region

Optimization and in Vivo Validation of Peptide Vectors Targeting the LDL Receptor.

Science.gov (United States)

Jacquot, Guillaume; Lécorché, Pascaline; Malcor, Jean-Daniel; Laurencin, Mathieu; Smirnova, Maria; Varini, Karine; Malicet, Cédric; Gassiot, Fanny; Abouzid, Karima; Faucon, Aude; David, Marion; Gaudin, Nicolas; Masse, Maxime; Ferracci, Géraldine; Dive, Vincent; Cisternino, Salvatore; Khrestchatisky, Michel

2016-12-05

Active targeting and delivery to pathophysiological organs of interest is of paramount importance to increase specific accumulation of therapeutic drugs or imaging agents while avoiding systemic side effects. We recently developed a family of new peptide ligands of the human and rodent LDL receptor (LDLR), an attractive cell-surface receptor with high uptake activity and local enrichment in several normal or pathological tissues (Malcor et al., J. Med. Chem. 2012, 55 (5), 2227). Initial chemical optimization of the 15-mer, all natural amino acid compound 1/VH411 (DSGL[CMPRLRGC] c DPR) and structure-activity relationship (SAR) investigation led to the cyclic 8 amino acid analogue compound 22/VH445 ([cMPRLRGC] c ) which specifically binds hLDLR with a K D of 76 nM and has an in vitro blood half-life of ∼3 h. Further introduction of non-natural amino acids led to the identification of compound 60/VH4106 ([(d)-"Pen"M"Thz"RLRGC] c ), which showed the highest K D value of 9 nM. However, this latter analogue displayed the lowest in vitro blood half-life (∼1.9 h). In the present study, we designed a new set of peptide analogues, namely, VH4127 to VH4131, with further improved biological properties. Detailed analysis of the hLDLR-binding kinetics of previous and new analogues showed that the latter all displayed very high on-rates, in the 10 6 s -1. M -1 range, and off-rates varying from the low 10 -2 s -1 to the 10 -1 s -1 range. Furthermore, all these new analogues showed increased blood half-lives in vitro, reaching ∼7 and 10 h for VH4129 and VH4131, respectively. Interestingly, we demonstrate in cell-based assays using both VH445 and the most balanced optimized analogue VH4127 ([cM"Thz"RLRG"Pen"] c ), showing a K D of 18 nM and a blood half-life of ∼4.3 h, that its higher on-rate correlated with a significant increase in both the extent of cell-surface binding to hLDLR and the endocytosis potential. Finally, intravenous injection of tritium-radiolabeled 3 H-VH

Multiannual runoff variability in the upper Danube region

International Nuclear Information System (INIS)

Pekarova, P.

2009-05-01

The development of mankind has depended on availability of water resources. Already the first agricultural civilizations noticed the temporal variability of water resources and oscillation of the multi-annual dry and wet periods. The presented thesis summarizes results of more than fifteen years research activities of the author in the field of long-term runoff prediction. Statistical analysis of the runoff oscillations depends on availability of long time series of data. Systematic measurements of discharge in modern era started relatively late. The longest time series are available in Europe, but they do not exceed 200 years. Such long series are exceptional and in most parts of the world only much shorter series exist. Since studies dealing with the natural runoff oscillation and NAO phenomenon recently absent in Slovakia, there is the one aim of the thesis to fill in the gap in the long-term runoff fluctuation analysis and long-term discharge prediction methods development. The thesis focuses on the natural runoff cyclicity identification. In stochastic models, the climate changes scenarios caused by atmosphere warming are not involved however the runoff tele-connection around the Earth is studied. Scientific objectives of the thesis: 1. To reconstruct the Danube daily discharge series at Bratislava (1876-1890) based upon the Bratislava gauge daily water level observations; 2. to analyze variability and long term trends of the selected discharge Danube series characteristics for its Bratislava gauge; 3. to propose and develop the combined periodogram method for more exact spectral density identification in discharge time series; to analyze trends and periodicity in discharge long term series; to identify occurrence of the wet and dry periods over the world, to identify the influence of the NAO/AO/ENSO/QBO phenomena and the Sun activity on the runoff variability. 4. to present some long term stochastic prediction methods; to use two of them, the classical

Temperature variability over the tropical middle atmosphere

Directory of Open Access Journals (Sweden)

K. Mohanakumar

1994-04-01

Full Text Available A study on the variability of temperature in the tropical middle atmosphere over Thumba (8 32' N, 76 52' E, located at the southern part of India, has been carried out based on rocket observations for a period of 20 years, extending from 1970 to 1990. The rocketsonde-derived mean temperatures over Thumba are corrected prior to 1978 and then compared with the middle atmospheric reference model developed from satellite observations and Solar Mesosphere Explorer (SME satellite data. Temperature variability at every 1 km interval in the 25-75 km region was analysed. The tropical stratosphere is found to be highly stable, whereas considerable variability is noted in the middle mesosphere. The effect of seasonal cycle is least in the lower stratosphere. Annual and semi-annual oscillations in temperature are the primary oscillations in the tropical middle atmosphere. Annual temperature oscillations are dominant in the mesosphere and semi-annual oscillations are strong in the stratosphere. The stratopause region is noted to be the part of the middle atmosphere least sensitive to the changes in solar activity and long-term variability.

Neural, electrophysiological and anatomical basis of brain-network variability and its characteristic changes in mental disorders.

Science.gov (United States)

Zhang, Jie; Cheng, Wei; Liu, Zhaowen; Zhang, Kai; Lei, Xu; Yao, Ye; Becker, Benjamin; Liu, Yicen; Kendrick, Keith M; Lu, Guangming; Feng, Jianfeng

2016-08-01

SEE MATTAR ET AL DOI101093/AWW151 FOR A SCIENTIFIC COMMENTARY ON THIS ARTICLE: Functional brain networks demonstrate significant temporal variability and dynamic reconfiguration even in the resting state. Currently, most studies investigate temporal variability of brain networks at the scale of single (micro) or whole-brain (macro) connectivity. However, the mechanism underlying time-varying properties remains unclear, as the coupling between brain network variability and neural activity is not readily apparent when analysed at either micro or macroscales. We propose an intermediate (meso) scale analysis and characterize temporal variability of the functional architecture associated with a particular region. This yields a topography of variability that reflects the whole-brain and, most importantly, creates an analytical framework to establish the fundamental relationship between variability of regional functional architecture and its neural activity or structural connectivity. We find that temporal variability reflects the dynamical reconfiguration of a brain region into distinct functional modules at different times and may be indicative of brain flexibility and adaptability. Primary and unimodal sensory-motor cortices demonstrate low temporal variability, while transmodal areas, including heteromodal association areas and limbic system, demonstrate the high variability. In particular, regions with highest variability such as hippocampus/parahippocampus, inferior and middle temporal gyrus, olfactory gyrus and caudate are all related to learning, suggesting that the temporal variability may indicate the level of brain adaptability. With simultaneously recorded electroencephalography/functional magnetic resonance imaging and functional magnetic resonance imaging/diffusion tensor imaging data, we also find that variability of regional functional architecture is modulated by local blood oxygen level-dependent activity and α-band oscillation, and is governed by the

Interdecadal variability of the tropospheric biennial oscillation in the western North Pacific

International Nuclear Information System (INIS)

Zheng Bin; Lin Ailan; Gu Dejun; Li Chunhui

2008-01-01

The observed tropospheric biennial oscillation (TBO) in the western North Pacific (WNP) monsoon region has an interdecadal variability with a period of 40–50 yr. That suggests a weaker effect of the TBO on the East Asia followed by a stronger one. A simple analytic model was designed to investigate the mechanism of the interdecadal variability of the TBO. The results indicated that a local TBO air-sea system not only supports the TBO variability in the WNP monsoon region but also produces an interdecadal variability of the TBO

Monetary policy and regional output in Brazil

Directory of Open Access Journals (Sweden)

Rafael Rockenbach da Silva Guimarães

2014-03-01

Full Text Available This work presents an analysis of whether the effects of the Brazilian monetary policy on regional outputs are symmetric. The strategy developed combines the techniques of principal component analysis (PCA to decompose the variables that measure regional economic activity into common and region-specific components and vector autoregressions (VAR to observe the behavior of these variables in response to monetary policy shocks. The common component responds to monetary policy as expected. Additionally, the idiosyncratic components of the regions showed no impact of monetary policy. The main finding of this paper is that the monetary policy responses on regional output are symmetrical when the regional output decomposition is performed, and the responses are asymmetrical when this decomposition is not performed. Therefore, performing the regional output decomposition corroborates the economic intuition that monetary policy has no impact on region-specific issues. Once monetary policy affects the common component of the regional economic activity and does not impact its idiosyncratic components, it can be considered symmetrical.

Effects of fumonisin B1 on selected biological responses and performance of broiler chickens

Directory of Open Access Journals (Sweden)

Ricardo H. Rauber

2013-09-01

Full Text Available The objective of this study was to determine the effects of three doses of fumonisin B1 (0, 100, and 200mg/kg of feed on biological variables (relative weight of liver [RWL], total plasma protein [TPP], albumin [Alb], calcium [Ca], phosphorus [P], uric acid [UA], alanine aminotransferase [ALT], aspartate aminotransferase [AST], gamma glutamyltransferase [GGT], alkaline phosphatase [AP], total cholesterol [Chol], triglycerides [Tri], sphinganine-to-sphingosine ratio [SA:SO], and C-reactive protein [CRP], morphological evaluation of the small intestine (villus height [VH], crypt depth [CD], and villus-to-crypt ratio [V:C], histological evaluation, and on performance (body weight [BW], feed intake [FI], and feed conversion rate [FCR] of broiler chickens. Significant effects of FB were observed on BW and FI (reduced, on RWL, TPP, Ca, ALT, AST, GGT, Chol, and Tri (increased at both 14 and 28 days evaluations. In addition, significant increase was observed on FCR, Alb, P, SA:SO, and CRP and significant reduction in UA, VH, and V:C only at the 28 days evaluation. Significant histological lesions were observed on liver and kidney of FB inoculated broilers at 14 and 28 days. Those results show that FB has a significant effect on biological and histological variables and on performance of broiler chickens.

Observations of fast variable objects

International Nuclear Information System (INIS)

Alekseev, G.N.

1978-01-01

A problem on studying fast variable astronomic objects is considered. The basis of the method used in the experiment is a detailed photoelectric study of a fast variableness along with spectroscopy of a high time resolution. Power spectrum of the SS Cyg brightness oscillations and autocorrelation function of the AX Mon brightness are analyzed as an example. To provide a reliable identification of parameters of star active regions responsible for the fast variableness, an experiment is proposed, the ''synchronous spectroscopy'' method being used. The method is based on the supposition about temporary stationarity of occasional processes within the limits of the time scale of several hours. The block diagram of the experiment is described

Immunoglobulin Heavy Chain Variable Region and Major Histocompatibility Region Genes Are Linked to Induced Graves' Disease in Females From Two Very Large Families of Recombinant Inbred Mice

Science.gov (United States)

Aliesky, Holly; Banuelos, Bianca; Magana, Jessica; Williams, Robert W.; Rapoport, Basil

2014-01-01

Graves' hyperthyroidism is caused by antibodies to the TSH receptor (TSHR) that mimic thyroid stimulation by TSH. Stimulating TSHR antibodies and hyperthyroidism can be induced by immunizing mice with adenovirus expressing the human TSHR A-subunit. Prior analysis of induced Graves' disease in small families of recombinant inbred (RI) female mice demonstrated strong genetic control but did not resolve trait loci for TSHR antibodies or elevated serum T4. We investigated the genetic basis for induced Graves' disease in female mice of two large RI families and combined data with earlier findings to provide phenotypes for 178 genotypes. TSHR antibodies measured by inhibition of TSH binding to its receptor were highly significantly linked in the BXD set to the major histocompatibility region (chromosome 17), consistent with observations in 3 other RI families. In the LXS family, we detected linkage between T4 levels after TSHR-adenovirus immunization and the Ig heavy chain variable region (Igvh, chromosome 12). This observation is a key finding because components of the antigen binding region of Igs determine antibody specificity and have been previously linked to induced thyroid-stimulating antibodies. Data from the LXS family provide the first evidence in mice of a direct link between induced hyperthyroidism and Igvh genes. A role for major histocompatibility genes has now been established for genetic susceptibility to Graves' disease in both humans and mice. Future studies using arrays incorporating variation in the complex human Ig gene locus will be necessary to determine whether Igvh genes are also linked to Graves' disease in humans. PMID:25051451

Variability in the growth and nodulation of soybean in response to elevation and soil properties in the himalayan region of kashmir-pakistan

International Nuclear Information System (INIS)

Rahim, N.; Abbasi, M.K.

2017-01-01

This study was conducted to examine the variability of soybean nodulation and growth in relation to elevation and soil properties across the slopping uplands of the Himalayan region of Rawalakot Azad Jammu and Kashmir (AJK), Pakistan in order to find efficient native N2 fixing bacteria adapted to local soil and climatic characteristics. Soils from twenty two different sites with variable altitude were collected and analyzed for different physico-chemical characteristics including the quantitative estimation of rhizobium population through most probable number (MPN) technique. Soybean cultivar William-82 was grown in these soils under greenhouse condition for determining the nodulation potential (number and mass) and plant growth characteristics. Morphology of the nodules were observed through optical and transmission electron microscopy. Principal component analysis (PCA) and Biplot graph were used to jointly interpret the relationship between variables and soils (treatments). Soil altitude ranged from 855 m to 3000 m while organic matter content varied between 0.8% to 3.5% and pH from 6.0 to 8.1. The indigenous rhizobia population varied between 5.0 x104 to 8.0 x106 CFU g-1 showing the existence of a substantial rhizobial population in these soils. The number of nodules per plant varied from 7 to 40 (CV 38%) suggesting site/location as an important factor contributing towards rhizobia population and impacting root nodulation. The electron microscopy of green plant nodules showed densely populated bacteria in these cells and nodule tissue cells were completely infected with bacteria. The growth characteristics of soybean i.e. shoot length, shoot fresh and dry weight, root length, root fresh and dry weight varied among the sites but in general a vigorous and healthy plant growth was observed reflecting N assimilation from native soils. Results showed a substantial variability between sites and this is likely to be due to inter/intra species diversity, as well as

Predictive Models of Primary Tropical Forest Structure from Geomorphometric Variables Based on SRTM in the Tapajós Region, Brazilian Amazon.

Science.gov (United States)

Bispo, Polyanna da Conceição; Dos Santos, João Roberto; Valeriano, Márcio de Morisson; Graça, Paulo Maurício Lima de Alencastro; Balzter, Heiko; França, Helena; Bispo, Pitágoras da Conceição

2016-01-01

Surveying primary tropical forest over large regions is challenging. Indirect methods of relating terrain information or other external spatial datasets to forest biophysical parameters can provide forest structural maps at large scales but the inherent uncertainties need to be evaluated fully. The goal of the present study was to evaluate relief characteristics, measured through geomorphometric variables, as predictors of forest structural characteristics such as average tree basal area (BA) and height (H) and average percentage canopy openness (CO). Our hypothesis is that geomorphometric variables are good predictors of the structure of primary tropical forest, even in areas, with low altitude variation. The study was performed at the Tapajós National Forest, located in the Western State of Pará, Brazil. Forty-three plots were sampled. Predictive models for BA, H and CO were parameterized based on geomorphometric variables using multiple linear regression. Validation of the models with nine independent sample plots revealed a Root Mean Square Error (RMSE) of 3.73 m2/ha (20%) for BA, 1.70 m (12%) for H, and 1.78% (21%) for CO. The coefficient of determination between observed and predicted values were r2 = 0.32 for CO, r2 = 0.26 for H and r2 = 0.52 for BA. The models obtained were able to adequately estimate BA and CO. In summary, it can be concluded that relief variables are good predictors of vegetation structure and enable the creation of forest structure maps in primary tropical rainforest with an acceptable uncertainty.

Immunoglobulin Genomics in the Guinea Pig (Cavia porcellus)

Science.gov (United States)

Guo, Yongchen; Bao, Yonghua; Meng, Qingwen; Hu, Xiaoxiang; Meng, Qingyong; Ren, Liming; Li, Ning; Zhao, Yaofeng

2012-01-01

In science, the guinea pig is known as one of the gold standards for modeling human disease. It is especially important as a molecular and cellular biology model for studying the human immune system, as its immunological genes are more similar to human genes than are those of mice. The utility of the guinea pig as a model organism can be further enhanced by further characterization of the genes encoding components of the immune system. Here, we report the genomic organization of the guinea pig immunoglobulin (Ig) heavy and light chain genes. The guinea pig IgH locus is located in genomic scaffolds 54 and 75, and spans approximately 6,480 kb. 507 VH segments (94 potentially functional genes and 413 pseudogenes), 41 DH segments, six JH segments, four constant region genes (μ, γ, ε, and α), and one reverse δ remnant fragment were identified within the two scaffolds. Many VH pseudogenes were found within the guinea pig, and likely constituted a potential donor pool for gene conversion during evolution. The Igκ locus mapped to a 4,029 kb region of scaffold 37 and 24 is composed of 349 Vκ (111 potentially functional genes and 238 pseudogenes), three Jκ and one Cκ genes. The Igλ locus spans 1,642 kb in scaffold 4 and consists of 142 Vλ (58 potentially functional genes and 84 pseudogenes) and 11 Jλ -Cλ clusters. Phylogenetic analysis suggested the guinea pig’s large germline VH gene segments appear to form limited gene families. Therefore, this species may generate antibody diversity via a gene conversion-like mechanism associated with its pseudogene reserves. PMID:22761756

Visual Hallucinations in PD and Lewy Body Dementias: Old and New Hypotheses

Directory of Open Access Journals (Sweden)

M. Onofrj

2013-01-01

Full Text Available Visual Hallucinations (VH are a common non-motor symptom of Parkinson’s Disease (PD and the Lewy body dementias (LBD of Parkinson's disease with dementia (PDD and Dementia with Lewy Bodies (DLB. The origin of VH in PD and LBD is debated: earlier studies considered a number of different possible mechanisms underlying VH including visual disorders, Rapid Eye Movement (REM Sleep Intrusions, dysfunctions of top down or bottom up visual pathways, and neurotransmitter imbalance.

Groundwater Variability Across Temporal and Spatial Scales in the Central and Northeastern U.S.

Science.gov (United States)

Li, Bailing; Rodell, Matthew; Famiglietti, James S.

2015-01-01

Depth-to-water measurements from 181 monitoring wells in unconfined or semi-confined aquifers in nine regions of the central and northeastern U.S. were analyzed. Groundwater storage exhibited strong seasonal variations in all regions, with peaks in spring and lows in autumn, and its interannual variability was nearly unbounded, such that the impacts of droughts, floods, and excessive pumping could persist for many years. We found that the spatial variability of groundwater storage anomalies (deviations from the long term mean) increases as a power function of extent scale (square root of area). That relationship, which is linear on a log-log graph, is common to other hydrological variables but had never before been shown with groundwater data. We describe how the derived power function can be used to determine the number of wells needed to estimate regional mean groundwater storage anomalies with a desired level of accuracy, or to assess uncertainty in regional mean estimates from a set number of observations. We found that the spatial variability of groundwater storage anomalies within a region often increases with the absolute value of the regional mean anomaly, the opposite of the relationship between soil moisture spatial variability and mean. Recharge (drainage from the lowest model soil layer) simulated by the Variable Infiltration Capacity (VIC) model was compatible with observed monthly groundwater storage anomalies and month-to-month changes in groundwater storage.

A quantitative magnetic resonance histology atlas of postnatal rat brain development with regional estimates of growth and variability.

Science.gov (United States)

Calabrese, Evan; Badea, Alexandra; Watson, Charles; Johnson, G Allan

2013-05-01

There has been growing interest in the role of postnatal brain development in the etiology of several neurologic diseases. The rat has long been recognized as a powerful model system for studying neuropathology and the safety of pharmacologic treatments. However, the complex spatiotemporal changes that occur during rat neurodevelopment remain to be elucidated. This work establishes the first magnetic resonance histology (MRH) atlas of the developing rat brain, with an emphasis on quantitation. The atlas comprises five specimens at each of nine time points, imaged with eight distinct MR contrasts and segmented into 26 developmentally defined brain regions. The atlas was used to establish a timeline of morphometric changes and variability throughout neurodevelopment and represents a quantitative database of rat neurodevelopment for characterizing rat models of human neurologic disease. Published by Elsevier Inc.

Description, evaluation and clinical decision making according to various fetal heart rate patterns. Inter-observer and regional variability

DEFF Research Database (Denmark)

Lidegaard, O; Bøttcher, L M; Weber, Tom

1992-01-01

departments, especially between departments far apart. It is concluded that we still need a scientific clarification of which specific heart rate changes are the best predictors of fetal stress. Artificial intelligence programs for interpreting fetal cardiotocograms and ECG signals constitute one promising......At 10 Danish obstetrical departments, 116 residents (42 senior and 74 junior) participated in a study to assess inter-observer and regional variability in the description and evaluation of and clinical decision regarding 11 fetal heart rate patterns. The 11 traces included normal as well...... as pathological patterns, and normal as well as clinically asphyxiated babies. Five antepartum and six intrapartum patterns were included. A total of 1,276 descriptions and evaluations were obtained. The degree of agreement in description of fetal heart rate changes was high regarding the baseline...

Spatial variability of the response to climate change in regional groundwater systems -- examples from simulations in the Deschutes Basin, Oregon

Science.gov (United States)

Waibel, Michael S.; Gannett, Marshall W.; Chang, Heejun; Hulbe, Christina L.

2013-01-01

We examine the spatial variability of the response of aquifer systems to climate change in and adjacent to the Cascade Range volcanic arc in the Deschutes Basin, Oregon using downscaled global climate model projections to drive surface hydrologic process and groundwater flow models. Projected warming over the 21st century is anticipated to shift the phase of precipitation toward more rain and less snow in mountainous areas in the Pacific Northwest, resulting in smaller winter snowpack and in a shift in the timing of runoff to earlier in the year. This will be accompanied by spatially variable changes in the timing of groundwater recharge. Analysis of historic climate and hydrologic data and modeling studies show that groundwater plays a key role in determining the response of stream systems to climate change. The spatial variability in the response of groundwater systems to climate change, particularly with regard to flow-system scale, however, has generally not been addressed in the literature. Here we simulate the hydrologic response to projected future climate to show that the response of groundwater systems can vary depending on the location and spatial scale of the flow systems and their aquifer characteristics. Mean annual recharge averaged over the basin does not change significantly between the 1980s and 2080s climate periods given the ensemble of global climate models and emission scenarios evaluated. There are, however, changes in the seasonality of groundwater recharge within the basin. Simulation results show that short-flow-path groundwater systems, such as those providing baseflow to many headwater streams, will likely have substantial changes in the timing of discharge in response changes in seasonality of recharge. Regional-scale aquifer systems with flow paths on the order of many tens of kilometers, in contrast, are much less affected by changes in seasonality of recharge. Flow systems at all spatial scales, however, are likely to reflect

Sequence variability is correlated with weak immunogenicity in Streptococcus pyogenes M protein

Science.gov (United States)

Lannergård, Jonas; Kristensen, Bodil M; Gustafsson, Mattias C U; Persson, Jenny J; Norrby-Teglund, Anna; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

2015-01-01

The M protein of Streptococcus pyogenes, a major bacterial virulence factor, has an amino-terminal hypervariable region (HVR) that is a target for type-specific protective antibodies. Intriguingly, the HVR elicits a weak antibody response, indicating that it escapes host immunity by two mechanisms, sequence variability and weak immunogenicity. However, the properties influencing the immunogenicity of regions in an M protein remain poorly understood. Here, we studied the antibody response to different regions of the classical M1 and M5 proteins, in which not only the HVR but also the adjacent fibrinogen-binding B repeat region exhibits extensive sequence divergence. Analysis of antisera from S. pyogenes-infected patients, infected mice, and immunized mice showed that both the HVR and the B repeat region elicited weak antibody responses, while the conserved carboxy-terminal part was immunodominant. Thus, we identified a correlation between sequence variability and weak immunogenicity for M protein regions. A potential explanation for the weak immunogenicity was provided by the demonstration that protease digestion selectively eliminated the HVR-B part from whole M protein-expressing bacteria. These data support a coherent model, in which the entire variable HVR-B part evades antibody attack, not only by sequence variability but also by weak immunogenicity resulting from protease attack. PMID:26175306

Navy-Wide Personnel Survey (NPS) 2008: Summary of Survey Results

Science.gov (United States)

2009-11-01

1313–1336. Vroom , V.H. (1982). Work and Motivation . Malabar, FL: Robert E. Krieger Publishing Company. Whittam, K. P., Janega, J. B., Olmsted, M...Bray, Vincus & Bann, 2004; Vroom , 1982). As it is such an important work life variable, it has been tracked on the NPS since its inception...conveyed to over 300,000 Sailors. Effective communication is known to have positive effects upon organizational members by motivating them to work

Seven year satellite observations of the mean structures and variabilities in the regional aerosol distribution over the oceanic areas around the Indian subcontinent

Directory of Open Access Journals (Sweden)

S. K. Nair

2005-09-01

Full Text Available Aerosol distribution over the oceanic regions around the Indian subcontinent and its seasonal and interannual variabilities are studied using the aerosol optical depth (AOD derived from NOAA-14 and NOAA-16 AVHRR data for the period of November 1995–December 2003. The air-mass types over this region during the Asian summer monsoon season (June–September are significantly different from those during the Asian dry season (November–April. Hence, the aerosol loading and its properties over these oceanic regions are also distinctly different in these two periods. During the Asian dry season, the Arabian Sea and Bay of Bengal are dominated by the transport of aerosols from Northern Hemispheric landmasses, mainly the Indian subcontinent, Southeast Asia and Arabia. This aerosol transport is rather weak in the early part of the dry season (November–January compared to that in the later period (February–April. Large-scale transport of mineral dust from Arabia and the production of sea-salt aerosols, due to high surface wind speeds, contribute to the high aerosol loading over the Arabian Sea region during the summer monsoon season. As a result, the monthly mean AOD over the Arabian Sea shows a clear annual cycle with the highest values occurring in July. The AOD over the Bay of Bengal and the Southern Hemisphere Indian Ocean also displays an annual cycle with maxima during March and October, respectively. The amplitude of the annual variation is the largest in coastal Arabia and the least in the Southern Hemisphere Indian Ocean. The interannual variability in AOD is the largest over the Southeast Arabian Sea (seasonal mean AOD varies from 0.19 to 0.42 and the northern Bay of Bengal (seasonal mean AOD varies from 0.24 to 0.39 during the February–April period and is the least over the Southern Hemisphere Indian Ocean. This study also investigates the altitude regions and pathways of dominant aerosol transport by combining the AOD distribution with

A Fiji multi-coral δ18O composite approach to obtaining a more accurate reconstruction of the last two-centuries of the ocean-climate variability in the South Pacific Convergence Zone region

Science.gov (United States)

Dassié, Emilie P.; Linsley, Braddock K.; Corrège, Thierry; Wu, Henry C.; Lemley, Gavin M.; Howe, Steve; Cabioch, Guy

2014-12-01

The limited availability of oceanographic data in the tropical Pacific Ocean prior to the satellite era makes coral-based climate reconstructions a key tool for extending the instrumental record back in time, thereby providing a much needed test for climate models and projections. We have generated a unique regional network consisting of five Porites coral δ18O time series from different locations in the Fijian archipelago. Our results indicate that using a minimum of three Porites coral δ18O records from Fiji is statistically sufficient to obtain a reliable signal for climate reconstruction, and that application of an approach used in tree ring studies is a suitable tool to determine this number. The coral δ18O composite indicates that while sea surface temperature (SST) variability is the primary driver of seasonal δ18O variability in these Fiji corals, annual average coral δ18O is more closely correlated to sea surface salinity (SSS) as previously reported. Our results highlight the importance of water mass advection in controlling Fiji coral δ18O and salinity variability at interannual and decadal time scales despite being located in the heavy rainfall region of the South Pacific Convergence Zone (SPCZ). The Fiji δ18O composite presents a secular freshening and warming trend since the 1850s coupled with changes in both interannual (IA) and decadal/interdecadal (D/I) variance. The changes in IA and D/I variance suggest a re-organization of climatic variability in the SPCZ region beginning in the late 1800s to period of a more dominant interannual variability, which could correspond to a southeast expansion of the SPCZ.

An unusual helix-turn-helix protease inhibitory motif in a novel trypsin inhibitor from seeds of Veronica (Veronica hederifolia L.).

Science.gov (United States)

Conners, Rebecca; Konarev, Alexander V; Forsyth, Jane; Lovegrove, Alison; Marsh, Justin; Joseph-Horne, Timothy; Shewry, Peter; Brady, R Leo

2007-09-21

The storage tissues of many plants contain protease inhibitors that are believed to play an important role in defending the plant from invasion by pests and pathogens. These proteinaceous inhibitor molecules belong to a number of structurally distinct families. We describe here the isolation, purification, initial inhibitory properties, and three-dimensional structure of a novel trypsin inhibitor from seeds of Veronica hederifolia (VhTI). The VhTI peptide inhibits trypsin with a submicromolar apparent K(i) and is expected to be specific for trypsin-like serine proteases. VhTI differs dramatically in structure from all previously described families of trypsin inhibitors, consisting of a helix-turn-helix motif, with the two alpha helices tightly associated by two disulfide bonds. Unusually, the crystallized complex is in the form of a stabilized acyl-enzyme intermediate with the scissile bond of the VhTI inhibitor cleaved and the resulting N-terminal portion of the inhibitor remaining attached to the trypsin catalytic serine 195 by an ester bond. A synthetic, truncated version of the VhTI peptide has also been produced and co-crystallized with trypsin but, surprisingly, is seen to be uncleaved and consequently forms a noncovalent complex with trypsin. The VhTI peptide shows that effective enzyme inhibitors can be constructed from simple helical motifs and provides a new scaffold on which to base the design of novel serine protease inhibitors.

Italian regional health system structure and expected cancer survival.

Science.gov (United States)

Vercelli, Marina; Lillini, Roberto; Quaglia, Alberto; Capocaccia, Riccardo

2014-01-01

Few studies deal with the association of socioeconomic and health system resource variables with cancer survival at the Italian regional level, where the greatest number of decisions about social and health policies and resource allocations are taken. The present study aimed to describe the causal relationships between socioeconomic and health system resource factors and regional cancer survival and to compute the expected cancer survival at provincial, regional and area levels. Age-standardized relative survival at 5 years from diagnosis of cases incident in 1995-1998 and followed up to 2004 were derived by gender for 11 sites from the Italian Association of Cancer Registries data bank. The socioeconomic and health system resource variables, describing at a regional level the macro-economy, demography, labor market, and health resources for 1995-2005, came from the Health for All database. A principal components factor analysis was applied to the socioeconomic and health system resource variables. For every site, linear regression models were computed considering the relative survival at 5 years as a dependent variable and the principal components factor analysis factors as independent variables. The factors described the socioeconomic and health-related features of the regional systems and were causally related to the characteristics of the patient taken in charge. The models built by the factors allowed computation of the expected relative survival at 5 years with very good concordance with those observed at regional, macro-regional and national levels. In the regions without any cancer registry, survival was coherent with that of neighboring regions with similar socioeconomic and health system resources characteristics. The models highlighted the causal correlations between socioeconomic and health system resources and cancer survival, suggesting that they could be good evaluation tools for the efficiency of the resources allocation and use.

Unpacking vertical and horizontal integration: childhood overweight/obesity programs and planning, a Canadian perspective

Directory of Open Access Journals (Sweden)

Ashley Lisa

2010-05-01

Full Text Available Abstract Background Increasingly, multiple intervention programming is being understood and implemented as a key approach to developing public health initiatives and strategies. Using socio-ecological and population health perspectives, multiple intervention programming approaches are aimed at providing coordinated and strategic comprehensive programs operating over system levels and across sectors, allowing practitioners and decision makers to take advantage of synergistic effects. These approaches also require vertical and horizontal (v/h integration of policy and practice in order to be maximally effective. Discussion This paper examines v/h integration of interventions for childhood overweight/obesity prevention and reduction from a Canadian perspective. It describes the implications of v/h integration for childhood overweight and obesity prevention, with examples of interventions where v/h integration has been implemented. An application of a conceptual framework for structuring v/h integration of an overweight/obesity prevention initiative is presented. The paper concludes with a discussion of the implications of vertical/horizontal integration for policy, research, and practice related to childhood overweight and obesity prevention multiple intervention programs. Summary Both v/h integration across sectors and over system levels are needed to fully support multiple intervention programs of the complexity and scope required by obesity issues. V/h integration requires attention to system structures and processes. A conceptual framework is needed to support policy alignment, multi-level evaluation, and ongoing coordination of people at the front lines of practice. Using such tools to achieve integration may enhance sustainability, increase effectiveness of prevention and reduction efforts, decrease stigmatization, and lead to new ways to relate the environment to people and people to the environment for better health for children.

Unpacking vertical and horizontal integration: childhood overweight/obesity programs and planning, a Canadian perspective.

Science.gov (United States)

Maclean, Lynne M; Clinton, Kathryn; Edwards, Nancy; Garrard, Michael; Ashley, Lisa; Hansen-Ketchum, Patti; Walsh, Audrey

2010-05-17

Increasingly, multiple intervention programming is being understood and implemented as a key approach to developing public health initiatives and strategies. Using socio-ecological and population health perspectives, multiple intervention programming approaches are aimed at providing coordinated and strategic comprehensive programs operating over system levels and across sectors, allowing practitioners and decision makers to take advantage of synergistic effects. These approaches also require vertical and horizontal (v/h) integration of policy and practice in order to be maximally effective. This paper examines v/h integration of interventions for childhood overweight/obesity prevention and reduction from a Canadian perspective. It describes the implications of v/h integration for childhood overweight and obesity prevention, with examples of interventions where v/h integration has been implemented. An application of a conceptual framework for structuring v/h integration of an overweight/obesity prevention initiative is presented. The paper concludes with a discussion of the implications of vertical/horizontal integration for policy, research, and practice related to childhood overweight and obesity prevention multiple intervention programs. Both v/h integration across sectors and over system levels are needed to fully support multiple intervention programs of the complexity and scope required by obesity issues. V/h integration requires attention to system structures and processes. A conceptual framework is needed to support policy alignment, multi-level evaluation, and ongoing coordination of people at the front lines of practice. Using such tools to achieve integration may enhance sustainability, increase effectiveness of prevention and reduction efforts, decrease stigmatization, and lead to new ways to relate the environment to people and people to the environment for better health for children.

Production of a germline-humanized cetuximab scFv and evaluation of its activity in recognizing EGFR- overexpressing cancer cells.

Science.gov (United States)

Banisadr, Arsham; Safdari, Yaghoub; Kianmehr, Anvarsadat; Pourafshar, Mahdieh

2018-04-03

The aim of this study was to produce a humanized single chain antibody (scFv) as a potential improved product design to target EGFR (Epidermal Growth Factor Receptor) overexpressing cancer cells. To this end, CDR loops of cetuximab (an FDA-approved anti-EGFR antibody) were grafted on framework regions derived from type 3 (VH3 and VL3 kappa) human germline sequences to obtain recombinant VH and VL domainslinked together with a flexible linker [(Gly 4 Ser) 3 ] to form a scFv. Codon optimized synthetic gene encoding the scFv (with NH2-VH-linker-VL-COOH orientation) was expressed in E. coli Origami™ 2(DE3) cells and the resultant scFv purified by using Ni-NTA affinity chromatography. The scFv, called cet.Hum scFv, was evaluated in ELISA and immunoblot to determine whether it can recognize EGFR. The scFv was able to recognize EGFR over-expressing cancer cells (A-431) but failed to detect cancer cells with low levels of EGFR (MCF-7 cells). Although the affinity of the scFv forA-431 cells was 9 fold lower than that of cetuximab, it was strong enough to recognize these cells. Considering its ability to bind EGFR molecules, the scFv may exhibit a potential application for the detection of EGFR-overexpressing cancer cells.

Geographical and temporal variation of regional development and innovation in Finland

DEFF Research Database (Denmark)

Makkonen, Teemu; Inkinen, Tommi

2015-01-01

Variations in regional development are basically carried forward by technological development together with spatial concentrations of production and finance. The main argument behind this paper is that innovation and regional development variables have temporal variations in a spatial context....... Analysis was conducted using principal component indices from the years 1995–2007 to provide a temporal trend perspective of the most successful locations in innovation activity and regional development. Availability of an extensive workforce, income and higher education have steadily been the most...... “distinct” variables corresponding to regional development in Finland, whereas innovation occupies a stable middling position among explanative variables. Regional development and innovation activity is still concentrated in the core urban regions, but this tendency has lost at least some of its importance....

Initial construct validity evidence of a virtual human application for competency assessment in breaking bad news to a cancer patient

Directory of Open Access Journals (Sweden)

Guetterman TC

2017-07-01

Full Text Available Timothy C Guetterman,1 Frederick W Kron,1 Toby C Campbell,2 Mark W Scerbo,3 Amy B Zelenski,4 James F Cleary,5 Michael D Fetters1 1Department of Family Medicine, University of Michigan, Ann Arbor, MI, 2Department of Medicine, University of Wisconsin–Madison, Madison, WI, 3Department of Psychology, Old Dominion University, Norfolk, VA, 4Department of General Internal Medicine, University of Wisconsin–Madison, University of Wisconsin Medical Foundation, 5Department of Medicine, School of Medicine and Public Health, University of Wisconsin–Madison, Clinical Science Center, Madison, WI, USA Background: Despite interest in using virtual humans (VHs for assessing health care ­communication, evidence of validity is limited. We evaluated the validity of a VH application, MPathic-VR, for assessing performance-based competence in breaking bad news (BBN to a VH patient.Methods: We used a two-group quasi-experimental design, with residents participating in a 3-hour seminar on BBN. Group A (n=15 completed the VH simulation before and after the seminar, and Group B (n=12 completed the VH simulation only after the BBN seminar to avoid the possibility that testing alone affected performance. Pre- and postseminar differences for Group A were analyzed with a paired t-test, and comparisons between Groups A and B were analyzed with an independent t-test.Results: Compared to the preseminar result, Group A’s postseminar scores improved significantly, indicating that the VH program was sensitive to differences in assessing performance-based competence in BBN. Postseminar scores of Group A and Group B were not significantly different, indicating that both groups performed similarly on the VH program.Conclusion: Improved pre–post scores demonstrate acquisition of skills in BBN to a VH patient. Pretest sensitization did not appear to influence posttest assessment. These results provide initial construct validity evidence that the VH program is effective for

Causes for contemporary regional sea level changes.

Science.gov (United States)

Stammer, Detlef; Cazenave, Anny; Ponte, Rui M; Tamisiea, Mark E

2013-01-01

Regional sea level changes can deviate substantially from those of the global mean, can vary on a broad range of timescales, and in some regions can even lead to a reversal of long-term global mean sea level trends. The underlying causes are associated with dynamic variations in the ocean circulation as part of climate modes of variability and with an isostatic adjustment of Earth's crust to past and ongoing changes in polar ice masses and continental water storage. Relative to the coastline, sea level is also affected by processes such as earthquakes and anthropogenically induced subsidence. Present-day regional sea level changes appear to be caused primarily by natural climate variability. However, the imprint of anthropogenic effects on regional sea level-whether due to changes in the atmospheric forcing or to mass variations in the system-will grow with time as climate change progresses, and toward the end of the twenty-first century, regional sea level patterns will be a superposition of climate variability modes and natural and anthropogenically induced static sea level patterns. Attribution and predictions of ongoing and future sea level changes require an expanded and sustained climate observing system.

Galactic models with variable spiral structure

International Nuclear Information System (INIS)

James, R.A.; Sellwood, J.A.

1978-01-01

A series of three-dimensional computer simulations of disc galaxies has been run in which the self-consistent potential of the disc stars is supplemented by that arising from a small uniform Population II sphere. The models show variable spiral structure, which is more pronounced for thin discs. In addition, the thin discs form weak bars. In one case variable spiral structure associated with this bar has been seen. The relaxed discs are cool outside resonance regions. (author)

Modeling actual evapotranspiration with routine meteorological variables in the data-scarce region of the Tibetan Plateau: Comparisons and implications

Science.gov (United States)

Ma, Ning; Zhang, Yinsheng; Xu, Chong-Yu; Szilagyi, Jozsef

2015-08-01

Quantitative estimation of actual evapotranspiration (ETa) by in situ measurements and mathematical modeling is a fundamental task for physical understanding of ETa as well as the feedback mechanisms between land and the ambient atmosphere. However, the ETa information in the Tibetan Plateau (TP) has been greatly impeded by the extremely sparse ground observation network in the region. Approaches for estimating ETa solely from routine meteorological variables are therefore important for investigating spatiotemporal variations of ETa in the data-scarce region of the TP. Motivated by this need, the complementary relationship (CR) and Penman-Monteith approaches were evaluated against in situ measurements of ETa on a daily basis in an alpine steppe region of the TP. The former includes the Nonlinear Complementary Relationship (Nonlinear-CR) as well as the Complementary Relationship Areal Evapotranspiration (CRAE) models, while the latter involves the Katerji-Perrier and the Todorovic models. Results indicate that the Nonlinear-CR, CRAE, and Katerji-Perrier models are all capable of efficiently simulating daily ETa, provided their parameter values were appropriately calibrated. The Katerji-Perrier model performed best since its site-specific parameters take the soil water status into account. The Nonlinear-CR model also performed well with the advantage of not requiring the user to choose between a symmetric and asymmetric CR. The CRAE model, even with a relatively low Nash-Sutcliffe efficiency (NSE) value, is also an acceptable approach in this data-scarce region as it does not need information of wind speed and ground surface conditions. In contrast, application of the Todorovic model was found to be inappropriate in the dry regions of the TP due to its significant overestimation of ETa as it neglects the effect of water stress on the bulk surface resistance. Sensitivity analysis of the parameter values demonstrated the relative importance of each parameter in the

Maps of mesoscale wind variability over the North Sea region

DEFF Research Database (Denmark)

Vincent, Claire Louise; Hahmann, Andrea N.; Badger, Jake

Mesoscale wind fluctuations affect the operation of wind farms, particularly as the number of geographically concentrated wind farms in the North Sea increases (Akhmatov et al. 2007). The frequency and intensity of wind fluctuations could be considered as a new siting criterion, together with exi...... for a 1 year period. The model was run with a horizontal grid spacing of 2 km. The variability maps are created by integrating the average 24 hour spectra at every grid point over different time-scales....

Impact of catchment geophysical characteristics and climate on the regional variability of dissolved organic carbon (DOC) in surface water.

Science.gov (United States)

Cool, Geneviève; Lebel, Alexandre; Sadiq, Rehan; Rodriguez, Manuel J

2014-08-15

Dissolved organic carbon (DOC) is a recognized indicator of natural organic matter (NOM) in surface waters. The aim of this paper is twofold: to evaluate the impact of geophysical characteristics, climate and ecological zones on DOC concentrations in surface waters and, to develop a statistical model to estimate the regional variability of these concentrations. In this study, multilevel statistical analysis was used to achieve three specific objectives: (1) evaluate the influence of climate and geophysical characteristics on DOC concentrations in surface waters; (2) compare the influence of geophysical characteristics and ecological zones on DOC concentrations in surface waters; and (3) develop a model to estimate the most accurate DOC concentrations in surface waters. The case study involved 115 catchments from surface waters in the Province of Quebec, Canada. Results showed that mean temperatures recorded 60 days prior to sampling, total precipitation 10 days prior to sampling and percentages of wetlands, coniferous forests and mixed forests have a significant positive influence on DOC concentrations in surface waters. The catchment mean slope had a significant negative influence on DOC concentrations in surface waters. Water type (lake or river) and deciduous forest variables were not significant. The ecological zones had a significant influence on DOC concentrations. However, geophysical characteristics (wetlands, forests and slope) estimated DOC concentrations more accurately. A model describing the variability of DOC concentrations was developed and can be used, in future research, for estimating DBPs in drinking water as well evaluating the impact of climate change on the quality of surface waters and drinking water. Copyright © 2014 Elsevier B.V. All rights reserved.

Multi-site study of diffusion metric variability: effects of site, vendor, field strength, and echo time on regions-of-interest and histogram-bin analyses.

Science.gov (United States)

Helmer, K G; Chou, M-C; Preciado, R I; Gimi, B; Rollins, N K; Song, A; Turner, J; Mori, S

2016-02-27

It is now common for magnetic-resonance-imaging (MRI) based multi-site trials to include diffusion-weighted imaging (DWI) as part of the protocol. It is also common for these sites to possess MR scanners of different manufacturers, different software and hardware, and different software licenses. These differences mean that scanners may not be able to acquire data with the same number of gradient amplitude values and number of available gradient directions. Variability can also occur in achievable b-values and minimum echo times. The challenge of a multi-site study then, is to create a common protocol by understanding and then minimizing the effects of scanner variability and identifying reliable and accurate diffusion metrics. This study describes the effect of site, scanner vendor, field strength, and TE on two diffusion metrics: the first moment of the diffusion tensor field (mean diffusivity, MD), and the fractional anisotropy (FA) using two common analyses (region-of-interest and mean-bin value of whole brain histograms). The goal of the study was to identify sources of variability in diffusion-sensitized imaging and their influence on commonly reported metrics. The results demonstrate that the site, vendor, field strength, and echo time all contribute to variability in FA and MD, though to different extent. We conclude that characterization of the variability of DTI metrics due to site, vendor, field strength, and echo time is a worthwhile step in the construction of multi-center trials.

Sequence variability is correlated with weak immunogenicity in Streptococcus pyogenes M protein.

Science.gov (United States)

Lannergård, Jonas; Kristensen, Bodil M; Gustafsson, Mattias C U; Persson, Jenny J; Norrby-Teglund, Anna; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

2015-10-01

The M protein of Streptococcus pyogenes, a major bacterial virulence factor, has an amino-terminal hypervariable region (HVR) that is a target for type-specific protective antibodies. Intriguingly, the HVR elicits a weak antibody response, indicating that it escapes host immunity by two mechanisms, sequence variability and weak immunogenicity. However, the properties influencing the immunogenicity of regions in an M protein remain poorly understood. Here, we studied the antibody response to different regions of the classical M1 and M5 proteins, in which not only the HVR but also the adjacent fibrinogen-binding B repeat region exhibits extensive sequence divergence. Analysis of antisera from S. pyogenes-infected patients, infected mice, and immunized mice showed that both the HVR and the B repeat region elicited weak antibody responses, while the conserved carboxy-terminal part was immunodominant. Thus, we identified a correlation between sequence variability and weak immunogenicity for M protein regions. A potential explanation for the weak immunogenicity was provided by the demonstration that protease digestion selectively eliminated the HVR-B part from whole M protein-expressing bacteria. These data support a coherent model, in which the entire variable HVR-B part evades antibody attack, not only by sequence variability but also by weak immunogenicity resulting from protease attack. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Description and assessment of regional sea-level trends and variability from altimetry and tide gauges at the northern Australian coast

Science.gov (United States)

Gharineiat, Zahra; Deng, Xiaoli

2018-05-01

This paper aims at providing a descriptive view of the low-frequency sea-level changes around the northern Australian coastline. Twenty years of sea-level observations from multi-mission satellite altimetry and tide gauges are used to characterize sea-level trends and inter-annual variability over the study region. The results show that the interannual sea-level fingerprint in the northern Australian coastline is closely related to El Niño Southern Oscillation (ENSO) and Madden-Julian Oscillation (MJO) events, with the greatest influence on the Gulf Carpentaria, Arafura Sea, and the Timor Sea. The basin average of 14 tide-gauge time series is in strong agreement with the basin average of the altimeter data, with a root mean square difference of 18 mm and a correlation coefficient of 0.95. The rate of the sea-level trend over the altimetry period (6.3 ± 1.4 mm/yr) estimated from tide gauges is slightly higher than that (6.1 ± 1.3 mm/yr) from altimetry in the time interval 1993-2013, which can vary with the length of the time interval. Here we provide new insights into examining the significance of sea-level trends by applying the non-parametric Mann-Kendall test. This test is applied to assess if the trends are significant (upward or downward). Apart from a positive rate of sea-level trends are not statistically significant in this region due to the effects of natural variability. The findings suggest that altimetric trends are not significant along the coasts and some parts of the Gulf Carpentaria (14°S-8°S), where geophysical corrections (e.g., ocean tides) cannot be estimated accurately and altimeter measurements are contaminated by reflections from the land.

Cross-Regional Assessment Of Coupling And Variability In Precipitation-Runoff Relationships

Science.gov (United States)

Carey, S. K.; Tetzlaff, D.; Soulsby, C.; Buttle, J. M.; Laudon, H.; McDonnell, J. J.; McGuire, K. J.; Seibert, J.; Shanley, J. B.

2011-12-01

The higher mid-latitudes of the northern hemisphere are particularly sensitive to change due to the important role the zero-degree isotherm plays in the phase of precipitation and intermediate storage as snow. An international inter-catchment comparison program North-Watch seeks to improve our understanding of the sensitivity of northern catchments to change by examining their hydrological and biogeochemical variability and response. The catchments are located in Sweden (Krycklan), Scotland (Mharcaidh, Girnock and Strontian), the United States (Sleepers River, Hubbard Brook and HJ Andrews) and Canada (Catamaran, Dorset and Wolf Creek). For this study, 8 catchments with 10 continuous years of daily precipitation and runoff data were selected to assess the seasonal coupling of rainfall and runoff and the memory effect of runoff events on the hydrograph at different time scales. To assess the coupling and synchroneity of precipitation, continuous wavelet transforms and wavelet coherence were used. Wavelet spectra identified the relative importance of both annual versus seasonal flows while wavelet coherence was applied to identify over different time scales along the 10-year window how well precipitation and runoff were coupled. For example, while on a given day, precipitation may be closely coupled to runoff, a wet year may not necessarily be a high runoff year in catchments with large storage. Assessing different averaging periods in the variation of daily flows highlights the importance of seasonality in runoff response and the relative influence of rain versus snowmelt on flow magnitude and variability. Wet catchments with limited seasonal precipitation variability (Strontian, Girnock) have precipitation signals more closely coupled with runoff, whereas dryer catchments dominated by snow (Wolf Creek, Krycklan) have strongly coupling only during freshet. Most catchments with highly seasonal precipitation show strong intermittent coupling during their wet season. At

Geographical and temporal variation of regional development and innovation in Finland

Directory of Open Access Journals (Sweden)

Teemu Makkonen

2015-03-01

Full Text Available Variations in regional development are basically carried forward by technological development together with spatial concentrations of production and finance. The main argument behind this paper is that innovation and regional development variables have temporal variations in a spatial context. Analysis was conducted using principal component indices from the years 1995–2007 to provide a temporal trend perspective of the most successful locations in innovation activity and regional development. Availability of an extensive workforce, income and higher education have steadily been the most “distinct” variables corresponding to regional development in Finland, whereas innovation occupies a stable middling position among explanative variables. Regional development and innovation activity is still concentrated in the core urban regions, but this tendency has lost at least some of its importance.

Seychelles Dome variability in a high resolution ocean model

Science.gov (United States)

Nyadjro, E. S.; Jensen, T.; Richman, J. G.; Shriver, J. F.

2016-02-01

The Seychelles-Chagos Thermocline Ridge (SCTR; 5ºS-10ºS, 50ºE-80ºE) in the tropical Southwest Indian Ocean (SWIO) has been recognized as a region of prominence with regards to climate variability in the Indian Ocean. Convective activities in this region have regional consequences as it affect socio-economic livelihood of the people especially in the countries along the Indian Ocean rim. The SCTR is characterized by a quasi-permanent upwelling that is often associated with thermocline shoaling. This upwelling affects sea surface temperature (SST) variability. We present results on the variability and dynamics of the SCTR as simulated by the 1/12º high resolution HYbrid Coordinate Ocean Model (HYCOM). It is observed that locally, wind stress affects SST via Ekman pumping of cooler subsurface waters, mixing and anomalous zonal advection. Remotely, wind stress curl in the eastern equatorial Indian Ocean generates westward-propagating Rossby waves that impacts the depth of the thermocline which in turn impacts SST variability in the SCTR region. The variability of the contributions of these processes, especially with regard to the Indian Ocean Dipole (IOD) are further examined. In a typical positive IOD (PIOD) year, the net vertical velocity in the SCTR is negative year-round as easterlies along the region are intensified leading to a strong positive curl. This vertical velocity is caused mainly by anomalous local Ekman downwelling (with peak during September-November), a direct opposite to the climatology scenario when local Ekman pumping is positive (upwelling favorable) year-round. The anomalous remote contribution to the vertical velocity changes is minimal especially during the developing and peak stages of PIOD events. In a typical negative IOD (NIOD) year, anomalous vertical velocity is positive almost year-round with peaks in May and October. The remote contribution is positive, in contrast to the climatology and most of the PIOD years.

Regional welfare disparities and regional economic growth in Vietnam

NARCIS (Netherlands)

Nguyen Huy Hoang,

2009-01-01

This study had multiple objectives. First, it aimed at examining regional inequality
in several welfare variables, such as health and education during the 1998-2004 period, and
per capita income over time from 1990 to 2006. The first objective of the study was to gain
a better

Interannual variability of sea surface temperature and circulation in ...

African Journals Online (AJOL)

Local surface heat flux exchanges driven by the anomalous shortwave radiation dominated the interannual SST variability in the Tanzanian shelf region, with some contribution by the advection of heat anomalies from the North-East Madagascar Current. Farther offshore, the interannual variability of the SST was dominated ...

Small-scale variability in tropical tropopause layer humidity

Science.gov (United States)

Jensen, E. J.; Ueyama, R.; Pfister, L.; Karcher, B.; Podglajen, A.; Diskin, G. S.; DiGangi, J. P.; Thornberry, T. D.; Rollins, A. W.; Bui, T. V.; Woods, S.; Lawson, P.

2016-12-01

Recent advances in statistical parameterizations of cirrus cloud processes for use in global models are highlighting the need for information about small-scale fluctuations in upper tropospheric humidity and the physical processes that control the humidity variability. To address these issues, we have analyzed high-resolution airborne water vapor measurements obtained in the Airborne Tropical TRopopause EXperiment over the tropical Pacific between 14 and 20 km. Using accurate and precise 1-Hz water vapor measurements along approximately-level aircraft flight legs, we calculate structure functions spanning horizontal scales ranging from about 0.2 to 50 km, and we compare the water vapor variability in the lower (about 14 km) and upper (16-19 km) Tropical Tropopause Layer (TTL). We also compare the magnitudes and scales of variability inside TTL cirrus versus in clear-sky regions. The measurements show that in the upper TTL, water vapor concentration variance is stronger inside cirrus than in clear-sky regions. Using simulations of TTL cirrus formation, we show that small variability in clear-sky humidity is amplified by the strong sensitivity of ice nucleation rate to supersaturation, which results in highly-structured clouds that subsequently drive variability in the water vapor field. In the lower TTL, humidity variability is correlated with recent detrainment from deep convection. The structure functions indicate approximately power-law scaling with spectral slopes ranging from about -5/3 to -2.

Temporal variability of mass transport across Canary Islands Channels

Science.gov (United States)

Marrero-Díaz, Ángeles; Rodríguez-Santana, Ángel; José Machín, Francisco; García-Weil, Luis; Sangrà, Pablo; Vélez-Belchí, Pedro; Fraile-Nuez, Eugenio

2014-05-01

The equatorward flowing Canary Current (CC) is the main feature of the circulation in the Canary Islands region. The CC flow perturbation by the Canary Islands originate the Canary Eddy Corridor which is the major pathway for long lived eddies in the subtropical North Atlantic (Sangrà et al., 2009, DSR). Therefore the variability of the CC passing through the Canary Archipelago will have both local and regional importance. Past studies on the CC variability trough the Canary Islands point out a clearly seasonal variability (Fraile-Nuez et al, 2010 (JGR); Hernández-Guerra et al, 2002 (DSR)). However those studies where focused on the eastern islands channels missing the variability through the western island channels which are the main source of long lived eddies. In order to fill this gap from November 2012 until September 2013 we conducted trimonthly surveys crossing the whole islands channels using opportunity ships (Naviera Armas Ferries). XBT and XCTD where launched along the cross channels transects. Additionally a closed box circling the Archipelago was performed on October 2013 as part of the cruise RAPROCAN-2013 (IEO) using also XBT and XCTD. Dynamical variables where derived inferring salinity from S(T,p) analytical relationships for the region updated with new XCTD data. High resolution, vertical sections of temperature, potential density, geostrophic velocity and transport where obtained. Our preliminary results suggest that the CC suffer a noticeable acceleration in those islands channels where eddy shedding is more frequent. They also indicate a clearly seasonal variability of the flows passing the islands channels. With this regard we observed significant differences on the obtained seasonal variability with respect the cited past studies on the eastern islands channel (Lanzarote / Fuerteventura - Africa coast). This work was co-funded by Canary Government (TRAMIC project: PROID20100092) and the European Union (FEDER).

Internal variability of a 3-D ocean model

Directory of Open Access Journals (Sweden)

Bjarne Büchmann

2016-11-01

Full Text Available The Defence Centre for Operational Oceanography runs operational forecasts for the Danish waters. The core setup is a 60-layer baroclinic circulation model based on the General Estuarine Transport Model code. At intervals, the model setup is tuned to improve ‘model skill’ and overall performance. It has been an area of concern that the uncertainty inherent to the stochastical/chaotic nature of the model is unknown. Thus, it is difficult to state with certainty that a particular setup is improved, even if the computed model skill increases. This issue also extends to the cases, where the model is tuned during an iterative process, where model results are fed back to improve model parameters, such as bathymetry.An ensemble of identical model setups with slightly perturbed initial conditions is examined. It is found that the initial perturbation causes the models to deviate from each other exponentially fast, causing differences of several PSUs and several kelvin within a few days of simulation. The ensemble is run for a full year, and the long-term variability of salinity and temperature is found for different regions within the modelled area. Further, the developing time scale is estimated for each region, and great regional differences are found – in both variability and time scale. It is observed that periods with very high ensemble variability are typically short-term and spatially limited events.A particular event is examined in detail to shed light on how the ensemble ‘behaves’ in periods with large internal model variability. It is found that the ensemble does not seem to follow any particular stochastic distribution: both the ensemble variability (standard deviation or range as well as the ensemble distribution within that range seem to vary with time and place. Further, it is observed that a large spatial variability due to mesoscale features does not necessarily correlate to large ensemble variability. These findings bear

Comparison of the spatial and temporal variability of drought indices ...

African Journals Online (AJOL)

Churchill

variability of regional water resources. Lake Chad for ... and water resources management question in drought prone regions of Africa .... implementation of contingency plans during the drought .... management (IWRM) by the Lake Chad Basin.

Expression of recombinant multi-coloured fluorescent antibodies in gor -/trxB- E. coli cytoplasm

Directory of Open Access Journals (Sweden)

Markiv Anatoliy

2011-11-01

Full Text Available Abstract Background Antibody-fluorophore conjugates are invaluable reagents used in contemporary molecular cell biology for imaging, cell sorting and tracking intracellular events. However they suffer in some cases from batch to batch variation, partial loss of binding and susceptibility to photo-bleaching. In theory, these issues can all be addressed by using recombinant antibody fused directly to genetically encoded fluorescent reporters. However, single-chain fragment variable domains linked by long flexible linkers are themselves prone to disassociation and aggregation, and in some cases with isoelectric points incompatible with use in physiologically relevant milieu. Here we describe a general approach that permits fully functional intracellular production of a range of coloured fluorescent recombinant antibodies with optimally orientated VH/VL interfaces and isoelectric points compatible for use in physiological solutions at pH 7.4 with a binding site to fluorophore stoichiometry of 1:1. Results Here we report the design, assembly, intracellular bacterial production and purification of a panel of novel antibody fluorescent protein fusion constructs. The insertion of monomeric fluorescent protein derived from either Discosoma or Aequorea in-between the variable regions of anti-p185HER2-ECD antibody 4D5-8 resulted in optimal VH/VL interface interactions to create soluble coloured antibodies each with a single binding site, with isoelectric points of 6.5- 6. The fluorescent antibodies used in cell staining studies with SK-BR-3 cells retained the fluorophore properties and antibody specificity functions, whereas the conventional 4D5-8 single chain antibody with a (Gly4Ser3 linker precipitated at physiological pH 7.4. Conclusions This modular monomeric recombinant fluorescent antibody platform may be used to create a range of recombinant coloured antibody molecules for quantitative in situ, in vivo and ex vivo imaging, cell sorting and cell

Variability of Mediterranean aerosols properties at three regional background sites in the western Mediterranean Basin

Science.gov (United States)

Sicard, Michaël.; Totems, Julien; Barragan, Rubén.; Dulac, François; Mallet, Marc; Comerón, Adolfo; Alados-Arboledas, Lucas; Augustin, Patrick; Chazette, Patrick; Léon, Jean-François; Olmo-Reyes, Francisco José; Renard, Jean-Baptiste; Rocadenbosch, Francesc

2014-10-01

In the framework of the project ChArMEx (the Chemistry-Aerosol Mediterranean Experiment, http://charmex.lsce.ipsl.fr/), the variability of aerosol optical, microphysical and radiative properties is examined in three regional background sites on a southwest - northeast (SW-NE) straight line in the middle of the western Mediterranean Basin (WMB). The three sites are on the northward transport pathway of African dust: - Ersa, Corsica Island, France (43.00ºN, 9.36ºW, 80 m a.s.l), - Palma de Mallorca, Mallorca Island, Spain (39.55ºN, 2.62ºE, 10 m a.s.l) and - Alborán, Alboran Island, Spain (35.94ºN, 3.04ºW, 15 m a.s.l). AERONET (AErosol RObotic NETwork) sun-photometer products are mainly used. A preliminary analysis shows that at Ersa and Palma sites the annual aerosol optical depth (AOD) has a similar trend with a peak around 0.2 in July. The winter/spring AOD is lower in Palma than in Ersa, while it is reverse in summer/autumn. The aerosol particle size distribution (and the coarse mode fraction) shows clearly the SW-NE gradient with a decreasing coarse mode peak (and a decreasing coarse mode fraction from 0.5 - 0.35 - 0.2 in July) along the axis Alborán - Palma de Mallorca - Ersa. In addition to the seasonal and annual variability analysis, the analysis of AERONET products is completed with a large variety of ground-based and sounding balloons remote sensing and in situ instruments during the Special Observation Period (SOP) of the ADRIMED campaign in June 2013. The second part of the presentation will focus on the comparison of the observations at Palma de Mallorca and Ersa of the same long-range transported airmasses. The observations include lidar vertical profiles, balloon borne OPC (Optical Particle Counter) and MSG/SEVIRI AOD, among others.

Unveiling the pan-genome of the SXT/R391 family of ICEs: molecular characterisation of new variable regions of SXT/R391-like ICEs detected in Pseudoalteromonas sp. and Vibrio scophthalmi.

Science.gov (United States)

Rodríguez-Blanco, Arturo; Lemos, Manuel L; Osorio, Carlos R

2016-08-01

Integrating conjugative elements (ICEs) of the SXT/R391 family have been identified in fish-isolated bacterial strains collected from marine aquaculture environments of the northwestern Iberian Peninsula. Here we analysed the variable regions of two ICEs, one preliminarily characterised in a previous study (ICEVscSpa3) and one newly identified (ICEPspSpa1). Bacterial strains harboring these ICEs were phylogenetically assigned to Vibrio scophthalmi and Pseudoalteromonas sp., thus constituting the first evidence of SXT/R391-like ICEs in the genus Pseudoalteromonas to date. Variable DNA regions, which confer element-specific properties to ICEs of this family, were characterised. Interestingly, the two ICEs contained 29 genes not found in variable DNA insertions of previously described ICEs. Most notably, variable gene content for ICEVscSpa3 showed similarity to genes potentially involved in housekeeping functions of replication, nucleotide metabolism and transcription. For these genes, closest homologues were found clustered in the genome of Pseudomonas psychrotolerans L19, suggesting a transfer as a block to ICEVscSpa3. Genes encoding antibiotic resistance, restriction modification systems and toxin/antitoxin systems were absent from hotspots of ICEVscSpa3. In contrast, the variable gene content of ICEPspSpa1 included genes involved in restriction/modification functions in two different hotspots and genes related to ICE maintenance. The present study unveils a relatively large number of novel genes in SXT/R391-ICEs, and demonstrates the major role of ICE elements as contributors to horizontal gene transfer.

Neonatal exposure to phenobarbital potentiates schizophrenia-like behavioral outcomes in the rat.

Science.gov (United States)

Bhardwaj, S K; Forcelli, P A; Palchik, G; Gale, K; Srivastava, L K; Kondratyev, A

2012-06-01

Previous work has indicated an association between seizures early in life and increased risk of psychiatric disorders, including schizophrenia. However, because early-life seizures are commonly treated with antiepileptic drugs (AEDs) such as phenobarbital, the possibility that drug treatment may affect later-life psychiatric outcomes needs to be evaluated. We therefore tested the hypothesis that phenobarbital exposure in the neonatal rat increases the risk of schizophrenia-like behavioral abnormalities in adulthood. Thus, in this study, we examined the effects of a single acute neonatal exposure to phenobarbital on adult behavioral outcomes in the rat neonatal ventral hippocampal (nVH) lesion model of schizophrenia. We compared these outcomes to those in rats a) without nVH lesions and b) with nVH lesions, without phenobarbital. The tasks used for behavioral evaluation were: amphetamine-induced locomotion, prepulse inhibition, elevated plus-maze, and novel object recognition task. We found that neonatal phenobarbital treatment (in the absence of nVH lesions) was sufficient to disrupt sensorimotor gating (as tested by prepulse inhibition) in adulthood to an extent equivalent to nVH lesions. Additionally, neonatal phenobarbital exposure enhanced the locomotor response to amphetamine in adult animals with and without nVH lesions. Our findings suggest that neonatal exposure to phenobarbital can predispose to schizophrenia-like behavioral abnormalities. Our findings underscore the importance of examining AED exposure early in life as a potential risk factor for later-life neuropsychiatric abnormalities in clinical populations. Copyright © 2012 Elsevier Ltd. All rights reserved.

Comparing farmers' perception of climate change and variability with ...

African Journals Online (AJOL)

Perception of climate change and variability supported by local knowledge has helped to advance understanding of climate change and its impacts on agricultural land-use systems. This study compares farmers' perception of climate change and variability in four communities of the Upper East Region of Ghana. Using a ...

Analysis of the variability of extra-tropical cyclones at the regional scale for the coasts of Northern Germany and investigation of their coastal impacts

Science.gov (United States)

Schaaf, Benjamin; Feser, Frauke

2015-04-01

The evaluation of long-term changes in wind speeds is very important for the coastal areas and the protection measures. Therefor the wind variability at the regional scale for the coast of Northern Germany shall be analysed. In order to derive changes in storminess it is essential to analyse long, homogeneous meteorological time series. Wind measurements often suffer from inconsistencies which arise from changes in instrumentation, observation method, or station location. Reanalysis data take into account such inhomogeneities of observation data and convert these measurements into a consistent, gridded data set with the same grid spacing and time intervals. This leads to a smooth, homogeneous data set, but with relatively low resolution (about 210 km for the longest reanalysis data set, the NCEP reanalysis starting in 1948). Therefore a high-resolution regional atmospheric model will be used to bring these reanalyses to a higher resolution, using in addition to a dynamical downscaling approach the spectral nudging technique. This method 'nudges' the large spatial scales of the regional climate model towards the reanalysis, while the smaller spatial scales are left unchanged. It was applied successfully in a number of applications, leading to realistic atmospheric weather descriptions of the past. With the regional climate model COSMO-CLM a very high-resolution data set was calculated for the last 67 years, the period from 1948 until now. The model area is North Germany with the coastal area of the North sea and parts of the Baltic sea. This is one of the first model simulations on climate scale with a very high resolution of 2.8 km, so even small scale effects can be detected. With this hindcast-simulation there are numerous options of evaluation. One can create wind climatologies for regional areas such as for the metropolitan region of Hamburg. Otherwise one can investigate individual storms in a case study. With a filtering and tracking program the course of

Regions of pollution with particulate matter in Poland

Directory of Open Access Journals (Sweden)

Rawicki Kacper

2018-01-01

Full Text Available The study presents the temporal and spatial variability of particulate matter concentration in Poland in the calendar winter season (December-February. The basis for the study were the hourly and daily values of particulate matter PM10 concentration from the period 2005/06 – 2014/15, obtained from 33 air pollution monitoring stations. In Poland, the obligation to monitor the concentration of the finer fraction of particles smaller than 2.5µm in aerodynamic diameter was introduced only in 2010. Consequently, data on PM2.5 concentration refer to a shorter period, i.e. 2009/10 – 2014/15, and were obtained from 23 stations. Using the cluster analysis (k-means method, three regions of comparable variability of particulate matter concentration were delineated. The largest region, i.e. Region I, comprises the northern and eastern central area of Poland, and its southern boundary is along the line Gorzów Wlkp-Bydgoszcz-Konin-Łódź-Kielce-Lublin. Markedly smaller Region II is located to the south of Region I. By far the smallest area was designated to Region III which covers the south west area of Poland. The delineated regions show a marked variability in terms of mean concentration of both PM fractions in winter (PM10: region I - 33 µg·m-3, region II - 55 µg·m-3, region III - 83 µg·m-3; PM2,5: region I - 35 µg·m-3, region II - 50 µg·m-3, region III - 60 µg·m-3 and, in the case of PM10, the frequency of excessive daily limit value.

Regions of pollution with particulate matter in Poland

Science.gov (United States)

Rawicki, Kacper; Czarnecka, Małgorzata; Nidzgorska-Lencewicz, Jadwiga